Voltage-dependent gating in a "voltage sensor-less" ion channel.
Directory of Open Access Journals (Sweden)
Harley T Kurata
2010-02-01
Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.
Directory of Open Access Journals (Sweden)
Rajeev Gupta
2017-06-01
Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.
Gupta, Rajeev; Ghosh, Subhendu
2017-06-01
Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.
Voltage-dependent gating of hERG potassium channels
Directory of Open Access Journals (Sweden)
Yen May eCheng
2012-05-01
Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.
Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels
Cui, Jianmin
2016-01-01
Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405
Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel
Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael
1993-06-01
Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.
Voltage-Dependent Gating of hERG Potassium Channels
Cheng, Yen May; Claydon, Tom W.
2012-01-01
The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397
Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating
Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar
2012-01-01
The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342
The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.
Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin
2017-08-01
Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.
Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel
International Nuclear Information System (INIS)
Barchi, R.L.; Tanaka, J.C.
1984-01-01
In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab
Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.
Held, Katharina; Voets, Thomas; Vriens, Joris
2016-01-01
Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.
Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R
2003-03-01
The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.
Regulation of KV channel voltage-dependent activation by transmembrane β subunits
Directory of Open Access Journals (Sweden)
Xiaohui eSun
2012-04-01
Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.
Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.
Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio
2016-11-17
Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.
Voltage-gated lipid ion channels
DEFF Research Database (Denmark)
Blicher, Andreas; Heimburg, Thomas Rainer
2013-01-01
Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...
Energy Technology Data Exchange (ETDEWEB)
Liu, Kuan-Hsien; Chou, Wu-Ching [Department of Electrophysics, National Chiao Tung University, Hsinchu, Taiwan (China); Chang, Ting-Chang, E-mail: tcchang@mail.phys.nsysu.edu.tw [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Advanced Optoelectronics Technology Center, National Cheng Kung University, Taiwan (China); Wu, Ming-Siou; Hung, Yi-Syuan; Sze, Simon M. [Department of Electronics Engineering, National Chiao Tung University, Hsinchu, Taiwan (China); Hung, Pei-Hua; Chu, Ann-Kuo [Department of Photonics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Hsieh, Tien-Yu [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Yeh, Bo-Liang [Advanced Display Technology Research Center, AU Optronics, No. 1, Li-Hsin Rd. 2, Hsinchu Science Park, Hsinchu 30078, Taiwan (China)
2014-03-31
This Letter investigates abnormal channel width-dependent threshold voltage variation in amorphous indium-gallium-zinc-oxide (a-IGZO) thin-film transistors. Unlike drain-induced source barrier lowering effect, threshold voltage increases with increasing drain voltage. Furthermore, the wider the channel, the larger the threshold voltage observed. Because of the surrounding oxide and other thermal insulating material and the low thermal conductivity of the IGZO layer, the self-heating effect will be pronounced in wider channel devices and those with a larger operating drain bias. To further clarify the physical mechanism, fast IV measurement is utilized to demonstrate the self-heating induced anomalous channel width-dependent threshold voltage variation.
DEFF Research Database (Denmark)
Timmermann, D B; Lund, Trine Meldgaard; Belhage, B
2001-01-01
The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...
Cloning and functional expression of a plant voltage-dependent chloride channel.
Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C
1996-01-01
Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442
Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A
2018-02-21
Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.
Grafting voltage and pharmacological sensitivity in potassium channels.
Lan, Xi; Fan, Chunyan; Ji, Wei; Tian, Fuyun; Xu, Tao; Gao, Zhaobing
2016-08-01
A classical voltage-gated ion channel consists of four voltage-sensing domains (VSDs). However, the roles of each VSD in the channels remain elusive. We developed a GVTDT (Graft VSD To Dimeric TASK3 channels that lack endogenous VSDs) strategy to produce voltage-gated channels with a reduced number of VSDs. TASK3 channels exhibit a high host tolerance to VSDs of various voltage-gated ion channels without interfering with the intrinsic properties of the TASK3 selectivity filter. The constructed channels, exemplified by the channels grafted with one or two VSDs from Kv7.1 channels, exhibit classical voltage sensitivity, including voltage-dependent opening and closing. Furthermore, the grafted Kv7.1 VSD transfers the potentiation activity of benzbromarone, an activator that acts on the VSDs of the donor channels, to the constructed channels. Our study indicates that one VSD is sufficient to voltage-dependently gate the pore and provides new insight into the roles of VSDs.
Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel
Energy Technology Data Exchange (ETDEWEB)
Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)
2011-07-29
Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.
Directory of Open Access Journals (Sweden)
Seok-Yong Lee
2009-03-01
Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.
Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.
Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan
2018-04-18
Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.
Molecular mechanism of voltage sensing in voltage-gated proton channels
Rebolledo, Santiago; Perez, Marta E.
2013-01-01
Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575
DEFF Research Database (Denmark)
Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D
2001-01-01
The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...
New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.
Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy
2004-10-01
We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.
Gabapentin Modulates HCN4 Channel Voltage-Dependence
Directory of Open Access Journals (Sweden)
Han-Shen Tae
2017-08-01
Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.
The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.
Directory of Open Access Journals (Sweden)
Ting-Feng Lin
Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.
Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.
2015-03-01
Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.
Dual Regulation of Voltage-Sensitive Ion Channels by PIP2
Directory of Open Access Journals (Sweden)
Aldo A Rodríguez Menchaca
2012-09-01
Full Text Available Over the past 16 years, there has been an impressive number of ion channels shown to be sensitive to the major phosphoinositide in the plasma membrane, phosphatidilinositol 4,5-bisphosphate (PIP2. Among them are voltage-gated channels, which are crucial for both neuronal and cardiac excitability. Voltage-gated calcium (Cav channels were shown to be regulated bidirectionally by PIP2. On one hand, PIP2 stabilized their activity by reducing current rundown but on the other hand it produced a voltage-dependent inhibition by shifting the activation curve to more positive voltages. For voltage-gated potassium (Kv channels PIP2 was first shown to prevent N-type inactivation. Careful examination of the effects of PIP2 on the activation mechanism of Kv1.2 has shown a similar bidirectional regulation as in the Cav channels. The two effects could be distinguished kinetically, in terms of their sensitivities to PIP2 and by distinct molecular determinants. The rightward shift of the Kv1.2 voltage dependence implicated basic residues in the S4-S5 linker and was consistent with stabilization of the inactive state of the voltage sensor. A third type of a voltage-gated ion channel modulated by PIP2 is the hyperpolarization-activated cyclic nucleotide-gated (HCN channel. PIP2 has been shown to enhance the opening of HCN channels by shifting their voltage-dependent activation toward depolarized potentials. The sea urchin HCN channel, SpIH, showed again a PIP2-mediated bidirectional effect but in reverse order than the depolarization-activated Cav and Kv channels: a voltage-dependent potentiation, like the mammalian HCN channels, but also an inhibition of the cGMP-induced current activation. Just like the Kv1.2 channels, distinct molecular determinants underlied the PIP2 dual effects on SpIH channels. The dual regulation of these very different ion channels, all of which are voltage dependent, points to conserved mechanisms of regulation of these channels by PIP2.
Directory of Open Access Journals (Sweden)
Sameera Dharia
2011-02-01
Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.
Dharia, Sameera; Rabbitt, Richard D
2011-02-28
Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.
DEFF Research Database (Denmark)
Bennekou, P.; Barksmann, T. L.; Christophersen, P.
2006-01-01
The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...
Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice.
Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf
2006-03-01
We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.
Mechanism of voltage-gated channel formation in lipid membranes.
Guidelli, Rolando; Becucci, Lucia
2016-04-01
Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.
Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing
2014-07-01
Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.
Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes
DEFF Research Database (Denmark)
Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R
2006-01-01
Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....
Directory of Open Access Journals (Sweden)
Wei Xia
2015-01-01
Full Text Available Interleukin-6 has been shown to be involved in nerve injury and nerve regeneration, but the effects of long-term administration of high concentrations of interleukin-6 on neurons in the central nervous system is poorly understood. This study investigated the effects of 24 hour exposure of interleukin-6 on cortical neurons at various concentrations (0.1, 1, 5 and 10 ng/mL and the effects of 10 ng/mL interleukin-6 exposure to cortical neurons for various durations (2, 4, 8, 24 and 48 hours by studying voltage-gated Na + channels using a patch-clamp technique. Voltage-clamp recording results demonstrated that interleukin-6 suppressed Na + currents through its receptor in a time- and dose-dependent manner, but did not alter voltage-dependent activation and inactivation. Current-clamp recording results were consistent with voltage-clamp recording results. Interleukin-6 reduced the action potential amplitude of cortical neurons, but did not change the action potential threshold. The regulation of voltage-gated Na + channels in rat cortical neurons by interleukin-6 is time- and dose-dependent.
C-terminus-mediated voltage gating of Arabidopsis guard cell anion channel QUAC1.
Mumm, Patrick; Imes, Dennis; Martinoia, Enrico; Al-Rasheid, Khaled A S; Geiger, Dietmar; Marten, Irene; Hedrich, Rainer
2013-09-01
Anion transporters in plants play a fundamental role in volume regulation and signaling. Currently, two plasma membrane-located anion channel families—SLAC/SLAH and ALMT—are known. Among the ALMT family, the root-expressed ALuminium-activated Malate Transporter 1 was identified by comparison of aluminum-tolerant and Al(3+)-sensitive wheat cultivars and was subsequently shown to mediate voltage-independent malate currents. In contrast, ALMT12/QUAC1 (QUickly activating Anion Channel1) is expressed in guard cells transporting malate in an Al(3+)-insensitive and highly voltage-dependent manner. So far, no information is available about the structure and mechanism of voltage-dependent gating with the QUAC1 channel protein. Here, we analyzed gating of QUAC1-type currents in the plasma membrane of guard cells and QUAC1-expressing oocytes revealing similar voltage dependencies and activation–deactivation kinetics. In the heterologous expression system, QUAC1 was electrophysiologically characterized at increasing extra- and intracellular malate concentrations. Thereby, malate additively stimulated the voltage-dependent QUAC1 activity. In search of structural determinants of the gating process, we could not identify transmembrane domains common for voltage-sensitive channels. However, site-directed mutations and deletions at the C-terminus of QUAC1 resulted in altered voltage-dependent channel activity. Interestingly, the replacement of a single glutamate residue, which is conserved in ALMT channels from different clades, by an alanine disrupted QUAC1 activity. Together with C- and N-terminal tagging, these results indicate that the cytosolic C-terminus is involved in the voltage-dependent gating mechanism of QUAC1.
DEFF Research Database (Denmark)
Garau, Gianpiero; Magotti, Paola; Heine, Martin
2015-01-01
Our previous studies revealed that L-type voltage-dependent Ca2+ channels (Cav1.2 L-VDCCs) are modulated by the neural extracellular matrix backbone, polyanionic glycan hyaluronic acid. Here we used isothermal titration calorimetry and screened a set of peptides derived from the extracellular......M), integrating their enthalpic and entropic binding contributions. Interaction between heparin and recombinant as well as native full-length neuronal Cav1.2α1 channels was confirmed using the heparin–agarose pull down assay. Whole cell patch clamp recordings in HEK293 cells transfected with neuronal Cav1.......2 channels revealed that enzymatic digestion of highly sulfated heparan sulfates with heparinase 1 affects neither voltage-dependence of channel activation nor the level of steady state inactivation, but did speed up channel inactivation. Treatment of hippocampal cultures with heparinase 1 reduced the firing...
Coupling between the voltage-sensing and pore domains in a voltage-gated potassium channel.
Schow, Eric V; Freites, J Alfredo; Nizkorodov, Alex; White, Stephen H; Tobias, Douglas J
2012-07-01
Voltage-dependent potassium (Kv), sodium (Nav), and calcium channels open and close in response to changes in transmembrane (TM) potential, thus regulating cell excitability by controlling ion flow across the membrane. An outstanding question concerning voltage gating is how voltage-induced conformational changes of the channel voltage-sensing domains (VSDs) are coupled through the S4-S5 interfacial linking helices to the opening and closing of the pore domain (PD). To investigate the coupling between the VSDs and the PD, we generated a closed Kv channel configuration from Aeropyrum pernix (KvAP) using atomistic simulations with experiment-based restraints on the VSDs. Full closure of the channel required, in addition to the experimentally determined TM displacement, that the VSDs be displaced both inwardly and laterally around the PD. This twisting motion generates a tight hydrophobic interface between the S4-S5 linkers and the C-terminal ends of the pore domain S6 helices in agreement with available experimental evidence.
Free-energy relationships in ion channels activated by voltage and ligand
Chowdhury, Sandipan
2013-01-01
Many ion channels are modulated by multiple stimuli, which allow them to integrate a variety of cellular signals and precisely respond to physiological needs. Understanding how these different signaling pathways interact has been a challenge in part because of the complexity of underlying models. In this study, we analyzed the energetic relationships in polymodal ion channels using linkage principles. We first show that in proteins dually modulated by voltage and ligand, the net free-energy change can be obtained by measuring the charge-voltage (Q-V) relationship in zero ligand condition and the ligand binding curve at highly depolarizing membrane voltages. Next, we show that the voltage-dependent changes in ligand occupancy of the protein can be directly obtained by measuring the Q-V curves at multiple ligand concentrations. When a single reference ligand binding curve is available, this relationship allows us to reconstruct ligand binding curves at different voltages. More significantly, we establish that the shift of the Q-V curve between zero and saturating ligand concentration is a direct estimate of the interaction energy between the ligand- and voltage-dependent pathway. These free-energy relationships were tested by numerical simulations of a detailed gating model of the BK channel. Furthermore, as a proof of principle, we estimate the interaction energy between the ligand binding and voltage-dependent pathways for HCN2 channels whose ligand binding curves at various voltages are available. These emerging principles will be useful for high-throughput mutagenesis studies aimed at identifying interaction pathways between various regulatory domains in a polymodal ion channel. PMID:23250866
Tomczak, Adam P; Fernández-Trillo, Jorge; Bharill, Shashank; Papp, Ferenc; Panyi, Gyorgy; Stühmer, Walter; Isacoff, Ehud Y; Pardo, Luis A
2017-05-01
Voltage-gated ion channels couple transmembrane potential changes to ion flow. Conformational changes in the voltage-sensing domain (VSD) of the channel are thought to be transmitted to the pore domain (PD) through an α-helical linker between them (S4-S5 linker). However, our recent work on channels disrupted in the S4-S5 linker has challenged this interpretation for the KCNH family. Furthermore, a recent single-particle cryo-electron microscopy structure of K V 10.1 revealed that the S4-S5 linker is a short loop in this KCNH family member, confirming the need for an alternative gating model. Here we use "split" channels made by expression of VSD and PD as separate fragments to investigate the mechanism of gating in K V 10.1. We find that disruption of the covalent connection within the S4 helix compromises the ability of channels to close at negative voltage, whereas disconnecting the S4-S5 linker from S5 slows down activation and deactivation kinetics. Surprisingly, voltage-clamp fluorometry and MTS accessibility assays show that the motion of the S4 voltage sensor is virtually unaffected when VSD and PD are not covalently bound. Finally, experiments using constitutively open PD mutants suggest that the presence of the VSD is structurally important for the conducting conformation of the pore. Collectively, our observations offer partial support to the gating model that assumes that an inward motion of the C-terminal S4 helix, rather than the S4-S5 linker, closes the channel gate, while also suggesting that control of the pore by the voltage sensor involves more than one mechanism. © 2017 Tomczak et al.
Dharia, Sameera; Rabbitt, Richard D.
2011-01-01
Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...
Large conductance Ca2+-activated K+ (BK channel: Activation by Ca2+ and voltage
Directory of Open Access Journals (Sweden)
RAMÓN LATORRE
2006-01-01
Full Text Available Large conductance Ca2+-activated K+ (BK channels belong to the S4 superfamily of K+ channels that include voltage-dependent K+ (Kv channels characterized by having six (S1-S6 transmembrane domains and a positively charged S4 domain. As Kv channels, BK channels contain a S4 domain, but they have an extra (S0 transmembrane domain that leads to an external NH2-terminus. The BK channel is activated by internal Ca2+, and using chimeric channels and mutagenesis, three distinct Ca2+-dependent regulatory mechanisms with different divalent cation selectivity have been identified in its large COOH-terminus. Two of these putative Ca2+-binding domains activate the BK channel when cytoplasmic Ca2+ reaches micromolar concentrations, and a low Ca2+ affinity mechanism may be involved in the physiological regulation by Mg2+. The presence in the BK channel of multiple Ca2+-binding sites explains the huge Ca2+ concentration range (0.1 μM-100 μM in which the divalent cation influences channel gating. BK channels are also voltage-dependent, and all the experimental evidence points toward the S4 domain as the domain in charge of sensing the voltage. Calcium can open BK channels when all the voltage sensors are in their resting configuration, and voltage is able to activate channels in the complete absence of Ca2+. Therefore, Ca2+ and voltage act independently to enhance channel opening, and this behavior can be explained using a two-tiered allosteric gating mechanism.
Gupta, Rajeev
2017-09-02
The drift kinetic energy of ionic flow through single ion channels cause vibrations of the pore walls which are observed as open-state current fluctuations (open-channel noise) during single-channel recordings. Vibration of the pore wall leads to transitions among different conformational sub-states of the channel protein in the open-state. Open-channel noise analysis can provide important information about the different conformational sub-state transitions and how biochemical modifications of ion channels would affect their transport properties. It has been shown that c-Jun N-terminal kinase-3 (JNK3) becomes activated by phosphorylation in various neurodegenerative diseases and phosphorylates outer mitochondrion associated proteins leading to neuronal apoptosis. In our earlier work, JNK3 has been reported to phosphorylate purified rat brain mitochondrial voltage-dependent anion channel (VDAC) in vitro and modify its conductance and opening probability. In this article we have compared the open-state noise profile of the native and the JNK3 phosphorylated VDAC using Power Spectral Density vs frequency plots. Power spectral density analysis of open-state noise indicated power law with average slope value α ≈1 for native VDAC at both positive and negative voltage whereas average α value open-state noise arises due to coupling of ionic transport and conformational sub-states transitions in open-state and this coupling is perturbed as a result of channel phosphorylation. Copyright © 2017 Elsevier Inc. All rights reserved.
VKCDB: Voltage-gated potassium channel database
Directory of Open Access Journals (Sweden)
Gallin Warren J
2004-01-01
Full Text Available Abstract Background The family of voltage-gated potassium channels comprises a functionally diverse group of membrane proteins. They help maintain and regulate the potassium ion-based component of the membrane potential and are thus central to many critical physiological processes. VKCDB (Voltage-gated potassium [K] Channel DataBase is a database of structural and functional data on these channels. It is designed as a resource for research on the molecular basis of voltage-gated potassium channel function. Description Voltage-gated potassium channel sequences were identified by using BLASTP to search GENBANK and SWISSPROT. Annotations for all voltage-gated potassium channels were selectively parsed and integrated into VKCDB. Electrophysiological and pharmacological data for the channels were collected from published journal articles. Transmembrane domain predictions by TMHMM and PHD are included for each VKCDB entry. Multiple sequence alignments of conserved domains of channels of the four Kv families and the KCNQ family are also included. Currently VKCDB contains 346 channel entries. It can be browsed and searched using a set of functionally relevant categories. Protein sequences can also be searched using a local BLAST engine. Conclusions VKCDB is a resource for comparative studies of voltage-gated potassium channels. The methods used to construct VKCDB are general; they can be used to create specialized databases for other protein families. VKCDB is accessible at http://vkcdb.biology.ualberta.ca.
International Nuclear Information System (INIS)
Abalis, I.M.; Chiang, P.K.; Wirtz, R.A.; Andre, R.G.
1986-01-01
Diisopropylfluorophosphate (DFP), a potent organophosphate inhibitor of cholinesterases, was found to inhibit the specific binding of [ 35 S]t-butylbicyclophosphorothionate (TBPS), specific chloride channels ligand, to the electric organ membranes of Torpedo, with a Ki of 21 +/- 3 μM. The binding sites of [ 35 S]TBPS in the Torpedo membranes were found not to be GABA receptors or nicotinic acetylcholine receptors as previously described. Interestingly, a stimulation of the binding of [ 35 S]TBPS was observed in the presence of atropine and three oximes, monopyridinium oxime 2-PAM, bispyridinium bis-oxime TMB-4 and H-oxime HI-6. The maximal stimulation was 300-500% of control, after which, the stimulation was reversed at higher concentrations. The three oximes protected by more than 95% the inhibition by 1 mM DFP of the binding of [ 35 S]TBPS to the voltage-dependent chloride channel. However, atropine protected only 20% of the inhibited channel. These results, thus, suggest that the protection against the toxic effects of DFP or other anticholinesterase agents by the tested oximes may not be solely a result of the reactivation of cholinesterases but also the protection of the voltage-dependent chloride channel
CONTRIBUTIONS OF INTRACELLULAR IONS TO Kv CHANNEL VOLTAGE SENSOR DYNAMICS.
Directory of Open Access Journals (Sweden)
Samuel eGoodchild
2012-06-01
Full Text Available Voltage sensing domains of Kv channels control ionic conductance through coupling of the movement of charged residues in the S4 segment to conformational changes at the cytoplasmic region of the pore domain, that allow K+ ions to flow. Conformational transitions within the voltage sensing domain caused by changes in the applied voltage across the membrane field are coupled to the conducting pore region and the gating of ionic conductance. However, several other factors not directly linked to the voltage dependent movement of charged residues within the voltage sensor impact the dynamics of the voltage sensor, such as inactivation, ionic conductance, intracellular ion identity and block of the channel by intracellular ligands. The effect of intracellular ions on voltage sensor dynamics is of importance in the interpretation of gating current measurements and the physiology of pore/voltage sensor coupling. There is a significant amount of variability in the reported kinetics of voltage sensor deactivation kinetics of Kv channels attributed to different mechanisms such as open state stabilization, immobilization and relaxation processes of the voltage sensor. Here we separate these factors and focus on the causal role that intracellular ions can play in allosterically modulating the dynamics of Kv voltage sensor deactivation kinetics. These considerations are of critical importance in understanding the molecular determinants of the complete channel gating cycle from activation to deactivation.
Navakkode, Sheeja; Sajikumar, Sreedharan; Korte, Martin; Soong, Tuck Wah
2012-01-01
The dopaminergic modulation of long-term potentiation (LTP) has been studied well, but the mechanism by which dopamine induces LTP (DA-LTP) in CA1 pyramidal neurons is unknown. Here, we report that DA-LTP in basal dendrites is dependent while in apical dendrites it is independent of activation of L-type voltage-gated calcium channels (VDCC).…
Unfolding of a Temperature-Sensitive Domain Controls Voltage-Gated Channel Activation.
Arrigoni, Cristina; Rohaim, Ahmed; Shaya, David; Findeisen, Felix; Stein, Richard A; Nurva, Shailika Reddy; Mishra, Smriti; Mchaourab, Hassane S; Minor, Daniel L
2016-02-25
Voltage-gated ion channels (VGICs) are outfitted with diverse cytoplasmic domains that impact function. To examine how such elements may affect VGIC behavior, we addressed how the bacterial voltage-gated sodium channel (BacNa(V)) C-terminal cytoplasmic domain (CTD) affects function. Our studies show that the BacNa(V) CTD exerts a profound influence on gating through a temperature-dependent unfolding transition in a discrete cytoplasmic domain, the neck domain, proximal to the pore. Structural and functional studies establish that the BacNa(V) CTD comprises a bi-partite four-helix bundle that bears an unusual hydrophilic core whose integrity is central to the unfolding mechanism and that couples directly to the channel activation gate. Together, our findings define a general principle for how the widespread four-helix bundle cytoplasmic domain architecture can control VGIC responses, uncover a mechanism underlying the diverse BacNa(V) voltage dependencies, and demonstrate that a discrete domain can encode the temperature-dependent response of a channel. Copyright © 2016 Elsevier Inc. All rights reserved.
Voltage gating of mechanosensitive PIEZO channels.
Moroni, Mirko; Servin-Vences, M Rocio; Fleischer, Raluca; Sánchez-Carranza, Oscar; Lewin, Gary R
2018-03-15
Mechanosensitive PIEZO ion channels are evolutionarily conserved proteins whose presence is critical for normal physiology in multicellular organisms. Here we show that, in addition to mechanical stimuli, PIEZO channels are also powerfully modulated by voltage and can even switch to a purely voltage-gated mode. Mutations that cause human diseases, such as xerocytosis, profoundly shift voltage sensitivity of PIEZO1 channels toward the resting membrane potential and strongly promote voltage gating. Voltage modulation may be explained by the presence of an inactivation gate in the pore, the opening of which is promoted by outward permeation. Older invertebrate (fly) and vertebrate (fish) PIEZO proteins are also voltage sensitive, but voltage gating is a much more prominent feature of these older channels. We propose that the voltage sensitivity of PIEZO channels is a deep property co-opted to add a regulatory mechanism for PIEZO activation in widely different cellular contexts.
Cantrell, A R; Scheuer, T; Catterall, W A
1999-07-01
Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.
Identification of an HV 1 voltage-gated proton channel in insects.
Chaves, Gustavo; Derst, Christian; Franzen, Arne; Mashimo, Yuta; Machida, Ryuichiro; Musset, Boris
2016-04-01
The voltage-gated proton channel 1 (HV 1) is an important component of the cellular proton extrusion machinery and is essential for charge compensation during the respiratory burst of phagocytes. HV 1 has been identified in a wide range of eukaryotes throughout the animal kingdom, with the exception of insects. Therefore, it has been proposed that insects do not possess an HV 1 channel. In the present study, we report the existence of an HV 1-type proton channel in insects. We searched insect transcriptome shotgun assembly (TSA) sequence databases and found putative HV 1 orthologues in various polyneopteran insects. To confirm that these putative HV 1 orthologues were functional channels, we studied the HV 1 channel of Nicoletia phytophila (NpHV 1), an insect of the Zygentoma order, in more detail. NpHV 1 comprises 239 amino acids and is 33% identical to the human voltage-gated proton channel 1. Patch clamp measurements in a heterologous expression system showed proton selectivity, as well as pH- and voltage-dependent gating. Interestingly, NpHV 1 shows slightly enhanced pH-dependent gating compared to the human channel. Mutations in the first transmembrane segment at position 66 (Asp66), the presumed selectivity filter, lead to a loss of proton-selective conduction, confirming the importance of this aspartate residue in voltage-gated proton channels. Nucleotide sequence data have been deposited in the GenBank database under accession number KT780722. © 2016 Federation of European Biochemical Societies.
A Non-canonical Voltage-Sensing Mechanism Controls Gating in K2P K(+) Channels.
Schewe, Marcus; Nematian-Ardestani, Ehsan; Sun, Han; Musinszki, Marianne; Cordeiro, Sönke; Bucci, Giovanna; de Groot, Bert L; Tucker, Stephen J; Rapedius, Markus; Baukrowitz, Thomas
2016-02-25
Two-pore domain (K2P) K(+) channels are major regulators of excitability that endow cells with an outwardly rectifying background "leak" conductance. In some K2P channels, strong voltage-dependent activation has been observed, but the mechanism remains unresolved because they lack a canonical voltage-sensing domain. Here, we show voltage-dependent gating is common to most K2P channels and that this voltage sensitivity originates from the movement of three to four ions into the high electric field of an inactive selectivity filter. Overall, this ion-flux gating mechanism generates a one-way "check valve" within the filter because outward movement of K(+) induces filter opening, whereas inward movement promotes inactivation. Furthermore, many physiological stimuli switch off this flux gating mode to convert K2P channels into a leak conductance. These findings provide insight into the functional plasticity of a K(+)-selective filter and also refine our understanding of K2P channels and the mechanisms by which ion channels can sense voltage. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Axonal voltage-gated ion channels as pharmacological targets for pain
DEFF Research Database (Denmark)
Moldovan, Mihai; Alvarez, Susana; Romer Rosberg, Mette
2013-01-01
Upon peripheral nerve injury (caused by trauma or disease process) axons of the dorsal root ganglion (DRG) somatosensory neurons have the ability to sprout and regrow/remyelinate to reinnervate distant target tissue or form a tangled scar mass called a neuroma. This regenerative response can become...... maladaptive leading to a persistent and debilitating pain state referred to as chronic pain corresponding to the clinical description of neuropathic/chronic inflammatory pain. There is little agreement to what causes peripheral chronic pain other than hyperactivity of the nociceptive DRG neurons which...... ultimately depends on the function of voltage-gated ion channels. This review focuses on the pharmacological modulators of voltage-gated ion channels known to be present on axonal membrane which represents by far the largest surface of DRG neurons. Blockers of voltage-gated Na(+) channels, openers of voltage...
Modeling hysteresis observed in the human erythrocyte voltage-dependent cation channel
DEFF Research Database (Denmark)
Flyvbjerg, Henrik; Gudowska-Nowak, Ewa; Christophersen, Palle
2012-01-01
The non-selective voltage-activated cation channel from human red cells, which is activated at depolarizing potentials, has been shown to exhibit counter-clockwise gating hysteresis. Here, we analyze this phenomenon with the simplest possible phenomenological models. Specifically, the hysteresis ...
Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori
2018-01-01
Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.
Czech Academy of Sciences Publication Activity Database
Zicha, Josef; Pintérová, Mária; Dobešová, Zdenka; Líšková, Silvia; Kuneš, Jaroslav
2006-01-01
Roč. 24, č. S6 (2006), s. 34-34 ISSN 0263-6352. [Scientific Meeting of the International Society of Hypertension /21./. 15.10.2006-19.10.2006, Fukuoka] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : pertussis toxin * alpha adrenergic vasoconstriction * voltage-dependent calcium channels * SHR rat Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery
Vaccaro, S. R.
2011-09-01
The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.
Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.
2008-01-01
External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222
Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J
2008-11-01
External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.
Directory of Open Access Journals (Sweden)
Erin K Purcell
Full Text Available The influence of membrane cholesterol content on a variety of ion channel conductances in numerous cell models has been shown, but studies exploring its role in auditory hair cell physiology are scarce. Recent evidence shows that cholesterol depletion affects outer hair cell electromotility and the voltage-gated potassium currents underlying tall hair cell development, but the effects of cholesterol on the major ionic currents governing auditory hair cell excitability are unknown. We investigated the effects of a cholesterol-depleting agent (methyl beta cyclodextrin, MβCD on ion channels necessary for the early stages of sound processing. Large-conductance BK-type potassium channels underlie temporal processing and open in a voltage- and calcium-dependent manner. Voltage-gated calcium channels (VGCCs are responsible for calcium-dependent exocytosis and synaptic transmission to the auditory nerve. Our results demonstrate that cholesterol depletion reduced peak steady-state calcium-sensitive (BK-type potassium current by 50% in chick cochlear hair cells. In contrast, MβCD treatment increased peak inward calcium current (~30%, ruling out loss of calcium channel expression or function as a cause of reduced calcium-sensitive outward current. Changes in maximal conductance indicated a direct impact of cholesterol on channel number or unitary conductance. Immunoblotting following sucrose-gradient ultracentrifugation revealed BK expression in cholesterol-enriched microdomains. Both direct impacts of cholesterol on channel biophysics, as well as channel localization in the membrane, may contribute to the influence of cholesterol on hair cell physiology. Our results reveal a new role for cholesterol in the regulation of auditory calcium and calcium-activated potassium channels and add to the growing evidence that cholesterol is a key determinant in auditory physiology.
Directory of Open Access Journals (Sweden)
Seong-Ho Ok
2013-01-01
Full Text Available This study investigated endothelium-derived vasodilators and potassium channels involved in the modulation of ropivacaine-induced contraction. In endothelium-intact rat aortae, ropivacaine concentration-response curves were generated in the presence or absence of the following inhibitors: the nonspecific nitric oxide synthase (NOS inhibitor Nω-nitro-L-arginine methyl ester (L-NAME, the neuronal NOS inhibitor Nω-propyl-L-arginine hydrochloride, the inducible NOS inhibitor 1400W dihydrochloride, the nitric oxide-sensitive guanylyl cyclase (GC inhibitor ODQ, the NOS and GC inhibitor methylene blue, the phosphoinositide-3 kinase inhibitor wortmannin, the cytochrome p450 epoxygenase inhibitor fluconazole, the voltage-dependent potassium channel inhibitor 4-aminopyridine (4-AP, the calcium-activated potassium channel inhibitor tetraethylammonium (TEA, the inward-rectifying potassium channel inhibitor barium chloride, and the ATP-sensitive potassium channel inhibitor glibenclamide. The effect of ropivacaine on endothelial nitric oxide synthase (eNOS phosphorylation in human umbilical vein endothelial cells was examined by western blotting. Ropivacaine-induced contraction was weaker in endothelium-intact aortae than in endothelium-denuded aortae. L-NAME, ODQ, and methylene blue enhanced ropivacaine-induced contraction, whereas wortmannin, Nω-propyl-L-arginine hydrochloride, 1400W dihydrochloride, and fluconazole had no effect. 4-AP and TEA enhanced ropivacaine-induced contraction; however, barium chloride and glibenclamide had no effect. eNOS phosphorylation was induced by ropivacaine. These results suggest that ropivacaine-induced contraction is attenuated primarily by both endothelial nitric oxide and voltage-dependent potassium channels.
Functional diversity of potassium channel voltage-sensing domains.
Islas, León D
2016-01-01
Voltage-gated potassium channels or Kv's are membrane proteins with fundamental physiological roles. They are composed of 2 main functional protein domains, the pore domain, which regulates ion permeation, and the voltage-sensing domain, which is in charge of sensing voltage and undergoing a conformational change that is later transduced into pore opening. The voltage-sensing domain or VSD is a highly conserved structural motif found in all voltage-gated ion channels and can also exist as an independent feature, giving rise to voltage sensitive enzymes and also sustaining proton fluxes in proton-permeable channels. In spite of the structural conservation of VSDs in potassium channels, there are several differences in the details of VSD function found across variants of Kvs. These differences are mainly reflected in variations in the electrostatic energy needed to open different potassium channels. In turn, the differences in detailed VSD functioning among voltage-gated potassium channels might have physiological consequences that have not been explored and which might reflect evolutionary adaptations to the different roles played by Kv channels in cell physiology.
Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E
2016-06-01
Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms
The voltage-sensing domain of a phosphatase gates the pore of a potassium channel.
Arrigoni, Cristina; Schroeder, Indra; Romani, Giulia; Van Etten, James L; Thiel, Gerhard; Moroni, Anna
2013-03-01
The modular architecture of voltage-gated K(+) (Kv) channels suggests that they resulted from the fusion of a voltage-sensing domain (VSD) to a pore module. Here, we show that the VSD of Ciona intestinalis phosphatase (Ci-VSP) fused to the viral channel Kcv creates Kv(Synth1), a functional voltage-gated, outwardly rectifying K(+) channel. Kv(Synth1) displays the summed features of its individual components: pore properties of Kcv (selectivity and filter gating) and voltage dependence of Ci-VSP (V(1/2) = +56 mV; z of ~1), including the depolarization-induced mode shift. The degree of outward rectification of the channel is critically dependent on the length of the linker more than on its amino acid composition. This highlights a mechanistic role of the linker in transmitting the movement of the sensor to the pore and shows that electromechanical coupling can occur without coevolution of the two domains.
LRRK2 regulates voltage-gated calcium channel function.
Directory of Open Access Journals (Sweden)
Cade eBedford
2016-05-01
Full Text Available Voltage-gated Ca2+ (CaV channels enable Ca2+ influx in response to membrane depolarization. CaV2.1 channels are localized to the presynaptic membrane of many types of neurons where they are involved in triggering neurotransmitter release. Several signaling proteins have been identified as important CaV2.1 regulators including protein kinases, G-proteins and Ca2+ binding proteins. Recently, we discovered that leucine rich repeat kinase 2 (LRRK2, a protein associated with inherited Parkinson’s disease, interacts with specific synaptic proteins and influences synaptic transmission. Since synaptic proteins functionally interact with CaV2.1 channels and synaptic transmission is triggered by Ca2+ entry via CaV2.1, we investigated whether LRRK2 could impact CaV2.1 channel function. CaV2.1 channel properties were measured using whole cell patch clamp electrophysiology in HEK293 cells transfected with CaV2.1 subunits and various LRRK2 constructs. Our results demonstrate that both wild type LRRK2 and the G2019S LRRK2 mutant caused a significant increase in whole cell Ca2+ current density compared to cells expressing only the CaV2.1 channel complex. In addition, LRRK2 expression caused a significant hyperpolarizing shift in voltage-dependent activation while having no significant effect on inactivation properties. These functional changes in CaV2.1 activity are likely due to a direct action of LRRK2 as we detected a physical interaction between LRRK2 and the β3 CaV channel subunit via coimmunoprecipitation. Furthermore, effects on CaV2.1 channel function are dependent on LRRK2 kinase activity as these could be reversed via treatment with a LRRK2 inhibitor. Interestingly, LRRK2 also augmented endogenous voltage-gated Ca2+ channel function in PC12 cells suggesting other CaV channels could also be regulated by LRRK2. Overall, our findings support a novel physiological role for LRRK2 in regulating CaV2.1 function that could have implications for how
Liu, Dong-Hai; Huang, Xu; Guo, Xin; Meng, Xiang-Min; Wu, Yi-Song; Lu, Hong-Li; Zhang, Chun-Mei; Kim, Young-chul; Xu, Wen-Xie
2014-01-01
Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV) was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV) to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.
Raddatz, Natalia; Castillo, Juan P.; Gonzalez, Carlos; Alvarez, Osvaldo; Latorre, Ramon
2014-01-01
Expressed in somatosensory neurons of the dorsal root and trigeminal ganglion, the transient receptor potential melastatin 8 (TRPM8) channel is a Ca2+-permeable cation channel activated by cold, voltage, phosphatidylinositol 4,5-bisphosphate, and menthol. Although TRPM8 channel gating has been characterized at the single channel and macroscopic current levels, there is currently no consensus regarding the extent to which temperature and voltage sensors couple to the conduction gate. In this study, we extended the range of voltages where TRPM8-induced ionic currents were measured and made careful measurements of the maximum open probability the channel can attain at different temperatures by means of fluctuation analysis. The first direct measurements of TRPM8 channel temperature-driven conformational rearrangements provided here suggest that temperature alone is able to open the channel and that the opening reaction is voltage-independent. Voltage is a partial activator of TRPM8 channels, because absolute open probability values measured with fully activated voltage sensors are less than 1, and they decrease as temperature rises. By unveiling the fast temperature-dependent deactivation process, we show that TRPM8 channel deactivation is well described by a double exponential time course. The fast and slow deactivation processes are temperature-dependent with enthalpy changes of 27.2 and 30.8 kcal mol−1. The overall Q10 for the closing reaction is about 33. A three-tiered allosteric model containing four voltage sensors and four temperature sensors can account for the complex deactivation kinetics and coupling between voltage and temperature sensor activation and channel opening. PMID:25352597
Schultz, D; Mikala, G; Yatani, A; Engle, D B; Iles, D E; Segers, B; Sinke, R J; Weghuis, D O; Klöckner, U; Wakamori, M
1993-01-01
A unique structural variant of the cardiac L-type voltage-dependent calcium channel alpha 1 subunit cDNA was isolated from libraries derived from normal human heart mRNA. The deduced amino acid sequence shows significant homology to other calcium channel alpha 1 subunits. However, differences from
Rehn, Matthias; Bader, Sandra; Bell, Anna; Diener, Martin
2013-09-01
We recently observed a bradykinin-induced increase in the cytosolic Ca2+ concentration in submucosal neurons of rat colon, an increase inhibited by blockers of voltage-dependent Ca2+ (Ca(v)) channels. As the types of Ca(v) channels used by this part of the enteric nervous system are unknown, the expression of various Ca(v) subunits has been investigated in whole-mount submucosal preparations by immunohistochemistry. Submucosal neurons, identified by a neuronal marker (microtubule-associated protein 2), are immunoreactive for Ca(v)1.2, Ca(v)1.3 and Ca(v)2.2, expression being confirmed by reverse transcription plus the polymerase chain reaction. These data agree with previous observations that the inhibition of L- and N-type Ca2+ currents strongly inhibits the response to bradykinin. However, whole-cell patch-clamp experiments have revealed that bradykinin does not enhance Ca2+ inward currents under voltage-clamp conditions. Consequently, bradykinin does not directly interact with Ca(v) channels. Instead, the kinin-induced Ca2+ influx is caused indirectly by the membrane depolarization evoked by this peptide. As intracellular Ca2+ channels on Ca(2+)-storing organelles can also contribute to Ca2+ signaling, their expression has been investigated by imaging experiments and immunohistochemistry. Inositol 1,4,5-trisphosphate (IP3) receptors (IP3R) have been functionally demonstrated in submucosal neurons loaded with the Ca(2+)-sensitive fluorescent dye, fura-2. Histamine, a typical agonist coupled to the phospholipase C pathway, induces an increase in the fura-2 signal ratio, which is suppressed by 2-aminophenylborate, a blocker of IP3 receptors. The expression of IP3R1 has been confirmed by immunohistochemistry. In contrast, ryanodine, tested over a wide concentration range, evokes no increase in the cytosolic Ca2+ concentration nor is there immunohistochemical evidence for the expression of ryanodine receptors in these neurons. Thus, rat submucosal neurons are equipped
Ciguatoxins: Cyclic Polyether Modulators of Voltage-gated Iion Channel Function
Nicholson, Graham M.; Lewis, Richard J.
2006-01-01
Ciguatoxins are cyclic polyether toxins, derived from marine dinoflagellates, which are responsible for the symptoms of ciguatera poisoning. Ingestion of tropical and subtropical fin fish contaminated by ciguatoxins results in an illness characterised by neurological, cardiovascular and gastrointestinal disorders. The pharmacology of ciguatoxins is characterised by their ability to cause persistent activation of voltage-gated sodium channels, to increase neuronal excitability and neurotransmitter release, to impair synaptic vesicle recycling, and to cause cell swelling. It is these effects, in combination with an action to block voltage-gated potassium channels at high doses, which are believed to underlie the complex of symptoms associated with ciguatera. This review examines the sources, structures and pharmacology of ciguatoxins. In particular, attention is placed on their cellular modes of actions to modulate voltage-gated ion channels and other Na+-dependent mechanisms in numerous cell types and to current approaches for detection and treatment of ciguatera.
Lin, C S; Boltz, R C; Blake, J T; Nguyen, M; Talento, A; Fischer, P A; Springer, M S; Sigal, N H; Slaughter, R S; Garcia, M L
1993-03-01
The role that potassium channels play in human T lymphocyte activation has been investigated by using specific potassium channel probes. Charybdotoxin (ChTX), a blocker of small conductance Ca(2+)-activated potassium channels (PK,Ca) and voltage-gated potassium channels (PK,V) that are present in human T cells, inhibits the activation of these cells. ChTX blocks T cell activation induced by signals (e.g., anti-CD2, anti-CD3, ionomycin) that elicit a rise in intracellular calcium ([Ca2+]i) by preventing the elevation of [Ca2+]i in a dose-dependent manner. However, ChTX has no effect on the activation pathways (e.g., anti-CD28, interleukin 2 [IL-2]) that are independent of a rise in [Ca2+]i. In the former case, both proliferative response and lymphokine production (IL-2 and interferon gamma) are inhibited by ChTX. The inhibitory effect of ChTX can be demonstrated when added simultaneously, or up to 4 h after the addition of the stimulants. Since ChTX inhibits both PK,Ca and PK,V, we investigated which channel is responsible for these immunosuppressive effects with the use of two other peptides, noxiustoxin (NxTX) and margatoxin (MgTX), which are specific for PK,V. These studies demonstrate that, similar to ChTX, both NxTX and MgTX inhibit lymphokine production and the rise in [Ca2+]i. Taken together, these data provide evidence that blockade of PK,V affects the Ca(2+)-dependent pathways involved in T lymphocyte proliferation and lymphokine production by diminishing the rise in [Ca2+]i that occurs upon T cell activation.
Directory of Open Access Journals (Sweden)
Lei Zhu
Full Text Available CaV2.2 (N-type voltage-gated calcium channels (Ca2+ channels play key roles in neurons and neuroendocrine cells including the control of cellular excitability, neurotransmitter / hormone secretion, and gene expression. Calcium entry is precisely controlled by channel gating properties including multiple forms of inactivation. "Fast" voltage-dependent inactivation is relatively well-characterized and occurs over the tens-to- hundreds of milliseconds timeframe. Superimposed on this is the molecularly distinct, but poorly understood process of "slow" voltage-dependent inactivation, which develops / recovers over seconds-to-minutes. Protein kinases can modulate "slow" inactivation of sodium channels, but little is known about if/how second messengers control "slow" inactivation of Ca2+ channels. We investigated this using recombinant CaV2.2 channels expressed in HEK293 cells and native CaV2 channels endogenously expressed in adrenal chromaffin cells. The PKC activator phorbol 12-myristate 13-acetate (PMA dramatically prolonged recovery from "slow" inactivation, but an inactive control (4α-PMA had no effect. This effect of PMA was prevented by calphostin C, which targets the C1-domain on PKC, but only partially reduced by inhibitors that target the catalytic domain of PKC. The subtype of the channel β-subunit altered the kinetics of inactivation but not the magnitude of slowing produced by PMA. Intracellular GDP-β-S reduced the effect of PMA suggesting a role for G proteins in modulating "slow" inactivation. We postulate that the kinetics of recovery from "slow" inactivation could provide a molecular memory of recent cellular activity and help control CaV2 channel availability, electrical excitability, and neurotransmission in the seconds-to-minutes timeframe.
Voltage-gated proton channel is expressed on phagosomes
International Nuclear Information System (INIS)
Okochi, Yoshifumi; Sasaki, Mari; Iwasaki, Hirohide; Okamura, Yasushi
2009-01-01
Voltage-gated proton channel has been suggested to help NADPH oxidase activity during respiratory burst of phagocytes through its activities of compensating charge imbalance and regulation of pH. In phagocytes, robust production of reactive oxygen species occurs in closed membrane compartments, which are called phagosomes. However, direct evidence for the presence of voltage-gated proton channels in phagosome has been lacking. In this study, the expression of voltage-gated proton channels was studied by Western blot with the antibody specific to the voltage-sensor domain protein, VSOP/Hv1, that has recently been identified as the molecular correlate for the voltage-gated proton channel. Phagosomal membranes of neutrophils contain VSOP/Hv1 in accordance with subunits of NADPH oxidases, gp91, p22, p47 and p67. Superoxide anion production upon PMA activation was significantly reduced in neutrophils from VSOP/Hv1 knockout mice. These are consistent with the idea that voltage-gated proton channels help NADPH oxidase in phagocytes to produce reactive oxygen species.
Directory of Open Access Journals (Sweden)
Dong-Hai Liu
Full Text Available Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.
Expression and distribution of voltage-gated ion channels in ferret sinoatrial node.
Brahmajothi, Mulugu V; Morales, Michael J; Campbell, Donald L; Steenbergen, Charles; Strauss, Harold C
2010-10-01
Spontaneous diastolic depolarization in the sinoatrial (SA) node enables it to serve as pacemaker of the heart. The variable cell morphology within the SA node predicts that ion channel expression would be heterogeneous and different from that in the atrium. To evaluate ion channel heterogeneity within the SA node, we used fluorescent in situ hybridization to examine ion channel expression in the ferret SA node region and atrial appendage. SA nodal cells were distinguished from surrounding cardiac myocytes by expression of the slow (SA node) and cardiac (surrounding tissue) forms of troponin I. Nerve cells in the sections were identified by detection of GAP-43 and cytoskeletal middle neurofilament. Transcript expression was characterized for the 4 hyperpolarization-activated cation channels, 6 voltage-gated Na(+) channels, 3 voltage-gated Ca(2+) channels, 24 voltage-gated K(+) channel α-subunits, and 3 ancillary subunits. To ensure that transcript expression was representative of protein expression, immunofluorescence was used to verify localization patterns of voltage-dependent K(+) channels. Colocalizations were performed to observe any preferential patterns. Some overlapping and nonoverlapping binding patterns were observed. Measurement of different cation channel transcripts showed heterogeneous expression with many different patterns of expression, attesting to the complexity of electrical activity in the SA node. This study provides insight into the possible role ion channel heterogeneity plays in SA node pacemaker activity.
Modulation of voltage-gated channel currents by harmaline and harmane.
Splettstoesser, Frank; Bonnet, Udo; Wiemann, Martin; Bingmann, Dieter; Büsselberg, Dietrich
2005-01-01
Harmala alkaloids are endogenous substances, which are involved in neurodegenerative disorders such as M. Parkinson, but some of them also have neuroprotective effects in the nervous system. While several sites of action at the cellular level (e.g. benzodiazepine receptors, 5-HT and GABA(A) receptors) have been identified, there is no report on how harmala alkaloids interact with voltage-gated membrane channels. The aim of this study was to investigate the effects of harmaline and harmane on voltage-activated calcium- (I(Ca(V))), sodium- (I(Na(V))) and potassium (I(K(V)))-channel currents, using the whole-cell patch-clamp method with cultured dorsal root ganglion neurones of 3-week-old rats. Currents were elicited by voltage steps from the holding potential to different command potentials. Harmaline and harmane reduced I(Ca(V)), I(Na(V)) and I(K(V)) concentration-dependent (10-500 microM) over the voltage range tested. I(Ca(V)) was reduced with an IC(50) of 100.6 microM for harmaline and by a significantly lower concentration of 75.8 microM (P<0.001, t-test) for harmane. The Hill coefficient was close to 1. Threshold concentration was around 10 microM for both substances. The steady state of inhibition of I(Ca(V)) by harmaline or harmane was reached within several minutes. The action was not use-dependent and at least partly reversible. It was mainly due to a reduction in the sustained calcium channel current (I(Ca(L+N))), while the transient voltage-gated calcium channel current (I(Ca(T))) was only partially affected. We conclude that harmaline and harmane are modulators of I(Ca(V)) in vitro. This might be related to their neuroprotective effects.
Directory of Open Access Journals (Sweden)
Kota Kasahara
Full Text Available The mechanism of ion conduction by potassium channels is one of the central issues in physiology. In particular, it is still unclear how the ion concentration and the membrane voltage drive ion conduction. We have investigated the dynamics of the ion conduction processes in the Kv1.2 pore domain, by molecular dynamics (MD simulations with several different voltages and ion concentrations. By focusing on the detailed ion movements through the pore including selectivity filter (SF and cavity, we found two major conduction mechanisms, called the III-IV-III and III-II-III mechanisms, and the balance between the ion concentration and the voltage determines the mechanism preference. In the III-IV-III mechanism, the outermost ion in the pore is pushed out by a new ion coming from the intracellular fluid, and four-ion states were transiently observed. In the III-II-III mechanism, the outermost ion is pulled out first, without pushing by incoming ions. Increases in the ion concentration and voltage accelerated ion conductions, but their mechanisms were different. The increase in the ion concentrations facilitated the III-IV-III conductions, while the higher voltages increased the III-II-III conductions, indicating that the pore domain of potassium channels permeates ions by using two different driving forces: a push by intracellular ions and a pull by voltage.
Ciguatoxins: Cyclic Polyether Modulators of Voltage-gated Iion Channel Function
Directory of Open Access Journals (Sweden)
Richard J. Lewis
2006-04-01
Full Text Available Ciguatoxins are cyclic polyether toxins, derived from marine dinoflagellates, which are responsible for the symptoms of ciguatera poisoning. Ingestion of tropical and subtropical fin fish contaminated by ciguatoxins results in an illness characterised by neurological, cardiovascular and gastrointestinal disorders. The pharmacology of ciguatoxins is characterised by their ability to cause persistent activation of voltage-gated sodium channels, to increase neuronal excitability and neurotransmitter release, to impair synaptic vesicle recycling, and to cause cell swelling. It is these effects, in combination with an action to block voltage-gated potassium channels at high doses, which are believed to underlie the complex of symptoms associated with ciguatera. This review examines the sources, structures and pharmacology of ciguatoxins. In particular, attention is placed on their cellular modes of actions to modulate voltage-gated ion channels and other Na+-dependent mechanisms in numerous cell types and to current approaches for detection and treatment of ciguatera.
Bargiello, Thaddeus A; Oh, Seunghoon; Tang, Qingxiu; Bargiello, Nicholas K; Dowd, Terry L; Kwon, Taekyung
2018-01-01
Voltage is an important physiologic regulator of channels formed by the connexin gene family. Connexins are unique among ion channels in that both plasma membrane inserted hemichannels (undocked hemichannels) and intercellular channels (aggregates of which form gap junctions) have important physiological roles. The hemichannel is the fundamental unit of gap junction voltage-gating. Each hemichannel displays two distinct voltage-gating mechanisms that are primarily sensitive to a voltage gradient formed along the length of the channel pore (the transjunctional voltage) rather than sensitivity to the absolute membrane potential (V m or V i-o ). These transjunctional voltage dependent processes have been termed V j - or fast-gating and loop- or slow-gating. Understanding the mechanism of voltage-gating, defined as the sequence of voltage-driven transitions that connect open and closed states, first and foremost requires atomic resolution models of the end states. Although ion channels formed by connexins were among the first to be characterized structurally by electron microscopy and x-ray diffraction in the early 1980's, subsequent progress has been slow. Much of the current understanding of the structure-function relations of connexin channels is based on two crystal structures of Cx26 gap junction channels. Refinement of crystal structure by all-atom molecular dynamics and incorporation of charge changing protein modifications has resulted in an atomic model of the open state that arguably corresponds to the physiologic open state. Obtaining validated atomic models of voltage-dependent closed states is more challenging, as there are currently no methods to solve protein structure while a stable voltage gradient is applied across the length of an oriented channel. It is widely believed that the best approach to solve the atomic structure of a voltage-gated closed ion channel is to apply different but complementary experimental and computational methods and to use
Directory of Open Access Journals (Sweden)
E.F. Schwartz
2003-09-01
Full Text Available The effect of the skin secretion of the amphibian Siphonops paulensis was investigated by monitoring the changes in conductance of an artificial planar lipid bilayer. Skin secretion was obtained by exposure of the animals to ether-saturated air, and then rinsing the animals with distilled water. Artificial lipid bilayers were obtained by spreading a solution of azolectin over an aperture of a Delrin cup inserted into a cut-away polyvinyl chloride block. In 9 of 12 experiments, the addition of the skin secretion to lipid bilayers displayed voltage-dependent channels with average unitary conductance of 258 ± 41.67 pS, rather than nonspecific changes in bilayer conductance. These channels were not sensitive to 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid or tetraethylammonium ion, but the experimental protocol used does not permit us to specify their characteristics.
Leipold, Enrico; Borges, Adolfo
2012-01-01
Scorpion β toxins, peptides of ∼70 residues, specifically target voltage-gated sodium (NaV) channels to cause use-dependent subthreshold channel openings via a voltage–sensor trapping mechanism. This excitatory action is often overlaid by a not yet understood depressant mode in which NaV channel activity is inhibited. Here, we analyzed these two modes of gating modification by β-toxin Tz1 from Tityus zulianus on heterologously expressed NaV1.4 and NaV1.5 channels using the whole cell patch-clamp method. Tz1 facilitated the opening of NaV1.4 in a use-dependent manner and inhibited channel opening with a reversed use dependence. In contrast, the opening of NaV1.5 was exclusively inhibited without noticeable use dependence. Using chimeras of NaV1.4 and NaV1.5 channels, we demonstrated that gating modification by Tz1 depends on the specific structure of the voltage sensor in domain 2. Although residue G658 in NaV1.4 promotes the use-dependent transitions between Tz1 modification phenotypes, the equivalent residue in NaV1.5, N803, abolishes them. Gating charge neutralizations in the NaV1.4 domain 2 voltage sensor identified arginine residues at positions 663 and 669 as crucial for the outward and inward movement of this sensor, respectively. Our data support a model in which Tz1 can stabilize two conformations of the domain 2 voltage sensor: a preactivated outward position leading to NaV channels that open at subthreshold potentials, and a deactivated inward position preventing channels from opening. The results are best explained by a two-state voltage–sensor trapping model in that bound scorpion β toxin slows the activation as well as the deactivation kinetics of the voltage sensor in domain 2. PMID:22450487
Kv7.1 ion channels require a lipid to couple voltage sensing to pore opening.
Zaydman, Mark A; Silva, Jonathan R; Delaloye, Kelli; Li, Yang; Liang, Hongwu; Larsson, H Peter; Shi, Jingyi; Cui, Jianmin
2013-08-06
Voltage-gated ion channels generate dynamic ionic currents that are vital to the physiological functions of many tissues. These proteins contain separate voltage-sensing domains, which detect changes in transmembrane voltage, and pore domains, which conduct ions. Coupling of voltage sensing and pore opening is critical to the channel function and has been modeled as a protein-protein interaction between the two domains. Here, we show that coupling in Kv7.1 channels requires the lipid phosphatidylinositol 4,5-bisphosphate (PIP2). We found that voltage-sensing domain activation failed to open the pore in the absence of PIP2. This result is due to loss of coupling because PIP2 was also required for pore opening to affect voltage-sensing domain activation. We identified a critical site for PIP2-dependent coupling at the interface between the voltage-sensing domain and the pore domain. This site is actually a conserved lipid-binding site among different K(+) channels, suggesting that lipids play an important role in coupling in many ion channels.
Voltage-Gated Calcium Channels
Zamponi, Gerald Werner
Voltage Gated Calcium Channels is the first comprehensive book in the calcium channel field, encompassing over thirty years of progress towards our understanding of calcium channel structure, function, regulation, physiology, pharmacology, and genetics. This book balances contributions from many of the leading authorities in the calcium channel field with fresh perspectives from risings stars in the area, taking into account the most recent literature and concepts. This is the only all-encompassing calcium channel book currently available, and is an essential resource for academic researchers at all levels in the areas neuroscience, biophysics, and cardiovascular sciences, as well as to researchers in the drug discovery area.
Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik
2018-05-01
Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely
de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco
2018-03-01
Kv11.1 (hERG, KCNH2) is a voltage-gated potassium channel crucial in setting the cardiac rhythm and the electrical behaviour of several non-cardiac cell types. Voltage-dependent gating of Kv11.1 can be reconstructed from non-covalently linked voltage sensing and pore modules (split channels), challenging classical views of voltage-dependent channel activation based on a S4-S5 linker acting as a rigid mechanical lever to open the gate. Progressive displacement of the split position from the end to the beginning of the S4-S5 linker induces an increasing negative shift in activation voltage dependence, a reduced z g value and a more negative ΔG 0 for current activation, an almost complete abolition of the activation time course sigmoid shape and a slowing of the voltage-dependent deactivation. Channels disconnected at the S4-S5 linker near the S4 helix show a destabilization of the closed state(s). Furthermore, the isochronal ion current mode shift magnitude is clearly reduced in the different splits. Interestingly, the progressive modifications of voltage dependence activation gating by changing the split position are accompanied by a shift in the voltage-dependent availability to a methanethiosulfonate reagent of a Cys introduced at the upper S4 helix. Our data demonstrate for the first time that alterations in the covalent connection between the voltage sensor and the pore domains impact on the structural reorganizations of the voltage sensor domain. Also, they support the hypothesis that the S4-S5 linker integrates signals coming from other cytoplasmic domains that constitute either an important component or a crucial regulator of the gating machinery in Kv11.1 and other KCNH channels.
Dynamics of the resistive state of a narrow superconducting channel in the ac voltage-driven regime
International Nuclear Information System (INIS)
Yerin, Yu.S.; Fenchenko, V.N.
2013-01-01
Within the time-dependent Ginzburg-Landau equations the dynamics of the order parameter in superconducting narrow channels of different lengths is investigated in the ac voltage-driven regime. The resistive state of the system at low frequencies of the applied voltage is characterized by the formation of periodic-in-time groups of oscillating phase-slip centers (PSC). An increase in frequency reduces the duration of the existence of these periodic groups. Depending on the length of the channel the ac voltage either tends to revert the channel to the state with one central PSC in periodic groups or minimizes the number of forming PSCs and orders their pattern in the system. A further increase in frequency for rather short channels leads to suppression of the order parameter without any creation of PSCs. For systems, whose length exceeds the specified limit, the formation of PSC occurs after a certain time which increases rapidly with frequency. The current-voltage characteristics of rather short channels at different applied voltage frequencies are calculated too. It is found that the current-voltage characteristics have a step-like structure, and the height of the first step is determined by the quadruple value of the Josephson frequency.
Sinusoidal voltage protocols for rapid characterisation of ion channel kinetics.
Beattie, Kylie A; Hill, Adam P; Bardenet, Rémi; Cui, Yi; Vandenberg, Jamie I; Gavaghan, David J; de Boer, Teun P; Mirams, Gary R
2018-03-24
Ion current kinetics are commonly represented by current-voltage relationships, time constant-voltage relationships and subsequently mathematical models fitted to these. These experiments take substantial time, which means they are rarely performed in the same cell. Rather than traditional square-wave voltage clamps, we fitted a model to the current evoked by a novel sum-of-sinusoids voltage clamp that was only 8 s long. Short protocols that can be performed multiple times within a single cell will offer many new opportunities to measure how ion current kinetics are affected by changing conditions. The new model predicts the current under traditional square-wave protocols well, with better predictions of underlying currents than literature models. The current under a novel physiologically relevant series of action potential clamps is predicted extremely well. The short sinusoidal protocols allow a model to be fully fitted to individual cells, allowing us to examine cell-cell variability in current kinetics for the first time. Understanding the roles of ion currents is crucial to predict the action of pharmaceuticals and mutations in different scenarios, and thereby to guide clinical interventions in the heart, brain and other electrophysiological systems. Our ability to predict how ion currents contribute to cellular electrophysiology is in turn critically dependent on our characterisation of ion channel kinetics - the voltage-dependent rates of transition between open, closed and inactivated channel states. We present a new method for rapidly exploring and characterising ion channel kinetics, applying it to the hERG potassium channel as an example, with the aim of generating a quantitatively predictive representation of the ion current. We fitted a mathematical model to currents evoked by a novel 8 second sinusoidal voltage clamp in CHO cells overexpressing hERG1a. The model was then used to predict over 5 minutes of recordings in the same cell in response to
Directory of Open Access Journals (Sweden)
Jader Santos Cruz
2012-10-01
Full Text Available trans-Caryophyllene is a major component in the essential oils of various species of medicinal plants used in popular medicine in Brazil. It belongs to the chemical class of the sesquiterpenes and has been the subject of a number of studies. Here, we evaluated the effects of this compound in airway smooth muscle. The biological activities of trans-caryophyllene were examined in isolated bath organs to investigate the effect in basal tonus. Electromechanical and pharmacomechanical couplings were evaluated through the responses to K+ depolarization and exposure to acetylcholine (ACh, respectively. Isolated cells of rat tracheal smooth muscle were used to investigate trans-caryophyllene effects on voltage-dependent Ca2+ channels by using the whole-cell voltage-clamp configuration of the patch-clamp technique. trans-Caryophyllene showed more efficiency in the blockade of electromechanical excitation-contraction coupling while it has only minor inhibitory effect on pharmacomechanical coupling. Epithelium removal does not modify tracheal smooth muscle response elicited by trans-caryophyllene in the pharmacomechanical coupling. Under Ca2+-free conditions, pre-exposure to trans-caryophyllene did not reduce the contraction induced by ACh in isolated rat tracheal smooth muscle, regardless of the presence of intact epithelium. In the whole-cell configuration, trans-caryophyllene (3 mM, inhibited the inward Ba2+ current (IBa to approximately 50% of control levels. Altogether, our results demonstrate that trans-caryophyllene has anti-spasmodic activity on rat tracheal smooth muscle which could be explained, at least in part, by the voltage-dependent Ca2+ channels blockade.
Voltage-dependent amplification of synaptic inputs in respiratory motoneurones
Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A
2012-01-01
The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582
Voltage-Dependent Inhibition of Glycine Receptor Channels by Niflumic Acid
Directory of Open Access Journals (Sweden)
Galyna Maleeva
2017-05-01
Full Text Available Niflumic acid (NFA is a member of the fenamate class of nonsteroidal anti-inflammatory drugs. This compound and its derivatives are used worldwide clinically for the relief of chronic and acute pain. NFA is also a commonly used blocker of voltage-gated chloride channels. Here we present evidence that NFA is an efficient blocker of chloride-permeable glycine receptors (GlyRs with subunit heterogeneity of action. Using the whole-cell configuration of patch-clamp recordings and molecular modeling, we analyzed the action of NFA on homomeric α1ΔIns, α2B, α3L, and heteromeric α1β and α2β GlyRs expressed in CHO cells. NFA inhibited glycine-induced currents in a voltage-dependent manner and its blocking potency in α2 and α3 GlyRs was higher than that in α1 GlyR. The Woodhull analysis suggests that NFA blocks α1 and α2 GlyRs at the fractional electrical distances of 0.16 and 0.65 from the external membrane surface, respectively. Thus, NFA binding site in α1 GlyR is closer to the external part of the membrane, while in α2 GlyR it is significantly deeper in the pore. Mutation G254A at the cytoplasmic part of the α1 GlyR pore-lining TM2 helix (level 2′ increased the NFA blocking potency, while incorporation of the β subunit did not have a significant effect. The Hill plot analysis suggests that α1 and α2 GlyRs are preferably blocked by two and one NFA molecules, respectively. Molecular modeling using Monte Carlo energy minimizations provides the structural rationale for the experimental data and proposes more than one interaction site along the pore where NFA can suppress the ion permeation.
Czech Academy of Sciences Publication Activity Database
Zicha, Josef; Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Kuneš, Jaroslav
2007-01-01
Roč. 29, č. 4 (2007), s. 229-229 ISSN 1064-1963. [International symposium on SHR /12./. 20.10.2006-21.10.2006, Kyoto] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : genetic hypertension * noradrenergic mechanisms * Gi proteins * voltage-dependent calcium channels Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery
Cnidarian Toxins Acting on Voltage-Gated Ion Channels
Directory of Open Access Journals (Sweden)
Robert M. Greenberg
2006-04-01
Full Text Available Abstract: Voltage-gated ion channels generate electrical activity in excitable cells. As such, they are essential components of neuromuscular and neuronal systems, and are targeted by toxins from a wide variety of phyla, including the cnidarians. Here, we review cnidarian toxins known to target voltage-gated ion channels, the specific channel types targeted, and, where known, the sites of action of cnidarian toxins on different channels.
International Nuclear Information System (INIS)
Saad, A.H.; Zhou, L.Y.; Lambe, E.K.; Hahn, G.M.
1994-01-01
In mammalian cells, little is known about the initial events whose ultimate consequence is mutagenesis or DNA repair. The role the plasma membrane may play as an initiator of such a pathway is not understood. We show, for the first time, that membrane voltage-dependent potassium (K + ) currents, activated by ionizing radiation play a significant role in radiation mutagenesis. Specifically, we show that the frequency of mutation at the HGPRT locus is increased as expected to 37.6±4.0 mutations per 100,000 survivors by 800 cGy of ionizing radiation from a spontaneous frequency of 1.5±1.5. This increase, however, is abolished if either K + channel blocker, CsCl or BaCl 2 , is present for 2h following irradiation of the cells. RbCl, chemically similar to CsCl but known not to block K + channels, is ineffective in reducing the mutation frequency. Treatment of cells with CsCl or BaCl 2 had no effect on radiation-induced cell killing
Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi
2016-07-05
The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.
Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi
2016-01-01
The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112
Wood, Mona L; Freites, J Alfredo; Tombola, Francesco; Tobias, Douglas J
2017-04-20
Voltage-sensing domains (VSDs) sense changes in the membrane electrostatic potential and, through conformational changes, regulate a specific function. The VSDs of wild-type voltage-dependent K + , Na + , and Ca 2+ channels do not conduct ions, but they can become ion-permeable through pathological mutations in the VSD. Relatively little is known about the underlying mechanisms of conduction through VSDs. The most detailed studies have been performed on Shaker K + channel variants in which ion conduction through the VSD is manifested in electrophysiology experiments as a voltage-dependent inward current, the so-called omega current, which appears when the VSDs are in their resting state conformation. Only monovalent cations appear to permeate the Shaker VSD via a pathway that is believed to be, at least in part, the same as that followed by the S4 basic side chains during voltage-dependent activation. We performed μs-time scale atomistic molecular dynamics simulations of a cation-conducting variant of the Shaker VSD under applied electric fields in an experimentally validated resting-state conformation, embedded in a lipid bilayer surrounded by solutions containing guanidinium chloride or potassium chloride. Our simulations provide insights into the Shaker VSD permeation pathway, the protein-ion interactions that control permeation kinetics, and the mechanism of voltage-dependent activation of voltage-gated ion channels.
Mechanism of electromechanical coupling in voltage-gated potassium channels
Directory of Open Access Journals (Sweden)
Rikard eBlunck
2012-09-01
Full Text Available Voltage-gated ion channels play a central role in the generation of action potentials in the nervous system. They are selective for one type of ion – sodium, calcium or potassium. Voltage-gated ion channels are composed of a central pore that allows ions to pass through the membrane and four peripheral voltage sensing domains that respond to changes in the membrane potential. Upon depolarization, voltage sensors in voltage-gated potassium channels (Kv undergo conformational changes driven by positive charges in the S4 segment and aided by pairwise electrostatic interactions with the surrounding voltage sensor. Structure-function relations of Kv channels have been investigated in detail, and the resulting models on the movement of the voltage sensors now converge to a consensus; the S4 segment undergoes a combined movement of rotation, tilt and vertical displacement in order to bring 3-4 e+ each through the electric field focused in this region. Nevertheless, the mechanism by which the voltage sensor movement leads to pore opening, the electromechanical coupling, is still not fully understood. Thus, recently, electromechanical coupling in different Kv channels has been investigated with a multitude of techniques including electrophysiology, 3D crystal structures, fluorescence spectroscopy and molecular dynamics simulations. Evidently, the S4-S5 linker, the covalent link between the voltage sensor and pore, plays a crucial role. The linker transfers the energy from the voltage sensor movement to the pore domain via an interaction with the S6 C-termini, which are pulled open during gating. In addition, other contact regions have been proposed. This review aims to provide (i an in-depth comparison of the molecular mechanisms of electromechanical coupling in different Kv channels; (ii insight as to how the voltage sensor and pore domain influence one another; and (iii theoretical predictions on the movement of the cytosolic face of the KV channels
Voltage-Gated Proton Channels: Molecular Biology, Physiology, and Pathophysiology of the HV Family
2013-01-01
Voltage-gated proton channels (HV) are unique, in part because the ion they conduct is unique. HV channels are perfectly selective for protons and have a very small unitary conductance, both arguably manifestations of the extremely low H+ concentration in physiological solutions. They open with membrane depolarization, but their voltage dependence is strongly regulated by the pH gradient across the membrane (ΔpH), with the result that in most species they normally conduct only outward current. The HV channel protein is strikingly similar to the voltage-sensing domain (VSD, the first four membrane-spanning segments) of voltage-gated K+ and Na+ channels. In higher species, HV channels exist as dimers in which each protomer has its own conduction pathway, yet gating is cooperative. HV channels are phylogenetically diverse, distributed from humans to unicellular marine life, and perhaps even plants. Correspondingly, HV functions vary widely as well, from promoting calcification in coccolithophores and triggering bioluminescent flashes in dinoflagellates to facilitating killing bacteria, airway pH regulation, basophil histamine release, sperm maturation, and B lymphocyte responses in humans. Recent evidence that hHV1 may exacerbate breast cancer metastasis and cerebral damage from ischemic stroke highlights the rapidly expanding recognition of the clinical importance of hHV1. PMID:23589829
DEFF Research Database (Denmark)
Fuchs, W; Larsen, Erik Hviid; Lindemann, B
1977-01-01
1. The inward facing membranes of in vitro frog skin epithelium were depolarized with solutions of high K concentration. The electrical properties of the epithelium are then expected to be governed by the outward facing, Na-selective membrane.2. In this state, the transepithelial voltage (V...... was recorded. This procedure was repeated after blocking the Na channels with amiloride to obtain the current-voltage curve of transmembrane and paracellular shunt pathways. The current-voltage curve of the Na channels was computed by subtracting the shunt current from the total current.4. The instantaneous I...... of the inward facing membranes but reflects the true behaviour of P(Na).6. The steady-state P(Na) at a given (Na)(o) is smaller than the transient P(Na) observed right after a stepwise increase of (Na)(o) to this value. The time constant of P(Na)-relaxation is in the order of seconds.7. In conclusion, Na...
Capes, Deborah L; Arcisio-Miranda, Manoel; Jarecki, Brian W; French, Robert J; Chanda, Baron
2012-02-14
Voltage-dependent ion channels are crucial for generation and propagation of electrical activity in biological systems. The primary mechanism for voltage transduction in these proteins involves the movement of a voltage-sensing domain (D), which opens a gate located on the cytoplasmic side. A distinct conformational change in the selectivity filter near the extracellular side has been implicated in slow inactivation gating, which is important for spike frequency adaptation in neural circuits. However, it remains an open question whether gating transitions in the selectivity filter region are also actuated by voltage sensors. Here, we examine conformational coupling between each of the four voltage sensors and the outer pore of a eukaryotic voltage-dependent sodium channel. The voltage sensors of these sodium channels are not structurally symmetric and exhibit functional specialization. To track the conformational rearrangements of individual voltage-sensing domains, we recorded domain-specific gating pore currents. Our data show that, of the four voltage sensors, only the domain IV voltage sensor is coupled to the conformation of the selectivity filter region of the sodium channel. Trapping the outer pore in a particular conformation with a high-affinity toxin or disulphide crossbridge impedes the return of this voltage sensor to its resting conformation. Our findings directly establish that, in addition to the canonical electromechanical coupling between voltage sensor and inner pore gates of a sodium channel, gating transitions in the selectivity filter region are also coupled to the movement of a voltage sensor. Furthermore, our results also imply that the voltage sensor of domain IV is unique in this linkage and in the ability to initiate slow inactivation in sodium channels.
Schlumberger, Sébastien; Mattei, César; Molgó, Jordi; Benoit, Evelyne
2010-10-01
The effects of Pacific ciguatoxin-4B (P-CTX-4B, also named gambiertoxin), extracted from toxic Gambierdiscus dinoflagellates, were assessed on nodal K(+) and Na(+) currents of frog myelinated axons, using a conventional voltage-clamp technique. P-CTX-4B decreased, within a few minutes, both K(+) and Na(+) currents in a dose-dependent manner, without inducing any marked change in current kinetics. The toxin was more effective in blocking K(+) than Na(+) channels. P-CTX-4B shifted the voltage-dependence of Na(+) conductance by about 14 mV towards more negative membrane potentials. This effect was reversed by increasing Ca(2+) in the external solution. A negative shift of about 16 mV in the steady-state Na(+) inactivation-voltage curve was also observed in the presence of the toxin. Unmodified and P-CTX-4B-modified Na(+) currents were similarly affected by the local anaesthetic lidocaine. The decrease of the two currents by lidocaine was dependent on both the concentration and the membrane potential during pre-pulses. In conclusion, P-CTX-4B appears about four times more effective than P-CTX-1B to affect K(+) channels, whereas it is about 50 times less efficient to affect Na(+) channels of axonal membranes. These actions may be related to subtle differences between the two chemical structures of molecules. Copyright 2009 Elsevier Ltd. All rights reserved.
Critical voltage effects in electron channeling patterns
International Nuclear Information System (INIS)
Farrow, R.C.
1984-01-01
Electron channeling patterns were used to study critical voltage effects in the metals molybdenum and tungsten. The purpose was to characterize both theoretically and experimentally how a critical voltage will affect the channeling pattern line shapes. The study focused on the second order critical voltage that results from the degeneracy between the Bloch wave states of the (110) and (220) reflections. Theoretical (110) series electron channeling pattern line profiles were calculated using the dynamical theory of Hirsch and Humphreys (1970). A 10 beam dynamical electron diffraction calculation was performed (using complex Fourier lattice potentials) to generate Bloch wave coefficients, excitation amplitudes, and absorption coefficients needed for determining backscattering coefficients and subsequent backscattered electron intensities. The theoretical model is applicable to electron diffraction at all energies since no high energy approximation or perturbation method was used
Nonsensing residues in S3-S4 linker's C terminus affect the voltage sensor set point in K+ channels.
Carvalho-de-Souza, Joao L; Bezanilla, Francisco
2018-02-05
Voltage sensitivity in ion channels is a function of highly conserved arginine residues in their voltage-sensing domains (VSDs), but this conservation does not explain the diversity in voltage dependence among different K + channels. Here we study the non-voltage-sensing residues 353 to 361 in Shaker K + channels and find that residues 358 and 361 strongly modulate the voltage dependence of the channel. We mutate these two residues into all possible remaining amino acids (AAs) and obtain Q-V and G-V curves. We introduced the nonconducting W434F mutation to record sensing currents in all mutants except L361R, which requires K + depletion because it is affected by W434F. By fitting Q-Vs with a sequential three-state model for two voltage dependence-related parameters ( V 0 , the voltage-dependent transition from the resting to intermediate state and V 1 , from the latter to the active state) and G-Vs with a two-state model for the voltage dependence of the pore domain parameter ( V 1/2 ), Spearman's coefficients denoting variable relationships with hydrophobicity, available area, length, width, and volume of the AAs in 358 and 361 positions could be calculated. We find that mutations in residue 358 shift Q-Vs and G-Vs along the voltage axis by affecting V 0 , V 1 , and V 1/2 according to the hydrophobicity of the AA. Mutations in residue 361 also shift both curves, but V 0 is affected by the hydrophobicity of the AA in position 361, whereas V 1 and V 1/2 are affected by size-related AA indices. Small-to-tiny AAs have opposite effects on V 1 and V 1/2 in position 358 compared with 361. We hypothesize possible coordination points in the protein that residues 358 and 361 would temporarily and differently interact with in an intermediate state of VSD activation. Our data contribute to the accumulating knowledge of voltage-dependent ion channel activation by adding functional information about the effects of so-called non-voltage-sensing residues on VSD dynamics. © 2018
Energy Technology Data Exchange (ETDEWEB)
Li, Hongliang; Hong, Da Hye; Kim, Han Sol; Kim, Hye Won [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of); Jung, Won-Kyo [Department of Biomedical Engineering, Center for Marine-Integrated Biomedical Technology (BK21 Plus), Pukyong National University, Busan 608-737 (Korea, Republic of); Na, Sung Hun [Institute of Medical Sciences, Department of Obstetrics and Gynecology, Kangwon National University Hospital, School of Medicine, Kangwon National University, Chuncheon, 200-701 (Korea, Republic of); Jung, In Duk; Park, Yeong-Min [Department of Immunology, Lab of Dendritic Cell Differentiation and Regulation, College of Medicine, Konkuk University, Chungju 380-701 (Korea, Republic of); Choi, Il-Whan, E-mail: cihima@inje.ac.kr [Department of Microbiology, Inje University College of Medicine, Busan, 614-735 (Korea, Republic of); Park, Won Sun, E-mail: parkws@kangwon.ac.kr [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of)
2015-06-15
We investigated the effects of the calmodulin inhibitor CGS 9343B on voltage-dependent K{sup +} (Kv) channels using whole-cell patch clamp technique in freshly isolated rabbit coronary arterial smooth muscle cells. CGS 9343B inhibited Kv currents in a concentration-dependent manner, with a half-maximal inhibitory concentration (IC{sub 50}) value of 0.81 μM. The decay rate of Kv channel inactivation was accelerated by CGS 9343B. The rate constants of association and dissociation for CGS 9343B were 2.77 ± 0.04 μM{sup −1} s{sup −1} and 2.55 ± 1.50 s{sup −1}, respectively. CGS 9343B did not affect the steady-state activation curve, but shifted the inactivation curve toward to a more negative potential. Train pulses (1 or 2 Hz) application progressively increased the CGS 9343B-induced Kv channel inhibition. In addition, the inactivation recovery time constant was increased in the presence of CGS 9343B, suggesting that CGS 9343B-induced inhibition of Kv channel was use-dependent. Another calmodulin inhibitor, W-13, did not affect Kv currents, and did not change the inhibitory effect of CGS 9343B on Kv current. Our results demonstrated that CGS 9343B inhibited Kv currents in a state-, time-, and use-dependent manner, independent of calmodulin inhibition. - Highlights: • We investigated the effects of CGS 9394B on Kv channels. • CGS 9394B inhibited Kv current in a state-, time-, and use-dependent manner. • Caution is required when using CGS 9394B in vascular function studies.
Wawrzkiewicz-Jałowiecka, Agata; Dworakowska, Beata; Grzywna, Zbigniew J
2017-10-01
Large-conductance, voltage dependent, Ca 2+ -activated potassium channels (BK) are transmembrane proteins that regulate many biological processes by controlling potassium flow across cell membranes. Here, we investigate to what extent temperature (in the range of 17-37°C with ΔT=5°C step) is a regulating parameter of kinetic properties of the channel gating and memory effect in the series of dwell-time series of subsequent channel's states, at membrane depolarization and hyperpolarization. The obtained results indicate that temperature affects strongly the BK channels' gating, but, counterintuitively, it exerts no effect on the long-range correlations, as measured by the Hurst coefficient. Quantitative differences between dependencies of appropriate channel's characteristics on temperature are evident for different regimes of voltage. Examining the characteristics of BK channel activity as a function of temperature allows to estimate the net activation energy (E act ) and changes of thermodynamic parameters (ΔH, ΔS, ΔG) by channel opening. Larger E act corresponds to the channel activity at membrane hyperpolarization. The analysis of entropy and enthalpy changes of closed to open channel's transition suggest the entropy-driven nature of the increase of open state probability during voltage activation and supports the hypothesis about the voltage-dependent geometry of the channel vestibule. Copyright © 2017 Elsevier B.V. All rights reserved.
Ca2+-dependent K+ Channels in Exocrine Salivary Glands
Catalán, Marcelo A.; Peña-Munzenmayer, Gaspar; Melvin, James E.
2014-01-01
In the last 15 years, remarkable progress has been realized in identifying the genes that encode the ion-transporting proteins involved in exocrine gland function, including salivary glands. Among these proteins, Ca2+-dependent K+ channels take part in key functions including membrane potential regulation, fluid movement and K+ secretion in exocrine glands. Two K+ channels have been identified in exocrine salivary glands: 1) a Ca2+-activated K+ channel of intermediate single channel conductance encoded by the KCNN4 gene; and, 2) a voltage- and Ca2+-dependent K+ channel of large single channel conductance encoded by the KCNMA1 gene. This review focuses on the physiological roles of Ca2+-dependent K+ channels in exocrine salivary glands. We also discuss interesting recent findings on the regulation of Ca2+-dependent K+ channels by protein-protein interactions that may significantly impact exocrine gland physiology. PMID:24559652
A complicated complex: Ion channels, voltage sensing, cell membranes and peptide inhibitors.
Zhang, Alan H; Sharma, Gagan; Undheim, Eivind A B; Jia, Xinying; Mobli, Mehdi
2018-04-21
Voltage-gated ion channels (VGICs) are specialised ion channels that have a voltage dependent mode of action, where ion conduction, or gating, is controlled by a voltage-sensing mechanism. VGICs are critical for electrical signalling and are therefore important pharmacological targets. Among these, voltage-gated sodium channels (Na V s) have attracted particular attention as potential analgesic targets. Na V s, however, comprise several structurally similar subtypes with unique localisations and distinct functions, ranging from amplification of action potentials in nociception (e.g. Na V 1.7) to controlling electrical signalling in cardiac function (Na V 1.5). Understanding the structural basis of Na V function is therefore of great significance, both to our knowledge of electrical signalling and in development of subtype and state selective drugs. An important tool in this pursuit has been the use of peptides from animal venoms as selective Na V modulators. In this review, we look at peptides, particularly from spider venoms, that inhibit Na V s by binding to the voltage sensing domain (VSD) of this channel, known as gating modifier toxins (GMT). In the first part of the review, we look at the structural determinants of voltage sensing in VGICs, the gating cycle and the conformational changes that accompany VSD movement. Next, the modulation of the analgesic target Na V 1.7 by GMTs is reviewed to develop bioinformatic tools that, based on sequence information alone, can identify toxins that are likely to inhibit this channel. The same approach is also used to define VSD sequences, other than that from Na V 1.7, which are likely to be sensitive to this class of toxins. The final section of the review focuses on the important role of the cellular membrane in channel modulation and also how the lipid composition affects measurements of peptide-channel interactions both in binding kinetics measurements in solution and in cell-based functional assays. Copyright © 2018
Minor, Daniel L; Findeisen, Felix
2010-01-01
Voltage-gated calcium channels (CaVs) are large, transmembrane multiprotein complexes that couple membrane depolarization to cellular calcium entry. These channels are central to cardiac action potential propagation, neurotransmitter and hormone release, muscle contraction, and calcium-dependent gene transcription. Over the past six years, the advent of high-resolution structural studies of CaV components from different isoforms and CaV modulators has begun to reveal the architecture that underlies the exceptionally rich feedback modulation that controls CaV action. These descriptions of CaV molecular anatomy have provided new, structure-based insights into the mechanisms by which particular channel elements affect voltage-dependent inactivation (VDI), calcium‑dependent inactivation (CDI), and calcium‑dependent facilitation (CDF). The initial successes have been achieved through structural studies of soluble channel domains and modulator proteins and have proven most powerful when paired with biochemical and functional studies that validate ideas inspired by the structures. Here, we review the progress in this growing area and highlight some key open challenges for future efforts.
Muroi, Yukiko; Chanda, Baron
2009-01-01
Local anesthetics block sodium channels in a state-dependent fashion, binding with higher affinity to open and/or inactivated states. Gating current measurements show that local anesthetics immobilize a fraction of the gating charge, suggesting that the movement of voltage sensors is modified when a local anesthetic binds to the pore of the sodium channel. Here, using voltage clamp fluorescence measurements, we provide a quantitative description of the effect of local anesthetics on the steady-state behavior of the voltage-sensing segments of a sodium channel. Lidocaine and QX-314 shifted the midpoints of the fluorescence-voltage (F-V) curves of S4 domain III in the hyperpolarizing direction by 57 and 65 mV, respectively. A single mutation in the S6 of domain IV (F1579A), a site critical for local anesthetic block, abolished the effect of QX-314 on the voltage sensor of domain III. Both local anesthetics modestly shifted the F-V relationships of S4 domain IV toward hyperpolarized potentials. In contrast, the F-V curve of the S4 domain I was shifted by 11 mV in the depolarizing direction upon QX-314 binding. These antagonistic effects of the local anesthetic indicate that the drug modifies the coupling between the voltage-sensing domains of the sodium channel. Our findings suggest a novel role of local anesthetics in modulating the gating apparatus of the sodium channel.
New Role of P/Q-type Voltage-gated Calcium Channels
DEFF Research Database (Denmark)
Hansen, Pernille B L
2015-01-01
Voltage-gated calcium channels are important for the depolarization-evoked contraction of vascular smooth muscle cells (SMCs), with L-type channels being the classical channel involved in this mechanism. However, it has been demonstrated that the CaV2.1 subunit, which encodes a neuronal isoform...... of the voltage-gated calcium channels (P/Q-type), is also expressed and contributes functionally to contraction of renal blood vessels in both mice and humans. Furthermore, preglomerular vascular SMCs and aortic SMCs coexpress L-, P-, and Q-type calcium channels within the same cell. Calcium channel blockers...... are widely used as pharmacological treatments. However, calcium channel antagonists vary in their selectivity for the various calcium channel subtypes, and the functional contribution from P/Q-type channels as compared with L-type should be considered. Confirming the presence of P/Q-type voltage...
Miceli, Francesco; Soldovieri, Maria Virginia; Iannotti, Fabio Arturo; Barrese, Vincenzo; Ambrosino, Paolo; Martire, Maria; Cilio, Maria Roberta; Taglialatela, Maurizio
2010-01-01
Understanding the molecular mechanisms underlying voltage-dependent gating in voltage-gated ion channels (VGICs) has been a major effort over the last decades. In recent years, changes in the gating process have emerged as common denominators for several genetically determined channelopathies affecting heart rhythm (arrhythmias), neuronal excitability (epilepsy, pain), or skeletal muscle contraction (periodic paralysis). Moreover, gating changes appear as the main molecular mechanism by which several natural toxins from a variety of species affect ion channel function. In this work, we describe the pathophysiological and pharmacological relevance of the gating process in voltage-gated K+ channels encoded by the Kv7 gene family. After reviewing the current knowledge on the molecular mechanisms and on the structural models of voltage-dependent gating in VGICs, we describe the physiological relevance of these channels, with particular emphasis on those formed by Kv7.2–Kv7.5 subunits having a well-established role in controlling neuronal excitability in humans. In fact, genetically determined alterations in Kv7.2 and Kv7.3 genes are responsible for benign familial neonatal convulsions, a rare seizure disorder affecting newborns, and the pharmacological activation of Kv7.2/3 channels can exert antiepileptic activity in humans. Both mutation-triggered channel dysfunction and drug-induced channel activation can occur by impeding or facilitating, respectively, channel sensitivity to membrane voltage and can affect overlapping molecular sites within the voltage-sensing domain of these channels. Thus, understanding the molecular steps involved in voltage-sensing in Kv7 channels will allow to better define the pathogenesis of rare human epilepsy, and to design innovative pharmacological strategies for the treatment of epilepsies and, possibly, other human diseases characterized by neuronal hyperexcitability. PMID:21687499
Directory of Open Access Journals (Sweden)
Francesco eMiceli
2011-02-01
Full Text Available Understanding the molecular mechanisms underlying voltage-dependent gating in voltage-gated ion channels (VGICs has been a major effort over the last decades. In recent years, changes in the gating process have emerged as common denominators for several genetically-determined channelopathies affecting heart rhythm (arrhythmias, neuronal excitability (epilepsy, pain or skeletal muscle contraction (periodic paralysis. Moreover, gating changes appear as the main molecular mechanism by which several natural toxins from a variety of species affect ion channel function.In this work, we describe the pathophysiological and pharmacological relevance of the gating process in voltage-gated K+ channels encoded by the Kv7 gene family. After reviewing the current knowledge on the molecular mechanisms and on the structural models of voltage-dependent gating in VGICs, we describe the physiological relevance of these channels, with particular emphasis on those formed by Kv7.2-5 subunits having a well-established role in controlling neuronal excitability in humans. In fact, genetically-determined alterations in Kv7.2 and Kv7.3 genes are responsible for benign familial neonatal convulsions, a rare seizure disorder affecting newborns, and the pharmacological activation of Kv7.2/3 channels can exert antiepileptic activity in humans. Both mutation-triggered channel dysfunction and drug-induced channel activation can occur by impeding or facilitating, respectively, channel sensitivity to membrane voltage and can affect overlapping molecular sites within the voltage-sensing domain of these channels. Thus, understanding the molecular steps involved in voltage-sensing in Kv7 channels will allow to better define the pathogenesis of rare human epilepsy, and to design innovative pharmacological strategies for the treatment of epilepsies and, possibly, other human diseases characterized by neuronal hyperexcitability.
Voltage-Gated Sodium Channels: Evolutionary History and Distinctive Sequence Features.
Kasimova, M A; Granata, D; Carnevale, V
2016-01-01
Voltage-gated sodium channels (Nav) are responsible for the rising phase of the action potential. Their role in electrical signal transmission is so relevant that their emergence is believed to be one of the crucial factors enabling development of nervous system. The presence of voltage-gated sodium-selective channels in bacteria (BacNav) has raised questions concerning the evolutionary history of the ones in animals. Here we review some of the milestones in the field of Nav phylogenetic analysis and discuss some of the most important sequence features that distinguish these channels from voltage-gated potassium channels and transient receptor potential channels. Copyright © 2016 Elsevier Inc. All rights reserved.
Functional characterization of Kv11.1 (hERG) potassium channels split in the voltage-sensing domain.
de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco
2018-03-23
Voltage-dependent KCNH family potassium channel functionality can be reconstructed using non-covalently linked voltage-sensing domain (VSD) and pore modules (split channels). However, the necessity of a covalent continuity for channel function has not been evaluated at other points within the two functionally independent channel modules. We find here that by cutting Kv11.1 (hERG, KCNH2) channels at the different loops linking the transmembrane spans of the channel core, not only channels split at the S4-S5 linker level, but also those split at the intracellular S2-S3 and the extracellular S3-S4 loops, yield fully functional channel proteins. Our data indicate that albeit less markedly, channels split after residue 482 in the S2-S3 linker resemble the uncoupled gating phenotype of those split at the C-terminal end of the VSD S4 transmembrane segment. Channels split after residues 514 and 518 in the S3-S4 linker show gating characteristics similar to those of the continuous wild-type channel. However, breaking the covalent link at this level strongly accelerates the voltage-dependent accessibility of a membrane impermeable methanethiosulfonate reagent to an engineered cysteine at the N-terminal region of the S4 transmembrane helix. Thus, besides that of the S4-S5 linker, structural integrity of the intracellular S2-S3 linker seems to constitute an important factor for proper transduction of VSD rearrangements to opening and closing the cytoplasmic gate. Furthermore, our data suggest that the short and probably rigid characteristics of the extracellular S3-S4 linker are not an essential component of the Kv11.1 voltage sensing machinery.
Moroni, Mirko; Biro, Istvan; Giugliano, Michele; Vijayan, Ranjit; Biggin, Philip C.; Beato, Marco; Sivilotti, Lucia G.
2011-01-01
In the vertebrate CNS, fast synaptic inhibition is mediated by GABA and glycine receptors. We recently reported that the time course of these synaptic currents is slower when intracellular chloride is high. Here we extend these findings to measure the effects of both extracellular and intracellular chloride on the deactivation of glycine and GABA currents at both negative and positive holding potentials. Currents were elicited by fast agonist application to outside-out patches from HEK293 cells expressing rat glycine or GABA receptors. The slowing effect of high extracellular chloride on current decay was detectable only in low intracellular chloride (4 mM). Our main finding is that glycine and GABA receptors “sense” chloride concentrations because of interactions between the M2 pore-lining domain and the permeating ions. This hypothesis is supported by the observation that the sensitivity of channel gating to intracellular chloride is abolished if the channel is engineered to become cation-selective, or if positive charges in the external pore vestibule are eliminated by mutagenesis. The appropriate interaction between permeating ions and channel pore is also necessary to maintain the channel voltage sensitivity of gating, which prolongs current decay at depolarized potentials. Voltage-dependence is abolished by the same mutations that suppress the effect of intracellular chloride and also by replacing chloride with another permeant ion, thiocyanate. These observations suggest that permeant chloride affects gating by a foot-in-the-door effect, binding to a channel site with asymmetrical access from the intracellular and extracellular sides of the membrane. PMID:21976494
Mechanisms of Gain Control by Voltage-Gated Channels in Intrinsically-Firing Neurons
Patel, Ameera X.; Burdakov, Denis
2015-01-01
Gain modulation is a key feature of neural information processing, but underlying mechanisms remain unclear. In single neurons, gain can be measured as the slope of the current-frequency (input-output) relationship over any given range of inputs. While much work has focused on the control of basal firing rates and spike rate adaptation, gain control has been relatively unstudied. Of the limited studies on gain control, some have examined the roles of synaptic noise and passive somatic currents, but the roles of voltage-gated channels present ubiquitously in neurons have been less explored. Here, we systematically examined the relationship between gain and voltage-gated ion channels in a conductance-based, tonically-active, model neuron. Changes in expression (conductance density) of voltage-gated channels increased (Ca2+ channel), reduced (K+ channels), or produced little effect (h-type channel) on gain. We found that the gain-controlling ability of channels increased exponentially with the steepness of their activation within the dynamic voltage window (voltage range associated with firing). For depolarization-activated channels, this produced a greater channel current per action potential at higher firing rates. This allowed these channels to modulate gain by contributing to firing preferentially at states of higher excitation. A finer analysis of the current-voltage relationship during tonic firing identified narrow voltage windows at which the gain-modulating channels exerted their effects. As a proof of concept, we show that h-type channels can be tuned to modulate gain by changing the steepness of their activation within the dynamic voltage window. These results show how the impact of an ion channel on gain can be predicted from the relationship between channel kinetics and the membrane potential during firing. This is potentially relevant to understanding input-output scaling in a wide class of neurons found throughout the brain and other nervous systems
Miceli, Francesco; Soldovieri, Maria Virginia; Iannotti, Fabio Arturo; Barrese, Vincenzo; Ambrosino, Paolo; Martire, Maria; Cilio, Maria Roberta; Taglialatela, Maurizio
2011-01-01
Understanding the molecular mechanisms underlying voltage-dependent gating in voltage-gated ion channels (VGICs) has been a major effort over the last decades. In recent years, changes in the gating process have emerged as common denominators for several genetically determined channelopathies affecting heart rhythm (arrhythmias), neuronal excitability (epilepsy, pain), or skeletal muscle contraction (periodic paralysis). Moreover, gating changes appear as the main molecular mechanism by which several natural toxins from a variety of species affect ion channel function. In this work, we describe the pathophysiological and pharmacological relevance of the gating process in voltage-gated K(+) channels encoded by the K(v)7 gene family. After reviewing the current knowledge on the molecular mechanisms and on the structural models of voltage-dependent gating in VGICs, we describe the physiological relevance of these channels, with particular emphasis on those formed by K(v)7.2-K(v)7.5 subunits having a well-established role in controlling neuronal excitability in humans. In fact, genetically determined alterations in K(v)7.2 and K(v)7.3 genes are responsible for benign familial neonatal convulsions, a rare seizure disorder affecting newborns, and the pharmacological activation of K(v)7.2/3 channels can exert antiepileptic activity in humans. Both mutation-triggered channel dysfunction and drug-induced channel activation can occur by impeding or facilitating, respectively, channel sensitivity to membrane voltage and can affect overlapping molecular sites within the voltage-sensing domain of these channels. Thus, understanding the molecular steps involved in voltage-sensing in K(v)7 channels will allow to better define the pathogenesis of rare human epilepsy, and to design innovative pharmacological strategies for the treatment of epilepsies and, possibly, other human diseases characterized by neuronal hyperexcitability.
Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.
Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo
2014-03-01
The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.
Constraints on voltage sensor movement in the shaker K+ channel.
Darman, Rachel B; Ivy, Allison A; Ketty, Vina; Blaustein, Robert O
2006-12-01
In nerve and muscle cells, the voltage-gated opening and closing of cation-selective ion channels is accompanied by the translocation of 12-14 elementary charges across the membrane's electric field. Although most of these charges are carried by residues in the S4 helix of the gating module of these channels, the precise nature of their physical movement is currently the topic of spirited debate. Broadly speaking, two classes of models have emerged: those that suggest that small-scale motions can account for the extensive charge displacement, and those that invoke a much larger physical movement. In the most recent incarnation of the latter type of model, which is based on structural and functional data from the archaebacterial K(+) channel KvAP, a "voltage-sensor paddle" comprising a helix-turn-helix of S3-S4 translocates approximately 20 A through the bilayer during the gating cycle (Jiang, Y., A. Lee, J. Chen, V. Ruta, M. Cadene, B.T. Chait, and R. MacKinnon. 2003. Nature. 423:33-41; Jiang, Y., V. Ruta, J. Chen, A. Lee, and R. MacKinnon. 2003. Nature. 423:42-48.; Ruta, V., J. Chen, and R. MacKinnon. 2005. Cell. 123:463-475). We used two methods to test for analogous motions in the Shaker K(+) channel, each examining the aqueous exposure of residues near S3. In the first, we employed a pore-blocking maleimide reagent (Blaustein, R.O., P.A. Cole, C. Williams, and C. Miller. 2000. Nat. Struct. Biol. 7:309-311) to probe for state-dependent changes in the chemical reactivity of substituted cysteines; in the second, we tested the state-dependent accessibility of a tethered biotin to external streptavidin (Qiu, X.Q., K.S. Jakes, A. Finkelstein, and S.L. Slatin. 1994. J. Biol. Chem. 269:7483-7488; Slatin, S.L., X.Q. Qiu, K.S. Jakes, and A. Finkelstein. 1994. Nature. 371:158-161). In both types of experiments, residues predicted to lie near the top of S3 did not exhibit any change in aqueous exposure during the gating cycle. This lack of state dependence argues against
Taft, William C.; Delorenzo, Robert J.
1984-05-01
Benzodiazepines in micromolar concentrations significantly inhibit depolarization-sensitive Ca2+ uptake in intact nerve-terminal preparations. Benzodiazepine inhibition of Ca2+ uptake is concentration dependent and stereospecific. Micromolar-affinity benzodiazepine receptors have been identified and characterized in brain membrane and shown to be distinct from nanomolar-affinity benzodiazepine receptors. Evidence is presented that micromolar, and not nanomolar, benzodiazepine binding sites mediate benzodiazepine inhibition of Ca2+ uptake. Irreversible binding to micromolar benzodiazepine binding sites also irreversibly blocked depolarization-dependent Ca2+ uptake in synaptosomes, indicating that these compounds may represent a useful marker for identifying the molecular components of Ca2+ channels in brain. Characterization of benzodiazepine inhibition of Ca2+ uptake demonstrates that these drugs function as Ca2+ channel antagonists, because benzodiazepines effectively blocked voltage-sensitive Ca2+ uptake inhibited by Mn2+, Co2+, verapamil, nitrendipine, and nimodipine. These results indicate that micromolar benzodiazepine binding sites regulate voltage-sensitive Ca2+ channels in brain membrane and suggest that some of the neuronal stabilizing effects of micromolar benzodiazepine receptors may be mediated by the regulation of Ca2+ conductance.
Directory of Open Access Journals (Sweden)
Salvador Valle-Reyes
2018-05-01
Full Text Available Activation of resting T cells relies on sustained Ca2+ influx across the plasma membrane, which in turn depends on the functional expression of potassium channels, whose activity repolarizes the membrane potential. Depending on the T-cells subset, upon activation the expression of Ca2+- or voltage-activated K+ channels, KCa or Kv, is up-regulated. In this study, by means of patch-clamp technique in the whole cell mode, we have studied in detail the characteristics of Kv and KCa currents in resting and activated human T cells, the only well explored human T-leukemic cell line Jurkat, and two additional human leukemic T cell lines, CEM and MOLT-3. Voltage dependence of activation and inactivation of Kv1.3 current were shifted up to by 15 mV to more negative potentials upon a prolonged incubation in the whole cell mode and displayed little difference at a stable state in all cell lines but CEM, where the activation curve was biphasic, with a high and low potential components. In Jurkat, KCa currents were dominated by apamine-sensitive KCa2.2 channels, whereas only KCa3.1 current was detected in healthy T and leukemic CEM and MOLT-3 cells. Despite a high proliferation potential of Jurkat cells, Kv and KCa currents were unexpectedly small, more than 10-fold lesser as compared to activated healthy human T cells, CEM and MOLT-3, which displayed characteristic Kv1.3high:KCa3.1high phenotype. Our results suggest that Jurkat cells represent perhaps a singular case and call for more extensive studies on primary leukemic T cell lines as well as a verification of the therapeutic potential of specific KCa3.1 blockers to combat acute lymphoblastic T leukemias.
Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar
2014-01-01
Background The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. Findings The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Conclusions Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons. PMID:24598811
Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar
2014-01-01
The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.
Directory of Open Access Journals (Sweden)
José Joaquín Merino
Full Text Available The discovery that nitric oxide (NO functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated.The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated.Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.
Contributions of counter-charge in a potassium channel voltage-sensor domain
DEFF Research Database (Denmark)
Pless, Stephan Alexander; Galpin, Jason D; Niciforovic, Ana P
2011-01-01
Voltage-sensor domains couple membrane potential to conformational changes in voltage-gated ion channels and phosphatases. Highly coevolved acidic and aromatic side chains assist the transfer of cationic side chains across the transmembrane electric field during voltage sensing. We investigated...... the functional contribution of negative electrostatic potentials from these residues to channel gating and voltage sensing with unnatural amino acid mutagenesis, electrophysiology, voltage-clamp fluorometry and ab initio calculations. The data show that neutralization of two conserved acidic side chains...
Capes, Deborah L; Goldschen-Ohm, Marcel P; Arcisio-Miranda, Manoel; Bezanilla, Francisco; Chanda, Baron
2013-08-01
Voltage-gated sodium channels are critical for the generation and propagation of electrical signals in most excitable cells. Activation of Na(+) channels initiates an action potential, and fast inactivation facilitates repolarization of the membrane by the outward K(+) current. Fast inactivation is also the main determinant of the refractory period between successive electrical impulses. Although the voltage sensor of domain IV (DIV) has been implicated in fast inactivation, it remains unclear whether the activation of DIV alone is sufficient for fast inactivation to occur. Here, we functionally neutralize each specific voltage sensor by mutating several critical arginines in the S4 segment to glutamines. We assess the individual role of each voltage-sensing domain in the voltage dependence and kinetics of fast inactivation upon its specific inhibition. We show that movement of the DIV voltage sensor is the rate-limiting step for both development and recovery from fast inactivation. Our data suggest that activation of the DIV voltage sensor alone is sufficient for fast inactivation to occur, and that activation of DIV before channel opening is the molecular mechanism for closed-state inactivation. We propose a kinetic model of sodium channel gating that can account for our major findings over a wide voltage range by postulating that DIV movement is both necessary and sufficient for fast inactivation.
Okuda, Hiroko; Yonezawa, Yasushige; Takano, Yu; Okamura, Yasushi; Fujiwara, Yuichiro
2016-01-01
The voltage-gated H+ channel (Hv) is a voltage sensor domain-like protein consisting of four transmembrane segments (S1?S4). The native Hv structure is a homodimer, with the two channel subunits functioning cooperatively. Here we show that the two voltage sensor S4 helices within the dimer directly cooperate via a ?-stacking interaction between Trp residues at the middle of each segment. Scanning mutagenesis showed that Trp situated around the original position provides the slow gating kineti...
Directory of Open Access Journals (Sweden)
Sheyda R Frolova
Full Text Available The ability of azobenzene trimethylammonium bromide (azoTAB to sensitize cardiac tissue excitability to light was recently reported. The dark, thermally relaxed trans- isomer of azoTAB suppressed spontaneous activity and excitation propagation speed, whereas the cis- isomer had no detectable effect on the electrical properties of cardiomyocyte monolayers. As the membrane potential of cardiac cells is mainly controlled by activity of voltage-gated ion channels, this study examined whether the sensitization effect of azoTAB was exerted primarily via the modulation of voltage-gated ion channel activity. The effects of trans- and cis- isomers of azoTAB on voltage-dependent sodium (INav, calcium (ICav, and potassium (IKv currents in isolated neonatal rat cardiomyocytes were investigated using the whole-cell patch-clamp technique. The experiments showed that azoTAB modulated ion currents, causing suppression of sodium (Na+ and calcium (Ca2+ currents and potentiation of net potassium (K+ currents. This finding confirms that azoTAB-effect on cardiac tissue excitability do indeed result from modulation of voltage-gated ion channels responsible for action potential.
Dual regulation of the native ClC-K2 chloride channel in the distal nephron by voltage and pH.
Pinelli, Laurent; Nissant, Antoine; Edwards, Aurélie; Lourdel, Stéphane; Teulon, Jacques; Paulais, Marc
2016-09-01
ClC-K2, a member of the ClC family of Cl(-) channels and transporters, forms the major basolateral Cl(-) conductance in distal nephron epithelial cells and therefore plays a central role in renal Cl(-) absorption. However, its regulation remains largely unknown because of the fact that recombinant ClC-K2 has not yet been studied at the single-channel level. In the present study, we investigate the effects of voltage, pH, Cl(-), and Ca(2+) on native ClC-K2 in the basolateral membrane of intercalated cells from the mouse connecting tubule. The ∼10-pS channel shows a steep voltage dependence such that channel activity increases with membrane depolarization. Intracellular pH (pHi) and extracellular pH (pHo) differentially modulate the voltage dependence curve: alkaline pHi flattens the curve by causing an increase in activity at negative voltages, whereas alkaline pHo shifts the curve toward negative voltages. In addition, pHi, pHo, and extracellular Ca(2+) strongly increase activity, mainly because of an increase in the number of active channels with a comparatively minor effect on channel open probability. Furthermore, voltage alters both the number of active channels and their open probability, whereas intracellular Cl(-) has little influence. We propose that changes in the number of active channels correspond to them entering or leaving an inactivated state, whereas modulation of open probability corresponds to common gating by these channels. We suggest that pH, through the combined effects of pHi and pHo on ClC-K2, might be a key regulator of NaCl absorption and Cl(-)/HCO3 (-) exchange in type B intercalated cells. © 2016 Pinelli et al.
DEFF Research Database (Denmark)
Hjæresen, Marie-Louise; Hageman, Ida; Wörtwein, Gitta
2008-01-01
The mechanisms by which stress and electroconvulsive therapy exert opposite effects on the course of major depression are not known. Potential candidates might include the voltage-dependent potassium channels. Potassium channels play an important role in maintaining the resting membrane potential...... and controlling neuronal excitability. To explore this hypothesis, we examined the effects of one or several electroconvulsive stimulations and chronic restraint stress (6 h/day for 21 days) on the expression of voltage-dependent potassium channel Kv7.2, Kv11.1, and Kv11.3 mRNA in the rat brain using in situ...... hybridization. Repeated, but not acute, electroconvulsive stimulation increased Kv7.2 and Kv11.1 mRNA levels in the piriform cortex. In contrast, restraint stress had no significant effect on mRNA expression of Kv7.2, Kv11.1, or Kv11.3 in any of the brain regions examined. Thus, it appears that the investigated...
Directory of Open Access Journals (Sweden)
Mohamed-Yassine eAMAROUCH
2015-02-01
Full Text Available Voltage-gated sodium channels (Nav are widely expressed as macro-molecular complexes in both excitable and non-excitable tissues. In excitable tissues, the upstroke of the action potential is the result of the passage of a large and rapid influx of sodium ions through these channels. NaV dysfunction has been associated with an increasingly wide range of neurological, muscular and cardiac disorders. The purpose of this review is to summarize the recently identified sodium channel mutations that are linked to hyper-excitability phenotypes and associated with the alteration of the activation process of voltage gated sodium channels. Indeed, several clinical manifestations that demonstrate an alteration of tissue excitability were recently shown to be strongly associated with the presence of mutations that affect the activation process of the voltage-gated sodium channels. These emerging genotype-phenotype correlations have expanded the clinical spectrum of sodium channelopathies to include disorders which feature a hyper-excitability phenotype that may or may not be associated with a cardiomyopathy. The p.I141V mutation in SCN4A and SCN5A, as well as its homologous p.I136V mutation in SCN9A, are interesting examples of mutations that have been linked to inherited hyperexcitability myotonia, exercise-induced polymorphic ventricular arrhythmias and erythromelalgia, respectively. Regardless of which sodium channel isoform is investigated, the substitution of the isoleucine to valine in the locus 141 induces similar modifications in the biophysical properties of the voltage-gated sodium channels by shifting the voltage-dependence of steady state activation towards more negative potentials.
Voltage-Gated Potassium Channels: A Structural Examination of Selectivity and Gating
Kim, Dorothy M.; Nimigean, Crina M.
2016-01-01
Voltage-gated potassium channels play a fundamental role in the generation and propagation of the action potential. The discovery of these channels began with predictions made by early pioneers, and has culminated in their extensive functional and structural characterization by electrophysiological, spectroscopic, and crystallographic studies. With the aid of a variety of crystal structures of these channels, a highly detailed picture emerges of how the voltage-sensing domain reports changes in the membrane electric field and couples this to conformational changes in the activation gate. In addition, high-resolution structural and functional studies of K+ channel pores, such as KcsA and MthK, offer a comprehensive picture on how selectivity is achieved in K+ channels. Here, we illustrate the remarkable features of voltage-gated potassium channels and explain the mechanisms used by these machines with experimental data. PMID:27141052
Effects of Voltage-Gated K+ Channel on Cell Proliferation in Multiple Myeloma
Directory of Open Access Journals (Sweden)
Wei Wang
2014-01-01
Full Text Available Objective. To study the effects and underlying mechanisms of voltage-gated K+ channels on the proliferation of multiple myeloma cells. Methods. RPMI-8226 MM cell line was used for the experiments. Voltage-gated K+ currents and the resting potential were recorded by whole-cell patch-clamp technique. RT-PCR detected Kv channel mRNA expression. Cell viability was analyzed with MTT assay. Cell counting system was employed to monitor cell proliferation. DNA contents and cell volume were analyzed by flow cytometry. Results. Currents recorded in RPMI-8226 cells were confirmed to be voltage-gated K+ channels. A high level of Kv1.3 mRNA was detected but no Kv3.1 mRNA was detected in RPMI-8226 cells. Voltage-gated K+ channel blocker 4-aminopyridine (4-AP (2 mM depolarized the resting potential from −42 ± 1.7 mV to −31.8 ± 2.8 mV (P0.05. Conclusions. In RPMI-8226, voltage-gated K+ channels are involved in proliferation and cell cycle progression its influence on the resting potential and cell volume may be responsible for this process; the inhibitory effect of the voltage-gated K+ channel blocker on RPMI-8226 cell proliferation is a phase-specific event.
Conotoxins as Tools to Understand the Physiological Function of Voltage-Gated Calcium (CaV Channels
Directory of Open Access Journals (Sweden)
David Ramírez
2017-10-01
Full Text Available Voltage-gated calcium (CaV channels are widely expressed and are essential for the completion of multiple physiological processes. Close regulation of their activity by specific inhibitors and agonists become fundamental to understand their role in cellular homeostasis as well as in human tissues and organs. CaV channels are divided into two groups depending on the membrane potential required to activate them: High-voltage activated (HVA, CaV1.1–1.4; CaV2.1–2.3 and Low-voltage activated (LVA, CaV3.1–3.3. HVA channels are highly expressed in brain (neurons, heart, and adrenal medulla (chromaffin cells, among others, and are also classified into subtypes which can be distinguished using pharmacological approaches. Cone snails are marine gastropods that capture their prey by injecting venom, “conopeptides”, which cause paralysis in a few seconds. A subset of conopeptides called conotoxins are relatively small polypeptides, rich in disulfide bonds, that target ion channels, transporters and receptors localized at the neuromuscular system of the animal target. In this review, we describe the structure and properties of conotoxins that selectively block HVA calcium channels. We compare their potency on several HVA channel subtypes, emphasizing neuronal calcium channels. Lastly, we analyze recent advances in the therapeutic use of conotoxins for medical treatments.
Martín, Pedro; Enrique, Nicolás; Palomo, Ana R. Roldán; Rebolledo, Alejandro; Milesi, Veronica
2012-01-01
Bupivacaine is a local anesthetic compound belonging to the amino amide group. Its anesthetic effect is commonly related to its inhibitory effect on voltage-gated sodium channels. However, several studies have shown that this drug can also inhibit voltage-operated K+ channels by a different blocking mechanism. This could explain the observed contractile effects of bupivacaine on blood vessels. Up to now, there were no previous reports in the literature about bupivacaine effects on large conductance voltage- and Ca2+-activated K+ channels (BKCa). Using the patch-clamp technique, it is shown that bupivacaine inhibits single-channel and whole-cell K+ currents carried by BKCa channels in smooth muscle cells isolated from human umbilical artery (HUA). At the single-channel level bupivacaine produced, in a concentration- and voltage-dependent manner (IC50 324 µM at +80 mV), a reduction of single-channel current amplitude and induced a flickery mode of the open channel state. Bupivacaine (300 µM) can also block whole-cell K+ currents (~45% blockage) in which, under our working conditions, BKCa is the main component. This study presents a new inhibitory effect of bupivacaine on an ion channel involved in different cell functions. Hence, the inhibitory effect of bupivacaine on BKCa channel activity could affect different physiological functions where these channels are involved. Since bupivacaine is commonly used during labor and delivery, its effects on umbilical arteries, where this channel is highly expressed, should be taken into account. PMID:22688134
Ca²⁺-dependent K⁺ channels in exocrine salivary glands.
Catalán, Marcelo A; Peña-Munzenmayer, Gaspar; Melvin, James E
2014-06-01
In the last 15 years, remarkable progress has been realized in identifying the genes that encode the ion-transporting proteins involved in exocrine gland function, including salivary glands. Among these proteins, Ca(2+)-dependent K(+) channels take part in key functions including membrane potential regulation, fluid movement and K(+) secretion in exocrine glands. Two K(+) channels have been identified in exocrine salivary glands: (1) a Ca(2+)-activated K(+) channel of intermediate single channel conductance encoded by the KCNN4 gene, and (2) a voltage- and Ca(2+)-dependent K(+) channel of large single channel conductance encoded by the KCNMA1 gene. This review focuses on the physiological roles of Ca(2+)-dependent K(+) channels in exocrine salivary glands. We also discuss interesting recent findings on the regulation of Ca(2+)-dependent K(+) channels by protein-protein interactions that may significantly impact exocrine gland physiology. Published by Elsevier Ltd.
Outward Rectification of Voltage-Gated K+ Channels Evolved at Least Twice in Life History.
Directory of Open Access Journals (Sweden)
Janin Riedelsberger
Full Text Available Voltage-gated potassium (K+ channels are present in all living systems. Despite high structural similarities in the transmembrane domains (TMD, this K+ channel type segregates into at least two main functional categories-hyperpolarization-activated, inward-rectifying (Kin and depolarization-activated, outward-rectifying (Kout channels. Voltage-gated K+ channels sense the membrane voltage via a voltage-sensing domain that is connected to the conduction pathway of the channel. It has been shown that the voltage-sensing mechanism is the same in Kin and Kout channels, but its performance results in opposite pore conformations. It is not known how the different coupling of voltage-sensor and pore is implemented. Here, we studied sequence and structural data of voltage-gated K+ channels from animals and plants with emphasis on the property of opposite rectification. We identified structural hotspots that alone allow already the distinction between Kin and Kout channels. Among them is a loop between TMD S5 and the pore that is very short in animal Kout, longer in plant and animal Kin and the longest in plant Kout channels. In combination with further structural and phylogenetic analyses this finding suggests that outward-rectification evolved twice and independently in the animal and plant kingdom.
Hong, Liang; Pathak, Medha M; Kim, Iris H; Ta, Dennis; Tombola, Francesco
2013-01-23
Voltage-gated sodium, potassium, and calcium channels are made of a pore domain (PD) controlled by four voltage-sensing domains (VSDs). The PD contains the ion permeation pathway and the activation gate located on the intracellular side of the membrane. A large number of small molecules are known to inhibit the PD by acting as open channel blockers. The voltage-gated proton channel Hv1 is made of two VSDs and lacks the PD. The location of the activation gate in the VSD is unknown and open channel blockers for VSDs have not yet been identified. Here, we describe a class of small molecules which act as open channel blockers on the Hv1 VSD and find that a highly conserved phenylalanine in the charge transfer center of the VSD plays a key role in blocker binding. We then use one of the blockers to show that Hv1 contains two intracellular and allosterically coupled gates. Copyright © 2013 Elsevier Inc. All rights reserved.
Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles
Shirokov, Roman E.
2018-01-01
Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371
Song, Weizhong; Du, Yuzhe; Liu, Zhiqi; Luo, Ningguang; Turkov, Michael; Gordon, Dalia; Gurevitz, Michael; Goldin, Alan L; Dong, Ke
2011-05-06
Scorpion β-toxins bind to the extracellular regions of the voltage-sensing module of domain II and to the pore module of domain III in voltage-gated sodium channels and enhance channel activation by trapping and stabilizing the voltage sensor of domain II in its activated state. We investigated the interaction of a highly potent insect-selective scorpion depressant β-toxin, Lqh-dprIT(3), from Leiurus quinquestriatus hebraeus with insect sodium channels from Blattella germanica (BgNa(v)). Like other scorpion β-toxins, Lqh-dprIT(3) shifts the voltage dependence of activation of BgNa(v) channels expressed in Xenopus oocytes to more negative membrane potentials but only after strong depolarizing prepulses. Notably, among 10 BgNa(v) splice variants tested for their sensitivity to the toxin, only BgNa(v)1-1 was hypersensitive due to an L1285P substitution in IIIS1 resulting from a U-to-C RNA-editing event. Furthermore, charge reversal of a negatively charged residue (E1290K) at the extracellular end of IIIS1 and the two innermost positively charged residues (R4E and R5E) in IIIS4 also increased the channel sensitivity to Lqh-dprIT(3). Besides enhancement of toxin sensitivity, the R4E substitution caused an additional 20-mV negative shift in the voltage dependence of activation of toxin-modified channels, inducing a unique toxin-modified state. Our findings provide the first direct evidence for the involvement of the domain III voltage-sensing module in the action of scorpion β-toxins. This hypersensitivity most likely reflects an increase in IIS4 trapping via allosteric mechanisms, suggesting coupling between the voltage sensors in neighboring domains during channel activation.
Voltage-gated sodium channels in taste bud cells
Directory of Open Access Journals (Sweden)
Williams Mark E
2009-03-01
Full Text Available Abstract Background Taste bud cells transmit information regarding the contents of food from taste receptors embedded in apical microvilli to gustatory nerve fibers innervating basolateral membranes. In particular, taste cells depolarize, activate voltage-gated sodium channels, and fire action potentials in response to tastants. Initial cell depolarization is attributable to sodium influx through TRPM5 in sweet, bitter, and umami cells and an undetermined cation influx through an ion channel in sour cells expressing PKD2L1, a candidate sour taste receptor. The molecular identity of the voltage-gated sodium channels that sense depolarizing signals and subsequently initiate action potentials coding taste information to gustatory nerve fibers is unknown. Results We describe the molecular and histological expression profiles of cation channels involved in electrical signal transmission from apical to basolateral membrane domains. TRPM5 was positioned immediately beneath tight junctions to receive calcium signals originating from sweet, bitter, and umami receptor activation, while PKD2L1 was positioned at the taste pore. Using mouse taste bud and lingual epithelial cells collected by laser capture microdissection, SCN2A, SCN3A, and SCN9A voltage-gated sodium channel transcripts were expressed in taste tissue. SCN2A, SCN3A, and SCN9A were expressed beneath tight junctions in subsets of taste cells. SCN3A and SCN9A were expressed in TRPM5 cells, while SCN2A was expressed in TRPM5 and PKD2L1 cells. HCN4, a gene previously implicated in sour taste, was expressed in PKD2L1 cells and localized to cell processes beneath the taste pore. Conclusion SCN2A, SCN3A and SCN9A voltage-gated sodium channels are positioned to sense initial depolarizing signals stemming from taste receptor activation and initiate taste cell action potentials. SCN2A, SCN3A and SCN9A gene products likely account for the tetrodotoxin-sensitive sodium currents in taste receptor cells.
Voltage-gated sodium channels in taste bud cells.
Gao, Na; Lu, Min; Echeverri, Fernando; Laita, Bianca; Kalabat, Dalia; Williams, Mark E; Hevezi, Peter; Zlotnik, Albert; Moyer, Bryan D
2009-03-12
Taste bud cells transmit information regarding the contents of food from taste receptors embedded in apical microvilli to gustatory nerve fibers innervating basolateral membranes. In particular, taste cells depolarize, activate voltage-gated sodium channels, and fire action potentials in response to tastants. Initial cell depolarization is attributable to sodium influx through TRPM5 in sweet, bitter, and umami cells and an undetermined cation influx through an ion channel in sour cells expressing PKD2L1, a candidate sour taste receptor. The molecular identity of the voltage-gated sodium channels that sense depolarizing signals and subsequently initiate action potentials coding taste information to gustatory nerve fibers is unknown. We describe the molecular and histological expression profiles of cation channels involved in electrical signal transmission from apical to basolateral membrane domains. TRPM5 was positioned immediately beneath tight junctions to receive calcium signals originating from sweet, bitter, and umami receptor activation, while PKD2L1 was positioned at the taste pore. Using mouse taste bud and lingual epithelial cells collected by laser capture microdissection, SCN2A, SCN3A, and SCN9A voltage-gated sodium channel transcripts were expressed in taste tissue. SCN2A, SCN3A, and SCN9A were expressed beneath tight junctions in subsets of taste cells. SCN3A and SCN9A were expressed in TRPM5 cells, while SCN2A was expressed in TRPM5 and PKD2L1 cells. HCN4, a gene previously implicated in sour taste, was expressed in PKD2L1 cells and localized to cell processes beneath the taste pore. SCN2A, SCN3A and SCN9A voltage-gated sodium channels are positioned to sense initial depolarizing signals stemming from taste receptor activation and initiate taste cell action potentials. SCN2A, SCN3A and SCN9A gene products likely account for the tetrodotoxin-sensitive sodium currents in taste receptor cells.
Liu, Jinxu; Tu, Huiyin; Zhang, Dongze; Zheng, Hong; Li, Yu-Long
2012-10-25
The generation of action potential is required for stimulus-evoked neurotransmitter release in most neurons. Although various voltage-gated ion channels are involved in action potential production, the initiation of the action potential is mainly mediated by voltage-gated Na+ channels. In the present study, differentiation-induced changes of mRNA and protein expression of Na+ channels, Na+ currents, and cell membrane excitability were investigated in NG108-15 cells. Whole-cell patch-clamp results showed that differentiation (9 days) didn't change cell membrane excitability, compared to undifferentiated state. But differentiation (21 days) induced the action potential generation in 45.5% of NG108-15 cells (25/55 cells). In 9-day-differentiated cells, Na+ currents were mildly increased, which was also found in 21-day differentiated cells without action potential. In 21-day differentiated cells with action potential, Na+ currents were significantly enhanced. Western blot data showed that the expression of Na+ channels was increased with differentiated-time dependent manner. Single-cell real-time PCR data demonstrated that the expression of Na+ channel mRNA was increased by 21 days of differentiation in NG108-15 cells. More importantly, the mRNA level of Na+ channels in cells with action potential was higher than that in cells without action potential. Differentiation induces expression of voltage-gated Na+ channels and action potential generation in NG108-15 cells. A high level of the Na+ channel density is required for differentiation-triggered action potential generation.
Numata, Tomohiro; Tsumoto, Kunichika; Yamada, Kazunori; Kurokawa, Tatsuki; Hirose, Shinichi; Nomura, Hideki; Kawano, Mitsuhiro; Kurachi, Yoshihisa; Inoue, Ryuji; Mori, Yasuo
2017-08-29
Numerical model-based simulations provide important insights into ion channel gating when experimental limitations exist. Here, a novel strategy combining numerical simulations with patch clamp experiments was used to investigate the net positive charges in the putative transmembrane segment 4 (S4) of the atypical, positively-shifted voltage-dependence of polycystic kidney disease 2-like 1 (PKD2L1) channel. Charge-neutralising mutations (K452Q, K455Q and K461Q) in S4 reduced gating charges, positively shifted the Boltzmann-type activation curve [i.e., open probability (P open )-V curve] and altered the time-courses of activation/deactivation of PKD2L1, indicating that this region constitutes part of a voltage sensor. Numerical reconstruction of wild-type (WT) and mutant PKD2L1-mediated currents necessitated, besides their voltage-dependent gating parameters, a scaling factor that describes the voltage-dependence of maximal conductance, G max . Subsequent single-channel conductance (γ) measurements revealed that voltage-dependence of G max in WT can be explained by the inward-rectifying property of γ, which is greatly changed in PKD2L1 mutants. Homology modelling based on PKD2 and Na V Ab structures suggest that such voltage dependence of P open and γ in PKD2L1 could both reflect the charged state of the S4 domain. The present conjunctive experimental and theoretical approaches provide a framework to explore the undetermined mechanism(s) regulating TRP channels that possess non-classical voltage-dependent properties.
Structure of Voltage-gated Two-pore Channel TPC1 from Arabidopsis thaliana
Guo, Jiangtao; Zeng, Weizhong; Chen, Qingfeng; Lee, Changkeun; Chen, Liping; Yang, Yi; Cang, Chunlei; Ren, Dejian; Jiang, Youxing
2015-01-01
Two-pore channels (TPCs) contain two copies of a Shaker-like six-transmembrane (6-TM) domain in each subunit and are ubiquitously expressed in both animals and plants as organellar cation channels. Here, we present the first crystal structure of a vacuolar two-pore channel from Arabidopsis thaliana, AtTPC1, which functions as a homodimer. AtTPC1 activation requires both voltage and cytosolic Ca2+. Ca2+ binding to the cytosolic EF-hand domain triggers conformational changes coupled to the pair of pore-lining inner helices (IS6 helices) from the first 6-TM domains, whereas membrane potential only activates the second voltage-sensing domain (VSD2) whose conformational changes are coupled to the pair of inner helices (IIS6 helices) from the second 6-TM domains. Luminal Ca2+ or Ba2+ can modulate voltage activation by stabilizing VSD2 in the resting state and shifts voltage activation towards more positive potentials. Our Ba2+ bound AtTPC1 structure reveals a voltage sensor in the resting state, providing hitherto unseen structural insight into the general voltage-gating mechanism among voltage-gated channels. PMID:26689363
KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current
DEFF Research Database (Denmark)
Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten
2002-01-01
The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....
The hitchhiker’s guide to the voltage-gated sodium channel galaxy
2016-01-01
Eukaryotic voltage-gated sodium (Nav) channels contribute to the rising phase of action potentials and served as an early muse for biophysicists laying the foundation for our current understanding of electrical signaling. Given their central role in electrical excitability, it is not surprising that (a) inherited mutations in genes encoding for Nav channels and their accessory subunits have been linked to excitability disorders in brain, muscle, and heart; and (b) Nav channels are targeted by various drugs and naturally occurring toxins. Although the overall architecture and behavior of these channels are likely to be similar to the more well-studied voltage-gated potassium channels, eukaryotic Nav channels lack structural and functional symmetry, a notable difference that has implications for gating and selectivity. Activation of voltage-sensing modules of the first three domains in Nav channels is sufficient to open the channel pore, whereas movement of the domain IV voltage sensor is correlated with inactivation. Also, structure–function studies of eukaryotic Nav channels show that a set of amino acids in the selectivity filter, referred to as DEKA locus, is essential for Na+ selectivity. Structures of prokaryotic Nav channels have also shed new light on mechanisms of drug block. These structures exhibit lateral fenestrations that are large enough to allow drugs or lipophilic molecules to gain access into the inner vestibule, suggesting that this might be the passage for drug entry into a closed channel. In this Review, we will synthesize our current understanding of Nav channel gating mechanisms, ion selectivity and permeation, and modulation by therapeutics and toxins in light of the new structures of the prokaryotic Nav channels that, for the time being, serve as structural models of their eukaryotic counterparts. PMID:26712848
Directory of Open Access Journals (Sweden)
John J. Lemasters
2017-12-01
Full Text Available The voltage-dependent anion channel (VDAC is well known as the pathway for passive diffusion of anionic hydrophilic mitochondrial metabolites across the outer membrane, but a more complex functionality of the three isoforms of VDAC has emerged, as addressed in the Frontiers in Oncology Research Topic on “Uncovering the Function of the Mitochondrial Protein VDAC in Health and Disease: from Structure-Function to Novel Therapeutic Strategies.” VDAC as the single most abundant protein in mitochondrial outer membranes is typically involved in isoform-specific interactions of the mitochondrion with its surroundings as, for example, during mitochondria-dependent pathways of cell death. VDAC closure can also act as an adjustable limiter (governator of global mitochondrial metabolism, as during hepatic ethanol metabolism to promote selective oxidation of membrane-permeant acetaldehyde. In cancer cells, high free tubulin inhibits VDAC1 and VDAC2, contributing to suppression of mitochondrial function in the Warburg phenomenon. Erastin, the canonical inducer of ferroptosis, opens VDAC in the presence of tubulin and hyperpolarizes mitochondria, leading to mitochondrial production of reactive oxygen species, mitochondrial dysfunction, and cell death. Our understanding of VDAC function continues to evolve.
Directory of Open Access Journals (Sweden)
Ana Laura Sanchez-Sandoval
Full Text Available Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA and low-voltage (LVA activated calcium channels is around 30-40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers.
Sanchez-Sandoval, Ana Laura; Herrera Carrillo, Zazil; Díaz Velásquez, Clara Estela; Delgadillo, Dulce María; Rivera, Heriberto Manuel
2018-01-01
Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA) and low-voltage (LVA) activated calcium channels is around 30–40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C) induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers. PMID:29474447
Sanchez-Sandoval, Ana Laura; Herrera Carrillo, Zazil; Díaz Velásquez, Clara Estela; Delgadillo, Dulce María; Rivera, Heriberto Manuel; Gomora, Juan Carlos
2018-01-01
Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA) and low-voltage (LVA) activated calcium channels is around 30-40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C) induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers.
Cheng, Lan; Sanguinetti, Michael C
2009-05-01
Niflumic acid, 2-[[3-(trifluoromethyl)phenyl]amino]pyridine-3-carboxylic acid (NFA), is a nonsteroidal anti-inflammatory drug that also blocks or modifies the gating of many ion channels. Here, we investigated the effects of NFA on hyperpolarization-activated cyclic nucleotide-gated cation (HCN) pacemaker channels expressed in X. laevis oocytes using site-directed mutagenesis and the two-electrode voltage-clamp technique. Extracellular NFA acted rapidly and caused a slowing of activation and deactivation and a hyperpolarizing shift in the voltage dependence of HCN2 channel activation (-24.5 +/- 1.2 mV at 1 mM). Slowed channel gating and reduction of current magnitude was marked in oocytes treated with NFA, while clamped at 0 mV but minimal in oocytes clamped at -100 mV, indicating the drug preferentially interacts with channels in the closed state. NFA at 0.1 to 3 mM shifted the half-point for channel activation in a concentration-dependent manner, with an EC(50) of 0.54 +/- 0.068 mM and a predicted maximum shift of -38 mV. NFA at 1 mM also reduced maximum HCN2 conductance by approximately 20%, presumably by direct block of the pore. The rapid onset and state-dependence of NFA-induced changes in channel gating suggests an interaction with the extracellular region of the S4 transmembrane helix, the primary voltage-sensing domain of HCN2. Neutralization (by mutation to Gln) of any three of the outer four basic charged residues in S4, but not single mutations, abrogated the NFA-induced shift in channel activation. We conclude that NFA alters HCN2 gating by interacting with the extracellular end of the S4 voltage sensor domains.
International Nuclear Information System (INIS)
Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.
1988-01-01
The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns
Mishima, Eriko; Sato, Yoko; Nanatani, Kei; Hoshi, Naomi; Lee, Jong-Kook; Schiller, Nina; von Heijne, Gunnar; Sakaguchi, Masao; Uozumi, Nobuyuki
2016-12-01
Voltage-dependent K + (K V ) channels control K + permeability in response to shifts in the membrane potential. Voltage sensing in K V channels is mediated by the positively charged transmembrane domain S4. The best-characterized K V channel, KvAP, lacks the distinct hydrophilic region corresponding to the S3-S4 extracellular loop that is found in other K + channels. In the present study, we evaluated the topogenic properties of the transmembrane regions within the voltage-sensing domain in KvAP. S3 had low membrane insertion activity, whereas S4 possessed a unique type-I signal anchor (SA-I) function, which enabled it to insert into the membrane by itself. S4 was also found to function as a stop-transfer signal for retention in the membrane. The length and structural nature of the extracellular S3-S4 loop affected the membrane insertion of S3 and S4, suggesting that S3 membrane insertion was dependent on S4. Replacement of charged residues within the transmembrane regions with residues of opposite charge revealed that Asp 72 in S2 and Glu 93 in S3 contributed to membrane insertion of S3 and S4, and increased the stability of S4 in the membrane. These results indicate that the SA-I function of S4, unique among K + channels studied to date, promotes the insertion of S3 into the membrane, and that the charged residues essential for voltage sensing contribute to the membrane-insertion of the voltage sensor domain in KvAP. © 2016 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.
Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W
2016-02-01
Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.
Directory of Open Access Journals (Sweden)
Zhixin Lin
Full Text Available The voltage dependent sodium channel Nav1.9, is expressed preferentially in peripheral sensory neurons and has been linked to human genetic pain disorders, which makes it target of interest for the development of new pain therapeutics. However, characterization of Nav1.9 pharmacology has been limited due in part to the historical difficulty of functionally expressing recombinant channels. Here we report the successful generation and characterization of human, mouse and rat Nav1.9 stably expressed in human HEK-293 cells. These cells exhibit slowly activating and inactivating inward sodium channel currents that have characteristics of native Nav1.9. Optimal functional expression was achieved by coexpression of Nav1.9 with β1/β2 subunits. While recombinantly expressed Nav1.9 was found to be sensitive to sodium channel inhibitors TC-N 1752 and tetracaine, potency was up to 100-fold less than reported for other Nav channel subtypes despite evidence to support an interaction with the canonical local anesthetic (LA binding region on Domain 4 S6. Nav1.9 Domain 2 S6 pore domain contains a unique lysine residue (K799 which is predicted to be spatially near the local anesthetic interaction site. Mutation of this residue to the consensus asparagine (K799N resulted in an increase in potency for tetracaine, but a decrease for TC-N 1752, suggesting that this residue can influence interaction of inhibitors with the Nav1.9 pore. In summary, we have shown that stable functional expression of Nav1.9 in the widely used HEK-293 cells is possible, which opens up opportunities to better understand channel properties and may potentially aid identification of novel Nav1.9 based pharmacotherapies.
Voltage-gated sodium channels: action players with many faces
Koopmann, Tamara T.; Bezzina, Connie R.; Wilde, Arthur A. M.
2006-01-01
Voltage-gated sodium channels are responsible for the upstroke of the action potential and thereby play an important role in propagation of the electrical impulse in excitable tissues like muscle, nerve and the heart. Duplication of the sodium channels encoding genes during evolution generated the
Jaślan, D; Mueller, T D; Becker, D; Schultz, J; Cuin, T A; Marten, I; Dreyer, I; Schönknecht, G; Hedrich, R
2016-09-01
The two-pore cation channel TPC1 operates as a dimeric channel in animal and plant endomembranes. Each subunit consists of two homologous Shaker-like halves, with 12 transmembrane domains in total (S1-S6, S7-S12). In plants, TPC1 channels reside in the vacuolar membrane, and upon voltage stimulation, give rise to the well-known slow-activating SV currents. Here, we combined bioinformatics, structure modelling, site-directed mutagenesis, and in planta patch clamp studies to elucidate the molecular mechanisms of voltage-dependent channel gating in TPC1 in its native plant background. Structure-function analysis of the Arabidopsis TPC1 channel in planta confirmed that helix S10 operates as the major voltage-sensing site, with Glu450 and Glu478 identified as possible ion-pair partners for voltage-sensing Arg537. The contribution of helix S4 to voltage sensing was found to be negligible. Several conserved negative residues on the luminal site contribute to calcium binding, stabilizing the closed channel. During evolution of plant TPC1s from two separate Shaker-like domains, the voltage-sensing function in the N-terminal Shaker-unit (S1-S4) vanished. © 2016 German Botanical Society and The Royal Botanical Society of the Netherlands.
Energy Technology Data Exchange (ETDEWEB)
Arora, N D
1987-05-01
A simple and accurate semi-empirical model for the threshold voltage of a small geometry double implanted enhancement type MOSFET, especially useful in a circuit simulation program like SPICE, has been developed. The effect of short channel length and narrow width on the threshold voltage has been taken into account through a geometrical approximation, which involves parameters whose values can be determined from the curve fitting experimental data. A model for the temperature dependence of the threshold voltage for the implanted devices has also been presented. The temperature coefficient of the threshold voltage was found to change with decreasing channel length and width. Experimental results from various device sizes, both short and narrow, show very good agreement with the model. The model has been implemented in SPICE as part of the complete dc model.
Directory of Open Access Journals (Sweden)
Jessica A Hennessey
Full Text Available Mutations in CACNA1C that increase current through the CaV1.2 L-type Ca2+ channel underlie rare forms of long QT syndrome (LQTS, and Timothy syndrome (TS. We identified a variant in CACNA1C in a male child of Filipino descent with arrhythmias and extracardiac features by candidate gene sequencing and performed functional expression studies to electrophysiologically characterize the effects of the variant on CaV1.2 channels. As a baby, the subject developed seizures and displayed developmental delays at 30 months of age. At age 5 years, he displayed a QTc of 520 ms and experienced recurrent VT. Physical exam at 17 years of age was notable for microcephaly, short stature, lower extremity weakness and atrophy with hyperreflexia, spastic diplegia, multiple dental caries and episodes of rhabdomyolysis. Candidate gene sequencing identified a G>C transversion at position 5731 of CACNA1C (rs374528680 predicting a glycine>arginine substitution at residue 1911 (p.G1911R of CaV1.2. The allele frequency of this variant is 0.01 in Malays, but absent in 984 Caucasian alleles and in the 1000 genomes project. In electrophysiological analyses, the variant decreased voltage-dependent inactivation, thus causing a gain of function of CaV1.2. We also observed a negative shift of V1/2 of activation and positive shift of V1/2 of channel inactivation, resulting in an increase of the window current. Together, these suggest a gain-of-function effect on CaV1.2 and suggest increased susceptibility for arrhythmias in certain clinical settings. The p.G1911R variant was also identified in a case of sudden unexplained infant death (SUID, for which an increasing number of clinical observations have demonstrated can be associated with arrhythmogenic mutations in cardiac ion channels. In summary, the combined effects of the CACNA1C variant to diminish voltage-dependent inactivation of CaV1.2 and increase window current expand our appreciation of mechanisms by which a gain of
Directory of Open Access Journals (Sweden)
Xufeng Li
2009-05-01
Full Text Available The voltage-dependent anion channel (VDAC is the major transport protein in the outer membrane of mitochondria and plays crucial roles in energy metabolism, apoptosis, and metabolites transport. In plants, the expression of VDACs can be affected by different stresses, including drought, salinity and pathogen defense. In this study, we investigated the expression pattern of AtVDAC2 in A. thaliana and found ABA suppressed the accumulation of AtVDAC2 transcripts. Further, phenotype analysis of this VDAC deregulated-expression transgenic Arabidopsis plants indicated that AtVDAC2 anti-sense line showed an ABA-insensitivity phenotype during the early seedling development under ABA treatment. The results suggested that AtVDAC2 might be involved in ABA signaling in A. thaliana.
History-dependent dynamics in a generic model of ion channels - an analytic study
Directory of Open Access Journals (Sweden)
Daniel Soudry
2010-04-01
Full Text Available Recent experiments have demonstrated that the timescale of adaptation of single neurons and ion channel populations to stimuli slows down as the length of stimulation increases; in fact, no upper bound on temporal time-scales seems to exist in such systems. Furthermore, patch clamp experiments on single ion channels have hinted at the existence of large, mostly unobservable, inactivation state spaces within a single ion channel. This raises the question of the relation between this multitude of inactivation states and the observed behavior. In this work we propose a minimal model for ion channel dynamics which does not assume any specific structure of the inactivation state space. The model is simple enough to render an analytical study possible. This leads to a clear and concise explanation of the experimentally observed exponential history-dependent relaxation in sodium channels in a voltage clamp setting, and shows that their recovery rate from slow inactivation must be voltage dependent. Furthermore, we predict that history-dependent relaxation cannot be created by overly sparse spiking activity. While the model was created with ion channel populations in mind, its simplicity and genericalness render it a good starting point for modeling similar effects in other systems, and for scaling up to higher levels such as single neurons which are also known to exhibit multiple time scales.
Investigating ion channel conformational changes using voltage clamp fluorometry.
Talwar, Sahil; Lynch, Joseph W
2015-11-01
Ion channels are membrane proteins whose functions are governed by conformational changes. The widespread distribution of ion channels, coupled with their involvement in most physiological and pathological processes and their importance as therapeutic targets, renders the elucidation of these conformational mechanisms highly compelling from a drug discovery perspective. Thanks to recent advances in structural biology techniques, we now have high-resolution static molecular structures for members of the major ion channel families. However, major questions remain to be resolved about the conformational states that ion channels adopt during activation, drug modulation and desensitization. Patch-clamp electrophysiology has long been used to define ion channel conformational states based on functional criteria. It achieves this by monitoring conformational changes at the channel gate and cannot detect conformational changes occurring in regions distant from the gate. Voltage clamp fluorometry involves labelling cysteines introduced into domains of interest with environmentally sensitive fluorophores and inferring structural rearrangements from voltage or ligand-induced fluorescence changes. Ion channel currents are monitored simultaneously to verify the conformational status. By defining real time conformational changes in domains distant from the gate, this technique provides unexpected new insights into ion channel structure and function. This review aims to summarise the methodology and highlight recent innovative applications of this powerful technique. This article is part of the Special Issue entitled 'Fluorescent Tools in Neuropharmacology'. Copyright © 2015 Elsevier Ltd. All rights reserved.
Voltage Dependence of Supercapacitor Capacitance
Directory of Open Access Journals (Sweden)
Szewczyk Arkadiusz
2016-09-01
Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.
Intracellular calcium modulation of voltage-gated sodium channels in ventricular myocytes
Casini, Simona; Verkerk, Arie O.; van Borren, Marcel M. G. J.; van Ginneken, Antoni C. G.; Veldkamp, Marieke W.; de Bakker, Jacques M. T.; Tan, Hanno L.
2009-01-01
AIMS: Cardiac voltage-gated sodium channels control action potential (AP) upstroke and cell excitability. Intracellular calcium (Ca(i)(2+)) regulates AP properties by modulating various ion channels. Whether Ca(i)(2+) modulates sodium channels in ventricular myocytes, is unresolved. We studied
Directory of Open Access Journals (Sweden)
Tzilhav Shem-Ad
Full Text Available The tight electro-mechanical coupling between the voltage-sensing and pore domains of Kv channels lies at the heart of their fundamental roles in electrical signaling. Structural data have identified two voltage sensor pore inter-domain interaction surfaces, thus providing a framework to explain the molecular basis for the tight coupling of these domains. While the contribution of the intra-subunit lower domain interface to the electro-mechanical coupling that underlies channel opening is relatively well understood, the contribution of the inter-subunit upper interface to channel gating is not yet clear. Relying on energy perturbation and thermodynamic coupling analyses of tandem-dimeric Shaker Kv channels, we show that mutation of upper interface residues from both sides of the voltage sensor-pore domain interface stabilizes the closed channel state. These mutations, however, do not affect slow inactivation gating. We, moreover, find that upper interface residues form a network of state-dependent interactions that stabilize the open channel state. Finally, we note that the observed residue interaction network does not change during slow inactivation gating. The upper voltage sensing-pore interaction surface thus only undergoes conformational rearrangements during channel activation gating. We suggest that inter-subunit interactions across the upper domain interface mediate allosteric communication between channel subunits that contributes to the concerted nature of the late pore opening transition of Kv channels.
Shem-Ad, Tzilhav; Irit, Orr; Yifrach, Ofer
2013-01-01
The tight electro-mechanical coupling between the voltage-sensing and pore domains of Kv channels lies at the heart of their fundamental roles in electrical signaling. Structural data have identified two voltage sensor pore inter-domain interaction surfaces, thus providing a framework to explain the molecular basis for the tight coupling of these domains. While the contribution of the intra-subunit lower domain interface to the electro-mechanical coupling that underlies channel opening is relatively well understood, the contribution of the inter-subunit upper interface to channel gating is not yet clear. Relying on energy perturbation and thermodynamic coupling analyses of tandem-dimeric Shaker Kv channels, we show that mutation of upper interface residues from both sides of the voltage sensor-pore domain interface stabilizes the closed channel state. These mutations, however, do not affect slow inactivation gating. We, moreover, find that upper interface residues form a network of state-dependent interactions that stabilize the open channel state. Finally, we note that the observed residue interaction network does not change during slow inactivation gating. The upper voltage sensing-pore interaction surface thus only undergoes conformational rearrangements during channel activation gating. We suggest that inter-subunit interactions across the upper domain interface mediate allosteric communication between channel subunits that contributes to the concerted nature of the late pore opening transition of Kv channels.
Microscopic origin of gating current fluctuations in a potassium channel voltage sensor.
Freites, J Alfredo; Schow, Eric V; White, Stephen H; Tobias, Douglas J
2012-06-06
Voltage-dependent ion channels open and close in response to changes in membrane electrical potential due to the motion of their voltage-sensing domains (VSDs). VSD charge displacements within the membrane electric field are observed in electrophysiology experiments as gating currents preceding ionic conduction. The elementary charge motions that give rise to the gating current cannot be observed directly, but appear as discrete current pulses that generate fluctuations in gating current measurements. Here we report direct observation of gating-charge displacements in an atomistic molecular dynamics simulation of the isolated VSD from the KvAP channel in a hydrated lipid bilayer on the timescale (10-μs) expected for elementary gating charge transitions. The results reveal that gating-charge displacements are associated with the water-catalyzed rearrangement of salt bridges between the S4 arginines and a set of conserved acidic side chains on the S1-S3 transmembrane segments in the hydrated interior of the VSD. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Lazcano-Pérez, Fernando; Castro, Héctor; Arenas, Isabel; García, David E; González-Muñoz, Ricardo; Arreguín-Espinosa, Roberto
2016-05-05
The Zoanthids are an order of cnidarians whose venoms and toxins have been poorly studied. Palythoa caribaeorum is a zoanthid commonly found around the Mexican coastline. In this study, we tested the activity of P. caribaeorum venom on voltage-gated sodium channel (NaV1.7), voltage-gated calcium channel (CaV2.2), the A-type transient outward (IA) and delayed rectifier (IDR) currents of KV channels of the superior cervical ganglion (SCG) neurons of the rat. These results showed that the venom reversibly delays the inactivation process of voltage-gated sodium channels and inhibits voltage-gated calcium and potassium channels in this mammalian model. The compounds responsible for these effects seem to be low molecular weight peptides. Together, these results provide evidence for the potential use of zoanthids as a novel source of cnidarian toxins active on voltage-gated ion channels.
A voltage-gated H+ channel underlying pH homeostasis in calcifying coccolithophores.
Directory of Open Access Journals (Sweden)
Alison R Taylor
2011-06-01
Full Text Available Marine coccolithophorid phytoplankton are major producers of biogenic calcite, playing a significant role in the global carbon cycle. Predicting the impacts of ocean acidification on coccolithophore calcification has received much recent attention and requires improved knowledge of cellular calcification mechanisms. Uniquely amongst calcifying organisms, coccolithophores produce calcified scales (coccoliths in an intracellular compartment and secrete them to the cell surface, requiring large transcellular ionic fluxes to support calcification. In particular, intracellular calcite precipitation using HCO₃⁻ as the substrate generates equimolar quantities of H+ that must be rapidly removed to prevent cytoplasmic acidification. We have used electrophysiological approaches to identify a plasma membrane voltage-gated H+ conductance in Coccolithus pelagicus ssp braarudii with remarkably similar biophysical and functional properties to those found in metazoans. We show that both C. pelagicus and Emiliania huxleyi possess homologues of metazoan H(v1 H+ channels, which function as voltage-gated H+ channels when expressed in heterologous systems. Homologues of the coccolithophore H+ channels were also identified in a diversity of eukaryotes, suggesting a wide range of cellular roles for the H(v1 class of proteins. Using single cell imaging, we demonstrate that the coccolithophore H+ conductance mediates rapid H+ efflux and plays an important role in pH homeostasis in calcifying cells. The results demonstrate a novel cellular role for voltage gated H+ channels and provide mechanistic insight into biomineralisation by establishing a direct link between pH homeostasis and calcification. As the coccolithophore H+ conductance is dependent on the trans-membrane H+ electrochemical gradient, this mechanism will be directly impacted by, and may underlie adaptation to, ocean acidification. The presence of this H+ efflux pathway suggests that there is no obligate
The orientation and molecular movement of a k(+) channel voltage-sensing domain.
Gandhi, Chris S; Clark, Eliana; Loots, Eli; Pralle, Arnd; Isacoff, Ehud Y
2003-10-30
Voltage-gated channels operate through the action of a voltage-sensing domain (membrane segments S1-S4) that controls the conformation of gates located in the pore domain (membrane segments S5-S6). Recent structural studies on the bacterial K(v)AP potassium channel have led to a new model of voltage sensing in which S4 lies in the lipid at the channel periphery and moves through the membrane as a unit with a portion of S3. Here we describe accessibility probing and disulfide scanning experiments aimed at determining how well the K(v)AP model describes the Drosophila Shaker potassium channel. We find that the S1-S3 helices have one end that is externally exposed, S3 does not undergo a transmembrane motion, and S4 lies in close apposition to the pore domain in the resting and activated state.
Directory of Open Access Journals (Sweden)
Fernando Lazcano-Pérez
2016-05-01
Full Text Available The Zoanthids are an order of cnidarians whose venoms and toxins have been poorly studied. Palythoa caribaeorum is a zoanthid commonly found around the Mexican coastline. In this study, we tested the activity of P. caribaeorum venom on voltage-gated sodium channel (NaV1.7, voltage-gated calcium channel (CaV2.2, the A-type transient outward (IA and delayed rectifier (IDR currents of KV channels of the superior cervical ganglion (SCG neurons of the rat. These results showed that the venom reversibly delays the inactivation process of voltage-gated sodium channels and inhibits voltage-gated calcium and potassium channels in this mammalian model. The compounds responsible for these effects seem to be low molecular weight peptides. Together, these results provide evidence for the potential use of zoanthids as a novel source of cnidarian toxins active on voltage-gated ion channels.
Voltage Dependence of a Neuromodulator-Activated Ionic Current123
2016-01-01
Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619
International Nuclear Information System (INIS)
Birinyi-Strachan, Liesl C.; Gunning, Simon J.; Lewis, Richard J.; Nicholson, Graham M.
2005-01-01
The present study investigated the actions of the polyether marine toxin Pacific ciguatoxin-1 (P-CTX-1) on neuronal excitability in rat dorsal root ganglion (DRG) neurons using patch-clamp recording techniques. Under current-clamp conditions, bath application of 2-20 nM P-CTX-1 caused a rapid, concentration-dependent depolarization of the resting membrane potential in neurons expressing tetrodotoxin (TTX)-sensitive voltage-gated sodium (Na v ) channels. This action was completely suppressed by the addition of 200 nM TTX to the external solution, indicating that this effect was mediated through TTX-sensitive Na v channels. In addition, P-CTX-1 also prolonged action potential and afterhyperpolarization (AHP) duration. In a subpopulation of neurons, P-CTX-1 also produced tonic action potential firing, an effect that was not accompanied by significant oscillation of the resting membrane potential. Conversely, in neurons expressing TTX-resistant Na v currents, P-CTX-1 failed to alter any parameter of neuronal excitability examined in this study. Under voltage-clamp conditions in rat DRG neurons, P-CTX-1 inhibited both delayed-rectifier and 'A-type' potassium currents in a dose-dependent manner, actions that occurred in the absence of alterations to the voltage dependence of activation. These actions appear to underlie the prolongation of the action potential and AHP, and contribute to repetitive firing. These data indicate that a block of potassium channels contributes to the increase in neuronal excitability, associated with a modulation of Na v channel gating, observed clinically in response to ciguatera poisoning
International Nuclear Information System (INIS)
Tripathi Shweta
2014-01-01
An analytical model for the channel potential and the threshold voltage of the short channel dual-material-gate lightly doped drain (DMG-LDD) metal—oxide—semiconductor field-effect transistor (MOSFET) is presented using the parabolic approximation method. The proposed model takes into account the effects of the LDD region length, the LDD region doping, the lengths of the gate materials and their respective work functions, along with all the major geometrical parameters of the MOSFET. The impact of the LDD region length, the LDD region doping, and the channel length on the channel potential is studied in detail. Furthermore, the threshold voltage of the device is calculated using the minimum middle channel potential, and the result obtained is compared with the DMG MOSFET threshold voltage to show the improvement in the threshold voltage roll-off. It is shown that the DMG-LDD MOSFET structure alleviates the problem of short channel effects (SCEs) and the drain induced barrier lowering (DIBL) more efficiently. The proposed model is verified by comparing the theoretical results with the simulated data obtained by using the commercially available ATLAS™ 2D device simulator. (interdisciplinary physics and related areas of science and technology)
Shweta, Tripathi
2014-11-01
An analytical model for the channel potential and the threshold voltage of the short channel dual-material-gate lightly doped drain (DMG-LDD) metal—oxide—semiconductor field-effect transistor (MOSFET) is presented using the parabolic approximation method. The proposed model takes into account the effects of the LDD region length, the LDD region doping, the lengths of the gate materials and their respective work functions, along with all the major geometrical parameters of the MOSFET. The impact of the LDD region length, the LDD region doping, and the channel length on the channel potential is studied in detail. Furthermore, the threshold voltage of the device is calculated using the minimum middle channel potential, and the result obtained is compared with the DMG MOSFET threshold voltage to show the improvement in the threshold voltage roll-off. It is shown that the DMG-LDD MOSFET structure alleviates the problem of short channel effects (SCEs) and the drain induced barrier lowering (DIBL) more efficiently. The proposed model is verified by comparing the theoretical results with the simulated data obtained by using the commercially available ATLAS™ 2D device simulator.
Hebeisen, Simon; Pires, Nuno; Loureiro, Ana I; Bonifácio, Maria João; Palma, Nuno; Whyment, Andrew; Spanswick, David; Soares-da-Silva, Patrício
2015-02-01
This study aimed at evaluating the effects of eslicarbazepine, carbamazepine (CBZ), oxcarbazepine (OXC) and lacosamide (LCM) on the fast and slow inactivated states of voltage-gated sodium channels (VGSC). The anti-epileptiform activity was evaluated in mouse isolated hippocampal slices. The anticonvulsant effects were evaluated in MES and the 6-Hz psychomotor tests. The whole-cell patch-clamp technique was used to investigate the effects of eslicarbazepine, CBZ, OXC and LCM on sodium channels endogenously expressed in N1E-115 mouse neuroblastoma cells. CBZ and eslicarbazepine exhibit similar concentration dependent suppression of epileptiform activity in hippocampal slices. In N1E-115 mouse neuroblastoma cells, at a concentration of 250 μM, the voltage dependence of the fast inactivation was not influenced by eslicarbazepine, whereas LCM, CBZ and OXC shifted the V0.5 value (mV) by -4.8, -12.0 and -16.6, respectively. Eslicarbazepine- and LCM-treated fast-inactivated channels recovered similarly to control conditions, whereas CBZ- and OXC-treated channels required longer pulses to recover. CBZ, eslicarbazepine and LCM shifted the voltage dependence of the slow inactivation (V0.5, mV) by -4.6, -31.2 and -53.3, respectively. For eslicarbazepine, LCM, CBZ and OXC, the affinity to the slow inactivated state was 5.9, 10.4, 1.7 and 1.8 times higher than to the channels in the resting state, respectively. In conclusion, eslicarbazepine did not share with CBZ and OXC the ability to alter fast inactivation of VGSC. Both eslicarbazepine and LCM reduce VGSC availability through enhancement of slow inactivation, but LCM demonstrated higher interaction with VGSC in the resting state and with fast inactivation gating. Copyright © 2014 Elsevier Ltd. All rights reserved.
Hydrogen bonds as molecular timers for slow inactivation in voltage-gated potassium channels
DEFF Research Database (Denmark)
Pless, Stephan Alexander; Galpin, Jason D; Niciforovic, Ana P
2013-01-01
Voltage-gated potassium (Kv) channels enable potassium efflux and membrane repolarization in excitable tissues. Many Kv channels undergo a progressive loss of ion conductance in the presence of a prolonged voltage stimulus, termed slow inactivation, but the atomic determinants that regulate the k...... subunit(s). DOI: http://dx.doi.org/10.7554/eLife.01289.001....
Directory of Open Access Journals (Sweden)
Céline M Bourdin
Full Text Available Insect voltage-gated sodium (Nav channels are formed by a well-known pore-forming α-subunit encoded by para-like gene and ancillary subunits related to TipE from the mutation "temperature-induced-paralysis locus E." The role of these ancillary subunits in the modulation of biophysical and pharmacological properties of Na(+ currents are not enough documented. The unique neuronal ancillary subunit TipE-homologous protein 1 of Drosophila melanogaster (DmTEH1 strongly enhances the expression of insect Nav channels when heterologously expressed in Xenopus oocytes. Here we report the cloning and functional expression of two neuronal DmTEH1-homologs of the cockroach, Periplaneta americana, PaTEH1A and PaTEH1B, encoded by a single bicistronic gene. In PaTEH1B, the second exon encoding the last 11-amino-acid residues of PaTEH1A is shifted to 3'UTR by the retention of a 96-bp intron-containing coding-message, thus generating a new C-terminal end. We investigated the gating and pharmacological properties of the Drosophila Nav channel variant (DmNav1-1 co-expressed with DmTEH1, PaTEH1A, PaTEH1B or a truncated mutant PaTEH1Δ(270-280 in Xenopus oocytes. PaTEH1B caused a 2.2-fold current density decrease, concomitant with an equivalent α-subunit incorporation decrease in the plasma membrane, compared to PaTEH1A and PaTEH1Δ(270-280. PaTEH1B positively shifted the voltage-dependences of activation and slow inactivation of DmNav1-1 channels to more positive potentials compared to PaTEH1A, suggesting that the C-terminal end of both proteins may influence the function of the voltage-sensor and the pore of Nav channel. Interestingly, our findings showed that the sensitivity of DmNav1-1 channels to lidocaine and to the pyrazoline-type insecticide metabolite DCJW depends on associated TEH1-like subunits. In conclusion, our work demonstrates for the first time that density, gating and pharmacological properties of Nav channels expressed in Xenopus oocytes can be
International Nuclear Information System (INIS)
Dargent, B.; Couraud, F.
1990-01-01
To address the issue of whether regulatory feedback exists between the electrical activity of a neuron and ion-channel density, the authors investigated the effect of Na + -channel activators (scorpion α toxin, batrachotoxin, and veratridine) on the density of Na + channels in fetal rat brain neurons in vitro. A partial but rapid (t 1/2 , 15 min) disappearance of surface Na + channels was observed as measured by a decrease in the specific binding of [ 3 H]saxitoxin and 125 I-labeled scorpion β toxin and a decrease in specific 22 Na + uptake. Moreover, the increase in the number of Na + channels that normally occurs during neuronal maturation in vitro was inhibited by chronic channel activator treatment. The induced disappearance of Na + channels was abolished by tetrodotoxin, was found to be dependent on the external Na + concentration, and was prevented when either choline (a nonpermeant ion) or Li + (a permeant ion) was substituted for Na + . Amphotericin B, a Na + ionophore, and monensin were able to mimick the effect of Na + -channel activators, while a KCl depolarization failed to do this. This feedback regulation seems to be a neuronal property since Na + -channel density in cultured astrocytes was not affected by channel activator treatment or by amphotericin B. The present evidence suggests that an increase in intracellular Na + concentration, whether elicited by Na + -channel activators or mediated by a Na + ionophore, can induce a decrease in surface Na + channels and therefore is involved in down-regulation of Na + -channel density in fetal rat brain neurons in vitro
Sterol Regulation of Voltage-Gated K+ Channels.
Balajthy, Andras; Hajdu, Peter; Panyi, Gyorgy; Varga, Zoltan
2017-01-01
Cholesterol is an essential lipid building block of the cellular plasma membrane. In addition to its structural role, it regulates the fluidity and raft structure of the membrane and influences the course of numerous membrane-linked signaling pathways and the function of transmembrane proteins, including ion channels. This is supported by a vast body of scientific data, which demonstrates the modulation of ion channels with a great variety of ion selectivity, gating, and tissue distribution by changes in membrane cholesterol. Here, we review what is currently known about the modulation of voltage-gated K + (Kv) channels by changes in membrane cholesterol content, considering raft association of the channels, the roles of cholesterol recognition sites, and those of adaptor proteins in cholesterol-Kv channel interactions. We specifically focus on Kv1.3, the dominant K + channel of human T cells. Effects of cholesterol depletion and enrichment and 7-dehydrocholesterol enrichment on Kv1.3 gating are discussed in the context of the immunological synapse and the comparison of the in vitro effects of sterol modifications on Kv1.3 function with ex vivo effects on cells from hypercholesterolemic and Smith-Lemli-Opitz patients. © 2017 Elsevier Inc. All rights reserved.
Tan, Peter S; Perry, Matthew D; Ng, Chai Ann; Vandenberg, Jamie I; Hill, Adam P
2012-09-01
Human ether-a-go-go-related gene (hERG) potassium channels exhibit unique gating kinetics characterized by unusually slow activation and deactivation. The N terminus of the channel, which contains an amphipathic helix and an unstructured tail, has been shown to be involved in regulation of this slow deactivation. However, the mechanism of how this occurs and the connection between voltage-sensing domain (VSD) return and closing of the gate are unclear. To examine this relationship, we have used voltage-clamp fluorometry to simultaneously measure VSD motion and gate closure in N-terminally truncated constructs. We report that mode shifting of the hERG VSD results in a corresponding shift in the voltage-dependent equilibrium of channel closing and that at negative potentials, coupling of the mode-shifted VSD to the gate defines the rate of channel closure. Deletion of the first 25 aa from the N terminus of hERG does not alter mode shifting of the VSD but uncouples the shift from closure of the cytoplasmic gate. Based on these observations, we propose the N-terminal tail as an adaptor that couples voltage sensor return to gate closure to define slow deactivation gating in hERG channels. Furthermore, because the mode shift occurs on a time scale relevant to the cardiac action potential, we suggest a physiological role for this phenomenon in maximizing current flow through hERG channels during repolarization.
Lieb, Andreas; Ortner, Nadine; Striessnig, Jörg
2014-04-01
Activity of voltage-gated Cav1.3 L-type Ca(2+) channels is required for proper hearing as well as sinoatrial node and brain function. This critically depends on their negative activation voltage range, which is further fine-tuned by alternative splicing. Shorter variants miss a C-terminal regulatory domain (CTM), which allows them to activate at even more negative potentials than C-terminally long-splice variants. It is at present unclear whether this is due to an increased voltage sensitivity of the Cav1.3 voltage-sensing domain, or an enhanced coupling of voltage-sensor conformational changes to the subsequent opening of the activation gate. We studied the voltage-dependence of voltage-sensor charge movement (QON-V) and of current activation (ICa-V) of the long (Cav1.3L) and a short Cav1.3 splice variant (Cav1.342A) expressed in tsA-201 cells using whole cell patch-clamp. Charge movement (QON) of Cav1.3L displayed a much steeper voltage-dependence and a more negative half-maximal activation voltage than Cav1.2 and Cav3.1. However, a significantly higher fraction of the total charge had to move for activation of Cav1.3 half-maximal conductance (Cav1.3: 68%; Cav1.2: 52%; Cav3.1: 22%). This indicated a weaker coupling of Cav1.3 voltage-sensor charge movement to pore opening. However, the coupling efficiency was strengthened in the absence of the CTM in Cav1.342A, thereby shifting ICa-V by 7.2 mV to potentials that were more negative without changing QON-V. We independently show that the presence of intracellular organic cations (such as n-methyl-D-glucamine) induces a pronounced negative shift of QON-V and a more negative activation of ICa-V of all three channels. These findings illustrate that the voltage sensors of Cav1.3 channels respond more sensitively to depolarization than those of Cav1.2 or Cav3.1. Weak coupling of voltage sensing to pore opening is enhanced in the absence of the CTM, allowing short Cav1.342A splice variants to activate at lower voltages
Distribution and function of voltage-gated sodium channels in the nervous system.
Wang, Jun; Ou, Shao-Wu; Wang, Yun-Jie
2017-11-02
Voltage-gated sodium channels (VGSCs) are the basic ion channels for neuronal excitability, which are crucial for the resting potential and the generation and propagation of action potentials in neurons. To date, at least nine distinct sodium channel isoforms have been detected in the nervous system. Recent studies have identified that voltage-gated sodium channels not only play an essential role in the normal electrophysiological activities of neurons but also have a close relationship with neurological diseases. In this study, the latest research findings regarding the structure, type, distribution, and function of VGSCs in the nervous system and their relationship to neurological diseases, such as epilepsy, neuropathic pain, brain tumors, neural trauma, and multiple sclerosis, are reviewed in detail.
A localized interaction surface for voltage-sensing domains on the pore domain of a K+ channel.
Li-Smerin, Y; Hackos, D H; Swartz, K J
2000-02-01
Voltage-gated K+ channels contain a central pore domain and four surrounding voltage-sensing domains. How and where changes in the structure of the voltage-sensing domains couple to the pore domain so as to gate ion conduction is not understood. The crystal structure of KcsA, a bacterial K+ channel homologous to the pore domain of voltage-gated K+ channels, provides a starting point for addressing this question. Guided by this structure, we used tryptophan-scanning mutagenesis on the transmembrane shell of the pore domain in the Shaker voltage-gated K+ channel to localize potential protein-protein and protein-lipid interfaces. Some mutants cause only minor changes in gating and when mapped onto the KcsA structure cluster away from the interface between pore domain subunits. In contrast, mutants producing large changes in gating tend to cluster near this interface. These results imply that voltage-sensing domains interact with localized regions near the interface between adjacent pore domain subunits.
Shaping charge excitations in chiral edge states with a time-dependent gate voltage
Misiorny, Maciej; Fève, Gwendal; Splettstoesser, Janine
2018-02-01
We study a coherent conductor supporting a single edge channel in which alternating current pulses are created by local time-dependent gating and sent on a beam-splitter realized by a quantum point contact. The current response to the gate voltage in this setup is intrinsically linear. Based on a fully self-consistent treatment employing a Floquet scattering theory, we analyze the effect of different voltage shapes and frequencies, as well as the role of the gate geometry on the injected signal. In particular, we highlight the impact of frequency-dependent screening on the process of shaping the current signal. The feasibility of creating true single-particle excitations with this method is confirmed by investigating the suppression of excess noise, which is otherwise created by additional electron-hole pair excitations in the current signal.
Molecular determinants of voltage-gated sodium channel regulation by the Nedd4/Nedd4-like proteins
DEFF Research Database (Denmark)
Rougier, Jean-Sébastien; van Bemmelen, Miguel X; Bruce, M Christine
2004-01-01
-ubiquitin ligases of the Nedd4 family. We recently reported that cardiac Na(v)1.5 is regulated by Nedd4-2. In this study, we further investigated the molecular determinants of regulation of Na(v) proteins. When expressed in HEK-293 cells and studied using whole cell voltage clamping, the neuronal Na(v)1.2 and Na...... that Nedd4-dependent ubiquitination of Na(v) channels may represent a general mechanism regulating the excitability of neurons and myocytes via modulation of channel density at the plasma membrane....
Functionalized Fullerene Targeting Human Voltage-Gated Sodium Channel, hNav1.7.
Hilder, Tamsyn A; Robinson, Anna; Chung, Shin-Ho
2017-08-16
Mutations of hNa v 1.7 that cause its activities to be enhanced contribute to severe neuropathic pain. Only a small number of hNa v 1.7 specific inhibitors have been identified, most of which interact with the voltage-sensing domain of the voltage-activated sodium ion channel. In our previous computational study, we demonstrated that a [Lys 6 ]-C 84 fullerene binds tightly (affinity of 46 nM) to Na v Ab, the voltage-gated sodium channel from the bacterium Arcobacter butzleri. Here, we extend this work and, using molecular dynamics simulations, demonstrate that the same [Lys 6 ]-C 84 fullerene binds strongly (2.7 nM) to the pore of a modeled human sodium ion channel hNa v 1.7. In contrast, the fullerene binds only weakly to a mutated model of hNa v 1.7 (I1399D) (14.5 mM) and a model of the skeletal muscle hNa v 1.4 (3.7 mM). Comparison of one representative sequence from each of the nine human sodium channel isoforms shows that only hNa v 1.7 possesses residues that are critical for binding the fullerene derivative and blocking the channel pore.
SGK3 Sensitivity of Voltage Gated K+ Channel Kv1.5 (KCNA5
Directory of Open Access Journals (Sweden)
Musaab Ahmed
2016-01-01
Full Text Available Background: The serum & glucocorticoid inducible kinase isoform SGK3 is a powerful regulator of several transporters, ion channels and the Na+/K+ ATPase. Targets of SGK3 include the ubiquitin ligase Nedd4-2, which is in turn a known regulator of the voltage gated K+ channel Kv1.5 (KCNA5. The present study thus explored whether SGK3 modifies the activity of the voltage gated K+ channel KCNA5, which participates in the regulation of diverse functions including atrial cardiac action potential, activity of vascular smooth muscle cells, insulin release and tumour cell proliferation. Methods: cRNA encoding KCNA5 was injected into Xenopus oocytes with and without additional injection of cRNA encoding wild-type SGK3, constitutively active S419DSGK3, inactive K191NSGK3 and/or wild type Nedd4-2. Voltage gated K+ channel activity was quantified utilizing dual electrode voltage clamp. Results: Voltage gated current in KCNA5 expressing Xenopus oocytes was significantly enhanced by wild-type SGK3 and S419DSGK3, but not by K191NSGK3. SGK3 was effective in the presence of ouabain (1 mM and thus did not require Na+/K+ ATPase activity. Coexpression of Nedd4-2 decreased the voltage gated current in KCNA5 expressing Xenopus oocytes, an effect largely reversed by additional coexpression of SGK3. Conclusion: SGK3 is a positive regulator of KCNA5, which is at least partially effective by abrogating the effect of Nedd4-2.
Directory of Open Access Journals (Sweden)
Frank S Choveau
2012-07-01
Full Text Available Voltage-gated potassium (Kv channels are tetramers, each subunit presenting six transmembrane segments (S1-S6, with each S1-S4 segments forming a voltage-sensing domain (VSD and the four S5-S6 forming both the conduction pathway and its gate. S4 segments control the opening of the intracellular activation gate in response to changes in membrane potential. Crystal structures of several voltage-gated ion channels in combination with biophysical and mutagenesis studies highlighted the critical role of the S4-S5 linker (S4S5L and of the S6 C-terminal part (S6T in the coupling between the VSD and the activation gate. Several mechanisms have been proposed to describe the coupling at a molecular scale. This review summarizes the mechanisms suggested for various voltage-gated ion channels, including a mechanism that we described for KCNQ1, in which S4S5L is acting like a ligand binding to S6T to stabilize the channel in a closed state. As discussed in this review, this mechanism may explain the reverse response to depolarization in HCN-like channels. As opposed to S4S5L, the phosphoinositide, phosphatidylinositol 4,5-bisphosphate (PIP2, stabilizes KCNQ1 channel in an open state. Many other ion channels (not only voltage-gated require PIP2 to function properly, confirming its crucial importance as an ion channel co-factor. This is highlighted in cases in which an altered regulation of ion channels by PIP2 leads to channelopathies, as observed for KCNQ1. This review summarizes the state of the art on the two regulatory mechanisms that are critical for KCNQ1 and other voltage-gated channels function (PIP2 and S4-S5L, and assesses their potential physiological and pathophysiological roles.
Directory of Open Access Journals (Sweden)
Marianna F Tomasello
Full Text Available Voltage-Dependent Anion selective Channel maintains the permeability of the outer mitochondrial membrane and is relevant in bioenergetic metabolism and apoptosis. The structure of the protein was shown to be a β-barrel formed by 19 strands. The topology or sideness of the pore has been predicted with various approaches but a general consensus was never reached. This is an important issue since VDAC is considered receptor of Hexokinase and Bcl-2. We fused at VDAC1 C-terminus two tags separated by a caspase cleavage site. Activation in cellulo of caspases was used to eventually separate the two reporters. This experiment did not require the isolation of mitochondria and limited the possibility of outer membrane rupture due to similar procedures. Our results show that the C-terminus end of VDAC faces the mitochondrial inter-membrane space.
Structure of a eukaryotic voltage-gated sodium channel at near-atomic resolution.
Shen, Huaizong; Zhou, Qiang; Pan, Xiaojing; Li, Zhangqiang; Wu, Jianping; Yan, Nieng
2017-03-03
Voltage-gated sodium (Na v ) channels are responsible for the initiation and propagation of action potentials. They are associated with a variety of channelopathies and are targeted by multiple pharmaceutical drugs and natural toxins. Here, we report the cryogenic electron microscopy structure of a putative Na v channel from American cockroach (designated Na v PaS) at 3.8 angstrom resolution. The voltage-sensing domains (VSDs) of the four repeats exhibit distinct conformations. The entrance to the asymmetric selectivity filter vestibule is guarded by heavily glycosylated and disulfide bond-stabilized extracellular loops. On the cytoplasmic side, a conserved amino-terminal domain is placed below VSD I , and a carboxy-terminal domain binds to the III-IV linker. The structure of Na v PaS establishes an important foundation for understanding function and disease mechanism of Na v and related voltage-gated calcium channels. Copyright © 2017, American Association for the Advancement of Science.
Ketabi, N; Mobasheri, H; Faraji-Dana, R
2015-03-01
The effects of ultra high frequency (UHF) nonionizing electromagnetic fields (EMF) on the channel activities of nanopore forming protein, OmpF porin, were investigated. The voltage clamp technique was used to study the single channel activity of the pore in an artificial bilayer in the presence and absence of the electromagnetic fields at 910 to 990 MHz in real time. Channel activity patterns were used to address the effect of EMF on the dynamic, arrangement and dielectric properties of water molecules, as well as on the hydration state and arrangements of side chains lining the channel barrel. Based on the varied voltage sensitivity of the channel at different temperatures in the presence and absence of EMF, the amount of energy transferred to nano-environments of accessible groups was estimated to address the possible thermal effects of EMF. Our results show that the effects of EMF on channel activities are frequency dependent, with a maximum effect at 930 MHz. The frequency of channel gating and the voltage sensitivity is increased when the channel is exposed to EMF, while its conductance remains unchanged at all frequencies applied. We have not identified any changes in the capacitance and permeability of membrane in the presence of EMF. The effect of the EMF irradiated by cell phones is measured by Specific Absorption Rate (SAR) in artificial model of human head, Phantom. Thus, current approach applied to biological molecules and electrolytes might be considered as complement to evaluate safety of irradiating sources on biological matter at molecular level.
Glycosylation of voltage-gated calcium channels in health and disease
Czech Academy of Sciences Publication Activity Database
Lazniewska, Joanna; Weiss, Norbert
2017-01-01
Roč. 1859, č. 5 (2017), s. 662-668 ISSN 0005-2736 R&D Projects: GA ČR GA15-13556S; GA MŠk 7AMB15FR015 Institutional support: RVO:61388963 Keywords : calcium channels * voltage-gated calcium channels * N-glycosylation * ancillary subunit * trafficking * stability Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 3.498, year: 2016
Zhang, M; Liu, J; Jiang, M; Wu, D-M; Sonawane, K; Guy, H R; Tseng, G-N
2005-10-01
Studies on voltage-gated K channels such as Shaker have shown that positive charges in the voltage-sensor (S4) can form salt bridges with negative charges in the surrounding transmembrane segments in a state-dependent manner, and different charge pairings can stabilize the channels in closed or open states. The goal of this study is to identify such charge interactions in the hERG channel. This knowledge can provide constraints on the spatial relationship among transmembrane segments in the channel's voltage-sensing domain, which are necessary for modeling its structure. We first study the effects of reversing S4's positive charges on channel activation. Reversing positive charges at the outer (K525D) and inner (K538D) ends of S4 markedly accelerates hERG activation, whereas reversing the 4 positive charges in between either has no effect or slows activation. We then use the 'mutant cycle analysis' to test whether D456 (outer end of S2) and D411 (inner end of S1) can pair with K525 and K538, respectively. Other positive charges predicted to be able, or unable, to interact with D456 or D411 are also included in the analysis. The results are consistent with predictions based on the distribution of these charged residues, and confirm that there is functional coupling between D456 and K525 and between D411 and K538.
Functional Importance of L- and P/Q-Type Voltage-Gated Calcium Channels in Human Renal Vasculature
DEFF Research Database (Denmark)
Hansen, Pernille B; Poulsen, Christian B; Walter, Steen
2011-01-01
Calcium channel blockers are widely used for treatment of hypertension, because they decrease peripheral vascular resistance through inhibition of voltage-gated calcium channels. Animal studies of renal vasculature have shown expression of several types of calcium channels that are involved......-type subtype (Ca(v) 3.1 and Ca(v) 3.2) voltage-gated calcium channels (Ca(v)s), and quantitative PCR showed highest expression of L-type channels in renal arteries and variable expression between patients of subtypes of calcium channels in intrarenal vessels. Immunohistochemical labeling of kidney sections...
Voltage-gated calcium channels of Paramecium cilia.
Lodh, Sukanya; Yano, Junji; Valentine, Megan S; Van Houten, Judith L
2016-10-01
Paramecium cells swim by beating their cilia, and make turns by transiently reversing their power stroke. Reversal is caused by Ca 2+ entering the cilium through voltage-gated Ca 2+ (Ca V ) channels that are found exclusively in the cilia. As ciliary Ca 2+ levels return to normal, the cell pivots and swims forward in a new direction. Thus, the activation of the Ca V channels causes cells to make a turn in their swimming paths. For 45 years, the physiological characteristics of the Paramecium ciliary Ca V channels have been known, but the proteins were not identified until recently, when the P. tetraurelia ciliary membrane proteome was determined. Three Ca V α1 subunits that were identified among the proteins were cloned and confirmed to be expressed in the cilia. We demonstrate using RNA interference that these channels function as the ciliary Ca V channels that are responsible for the reversal of ciliary beating. Furthermore, we show that Pawn (pw) mutants of Paramecium that cannot swim backward for lack of Ca V channel activity do not express any of the three Ca V 1 channels in their ciliary membrane, until they are rescued from the mutant phenotype by expression of the wild-type PW gene. These results reinforce the correlation of the three Ca V channels with backward swimming through ciliary reversal. The PwB protein, found in endoplasmic reticulum fractions, co-immunoprecipitates with the Ca V 1c channel and perhaps functions in trafficking. The PwA protein does not appear to have an interaction with the channel proteins but affects their appearance in the cilia. © 2016. Published by The Company of Biologists Ltd.
DEFF Research Database (Denmark)
Grunnet, Morten; Kaufmann, Walter A
2004-01-01
Based on electrophysiological studies, Ca(2+)-activated K(+) channels and voltage-gated Ca(2+) channels appear to be located in close proximity in neurons. Such colocalization would ensure selective and rapid activation of K(+) channels by local increases in the cytosolic calcium concentration...
International Nuclear Information System (INIS)
Chacko, Alex D; Liberante, Fabio; Paul, Ian; Longley, Daniel B; Fennell, Dean A
2010-01-01
Activation of the extrinsic apoptosis pathway by tumour necrosis factor related apoptosis inducing ligand (TRAIL) is a novel therapeutic strategy for treating cancer that is currently under clinical evaluation. Identification of molecular biomarkers of resistance is likely to play an important role in predicting clinical anti tumour activity. The involvement of the mitochondrial type 1 voltage dependent anion channel (VDAC1) in regulating apoptosis has been highly debated. To date, a functional role in regulating the extrinsic apoptosis pathway has not been formally excluded. We carried out stable and transient RNAi knockdowns of VDAC1 in non-small cell lung cancer cells, and stimulated the extrinsic apoptotic pathway principally by incubating cells with the death ligand TRAIL. We used in-vitro apoptotic and cell viability assays, as well as western blot for markers of apoptosis, to demonstrate that TRAIL-induced toxicity is VDAC1 dependant. Confocal microscopy and mitochondrial fractionation were used to determine the importance of mitochondria for caspase-8 activation. Here we show that either stable or transient knockdown of VDAC1 is sufficient to antagonize TRAIL mediated apoptosis in non-small cell lung cancer (NSCLC) cells. Specifically, VDAC1 is required for processing of procaspase-8 to its fully active p18 form at the mitochondria. Loss of VDAC1 does not alter mitochondrial sensitivity to exogenous caspase-8-cleaved BID induced mitochondrial depolarization, even though VDAC1 expression is essential for TRAIL dependent activation of the intrinsic apoptosis pathway. Furthermore, expression of exogenous VDAC1 restores the apoptotic response to TRAIL in cells in which endogenous VDAC1 has been selectively silenced. Expression of VDAC1 is required for full processing and activation of caspase-8 and supports a role for mitochondria in regulating apoptosis signaling via the death receptor pathway
Twenty-channel high-voltage pulse generators
International Nuclear Information System (INIS)
Anan'in, P.S.; Kashirin, A.P.
1980-01-01
A 20-channel high-voltage pulse generator operating with a mismatched load is described. The generator contains shaping lines 20 m long made of coaxial cable, a trigatron-type discharged, and isolating plates. The channel characteristic impedance is 50 Ohm. The maximum pulse amplitude is up to 15 kV on a high-resistance load and 7.5 kV on a matched one. The pulse duration is 100 ns at a pulse rise time of 12 ns, the delay introduced by the generator is 200 +-2.5 ns. Provision is made in the control circuit for compensation of the shaped pulse and separation of a pulse reflected from the load. The reflected pulse shape and amplitude characterize load parameters. Generator tests proved its high operational reliability (after 10 5 operations no significant changes in generator performances have been observed). The generator is intended for filmless data output from spark chambers
A common pathway for charge transport through voltage-sensing domains.
Chanda, Baron; Bezanilla, Francisco
2008-02-07
Voltage-gated ion channels derive their voltage sensitivity from the movement of specific charged residues in response to a change in transmembrane potential. Several studies on mechanisms of voltage sensing in ion channels support the idea that these gating charges move through a well-defined permeation pathway. This gating pathway in a voltage-gated ion channel can also be mutated to transport free cations, including protons. The recent discovery of proton channels with sequence homology to the voltage-sensing domains suggests that evolution has perhaps exploited the same gating pathway to generate a bona fide voltage-dependent proton transporter. Here we will discuss implications of these findings on the mechanisms underlying charge (and ion) transport by voltage-sensing domains.
The voltage-gated potassium channel subunit, Kv1.3, is expressed in epithelia
DEFF Research Database (Denmark)
Grunnet, Morten; Rasmussen, Hanne B; Hay-Schmidt, Anders
2003-01-01
The Shaker-type voltage-gated potassium channel, Kv1.3, is believed to be restricted in distribution to lymphocytes and neurons. In lymphocytes, this channel has gained intense attention since it has been proven that inhibition of Kv1.3 channels compromise T lymphocyte activation. To investigate...
Marine Toxins That Target Voltage-gated Sodium Channels
Directory of Open Access Journals (Sweden)
Robert J. French
2006-04-01
Full Text Available Abstract: Eukaryotic, voltage-gated sodium (NaV channels are large membrane proteins which underlie generation and propagation of rapid electrical signals in nerve, muscle and heart. Nine different NaV receptor sites, for natural ligands and/or drugs, have been identified, based on functional analyses and site-directed mutagenesis. In the marine ecosystem, numerous toxins have evolved to disrupt NaV channel function, either by inhibition of current flow through the channels, or by modifying the activation and inactivation gating processes by which the channels open and close. These toxins function in their native environment as offensive or defensive weapons in prey capture or deterrence of predators. In composition, they range from organic molecules of varying size and complexity to peptides consisting of ~10-70 amino acids. We review the variety of known NaV-targeted marine toxins, outlining, where known, their sites of interaction with the channel protein and their functional effects. In a number of cases, these natural ligands have the potential applications as drugs in clinical settings, or as models for drug development.
Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas
2008-06-25
Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.
Induced voltage due to time-dependent magnetisation textures
International Nuclear Information System (INIS)
Kudtarkar, Santosh Kumar; Dhadwal, Renu
2010-01-01
We determine the induced voltage generated by spatial and temporal magnetisation textures (inhomogeneities) in metallic ferromagnets due to the spin diffusion of non-equilibrium electrons. Using time dependent semi-classical theory as formulated in Zhang and Li and the drift-diffusion model of transport it is shown that the voltage generated depends critically on the difference in the diffusion constants of up and down spins. Including spin relaxation results in a crucial contribution to the induced voltage. We also show that the presence of magnetisation textures results in the modification of the conductivity of the system. As an illustration, we calculate the voltage generated due to a time dependent field driven helimagnet by solving the Landau-Lifshitz equation with Gilbert damping and explicitly calculate the dependence on the relaxation and damping parameters.
Mapping the membrane-aqueous border for the voltage-sensing domain of a potassium channel.
Neale, Edward J; Rong, Honglin; Cockcroft, Christopher J; Sivaprasadarao, Asipu
2007-12-28
Voltage-sensing domains (VSDs) play diverse roles in biology. As integral components, they can detect changes in the membrane potential of a cell and couple these changes to activity of ion channels and enzymes. As independent proteins, homologues of the VSD can function as voltage-dependent proton channels. To sense voltage changes, the positively charged fourth transmembrane segment, S4, must move across the energetically unfavorable hydrophobic core of the bilayer, which presents a barrier to movement of both charged species and protons. To reduce the barrier to S4 movement, it has been suggested that aqueous crevices may penetrate the protein, reducing the extent of total movement. To investigate this hypothesis in a system containing fully functional channels in a native environment with an intact membrane potential, we have determined the contour of the membrane-aqueous border of the VSD of KvAP in Escherichia coli by examining the chemical accessibility of introduced cysteines. The results revealed the contour of the membrane-aqueous border of the VSD in its activated conformation. The water-inaccessible regions of S1 and S2 correspond to the standard width of the membrane bilayer (~28 A), but those of S3 and S4 are considerably shorter (> or = 40%), consistent with aqueous crevices pervading both the extracellular and intracellular ends. One face of S3b and the entire S3a were water-accessible, reducing the water-inaccessible region of S3 to just 10 residues, significantly shorter than for S4. The results suggest a key role for S3 in reducing the distance S4 needs to move to elicit gating.
Sesti, Federico; Rajan, Sindhu; Gonzalez-Colaso, Rosana; Nikolaeva, Natalia; Goldstein, Steve A N
2003-04-01
MVP, a Methanococcus jannaschii voltage-gated potassium channel, was cloned and shown to operate in eukaryotic and prokaryotic cells. Like pacemaker channels, MVP opens on hyperpolarization using S4 voltage sensors like those in classical channels activated by depolarization. The MVP S4 span resembles classical sensors in sequence, charge, topology and movement, traveling inward on hyperpolarization and outward on depolarization (via canaliculi in the protein that bring the extracellular and internal solutions into proximity across a short barrier). Thus, MVP opens with sensors inward indicating a reversal of S4 position and pore state compared to classical channels. Homologous channels in mammals and plants are expected to function similarly.
Structure-based assessment of disease-related mutations in human voltage-gated sodium channels
Directory of Open Access Journals (Sweden)
Weiyun Huang
2017-02-01
Full Text Available ABSTRACT Voltage-gated sodium (Nav channels are essential for the rapid upstroke of action potentials and the propagation of electrical signals in nerves and muscles. Defects of Nav channels are associated with a variety of channelopathies. More than 1000 disease-related mutations have been identified in Nav channels, with Nav1.1 and Nav1.5 each harboring more than 400 mutations. Nav channels represent major targets for a wide array of neurotoxins and drugs. Atomic structures of Nav channels are required to understand their function and disease mechanisms. The recently determined atomic structure of the rabbit voltage-gated calcium (Cav channel Cav1.1 provides a template for homology-based structural modeling of the evolutionarily related Nav channels. In this Resource article, we summarized all the reported disease-related mutations in human Nav channels, generated a homologous model of human Nav1.7, and structurally mapped disease-associated mutations. Before the determination of structures of human Nav channels, the analysis presented here serves as the base framework for mechanistic investigation of Nav channelopathies and for potential structure-based drug discovery.
Structure-based assessment of disease-related mutations in human voltage-gated sodium channels.
Huang, Weiyun; Liu, Minhao; Yan, S Frank; Yan, Nieng
2017-06-01
Voltage-gated sodium (Na v ) channels are essential for the rapid upstroke of action potentials and the propagation of electrical signals in nerves and muscles. Defects of Na v channels are associated with a variety of channelopathies. More than 1000 disease-related mutations have been identified in Na v channels, with Na v 1.1 and Na v 1.5 each harboring more than 400 mutations. Na v channels represent major targets for a wide array of neurotoxins and drugs. Atomic structures of Na v channels are required to understand their function and disease mechanisms. The recently determined atomic structure of the rabbit voltage-gated calcium (Ca v ) channel Ca v 1.1 provides a template for homology-based structural modeling of the evolutionarily related Na v channels. In this Resource article, we summarized all the reported disease-related mutations in human Na v channels, generated a homologous model of human Na v 1.7, and structurally mapped disease-associated mutations. Before the determination of structures of human Na v channels, the analysis presented here serves as the base framework for mechanistic investigation of Na v channelopathies and for potential structure-based drug discovery.
Voltage-gated sodium channels as targets for pyrethroid insecticides.
Field, Linda M; Emyr Davies, T G; O'Reilly, Andrias O; Williamson, Martin S; Wallace, B A
2017-10-01
The pyrethroid insecticides are a very successful group of compounds that have been used extensively for the control of arthropod pests of agricultural crops and vectors of animal and human disease. Unfortunately, this has led to the development of resistance to the compounds in many species. The mode of action of pyrethroids is known to be via interactions with the voltage-gated sodium channel. Understanding how binding to the channel is affected by amino acid substitutions that give rise to resistance has helped to elucidate the mode of action of the compounds and the molecular basis of their selectivity for insects vs mammals and between insects and other arthropods. Modelling of the channel/pyrethroid interactions, coupled with the ability to express mutant channels in oocytes and study function, has led to knowledge of both how the channels function and potentially how to design novel insecticides with greater species selectivity.
Single-channel kinetics of BK (Slo1 channels
Directory of Open Access Journals (Sweden)
Yanyan eGeng
2015-01-01
Full Text Available Single-channel kinetics has proven a powerful tool to reveal information about the gating mechanisms that control the opening and closing of ion channels. This introductory review focuses on the gating of large conductance Ca2+- and voltage-activated K+ (BK or Slo1 channels at the single-channel level. It starts with single-channel current records and progresses to presentation and analysis of single-channel data and the development of gating mechanisms in terms of discrete state Markov (DSM models. The DSM models are formulated in terms of the tetrameric modular structure of BK channels, consisting of a central transmembrane pore-gate domain (PGD attached to four surrounding transmembrane voltage sensing domains (VSD and a large intracellular cytosolic domain (CTD, also referred to as the gating ring. The modular structure and data analysis shows that the Ca2+ and voltage dependent gating considered separately can each be approximated by 10-state two-tiered models with 5 closed states on the upper tier and 5 open states on the lower tier. The modular structure and joint Ca2+ and voltage dependent gating are consistent with a 50 state two-tiered model with 25 closed states on the upper tier and 25 open states on the lower tier. Adding an additional tier of brief closed (flicker states to the 10-state or 50-state models improved the description of the gating. For fixed experimental conditions a channel would gate in only a subset of the potential number of states. The detected number of states and the correlations between adjacent interval durations are consistent with the tiered models. The examined models can account for the single-channel kinetics and the bursting behavior of gating. Ca2+ and voltage activate BK channels by predominantly increasing the effective opening rate of the channel with a smaller decrease in the effective closing rate. Ca2+ and depolarization thus activate by mainly destabilizing the closed states.
A novel tarantula toxin stabilizes the deactivated voltage sensor of bacterial sodium channel.
Tang, Cheng; Zhou, Xi; Nguyen, Phuong Tran; Zhang, Yunxiao; Hu, Zhaotun; Zhang, Changxin; Yarov-Yarovoy, Vladimir; DeCaen, Paul G; Liang, Songping; Liu, Zhonghua
2017-07-01
Voltage-gated sodium channels (Na V s) are activated by transiting the voltage sensor from the deactivated to the activated state. The crystal structures of several bacterial Na V s have captured the voltage sensor module (VSM) in an activated state, but structure of the deactivated voltage sensor remains elusive. In this study, we sought to identify peptide toxins stabilizing the deactivated VSM of bacterial Na V s. We screened fractions from several venoms and characterized a cystine knot toxin called JZTx-27 from the venom of tarantula Chilobrachys jingzhao as a high-affinity antagonist of the prokaryotic Na V s Ns V Ba (nonselective voltage-gated Bacillus alcalophilus ) and NaChBac (bacterial sodium channel from Bacillus halodurans ) (IC 50 = 112 nM and 30 nM, respectively). JZTx-27 was more efficacious at weaker depolarizing voltages and significantly slowed the activation but accelerated the deactivation of Ns V Ba, whereas the local anesthetic drug lidocaine was shown to antagonize Ns V Ba without affecting channel gating. Mutation analysis confirmed that JZTx-27 bound to S3-4 linker of Ns V Ba, with F98 being the critical residue in determining toxin affinity. All electrophysiological data and in silico analysis suggested that JZTx-27 trapped VSM of Ns V Ba in one of the deactivated states. In mammalian Na V s, JZTx-27 preferably inhibited the inactivation of Na V 1.5 by targeting the fourth transmembrane domain. To our knowledge, this is the first report of peptide antagonist for prokaryotic Na V s. More important, we proposed that JZTx-27 stabilized the Ns V Ba VSM in the deactivated state and may be used as a probe to determine the structure of the deactivated VSM of Na V s.-Tang, C., Zhou, X., Nguyen, P. T., Zhang, Y., Hu, Z., Zhang, C., Yarov-Yarovoy, V., DeCaen, P. G., Liang, S., Liu, Z. A novel tarantula toxin stabilizes the deactivated voltage sensor of bacterial sodium channel. © FASEB.
Directory of Open Access Journals (Sweden)
Alicia Lundby
2008-06-01
Full Text Available Ci-VSP contains a voltage-sensing domain (VSD homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.
Field angle dependence of voltage-induced ferromagnetic resonance under DC bias voltage
International Nuclear Information System (INIS)
Shiota, Yoichi; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Suzuki, Yoshishige; Yuasa, Shinji
2016-01-01
We studied the rectification function of microwaves in CoFeB/MgO-based magnetic tunnel junctions using voltage-induced ferromagnetic resonance (FMR). Our findings reveal that the shape of the structure of the spectrum depends on the rotation angle of the external magnetic field, providing clear evidence that FMR dynamics are excited by voltage-induced magnetic anisotropy changes. Further, enhancement of the rectified voltage was demonstrated under a DC bias voltage. In our experiments, the highest microwave detection sensitivity obtained was 350 mV/mW, at an RF frequency of 1.0 GHz and field angle of θ_H=80°, ϕ_H=0°. The experimental results correlated with those obtained via simulation, and the calculated results revealed the magnetization dynamics at the resonance state. - Highlights: • Examined voltage-induced ferromagnetic resonance (FMR) under various field angles. • FMR dynamics are excited by voltage-induced magnetic anisotropy changes. • Microwave detection sensitivity depends on input RF and elevation angle. • Microwave detection sensitivity=350 mV/mW at RF=1.0 GHz, θ_H=80°, ϕ_H=0°.
Energy Technology Data Exchange (ETDEWEB)
He, Bingjun [College of Life Sciences, Nankai University, Tianjin 300071 (China); Soderlund, David M., E-mail: dms6@cornell.edu [Department of Entomology, Cornell University, New York State Agricultural Experiment Station, Geneva, NY 14456 (United States)
2011-12-15
We expressed rat Na{sub v}1.6 sodium channels in combination with the rat {beta}1 and {beta}2 auxiliary subunits in human embryonic kidney (HEK293) cells and evaluated the effects of the pyrethroid insecticides tefluthrin and deltamethrin on expressed sodium currents using the whole-cell patch clamp technique. Both pyrethroids produced concentration-dependent, resting modification of Na{sub v}1.6 channels, prolonging the kinetics of channel inactivation and deactivation to produce persistent 'late' currents during depolarization and tail currents following repolarization. Both pyrethroids also produced concentration dependent hyperpolarizing shifts in the voltage dependence of channel activation and steady-state inactivation. Maximal shifts in activation, determined from the voltage dependence of the pyrethroid-induced late and tail currents, were {approx} 25 mV for tefluthrin and {approx} 20 mV for deltamethrin. The highest attainable concentrations of these compounds also caused shifts of {approx} 5-10 mV in the voltage dependence of steady-state inactivation. In addition to their effects on the voltage dependence of inactivation, both compounds caused concentration-dependent increases in the fraction of sodium current that was resistant to inactivation following strong depolarizing prepulses. We assessed the use-dependent effects of tefluthrin and deltamethrin on Na{sub v}1.6 channels by determining the effect of trains of 1 to 100 5-ms depolarizing prepulses at frequencies of 20 or 66.7 Hz on the extent of channel modification. Repetitive depolarization at either frequency increased modification by deltamethrin by {approx} 2.3-fold but had no effect on modification by tefluthrin. Tefluthrin and deltamethrin were equally potent as modifiers of Na{sub v}1.6 channels in HEK293 cells using the conditions producing maximal modification as the basis for comparison. These findings show that the actions of tefluthrin and deltamethrin of Na{sub v}1.6 channels
Pessia, Mauro; Servettini, Ilenio; Panichi, Roberto; Guasti, Leonardo; Grassi, Silvarosa; Arcangeli, Annarosa; Wanke, Enzo; Pettorossi, Vito Enrico
2008-10-15
The discharge properties of the medial vestibular nucleus neurones (MVNn) critically depend on the activity of several ion channel types. In this study we show, immunohistochemically, that the voltage-gated K(+) channels ERG1A, ERG1B, ERG2 and ERG3 are highly expressed within the vestibular nuclei of P10 and P60 mice. The role played by these channels in the spike-generating mechanisms of the MVNn and in temporal information processing was investigated electrophysiologically from mouse brain slices, in vitro, by analysing the spontaneous discharge and the response to square-, ramp- and sinusoid-like intracellular DC current injections in extracellular and whole-cell patch-clamp studies. We show that more than half of the recorded MVNn were responsive to ERG channel block (WAY-123,398, E4031), displaying an increase in spontaneous activity and discharge irregularity. The response to step and ramp current injection was also modified by ERG block showing a reduction of first spike latency, enhancement of discharge rate and reduction of the slow spike-frequency adaptation process. ERG channels influence the interspike slope without affecting the spike shape. Moreover, in response to sinusoid-like current, ERG channel block caused frequency-dependent gain enhancement and phase-lead shift. Taken together, the data demonstrate that ERG channels control the excitability of MVNn, their discharge regularity and probably their resonance properties.
A novel ZVS high voltage power supply for micro-channel plate photomultiplier tubes
International Nuclear Information System (INIS)
Pei, Chengquan; Tian, Jinshou; Liu, Zhen; Qin, Hong; Wu, Shengli
2017-01-01
A novel resonant high voltage power supply (HVPS) with zero voltage switching (ZVS), to reduce the voltage stress on switching devices and improve conversion efficiency, is proposed. The proposed HVPS includes a drive circuit, a transformer, several voltage multiplying circuits, and a regulator circuit. The HVPS contains several secondary windings that can be precisely regulated. The proposed HVPS performed better than the traditional resistor voltage divider, which requires replacing matching resistors resulting in resistor dispersibility in the Micro-Channel Plate (MCP). The equivalent circuit of the proposed HVPS was established and the operational principle analyzed. The entire switching element can achieve ZVS, which was validated by a simulation and experiments. The properties of this HVPS were tested including minimum power loss (240 mW), maximum power loss (1 W) and conversion efficiency (85%). The results of this research are that the proposed HVPS was suitable for driving the micro-channel plate photomultiplier tube (MCP-PMT). It was therefore adopted to test the MCP-PMT, which will be used in Daya Bay reactor neutrino experiment II in China.
A novel ZVS high voltage power supply for micro-channel plate photomultiplier tubes
Energy Technology Data Exchange (ETDEWEB)
Pei, Chengquan [Key Laboratory for Physical Electronics and Devices of the Ministry of Education, Xi' an Jiaotong University, Xi’an 710049 (China); Tian, Jinshou [Xi’an Institute of Optics and Precision Mechanics, Chinese Academy of Sciences, Xi' an 710119 (China); Liu, Zhen [Key Laboratory for Physical Electronics and Devices of the Ministry of Education, Xi' an Jiaotong University, Xi’an 710049 (China); Qin, Hong [School of Computer Science and Technology, Xi' an University of Science and Technology, Xi' an 710054 (China); Wu, Shengli, E-mail: slwu@mail.xjtu.edu.cn [Key Laboratory for Physical Electronics and Devices of the Ministry of Education, Xi' an Jiaotong University, Xi’an 710049 (China)
2017-04-11
A novel resonant high voltage power supply (HVPS) with zero voltage switching (ZVS), to reduce the voltage stress on switching devices and improve conversion efficiency, is proposed. The proposed HVPS includes a drive circuit, a transformer, several voltage multiplying circuits, and a regulator circuit. The HVPS contains several secondary windings that can be precisely regulated. The proposed HVPS performed better than the traditional resistor voltage divider, which requires replacing matching resistors resulting in resistor dispersibility in the Micro-Channel Plate (MCP). The equivalent circuit of the proposed HVPS was established and the operational principle analyzed. The entire switching element can achieve ZVS, which was validated by a simulation and experiments. The properties of this HVPS were tested including minimum power loss (240 mW), maximum power loss (1 W) and conversion efficiency (85%). The results of this research are that the proposed HVPS was suitable for driving the micro-channel plate photomultiplier tube (MCP-PMT). It was therefore adopted to test the MCP-PMT, which will be used in Daya Bay reactor neutrino experiment II in China.
Voltage gated potassium channels expressed in Xenopus laevis(AMPHIBIA oocytes
Directory of Open Access Journals (Sweden)
Hedna Chaves
2003-01-01
Full Text Available Heterologous expression has been an important tool for structural and functionalcharacterization of proteins. The study of biophysical properties of ion channels,pumps and transporters has been possible thanks to their expression in Xenopuslaevisoocytes. Here we report the expression of two voltage gated channels, Kv1.1and Shaker, in X. laevisoocytes using a method for oocyte extraction, isolation, cul-ture, and microinjection adapted to the latitude and altitude conditions of Bogotá,Colombia.
DEFF Research Database (Denmark)
Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D
2000-01-01
In the present study, we tested whether the alpha(1A) subunit, which encodes a neuronal isoform of voltage-dependent Ca(2+) channels (VDCCs) (P-/Q-type), was present and functional in vascular smooth muscle and renal resistance vessels. By reverse transcription-polymerase chain reaction...... preglomerular resistance vessels and aorta, as well as mesangial cells, and that P-type VDCCs contribute to Ca(2+) influx in aortic and renal VSMCs and are involved in depolarization-mediated contraction in renal afferent arterioles....
Regulation of Na+ channel inactivation by the DIII and DIV voltage-sensing domains.
Hsu, Eric J; Zhu, Wandi; Schubert, Angela R; Voelker, Taylor; Varga, Zoltan; Silva, Jonathan R
2017-03-06
Functional eukaryotic voltage-gated Na + (Na V ) channels comprise four domains (DI-DIV), each containing six membrane-spanning segments (S1-S6). Voltage sensing is accomplished by the first four membrane-spanning segments (S1-S4), which together form a voltage-sensing domain (VSD). A critical Na V channel gating process, inactivation, has previously been linked to activation of the VSDs in DIII and DIV. Here, we probe this interaction by using voltage-clamp fluorometry to observe VSD kinetics in the presence of mutations at locations that have been shown to impair Na V channel inactivation. These locations include the DIII-DIV linker, the DIII S4-S5 linker, and the DIV S4-S5 linker. Our results show that, within the 10-ms timeframe of fast inactivation, the DIV-VSD is the primary regulator of inactivation. However, after longer 100-ms pulses, the DIII-DIV linker slows DIII-VSD deactivation, and the rate of DIII deactivation correlates strongly with the rate of recovery from inactivation. Our results imply that, over the course of an action potential, DIV-VSDs regulate the onset of fast inactivation while DIII-VSDs determine its recovery. © 2017 Hsu et al.
Molecular pathophysiology and pharmacology of the voltage-sensing module of neuronal ion channels.
Miceli, Francesco; Soldovieri, Maria Virginia; Ambrosino, Paolo; De Maria, Michela; Manocchio, Laura; Medoro, Alessandro; Taglialatela, Maurizio
2015-01-01
Voltage-gated ion channels (VGICs) are membrane proteins that switch from a closed to open state in response to changes in membrane potential, thus enabling ion fluxes across the cell membranes. The mechanism that regulate the structural rearrangements occurring in VGICs in response to changes in membrane potential still remains one of the most challenging topic of modern biophysics. Na(+), Ca(2+) and K(+) voltage-gated channels are structurally formed by the assembly of four similar domains, each comprising six transmembrane segments. Each domain can be divided into two main regions: the Pore Module (PM) and the Voltage-Sensing Module (VSM). The PM (helices S5 and S6 and intervening linker) is responsible for gate opening and ion selectivity; by contrast, the VSM, comprising the first four transmembrane helices (S1-S4), undergoes the first conformational changes in response to membrane voltage variations. In particular, the S4 segment of each domain, which contains several positively charged residues interspersed with hydrophobic amino acids, is located within the membrane electric field and plays an essential role in voltage sensing. In neurons, specific gating properties of each channel subtype underlie a variety of biological events, ranging from the generation and propagation of electrical impulses, to the secretion of neurotransmitters and to the regulation of gene expression. Given the important functional role played by the VSM in neuronal VGICs, it is not surprising that various VSM mutations affecting the gating process of these channels are responsible for human diseases, and that compounds acting on the VSM have emerged as important investigational tools with great therapeutic potential. In the present review we will briefly describe the most recent discoveries concerning how the VSM exerts its function, how genetically inherited diseases caused by mutations occurring in the VSM affects gating in VGICs, and how several classes of drugs and toxins
Park, Jihoon
2016-11-29
Multilayer channel structure is used to effectively manipulate the threshold voltage of zinc oxide transistors without degrading its field-effect mobility. Transistors operating in enhancement mode with good mobility are fabricated by optimizing the structure of the multilayer channel. The optimization is attributed to the formation of additional channel and suppression of the diffusion of absorbed water molecules and oxygen vacancies.
Park, Jihoon; Alshammari, Fwzah Hamud; Wang, Zhenwei; Alshareef, Husam N.
2016-01-01
Multilayer channel structure is used to effectively manipulate the threshold voltage of zinc oxide transistors without degrading its field-effect mobility. Transistors operating in enhancement mode with good mobility are fabricated by optimizing the structure of the multilayer channel. The optimization is attributed to the formation of additional channel and suppression of the diffusion of absorbed water molecules and oxygen vacancies.
Functional role of voltage gated Ca2+ channels in heart automaticity
Directory of Open Access Journals (Sweden)
Pietro eMesirca
2015-02-01
Full Text Available Pacemaker activity of automatic cardiac myocytes controls the heartbeat in everyday life. Cardiac automaticity is under the control of several neurotransmitters and hormones and is constantly regulated by the autonomic nervous system to match the physiological needs of the organism. Several classes of ion channels and proteins involved in intracellular Ca2+ dynamics contribute to pacemaker activity. The functional role of voltage-gated calcium channels (VGCCs in heart automaticity and impulse conduction has been matter of debate for 30 years. However, growing evidence shows that VGCCs are important regulators of the pacemaker mechanisms and play also a major role in atrio-ventricular impulse conduction. Incidentally, studies performed in genetically modified mice lacking L-type Cav1.3 (Cav1.3-/- or T-type Cav3.1 (Cav3.1-/- channels show that genetic inactivation of these channels strongly impacts pacemaking. In cardiac pacemaker cells, VGCCs activate at negative voltages at the beginning of the diastolic depolarization and importantly contribute to this phase by supplying inward current. Loss-of-function of these channels also impairs atrio-ventricular conduction. Furthermore, inactivation of Cav1.3 channels promotes also atrial fibrillation and flutter in knockout mice suggesting that these channels can play a role in stabilizing atrial rhythm. Genomic analysis demonstrated that Cav1.3 and Cav3.1 channels are widely expressed in pacemaker tissue of mice, rabbits and humans. Importantly, human diseases of pacemaker activity such as congenital bradycardia and heart block have been attributed to loss-of-function of Cav1.3 and Cav3.1 channels. In this article, we will review the current knowledge on the role of VGCCs in the generation and regulation of heart rate and rhythm. We will discuss also how loss of Ca2+ entry through VGCCs could influence intracellular Ca2+ handling and promote atrial arrhythmias.
KCNQ1 channel modulation by KCNE proteins via the voltage-sensing domain.
Nakajo, Koichi; Kubo, Yoshihiro
2015-06-15
The gating of the KCNQ1 potassium channel is drastically regulated by auxiliary subunit KCNE proteins. KCNE1, for example, slows the activation kinetics of KCNQ1 by two orders of magnitude. Like other voltage-gated ion channels, the opening of KCNQ1 is regulated by the voltage-sensing domain (VSD; S1-S4 segments). Although it has been known that KCNE proteins interact with KCNQ1 via the pore domain, some recent reports suggest that the VSD movement may be altered by KCNE. The altered VSD movement of KCNQ1 by KCNE proteins has been examined by site-directed mutagenesis, the scanning cysteine accessibility method (SCAM), voltage clamp fluorometry (VCF) and gating charge measurements. These accumulated data support the idea that KCNE proteins interact with the VSDs of KCNQ1 and modulate the gating of the KCNQ1 channel. In this review, we will summarize recent findings and current views of the KCNQ1 modulation by KCNE via the VSD. In this context, we discuss our recent findings that KCNE1 may alter physical interactions between the S4 segment (VSD) and the S5 segment (pore domain) of KCNQ1. Based on these findings from ourselves and others, we propose a hypothetical mechanism for how KCNE1 binding alters the VSD movement and the gating of the channel. © 2015 The Authors. The Journal of Physiology © 2015 The Physiological Society.
Soler-Llavina, Gilberto J; Chang, Tsg-Hui; Swartz, Kenton J
2006-11-22
Voltage-activated potassium (K(v)) channels contain a central pore domain that is partially surrounded by four voltage-sensing domains. Recent X-ray structures suggest that the two domains lack extensive protein-protein contacts within presumed transmembrane regions, but whether this is the case for functional channels embedded in lipid membranes remains to be tested. We investigated domain interactions in the Shaker K(v) channel by systematically mutating the pore domain and assessing tolerance by examining channel maturation, S4 gating charge movement, and channel opening. When mapped onto the X-ray structure of the K(v)1.2 channel the large number of permissive mutations support the notion of relatively independent domains, consistent with crystallographic studies. Inspection of the maps also identifies portions of the interface where residues are sensitive to mutation, an external cluster where mutations hinder voltage sensor activation, and an internal cluster where domain interactions between S4 and S5 helices from adjacent subunits appear crucial for the concerted opening transition.
Voltage-Sensitive Ion Channels Biophysics of Molecular Excitability
Leuchtag, H. Richard
2008-01-01
Voltage-sensitive ion channels are macromolecules embedded in the membranes of nerve and muscle fibers of animals. Because of their physiological functions, biochemical structures and electrical switching properties, they are at an intersection of biology, chemistry and physics. Despite decades of intensive research under the traditional approach of gated structural pores, the relation between the structure of these molecules and their function remains enigmatic. This book critically examines physically oriented approaches not covered in other ion-channel books. It looks at optical and thermal as well as electrical data, and at studies in the frequency domain as well as in the time domain. Rather than presenting the reader with only an option of mechanistic models at an inappropriate pseudo-macroscopic scale, it emphasizes concepts established in organic chemistry and condensed state physics. The book’s approach to the understanding of these unique structures breaks with the unproven view of ion channels as...
Toxins That Affect Voltage-Gated Sodium Channels.
Ji, Yonghua
2017-10-26
Voltage-gated sodium channels (VGSCs) are critical in generation and conduction of electrical signals in multiple excitable tissues. Natural toxins, produced by animal, plant, and microorganisms, target VGSCs through diverse strategies developed over millions of years of evolutions. Studying of the diverse interaction between VGSC and VGSC-targeting toxins has been contributing to the increasing understanding of molecular structure and function, pharmacology, and drug development potential of VGSCs. This chapter aims to summarize some of the current views on the VGSC-toxin interaction based on the established receptor sites of VGSC for natural toxins.
T-type voltage-gated calcium channels regulate the tone of mouse efferent arterioles
DEFF Research Database (Denmark)
Poulsen, Christian B; Al-Mashhadi, Rozh H; Cribbs, Leanne L
2011-01-01
Voltage-gated calcium channels are important for the regulation of renal blood flow and the glomerular filtration rate. Excitation-contraction coupling in afferent arterioles is known to require activation of these channels and we studied their role in the regulation of cortical efferent arteriolar...... tone. We used microdissected perfused mouse efferent arterioles and found a transient vasoconstriction in response to depolarization with potassium; an effect abolished by removal of extracellular calcium. The T-type voltage-gated calcium channel antagonists mibefradil and nickel blocked this potassium...... by immunocytochemistry to be located in mouse efferent arterioles, human pre- and postglomerular vasculature, and Ca(v)3.2 in rat glomerular arterioles. Inhibition of endothelial nitric oxide synthase by L-NAME or its deletion by gene knockout changed the potassium-elicited transient constriction to a sustained response...
DEFF Research Database (Denmark)
Pless, Stephan Alexander; Elstone, Fisal D; Niciforovic, Ana P
2014-01-01
largely enigmatic. To this end, natural and unnatural side chain substitutions were made in the S2 hydrophobic core (HC), the extracellular negative charge cluster (ENC), and the intracellular negative charge cluster (INC) of the four VSDs of the skeletal muscle sodium channel isoform (NaV1......Voltage-gated sodium (NaV) channels mediate electrical excitability in animals. Despite strong sequence conservation among the voltage-sensor domains (VSDs) of closely related voltage-gated potassium (KV) and NaV channels, the functional contributions of individual side chains in Nav VSDs remain.......4). The results show that the highly conserved aromatic side chain constituting the S2 HC makes distinct functional contributions in each of the four NaV domains. No obvious cation-pi interaction exists with nearby S4 charges in any domain, and natural and unnatural mutations at these aromatic sites produce...
International Nuclear Information System (INIS)
Wu Dake; Huang Ru; Wang Pengfei; Tang Poren; Wang Yangyuan
2008-01-01
In this paper, a low-voltage recessed channel SONOS flash memory using the gate-injection program/erase method is proposed and investigated for NAND application. It is shown that the proposed flash memory can achieve 8 V lower programming voltage compared with planar flash memory, due to the effective capacitance coupling and the electric-field enhancement by combining the recessed channel structure and the gate-injection program/erase method. In addition, more than 30% larger threshold voltage window and improved short channel effects can be obtained in the proposed flash memory
Findeisen, Felix; Minor, Daniel L
2009-03-01
Two processes dominate voltage-gated calcium channel (Ca(V)) inactivation: voltage-dependent inactivation (VDI) and calcium-dependent inactivation (CDI). The Ca(V)beta/Ca(V)alpha(1)-I-II loop and Ca(2+)/calmodulin (CaM)/Ca(V)alpha(1)-C-terminal tail complexes have been shown to modulate each, respectively. Nevertheless, how each complex couples to the pore and whether each affects inactivation independently have remained unresolved. Here, we demonstrate that the IS6-alpha-interaction domain (AID) linker provides a rigid connection between the pore and Ca(V)beta/I-II loop complex by showing that IS6-AID linker polyglycine mutations accelerate Ca(V)1.2 (L-type) and Ca(V)2.1 (P/Q-type) VDI. Remarkably, mutations that either break the rigid IS6-AID linker connection or disrupt Ca(V)beta/I-II association sharply decelerate CDI and reduce a second Ca(2+)/CaM/Ca(V)alpha(1)-C-terminal-mediated process known as calcium-dependent facilitation. Collectively, the data strongly suggest that components traditionally associated solely with VDI, Ca(V)beta and the IS6-AID linker, are essential for calcium-dependent modulation, and that both Ca(V)beta-dependent and CaM-dependent components couple to the pore by a common mechanism requiring Ca(V)beta and an intact IS6-AID linker.
The role of entropic potential in voltage activation and K+ transport through Kv 1.2 channels
Wawrzkiewicz-Jałowiecka, Agata; Grzywna, Zbigniew J.
2018-03-01
We analyze the entropic effects of inner pore geometry changes of Kv 1.2 channel during membrane depolarization and their implications for the rate of transmembrane transport of potassium ions. We base this on the idea that spatial confinements within the channel pore give rise to entropic barriers which can both effectively affect the stability of open macroconformation and influence channel's ability to conduct the potassium ions through the membrane. First, we calculate the differences in entropy between voltage-activated and resting states of the channel. As a template, we take a set of structures of channel pore in an open state at different membrane potentials generated in our previous research. The obtained results indicate that tendency to occupy open states at membrane depolarization is entropy facilitated. Second, we describe the differences in rates of K+ transport through the channel pore at different voltages based on the results of appropriate random walk simulations in entropic and electric potentials. The simulated single channel currents (I) suggest that the geometry changes during membrane depolarization are an important factor contributing to the observed flow of potassium ions through the channel. Nevertheless, the charge distribution within the channel pore (especially at the extracellular entrance) seems most prominent for the observed I/Imax relation at a qualitative level at analyzed voltages.
KCNE1 constrains the voltage sensor of Kv7.1 K+ channels.
Directory of Open Access Journals (Sweden)
Liora Shamgar
Full Text Available Kv7 potassium channels whose mutations cause cardiovascular and neurological disorders are members of the superfamily of voltage-gated K(+ channels, comprising a central pore enclosed by four voltage-sensing domains (VSDs and sharing a homologous S4 sensor sequence. The Kv7.1 pore-forming subunit can interact with various KCNE auxiliary subunits to form K(+ channels with very different gating behaviors. In an attempt to characterize the nature of the promiscuous gating of Kv7.1 channels, we performed a tryptophan-scanning mutagenesis of the S4 sensor and analyzed the mutation-induced perturbations in gating free energy. Perturbing the gating energetics of Kv7.1 bias most of the mutant channels towards the closed state, while fewer mutations stabilize the open state or the inactivated state. In the absence of auxiliary subunits, mutations of specific S4 residues mimic the gating phenotypes produced by co-assembly of Kv7.1 with either KCNE1 or KCNE3. Many S4 perturbations compromise the ability of KCNE1 to properly regulate Kv7.1 channel gating. The tryptophan-induced packing perturbations and cysteine engineering studies in S4 suggest that KCNE1 lodges at the inter-VSD S4-S1 interface between two adjacent subunits, a strategic location to exert its striking action on Kv7.1 gating functions.
Kazmierczak, Marcin; Zhang, Xiaofei; Chen, Bihan; Mulkey, Daniel K.; Shi, Yingtang; Wagner, Paul G.; Pivaroff-Ward, Kendra; Sassic, Jessica K.; Bayliss, Douglas A.
2013-01-01
The Ether-a-go-go (EAG) superfamily of voltage-gated K+ channels consists of three functionally distinct gene families (Eag, Elk, and Erg) encoding a diverse set of low-threshold K+ currents that regulate excitability in neurons and muscle. Previous studies indicate that external acidification inhibits activation of three EAG superfamily K+ channels, Kv10.1 (Eag1), Kv11.1 (Erg1), and Kv12.1 (Elk1). We show here that Kv10.2, Kv12.2, and Kv12.3 are similarly inhibited by external protons, suggesting that high sensitivity to physiological pH changes is a general property of EAG superfamily channels. External acidification depolarizes the conductance–voltage (GV) curves of these channels, reducing low threshold activation. We explored the mechanism of this high pH sensitivity in Kv12.1, Kv10.2, and Kv11.1. We first examined the role of acidic voltage sensor residues that mediate divalent cation block of voltage activation in EAG superfamily channels because protons reduce the sensitivity of Kv12.1 to Zn2+. Low pH similarly reduces Mg2+ sensitivity of Kv10.1, and we found that the pH sensitivity of Kv11.1 was greatly attenuated at 1 mM Ca2+. Individual neutralizations of a pair of EAG-specific acidic residues that have previously been implicated in divalent block of diverse EAG superfamily channels greatly reduced the pH response in Kv12.1, Kv10.2, and Kv11.1. Our results therefore suggest a common mechanism for pH-sensitive voltage activation in EAG superfamily channels. The EAG-specific acidic residues may form the proton-binding site or alternatively are required to hold the voltage sensor in a pH-sensitive conformation. The high pH sensitivity of EAG superfamily channels suggests that they could contribute to pH-sensitive K+ currents observed in vivo. PMID:23712551
Kazmierczak, Marcin; Zhang, Xiaofei; Chen, Bihan; Mulkey, Daniel K; Shi, Yingtang; Wagner, Paul G; Pivaroff-Ward, Kendra; Sassic, Jessica K; Bayliss, Douglas A; Jegla, Timothy
2013-06-01
The Ether-a-go-go (EAG) superfamily of voltage-gated K(+) channels consists of three functionally distinct gene families (Eag, Elk, and Erg) encoding a diverse set of low-threshold K(+) currents that regulate excitability in neurons and muscle. Previous studies indicate that external acidification inhibits activation of three EAG superfamily K(+) channels, Kv10.1 (Eag1), Kv11.1 (Erg1), and Kv12.1 (Elk1). We show here that Kv10.2, Kv12.2, and Kv12.3 are similarly inhibited by external protons, suggesting that high sensitivity to physiological pH changes is a general property of EAG superfamily channels. External acidification depolarizes the conductance-voltage (GV) curves of these channels, reducing low threshold activation. We explored the mechanism of this high pH sensitivity in Kv12.1, Kv10.2, and Kv11.1. We first examined the role of acidic voltage sensor residues that mediate divalent cation block of voltage activation in EAG superfamily channels because protons reduce the sensitivity of Kv12.1 to Zn(2+). Low pH similarly reduces Mg(2+) sensitivity of Kv10.1, and we found that the pH sensitivity of Kv11.1 was greatly attenuated at 1 mM Ca(2+). Individual neutralizations of a pair of EAG-specific acidic residues that have previously been implicated in divalent block of diverse EAG superfamily channels greatly reduced the pH response in Kv12.1, Kv10.2, and Kv11.1. Our results therefore suggest a common mechanism for pH-sensitive voltage activation in EAG superfamily channels. The EAG-specific acidic residues may form the proton-binding site or alternatively are required to hold the voltage sensor in a pH-sensitive conformation. The high pH sensitivity of EAG superfamily channels suggests that they could contribute to pH-sensitive K(+) currents observed in vivo.
Rozanski, Gabriela M; Nath, Arup R; Adams, Michael E; Stanley, Elise F
2013-11-15
A subpopulation of dorsal root ganglion (DRG) neurons are intimately attached in pairs and separated solely by thin satellite glial cell membrane septa. Stimulation of one neuron leads to transglial activation of its pair by a bi-, purinergic/glutamatergic synaptic pathway, a transmission mechanism that we term sandwich synapse (SS) transmission. Release of ATP from the stimulated neuron can be attributed to a classical mechanism involving Ca(2+) entry via voltage-gated calcium channels (CaV) but via an unknown channel type. Specific blockers and toxins ruled out CaV1, 2.1 and 2.2. Transmission was, however, blocked by a moderate depolarization (-50 mV) or low-concentration Ni(2+) (0.1 mM). Transmission persisted using a voltage pulse to -40 mV from a holding potential of -80 mV, confirming the involvement of a low voltage-activated channel type and limiting the candidate channel type to either CaV3.2 or a subpopulation of inactivation- and Ni(2+)-sensitive CaV2.3 channels. Resistance of the neuron calcium current and SS transmission to SNX482 argue against the latter. Hence, we conclude that inter-somatic transmission at the DRG SS is gated by CaV3.2 type calcium channels. The use of CaV3 family channels to gate transmission has important implications for the biological function of the DRG SS as information transfer would be predicted to occur not only in response to action potentials but also to sub-threshold membrane voltage oscillations. Thus, the SS synapse may serve as a homeostatic signalling mechanism between select neurons in the DRG and could play a role in abnormal sensation such as neuropathic pain.
Functional analysis of Kv1.2 and paddle chimera Kv channels in planar lipid bilayers
Tao, Xiao; MacKinnon, Roderick
2010-01-01
Summary Voltage-dependent K+ channels play key roles in shaping electrical signaling in both excitable as well as non-excitable cells. These channels open and close in response to the voltage changes across the cell membrane. Many studies have been carried out in order to understand the voltage sensing mechanism. Our laboratory recently determined the atomic structures of a mammalian voltage-dependent K+ channel Kv1.2 and a mutant of Kv1.2 named the ‘paddle-chimera’ channel, in which the voltage sensor paddle was transferred from Kv2.1 to Kv1.2. These two structures provide atomic descriptions of voltage-dependent channels with unprecedented clarity. Until now the functional integrity of these two channels biosynthesized in yeast cells have not been assessed. Here we report the electrophysiological and pharmacological properties of Kv1.2 and the paddle chimera channels in planar lipid bilayers. We demonstrate that Pichia yeast produce ‘normally functioning’ mammalian voltage-dependent K+ channels with qualitatively similar features to the Shaker K+ channel in the absence of the N-terminal inactivation gate, and that the paddle chimera mutant channel functions as well as Kv1.2. We find, however, that in several respects the Kv1.2 channel exhibits functional properties that are distinct from Kv1.2 channels reported in the literature. PMID:18638484
Li-Smerin, Yingying; Swartz, Kenton J.
2000-01-01
Hanatoxin inhibits voltage-gated K+ channels by modifying the energetics of activation. We studied the molecular determinants and physical location of the Hanatoxin receptors on the drk1 voltage-gated K+ channel. First, we made multiple substitutions at three previously identified positions in the COOH terminus of S3 to examine whether these residues interact intimately with the toxin. We also examined a region encompassing S1–S3 using alanine-scanning mutagenesis to identify additional determinants of the toxin receptors. Finally, guided by the structure of the KcsA K+ channel, we explored whether the toxin interacts with the peripheral extracellular surface of the pore domain in the drk1 K+ channel. Our results argue for an intimate interaction between the toxin and the COOH terminus of S3 and suggest that the Hanatoxin receptors are confined within the voltage-sensing domains of the channel, at least 20–25 Å away from the central pore axis. PMID:10828242
Benhassine, Narimane; Berger, Thomas
2005-02-01
Voltage-gated conductances on dendrites of layer 5 pyramidal neurons participate in synaptic integration and output generation. We investigated the properties and the distribution of large-conductance calcium-activated potassium channels (BK channels) in this cell type using excised patches in acute slice preparations of rat somatosensory cortex. BK channels were characterized by their large conductance and sensitivity to the specific blockers paxilline and iberiotoxin. BK channels showed a pronounced calcium-dependence with a maximal opening probability of 0.69 at 10 microm and 0.42 at 3 microm free calcium. Their opening probability and transition time constants between open and closed states are voltage-dependent. At depolarized potentials, BK channel gating is described by two open and one closed states. Depolarization increases the opening probability due to a prolongation of the open time constant and a shortening of the closed time constant. Calcium-dependence and biophysical properties of somatic and dendritic BK channels were identical. The presence of BK channels on the apical dendrite of layer 5 pyramidal neurons was shown by immunofluorescence. Patch-clamp recordings revealed a homogeneous density of BK channels on the soma and along the apical dendrite up to 850 microm with a mean density of 1.9 channels per microm(2). BK channels are expressed either isolated or in clusters containing up to four channels. This study shows the presence of BK channels on dendrites. Their activation might modulate the shape of sodium and calcium action potentials, their propagation along the dendrite, and thereby the electrotonic distance between the somatic and dendritic action potential initiation zones.
MOLECULAR PATHOPHYSIOLOGY AND PHARMACOLOGY OF THE VOLTAGE-SENSING DOMAIN OF NEURONAL ION CHANNELS
Directory of Open Access Journals (Sweden)
Francesco eMiceli
2015-07-01
Full Text Available Voltage-gated ion channels (VGIC are membrane proteins that switch from a closed to open state in response to changes in membrane potential, thus enabling ion fluxes across the cell membranes. The mechanism that regulate the structural rearrangements occurring in VGIC in response to changes in membrane potential still remains one of the most challenging topic of modern biophysics. Na+, Ca2+ and K+ voltage-gated channels are structurally formed by the assembly of four similar domains, each comprising six transmembrane segments. Each domain can be divided in two main regions: the Pore Module (PM and the Voltage-Sensing Module (VSM. The PM (helices S5 and S6 and intervening linker is responsible for gate opening and ion selectivity; by contrast, the VSM, comprising the first four transmembrane helices (S1-S4, undergoes the first conformational changes in response to membrane voltage. In particular, the S4 segment of each domain, which contains several positively charged residues interspersed with hydrophobic amino acids, is located within the membrane electric field and plays an essential role in voltage sensing. In neurons, specific gating properties of each channel subtype underlie a variety of biological events, ranging from the generation and propagation of electrical impulses, to the secretion of neurotransmitters, to the regulation of gene expression. Given the important functional role played by the VSM in neuronal VGICs, it is not surprising that various VSM mutations affecting the gating process of these channels are responsible for human diseases, and that compounds acting on the VSM have emerged as important investigational tools with great therapeutic potential. In the present review we will briefly describe the most recent discoveries concerning how the VSM exerts its function, how genetically inherited diseases caused by mutations occurring in the VSM affects gating in VGICs, and how several classes of drugs and toxins selectively
Thorpe, Andrew J; Offord, James
2010-07-01
Currently, there are two drugs on the market, gabapentin (Neurontin) and pregabalin (Lyrica), that are proposed to exert their therapeutic effect through binding to the alpha2-delta subunit of voltage-sensitive calcium channels. This activity was unexpected, as the alpha2-delta subunit had previously been considered not to be a pharmacological target. In this review, the role of the alpha2-delta subunits is discussed and the mechanism of action of the alpha2-delta ligands in vitro and in vivo is summarized. Finally, new insights into the mechanism of drugs that bind to this protein are discussed.
Neuronal trafficking of voltage-gated potassium channels
DEFF Research Database (Denmark)
Jensen, Camilla S; Rasmussen, Hanne Borger; Misonou, Hiroaki
2011-01-01
The computational ability of CNS neurons depends critically on the specific localization of ion channels in the somatodendritic and axonal membranes. Neuronal dendrites receive synaptic inputs at numerous spines and integrate them in time and space. The integration of synaptic potentials is regul......The computational ability of CNS neurons depends critically on the specific localization of ion channels in the somatodendritic and axonal membranes. Neuronal dendrites receive synaptic inputs at numerous spines and integrate them in time and space. The integration of synaptic potentials...
Free energy dissipation of the spontaneous gating of a single voltage-gated potassium channel.
Wang, Jia-Zeng; Wang, Rui-Zhen
2018-02-01
Potassium channels mainly contribute to the resting potential and re-polarizations, with the potassium electrochemical gradient being maintained by the pump Na + /K + -ATPase. In this paper, we construct a stochastic model mimicking the kinetics of a potassium channel, which integrates temporal evolving of the membrane voltage and the spontaneous gating of the channel. Its stationary probability density functions (PDFs) are found to be singular at the boundaries, which result from the fact that the evolving rates of voltage are greater than the gating rates of the channel. We apply PDFs to calculate the power dissipations of the potassium current, the leakage, and the gating currents. On a physical perspective, the essential role of the system is the K + -battery charging the leakage (L-)battery. A part of power will inevitably be dissipated among the process. So, the efficiency of energy transference is calculated.
Free energy dissipation of the spontaneous gating of a single voltage-gated potassium channel
Wang, Jia-Zeng; Wang, Rui-Zhen
2018-02-01
Potassium channels mainly contribute to the resting potential and re-polarizations, with the potassium electrochemical gradient being maintained by the pump Na+/K+-ATPase. In this paper, we construct a stochastic model mimicking the kinetics of a potassium channel, which integrates temporal evolving of the membrane voltage and the spontaneous gating of the channel. Its stationary probability density functions (PDFs) are found to be singular at the boundaries, which result from the fact that the evolving rates of voltage are greater than the gating rates of the channel. We apply PDFs to calculate the power dissipations of the potassium current, the leakage, and the gating currents. On a physical perspective, the essential role of the system is the K+-battery charging the leakage (L-)battery. A part of power will inevitably be dissipated among the process. So, the efficiency of energy transference is calculated.
Expression of voltage-activated calcium channels in the early zebrafish embryo.
Sanhueza, Dayán; Montoya, Andro; Sierralta, Jimena; Kukuljan, Manuel
2009-05-01
Increases in cytosolic calcium concentrations regulate many cellular processes, including aspects of early development. Calcium release from intracellular stores and calcium entry through non-voltage-gated channels account for signalling in non-excitable cells, whereas voltage-gated calcium channels (CaV) are important in excitable cells. We report the expression of multiple transcripts of CaV, identified by its homology to other species, in the early embryo of the zebrafish, Danio rerio, at stages prior to the differentiation of excitable cells. CaV mRNAs and proteins were detected as early as the 2-cell stages, which indicate that they arise from both maternal and zygotic transcription. Exposure of embryos to pharmacological blockers of CaV does not perturb early development significantly, although late effects are appreciable. These results suggest that CaV may have a role in calcium homeostasis and control of cellular process during early embryonic development.
Yang, Yoon-Sil; Jeon, Sang-Chan; Kim, Dong-Kwan; Eun, Su-Yong; Jung, Sung-Cherl
2017-03-01
Excessive influx and the subsequent rapid cytosolic elevation of Ca 2+ in neurons is the major cause to induce hyperexcitability and irreversible cell damage although it is an essential ion for cellular signalings. Therefore, most neurons exhibit several cellular mechanisms to homeostatically regulate cytosolic Ca 2+ level in normal as well as pathological conditions. Delayed rectifier K + channels (I DR channels) play a role to suppress membrane excitability by inducing K + outflow in various conditions, indicating their potential role in preventing pathogenic conditions and cell damage under Ca 2+ -mediated excitotoxic conditions. In the present study, we electrophysiologically evaluated the response of I DR channels to hyperexcitable conditions induced by high Ca 2+ pretreatment (3.6 mM, for 24 hours) in cultured hippocampal neurons. In results, high Ca 2+ -treatment significantly increased the amplitude of I DR without changes of gating kinetics. Nimodipine but not APV blocked Ca 2+ -induced I DR enhancement, confirming that the change of I DR might be targeted by Ca 2+ influx through voltage-dependent Ca 2+ channels (VDCCs) rather than NMDA receptors (NMDARs). The VDCC-mediated I DR enhancement was not affected by either Ca 2+ -induced Ca 2+ release (CICR) or small conductance Ca 2+ -activated K + channels (SK channels). Furthermore, PP2 but not H89 completely abolished I DR enhancement under high Ca 2+ condition, indicating that the activation of Src family tyrosine kinases (SFKs) is required for Ca 2+ -mediated I DR enhancement. Thus, SFKs may be sensitive to excessive Ca 2+ influx through VDCCs and enhance I DR to activate a neuroprotective mechanism against Ca 2+ -mediated hyperexcitability in neurons.
Pohl, P; Saparov, S M; Borgnia, M J; Agre, P
2001-08-14
Aquaporins are membrane channels selectively permeated by water or water plus glycerol. Conflicting reports have described ion conductance associated with some water channels, raising the question of whether ion conductance is a general property of the aquaporin family. To clarify this question, a defined system was developed to simultaneously measure water permeability and ion conductance. The Escherichia coli water channel aquaporin-Z (AqpZ) was studied, because it is a highly stable tetramer. Planar lipid bilayers were formed from unilamellar vesicles containing purified AqpZ. The hydraulic conductivity of bilayers made from the total extract of E. coli lipids increased 3-fold if reconstituted with AqpZ, but electric conductance was unchanged. No channel activity was detected under voltage-clamp conditions, indicating that less than one in 10(9) transport events is electrogenic. Microelectrode measurements were simultaneously undertaken adjacent to the membrane. Changes in sodium concentration profiles accompanying transmembrane water flow permitted calculation of the activation energies: 14 kcal/mol for protein-free lipid bilayers and 4 kcal/mol for lipid bilayers containing AqpZ. Neither the water permeability nor the electric conductivity exhibited voltage dependence. This sensitive system demonstrated that AqpZ is permeated by water but not charged ions and should permit direct analyses of putative electrogenic properties of other aquaporins.
Voltage-dependent modulation of cardiac ryanodine receptors (RyR2 by protamine.
Directory of Open Access Journals (Sweden)
Paula L Diaz-Sylvester
Full Text Available It has been reported that protamine (>10 microg/ml blocks single skeletal RyR1 channels and inhibits RyR1-mediated Ca2+ release from sarcoplasmic reticulum microsomes. We extended these studies to cardiac RyR2 reconstituted into planar lipid bilayers. We found that protamine (0.02-20 microg/ml added to the cytosolic surface of fully activated RyR2 affected channel activity in a voltage-dependent manner. At membrane voltage (V(m; SR lumen-cytosol = 0 mV, protamine induced conductance transitions to several intermediate states (substates as well as full block of RyR2. At V(m>10 mV, the substate with the highest level of conductance was predominant. Increasing V(m from 0 to +80 mV, decreased the number of transitions and residence of the channel in this substate. The drop in current amplitude (full opening to substate had the same magnitude at 0 and +80 mV despite the approximately 3-fold increase in amplitude of the full opening. This is more similar to rectification of channel conductance induced by other polycations than to the action of selective conductance modifiers (ryanoids, imperatoxin. A distinctive effect of protamine (which might be shared with polylysines and histones but not with non-peptidic polycations is the activation of RyR2 in the presence of nanomolar cytosolic Ca2+ and millimolar Mg2+ levels. Our results suggest that RyRs would be subject to dual modulation (activation and block by polycationic domains of neighboring proteins via electrostatic interactions. Understanding these interactions could be important as such anomalies may be associated with the increased RyR2-mediated Ca2+ leak observed in cardiac diseases.
Pérez, Sheila; Vale, Carmen; Alonso, Eva; Alfonso, Carmen; Rodríguez, Paula; Otero, Paz; Alfonso, Amparo; Vale, Paulo; Hirama, Masahiro; Vieytes, Mercedes R; Botana, Luis M
2011-04-18
Ciguatera is a global disease caused by the consumption of certain warm-water fish (ciguateric fish) that have accumulated orally effective levels of sodium channel activator toxins (ciguatoxins) through the marine food chain. The effect of ciguatoxin standards and contaminated ciguatoxin samples was evaluated by electrophysiological recordings in cultured cerebellar neurons. The toxins affected both voltage-gated sodium (Nav) and potassium channels (Kv) although with different potencies. CTX 3C was the most active toxin blocking the peak inward sodium currents, followed by P-CTX 1B and 51-OH CTX 3C. In contrast, P-CTX 1B was more effective in blocking potassium currents. The analysis of six different samples of contaminated fish, in which a ciguatoxin analogue of mass 1040.6, not identical with the standard 51-OH CTX 3C, was the most prevalent compound, indicated an additive effect of the different ciguatoxins present in the samples. The results presented here constitute the first comparison of the potencies of three different purified ciguatoxins on sodium and potassium channels in the same neuronal preparation and indicate that electrophysiological recordings from cultured cerebellar neurons may provide a valuable tool to detect and quantify ciguatoxins in the very low nanomolar range.
DEFF Research Database (Denmark)
Gloos, K.; Utko, P.; Aagesen, M.
2006-01-01
We investigate the I(V) characteristics (current versus bias voltage) of side-gated quantum-point contacts, defined in GaAs/AlxGa1-xAs heterostructures. These point contacts are operated in the closed-channel regime, that is, at fixed gate voltages below zero-bias pinch-off for conductance. Our....... Such a built-in energy-voltage calibration allows us to distinguish between the different contributions to the electron transport across the pinched-off contact due to thermal activation or quantum tunneling. The first involves the height of the barrier, and the latter also its length. In the model that we...
Manipulating the voltage dependence of tunneling spin torques
Manchon, Aurelien
2012-01-01
Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact
The cooperative voltage sensor motion that gates a potassium channel.
Pathak, Medha; Kurtz, Lisa; Tombola, Francesco; Isacoff, Ehud
2005-01-01
The four arginine-rich S4 helices of a voltage-gated channel move outward through the membrane in response to depolarization, opening and closing gates to generate a transient ionic current. Coupling of voltage sensing to gating was originally thought to operate with the S4s moving independently from an inward/resting to an outward/activated conformation, so that when all four S4s are activated, the gates are driven to open or closed. However, S4 has also been found to influence the cooperative opening step (Smith-Maxwell et al., 1998a), suggesting a more complex mechanism of coupling. Using fluorescence to monitor structural rearrangements in a Shaker channel mutant, the ILT channel (Ledwell and Aldrich, 1999), that energetically isolates the steps of activation from the cooperative opening step, we find that opening is accompanied by a previously unknown and cooperative movement of S4. This gating motion of S4 appears to be coupled to the internal S6 gate and to two forms of slow inactivation. Our results suggest that S4 plays a direct role in gating. While large transmembrane rearrangements of S4 may be required to unlock the gating machinery, as proposed before, it appears to be the gating motion of S4 that drives the gates to open and close.
The role of voltage-gated potassium channels in the regulation of mouse uterine contractility
Directory of Open Access Journals (Sweden)
Abel Peter W
2007-11-01
Full Text Available Abstract Background Uterine smooth muscle cells exhibit ionic currents that appear to be important in the control of uterine contractility, but how these currents might produce the changes in contractile activity seen in pregnant myometrium has not been established. There are conflicting reports concerning the role of voltage-gated potassium (Kv channels and large-conductance, calcium-activated potassium (BK channels in the regulation of uterine contractility. In this study we provide molecular and functional evidence for a role for Kv channels in the regulation of spontaneous contractile activity in mouse myometrium, and also demonstrate a change in Kv channel regulation of contractility in pregnant mouse myometrium. Methods Functional assays which evaluated the effects of channel blockers and various contractile agonists were accomplished by quantifying contractility of isolated uterine smooth muscle obtained from nonpregnant mice as well as mice at various stages of pregnancy. Expression of Kv channel proteins in isolated uterine smooth muscle was evaluated by Western blots. Results The Kv channel blocker 4-aminopyridine (4-AP caused contractions in nonpregnant mouse myometrium (EC50 = 54 micromolar, maximal effect at 300 micromolar but this effect disappeared in pregnant mice; similarly, the Kv4.2/Kv4.3 blocker phrixotoxin-2 caused contractions in nonpregnant, but not pregnant, myometrium. Contractile responses to 4-AP were not dependent upon nerves, as neither tetrodotoxin nor storage of tissues at room temperature significantly altered these responses, nor were responses dependent upon the presence of the endometrium. Spontaneous contractions and contractions in response to 4-AP did not appear to be mediated by BK, as the BK channel-selective blockers iberiotoxin, verruculogen, or tetraethylammonium failed to affect either spontaneous contractions or 4-AP-elicited responses. A number of different Kv channel alpha subunit proteins were
Directory of Open Access Journals (Sweden)
Samira Yazdi
2016-01-01
Full Text Available Voltage-gated potassium (KV channels are membrane proteins that respond to changes in membrane potential by enabling K+ ion flux across the membrane. Polyunsaturated fatty acids (PUFAs induce channel opening by modulating the voltage-sensitivity, which can provide effective treatment against refractory epilepsy by means of a ketogenic diet. While PUFAs have been reported to influence the gating mechanism by electrostatic interactions to the voltage-sensor domain (VSD, the exact PUFA-protein interactions are still elusive. In this study, we report on the interactions between the Shaker KV channel in open and closed states and a PUFA-enriched lipid bilayer using microsecond molecular dynamics simulations. We determined a putative PUFA binding site in the open state of the channel located at the protein-lipid interface in the vicinity of the extracellular halves of the S3 and S4 helices of the VSD. In particular, the lipophilic PUFA tail covered a wide range of non-specific hydrophobic interactions in the hydrophobic central core of the protein-lipid interface, while the carboxylic head group displayed more specific interactions to polar/charged residues at the extracellular regions of the S3 and S4 helices, encompassing the S3-S4 linker. Moreover, by studying the interactions between saturated fatty acids (SFA and the Shaker KV channel, our study confirmed an increased conformational flexibility in the polyunsaturated carbon tails compared to saturated carbon chains, which may explain the specificity of PUFA action on channel proteins.
TAURINE REGULATION OF VOLTAGE-GATED CHANNELS IN RETINAL NEURONS
Rowan, Matthew JM; Bulley, Simon; Purpura, Lauren; Ripps, Harris; Shen, Wen
2017-01-01
Taurine activates not only Cl−-permeable ionotropic receptors, but also receptors that mediate metabotropic responses. The metabotropic property of taurine was revealed in electrophysiological recordings obtained after fully blocking Cl−-permeable receptors with an inhibitory “cocktail” consisting of picrotoxin, SR95531, and strychnine. We found that taurine’s metabotropic effects regulate voltage-gated channels in retinal neurons. After applying the inhibitory cocktail, taurine enhanced delayed outward rectifier K+ channels preferentially in Off-bipolar cells, and the effect was completely blocked by the specific PKC inhibitor, GF109203X. Additionally, taurine also acted through a metabotropic pathway to suppress both L- and N-type Ca2+ channels in retinal neurons, which were insensitive to the potent GABAB receptor inhibitor, CGP55845. This study reinforces our previous finding that taurine in physiological concentrations produces a multiplicity of metabotropic effects that precisely govern the integration of signals being transmitted from the retina to the brain. PMID:23392926
Zinc-dependent multi-conductance channel activity in mitochondria isolated from ischemic brain.
Bonanni, Laura; Chachar, Mushtaque; Jover-Mengual, Teresa; Li, Hongmei; Jones, Adrienne; Yokota, Hidenori; Ofengeim, Dimitry; Flannery, Richard J; Miyawaki, Takahiro; Cho, Chang-Hoon; Polster, Brian M; Pypaert, Marc; Hardwick, J Marie; Sensi, Stefano L; Zukin, R Suzanne; Jonas, Elizabeth A
2006-06-21
Transient global ischemia is a neuronal insult that induces delayed cell death. A hallmark event in the early post-ischemic period is enhanced permeability of mitochondrial membranes. The precise mechanisms by which mitochondrial function is disrupted are, as yet, unclear. Here we show that global ischemia promotes alterations in mitochondrial membrane contact points, a rise in intramitochondrial Zn2+, and activation of large, multi-conductance channels in mitochondrial outer membranes by 1 h after insult. Mitochondrial channel activity was associated with enhanced protease activity and proteolytic cleavage of BCL-xL to generate its pro-death counterpart, deltaN-BCL-xL. The findings implicate deltaN-BCL-xL in large, multi-conductance channel activity. Consistent with this, large channel activity was mimicked by introduction of recombinant deltaN-BCL-xL to control mitochondria and blocked by introduction of a functional BCL-xL antibody to post-ischemic mitochondria via the patch pipette. Channel activity was also inhibited by nicotinamide adenine dinucleotide, indicative of a role for the voltage-dependent anion channel (VDAC) of the outer mitochondrial membrane. In vivo administration of the membrane-impermeant Zn2+ chelator CaEDTA before ischemia or in vitro application of the membrane-permeant Zn2+ chelator tetrakis-(2-pyridylmethyl) ethylenediamine attenuated channel activity, suggesting a requirement for Zn2+. These findings reveal a novel mechanism by which ischemic insults disrupt the functional integrity of the outer mitochondrial membrane and implicate deltaN-BCL-xL and VDAC in the large, Zn2+-dependent mitochondrial channels observed in post-ischemic hippocampal mitochondria.
Villalonga, Núria; David, Miren; Bielańska, Joanna; González, Teresa; Parra, David; Soler, Concepció; Comes, Núria; Valenzuela, Carmen; Felipe, Antonio
2010-09-15
Kv1.3 plays a crucial role in the activation and proliferation of T-lymphocytes and macrophages. While Kv1.3 is responsible for the voltage-dependent potassium current in T-cells, in macrophages this K(+) current is generated by the association of Kv1.3 and Kv1.5. Patients with autoimmune diseases show a high number of effector memory T cells that are characterized by a high expression of Kv1.3 and Kv1.3 antagonists ameliorate autoimmune disorders in vivo. Diclofenac is a non-steroidal anti-inflammatory drug (NSAID) used in patients who suffer from painful autoimmune diseases such as rheumatoid arthritis. In this study, we show that diclofenac impairs immune response via a mechanism that involves Kv1.3. While diclofenac inhibited Kv1.3 expression in activated macrophages and T-lymphocytes, Kv1.5 remained unaffected. Diclofenac also decreased iNOS levels in Raw 264.7 cells, impairing their activation in response to lipopolysaccharide (LPS). LPS-induced macrophage migration and IL-2 production in stimulated Jurkat T-cells were also blocked by pharmacological doses of diclofenac. These effects were mimicked by Margatoxin, a specific Kv1.3 inhibitor, and Charybdotoxin, which blocks both Kv1.3 and Ca(2+)-activated K(+) channels (K(Ca)3.1). Because Kv1.3 is a very good target for autoimmune therapies, the effects of diclofenac on Kv1.3 are of high pharmacological relevance. Copyright 2010 Elsevier Inc. All rights reserved.
NMR investigation of the isolated second voltage-sensing domain of human Nav1.4 channel.
Paramonov, A S; Lyukmanova, E N; Myshkin, M Yu; Shulepko, M A; Kulbatskii, D S; Petrosian, N S; Chugunov, A O; Dolgikh, D A; Kirpichnikov, M P; Arseniev, A S; Shenkarev, Z O
2017-03-01
Voltage-gated Na + channels are essential for the functioning of cardiovascular, muscular, and nervous systems. The α-subunit of eukaryotic Na + channel consists of ~2000 amino acid residues and encloses 24 transmembrane (TM) helices, which form five membrane domains: four voltage-sensing (VSD) and one pore domain. The structural complexity significantly impedes recombinant production and structural studies of full-sized Na + channels. Modular organization of voltage-gated channels gives an idea for studying of the isolated second VSD of human skeletal muscle Nav1.4 channel (VSD-II). Several variants of VSD-II (~150a.a., four TM helices) with different N- and C-termini were produced by cell-free expression. Screening of membrane mimetics revealed low stability of VSD-II samples in media containing phospholipids (bicelles, nanodiscs) associated with the aggregation of electrically neutral domain molecules. The almost complete resonance assignment of 13 C, 15 N-labeled VSD-II was obtained in LPPG micelles. The secondary structure of VSD-II showed similarity with the structures of bacterial Na + channels. The fragment of S4 TM helix between the first and second conserved Arg residues probably adopts 3 10 -helical conformation. Water accessibility of S3 helix, observed by the Mn 2+ titration, pointed to the formation of water-filled crevices in the micelle embedded VSD-II. 15 N relaxation data revealed characteristic pattern of μs-ms time scale motions in the VSD-II regions sharing expected interhelical contacts. VSD-II demonstrated enhanced mobility at ps-ns time scale as compared to isolated VSDs of K + channels. These results validate structural studies of isolated VSDs of Na + channels and show possible pitfalls in application of this 'divide and conquer' approach. Copyright © 2017 Elsevier B.V. All rights reserved.
Ostrowski, Tim D; Dantzler, Heather A; Polo-Parada, Luis; Kline, David D
2017-05-01
Reactive oxygen species (ROS) play a profound role in cardiorespiratory function under normal physiological conditions and disease states. ROS can influence neuronal activity by altering various ion channels and transporters. Within the nucleus tractus solitarii (nTS), a vital brainstem area for cardiorespiratory control, hydrogen peroxide (H 2 O 2 ) induces sustained hyperexcitability following an initial depression of neuronal activity. The mechanism(s) associated with the delayed hyperexcitability are unknown. Here we evaluate the effect(s) of H 2 O 2 on cytosolic Ca 2+ (via fura-2 imaging) and voltage-dependent calcium currents in dissociated rat nTS neurons. H 2 O 2 perfusion (200 µM; 1 min) induced a delayed, slow, and moderate increase (~27%) in intracellular Ca 2+ concentration ([Ca 2+ ] i ). The H 2 O 2 -mediated increase in [Ca 2+ ] i prevailed during thapsigargin, excluding the endoplasmic reticulum as a Ca 2+ source. The effect, however, was abolished by removal of extracellular Ca 2+ or the addition of cadmium to the bath solution, suggesting voltage-gated Ca 2+ channels (VGCCs) as targets for H 2 O 2 modulation. Recording of the total voltage-dependent Ca 2+ current confirmed H 2 O 2 enhanced Ca 2+ entry. Blocking VGCC L, N, and P/Q subtypes decreased the number of cells and their calcium currents that respond to H 2 O 2 The number of responder cells to H 2 O 2 also decreased in the presence of dithiothreitol, suggesting the actions of H 2 O 2 were dependent on sulfhydryl oxidation. In summary, here, we have shown that H 2 O 2 increases [Ca 2+ ] i and its Ca 2+ currents, which is dependent on multiple VGCCs likely by oxidation of sulfhydryl groups. These processes presumably contribute to the previously observed delayed hyperexcitability of nTS neurons in in vitro brainstem slices. Copyright © 2017 the American Physiological Society.
Intermediate state trapping of a voltage sensor
DEFF Research Database (Denmark)
Lacroix, Jérôme J; Pless, Stephan Alexander; Maragliano, Luca
2012-01-01
Voltage sensor domains (VSDs) regulate ion channels and enzymes by undergoing conformational changes depending on membrane electrical signals. The molecular mechanisms underlying the VSD transitions are not fully understood. Here, we show that some mutations of I241 in the S1 segment of the Shaker...... Kv channel positively shift the voltage dependence of the VSD movement and alter the functional coupling between VSD and pore domains. Among the I241 mutants, I241W immobilized the VSD movement during activation and deactivation, approximately halfway between the resting and active states......, and drastically shifted the voltage activation of the ionic conductance. This phenotype, which is consistent with a stabilization of an intermediate VSD conformation by the I241W mutation, was diminished by the charge-conserving R2K mutation but not by the charge-neutralizing R2Q mutation. Interestingly, most...
Arif Malik, Muhammad; Hughes, David
2016-04-01
Improvements in ozone synthesis from air and oxygen by increasing the number density of plasma channels and lower voltage for the same specific input energy (SIE) were explored in a nonthermal plasma based on a sliding discharge. The number of plasma channels and energy per pulse increased in direct proportion to the increase in the effective length of the anode (the high voltage electrode). Decreasing the discharge gap increased the energy per pulse for the same length and allowed the installation of more electrode pairs in the same space. It allowed the increase of the number of plasma channels in the same space to achieve the same SIE at a lower peak voltage with less energy per plasma channel. The ozone concentration gradually increased to ~1500 ppmv (140 to 50 g kWh-1) from air and to ~6000 ppmv (400 to 200 g kWh-1) from oxygen with a gradual increase in the SIE to ~200 J L-1, irrespective of the variations in electrode geometry, applied voltage or flow rate of the feed gas. A gradual increase in SIE beyond 200 J L-1 gradually increased the ozone concentration to a certain maximum value followed by a decline, but the rate of increase and the maximum value was higher for the greater number of plasma channels and lower peak voltage combination. The maximum ozone concentration was ~5000 ppmv (~30 g kWh-1) from air and ~22 000 ppmv (~80 g kWh-1) from oxygen. The results are explained on the basis of characteristics of the plasma and ozone synthesis mechanism.
Smilansky, Angela; Dangoor, Liron; Nakdimon, Itay; Ben-Hail, Danya; Mizrachi, Dario; Shoshan-Barmatz, Varda
2015-12-25
The voltage-dependent anion channel 1 (VDAC1), found in the mitochondrial outer membrane, forms the main interface between mitochondrial and cellular metabolisms, mediates the passage of a variety of molecules across the mitochondrial outer membrane, and is central to mitochondria-mediated apoptosis. VDAC1 is overexpressed in post-mortem brains of Alzheimer disease (AD) patients. The development and progress of AD are associated with mitochondrial dysfunction resulting from the cytotoxic effects of accumulated amyloid β (Aβ). In this study we demonstrate the involvement of VDAC1 and a VDAC1 N-terminal peptide (VDAC1-N-Ter) in Aβ cell penetration and cell death induction. Aβ directly interacted with VDAC1 and VDAC1-N-Ter, as monitored by VDAC1 channel conductance, surface plasmon resonance, and microscale thermophoresis. Preincubated Aβ interacted with bilayer-reconstituted VDAC1 and increased its conductance ∼ 2-fold. Incubation of cells with Aβ resulted in mitochondria-mediated apoptotic cell death. However, the presence of non-cell-penetrating VDAC1-N-Ter peptide prevented Aβ cellular entry and Aβ-induced mitochondria-mediated apoptosis. Likewise, silencing VDAC1 expression by specific siRNA prevented Aβ entry into the cytosol as well as Aβ-induced toxicity. Finally, the mode of Aβ-mediated action involves detachment of mitochondria-bound hexokinase, induction of VDAC1 oligomerization, and cytochrome c release, a sequence of events leading to apoptosis. As such, we suggest that Aβ-mediated toxicity involves mitochondrial and plasma membrane VDAC1, leading to mitochondrial dysfunction and apoptosis induction. The VDAC1-N-Ter peptide targeting Aβ cytotoxicity is thus a potential new therapeutic strategy for AD treatment. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Held, Katharina; Gruss, Fabian; Aloi, Vincenzo Davide; Janssens, Annelies; Ulens, Chris; Voets, Thomas; Vriens, Joris
2018-03-31
Mutagenesis at positively charged amino acids (arginines and lysines) (R1-R4) in the voltage-sensor domain (transmembrane segment (S) 4) of voltage-gated Na + , K + and Ca 2+ channels can lead to an alternative ion permeation pathway distinct from the central pore. Recently, a non-canonical ion permeation pathway was described in TRPM3, a member of the transient receptor potential (TRP) superfamily. The non-canonical pore exists in the native TRPM3 channel and can be activated by co-stimulation of the endogenous agonist pregnenolone sulphate and the antifungal drug clotrimazole or by stimulation of the synthetic agonist CIM0216. Alignment of the voltage sensor of Shaker K + channels with the entire TRPM3 sequence revealed the highest degree of similarity in the putative S4 region of TRPM3, and suggested that only one single gating charge arginine (R2) in the putative S4 region is conserved. Mutagenesis studies in the voltage-sensing domain of TRPM3 revealed several residues in the voltage sensor (S4) as well as in S1 and S3 that are crucial for the occurrence of the non-canonical inward currents. In conclusion, this study provides evidence for the involvement of the voltage-sensing domain of TRPM3 in the formation of an alternative ion permeation pathway. Transient receptor potential (TRP) channels are cationic channels involved in a broad array of functions, including homeostasis, motility and sensory functions. TRP channel subunits consist of six transmembrane segments (S1-S6), and form tetrameric channels with a central pore formed by the region encompassing S5 and S6. Recently, evidence was provided for the existence of an alternative ion permeation pathway in TRPM3, which allows large inward currents upon hyperpolarization independently of the central pore. However, very little knowledge is available concerning the localization of this alternative pathway in the native TRPM3 channel protein. Guided by sequence homology with Shaker K + channels, in which
Subunit Stoichiometry of Human Muscle Chloride Channels
Fahlke, Christoph; Knittle, Timothy; Gurnett, Christina A.; Campbell, Kevin P.; George, Alfred L.
1997-01-01
Voltage-gated Cl? channels belonging to the ClC family appear to function as homomultimers, but the number of subunits needed to form a functional channel is controversial. To determine subunit stoichiometry, we constructed dimeric human skeletal muscle Cl? channels in which one subunit was tagged by a mutation (D136G) that causes profound changes in voltage-dependent gating. Sucrose-density gradient centrifugation experiments indicate that both monomeric and dimeric hClC-1 channels in their ...
The CaV2.3 R-type voltage-gated Ca2+ channel in mouse sleep architecture.
Siwek, Magdalena Elisabeth; Müller, Ralf; Henseler, Christina; Broich, Karl; Papazoglou, Anna; Weiergräber, Marco
2014-05-01
Voltage-gated Ca(2+) channels (VGCCs) are key elements in mediating thalamocortical rhythmicity. Low-voltage activated (LVA) CaV 3 T-type Ca(2+) channels have been related to thalamic rebound burst firing and to generation of non-rapid eye movement (NREM) sleep. High-voltage activated (HVA) CaV 1 L-type Ca(2+) channels, on the opposite, favor the tonic mode of action associated with higher levels of vigilance. However, the role of the HVA Non-L-type CaV2.3 Ca(2+) channels, which are predominantly expressed in the reticular thalamic nucleus (RTN), still remains unclear. Recently, CaV2.3(-/-) mice were reported to exhibit altered spike-wave discharge (SWD)/absence seizure susceptibility supported by the observation that CaV2.3 mediated Ca(2+) influx into RTN neurons can trigger small-conductance Ca(2+)-activated K(+)-channel type 2 (SK2) currents capable of maintaining thalamic burst activity. Based on these studies we investigated the role of CaV2.3 R-type Ca(2+) channels in rodent sleep. The role of CaV2.3 Ca(2+) channels was analyzed in CaV2.3(-/-) mice and controls in both spontaneous and artificial urethane-induced sleep, using implantable video-EEG radiotelemetry. Data were analyzed for alterations in sleep architecture using sleep staging software and time-frequency analysis. CaV2.3 deficient mice exhibited reduced wake duration and increased slow-wave sleep (SWS). Whereas mean sleep stage durations remained unchanged, the total number of SWS epochs was increased in CaV2.3(-/-) mice. Additional changes were observed for sleep stage transitions and EEG amplitudes. Furthermore, urethane-induced SWS mimicked spontaneous sleep results obtained from CaV2.3 deficient mice. Quantitative Real-time PCR did not reveal changes in thalamic CaV3 T-type Ca(2+) channel expression. The detailed mechanisms of SWS increase in CaV2.3(-/-) mice remain to be determined. Low-voltage activated CaV2.3 R-type Ca(2+) channels in the thalamocortical loop and extra
Directory of Open Access Journals (Sweden)
Alan eNeely
2014-06-01
Full Text Available Openings of high-voltage-activated calcium channels lead to a transient increase in calcium concentration that in turn activate a plethora of cellular functions, including muscle contraction, secretion and gene transcription. To coordinate all these responses calcium channels form supramolecular assemblies containing effectors and regulatory proteins that couple calcium influx to the downstream signal cascades and to feedback elements. According to the original biochemical characterization of skeletal muscle Dihydropyridine receptors, high-voltage-activated calcium channels are multi-subunit protein complexes consisting of a pore-forming subunit (α1 associated with four additional polypeptide chains β, α2, δ and γ, often referred to as accessory subunits. Twenty-five years after the first purification of a high-voltage calcium channel, the concept of a flexible stoichiometry to expand the repertoire of mechanisms that regulate calcium channel influx has emerged. Several other proteins have been identified that associate directly with the α1-subunit, including calmodulin and multiple members of the small and large GTPase family. Some of these proteins only interact with a subset of α1-subunits and during specific stages of biogenesis. More strikingly, most of the α1-subunit interacting proteins, such as the β-subunit and small GTPases, regulate both gating and trafficking through a variety of mechanisms. Modulation of channel activity covers almost all biophysical properties of the channel. Likewise, regulation of the number of channels in the plasma membrane is performed by altering the release of the α1-subunit from the endoplasmic reticulum, by reducing its degradation or enhancing its recycling back to the cell surface. In this review, we discuss the structural basis, interplay and functional role of selected proteins that interact with the central pore-forming subunit of high-voltage-activated calcium channels.
Apo calmodulin binding to the L-type voltage-gated calcium channel Cav1.2 IQ peptide
International Nuclear Information System (INIS)
Lian Luyun; Myatt, Daniel; Kitmitto, Ashraf
2007-01-01
The influx of calcium through the L-type voltage-gated calcium channels (LTCCs) is the trigger for the process of calcium-induced calcium release (CICR) from the sarcoplasmic recticulum, an essential step for cardiac contraction. There are two feedback mechanisms that regulate LTCC activity: calcium-dependent inactivation (CDI) and calcium-dependent facilitation (CDF), both of which are mediated by calmodulin (CaM) binding. The IQ domain (aa 1645-1668) housed within the cytoplasmic domain of the LTCC Ca v 1.2 subunit has been shown to bind both calcium-loaded (Ca 2+ CaM ) and calcium-free CaM (apoCaM). Here, we provide new data for the structural basis for the interaction of apoCaM with the IQ peptide using NMR, revealing that the apoCaM C-lobe residues are most significantly perturbed upon complex formation. In addition, we have employed transmission electron microscopy of purified LTCC complexes which shows that both apoCaM and Ca 2+ CaM can bind to the intact channel
Surface dynamics of voltage-gated ion channels
Heine, Martin; Ciuraszkiewicz, Anna; Voigt, Andreas; Heck, Jennifer; Bikbaev, Arthur
2016-01-01
ABSTRACT Neurons encode information in fast changes of the membrane potential, and thus electrical membrane properties are critically important for the integration and processing of synaptic inputs by a neuron. These electrical properties are largely determined by ion channels embedded in the membrane. The distribution of most ion channels in the membrane is not spatially uniform: they undergo activity-driven changes in the range of minutes to days. Even in the range of milliseconds, the composition and topology of ion channels are not static but engage in highly dynamic processes including stochastic or activity-dependent transient association of the pore-forming and auxiliary subunits, lateral diffusion, as well as clustering of different channels. In this review we briefly discuss the potential impact of mobile sodium, calcium and potassium ion channels and the functional significance of this for individual neurons and neuronal networks. PMID:26891382
PIP2 mediates functional coupling and pharmacology of neuronal KCNQ channels
DEFF Research Database (Denmark)
Kim, Robin Y; Pless, Stephan A; Kurata, Harley T
2017-01-01
Retigabine (RTG) is a first-in-class antiepileptic drug that suppresses neuronal excitability through the activation of voltage-gated KCNQ2-5 potassium channels. Retigabine binds to the pore-forming domain, causing a hyperpolarizing shift in the voltage dependence of channel activation. To elucid......Retigabine (RTG) is a first-in-class antiepileptic drug that suppresses neuronal excitability through the activation of voltage-gated KCNQ2-5 potassium channels. Retigabine binds to the pore-forming domain, causing a hyperpolarizing shift in the voltage dependence of channel activation....... These findings reveal an important role for PIP2 in coupling retigabine binding to altered VSD function. We identify a polybasic motif in the proximal C terminus of retigabine-sensitive KCNQ channels that contributes to VSD-pore coupling via PIP2, and thereby influences the unique gating effects of retigabine....
Kang, Bok Eum; Baker, Bradley J
2016-04-04
An in silico search strategy was developed to identify potential voltage-sensing domains (VSD) for the development of genetically encoded voltage indicators (GEVIs). Using a conserved charge distribution in the S2 α-helix, a single in silico search yielded most voltage-sensing proteins including voltage-gated potassium channels, voltage-gated calcium channels, voltage-gated sodium channels, voltage-gated proton channels, and voltage-sensing phosphatases from organisms ranging from mammals to bacteria and plants. A GEVI utilizing the VSD from a voltage-gated proton channel identified from that search was able to optically report changes in membrane potential. In addition this sensor was capable of manipulating the internal pH while simultaneously reporting that change optically since it maintains the voltage-gated proton channel activity of the VSD. Biophysical characterization of this GEVI, Pado, demonstrated that the voltage-dependent signal was distinct from the pH-dependent signal and was dependent on the movement of the S4 α-helix. Further investigation into the mechanism of the voltage-dependent optical signal revealed that inhibiting the dimerization of the fluorescent protein greatly reduced the optical signal. Dimerization of the FP thereby enabled the movement of the S4 α-helix to mediate a fluorescent response.
Equilibrium fluctuation relations for voltage coupling in membrane proteins.
Kim, Ilsoo; Warshel, Arieh
2015-11-01
A general theoretical framework is developed to account for the effects of an external potential on the energetics of membrane proteins. The framework is based on the free energy relation between two (forward/backward) probability densities, which was recently generalized to non-equilibrium processes, culminating in the work-fluctuation theorem. Starting from the probability densities of the conformational states along the "voltage coupling" reaction coordinate, we investigate several interconnected free energy relations between these two conformational states, considering voltage activation of ion channels. The free energy difference between the two conformational states at zero (depolarization) membrane potential (i.e., known as the chemical component of free energy change in ion channels) is shown to be equivalent to the free energy difference between the two "equilibrium" (resting and activated) conformational states along the one-dimensional voltage couplin reaction coordinate. Furthermore, the requirement that the application of linear response approximation to the free energy functionals of voltage coupling should satisfy the general free energy relations, yields a novel closed-form expression for the gating charge in terms of other basic properties of ion channels. This connection is familiar in statistical mechanics, known as the equilibrium fluctuation-response relation. The theory is illustrated by considering the coupling of a unit charge to the external voltage in the two sites near the surface of membrane, representing the activated and resting states. This is done using a coarse-graining (CG) model of membrane proteins, which includes the membrane, the electrolytes and the electrodes. The CG model yields Marcus-type voltage dependent free energy parabolas for the response of the electrostatic environment (electrolytes etc.) to the transition from the initial to the final configuratinal states, leading to equilibrium free energy difference and free
Budelier, Melissa M; Cheng, Wayland W L; Bergdoll, Lucie; Chen, Zi-Wei; Janetka, James W; Abramson, Jeff; Krishnan, Kathiresan; Mydock-McGrane, Laurel; Covey, Douglas F; Whitelegge, Julian P; Evers, Alex S
2017-06-02
Voltage-dependent anion channel-1 (VDAC1) is a highly regulated β-barrel membrane protein that mediates transport of ions and metabolites between the mitochondria and cytosol of the cell. VDAC1 co-purifies with cholesterol and is functionally regulated by cholesterol, among other endogenous lipids. Molecular modeling studies based on NMR observations have suggested five cholesterol-binding sites in VDAC1, but direct experimental evidence for these sites is lacking. Here, to determine the sites of cholesterol binding, we photolabeled purified mouse VDAC1 (mVDAC1) with photoactivatable cholesterol analogues and analyzed the photolabeled sites with both top-down mass spectrometry (MS), and bottom-up MS paired with a clickable, stable isotope-labeled tag, FLI -tag. Using cholesterol analogues with a diazirine in either the 7 position of the steroid ring (LKM38) or the aliphatic tail (KK174), we mapped a binding pocket in mVDAC1 localized to Thr 83 and Glu 73 , respectively. When Glu 73 was mutated to a glutamine, KK174 no longer photolabeled this residue, but instead labeled the nearby Tyr 62 within this same binding pocket. The combination of analytical strategies employed in this work permits detailed molecular mapping of a cholesterol-binding site in a protein, including an orientation of the sterol within the site. Our work raises the interesting possibility that cholesterol-mediated regulation of VDAC1 may be facilitated through a specific binding site at the functionally important Glu 73 residue. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Adela Banciu
2018-05-01
Full Text Available Voltage-gated calcium channels and estrogen receptors are essential players in uterine physiology, and their association with different calcium signaling pathways contributes to healthy and pathological conditions of the uterine myometrium. Among the properties of the various cell subtypes present in human uterine myometrium, there is increasing evidence that calcium oscillations in telocytes (TCs contribute to contractile activity and pregnancy. Our study aimed to evaluate the effects of beta-estradiol on voltage-gated calcium channels and estrogen receptors in TCs from human uterine myometrium and to understand their role in pregnancy. For this purpose, we employed patch-clamp recordings, ratiometric Fura-2-based calcium imaging analysis, and qRT-PCR techniques for the analysis of cultured human myometrial TCs derived from pregnant and non-pregnant uterine samples. In human myometrial TCs from both non-pregnant and pregnant uterus, we evidenced by qRT-PCR the presence of genes encoding for voltage-gated calcium channels (Cav3.1, Ca3.2, Cav3.3, Cav2.1, estrogen receptors (ESR1, ESR2, GPR30, and nuclear receptor coactivator 3 (NCOA3. Pregnancy significantly upregulated Cav3.1 and downregulated Cav3.2, Cav3.3, ESR1, ESR2, and NCOA3, compared to the non-pregnant condition. Beta-estradiol treatment (24 h, 10, 100, 1000 nM downregulated Cav3.2, Cav3.3, Cav1.2, ESR1, ESR2, GRP30, and NCOA3 in TCs from human pregnant uterine myometrium. We also confirmed the functional expression of voltage-gated calcium channels by patch-clamp recordings and calcium imaging analysis of TCs from pregnant human myometrium by perfusing with BAY K8644, which induced calcium influx through these channels. Additionally, we demonstrated that beta-estradiol (1000 nM antagonized the effect of BAY K8644 (2.5 or 5 µM in the same preparations. In conclusion, we evidenced the presence of voltage-gated calcium channels and estrogen receptors in TCs from non-pregnant and pregnant
Banciu, Adela; Banciu, Daniel Dumitru; Mustaciosu, Cosmin Catalin; Radu, Mihai; Cretoiu, Dragos; Xiao, Junjie; Cretoiu, Sanda Maria; Suciu, Nicolae; Radu, Beatrice Mihaela
2018-05-09
Voltage-gated calcium channels and estrogen receptors are essential players in uterine physiology, and their association with different calcium signaling pathways contributes to healthy and pathological conditions of the uterine myometrium. Among the properties of the various cell subtypes present in human uterine myometrium, there is increasing evidence that calcium oscillations in telocytes (TCs) contribute to contractile activity and pregnancy. Our study aimed to evaluate the effects of beta-estradiol on voltage-gated calcium channels and estrogen receptors in TCs from human uterine myometrium and to understand their role in pregnancy. For this purpose, we employed patch-clamp recordings, ratiometric Fura-2-based calcium imaging analysis, and qRT-PCR techniques for the analysis of cultured human myometrial TCs derived from pregnant and non-pregnant uterine samples. In human myometrial TCs from both non-pregnant and pregnant uterus, we evidenced by qRT-PCR the presence of genes encoding for voltage-gated calcium channels (Cav3.1, Ca3.2, Cav3.3, Cav2.1), estrogen receptors (ESR1, ESR2, GPR30), and nuclear receptor coactivator 3 (NCOA3). Pregnancy significantly upregulated Cav3.1 and downregulated Cav3.2, Cav3.3, ESR1, ESR2, and NCOA3, compared to the non-pregnant condition. Beta-estradiol treatment (24 h, 10, 100, 1000 nM) downregulated Cav3.2, Cav3.3, Cav1.2, ESR1, ESR2, GRP30, and NCOA3 in TCs from human pregnant uterine myometrium. We also confirmed the functional expression of voltage-gated calcium channels by patch-clamp recordings and calcium imaging analysis of TCs from pregnant human myometrium by perfusing with BAY K8644, which induced calcium influx through these channels. Additionally, we demonstrated that beta-estradiol (1000 nM) antagonized the effect of BAY K8644 (2.5 or 5 µM) in the same preparations. In conclusion, we evidenced the presence of voltage-gated calcium channels and estrogen receptors in TCs from non-pregnant and pregnant human uterine
Lundby, Alicia; Akemann, Walther; Knöpfel, Thomas
2010-11-01
A voltage sensitive phosphatase was discovered in the ascidian Ciona intestinalis. The phosphatase, Ci-VSP, contains a voltage-sensing domain homologous to those known from voltage-gated ion channels, but unlike ion channels, the voltage-sensing domain of Ci-VSP can reside in the cell membrane as a monomer. We fused the voltage-sensing domain of Ci-VSP to a pair of fluorescent reporter proteins to generate a genetically encodable voltage-sensing fluorescent probe, VSFP2.3. VSFP2.3 is a fluorescent voltage probe that reports changes in membrane potential as a FRET (fluorescence resonance energy transfer) signal. Here we report sensing current measurements from VSFP2.3, and show that VSFP2.3 carries 1.2 e sensing charges, which are displaced within 1.5 ms. The sensing currents become faster at higher temperatures, and the voltage dependence of the decay time constants is temperature dependent. Neutralization of an arginine in S4, previously suggested to be a sensing charge, and measuring associated sensing currents indicate that this charge is likely to reside at the membrane-aqueous interface rather than within the membrane electric field. The data presented give us insights into the voltage-sensing mechanism of Ci-VSP, which will allow us to further improve the sensitivity and kinetics of the family of VSFP proteins.
Skyrmion-based multi-channel racetrack
Song, Chengkun; Jin, Chendong; Wang, Jinshuai; Xia, Haiyan; Wang, Jianbo; Liu, Qingfang
2017-11-01
Magnetic skyrmions are promising for the application of racetrack memories, logic gates, and other nano-devices, owing to their topologically protected stability, small size, and low driving current. In this work, we propose a skyrmion-based multi-channel racetrack memory where the skyrmion moves in the selected channel by applying voltage-controlled magnetic anisotropy gates. It is demonstrated numerically that a current-dependent skyrmion Hall effect can be restrained by the additional potential of the voltage-controlled region, and the skyrmion velocity and moving channel in the racetrack can be operated by tuning the voltage-controlled magnetic anisotropy, gate position, and current density. Our results offer a potential application of racetrack memory based on skyrmions.
Developmental regulation of voltage-sensitive sodium channels in rat skeletal muscle
International Nuclear Information System (INIS)
Sherman, S.J.
1985-01-01
The developmental regulation of the voltage-sensitive Na + channel in rat skeletal muscle was studied in vivo and in vitro. In triceps surae muscle developing in vivo the development of TTX-sensitive Na + channel occurred primarily during the first three postnatal weeks as determined by the specific binding of [ 3 H]saxitoxin. This development proceeded in two separate phases. The first phase occurs independently of continuing motor neuron innervation and accounts for 60% of the adult density of TTX-sensitive Na + channels. The second phase, which begins about day 11, requires innervation. Muscle cells in primary culture were found to have both TTX-sensitive and insensitive Na + channels. The development of the TTX-sensitive channel, in vitro, paralleled the initial innervation-independent phase of development observed in vivo. The density of TTX-sensitive Na + channels in cultured muscle cells was regulated by electrical activity and cytosolic Ca ++ levels. Pharmacological blockade of the spontaneous electrical activity present in these cells lead to a nearly 2-fold increase in the surface density of TTX-sensitive channels. The turnover time of the TTX-sensitive Na + channel was measured by blocking the incorporation of newly synthesized channels with tunicamycin, an inhibitor of N-linked protein glycosylation. The regulation of channel density by electrical activity, cytosolic Ca ++ levels, and agents affecting cyclic neucleotide levels had no effect on the turnover time of the TTX-sensitive Na + channel, indicating that these regulatory agents instead affect the synthesis of the channel
Independent and cooperative motions of the Kv1.2 channel: voltage sensing and gating.
Yeheskel, Adva; Haliloglu, Turkan; Ben-Tal, Nir
2010-05-19
Voltage-gated potassium (Kv) channels, such as Kv1.2, are involved in the generation and propagation of action potentials. The Kv channel is a homotetramer, and each monomer is composed of a voltage-sensing domain (VSD) and a pore domain (PD). We analyzed the fluctuations of a model structure of Kv1.2 using elastic network models. The analysis suggested a network of coupled fluctuations of eight rigid structural units and seven hinges that may control the transition between the active and inactive states of the channel. For the most part, the network is composed of amino acids that are known to affect channel activity. The results suggested allosteric interactions and cooperativity between the subunits in the coupling between the motion of the VSD and the selectivity filter of the PD, in accordance with recent empirical data. There are no direct contacts between the VSDs of the four subunits, and the contacts between these and the PDs are loose, suggesting that the VSDs are capable of functioning independently. Indeed, they manifest many inherent fluctuations that are decoupled from the rest of the structure. In general, the analysis suggests that the two domains contribute to the channel function both individually and cooperatively. Copyright 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Hsieh, Ming-Chun; Ho, Yu-Cheng; Lai, Cheng-Yuan; Wang, Hsueh-Hsiao; Lee, An-Sheng; Cheng, Jen-Kun; Chau, Yat-Pang; Peng, Hsien-Yu
2017-11-01
Bromodomain-containing protein 4 binds acetylated promoter histones and promotes transcription; however, the role of bromodomain-containing protein 4 in inflammatory hyperalgesia remains unclear. Male Sprague-Dawley rats received hind paw injections of complete Freund's adjuvant to induce hyperalgesia. The dorsal root ganglia were examined to detect changes in bromodomain-containing protein 4 expression and the activation of genes involved in the expression of voltage-gated sodium channel 1.7, which is a key pain-related ion channel. The intraplantar complete Freund's adjuvant injections resulted in thermal hyperalgesia (4.0 ± 1.5 s; n = 7). The immunohistochemistry and immunoblotting results demonstrated an increase in the bromodomain-containing protein 4-expressing dorsal root ganglia neurons (3.78 ± 0.38 fold; n = 7) and bromodomain-containing protein 4 protein levels (2.62 ± 0.39 fold; n = 6). After the complete Freund's adjuvant injection, histone H3 protein acetylation was enhanced in the voltage-gated sodium channel 1.7 promoter, and cyclin-dependent kinase 9 and phosphorylation of RNA polymerase II were recruited to this area. Furthermore, the voltage-gated sodium channel 1.7-mediated currents were enhanced in neurons of the complete Freund's adjuvant rats (55 ± 11 vs. 19 ± 9 pA/pF; n = 4 to 6 neurons). Using bromodomain-containing protein 4-targeted antisense small interfering RNA to the complete Freund's adjuvant-treated rats, the authors demonstrated a reduction in the expression of bromodomain-containing protein 4 (0.68 ± 0.16 fold; n = 7), a reduction in thermal hyperalgesia (7.5 ± 1.5 s; n = 7), and a reduction in the increased voltage-gated sodium channel 1.7 currents (21 ± 4 pA/pF; n = 4 to 6 neurons). Complete Freund's adjuvant triggers enhanced bromodomain-containing protein 4 expression, ultimately leading to the enhanced excitability of nociceptive neurons and thermal hyperalgesia. This effect is
Wilders, R.; Jongsma, H. J.
1992-01-01
The electrical properties of gap junctions in cell pairs are usually studied by means of the dual voltage clamp method. The voltage across the junctional channels, however, cannot be controlled adequately due to an artificial resistance and a natural resistance, both connected in series with the gap
alpha-helical structural elements within the voltage-sensing domains of a K(+) channel.
Li-Smerin, Y; Hackos, D H; Swartz, K J
2000-01-01
Voltage-gated K(+) channels are tetramers with each subunit containing six (S1-S6) putative membrane spanning segments. The fifth through sixth transmembrane segments (S5-S6) from each of four subunits assemble to form a central pore domain. A growing body of evidence suggests that the first four segments (S1-S4) comprise a domain-like voltage-sensing structure. While the topology of this region is reasonably well defined, the secondary and tertiary structures of these transmembrane segments are not. To explore the secondary structure of the voltage-sensing domains, we used alanine-scanning mutagenesis through the region encompassing the first four transmembrane segments in the drk1 voltage-gated K(+) channel. We examined the mutation-induced perturbation in gating free energy for periodicity characteristic of alpha-helices. Our results are consistent with at least portions of S1, S2, S3, and S4 adopting alpha-helical secondary structure. In addition, both the S1-S2 and S3-S4 linkers exhibited substantial helical character. The distribution of gating perturbations for S1 and S2 suggest that these two helices interact primarily with two environments. In contrast, the distribution of perturbations for S3 and S4 were more complex, suggesting that the latter two helices make more extensive protein contacts, possibly interfacing directly with the shell of the pore domain.
Directory of Open Access Journals (Sweden)
Zhongming Ma
Full Text Available The position of the voltage-sensing transmembrane segment, S4, in voltage-gated ion channels as a function of voltage remains incompletely elucidated. Site-3 toxins bind primarily to the extracellular loops connecting transmembrane helical segments S1-S2 and S3-S4 in Domain 4 (D4 and S5-S6 in Domain 1 (D1 and slow fast-inactivation of voltage-gated sodium channels. As S4 of the human skeletal muscle voltage-gated sodium channel, hNav1.4, moves in response to depolarization from the resting to the inactivated state, two D4S4 reporters (R2C and R3C, Arg1451Cys and Arg1454Cys, respectively move from internal to external positions as deduced by reactivity to internally or externally applied sulfhydryl group reagents, methane thiosulfonates (MTS. The changes in reporter reactivity, when cycling rapidly between hyperpolarized and depolarized voltages, enabled determination of the positions of the D4 voltage-sensor and of its rate of movement. Scorpion α-toxin binding impedes D4S4 segment movement during inactivation since the modification rates of R3C in hNav1.4 with methanethiosulfonate (CH3SO2SCH2CH2R, where R = -N(CH33 (+ trimethylammonium, MTSET and benzophenone-4-carboxamidocysteine methanethiosulfonate (BPMTS were slowed ~10-fold in toxin-modified channels. Based upon the different size, hydrophobicity and charge of the two reagents it is unlikely that the change in reactivity is due to direct or indirect blockage of access of this site to reagent in the presence of toxin (Tx, but rather is the result of inability of this segment to move outward to the normal extent and at the normal rate in the toxin-modified channel. Measurements of availability of R3C to internally applied reagent show decreased access (slower rates of thiol reaction providing further evidence for encumbered D4S4 movement in the presence of toxins consistent with the assignment of at least part of the toxin binding site to the region of D4S4 region of the voltage
Blöcker, Dagmar; Bachmeyer, Christoph; Benz, Roland; Aktories, Klaus; Barth, Holger
2003-05-13
The binding component (C2II) of the binary Clostridium botulinum C2 toxin mediates transport of the actin ADP-ribosylating enzyme component (C2I) into the cytosol of target cells. C2II (80 kDa) is activated by trypsin cleavage, and proteolytically activated C2II (60 kDa) oligomerizes to heptamers in solution. Activated C2II forms channels in lipid bilayer membranes which are highly cation selective and voltage-gated. A role for this channel in C2I translocation across the cell membrane into the cytosol is discussed. Amino acid residues 303-331 of C2II contain a conserved pattern of alternating hydrophobic and hydrophilic residues, which likely facilitates membrane insertion and channel formation by creating two antiparallel beta-strands. Some of the residues are in strategic positions within the putative C2II channel, in particular, glutamate 307 (E307) localized in its center and glycine 316 (G316) localized on the trans side of the membrane. Here, single-lysine substitutions of these amino acids and the double mutant E307K/G316K of C2II were analyzed in vivo and in artificial lipid bilayer experiments. The pH dependence of C2I transport across cellular membranes was altered, and a pH of properties of C2II were substantially changed by the mutations, as evidenced by reduced cation selectivity. Interestingly, the voltage dependence of wild-type C2II was completely lost for the E307K mutant, which means that E307 is responsible for voltage gating. Chloroquine blocked the E307K mutant channel and intoxication of Vero cells by mutant C2II and C2I, indicating that chloroquine binding does not involve E307. Overall, the voltage gating and cation selectivity of the C2II channel do not play an important role in translocation of C2I into the cytosol.
International Nuclear Information System (INIS)
Lytvynenko, Ia.M.; Hauet, T.; Montaigne, F.; Bibyk, V.V.; Andrieu, S.
2015-01-01
Interplay between voltage-induced magnetic anisotropy transition and voltage-induced atomic diffusion is studied in epitaxial V/Fe (0.7 nm)/ MgO/ Fe(5 nm)/Co/Au magnetic tunnel junction where thin Fe soft electrode has in-plane or out-of-plane anisotropy depending on the sign of the bias voltage. We investigate the origin of the slow resistance variation occurring when switching bias voltage in opposite polarity. We demonstrate that the time to reach resistance stability after voltage switching is reduced when increasing the voltage amplitude or the temperature. A single energy barrier of about 0.2 eV height is deduced from temperature dependence. Finally, we demonstrate that the resistance change is not correlated to a change in soft electrode anisotropy. This conclusion contrasts with observations recently reported on analogous systems. - Highlights: • Voltage-induced time dependence of resistance is studied in epitaxial Fe/MgO/Fe. • Resistance change is not related to the bottom Fe/MgO interface. • The effect is thermally activated with an energy barrier of the order of 0.2 eV height
New Conotoxin SO-3 Targeting N-type Voltage-Sensitive Calcium Channels
Directory of Open Access Journals (Sweden)
Lei Wen
2006-04-01
Full Text Available Selective blockers of the N-type voltage-sensitive calcium (CaV channels are useful in the management of severe chronic pain. Here, the structure and function characteristics of a novel N-type CaV channel blocker, SO-3, are reviewed. SO-3 is a 25-amino acid conopeptide originally derived from the venom of Conus striatus, and contains the same 4-loop, 6-cysteine framework (C-C-CC-C-C as O-superfamily conotoxins. The synthetic SO-3 has high analgesic activity similar to É-conotoxin MVIIA (MVIIA, a selective N-type CaV channel blocker approved in the USA and Europe for the alleviation of persistent pain states. In electrophysiological studies, SO-3 shows more selectivity towards the N-type CaV channels than MVIIA. The dissimilarity between SO-3 and MVIIA in the primary and tertiary structures is further discussed in an attempt to illustrate the difference in selectivity of SO-3 and MVIIA towards N-type CaV channels.
S1 constrains S4 in the voltage sensor domain of Kv7.1 K+ channels.
Directory of Open Access Journals (Sweden)
Yoni Haitin
Full Text Available Voltage-gated K(+ channels comprise a central pore enclosed by four voltage-sensing domains (VSDs. While movement of the S4 helix is known to couple to channel gate opening and closing, the nature of S4 motion is unclear. Here, we substituted S4 residues of Kv7.1 channels by cysteine and recorded whole-cell mutant channel currents in Xenopus oocytes using the two-electrode voltage-clamp technique. In the closed state, disulfide and metal bridges constrain residue S225 (S4 nearby C136 (S1 within the same VSD. In the open state, two neighboring I227 (S4 are constrained at proximity while residue R228 (S4 is confined close to C136 (S1 of an adjacent VSD. Structural modeling predicts that in the closed to open transition, an axial rotation (approximately 190 degrees and outward translation of S4 (approximately 12 A is accompanied by VSD rocking. This large sensor motion changes the intra-VSD S1-S4 interaction to an inter-VSD S1-S4 interaction. These constraints provide a ground for cooperative subunit interactions and suggest a key role of the S1 segment in steering S4 motion during Kv7.1 gating.
International Nuclear Information System (INIS)
Cohen-Armon, M.; Garty, H.; Sokolovsky, M.
1988-01-01
The authors previous experiments in membranes prepared from rat heart and brain led them to suggest that the binding of agonist to the muscarinic receptors and to the Na + channels is a coupled event mediated by guanine nucleotide binding protein(s) [G-protein(s)]. These in vitro findings prompted us to employ synaptoneurosomes from brain stem tissue to examine (i) the binding properties of [ 3 H] acetylcholine at resting potential and under depolarization conditions in the absence and presence of pertussis toxin; (ii) the binding of [ 3 H]batrachotoxin to Na + channel(s) in the presence of the muscarinic agonists; and (iii) muscarinically induced 22 Na + uptake in the presence and absence of tetrodotoxin, which blocks Na + channels. The findings indicate that agonist binding to muscarinic receptors is voltage dependent, that this process is mediated by G-protein(s), and that muscarinic agonists induce opening of Na + channels. The latter process persists even after pertussis toxin treatment, indicating that it is not likely to be mediated by pertussis toxin sensitive G-protein(s). The system with its three interacting components-receptor, G-protein, and Na + channel-is such that at resting potential the muscarinic receptor induces opening of Na + channels; this property may provide a possible physiological mechanism for the depolarization stimulus necessary for autoexcitation or repetitive firing in heart or brain tissues
Interaction of a dinoflagellate neurotoxin with voltage-activated ion channels in a marine diatom.
Kitchen, Sheila A; Bourdelais, Andrea J; Taylor, Alison R
2018-01-01
The potent neurotoxins produced by the harmful algal bloom species Karenia brevis are activators of sodium voltage-gated channels (VGC) in animals, resulting in altered channel kinetics and membrane hyperexcitability. Recent biophysical and genomic evidence supports widespread presence of homologous sodium (Na + ) and calcium (Ca 2+ ) permeable VGCs in unicellular algae, including marine phytoplankton. We therefore hypothesized that VGCs of these phytoplankton may be an allelopathic target for waterborne neurotoxins produced by K. brevis blooms that could lead to ion channel dysfunction and disruption of signaling in a similar manner to animal Na + VGCs. We examined the interaction of brevetoxin-3 (PbTx-3), a K. brevis neurotoxin, with the Na + /Ca 2+ VGC of the non-toxic diatom Odontella sinensi s using electrophysiology. Single electrode current- and voltage- clamp recordings from O. sinensis in the presence of PbTx-3 were used to examine the toxin's effect on voltage gated Na + /Ca 2+ currents. In silico analysis was used to identify the putative PbTx binding site in the diatoms. We identified Na + /Ca 2+ VCG homologs from the transcriptomes and genomes of 12 diatoms, including three transcripts from O. sinensis and aligned them with site-5 of Na + VGCs, previously identified as the PbTx binding site in animals. Up to 1 µM PbTx had no effect on diatom resting membrane potential or membrane excitability. The kinetics of fast inward Na + /Ca 2+ currents that underlie diatom action potentials were also unaffected. However, the peak inward current was inhibited by 33%, delayed outward current was inhibited by 25%, and reversal potential of the currents shifted positive, indicating a change in permeability of the underlying channels. Sequence analysis showed a lack of conservation of the PbTx binding site in diatom VGC homologs, many of which share molecular features more similar to single-domain bacterial Na + /Ca 2+ VGCs than the 4-domain eukaryote channels
Burke, Ryan C; Bardet, Sylvia M; Carr, Lynn; Romanenko, Sergii; Arnaud-Cormos, Delia; Leveque, Philippe; O'Connor, Rodney P
2017-10-01
Nanosecond pulsed electric fields (nsPEFs) have a variety of applications in the biomedical and biotechnology industries. Cancer treatment has been at the forefront of investigations thus far as nsPEFs permeabilize cellular and intracellular membranes leading to apoptosis and necrosis. nsPEFs may also influence ion channel gating and have the potential to modulate cell physiology without poration of the membrane. This phenomenon was explored using live cell imaging and a sensitive fluorescent probe of transmembrane voltage in the human glioblastoma cell line, U87 MG, known to express a number of voltage-gated ion channels. The specific ion channels involved in the nsPEF response were screened using a membrane potential imaging approach and a combination of pharmacological antagonists and ion substitutions. It was found that a single 10ns pulsed electric field of 34kV/cm depolarizes the transmembrane potential of cells by acting on specific voltage-sensitive ion channels; namely the voltage and Ca2 + gated BK potassium channel, L- and T-type calcium channels, and the TRPM8 transient receptor potential channel. Copyright © 2017 Elsevier B.V. All rights reserved.
Modulation of voltage-gated channel currents by harmaline and harmane
Splettstoesser, Frank; Bonnet, Udo; Wiemann, Martin; Bingmann, Dieter; Büsselberg, Dietrich
2004-01-01
Harmala alkaloids are endogenous substances, which are involved in neurodegenerative disorders such as M. Parkinson, but some of them also have neuroprotective effects in the nervous system.While several sites of action at the cellular level (e.g. benzodiazepine receptors, 5-HT and GABAA receptors) have been identified, there is no report on how harmala alkaloids interact with voltage-gated membrane channels.The aim of this study was to investigate the effects of harmaline and harmane on volt...
Vector spin modeling for magnetic tunnel junctions with voltage dependent effects
International Nuclear Information System (INIS)
Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.
2014-01-01
Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects
α-Helical Structural Elements within the Voltage-Sensing Domains of a K+ Channel
Li-Smerin, Yingying; Hackos, David H.; Swartz, Kenton J.
2000-01-01
Voltage-gated K+ channels are tetramers with each subunit containing six (S1–S6) putative membrane spanning segments. The fifth through sixth transmembrane segments (S5–S6) from each of four subunits assemble to form a central pore domain. A growing body of evidence suggests that the first four segments (S1–S4) comprise a domain-like voltage-sensing structure. While the topology of this region is reasonably well defined, the secondary and tertiary structures of these transmembrane segments are not. To explore the secondary structure of the voltage-sensing domains, we used alanine-scanning mutagenesis through the region encompassing the first four transmembrane segments in the drk1 voltage-gated K+ channel. We examined the mutation-induced perturbation in gating free energy for periodicity characteristic of α-helices. Our results are consistent with at least portions of S1, S2, S3, and S4 adopting α-helical secondary structure. In addition, both the S1–S2 and S3–S4 linkers exhibited substantial helical character. The distribution of gating perturbations for S1 and S2 suggest that these two helices interact primarily with two environments. In contrast, the distribution of perturbations for S3 and S4 were more complex, suggesting that the latter two helices make more extensive protein contacts, possibly interfacing directly with the shell of the pore domain. PMID:10613917
Escitalopram block of hERG potassium channels.
Chae, Yun Ju; Jeon, Ji Hyun; Lee, Hong Joon; Kim, In-Beom; Choi, Jin-Sung; Sung, Ki-Wug; Hahn, Sang June
2014-01-01
Escitalopram, a selective serotonin reuptake inhibitor, is the pharmacologically active S-enantiomer of the racemic mixture of RS-citalopram and is widely used in the treatment of depression. The effects of escitalopram and citalopram on the human ether-a-go-go-related gene (hERG) channels expressed in human embryonic kidney cells were investigated using voltage-clamp and Western blot analyses. Both drugs blocked hERG currents in a concentration-dependent manner with an IC50 value of 2.6 μM for escitalopram and an IC50 value of 3.2 μM for citalopram. The blocking of hERG by escitalopram was voltage-dependent, with a steep increase across the voltage range of channel activation. However, voltage independence was observed over the full range of activation. The blocking by escitalopram was frequency dependent. A rapid application of escitalopram induced a rapid and reversible blocking of the tail current of hERG. The extent of the blocking by escitalopram during the depolarizing pulse was less than that during the repolarizing pulse, suggesting that escitalopram has a high affinity for the open state of the hERG channel, with a relatively lower affinity for the inactivated state. Both escitalopram and citalopram produced a reduction of hERG channel protein trafficking to the plasma membrane but did not affect the short-term internalization of the hERG channel. These results suggest that escitalopram blocked hERG currents at a supratherapeutic concentration and that it did so by preferentially binding to both the open and the inactivated states of the channels and by inhibiting the trafficking of hERG channel protein to the plasma membrane.
Manipulating the voltage dependence of tunneling spin torques
Manchon, Aurelien
2012-10-01
Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.
Pharmacological dissection of K(v)7.1 channels in systemic and pulmonary arteries
DEFF Research Database (Denmark)
Chadha, Preet S; Zunke, Friederike; Davis, Alison J
2012-01-01
The aim of this study was to characterize the functional impact of KCNQ1-encoded voltage-dependent potassium channels (K(v)7.1) in the vasculature.......The aim of this study was to characterize the functional impact of KCNQ1-encoded voltage-dependent potassium channels (K(v)7.1) in the vasculature....
24-channel dual microcontroller-based voltage controller for ion optics remote control
Bengtsson, L.
2018-05-01
The design of a 24-channel voltage control instrument for Wenzel Elektronik N1130 NIM modules is described. This instrument is remote controlled from a LabVIEW GUI on a host Windows computer and is intended for ion optics control in electron affinity measurements on negative ions at the CERN-ISOLDE facility. Each channel has a resolution of 12 bits and has a normally distributed noise with a standard deviation of <1 mV. The instrument is designed as a standard 2-unit NIM module where the electronic hardware consists of a printed circuit board with two asynchronously operating microcontrollers.
Role of voltage-gated L-type Ca2+ channel isoforms for brain function.
Striessnig, J; Koschak, A; Sinnegger-Brauns, M J; Hetzenauer, A; Nguyen, N K; Busquet, P; Pelster, G; Singewald, N
2006-11-01
Voltage-gated LTCCs (L-type Ca2+ channels) are established drug targets for the treatment of cardiovascular diseases. LTCCs are also expressed outside the cardiovascular system. In the brain, LTCCs control synaptic plasticity in neurons, and DHP (dihydropyridine) LTCC blockers such as nifedipine modulate brain function (such as fear memory extinction and depression-like behaviour). Voltage-sensitive Ca2+ channels Cav1 .2 and Cav1.3 are the predominant brain LTCCs. As DHPs and other classes of organic LTCC blockers inhibit both isoforms, their pharmacological distinction is impossible and their individual contributions to defined brain functions remain largely unknown. Here, we summarize our recent experiments with two genetically modified mouse strains, which we generated to explore the individual biophysical features of Cav1.2 and Cav1.3 LTCCs and to determine their relative contributions to various physiological peripheral and neuronal functions. The results described here also allow predictions about the pharmacotherapeutic potential of isoform-selective LTCC modulators.
Energy Technology Data Exchange (ETDEWEB)
Bean, Bruce Palmer [Univ. of Rochester, NY (United States)
1979-01-01
The effects of ether and halothane on membrane currents in the voltage clamped crayfish giant axon membrane were investigated. Concentrations of ether up to 300 mM and of halothane up to 32 mM had no effect on resting potential or leakage conductance. Ether and halothane reduced the size of sodium currents without changing the voltage dependence of the peak currents or their reversal potential. Ether and halothane also produced a reversible, dose-dependent speeding of sodium current decay at all membrane potentials. Ether reduced the time constants for inactivation, and also shifted the midpoint of the steady-state inactivation curve in the hyperpolarizing direction. Potassium currents were smaller with ether present, with no change in the voltage dependence of steady-state currents. The activation of potassium channels was faster with ether present. There was no apparent change in the capacitance of the crayfish giant axon membrane with ether concentrations of up to 100 mM. Experiments on sodium channel inactivation kinetics were performed using 4-aminopyridine to block potassium currents. Sodium currents decayed with a time course generally fit well by a single exponential. The time constant of decay was a steep function of voltage, especially in the negative resistance region of the peak current vs voltage relation.The time course of inactivation was very similar to that of the decay of the current at the same potential. The measurement of steady-state inactivation curves with different test pulses showed no shifts along the voltage asix. The voltage-dependence of the integral of sodium conductance was measured to test models of sodium channel inactivation in which channels must open before inactivating; the results appear inconsistent with some of the simplest cases of such models.
Antibodies to voltage-gated potassium and calcium channels in epilepsy.
Majoie, H J Marian; de Baets, Mark; Renier, Willy; Lang, Bethan; Vincent, Angela
2006-10-01
To determine the prevalence of antibodies to ion channels in patients with long standing epilepsy. Although the CNS is thought to be protected from circulating antibodies by the blood brain barrier, glutamate receptor antibodies have been reported in Rasmussen's encephalitis, glutamic acid decarboxylase (GAD) antibodies have been found in a few patients with epilepsy, and antibodies to voltage-gated potassium channels (VGKC) have been found in a non-paraneoplastic form of limbic encephalitis (with amnesia and seizures) that responds to immunosuppressive therapy. We retrospectively screened sera from female epilepsy patients (n=106) for autoantibodies to VGKC (Kv 1.1, 1.2 or 1.6), voltage-gated calcium channels (VGCC) (P/Q-type), and GAD. All positive results, based on the values of control data [McKnight, K., Jiang, Y., et al. (2005). Serum antibodies in epilepsy and seizure-associated disorders. Neurology 65, 1730-1735], were retested at lower serum concentrations, and results compared with previously published control data. Demographics, medical history, and epilepsy related information was gathered. The studied group consisted predominantly of patients with long standing drug resistant epilepsy. VGKC antibodies were raised (>100 pM) in six patients. VGCC antibodies (>45 pM) were slightly raised in only one patient. GAD antibodies were VGKC antibodies differed from previously described patients with limbic encephalitis-like syndrome, and were not different with respect to seizure type, age at first seizure, duration of epilepsy, or use of anti-epileptic drugs from the VGKC antibody negative patients. The results demonstrate that antibodies to VGKC are present in 6% of patients with typical long-standing epilepsy, but whether these antibodies are pathogenic or secondary to the primary disease process needs to be determined.
Directory of Open Access Journals (Sweden)
Andreas Totzeck
2016-09-01
Full Text Available Neuromuscular junction disorders affect the pre- or postsynaptic nerve to muscle transmission due to autoimmune antibodies. Members of the group like myasthenia gravis and Lambert-Eaton syndrome have pathophysiologically distinct characteristics. However, in practice, distinction may be difficult. We present a series of three patients with a myasthenic syndrome, dropped-head syndrome, bulbar and respiratory muscle weakness and positive testing for anti-N-type voltage-gated calcium channel antibodies. In two cases anti-acetylcholin receptor antibodies were elevated, anti-P/Q-type voltage-gated calcium channel antibodies were negative. All patients initially responded to pyridostigmine with a non-response in the course of the disease. While one patient recovered well after treatment with intravenous immunoglobulins, 3,4-diaminopyridine, steroids and later on immunosuppression with mycophenolate mofetil, a second died after restriction of treatment due to unfavorable cancer diagnosis, the third patient declined treatment. Although new antibodies causing neuromuscular disorders were discovered, clinical distinction has not yet been made. Our patients showed features of pre- and postsynaptic myasthenic syndrome as well as severe dropped-head syndrome and bulbar and axial muscle weakness, but only anti-N-type voltage-gated calcium channel antibodies were positive. When administered, one patient benefited from 3,4-diaminopyridine. We suggest that this overlap-syndrome should be considered especially in patients with assumed seronegative myasthenia gravis and lack of improvement under standard therapy.
Zidar, Nace; Jakopin, Žiga; Madge, David J; Chan, Fiona; Tytgat, Jan; Peigneur, Steve; Dolenc, Marija Sollner; Tomašić, Tihomir; Ilaš, Janez; Mašič, Lucija Peterlin; Kikelj, Danijel
2014-03-03
Voltage-gated sodium channels play an integral part in neurotransmission and their dysfunction is frequently a cause of various neurological disorders. On the basis of the structure of marine alkaloid clathrodin, twenty eight new analogs were designed, synthesized and tested for their ability to block human NaV1.3, NaV1.4 and NaV1.7 channels, as well as for their selectivity against human cardiac isoform NaV1.5, using automated patch clamp electrophysiological assay. Several compounds exhibited promising activities on different NaV channel isoforms in the medium micromolar range and some of the compounds showed also moderate isoform selectivities. The most promising results were obtained for the NaV1.3 channel, for which four compounds were found to possess IC₅₀ values lower than 15 μM. All of the active compounds bind to the open-inactivated states of the channels and therefore act as state-dependent modulators. The obtained results validate the approach of using natural products driven chemistry for drug discovery starting points and represent a good foundation for future design of selective NaV modulators. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process
Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.
1988-08-01
Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.
Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim
2018-04-01
In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.
Voltage and pH sensing by the voltage-gated proton channel, HV1.
DeCoursey, Thomas E
2018-04-01
Voltage-gated proton channels are unique ion channels, membrane proteins that allow protons but no other ions to cross cell membranes. They are found in diverse species, from unicellular marine life to humans. In all cells, their function requires that they open and conduct current only under certain conditions, typically when the electrochemical gradient for protons is outwards. Consequently, these proteins behave like rectifiers, conducting protons out of cells. Their activity has electrical consequences and also changes the pH on both sides of the membrane. Here we summarize what is known about the way these proteins sense the membrane potential and the pH inside and outside the cell. Currently, it is hypothesized that membrane potential is sensed by permanently charged arginines (with very high p K a ) within the protein, which results in parts of the protein moving to produce a conduction pathway. The mechanism of pH sensing appears to involve titratable side chains of particular amino acids. For this purpose their p K a needs to be within the operational pH range. We propose a 'counter-charge' model for pH sensing in which electrostatic interactions within the protein are selectively disrupted by protonation of internally or externally accessible groups. © 2018 The Author.
Voltage and pH sensing by the voltage-gated proton channel, HV1
2018-01-01
Voltage-gated proton channels are unique ion channels, membrane proteins that allow protons but no other ions to cross cell membranes. They are found in diverse species, from unicellular marine life to humans. In all cells, their function requires that they open and conduct current only under certain conditions, typically when the electrochemical gradient for protons is outwards. Consequently, these proteins behave like rectifiers, conducting protons out of cells. Their activity has electrical consequences and also changes the pH on both sides of the membrane. Here we summarize what is known about the way these proteins sense the membrane potential and the pH inside and outside the cell. Currently, it is hypothesized that membrane potential is sensed by permanently charged arginines (with very high pKa) within the protein, which results in parts of the protein moving to produce a conduction pathway. The mechanism of pH sensing appears to involve titratable side chains of particular amino acids. For this purpose their pKa needs to be within the operational pH range. We propose a ‘counter-charge’ model for pH sensing in which electrostatic interactions within the protein are selectively disrupted by protonation of internally or externally accessible groups. PMID:29643227
Directory of Open Access Journals (Sweden)
Elke Bocksteins
Full Text Available The voltage-gated K(+ (Kv channel subunit Kv6.4 does not form functional homotetrameric channels but co-assembles with Kv2.1 to form functional Kv2.1/Kv6.4 heterotetrameric channels. Compared to Kv2.1 homotetramers, Kv6.4 exerts a ~40 mV hyperpolarizing shift in the voltage-dependence of Kv2.1/Kv6.4 channel inactivation, without a significant effect on activation gating. However, the underlying mechanism of this Kv6.4-induced modulation of Kv2.1 channel inactivation, and whether the Kv6.4 subunit participates in the voltage-dependent gating of heterotetrameric channels is not well understood. Here we report distinct gating charge movement of Kv2.1/Kv6.4 heterotetrameric channels, compared to Kv2.1 homotetramers, as revealed by gating current recordings from mammalian cells expressing these channels. The gating charge movement of Kv2.1/Kv6.4 heterotetrameric channels displayed an extra component around the physiological K(+ equilibrium potential, characterized by a second sigmoidal relationship of the voltage-dependence of gating charge movement. This distinct gating charge displacement reflects movement of the Kv6.4 voltage-sensing domain and has a voltage-dependency that matches the hyperpolarizing shift in Kv2.1/Kv6.4 channel inactivation. These results provide a mechanistic basis for the modulation of Kv2.1 channel inactivation gating kinetics by silent Kv6.4 subunits.
Xiao, Yucheng; Jackson, James O; Liang, Songping; Cummins, Theodore R
2011-08-05
The voltage sensors of domains II and IV of sodium channels are important determinants of activation and inactivation, respectively. Animal toxins that alter electrophysiological excitability of muscles and neurons often modify sodium channel activation by selectively interacting with domain II and inactivation by selectively interacting with domain IV. This suggests that there may be substantial differences between the toxin-binding sites in these two important domains. Here we explore the ability of the tarantula huwentoxin-IV (HWTX-IV) to inhibit the activity of the domain II and IV voltage sensors. HWTX-IV is specific for domain II, and we identify five residues in the S1-S2 (Glu-753) and S3-S4 (Glu-811, Leu-814, Asp-816, and Glu-818) regions of domain II that are crucial for inhibition of activation by HWTX-IV. These data indicate that a single residue in the S3-S4 linker (Glu-818 in hNav1.7) is crucial for allowing HWTX-IV to interact with the other key residues and trap the voltage sensor in the closed configuration. Mutagenesis analysis indicates that the five corresponding residues in domain IV are all critical for endowing HWTX-IV with the ability to inhibit fast inactivation. Our data suggest that the toxin-binding motif in domain II is conserved in domain IV. Increasing our understanding of the molecular determinants of toxin interactions with voltage-gated sodium channels may permit development of enhanced isoform-specific voltage-gating modifiers.
Shenkarev, Zakhar O; Paramonov, Alexander S; Lyukmanova, Ekaterina N; Shingarova, Lyudmila N; Yakimov, Sergei A; Dubinnyi, Maxim A; Chupin, Vladimir V; Kirpichnikov, Mikhail P; Blommers, Marcel J J; Arseniev, Alexander S
2010-04-28
The structure and dynamics of the isolated voltage-sensing domain (VSD) of the archaeal potassium channel KvAP was studied by high-resolution NMR. The almost complete backbone resonance assignment and partial side-chain assignment of the (2)H,(13)C,(15)N-labeled VSD were obtained for the protein domain solubilized in DPC/LDAO (2:1) mixed micelles. Secondary and tertiary structures of the VSD were characterized using secondary chemical shifts and NOE contacts. These data indicate that the spatial structure of the VSD solubilized in micelles corresponds to the structure of the domain in an open state of the channel. NOE contacts and secondary chemical shifts of amide protons indicate the presence of tightly bound water molecule as well as hydrogen bond formation involving an interhelical salt bridge (Asp62-R133) that stabilizes the overall structure of the domain. The backbone dynamics of the VSD was studied using (15)N relaxation measurements. The loop regions S1-S2 and S2-S3 were found mobile, while the S3-S4 loop (voltage-sensor paddle) was found stable at the ps-ns time scale. The moieties of S1, S2, S3, and S4 helices sharing interhelical contacts (at the level of the Asp62-R133 salt bridge) were observed in conformational exchange on the micros-ms time scale. Similar exchange-induced broadening of characteristic resonances was observed for the VSD solubilized in the membrane of lipid-protein nanodiscs composed of DMPC, DMPG, and POPC/DOPG lipids. Apparently, the observed interhelical motions represent an inherent property of the VSD of the KvAP channel and can play an important role in the voltage gating.
Directory of Open Access Journals (Sweden)
Alisher M. Kariev
2015-01-01
Full Text Available The gating mechanism of voltage sensitive ion channels is generally considered to be the motion of the S4 transmembrane segment of the voltage sensing domains (VSD. The primary supporting evidence came from R→C mutations on the S4 transmembrane segment of the VSD, followed by reaction with a methanethiosulfonate (MTS reagent. The cys side chain is –SH (reactive form –S−; the arginine side chain is much larger, leaving space big enough to accommodate the MTS sulfonate head group. The cavity created by the mutation has space for up to seven more water molecules than were present in wild type, which could be displaced irreversibly by the MTS reagent. Our quantum calculations show there is major reorientation of three aromatic residues that face into the cavity in response to proton displacement within the VSD. Two phenylalanines reorient sufficiently to shield/unshield the cysteine from the intracellular and extracellular ends, depending on the proton positions, and a tyrosine forms a hydrogen bond to the cysteine sulfur with its side chain –OH. These could produce the results of the experiments that have been interpreted as evidence for physical motion of the S4 segment, without physical motion of the S4 backbone. The computations strongly suggest that the interpretation of cysteine substitution reaction experiments be re-examined in the light of these considerations.
Xu, Hai-Dong; Su, Hong-Jun; Zou, Wei-Bin; Liu, Shan-Shan; Yan, Wen-Rui; Wang, Qian-Qian; Yuan, Li-Li; Chan, Siuming Francis; Yu, Xiao-Qiang; He, Jian-Guo; Weng, Shao-Ping
2015-05-01
Mud crab reovirus (MCRV) is the causative agent of a severe disease in cultured mud crab (Scylla paramamosain), which has caused huge economic losses in China. MCRV is a double-stranded RNA virus with 12 genomic segments. In this paper, SDS-PAGE, mass spectrometry and Western blot analyses revealed that the VP12 protein encoded by S12 gene is a structural protein of MCRV. Immune electron microscopy assay indicated that MCRV VP12 is a component of MCRV outer shell capsid. Yeast two hybrid cDNA library of mud crab was constructed and mud crab voltage-dependent anion-selective channel (mcVDAC) was obtained by MCRV VP12 screening. The full length of mcVDAC was 1180 bp with an open reading frame (ORF) of 849 bp encoding a 282 amino acid protein. The mcVDAC had a constitutive expression pattern in different tissues of mud crab. The interaction between MCRV VP12 and mcVDAC was determined by co-immunoprecipitation assay. The results of this study have provided an insight on the mechanisms of MCRV infection and the interactions between the virus and mud crab. Copyright © 2015 Elsevier Ltd. All rights reserved.
Abdelsayed, Mena; Sokolov, Stanislav
2013-01-01
Epilepsy is a brain disorder characterized by seizures and convulsions. The basis of epilepsy is an increase in neuronal excitability that, in some cases, may be caused by functional defects in neuronal voltage gated sodium channels, Nav1.1 and Nav1.2. The effects of antiepileptic drugs (AEDs) as effective therapies for epilepsy have been characterized by extensive research. Most of the classic AEDs targeting Nav share a common mechanism of action by stabilizing the channel's fast-inactivated state. In contrast, novel AEDs, such as lacosamide, stabilize the slow-inactivated state in neuronal Nav1.1 and Nav1.7 isoforms. This paper reviews the different mechanisms by which this stabilization occurs to determine new methods for treatment.
Mechanism of Estradiol-Induced Block of Voltage-Gated K+ Currents in Rat Medial Preoptic Neurons
Druzin, Michael; Malinina, Evgenya; Grimsholm, Ola; Johansson, Staffan
2011-01-01
The present study was conducted to characterize possible rapid effects of 17-β-estradiol on voltage-gated K+ channels in preoptic neurons and, in particular, to identify the mechanisms by which 17-β-estradiol affects the K+ channels. Whole-cell currents from dissociated rat preoptic neurons were studied by perforated-patch recording. 17-β-estradiol rapidly (within seconds) and reversibly reduced the K+ currents, showing an EC50 value of 9.7 µM. The effect was slightly voltage dependent, but independent of external Ca2+, and not sensitive to an estrogen-receptor blocker. Although 17-α-estradiol also significantly reduced the K+ currents, membrane-impermeant forms of estradiol did not reduce the K+ currents and other estrogens, testosterone and cholesterol were considerably less effective. The reduction induced by estradiol was overlapping with that of the KV-2-channel blocker r-stromatoxin-1. The time course of K+ current in 17-β-estradiol, with a time-dependent inhibition and a slight dependence on external K+, suggested an open-channel block mechanism. The properties of block were predicted from a computational model where 17-β-estradiol binds to open K+ channels. It was concluded that 17-β-estradiol rapidly reduces voltage-gated K+ currents in a way consistent with an open-channel block mechanism. This suggests a new mechanism for steroid action on ion channels. PMID:21625454
Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.
Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu
2016-11-14
Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.
Intracellular and non-neuronal targets of voltage-gated potassium channel complex antibodies
Lang, Bethan; Makuch, Mateusz; Moloney, Teresa; Dettmann, Inga; Mindorf, Swantje; Probst, Christian; Stoecker, Winfried; Buckley, Camilla; Newton, Charles R; Leite, M Isabel; Maddison, Paul; Komorowski, Lars; Adcock, Jane; Vincent, Angela; Waters, Patrick
2017-01-01
Objectives Autoantibodies against the extracellular domains of the voltage-gated potassium channel (VGKC) complex proteins, leucine-rich glioma-inactivated 1 (LGI1) and contactin-associated protein-2 (CASPR2), are found in patients with limbic encephalitis, faciobrachial dystonic seizures, Morvan's syndrome and neuromyotonia. However, in routine testing, VGKC complex antibodies without LGI1 or CASPR2 reactivities (double-negative) are more common than LGI1 or CASPR2 specificities. Therefore, ...
International Nuclear Information System (INIS)
Grasso, P.; Reichert, L.E. Jr.
1989-01-01
We have previously reported incorporation into liposomes of Triton X-100-solubilized FSH receptor-G-protein complexes derived from purified bovine calf testis membranes. In the present study we have used this model system to show that FSH induces flux of 45Ca2+ into such proteoliposomes in a hormone-specific concentration-dependent manner. FSH, inactivated by boiling, had no stimulatory effect on 45Ca2+ flux, nor did isolated alpha- or beta-subunits of FSH. Addition of GTP (or its analogs 5'-guanylylimidodiphosphate and guanosine-5'-O-[3-thiotriphosphate]) or sodium fluoride (in the presence or absence of GTP or its analogs) failed to induce 45Ca2+ flux into proteoliposomes, suggesting that the uptake of 45Ca2+ was receptor, and not G-protein, related. Voltage-independent (ruthenium red and gadolinium chloride) and voltage-activated (methyoxyverapamil and nifedipine) calcium channel-blocking agents reduced FSH-stimulated 45Ca2+ flux into proteoliposomes to control levels. FSH also induced uptake of 45Ca2+ by cultured rat Sertoli cells. Ruthenium red and gadolinium chloride had no effect on basal levels of 45Ca2+ uptake or estradiol secretion by cultured rat Sertoli cells, nor did methoxyverapamil or nifedipine. All four calcium channel blockers, however, were able to reduce FSH-induced 45Ca2+ uptake to basal levels and FSH-stimulated conversion of androstenedione to estradiol by up to 50%, indicating an involvement of Ca2+ in FSH-stimulated steroidogenesis. Our results suggest that the well documented changes in intracellular calcium levels consequent to FSH binding may be due, at least in part, to an influx of calcium through FSH receptor-regulated calcium channels
Reintjes, W.; Romijn, M.D.M.; den Hollander, D.; ter Bruggen, J.P.; van Marum, R.J.
2015-01-01
Voltage-gated potassium channel antibody-associated limbic encephalitis (VGKC-LE) is a rare disease that is a diagnostic and therapeutic challenge for medical practitioners. Two patients with VGKC-LE, both developing dementia are presented. Following treatment, both patients showed remarkable
Conotoxins Targeting Neuronal Voltage-Gated Sodium Channel Subtypes: Potential Analgesics?
Directory of Open Access Journals (Sweden)
Jeffrey R. McArthur
2012-11-01
Full Text Available Voltage-gated sodium channels (VGSC are the primary mediators of electrical signal amplification and propagation in excitable cells. VGSC subtypes are diverse, with different biophysical and pharmacological properties, and varied tissue distribution. Altered VGSC expression and/or increased VGSC activity in sensory neurons is characteristic of inflammatory and neuropathic pain states. Therefore, VGSC modulators could be used in prospective analgesic compounds. VGSCs have specific binding sites for four conotoxin families: μ-, μO-, δ- and ί-conotoxins. Various studies have identified that the binding site of these peptide toxins is restricted to well-defined areas or domains. To date, only the μ- and μO-family exhibit analgesic properties in animal pain models. This review will focus on conotoxins from the μ- and μO-families that act on neuronal VGSCs. Examples of how these conotoxins target various pharmacologically important neuronal ion channels, as well as potential problems with the development of drugs from conotoxins, will be discussed.
International Nuclear Information System (INIS)
Long, Yan; Lin, Zuoxian; Xia, Menghang; Zheng, Wei; Li, Zhiyuan
2013-01-01
Tetra-n-octylammonium bromide and benzethonium chloride are synthetic quaternary ammonium salts that are widely used in hospitals and industries for the disinfection and surface treatment and as the preservative agent. Recently, the activities of HERG channel inhibition by these compounds have been found to have potential risks to induce the long QT syndrome and cardiac arrhythmia, although the mechanism of action is still elusive. This study was conducted to investigate the mechanism of HERG channel inhibition by these compounds by using whole-cell patch clamp experiments in a CHO cell line stably expressing HERG channels. Tetra-n-octylammonium bromide and benzethonium chloride exhibited concentration-dependent inhibitions of HERG channel currents with IC 50 values of 4 nM and 17 nM, respectively, which were also voltage-dependent and use-dependent. Both compounds shifted the channel activation I–V curves in a hyperpolarized direction for 10–15 mV and accelerated channel activation and inactivation processes by 2-fold. In addition, tetra-n-octylammonium bromide shifted the inactivation I–V curve in a hyperpolarized direction for 24.4 mV and slowed the rate of channel deactivation by 2-fold, whereas benzethonium chloride did not. The results indicate that tetra-n-octylammonium bromide and benzethonium chloride are open-channel blockers that inhibit HERG channels in the voltage-dependent, use-dependent and state-dependent manners. - Highlights: ► Tetra-n-octylammonium and benzethonium are potent HERG channel inhibitors. ► Channel activation and inactivation processes are accelerated by the two compounds. ► Both compounds are the open-channel blockers to HERG channels. ► HERG channel inhibition by both compounds is use-, voltage- and state dependent. ► The in vivo risk of QT prolongation needs to be studied for the two compounds
Energy Technology Data Exchange (ETDEWEB)
Long, Yan; Lin, Zuoxian [Key Laboratory of Regenerative Biology, Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou 510530 (China); Xia, Menghang; Zheng, Wei [National Center for Advancing Translational Sciences, National Institutes of Health, Bethesda, MD 20892 (United States); Li, Zhiyuan, E-mail: li_zhiyuan@gibh.ac.cn [Key Laboratory of Regenerative Biology, Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou 510530 (China)
2013-03-01
Tetra-n-octylammonium bromide and benzethonium chloride are synthetic quaternary ammonium salts that are widely used in hospitals and industries for the disinfection and surface treatment and as the preservative agent. Recently, the activities of HERG channel inhibition by these compounds have been found to have potential risks to induce the long QT syndrome and cardiac arrhythmia, although the mechanism of action is still elusive. This study was conducted to investigate the mechanism of HERG channel inhibition by these compounds by using whole-cell patch clamp experiments in a CHO cell line stably expressing HERG channels. Tetra-n-octylammonium bromide and benzethonium chloride exhibited concentration-dependent inhibitions of HERG channel currents with IC{sub 50} values of 4 nM and 17 nM, respectively, which were also voltage-dependent and use-dependent. Both compounds shifted the channel activation I–V curves in a hyperpolarized direction for 10–15 mV and accelerated channel activation and inactivation processes by 2-fold. In addition, tetra-n-octylammonium bromide shifted the inactivation I–V curve in a hyperpolarized direction for 24.4 mV and slowed the rate of channel deactivation by 2-fold, whereas benzethonium chloride did not. The results indicate that tetra-n-octylammonium bromide and benzethonium chloride are open-channel blockers that inhibit HERG channels in the voltage-dependent, use-dependent and state-dependent manners. - Highlights: ► Tetra-n-octylammonium and benzethonium are potent HERG channel inhibitors. ► Channel activation and inactivation processes are accelerated by the two compounds. ► Both compounds are the open-channel blockers to HERG channels. ► HERG channel inhibition by both compounds is use-, voltage- and state dependent. ► The in vivo risk of QT prolongation needs to be studied for the two compounds.
Bannister, John P; Bulley, Simon; Narayanan, Damodaran; Thomas-Gatewood, Candice; Luzny, Patrik; Pachuau, Judith; Jaggar, Jonathan H
2012-10-01
A hallmark of hypertension is an increase in arterial myocyte voltage-dependent Ca2+ (CaV1.2) currents that induces pathological vasoconstriction. CaV1.2 channels are heteromeric complexes composed of a pore-forming CaV1.2α1 with auxiliary α2δ and β subunits. Molecular mechanisms that elevate CaV1.2 currents during hypertension and the potential contribution of CaV1.2 auxiliary subunits are unclear. Here, we investigated the pathological significance of α2δ subunits in vasoconstriction associated with hypertension. Age-dependent development of hypertension in spontaneously hypertensive rats was associated with an unequal elevation in α2δ-1 and CaV1.2α1 mRNA and protein in cerebral artery myocytes, with α2δ-1 increasing more than CaV1.2α1. Other α2δ isoforms did not emerge in hypertension. Myocytes and arteries of hypertensive spontaneously hypertensive rats displayed higher surface-localized α2δ-1 and CaV1.2α1 proteins, surface α2δ-1:CaV1.2α1 ratio, CaV1.2 current density and noninactivating current, and pressure- and depolarization-induced vasoconstriction than those of Wistar-Kyoto controls. Pregabalin, an α2δ-1 ligand, did not alter α2δ-1 or CaV1.2α1 total protein but normalized α2δ-1 and CaV1.2α1 surface expression, surface α2δ-1:CaV1.2α1, CaV1.2 current density and inactivation, and vasoconstriction in myocytes and arteries of hypertensive rats to control levels. Genetic hypertension is associated with an elevation in α2δ-1 expression that promotes surface trafficking of CaV1.2 channels in cerebral artery myocytes. This leads to an increase in CaV1.2 current-density and a reduction in current inactivation that induces vasoconstriction. Data also suggest that α2δ-1 targeting is a novel strategy that may be used to reverse pathological CaV1.2 channel trafficking to induce cerebrovascular dilation in hypertension.
Functional diversity of voltage-sensing phosphatases in two urodele amphibians.
Mutua, Joshua; Jinno, Yuka; Sakata, Souhei; Okochi, Yoshifumi; Ueno, Shuichi; Tsutsui, Hidekazu; Kawai, Takafumi; Iwao, Yasuhiro; Okamura, Yasushi
2014-07-16
Voltage-sensing phosphatases (VSPs) share the molecular architecture of the voltage sensor domain (VSD) with voltage-gated ion channels and the phosphoinositide phosphatase region with the phosphatase and tensin homolog (PTEN), respectively. VSPs enzymatic activities are regulated by the motions of VSD upon depolarization. The physiological role of these proteins has remained elusive, and insights may be gained by investigating biological variations in different animal species. Urodele amphibians are vertebrates with potent activities of regeneration and also show diverse mechanisms of polyspermy prevention. We cloned cDNAs of VSPs from the testes of two urodeles; Hynobius nebulosus and Cynops pyrrhogaster, and compared their expression and voltage-dependent activation. Their molecular architecture is highly conserved in both Hynobius VSP (Hn-VSP) and Cynops VSP (Cp-VSP), including the positively-charged arginine residues in the S4 segment of the VSD and the enzymatic active site for substrate binding, yet the C-terminal C2 domain of Hn-VSP is significantly shorter than that of Cp-VSP and other VSP orthologs. RT-PCR analysis showed that gene expression pattern was distinct between two VSPs. The voltage sensor motions and voltage-dependent phosphatase activities were investigated electrophysiologically by expression in Xenopus oocytes. Both VSPs showed "sensing" currents, indicating that their voltage sensor domains are functional. The phosphatase activity of Cp-VSP was found to be voltage dependent, as shown by its ability to regulate the conductance of coexpressed GIRK2 channels, but Hn-VSP lacked such phosphatase activity due to the truncation of its C2 domain. © 2014 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.
Wilders, R.; Jongsma, H.J.
1992-01-01
The electrical properties of gap junctions in cell pairs are usually studied by means of the dual voltage clamp method. The voltage across the junctional channels, however, cannot be controlled adequately due to an artificial resistance and a natural resistance, both connected in series with the gap junction. The access resistances to the cell interior of the recording pipettes make up the artificial resistance. The natural resistance consists of the cytoplasmic access resistances to the tigh...
Molecular identity of dendritic voltage-gated sodium channels.
Lorincz, Andrea; Nusser, Zoltan
2010-05-14
Active invasion of the dendritic tree by action potentials (APs) generated in the axon is essential for associative synaptic plasticity and neuronal ensemble formation. In cortical pyramidal cells (PCs), this AP back-propagation is supported by dendritic voltage-gated Na+ (Nav) channels, whose molecular identity is unknown. Using a highly sensitive electron microscopic immunogold technique, we revealed the presence of the Nav1.6 subunit in hippocampal CA1 PC proximal and distal dendrites. Here, the subunit density is lower by a factor of 35 to 80 than that found in axon initial segments. A gradual decrease in Nav1.6 density along the proximodistal axis of the dendritic tree was also detected without any labeling in dendritic spines. Our results reveal the characteristic subcellular distribution of the Nav1.6 subunit, identifying this molecule as a key substrate enabling dendritic excitability.
DEFF Research Database (Denmark)
Hansen, P B L
2013-01-01
Calcium channel blockers are widely used to treat hypertension because they inhibit voltage-gated calcium channels that mediate transmembrane calcium influx in, for example, vascular smooth muscle and cardiomyocytes. The calcium channel family consists of several subfamilies, of which the L......-type is usually associated with vascular contractility. However, the L-, T- and P-/Q-types of calcium channels are present in the renal vasculature and are differentially involved in controlling vascular contractility, thereby contributing to regulation of kidney function and blood pressure. In the preglomerular...... vascular bed, all the three channel families are present. However, the T-type channel is the only channel in cortical efferent arterioles which is in contrast to the juxtamedullary efferent arteriole, and that leads to diverse functional effects of L- and T-type channel inhibition. Furthermore...
International Nuclear Information System (INIS)
Du Yuzhe; Song Weizhong; Groome, James R.; Nomura, Yoshiko; Luo Ningguang; Dong Ke
2010-01-01
Voltage-gated sodium channels are the primary target of pyrethroids, an important class of synthetic insecticides. Pyrethroids bind to a distinct receptor site on sodium channels and prolong the open state by inhibiting channel deactivation and inactivation. Recent studies have begun to reveal sodium channel residues important for pyrethroid binding. However, how pyrethroid binding leads to inhibition of sodium channel deactivation and inactivation remains elusive. In this study, we show that a negatively charged aspartic acid residue at position 802 (D802) located in the extracellular end of transmembrane segment 1 of domain II (IIS1) is critical for both the action of pyrethroids and the voltage dependence of channel activation. Charge-reversing or -neutralizing substitutions (K, G, or A) of D802 shifted the voltage dependence of activation in the depolarizing direction and reduced channel sensitivity to deltamethrin, a pyrethroid insecticide. The charge-reversing mutation D802K also accelerated open-state deactivation, which may have counteracted the inhibition of sodium channel deactivation by deltamethrin. In contrast, the D802G substitution slowed open-state deactivation, suggesting an additional mechanism for neutralizing the action of deltamethrin. Importantly, Schild analysis showed that D802 is not involved in pyrethroid binding. Thus, we have identified a sodium channel residue that is critical for regulating the action of pyrethroids on the sodium channel without affecting the receptor site of pyrethroids.
[Mechanism of action of neurotoxins acting on the inactivation of voltage-gated sodium channels].
Benoit, E
1998-01-01
This review focuses on the mechanism(s) of action of neurotoxins acting on the inactivation of voltage-gated Na channels. Na channels are transmembrane proteins which are fundamental for cellular communication. These proteins form pores in the plasma membrane allowing passive ionic movements to occur. Their opening and closing are controlled by gating systems which depend on both membrane potential and time. Na channels have three functional properties, mainly studied using electrophysiological and biochemical techniques, to ensure their role in the generation and propagation of action potentials: 1) a highly selectivity for Na ions, 2) a rapid opening ("activation"), responsible for the depolarizing phase of the action potential, and 3) a late closing ("inactivation") involved in the repolarizing phase of the action potential. As an essential protein for membrane excitability, the Na channel is the specific target of a number of vegetal and animal toxins which, by binding to the channel, alter its activity by affecting one or more of its properties. At least six toxin receptor sites have been identified on the neuronal Na channel on the basis of binding studies. However, only toxins interacting with four of these sites (sites 2, 3, 5 et 6) produce alterations of channel inactivation. The maximal percentage of Na channels modified by the binding of neurotoxins to sites 2 (batrachotoxin and some alkaloids), 3 (alpha-scorpion and sea anemone toxins), 5 (brevetoxins and ciguatoxins) et 6 (delta-conotoxins) is different according to the site considered. However, in all cases, these channels do not inactivate. Moreover, Na channels modified by toxins which bind to sites 2, 5 and 6 activate at membrane potentials more negative than do unmodified channels. The physiological consequences of Na channel modifications, induced by the binding of neurotoxins to sites 2, 3, 5 and 6, are (i) an inhibition of cellular excitability due to an important membrane depolarization (site
Studies of alpha-helicity and intersegmental interactions in voltage-gated Na+ channels: S2D4.
Directory of Open Access Journals (Sweden)
Zhongming Ma
2009-11-01
Full Text Available Much data, including crystallographic, support structural models of sodium and potassium channels consisting of S1-S4 transmembrane segments (the "voltage-sensing domain" clustered around a central pore-forming region (S5-S6 segments and the intervening loop. Voltage gated sodium channels have four non-identical domains which differentiates them from the homotetrameric potassium channels that form the basis for current structural models. Since potassium and sodium channels also exhibit many different functional characteristics and the fourth domain (D4 of sodium channels differs in function from other domains (D1-D3, we have explored its structure in order to determine whether segments in D4 of sodium channels differ significantly from that determined for potassium channels. We have probed the secondary and tertiary structure and the role of the individual amino acid residues of the S2D4 of Na(v1.4 by employing cysteine-scanning mutagenesis (with tryptophan and glutamine substituted for native cysteine. A Fourier transform power spectrum of perturbations in free energy of steady-state inactivation gating (using midpoint potentials and slopes of Boltzmann equation fits of channel availability, h(infinity-V plots indicates a substantial amount of alpha-helical structure in S2D4 (peak at 106 degrees, alpha-Periodicity Index (alpha-PI of 3.10, This conclusion is supported by alpha-PI values of 3.28 and 2.84 for the perturbations in rate constants of entry into (beta and exit from (alpha fast inactivation at 0 mV for mutant channels relative to WT channels assuming a simple two-state model for transition from the open to inactivated state. The results of cysteine substitution at the two most sensitive sites of the S2D4 alpha-helix (N1382 and E1392C support the existence of electrostatic network interactions between S2 and other transmembrane segments within Na(v1.4D4 similar to but not identical to those proposed for K+ channels.
Salceda, Emilio; López, Omar; Zaharenko, André J; Garateix, Anoland; Soto, Enrique
2010-03-01
Sea anemone toxins bind to site 3 of the sodium channels, which is partially formed by the extracellular linker connecting S3 and S4 segments of domain IV, slowing down the inactivation process. In this work we have characterized the actions of BcIII, a sea anemone polypeptide toxin isolated from Bunodosoma caissarum, on neuronal sodium currents using the patch clamp technique. Neurons of the dorsal root ganglia of Wistar rats (P5-9) in primary culture were used for this study (n=65). The main effects of BcIII were a concentration-dependent increase in the sodium current inactivation time course (IC(50)=2.8 microM) as well as an increase in the current peak amplitude. BcIII did not modify the voltage at which 50% of the channels are activated or inactivated, nor the reversal potential of sodium current. BcIII shows a voltage-dependent action. A progressive acceleration of sodium current fast inactivation with longer conditioning pulses was observed, which was steeper as more depolarizing were the prepulses. The same was observed for other two anemone toxins (CgNa, from Condylactis gigantea and ATX-II, from Anemonia viridis). These results suggest that the binding affinity of sea anemone toxins may be reduced in a voltage-dependent manner, as has been described for alpha-scorpion toxins. (c) 2009 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Young, Stephanie Z; Platel, Jean-Claude; Nielsen, Jakob V
2010-01-01
In the adult neurogenic subventricular zone (SVZ), the behavior of astrocyte-like cells and some of their functions depend on changes in intracellular Ca(2+) levels and tonic GABA(A) receptor activation. However, it is unknown whether, and if so how, GABA(A) receptor activity regulates...... intracellular Ca(2+) dynamics in SVZ astrocytes. To monitor Ca(2+) activity selectively in astrocyte-like cells, we used two lines of transgenic mice expressing either GFP fused to a Gq-coupled receptor or DsRed under the human glial fibrillary acidic protein (hGFAP) promoter. GABA(A) receptor activation...... induced Ca(2+) increases in 40-50% of SVZ astrocytes. GABA(A)-induced Ca(2+) increases were prevented with nifedipine and mibefradil, blockers of L- and T-type voltage-gated calcium channels (VGCC). The L-type Ca(2+) channel activator BayK 8644 increased the percentage of GABA(A)-responding astrocyte...
Energy Technology Data Exchange (ETDEWEB)
Kumar, S.; Dhar, A., E-mail: adhar@phy.iitkgp.ernet.in
2015-10-15
Highlights: • Alternative to chemically crosslinking of PMMA to achieve low leakage in provided. • Effect of LiF in reducing gate leakage through the OFET device is studied. • Effect of gate leakage on transistor performance has been investigated. • Low voltage operable and low temperature processed n-channel OFETs were fabricated. - Abstract: We report low temperature processed, low voltage operable n-channel organic field effect transistors (OFETs) using N,N′-Dioctyl-3,4,9,10-perylenedicarboximide (PTCDI-C{sub 8}) organic semiconductor and poly(methylmethacrylate) (PMMA)/lithium fluoride (LiF) bilayer gate dielectric. We have studied the role of LiF buffer dielectric in effectively reducing the gate leakage through the device and thus obtaining superior performance in contrast to the single layer PMMA dielectric devices. The bilayer OFET devices had a low threshold voltage (V{sub t}) of the order of 5.3 V. The typical values of saturation electron mobility (μ{sub s}), on/off ratio and inverse sub-threshold slope (S) for the range of devices made were estimated to be 2.8 × 10{sup −3} cm{sup 2}/V s, 385, and 3.8 V/decade respectively. Our work thus provides a potential substitution for much complicated process of chemically crosslinking PMMA to achieve low leakage, high capacitance, and thus low operating voltage OFETs.
Voltage Sensing in Membranes: From Macroscopic Currents to Molecular Motions.
Freites, J Alfredo; Tobias, Douglas J
2015-06-01
Voltage-sensing domains (VSDs) are integral membrane protein units that sense changes in membrane electric potential, and through the resulting conformational changes, regulate a specific function. VSDs confer voltage-sensitivity to a large superfamily of membrane proteins that includes voltage-gated Na[Formula: see text], K[Formula: see text], Ca[Formula: see text] ,and H[Formula: see text] selective channels, hyperpolarization-activated cyclic nucleotide-gated channels, and voltage-sensing phosphatases. VSDs consist of four transmembrane segments (termed S1 through S4). Their most salient structural feature is the highly conserved positions for charged residues in their sequences. S4 exhibits at least three conserved triplet repeats composed of one basic residue (mostly arginine) followed by two hydrophobic residues. These S4 basic side chains participate in a state-dependent internal salt-bridge network with at least four acidic residues in S1-S3. The signature of voltage-dependent activation in electrophysiology experiments is a transient current (termed gating or sensing current) upon a change in applied membrane potential as the basic side chains in S4 move across the membrane electric field. Thus, the unique structural features of the VSD architecture allow for competing requirements: maintaining a series of stable transmembrane conformations, while allowing charge motion, as briefly reviewed here.
Saramekala, G. K.; Santra, Abirmoya; Dubey, Sarvesh; Jit, Satyabrata; Tiwari, Pramod Kumar
2013-08-01
In this paper, an analytical short-channel threshold voltage model is presented for a dual-metal-gate (DMG) fully depleted recessed source/drain (Re-S/D) SOI MOSFET. For the first time, the advantages of recessed source/drain (Re-S/D) and of dual-metal-gate structure are incorporated simultaneously in a fully depleted SOI MOSFET. The analytical surface potential model at Si-channel/SiO2 interface and Si-channel/buried-oxide (BOX) interface have been developed by solving the 2-D Poisson’s equation in the channel region with appropriate boundary conditions assuming parabolic potential profile in the transverse direction of the channel. Thereupon, a threshold voltage model is derived from the minimum surface potential in the channel. The developed model is analyzed extensively for a variety of device parameters like the oxide and silicon channel thicknesses, thickness of source/drain extension in the BOX, control and screen gate length ratio. The validity of the present 2D analytical model is verified with ATLAS™, a 2D device simulator from SILVACO Inc.
Directory of Open Access Journals (Sweden)
M Kristen Hall
Full Text Available The intrinsic electrical properties of a neuron depend on expression of voltage gated potassium (Kv channel isoforms, as well as their distribution and density in the plasma membrane. Recently, we showed that N-glycosylation site occupancy of Kv3.1b modulated its placement in the cell body and neurites of a neuronal-derived cell line, B35 neuroblastoma cells. To extrapolate this mechanism to other N-glycosylated Kv channels, we evaluated the impact of N-glycosylation occupancy of Kv3.1a and Kv1.1 channels. Western blots revealed that wild type Kv3.1a and Kv1.1 α-subunits had complex and oligomannose N-glycans, respectively, and that abolishment of the N-glycosylation site(s generated Kv proteins without N-glycans. Total internal reflection fluorescence microscopy images revealed that N-glycans of Kv3.1a contributed to its placement in the cell membrane while N-glycans had no effect on the distribution of Kv1.1. Based on particle analysis of EGFP-Kv proteins in the adhered membrane, glycosylated forms of Kv3.1a, Kv1.1, and Kv3.1b had differences in the number, size or density of Kv protein clusters in the cell membrane of neurites and cell body of B35 cells. Differences were also observed between the unglycosylated forms of the Kv proteins. Cell dissociation assays revealed that cell-cell adhesion was increased by the presence of complex N-glycans of Kv3.1a, like Kv3.1b, whereas cell adhesion was similar in the oligomannose and unglycosylated Kv1.1 subunit containing B35 cells. Our findings provide direct evidence that N-glycans of Kv3.1 splice variants contribute to the placement of these glycoproteins in the plasma membrane of neuronal-derived cells while those of Kv1.1 were absent. Further when the cell membrane distribution of the Kv channel was modified by N-glycans then the cell-cell adhesion properties were altered. Our study demonstrates that N-glycosylation of Kv3.1a, like Kv3.1b, provides a mechanism for the distribution of these
Directory of Open Access Journals (Sweden)
Iris H Kim
Full Text Available The Hv1 channel and voltage-sensitive phosphatases share with voltage-gated sodium, potassium, and calcium channels the ability to detect changes in membrane potential through voltage-sensing domains (VSDs. However, they lack the pore domain typical of these other channels. NaV, KV, and CaV proteins can be found in neurons and muscles, where they play important roles in electrical excitability. In contrast, VSD-containing proteins lacking a pore domain are found in non-excitable cells and are not involved in neuronal signaling. Here, we report the identification of HVRP1, a protein related to the Hv1 channel (from which the name Hv1 Related Protein 1 is derived, which we find to be expressed primarily in the central nervous system, and particularly in the cerebellum. Within the cerebellar tissue, HVRP1 is specifically expressed in granule neurons, as determined by in situ hybridization and immunohistochemistry. Analysis of subcellular distribution via electron microscopy and immunogold labeling reveals that the protein localizes on the post-synaptic side of contacts between glutamatergic mossy fibers and the granule cells. We also find that, despite the similarities in amino acid sequence and structural organization between Hv1 and HVRP1, the two proteins have distinct functional properties. The high conservation of HVRP1 in vertebrates and its cellular and subcellular localizations suggest an important function in the nervous system.
Directory of Open Access Journals (Sweden)
Guoqiang Zhong
2017-05-01
Full Text Available In cardiac tissues, the expression of multiple connexins (Cx40, Cx43, Cx45, and Cx30.2 is a requirement for proper development and function. Gap junctions formed by these connexins have distinct permeability and gating mechanisms. Since a single cell can express more than one connexin isoform, the formation of hetero-multimeric gap junction channels provides a tissue with an enormous repertoire of combinations to modulate intercellular communication. To study further the perm-selectivity and gating properties of channels containing Cx43 and Cx45, we studied two monoheteromeric combinations in which a HeLa cell co-transfected with Cx43 and Cx45 was paired with a cell expressing only one of these connexins. Macroscopic measurements of total conductance between cell pairs indicated a drastic reduction in total conductance for mono-heteromeric channels. In terms of Vj dependent gating, Cx43 homomeric connexons facing heteromeric connexons only responded weakly to voltage negativity. Cx45 homomeric connexons exhibited no change in Vj gating when facing heteromeric connexons. The distributions of unitary conductances (γj for both mono-heteromeric channels were smaller than predicted, and both showed low permeability to the fluorescent dyes Lucifer yellow and Rhodamine123. For both mono-heteromeric channels, we observed flux asymmetry regardless of dye charge: flux was higher in the direction of the heteromeric connexon for MhetCx45 and in the direction of the homomeric Cx43 connexon for MhetCx43. Thus, our data suggest that co-expression of Cx45 and Cx43 induces the formation of heteromeric connexons with greatly reduced permeability and unitary conductance. Furthermore, it increases the asymmetry for voltage gating for opposing connexons, and it favors asymmetric flux of molecules across the junction that depends primarily on the size (not the charge of the crossing molecules.
Zhong, Guoqiang; Akoum, Nazem; Appadurai, Daniel A.; Hayrapetyan, Volodya; Ahmed, Osman; Martinez, Agustin D.; Beyer, Eric C.; Moreno, Alonso P.
2017-01-01
In cardiac tissues, the expression of multiple connexins (Cx40, Cx43, Cx45, and Cx30.2) is a requirement for proper development and function. Gap junctions formed by these connexins have distinct permeability and gating mechanisms. Since a single cell can express more than one connexin isoform, the formation of hetero-multimeric gap junction channels provides a tissue with an enormous repertoire of combinations to modulate intercellular communication. To study further the perm-selectivity and gating properties of channels containing Cx43 and Cx45, we studied two monoheteromeric combinations in which a HeLa cell co-transfected with Cx43 and Cx45 was paired with a cell expressing only one of these connexins. Macroscopic measurements of total conductance between cell pairs indicated a drastic reduction in total conductance for mono-heteromeric channels. In terms of Vj dependent gating, Cx43 homomeric connexons facing heteromeric connexons only responded weakly to voltage negativity. Cx45 homomeric connexons exhibited no change in Vj gating when facing heteromeric connexons. The distributions of unitary conductances (γj) for both mono-heteromeric channels were smaller than predicted, and both showed low permeability to the fluorescent dyes Lucifer yellow and Rhodamine123. For both mono-heteromeric channels, we observed flux asymmetry regardless of dye charge: flux was higher in the direction of the heteromeric connexon for MhetCx45 and in the direction of the homomeric Cx43 connexon for MhetCx43. Thus, our data suggest that co-expression of Cx45 and Cx43 induces the formation of heteromeric connexons with greatly reduced permeability and unitary conductance. Furthermore, it increases the asymmetry for voltage gating for opposing connexons, and it favors asymmetric flux of molecules across the junction that depends primarily on the size (not the charge) of the crossing molecules. PMID:28611680
Investigation of capacitance voltage characteristics of strained Si/SiGe n-channel MODFET varactor
Elogail, Y.; Kasper, E.; Gunzer, F.; Shaker, A.; Schulze, J.
2016-06-01
This work is concerned with the investigation of Capacitance-Voltage (CV) behavior of n-channel Si/SiGe MODFET varactors. This investigation provides a valuable insight into the high frequency response of the device under test and its dependence on design parameters; especially regarding the modulation layer doping concentration. The heterostructure under consideration is much more complicated than conventional MOS varactor with respect to non-uniform doping, energy band offsets and the pn-junction in series. Subsequently, CV characterization has never been applied to such MODFET varactor structure. Experimental CV measurements have shown a non-monotonic behavior with a transition point minimum and higher saturation levels on both sides, in contradiction to the conventional high frequency MOS characteristics. This behavior was confirmed qualitatively using simulations. Moreover, we explain some fundamental capacitance properties of the structure, which provide already very interesting perceptions of the MODFET varactor operation, modeling and possible applications using the obtained stimulating results.
Directory of Open Access Journals (Sweden)
Yool Andrea J
2003-10-01
Full Text Available Abstract Background Aquaporin-1 (AQP1 functions as an osmotic water channel and a gated cation channel. Activation of the AQP1 ion conductance by intracellular cGMP was hypothesized to involve the carboxyl (C- terminus, based on amino acid sequence alignments with cyclic-nucleotide-gated channels and cGMP-selective phosphodiesterases. Results Voltage clamp analyses of human AQP1 channels expressed in Xenopus oocytes demonstrated that the nitric oxide donor, sodium nitroprusside (SNP; 3–14 mM activated the ionic conductance response in a dose-dependent manner. Block of soluble guanylate cyclase prevented the response. Enzyme immunoassays confirmed a linear dose-dependent relationship between SNP and the resulting intracellular cGMP levels (up to 1700 fmol cGMP /oocyte at 14 mM SNP. Results here are the first to show that the efficacy of ion channel activation is decreased by mutations of AQP1 at conserved residues in the C-terminal domain (aspartate D237 and lysine K243. Conclusions These data support the idea that the limited amino acid sequence similarities found between three diverse classes of cGMP-binding proteins are significant to the function of AQP1 as a cGMP-gated ion channel, and provide direct evidence for the involvement of the AQP1 C-terminal domain in cGMP-mediated ion channel activation.
Monitoring operating temperature and supply voltage in achieving high system dependability
Khan, M.A.; Kerkhoff, Hans G.
2013-01-01
System dependability being a set of number of attributes, of which the important reliability, heavily depends on operating temperature and supply voltage. Any change beyond the designed specifications may change the system performance and could result in system reliability and hence dependability
Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena
White, William E.
2013-01-01
Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698
Directory of Open Access Journals (Sweden)
Zhi-Yong Li
2013-01-01
Full Text Available The voltage-dependent anion channel (VDAC, a highly conserved major mitochondrial outer membrane protein, plays crucial roles in energy metabolism and metabolite transport. However, knowledge about the roles of the VDAC family in plants is limited. In this study, we investigated the expression pattern of VDAC1 in Arabidopsis and found that cold stress promoted the accumulation of VDAC1 transcripts in imbibed seeds and mature plants. Overexpression of VDAC1 reduced tolerance to cold stress in Arabidopsis. Phenotype analysis of VDAC1 T-DNA insertion mutant plants indicated that a vdac1 mutant line had faster germination kinetics under cold treatment and showed enhanced tolerance to freezing. The yeast two-hybrid system revealed that VDAC1 interacts with CBL1, a calcium sensor in plants. Like the vdac1, a cbl1 mutant also exhibited a higher seed germination rate. We conclude that both VDAC1 and CBL1 regulate cold stress responses during seed germination and plant development.
Liu, Gong Xin; Daut, Jürgen
2002-01-01
K+ channels of isolated guinea-pig cardiomyocytes were studied using the patch-clamp technique. At transmembrane potentials between −120 and −220 mV we observed inward currents through an apparently novel channel. The novel channel was strongly rectifying, no outward currents could be recorded. Between −200 and −160 mV it had a slope conductance of 42.8 ± 3.0 pS (s.d.; n = 96). The open probability (Po) showed a sigmoid voltage dependence and reached a maximum of 0.93 at −200 mV, half-maximal activation was approximately −150 mV. The voltage dependence of Po was not affected by application of 50 μm isoproterenol. The open-time distribution could be described by a single exponential function, the mean open time ranged between 73.5 ms at −220 mV and 1.4 ms at −160 mV. At least two exponential components were required to fit the closed time distribution. Experiments with different external Na+, K+ and Cl− concentrations suggested that the novel channel is K+ selective. Extracellular Ba2+ ions gave rise to a voltage-dependent reduction in Po by inducing long closed states; Cs+ markedly reduced mean open time at −200 mV. In cell-attached recordings the novel channel frequently converted to a classical inward rectifier channel, and vice versa. This conversion was not voltage dependent. After excision of the patch, the novel channel always converted to a classical inward rectifier channel within 0–3 min. This conversion was not affected by intracellular Mg2+, phosphatidylinositol (4,5)-bisphosphate or spermine. Taken together, our findings suggest that the novel K+ channel represents a different ‘mode’ of the classical inward rectifier channel in which opening occurs only at very negative potentials. PMID:11897847
Yu, Alec; Zhu, Wandi; Silva, Jonathan R.; Ruben, Peter C.
2017-01-01
E1784K is the most common mixed long QT syndrome/Brugada syndrome mutant in the cardiac voltage-gated sodium channel NaV1.5. E1784K shifts the midpoint of the channel conductance-voltage relationship to more depolarized membrane potentials and accelerates the rate of channel fast inactivation. The depolarizing shift in the midpoint of the conductance curve in E1784K is exacerbated by low extracellular pH. We tested whether the E1784K mutant shifts the channel conductance curve to more depolarized membrane potentials by affecting the channel voltage-sensors. We measured ionic currents and gating currents at pH 7.4 and pH 6.0 in Xenopus laevis oocytes. Contrary to our expectation, the movement of gating charges is shifted to more hyperpolarized membrane potentials by E1784K. Voltage-clamp fluorimetry experiments show that this gating charge shift is due to the movement of the DIVS4 voltage-sensor being shifted to more hyperpolarized membrane potentials. Using a model and experiments on fast inactivation-deficient channels, we show that changes to the rate and voltage-dependence of fast inactivation are sufficient to shift the conductance curve in E1784K. Our results localize the effects of E1784K to DIVS4, and provide novel insight into the role of the DIV-VSD in regulating the voltage-dependencies of activation and fast inactivation. PMID:28898267
Directory of Open Access Journals (Sweden)
Colin H Peters
Full Text Available E1784K is the most common mixed long QT syndrome/Brugada syndrome mutant in the cardiac voltage-gated sodium channel NaV1.5. E1784K shifts the midpoint of the channel conductance-voltage relationship to more depolarized membrane potentials and accelerates the rate of channel fast inactivation. The depolarizing shift in the midpoint of the conductance curve in E1784K is exacerbated by low extracellular pH. We tested whether the E1784K mutant shifts the channel conductance curve to more depolarized membrane potentials by affecting the channel voltage-sensors. We measured ionic currents and gating currents at pH 7.4 and pH 6.0 in Xenopus laevis oocytes. Contrary to our expectation, the movement of gating charges is shifted to more hyperpolarized membrane potentials by E1784K. Voltage-clamp fluorimetry experiments show that this gating charge shift is due to the movement of the DIVS4 voltage-sensor being shifted to more hyperpolarized membrane potentials. Using a model and experiments on fast inactivation-deficient channels, we show that changes to the rate and voltage-dependence of fast inactivation are sufficient to shift the conductance curve in E1784K. Our results localize the effects of E1784K to DIVS4, and provide novel insight into the role of the DIV-VSD in regulating the voltage-dependencies of activation and fast inactivation.
Directory of Open Access Journals (Sweden)
Jian-Min Jiang
2013-05-01
Full Text Available The (−-gallocatechin-3-gallate (GCG concentration in some tea beverages can account for as much as 50% of the total catechins. It has been shown that catechins have analgesic properties. Voltage-gated sodium channels (Nav mediate neuronal action potentials. Tetrodotoxin inhibits all Nav isoforms, but Nav1.8 and Nav1.9 are relatively tetrodotoxin-resistant compared to other isoforms and functionally linked to nociception. In this study, the effects of GCG on tetrodotoxin-resistant Na+ currents were investigated in rat primary cultures of dorsal root ganglion neurons via the whole-cell patch-clamp technique. We found that 1 μM GCG reduced the amplitudes of peak current density of tetrodotoxin-resistant Na+ currents significantly. Furthermore, the inhibition was accompanied by a depolarizing shift of the activation voltage and a hyperpolarizing shift of steady-state inactivation voltage. The percentage block of GCG (1 μM on tetrodotoxin-resistant Na+ current was 45.1% ± 1.1% in 10 min. In addition, GCG did not produce frequency-dependent block of tetrodotoxin-resistant Na+ currents at stimulation frequencies of 1 Hz, 2 Hz and 5 Hz. On the basis of these findings, we propose that GCG may be a potential analgesic agent.
Monitoring voltage-sensitive membrane impedance change using radio frequency interrogation.
Dharia, Sameera; Rabbitt, Richard D
2010-01-01
Here we present a new technique to monitor dynamic conformational changes in voltage-sensitive membrane-bound proteins using radio frequency (RF) impedance measurements. Xenopus oocytes were transfected to express ShakerB-IR K(+) ion channels, and step changes in membrane potential were applied using two-electrode voltage clamp (TEVC). Simultaneously, bipolar extracellular electrodes were used to measure the RF electrical impedance across the cell (300 kHz - 1 MHz). RF current will either pass through the media, around the cell, or displace charge across the cell membrane. The change in displacement current in the cell membrane during voltage clamp resulted in measurable RF impedance change. RF impedance change during DC membrane depolarization was significantly greater in ShakerB-IR expressing oocytes than in endogenous controls at 300 kHz, 500 kHz and, to a lesser extent, 1 MHz. Since the RF were too high to modulate ShakerB-IR protein conformational state (e.g. open channel probability), impedance changes are interpreted as reflections of voltage-dependent protein conformation and associated biophysics such as ion-channel dipole interactions, fluctuations in bound water, or charged lipid head-group rotations.
Worley, Jennings F.; Deitmer, Joachim W.; Nelson, Mark T.
1986-08-01
Single smooth muscle cells were enzymatically isolated from the rabbit mesenteric artery. At physiological levels of external Ca, these cells were relaxed and contracted on exposure to norepinephrine, caffeine, or high levels of potassium. The patch-clamp technique was used to measure unitary currents through single channels in the isolated cells. Single channels were selective for divalent cations and exhibited two conductance levels, 8 pS and 15 pS. Both types of channels were voltage-dependent, and channel activity occurred at potentials positive to -40 mV. The activity of both channel types was almost completely inhibited by 50 nM nisoldipine. These channels appear to be the pathways for voltage-dependent Ca influx in vascular smooth muscle and may be the targets of the clinically used dihydropyridines.
Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.
2018-04-01
Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.
DEFF Research Database (Denmark)
Khammy, Makhala M; Kim, Sukhan; Bentzen, Bo H
2018-01-01
has not been systematically studied. The aim of this study was to investigate the pharmacological activity of 4-AP on Kv7.4 and Kv7.5 channels and characterize the effect of 4-AP on rat resistance arteries. EXPERIMENTAL APPROACH: Voltage clamp experiments were performed on Xenopus laevis oocytes......BACKGROUND AND PURPOSE: Kv7.4 and Kv7.5 channels are regulators of vascular tone. 4-Aminopyridine (4-AP) is considered a broad inhibitor of voltage-gated potassium (KV) channels, with little inhibitory effect on Kv7 family members at mmol concentrations. However, the effect of 4-AP on Kv7 channels...
Dual patch voltage clamp study of low membrane resistance astrocytes in situ.
Ma, Baofeng; Xu, Guangjin; Wang, Wei; Enyeart, John J; Zhou, Min
2014-03-17
Whole-cell patch clamp recording has been successfully used in identifying the voltage-dependent gating and conductance properties of ion channels in a variety of cells. However, this powerful technique is of limited value in studying low membrane resistance cells, such as astrocytes in situ, because of the inability to control or accurately measure the real amplitude of command voltages. To facilitate the study of ionic conductances of astrocytes, we have developed a dual patch recording method which permits membrane current and membrane potential to be simultaneously recorded from astrocytes in spite of their extraordinarily low membrane resistance. The utility of this technique is demonstrated by measuring the voltage-dependent activation of the inwardly rectifying K+ current abundantly expressed in astrocytes and multiple ionic events associated with astrocytic GABAA receptor activation. This protocol can be performed routinely in the study of astrocytes. This method will be valuable for identifying and characterizing the individual ion channels that orchestrate the electrical activity of low membrane resistance cells.
Anion channels: master switches of stress responses.
Roelfsema, M Rob G; Hedrich, Rainer; Geiger, Dietmar
2012-04-01
During stress, plant cells activate anion channels and trigger the release of anions across the plasma membrane. Recently, two new gene families have been identified that encode major groups of anion channels. The SLAC/SLAH channels are characterized by slow voltage-dependent activation (S-type), whereas ALMT genes encode rapid-activating channels (R-type). Both S- and R-type channels are stimulated in guard cells by the stress hormone ABA, which leads to stomatal closure. Besides their role in ABA-dependent stomatal movement, anion channels are also activated by biotic stress factors such as microbe-associated molecular patterns (MAMPs). Given that anion channels occur throughout the plant kingdom, they are likely to serve a general function as master switches of stress responses. Copyright © 2012 Elsevier Ltd. All rights reserved.
Abd El Halim, Hesham M; Alshukri, Baida M H; Ahmad, Munawar S; Nakasu, Erich Y T; Awwad, Mohammed H; Salama, Elham M; Gatehouse, Angharad M R; Edwards, Martin G
2016-07-14
The voltage-gated sodium ion channel (VGSC) belongs to the largest superfamily of ion channels. Since VGSCs play key roles in physiological processes they are major targets for effective insecticides. RNA interference (RNAi) is widely used to analyse gene function, but recently, it has shown potential to contribute to novel strategies for selectively controlling agricultural insect pests. The current study evaluates the delivery of dsRNA targeted to the sodium ion channel paralytic A (TcNav) gene in Tribolium castaneum as a viable means of controlling this insect pest. Delivery of TcNav dsRNA caused severe developmental arrest with larval mortalities up to 73% post injection of dsRNA. Injected larvae showed significant (p < 0.05) knockdown in gene expression between 30-60%. Expression was also significantly (p < 0.05) reduced in pupae following injection causing 30% and 42% knockdown for early and late pupal stages, respectively. Oral delivery of dsRNA caused dose-dependant mortalities of between 19 and 51.34%; this was accompanied by significant (p < 0.05) knockdown in gene expression following 3 days of continuous feeding. The majority of larvae injected with, or fed, dsRNA died during the final larval stage prior to pupation. This work provides evidence of a viable RNAi-based strategy for insect control.
Energy Technology Data Exchange (ETDEWEB)
James, W.M.; Emerick, M.C.; Agnew, W.S. (Yale Univ. School of medicine, New Haven, CT (USA))
1989-07-11
The voltage-sensitive sodium channel present in the eel (Electrophorus electricus) has an unusually high content of sialic acid, including {alpha}-(2{yields}8)-linked polysialic acid, not found in other electroplax membrane glycopeptides. Lectins from Limax flavus (LFA) and wheat germ (WGA) proved the most effective of 11 lectin resins tried. The most selective resin was prepared from IgM antibodies against Neisseria meningitidis {alpha}-(2{yields}8)-polysialic acid which were affinity purified and coupled to Sepharose 4B. The sodium channel was found to bind to WGA, LFA, and IgM resins and was readily eluted with the appropriate soluble carbohydrates. Experiments with LFA and IgM resins demonstrated binding and unbinding rates and displacement kinetics, which suggest highly specific binding at multiple sites on the sodium channel protein. In preparative-scale purification of protein previously fractionated by anion-exchange chromatography, without stabilizing TTX, high yields were reproducibly obtained. Further, when detergent extracts were prepared from electroplax membranes fractionated by low-speed sedimentation, a single step over the IgM resin provided a 70-fold purification, yielding specific activities of 3,200 pmol of ({sup 3}H)TTX-binding sites/mg of protein and a single polypeptide of {approximately}285,000 Da on SDS-acrylamide gels. No small peptides were observed after this 5-h isolation. The authors describe a cation-dependent stabilization with millimolar levels of monovalent and micromolar levels of divalent species.
Inhibition of large conductance calcium-dependent potassium ...
African Journals Online (AJOL)
conductance, calcium and voltage- dependent potassium (BKCa) channels thereby promoting vasoconstriction. Our results show that the Rho-kinase inhibitor, Y-27632, induced concentration-dependent relaxation in rat mesenteric artery.
Neely, Alan; Hidalgo, Patricia
2014-01-01
Openings of high-voltage-activated (HVA) calcium channels lead to a transient increase in calcium concentration that in turn activate a plethora of cellular functions, including muscle contraction, secretion and gene transcription. To coordinate all these responses calcium channels form supramolecular assemblies containing effectors and regulatory proteins that couple calcium influx to the downstream signal cascades and to feedback elements. According to the original biochemical characterization of skeletal muscle Dihydropyridine receptors, HVA calcium channels are multi-subunit protein complexes consisting of a pore-forming subunit (α1) associated with four additional polypeptide chains β, α2, δ, and γ, often referred to as accessory subunits. Twenty-five years after the first purification of a high-voltage calcium channel, the concept of a flexible stoichiometry to expand the repertoire of mechanisms that regulate calcium channel influx has emerged. Several other proteins have been identified that associate directly with the α1-subunit, including calmodulin and multiple members of the small and large GTPase family. Some of these proteins only interact with a subset of α1-subunits and during specific stages of biogenesis. More strikingly, most of the α1-subunit interacting proteins, such as the β-subunit and small GTPases, regulate both gating and trafficking through a variety of mechanisms. Modulation of channel activity covers almost all biophysical properties of the channel. Likewise, regulation of the number of channels in the plasma membrane is performed by altering the release of the α1-subunit from the endoplasmic reticulum, by reducing its degradation or enhancing its recycling back to the cell surface. In this review, we discuss the structural basis, interplay and functional role of selected proteins that interact with the central pore-forming subunit of HVA calcium channels. PMID:24917826
Voltage and temperature dependence of the grain boundary tunneling magnetoresistance in manganites
Hoefener, C.; Philipp, J. B.; Klein, J.; Alff, L.; Marx, A.; Buechner, B.; Gross, R.
2000-01-01
We have performed a systematic analysis of the voltage and temperature dependence of the tunneling magnetoresistance (TMR) of grain boundaries (GB) in the manganites. We find a strong decrease of the TMR with increasing voltage and temperature. The decrease of the TMR with increasing voltage scales with an increase of the inelastic tunneling current due to multi-step inelastic tunneling via localized defect states in the tunneling barrier. This behavior can be described within a three-current...
International Nuclear Information System (INIS)
Halim, Md Abdul; Ishibashi, Kenji; Arima, Hidehiko; Terao, Norichika
2006-01-01
An electrochemical detector with biological material has been applied for the detection of neutrinos on the basis of a new hypothesis. The detector consisted of two electrodes with raw silk and purified water, and gave an appreciable output voltage. The reproducibility of the experimental results was as good as 99.4% at temperature of 300 K. The temperature dependence of the voltage of the detector was studied at 280, 290, 300 and 310 K. Among them, the detector at 310 K produced the highest output voltage and reached 104 mV in 16 days, whereas that at 280 K generated the lowest voltage and it was as low as 1.2 mV in 16 days. The detectors working at 290 and 300 K produced the voltages 18 and 57 mV in 16 days, respectively. The output voltages of the detector increased with temperature and were in good agreement in spite of the history of temperature. The internal resistance and electromotive force (internal voltage) of the experimental detector were obtained at each temperature by individual analysis and least square fitting method. It was found that the electromotive force was almost constant for these temperatures while the internal resistance showed a large dependence on temperature. The reduction of the output voltage with temperature is dominated by this behavior of internal resistance. (author)
Findeisen, Felix; Rumpf, Christine H; Minor, Daniel L
2013-09-09
In neurons, binding of calmodulin (CaM) or calcium-binding protein 1 (CaBP1) to the CaV1 (L-type) voltage-gated calcium channel IQ domain endows the channel with diametrically opposed properties. CaM causes calcium-dependent inactivation and limits calcium entry, whereas CaBP1 blocks calcium-dependent inactivation (CDI) and allows sustained calcium influx. Here, we combine isothermal titration calorimetry with cell-based functional measurements and mathematical modeling to show that these calcium sensors behave in a competitive manner that is explained quantitatively by their apo-state binding affinities for the IQ domain. This competition can be completely blocked by covalent tethering of CaM to the channel. Further, we show that Ca(2+)/CaM has a sub-picomolar affinity for the IQ domain that is achieved without drastic alteration of calcium-binding properties. The observation that the apo forms of CaM and CaBP1 compete with each other demonstrates a simple mechanism for direct modulation of CaV1 function and suggests a means by which excitable cells may dynamically tune CaV activity. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.
Sweeney, Michael; Galli, Jonathan; McNally, Scott; Tebo, Anne; Haven, Thomas; Thulin, Perla; Clardy, Stacey L
2017-01-01
We utilise a clinical case to highlight why exclusion of voltage-gated potassium channel (VGKC)-complex autoantibody testing in serological evaluation of patients may delay or miss the diagnosis. A 68-year-old man presented with increasing involuntary movements consistent with faciobrachial dystonic seizures (FBDS). Initial evaluation demonstrated VGKC antibody seropositivity with leucine-rich glioma-inactivated 1 (LGI1) and contactin-associated protein-like 2 (CASPR2) seronegativity. Aggress...
International Nuclear Information System (INIS)
Yamacli, Serhan; Avci, Mutlu
2009-01-01
In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.
Effects of the small molecule HERG activator NS1643 on Kv11.3 channels.
Directory of Open Access Journals (Sweden)
Arne Bilet
Full Text Available NS1643 is one of the small molecule HERG (Kv11.1 channel activators and has also been found to increase erg2 (Kv11.2 currents. We now investigated whether NS1643 is also able to act as an activator of Kv11.3 (erg3 channels expressed in CHO cells. Activation of rat Kv11.3 current occurred in a dose-dependent manner and maximal current increasing effects were obtained with 10 µM NS1643. At this concentration, steady-state outward current increased by about 80% and the current increase was associated with a significant shift in the voltage dependence of activation to more negative potentials by about 15 mV. In addition, activation kinetics were accelerated, whereas deactivation was slowed. There was no significant effect on the kinetics of inactivation and recovery from inactivation. The strong current-activating agonistic effect of NS1643 did not result from a shift in the voltage dependence of Kv11.3 channel inactivation and was independent from external Na(+ or Ca(2+. At the higher concentration of 20 µM, NS1643 induced clearly less current increase. The left shift in the voltage dependence of activation reversed and the voltage sensitivity of activation dramatically decreased along with a slowing of Kv11.3 channel activation. These data show that, in comparison to other Kv11 family members, NS1643 exerts distinct effects on Kv11.3 channels with especially pronounced partial antagonistic effects at higher concentration.
Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain
Directory of Open Access Journals (Sweden)
Yukiko eMishina
2014-09-01
Full Text Available Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviours. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP prototypical design or on the voltage dependent state transitions of microbial opsins.We recently introduced a new VSFP design in which the voltage-sensing domain (VSD is sandwiched between a FRET pair of fluorescent proteins (termed VSFP-Butterflies and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase (Ci-VSP are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.
Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain.
Mishina, Yukiko; Mutoh, Hiroki; Song, Chenchen; Knöpfel, Thomas
2014-01-01
Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviors. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs) has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP) prototypical design or on the voltage-dependent state transitions of microbial opsins. We recently introduced a new VSFP design in which the voltage-sensing domain (VSD) is sandwiched between a fluorescence resonance energy transfer pair of fluorescent proteins (termed VSFP-Butterflies) and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.
Is there a role for T-type Ca2+ channels in regulation of vasomotor tone in mesenteric arterioles?
DEFF Research Database (Denmark)
Jensen, Lars Jørn; Holstein-Rathlou, Niels-Henrik
2009-01-01
The largest peripheral blood pressure drop occurs in terminal arterioles (microm lumen diameter). L-type voltage-dependent Ca2+ channels (VDCCs) are considered the primary pathway for Ca2+ influx during physiologic activation of vascular smooth muscle cells (VSMC). Recent evidence suggests...... was predominantly expressed in endothelial cells. Voltage-dependent Ca2+ entry was inhibited by the new specific T-type blockers R(-)-efonidipine and NNC 55-0396. The effect of NNC 55-0396 persisted in depolarized arterioles, suggesting an unusually high activation threshold of mesenteric T-type channels. T...... that T-type VDCCs are expressed in renal afferent and efferent arterioles, mesenteric arterioles, and skeletal muscle arterioles. T-type channels are small-conductance, low voltage-activated, fast-inactivating channels. Thus, their role in supplying Ca2+ for contraction of VSMC has been disputed. However...
Martín, Víctor; Vale, Carmen; Rubiolo, Juan A; Roel, Maria; Hirama, Masahiro; Yamashita, Shuji; Vieytes, Mercedes R; Botana, Luís M
2015-06-15
Ciguatoxins are sodium channels activators that cause ciguatera, one of the most widespread nonbacterial forms of food poisoning, which presents with long-term neurological alterations. In central neurons, chronic perturbations in activity induce homeostatic synaptic mechanisms that adjust the strength of excitatory synapses and modulate glutamate receptor expression in order to stabilize the overall activity. Immediate early genes, such as Arc and Egr1, are induced in response to activity changes and underlie the trafficking of glutamate receptors during neuronal homeostasis. To better understand the long lasting neurological consequences of ciguatera, it is important to establish the role that chronic changes in activity produced by ciguatoxins represent to central neurons. Here, the effect of a 30 min exposure of 10-13 days in vitro (DIV) cortical neurons to the synthetic ciguatoxin CTX 3C on Arc and Egr1 expression was evaluated using real-time polymerase chain reaction approaches. Since the toxin increased the mRNA levels of both Arc and Egr1, the effect of CTX 3C in NaV channels, membrane potential, firing activity, miniature excitatory postsynaptic currents (mEPSCs), and glutamate receptors expression in cortical neurons after a 24 h exposure was evaluated using electrophysiological and western blot approaches. The data presented here show that CTX 3C induced an upregulation of Arc and Egr1 that was prevented by previous coincubation of the neurons with the NaV channel blocker tetrodotoxin. In addition, chronic CTX 3C caused a concentration-dependent shift in the activation voltage of NaV channels to more negative potentials and produced membrane potential depolarization. Moreover, 24 h treatment of cortical neurons with 5 nM CTX 3C decreased neuronal firing and induced synaptic scaling mechanisms, as evidenced by a decrease in the amplitude of mEPSCs and downregulation in the protein level of glutamate receptors that was also prevented by tetrodotoxin
Carrasco, Dario I; Vincent, Jacob A; Cope, Timothy C
2017-04-01
Knowledge of the molecular mechanisms underlying signaling of mechanical stimuli by muscle spindles remains incomplete. In particular, the ionic conductances that sustain tonic firing during static muscle stretch are unknown. We hypothesized that tonic firing by spindle afferents depends on sodium persistent inward current (INaP) and tested for the necessary presence of the appropriate voltage-gated sodium (NaV) channels in primary sensory endings. The NaV 1.6 isoform was selected for both its capacity to produce INaP and for its presence in other mechanosensors that fire tonically. The present study shows that NaV 1.6 immunoreactivity (IR) is concentrated in heminodes, presumably where tonic firing is generated, and we were surprised to find NaV 1.6 IR strongly expressed also in the sensory terminals, where mechanotransduction occurs. This spatial pattern of NaV 1.6 IR distribution was consistent for three mammalian species (rat, cat, and mouse), as was tonic firing by primary spindle afferents. These findings meet some of the conditions needed to establish participation of INaP in tonic firing by primary sensory endings. The study was extended to two additional NaV isoforms, selected for their sensitivity to TTX, excluding TTX-resistant NaV channels, which alone are insufficient to support firing by primary spindle endings. Positive immunoreactivity was found for NaV 1.1 , predominantly in sensory terminals together with NaV 1.6 and for NaV 1.7 , mainly in preterminal axons. Differential distribution in primary sensory endings suggests specialized roles for these three NaV isoforms in the process of mechanosensory signaling by muscle spindles. NEW & NOTEWORTHY The molecular mechanisms underlying mechanosensory signaling responsible for proprioceptive functions are not completely elucidated. This study provides the first evidence that voltage-gated sodium channels (NaVs) are expressed in the spindle primary sensory ending, where NaVs are found at every site
Sleep disturbances in voltage-gated potassium channel antibody syndrome.
Barone, Daniel A; Krieger, Ana C
2016-05-01
Voltage-gated potassium channels (VGKCs) are a family of membrane proteins responsible for controlling cell membrane potential. The presence of antibodies (Ab) against neuronal VGKC complexes aids in the diagnosis of idiopathic and paraneoplastic autoimmune neurologic disorders. The diagnosis of VGKC Ab-associated encephalopathy (VCKC Ab syndrome) should be suspected in patients with subacute onset of disorientation, confusion, and memory loss in the presence of seizures or a movement disorder. VGKC Ab syndrome may present with sleep-related symptoms, and the purpose of this communication is to alert sleep and neurology clinicians of this still-under-recognized condition. In this case, we are presenting the VGKC Ab syndrome which improved after treatment with solumedrol. The prompt recognition and treatment of this condition may prevent the morbidity associated with cerebral atrophy and the mortality associated with intractable seizures and electrolyte disturbances. Copyright © 2016. Published by Elsevier B.V.
Properties of Single K+ and Cl− Channels in Asclepias tuberosa Protoplasts 1
Schauf, Charles L.; Wilson, Kathryn J.
1987-01-01
Potassium and chloride channels were characterized in Asclepias tuberosa suspension cell derived protoplasts by patch voltage-clamp. Whole-cell currents and single channels in excised patches had linear instantaneous current-voltage relations, reversing at the Nernst potentials for K+ and Cl−, respectively. Whole cell K+ currents activated exponentially during step depolarizations, while voltage-dependent Cl− channels were activated by hyperpolarizations. Single K+ channel conductance was 40 ± 5 pS with a mean open time of 4.5 milliseconds at 100 millivolts. Potassium channels were blocked by Cs+ and tetraethylammonium, but were insensitive to 4-aminopyridine. Chloride channels had a single-channel conductance of 100 ± 17 picosiemens, mean open time of 8.8 milliseconds, and were blocked by Zn2+ and ethacrynic acid. Whole-cell Cl− currents were inhibited by abscisic acid, and were unaffected by indole-3-acetic acid and 2,4-dichlorophenoxyacetic acid. Since internal and external composition can be controlled, patch-clamped protoplasts are ideal systems for studying the role of ion channels in plant physiology and development. Images Fig. 5 PMID:16665712
Mechanosensitive gating of Kv channels.
Directory of Open Access Journals (Sweden)
Catherine E Morris
Full Text Available K-selective voltage-gated channels (Kv are multi-conformation bilayer-embedded proteins whose mechanosensitive (MS Popen(V implies that at least one conformational transition requires the restructuring of the channel-bilayer interface. Unlike Morris and colleagues, who attributed MS-Kv responses to a cooperative V-dependent closed-closed expansion↔compaction transition near the open state, Mackinnon and colleagues invoke expansion during a V-independent closed↔open transition. With increasing membrane tension, they suggest, the closed↔open equilibrium constant, L, can increase >100-fold, thereby taking steady-state Popen from 0→1; "exquisite sensitivity to small…mechanical perturbations", they state, makes a Kv "as much a mechanosensitive…as…a voltage-dependent channel". Devised to explain successive gK(V curves in excised patches where tension spontaneously increased until lysis, their L-based model falters in part because of an overlooked IK feature; with recovery from slow inactivation factored in, their g(V datasets are fully explained by the earlier model (a MS V-dependent closed-closed transition, invariant L≥4. An L-based MS-Kv predicts neither known Kv time courses nor the distinctive MS responses of Kv-ILT. It predicts Kv densities (hence gating charge per V-sensor several-fold different from established values. If opening depended on elevated tension (L-based model, standard gK(V operation would be compromised by animal cells' membrane flaccidity. A MS V-dependent transition is, by contrast, unproblematic on all counts. Since these issues bear directly on recent findings that mechanically-modulated Kv channels subtly tune pain-related excitability in peripheral mechanoreceptor neurons we undertook excitability modeling (evoked action potentials. Kvs with MS V-dependent closed-closed transitions produce nuanced mechanically-modulated excitability whereas an L-based MS-Kv yields extreme, possibly excessive
Balbi, Pietro; Massobrio, Paolo; Hellgren Kotaleski, Jeanette
2017-09-01
Modelling ionic channels represents a fundamental step towards developing biologically detailed neuron models. Until recently, the voltage-gated ion channels have been mainly modelled according to the formalism introduced by the seminal works of Hodgkin and Huxley (HH). However, following the continuing achievements in the biophysical and molecular comprehension of these pore-forming transmembrane proteins, the HH formalism turned out to carry limitations and inconsistencies in reproducing the ion-channels electrophysiological behaviour. At the same time, Markov-type kinetic models have been increasingly proven to successfully replicate both the electrophysiological and biophysical features of different ion channels. However, in order to model even the finest non-conducting molecular conformational change, they are often equipped with a considerable number of states and related transitions, which make them computationally heavy and less suitable for implementation in conductance-based neurons and large networks of those. In this purely modelling study we develop a Markov-type kinetic model for all human voltage-gated sodium channels (VGSCs). The model framework is detailed, unifying (i.e., it accounts for all ion-channel isoforms) and computationally efficient (i.e. with a minimal set of states and transitions). The electrophysiological data to be modelled are gathered from previously published studies on whole-cell patch-clamp experiments in mammalian cell lines heterologously expressing the human VGSC subtypes (from NaV1.1 to NaV1.9). By adopting a minimum sequence of states, and using the same state diagram for all the distinct isoforms, the model ensures the lightest computational load when used in neuron models and neural networks of increasing complexity. The transitions between the states are described by original ordinary differential equations, which represent the rate of the state transitions as a function of voltage (i.e., membrane potential). The
Energy Technology Data Exchange (ETDEWEB)
Um, Jae Gwang; Mativenga, Mallory; Jang, Jin, E-mail: jjang@khu.ac.kr [Advanced Display Research Center, Department of Information Display, Kyung Hee University, Dongdaemun-gu, Seoul 130-701 (Korea, Republic of); Migliorato, Piero [Advanced Display Research Center, Department of Information Display, Kyung Hee University, Dongdaemun-gu, Seoul 130-701 (Korea, Republic of); Electrical Engineering Division, Department of Engineering, Cambridge University, Cambridge CB3 0FA (United Kingdom)
2015-06-21
We have investigated the dependence of Negative-Bias-illumination-Stress (NBIS) upon channel length, in amorphous-indium-gallium-zinc-oxide (a-IGZO) thin-film transistors (TFTs). The negative shift of the transfer characteristic associated with NBIS decreases for increasing channel length and is practically suppressed in devices with L = 100-μm. The effect is consistent with creation of donor defects, mainly in the channel regions adjacent to source and drain contacts. Excellent agreement with experiment has been obtained by an analytical treatment, approximating the distribution of donors in the active layer by a double exponential with characteristic length L{sub D} ∼ L{sub n} ∼ 10-μm, the latter being the electron diffusion length. The model also shows that a device with a non-uniform doping distribution along the active layer is in all equivalent, at low drain voltages, to a device with the same doping averaged over the active layer length. These results highlight a new aspect of the NBIS mechanism, that is, the dependence of the effect upon the relative magnitude of photogenerated holes and electrons, which is controlled by the device potential/band profile. They may also provide the basis for device design solutions to minimize NBIS.
International Nuclear Information System (INIS)
Chaujar, Rishu; Kaur, Ravneet; Gupta, Mridula; Gupta, R S; Saxena, Manoj
2009-01-01
This paper discusses a threshold voltage model for novel device structure: gate electrode work function engineered recessed channel (GEWE-RC) nanoscale MOSFET, which combines the advantages of both RC and GEWE structures. In part I, the model accurately predicts (a) surface potential, (b) threshold voltage and (c) sub-threshold slope for single material gate recessed channel (SMG-RC) and GEWE-RC structures. Part II focuses on the development of compact analytical drain current model taking into account the transition regimes from sub-threshold to saturation. Furthermore, the drain conductance evaluation has also been obtained, reflecting relevance of the proposed device for analogue design. The analysis takes into account the effect of gate length and groove depth in order to develop a compact model suitable for device design. The analytical results predicted by the model confirm well with the simulated results. Results in part I also provide valuable design insights in the performance of nanoscale GEWE-RC MOSFET with optimum threshold voltage and negative junction depth (NJD), and hence serves as a tool to optimize important device and technological parameters for 40 nm technology
Action of insecticidal N-alkylamides at site 2 of the voltage-sensitive sodium channel
International Nuclear Information System (INIS)
Ottea, J.A.; Payne, G.T.; Soderlund, D.M.
1990-01-01
Nine synthetic N-alkylamides were examined as inhibitors of the specific binding of [ 3 H]batrachotoxinin A 20α-benzoate ([ 3 H]BTX-B) to sodium channels and as activators of sodium uptake in mouse brain synaptoneurosomes. In the presence of scorpion (Leiurus quinquestriatus) venom, the six insecticidal analogues were active as both inhibitors of [ 3 H]BTX-B binding and stimulators of sodium uptake. These findings are consistent with an action of these compounds at the alkaloid activator recognition site (site 2) of the voltage-sensitive sodium channel. The three noninsecticidal N-alkylamides also inhibited [ 3 H]BTX-B binding but were ineffective as activators of sodium uptake. Concentration-response studies revealed that some of the insecticidal amides also enhanced sodium uptake through a second, high-affinity interaction that does not involve site 2, but this secondary effect does not appear to be correlated with insecticidal activity. The activities of N-alkylamides as sodium channel activators were influenced by the length of the alkenyl chain and the location of unsaturation within the molecule. These results further define the actions of N-alkylamides on sodium channels and illustrate the significance of the multiple binding domains of the sodium channel as target sites for insect control agents
Directory of Open Access Journals (Sweden)
Zhong Tao P
2007-07-01
Full Text Available Abstract Background Action potential generation in excitable cells such as myocytes and neurons critically depends on voltage-gated sodium channels. In mammals, sodium channels exist as macromolecular complexes that include a pore-forming alpha subunit and 1 or more modulatory beta subunits. Although alpha subunit genes have been cloned from diverse metazoans including flies, jellyfish, and humans, beta subunits have not previously been identified in any non-mammalian species. To gain further insight into the evolution of electrical signaling in vertebrates, we investigated beta subunit genes in the teleost Danio rerio (zebrafish. Results We identified and cloned single zebrafish gene homologs for beta1-beta3 (zbeta1-zbeta3 and duplicate genes for beta4 (zbeta4.1, zbeta4.2. Sodium channel beta subunit loci are similarly organized in fish and mammalian genomes. Unlike their mammalian counterparts, zbeta1 and zbeta2 subunit genes display extensive alternative splicing. Zebrafish beta subunit genes and their splice variants are differentially-expressed in excitable tissues, indicating tissue-specific regulation of zbeta1-4 expression and splicing. Co-expression of the genes encoding zbeta1 and the zebrafish sodium channel alpha subunit Nav1.5 in Chinese Hamster Ovary cells increased sodium current and altered channel gating, demonstrating functional interactions between zebrafish alpha and beta subunits. Analysis of the synteny and phylogeny of mammalian, teleost, amphibian, and avian beta subunit and related genes indicated that all extant vertebrate beta subunits are orthologous, that beta2/beta4 and beta1/beta3 share common ancestry, and that beta subunits are closely related to other proteins sharing the V-type immunoglobulin domain structure. Vertebrate sodium channel beta subunit genes were not identified in the genomes of invertebrate chordates and are unrelated to known subunits of the para sodium channel in Drosophila. Conclusion The
Hubball, A W; Lang, B; Souza, M A N; Curran, O D; Martin, J E; Knowles, C H
2012-08-01
Autoantibodies directed against specific neuronal antigens are found in a significant number of patients with gastrointestinal neuromuscular diseases (GINMDs) secondary to neoplasia. This study examined the presence of antineuronal antibodies in idiopathic GINMD and GINMD secondary to South American Trypanosomiasis. The GI distribution of voltage-gated potassium channels (VGKCs) was also investigated. Seventy-three patients were included in the study with diagnoses of primary achalasia, enteric dysmotility, chronic intestinal pseudo-obstruction, esophageal or colonic dysmotility secondary to Chagas' disease. Sera were screened for specific antibodies to glutamic acid decarboxylase, voltage-gated calcium channels (VGCCs; P/Q subtype), nicotinic acetylcholine receptors (nAChRs; α3 subtype), and voltage-gated potassium channels (VGKCs, K(V) 1 subtype) using validated immunoprecipitation assays. The distribution of six VGKC subunits (K(V) 1.1-1.6), including those known to be antigenic targets of anti-VGKC antibodies was immunohistochemically investigated in all main human GI tract regions. Three patients (14%) with chagasic GI dysmotility were found to have positive anti-VGKC antibody titers. No antibodies were detected in patients with idiopathic GINMD. The VGKCs were found in enteric neurons at every level of the gut in unique yet overlapping distributions. The VGKC expression in GI smooth muscle was found to be limited to the esophagus. A small proportion of patients with GI dysfunction secondary to Chagas' disease have antibodies against VGKCs. The presence of these channels in the human enteric nervous system may have pathological relevance to the growing number of GINMDs with which anti-VGKC antibodies have been associated. © 2012 Blackwell Publishing Ltd.
Lysine and the Na+/K+ Selectivity in Mammalian Voltage-Gated Sodium Channels.
Directory of Open Access Journals (Sweden)
Yang Li
Full Text Available Voltage-gated sodium (Nav channels are critical in the generation and transmission of neuronal signals in mammals. The crystal structures of several prokaryotic Nav channels determined in recent years inspire the mechanistic studies on their selection upon the permeable cations (especially between Na+ and K+ ions, a property that is proposed to be mainly determined by residues in the selectivity filter. However, the mechanism of cation selection in mammalian Nav channels lacks direct explanation at atomic level due to the difference in amino acid sequences between mammalian and prokaryotic Nav homologues, especially at the constriction site where the DEKA motif has been identified to determine the Na+/K+ selectivity in mammalian Nav channels but is completely absent in the prokaryotic counterparts. Among the DEKA residues, Lys is of the most importance since its mutation to Arg abolishes the Na+/K+ selectivity. In this work, we modeled the pore domain of mammalian Nav channels by mutating the four residues at the constriction site of a prokaryotic Nav channel (NavRh to DEKA, and then mechanistically investigated the contribution of Lys in cation selection using molecular dynamics simulations. The DERA mutant was generated as a comparison to understand the loss of ion selectivity caused by the K-to-R mutation. Simulations and free energy calculations on the mutants indicate that Lys facilitates Na+/K+ selection by electrostatically repelling the cation to a highly Na+-selective location sandwiched by the carboxylate groups of Asp and Glu at the constriction site. In contrast, the electrostatic repulsion is substantially weakened when Lys is mutated to Arg, because of two intrinsic properties of the Arg side chain: the planar geometric design and the sparse charge distribution of the guanidine group.
Lysine and the Na+/K+ Selectivity in Mammalian Voltage-Gated Sodium Channels.
Li, Yang; Liu, Huihui; Xia, Mengdie; Gong, Haipeng
2016-01-01
Voltage-gated sodium (Nav) channels are critical in the generation and transmission of neuronal signals in mammals. The crystal structures of several prokaryotic Nav channels determined in recent years inspire the mechanistic studies on their selection upon the permeable cations (especially between Na+ and K+ ions), a property that is proposed to be mainly determined by residues in the selectivity filter. However, the mechanism of cation selection in mammalian Nav channels lacks direct explanation at atomic level due to the difference in amino acid sequences between mammalian and prokaryotic Nav homologues, especially at the constriction site where the DEKA motif has been identified to determine the Na+/K+ selectivity in mammalian Nav channels but is completely absent in the prokaryotic counterparts. Among the DEKA residues, Lys is of the most importance since its mutation to Arg abolishes the Na+/K+ selectivity. In this work, we modeled the pore domain of mammalian Nav channels by mutating the four residues at the constriction site of a prokaryotic Nav channel (NavRh) to DEKA, and then mechanistically investigated the contribution of Lys in cation selection using molecular dynamics simulations. The DERA mutant was generated as a comparison to understand the loss of ion selectivity caused by the K-to-R mutation. Simulations and free energy calculations on the mutants indicate that Lys facilitates Na+/K+ selection by electrostatically repelling the cation to a highly Na+-selective location sandwiched by the carboxylate groups of Asp and Glu at the constriction site. In contrast, the electrostatic repulsion is substantially weakened when Lys is mutated to Arg, because of two intrinsic properties of the Arg side chain: the planar geometric design and the sparse charge distribution of the guanidine group.
International Nuclear Information System (INIS)
Zhang, Q.; Shan, F. K.; Liu, G. X.; Liu, A.; Lee, W. J.; Shin, B. C.
2014-01-01
Amorphous indium-titanium-zinc-oxide (ITZO) thin-film transistors (TFTs) with various channel thicknesses were fabricated at room temperature by using pulsed laser deposition. The channel layer thickness (CLT) dependence of the TFTs was investigated. All the ITZO thin films were amorphous, and the surface roughnesses decreased slightly first and then increased with increasing CLT. With increasing CLT from 35 to 140 nm, the on/off current ratio and the field-effect mobility increased, and the subthreshold swing decreased. The TFT with a CLT of 210 nm exhibited the worst performance, while the ITZO TFT with a CLT of 140 nm exhibited the best performance with a subthreshold voltage of 2.86 V, a mobility of 53.9 cm 2 V -1 s -1 , a subthreshold swing of 0.29 V/decade and an on/off current ratio of 10 9 .
A novel NaV1.5 voltage sensor mutation associated with severe atrial and ventricular arrhythmias.
Wang, Hong-Gang; Zhu, Wandi; Kanter, Ronald J; Silva, Jonathan R; Honeywell, Christina; Gow, Robert M; Pitt, Geoffrey S
2016-03-01
Inherited autosomal dominant mutations in cardiac sodium channels (NaV1.5) cause various arrhythmias, such as long QT syndrome and Brugada syndrome. Although dozens of mutations throughout the protein have been reported, there are few reported mutations within a voltage sensor S4 transmembrane segment and few that are homozygous. Here we report analysis of a novel lidocaine-sensitive recessive mutation, p.R1309H, in the NaV1.5 DIII/S4 voltage sensor in a patient with a complex arrhythmia syndrome. We expressed the wild type or mutant NaV1.5 heterologously for analysis with the patch-clamp and voltage clamp fluorometry (VCF) techniques. p.R1309H depolarized the voltage-dependence of activation, hyperpolarized the voltage-dependence of inactivation, and slowed recovery from inactivation, thereby reducing the channel availability at physiologic membrane potentials. Additionally, p.R1309H increased the "late" Na(+) current. The location of the mutation in DIIIS4 prompted testing for a gating pore current. We observed an inward current at hyperpolarizing voltages that likely exacerbates the loss-of-function defects at resting membrane potentials. Lidocaine reduced the gating pore current. The p.R1309H homozygous NaV1.5 mutation conferred both gain-of-function and loss-of-function effects on NaV1.5 channel activity. Reduction of a mutation-induced gating pore current by lidocaine suggested a therapeutic mechanism. Copyright © 2016 Elsevier Ltd. All rights reserved.
Yamaoka, Kaoru; Inoue, Masayuki; Miyahara, Hidemichi; Miyazaki, Keisuke; Hirama, Masahiro
2004-01-01
Ciguatoxins (CTXs) are known to bind to receptor site 5 of the voltage-dependent Na channel, but the toxin's physiological effects are poorly understood. In this study, we investigated the effects of a ciguatoxin congener (CTX3C) on three different Na-channel isoforms, rNav1.2, rNav1.4, and rNav1.5, which were transiently expressed in HEK293 cells. The toxin (1.0 μmol l−1) shifted the activation potential (V1/2 of activation curve) in the negative direction by 4–9 mV and increased the slope factor (k) from 8 mV to between 9 and 12 mV (indicative of decreased steepness of the activation curve), thereby resulting in a hyperpolarizing shift of the threshold potential by 30 mV for all Na channel isoforms. The toxin (1.0 μmol l−1) significantly accelerated the time-to-peak current from 0.62 to 0.52 ms in isoform rNav1.2. Higher doses of the toxin (3–10 μmol l−1) additionally decreased time-to-peak current in rNav1.4 and rNav1.5. A toxin effect on decay of INa at −20 mV was either absent or marginal even at relatively high doses of CTX3C. The toxin (1 μmol l−1) shifted the inactivation potential (V1/2 of inactivation curve) in the negative direction by 15–18 mV in all isoforms. INa maxima of the I–V curve (at −20 mV) were suppressed by application of 1.0 μmol l−1 CTX3C to a similar extent (80–85% of the control) in all the three isoforms. Higher doses of CTX3C up to 10 μmol l−1 further suppressed INa to 61–72% of the control. Recovery from slow inactivation induced by a depolarizing prepulse of intermediate duration (500 ms) was dramatically delayed in the presence of 1.0 μmol l−1 CTX3C, as time constants describing the monoexponential recovery were increased from 38±8 to 588±151 ms (n=5), 53±6 to 338±85 ms (n=4), and 23±3 to 232±117 ms (n=3) in rNav1.2, rNav1.4, and rNav1.5, respectively. CTX3C exerted multimodal effects on sodium channels, with simultaneous stimulatory and inhibitory aspects, probably due to the large
MacDonald, Patrick E; De Marinis, Yang Zhang; Ramracheya, Reshma; Salehi, Albert; Ma, Xiaosong; Johnson, Paul R V; Cox, Roger; Eliasson, Lena; Rorsman, Patrik
2007-06-01
Glucagon, secreted from pancreatic islet alpha cells, stimulates gluconeogenesis and liver glycogen breakdown. The mechanism regulating glucagon release is debated, and variously attributed to neuronal control, paracrine control by neighbouring beta cells, or to an intrinsic glucose sensing by the alpha cells themselves. We examined hormone secretion and Ca(2+) responses of alpha and beta cells within intact rodent and human islets. Glucose-dependent suppression of glucagon release persisted when paracrine GABA or Zn(2+) signalling was blocked, but was reversed by low concentrations (1-20 muM) of the ATP-sensitive K(+) (KATP) channel opener diazoxide, which had no effect on insulin release or beta cell responses. This effect was prevented by the KATP channel blocker tolbutamide (100 muM). Higher diazoxide concentrations (>/=30 muM) decreased glucagon and insulin secretion, and alpha- and beta-cell Ca(2+) responses, in parallel. In the absence of glucose, tolbutamide at low concentrations (10 muM) were inhibitory. In the presence of a maximally inhibitory concentration of tolbutamide (0.5 mM), glucose had no additional suppressive effect. Downstream of the KATP channel, inhibition of voltage-gated Na(+) (TTX) and N-type Ca(2+) channels (omega-conotoxin), but not L-type Ca(2+) channels (nifedipine), prevented glucagon secretion. Both the N-type Ca(2+) channels and alpha-cell exocytosis were inactivated at depolarised membrane potentials. Rodent and human glucagon secretion is regulated by an alpha-cell KATP channel-dependent mechanism. We propose that elevated glucose reduces electrical activity and exocytosis via depolarisation-induced inactivation of ion channels involved in action potential firing and secretion.
Impaired control of L-type voltage-dependent calcium channels in experimental hypertension
Czech Academy of Sciences Publication Activity Database
Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Behuliak, M.; Kuneš, Jaroslav; Zicha, Josef
2009-01-01
Roč. 58, Suppl.2 (2009), S43-S54 ISSN 0862-8408 R&D Projects: GA ČR(CZ) GA305/08/0139; GA ČR(CZ) GA305/09/0336; GA AV ČR(CZ) IAA500110902; GA MŠk(CZ) 1M0510 Institutional research plan: CEZ:AV0Z50110509 Keywords : calcium -activated K+ and Cl- channels * vasoactive systems * EDCF Subject RIV: ED - Physiology Impact factor: 1.430, year: 2009
Channel sialic acids limit hERG channel activity during the ventricular action potential.
Norring, Sarah A; Ednie, Andrew R; Schwetz, Tara A; Du, Dongping; Yang, Hui; Bennett, Eric S
2013-02-01
Activity of human ether-a-go-go-related gene (hERG) 1 voltage-gated K(+) channels is responsible for portions of phase 2 and phase 3 repolarization of the human ventricular action potential. Here, we questioned whether and how physiologically and pathophysiologically relevant changes in surface N-glycosylation modified hERG channel function. Voltage-dependent hERG channel gating and activity were evaluated as expressed in a set of Chinese hamster ovary (CHO) cell lines under conditions of full glycosylation, no sialylation, no complex N-glycans, and following enzymatic deglycosylation of surface N-glycans. For each condition of reduced glycosylation, hERG channel steady-state activation and inactivation relationships were shifted linearly by significant depolarizing ∼9 and ∼18 mV, respectively. The hERG window current increased significantly by 50-150%, and the peak shifted by a depolarizing ∼10 mV. There was no significant change in maximum hERG current density. Deglycosylated channels were significantly more active (20-80%) than glycosylated controls during phases 2 and 3 of action potential clamp protocols. Simulations of hERG current and ventricular action potentials corroborated experimental data and predicted reduced sialylation leads to a 50-70-ms decrease in action potential duration. The data describe a novel mechanism by which hERG channel gating is modulated through physiologically and pathophysiologically relevant changes in N-glycosylation; reduced channel sialylation increases hERG channel activity during the action potential, thereby increasing the rate of action potential repolarization.
Ogino, Kazutoyo; Low, Sean E.; Yamada, Kenta; Saint-Amant, Louis; Zhou, Weibin; Muto, Akira; Asakawa, Kazuhide; Nakai, Junichi; Kawakami, Koichi; Kuwada, John Y.; Hirata, Hiromi
2015-01-01
Following their synthesis in the endoplasmic reticulum (ER), voltage-gated sodium channels (NaV) are transported to the membranes of excitable cells, where they often cluster, such as at the axon initial segment of neurons. Although the mechanisms by which NaV channels form and maintain clusters have been extensively examined, the processes that govern their transport and degradation have received less attention. Our entry into the study of these processes began with the isolation of a new allele of the zebrafish mutant alligator, which we found to be caused by mutations in the gene encoding really interesting new gene (RING) finger protein 121 (RNF121), an E3-ubiquitin ligase present in the ER and cis-Golgi compartments. Here we demonstrate that RNF121 facilitates two opposing fates of NaV channels: (i) ubiquitin-mediated proteasome degradation and (ii) membrane localization when coexpressed with auxiliary NaVβ subunits. Collectively, these results indicate that RNF121 participates in the quality control of NaV channels during their synthesis and subsequent transport to the membrane. PMID:25691753
Nagel, Rebecca; Kirschbaum, Frank; Tiedemann, Ralph
2017-03-01
In mormyrid weakly electric fish, the electric organ discharge (EOD) is used for species recognition, orientation and prey localization. Produced in the muscle-derived adult electric organ, the EOD exhibits a wide diversity across species in both waveform and duration. While certain defining EOD characteristics can be linked to anatomical features of the electric organ, many factors underlying EOD differentiation are yet unknown. Here, we report the differential expression of 13 Kv1 voltage-gated potassium channel genes, two inwardly rectifying potassium channel genes, two previously studied sodium channel genes and an ATPase pump in two sympatric species of the genus Campylomormyrus in both the adult electric organ and skeletal muscle. Campylomormyrus compressirostris displays a basal EOD, largely unchanged during development, while C. tshokwe has an elongated, putatively derived discharge. We report an upregulation in all Kv1 genes in the electric organ of Campylomormyrus tshokwe when compared to both skeletal muscle and C. compressirostris electric organ. This pattern of upregulation in a species with a derived EOD form suggests that voltage-gated potassium channels are potentially involved in the diversification of the EOD signal among mormyrid weakly electric fish.
Moreno-Galindo, Eloy G; Sanchez-Chapula, Jose A; Tristani-Firouzi, Martin; Navarro-Polanco, Ricardo A
2016-09-01
Potassium (K(+)) channels are crucial for determining the shape, duration, and frequency of action-potential firing in excitable cells. Broadly speaking, K(+) channels can be classified based on whether their macroscopic current outwardly or inwardly rectifies, whereby rectification refers to a change in conductance with voltage. Outwardly rectifying K(+) channels conduct greater current at depolarized membrane potentials, whereas inward rectifier channels conduct greater current at hyperpolarized membrane potentials. Under most circumstances, outward currents through inwardly rectifying K(+) channels are reduced at more depolarized potentials. However, the acetylcholine-gated K(+) channel (KACh) conducts current that inwardly rectifies when activated by some ligands (such as acetylcholine), and yet conducts current that outwardly rectifies when activated by other ligands (for example, pilocarpine and choline). The perplexing and paradoxical behavior of KACh channels is due to the intrinsic voltage sensitivity of the receptor that activates KACh channels, the M2 muscarinic receptor (M2R). Emerging evidence reveals that the affinity of M2R for distinct ligands varies in a voltage-dependent and ligand-specific manner. These intrinsic receptor properties determine whether current conducted by KACh channels inwardly or outwardly rectifies. This review summarizes the most recent concepts regarding the intrinsic voltage sensitivity of muscarinic receptors and the consequences of this intriguing behavior on cardiac physiology and pharmacology of KACh channels. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.
β1 subunit stabilises sodium channel Nav1.7 against mechanical stress.
Körner, Jannis; Meents, Jannis; Machtens, Jan-Philipp; Lampert, Angelika
2018-06-01
The voltage-gated sodium channel Nav1.7 is a key player in neuronal excitability and pain signalling. In addition to voltage sensing, the channel is also modulated by mechanical stress. Using whole-cell patch-clamp experiments, we discovered that the sodium channel subunit β1 is able to prevent the impact of mechanical stress on Nav1.7. An intramolecular disulfide bond of β1 was identified to be essential for stabilisation of inactivation, but not activation, against mechanical stress using molecular dynamics simulations, homology modelling and site-directed mutagenesis. Our results highlight the role of segment 6 of domain IV in fast inactivation. We present a candidate mechanism for sodium channel stabilisation against mechanical stress, ensuring reliable channel functionality in living systems. Voltage-gated sodium channels are key players in neuronal excitability and pain signalling. Precise gating of these channels is crucial as even small functional alterations can lead to pathological phenotypes such as pain or heart failure. Mechanical stress has been shown to affect sodium channel activation and inactivation. This suggests that stabilising components are necessary to ensure precise channel gating in living organisms. Here, we show that mechanical shear stress affects voltage dependence of activation and fast inactivation of the Nav1.7 channel. Co-expression of the β1 subunit, however, protects both gating modes of Nav1.7 against mechanical shear stress. Using molecular dynamics simulation, homology modelling and site-directed mutagenesis, we identify an intramolecular disulfide bond of β1 (Cys21-Cys43) which is partially involved in this process: the β1-C43A mutant prevents mechanical modulation of voltage dependence of activation, but not of fast inactivation. Our data emphasise the unique role of segment 6 of domain IV for sodium channel fast inactivation and confirm previous reports that the intracellular process of fast inactivation can be
Directory of Open Access Journals (Sweden)
Toru Kobayashi
Full Text Available Various antidepressants are commonly used for the treatment of depression and several other neuropsychiatric disorders. In addition to their primary effects on serotonergic or noradrenergic neurotransmitter systems, antidepressants have been shown to interact with several receptors and ion channels. However, the molecular mechanisms that underlie the effects of antidepressants have not yet been sufficiently clarified. G protein-activated inwardly rectifying K(+ (GIRK, Kir3 channels play an important role in regulating neuronal excitability and heart rate, and GIRK channel modulation has been suggested to have therapeutic potential for several neuropsychiatric disorders and cardiac arrhythmias. In the present study, we investigated the effects of various classes of antidepressants on GIRK channels using the Xenopus oocyte expression assay. In oocytes injected with mRNA for GIRK1/GIRK2 or GIRK1/GIRK4 subunits, extracellular application of sertraline, duloxetine, and amoxapine effectively reduced GIRK currents, whereas nefazodone, venlafaxine, mianserin, and mirtazapine weakly inhibited GIRK currents even at toxic levels. The inhibitory effects were concentration-dependent, with various degrees of potency and effectiveness. Furthermore, the effects of sertraline were voltage-independent and time-independent during each voltage pulse, whereas the effects of duloxetine were voltage-dependent with weaker inhibition with negative membrane potentials and time-dependent with a gradual decrease in each voltage pulse. However, Kir2.1 channels were insensitive to all of the drugs. Moreover, the GIRK currents induced by ethanol were inhibited by sertraline but not by intracellularly applied sertraline. The present results suggest that GIRK channel inhibition may reveal a novel characteristic of the commonly used antidepressants, particularly sertraline, and contributes to some of the therapeutic effects and adverse effects.
International Nuclear Information System (INIS)
Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki
2012-01-01
Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.
Conductance of Ion Channels - Theory vs. Experiment
Pohorille, Andrew; Wilson, Michael; Mijajlovic, Milan
2013-01-01
Transmembrane ion channels mediate a number of essential physiological processes in a cell ranging from regulating osmotic pressure to transmission of neural signals. Kinetics and selectivity of ion transport is of critical importance to a cell and, not surprisingly, it is a subject of numerous experimental and theoretical studies. In this presentation we will analyze in detail computer simulations of two simple channels from fungi - antiamoebin and trichotoxin. Each of these channels is made of an alpha-helical bundle of small, nongenomically synthesized peptides containing a number of rare amino acids and exhibits strong antimicrobial activity. We will focus on calculating ionic conductance defined as the ratio of ionic current through the channel to applied voltage. From molecular dynamics simulations, conductance can be calculated in at least two ways, each involving different approximations. Specifically, the current, given as the number of charges transferred through the channel per unit of time, can be obtained from the number of events in which ions cross the channel during the simulation. This method works well for large currents (high conductance values and/or applied voltages). If the number of crossing events is small, reliable estimates of current are difficult to achieve. Alternatively, conductance can be estimated assuming that ion transport can be well approximated as diffusion in the external potential given by the free energy profile. Then, the current can be calculated by solving the one-dimensional diffusion equation in this external potential and applied voltage (the generalized Nernst-Planck equation). To do so three ingredients are needed: the free energy profile, the position-dependent diffusion coefficient and the diffusive flux of ions into the channel. All these quantities can be obtained from molecular dynamics simulations. An important advantage of this method is that it can be used equally well to estimating large and small currents
A molecular switch between the outer and the inner vestibule of the voltage-gated Na+ channel
International Nuclear Information System (INIS)
Zarrabi, T.
2010-01-01
Na+ channels permit rapid transmission of depolarizing impulses throughout cells and cell networks, and are essential to the proper function of skeletal muscle, the heart and the nervous system. The selectivity filter of the channel is considered to be formed by the amino acids D400, E755, K1237, and A1529 ('DEKA' motif) which are located at the innermost turn of the P-loops connecting S5 and S6 segments of each domain. The inner vestibule is believed to be lined by four S6 helices, one from each domain. Comparison of crystal structures of K+ channels in open and closed states as well as electron paramagnetic resonance spectroscopic studies suggest that the activation gate of voltage-gated ion channels is located at the inner part of the S6 segments. This may also hold true for voltage-gated Na+ channels because mutations in S6 segments alter activation gating. The gate for fast inactivation of the channel has been mapped to the intracellular linker between domains III and IV. This intracellular loop is currently considered to produce channel inactivation by transiently occluding the intracellular vestibule of the channel. The time constants of entry into and recovery from fast inactivation are on the order of milliseconds. Apart from 'fast inactivation' a number of slower inactivated states have been described. During very long depolarizations, on the order of several minutes, rNaV1.4 channels enter a very stable inactivated state which we refer to as 'ultra-slow' inactivation (IUS). In these channels the likelihood of entry into IUS is substantially increased by a mutation in the selectivity filter, K1237E. IUS can be modulated by molecules binding to the outer vestibule, suggesting that a conformational change of the outer vestibule gives rise to this kinetic state. On the other hand, the local anesthetic drug lidocaine, which binds to the internal part of the channel pore, inhibits entry into IUS by a 'foot-in-the-door' mechanism indicating that a
A new pH-sensitive rectifying potassium channel in mitochondria from the embryonic rat hippocampus.
Kajma, Anna; Szewczyk, Adam
2012-10-01
Patch-clamp single-channel studies on mitochondria isolated from embryonic rat hippocampus revealed the presence of two different potassium ion channels: a large-conductance (288±4pS) calcium-activated potassium channel and second potassium channel with outwardly rectifying activity under symmetric conditions (150/150mM KCl). At positive voltages, this channel displayed a conductance of 67.84pS and a strong voltage dependence at holding potentials from -80mV to +80mV. The open probability was higher at positive than at negative voltages. Patch-clamp studies at the mitoplast-attached mode showed that the channel was not sensitive to activators and inhibitors of mitochondrial potassium channels but was regulated by pH. Moreover, we demonstrated that the channel activity was not affected by the application of lidocaine, an inhibitor of two-pore domain potassium channels, or by tertiapin, an inhibitor of inwardly rectifying potassium channels. In summary, based on the single-channel recordings, we characterised for the first time mitochondrial pH-sensitive ion channel that is selective for cations, permeable to potassium ions, displays voltage sensitivity and does not correspond to any previously described potassium ion channels in the inner mitochondrial membrane. This article is part of a Special Issue entitled: 17th European Bioenergetics Conference (EBEC 2012). Copyright © 2012 Elsevier B.V. All rights reserved.
Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.
2002-01-01
Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes
Guanidinium Toxins and Their Interactions with Voltage-Gated Sodium Ion Channels
Directory of Open Access Journals (Sweden)
Lorena M. Durán-Riveroll
2017-10-01
Full Text Available Guanidinium toxins, such as saxitoxin (STX, tetrodotoxin (TTX and their analogs, are naturally occurring alkaloids with divergent evolutionary origins and biogeographical distribution, but which share the common chemical feature of guanidinium moieties. These guanidinium groups confer high biological activity with high affinity and ion flux blockage capacity for voltage-gated sodium channels (NaV. Members of the STX group, known collectively as paralytic shellfish toxins (PSTs, are produced among three genera of marine dinoflagellates and about a dozen genera of primarily freshwater or brackish water cyanobacteria. In contrast, toxins of the TTX group occur mainly in macrozoa, particularly among puffer fish, several species of marine invertebrates and a few terrestrial amphibians. In the case of TTX and analogs, most evidence suggests that symbiotic bacteria are the origin of the toxins, although endogenous biosynthesis independent from bacteria has not been excluded. The evolutionary origin of the biosynthetic genes for STX and analogs in dinoflagellates and cyanobacteria remains elusive. These highly potent molecules have been the subject of intensive research since the latter half of the past century; first to study the mode of action of their toxigenicity, and later as tools to characterize the role and structure of NaV channels, and finally as therapeutics. Their pharmacological activities have provided encouragement for their use as therapeutants for ion channel-related pathologies, such as pain control. The functional role in aquatic and terrestrial ecosystems for both groups of toxins is unproven, although plausible mechanisms of ion channel regulation and chemical defense are often invoked. Molecular approaches and the development of improved detection methods will yield deeper understanding of their physiological and ecological roles. This knowledge will facilitate their further biotechnological exploitation and point the way towards
LENUS (Irish Health Repository)
Allen, Nicholas M
2012-05-01
A previously healthy 9-year-old girl presented with a 10-day history of slowly progressive unsteadiness, slurred speech, and behavior change. On examination there was cerebellar ataxia and dysarthria, excessive blinking, subtle perioral myoclonus, and labile mood. The finding of oligoclonal bands in the cerebrospinal fluid prompted paraneoplastic serological evaluation and search for an occult neural crest tumor. Antineuronal nuclear autoantibody type 1 (anti-Hu) and voltage-gated potassium channel complex antibodies were detected in serum. Metaiodobenzylguanidine scan and computed tomography scan of the abdomen showed a localized abdominal mass in the region of the porta hepatis. A diagnosis of occult neuroblastoma was made. Resection of the stage 1 neuroblastoma and treatment with pulsed corticosteroids resulted in resolution of all symptoms and signs. Excessive blinking has rarely been described with neuroblastoma, and, when it is not an isolated finding, it may be a useful clue to this paraneoplastic syndrome. Although voltage-gated potassium channel complex autoimmunity has not been described previously in the setting of neuroblastoma, it is associated with a spectrum of paraneoplastic neurologic manifestations in adults, including peripheral nerve hyperexcitability disorders.
DEFF Research Database (Denmark)
Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar
2008-01-01
Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development...
Directory of Open Access Journals (Sweden)
Anne-Kathrin Theis
2018-04-01
Full Text Available The majority of excitatory synapses are located on dendritic spines of cortical glutamatergic neurons. In spines, compartmentalized Ca2+ signals transduce electrical activity into specific long-term biochemical and structural changes. Action potentials (APs propagate back into the dendritic tree and activate voltage gated Ca2+ channels (VGCCs. For spines, this global mode of spine Ca2+ signaling is a direct biochemical feedback of suprathreshold neuronal activity. We previously demonstrated that backpropagating action potentials (bAPs result in long-term enhancement of spine VGCCs. This activity-dependent VGCC plasticity results in a large interspine variability of VGCC Ca2+ influx. Here, we investigate how spine VGCCs affect glutamatergic synaptic transmission. We combined electrophysiology, two-photon Ca2+ imaging and two-photon glutamate uncaging in acute brain slices from rats. T- and R-type VGCCs were the dominant depolarization-associated Ca2+conductances in dendritic spines of excitatory layer 2 neurons and do not affect synaptic excitatory postsynaptic potentials (EPSPs measured at the soma. Using two-photon glutamate uncaging, we compared the properties of glutamatergic synapses of single spines that express different levels of VGCCs. While VGCCs contributed to EPSP mediated Ca2+ influx, the amount of EPSP mediated Ca2+ influx is not determined by spine VGCC expression. On a longer timescale, the activation of VGCCs by bAP bursts results in downregulation of spine NMDAR function.
Deb, Rajib; Singh, Umesh; Kumar, Sushil; Kumar, Arun; Singh, Rani; Sengar, Gyanendra; Mann, Sandeep; Sharma, Arjava
2014-04-03
Calcium channel, voltage-dependent, alpha-2/delta subunit 1 (CACNA2D1) gene is considered to be an important noncytokine candidate gene influencing mastitis. Scanty of reports are available until today regarding the role play of CACNA2D1 gene on the susceptibility of bovine mastitis. We interrogated the CACNA2D1 G519663A [A>G] SNP by PCR-RFLP among two hundreds Frieswal (HF X Sahiwal) crossbred cattle of Indian origin. Genotypic frequency of AA (51.5, n=101) was comparatively higher than AG (35, n=70) and GG (14.5, n=29). Association of Somatic cell score (SCS) with genotypes revealed that, GG genotypes showing lesser count (less susceptible to mastitis) compare to AA and AG. Relative expression of CACNA2D1 transcript (in milk samples) was significantly higher among GG than AG and AA. Further we have also isolated blood sample from the all groups and PBMCs were cultured from each blood sample as per the standard protocol. They were treated with Calcium channel blocker and the expression level of the CACNA2D1 gene was evaluated by Real Time PCR. Results show that expression level decline in each genotypic group after treatment and expression level of GG are again significantly higher than AA and AG. Thus, it may be concluded that GG genotypic animals are favorable for selecting disease resistant breeds.
Directory of Open Access Journals (Sweden)
Patrick E MacDonald
2007-06-01
Full Text Available Glucagon, secreted from pancreatic islet alpha cells, stimulates gluconeogenesis and liver glycogen breakdown. The mechanism regulating glucagon release is debated, and variously attributed to neuronal control, paracrine control by neighbouring beta cells, or to an intrinsic glucose sensing by the alpha cells themselves. We examined hormone secretion and Ca(2+ responses of alpha and beta cells within intact rodent and human islets. Glucose-dependent suppression of glucagon release persisted when paracrine GABA or Zn(2+ signalling was blocked, but was reversed by low concentrations (1-20 muM of the ATP-sensitive K(+ (KATP channel opener diazoxide, which had no effect on insulin release or beta cell responses. This effect was prevented by the KATP channel blocker tolbutamide (100 muM. Higher diazoxide concentrations (>/=30 muM decreased glucagon and insulin secretion, and alpha- and beta-cell Ca(2+ responses, in parallel. In the absence of glucose, tolbutamide at low concentrations (10 muM were inhibitory. In the presence of a maximally inhibitory concentration of tolbutamide (0.5 mM, glucose had no additional suppressive effect. Downstream of the KATP channel, inhibition of voltage-gated Na(+ (TTX and N-type Ca(2+ channels (omega-conotoxin, but not L-type Ca(2+ channels (nifedipine, prevented glucagon secretion. Both the N-type Ca(2+ channels and alpha-cell exocytosis were inactivated at depolarised membrane potentials. Rodent and human glucagon secretion is regulated by an alpha-cell KATP channel-dependent mechanism. We propose that elevated glucose reduces electrical activity and exocytosis via depolarisation-induced inactivation of ion channels involved in action potential firing and secretion.
Aging-associated changes in motor axon voltage-gated Na+ channel function in mice
DEFF Research Database (Denmark)
Moldovan, Mihai; Rosberg, Mette Romer; Alvarez Herrero, Susana
2016-01-01
the functional impairment. The aim of the present study was to investigate the effect of regular aging on motor axon function with particular emphasis on Nav1.8. We compared tibial nerve conduction and excitability measures by threshold tracking in 12 months (mature) and 20 months (aged) wild-type (WT) mice...... expression was found by immunohistochemistry. The depolarizing excitability features were absent in Nav1.8 null mice, and they were counteracted in WT mice by a Nav1.8 blocker. Our data suggest that alteration in voltage-gated Na+ channel isoform expression contributes to changes in motor axon function...
Josephson tunneling current in the presence of a time-dependent voltage
International Nuclear Information System (INIS)
Harris, R.E.
1975-01-01
The expression for the current through a small Josephson tunnel junction in the presence of a time-dependent voltage is presented. Four terms appear: the usual sine, cosine, and quasiparticle terms, and a reactive part of the quasiparticle current. The latter is displayed graphically as a function of both energy and temperature. It is shown that in the limit of zero dc voltage and small ac voltage, the Josephson device behaves linearly. Interpretation of the in- and out-of-phase components of the current in this linear limit is given to provide physical insight into some of the details of the general expression. Finally, the tunneling current in the linear limit is shown for thin tunneling barriers to be proportional to the current in a single superconductor in the presence of an electromagnetic field
Xu, Y C; Leung, G P H; Wong, P Y D; Vanhoutte, P M; Man, R Y K
2008-01-01
Background and purpose: Kaempferol has been shown to possess a vasodilator effect but its mechanism of action remains unclear. In this study, experiments were carried out to study the effect of kaempferol on K+ channels in endothelial cells. Experimental approach: K+ channel activities in human umbilical vein endothelial cells (HUVECs) were studied by conventional whole cell and cell-attached patch-clamp electrophysiology. Key results: Kaempferol stimulated an outward-rectifying current in HUVECs in a dose-dependent manner with an EC50 value of 2.5±0.02 μM. This kaempferol-induced current was abolished by large conductance Ca2+-activated K+ (BKCa) channel blockers, such as iberiotoxin (IbTX) and charybdotoxin (ChTX), whereas the small conductance Ca2+-activated K+ (SKCa) channel blocker, apamin, and the voltage-dependent K+ (KV) channel blocker, 4-aminopyridine, had no effect. Cell-attached patches demonstrated that kaempferol increased the open probability of BkCa channels in HUVECs. Clamping intracellular Ca2+ did not prevent kaempferol-induced increases in outward current. In addition, the kaempferol-induced current was diminished by the adenylyl cyclase inhibitor SQ22536, the cAMP antagonist Rp-8-Br-cAMP and the PKA inhibitor KT5720, but was not affected by the guanylyl cyclase inhibitor ODQ, the cGMP antagonist Rp-8-Br-cGMP and the PKG inhibitor KT5823. The activation of BKCa channels by kaempferol caused membrane hyperpolarization of HUVECs. Conclusion and implications: These results demonstrate that kaempferol activates the opening of BKCa channels in HUVECs via a cAMP/PKA-dependent pathway, resulting in membrane hyperpolarization. This mechanism may partly account for the vasodilator effects of kaempferol. PMID:18493242
DEFF Research Database (Denmark)
Hansen, Gert Helge; Belhage, B; Schousboe, A
1992-01-01
Using cerebellar granule neurons in culture it was demonstrated that exposure of the cells to the GABAA receptor agonist 4,5,6,7-tetrahydroisoxazolo[5,4-c]pyridin-3-ol (THIP) leads to an increase in the number of voltage-gated calcium channels as revealed by quantitative preembedding indirect imm...
International Nuclear Information System (INIS)
Zhou Zhicheng
1992-01-01
A digital voltage discriminator is described, which is synthesized by digital comparator and ADC. The threshold is program controllable with high stability. Digital region of confusion is approximately equal to 1.5 LSB. This discriminator has a single channel analyzer function model with channel width of 1.5 LSB
Expression, purification, and reconstitution of the voltage-sensing domain from Ci-VSP.
Li, Qufei; Jogini, Vishwanath; Wanderling, Sherry; Cortes, D Marien; Perozo, Eduardo
2012-10-16
The voltage-sensing domain (VSD) is the common scaffold responsible for the functional behavior of voltage-gated ion channels, voltage sensitive enzymes, and proton channels. Because of the position of the voltage dependence of the available VSD structures, at present, they all represent the activated state of the sensor. Yet in the absence of a consensus resting state structure, the mechanistic details of voltage sensing remain controversial. The voltage dependence of the VSD from Ci-VSP (Ci-VSD) is dramatically right shifted, so that at 0 mV it presumably populates the putative resting state. Appropriate biochemical methods are an essential prerequisite for generating sufficient amounts of Ci-VSD protein for high-resolution structural studies. Here, we present a simple and robust protocol for the expression of eukaryotic Ci-VSD in Escherichia coli at milligram levels. The protein is pure, homogeneous, monodisperse, and well-folded after solubilization in Anzergent 3-14 at the analyzed concentration (~0.3 mg/mL). Ci-VSD can be reconstituted into liposomes of various compositions, and initial site-directed spin labeling and electron paramagnetic resonance (EPR) spectroscopic measurements indicate its first transmembrane segment folds into an α-helix, in agreement with the homologous region of other VSDs. On the basis of our results and enhanced relaxation EPR spectroscopy measurement, Ci-VSD reconstitutes essentially randomly in proteoliposomes, precluding straightforward application of transmembrane voltages in combination with spectroscopic methods. Nevertheless, these results represent an initial step that makes the resting state of a VSD accessible to a variety of biophysical and structural approaches, including X-ray crystallography, spectroscopic methods, and electrophysiology in lipid bilayers.
Expression, Purification and Reconstitution of the Voltage Sensing Domain from Ci-VSP
Li, Qufei; Jogini, Vishwanath; Wanderling, Sherry; Cortes, D. Marien; Perozo, Eduardo
2013-01-01
The voltage-sensing domain (VSD) is the common scaffold responsible for the functional behavior of voltage gated ion channels, voltage sensitive enzymes and proton channels. Because of the position of the voltage dependence of the available VSD structures, at present, they all represent the activated state of the sensor. Yet, in the absence of a consensus resting state structure, the mechanistic details of voltage sensing remain controversial. The voltage dependence of the VSD from Ci-VSP (Ci-VSD) is dramatically right shifted, so that at 0 mV It presumably populates the putative resting state. Appropriate biochemical methods are an essential prerequisite to generate sufficient amounts of Ci-VSD protein for high-resolution structural studies. Here, we present a simple and robust protocol for the Escherichia coli expression of eukaryotic Ci-VSD at milligram levels. The protein is pure, homogeneous, mono-disperse and well folded after solubilization in Anzergent 3-14 at the analyzed concentration (~ 0.3 mg/mL). Ci-VSD can be reconstituted into liposomes of various compositions and initial site-directed spin labeling and EPR spectroscopic measurements indicate its first transmembrane segment folds into an α-helix, in agreement to the homologous region of other VSDs. Based on current results and enhanced relaxation EPR spectroscopy measurement, Ci-VSD reconstitutes essentially randomly in proteo-liposomes, precluding straightforward application of transmembrane voltages in combination with spectroscopic methods. Nevertheless, the present results represent an initial step that makes the resting state of a VSD accessible to a variety of biophysical and structural approaches, including X-ray crystallography, spectroscopic methods and electrophysiology in lipid bilayers. PMID:22989304
International Nuclear Information System (INIS)
Hahlbohm, H.D.; Luebbig, H.; Luther, H.
1975-01-01
Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)
Directory of Open Access Journals (Sweden)
Brian G. Hiester
2017-11-01
Full Text Available The repertoire and abundance of proteins displayed on the surface of neuronal dendrites are tuned by regulated fusion of recycling endosomes (REs with the dendritic plasma membrane. While this process is critical for neuronal function and plasticity, how synaptic activity drives RE fusion remains unexplored. We demonstrate a multistep fusion mechanism that requires Ca2+ from distinct sources. NMDA receptor Ca2+ initiates RE fusion with the plasma membrane, while L-type voltage-gated Ca2+ channels (L-VGCCs regulate whether fused REs collapse into the membrane or reform without transferring their cargo to the cell surface. Accordingly, NMDA receptor activation triggered AMPA-type glutamate receptor trafficking to the dendritic surface in an L-VGCC-dependent manner. Conversely, potentiating L-VGCCs enhanced AMPA receptor surface expression only when NMDA receptors were also active. Thus L-VGCCs play a role in tuning activity-triggered surface expression of key synaptic proteins by gating the mode of RE fusion.
Directory of Open Access Journals (Sweden)
Ji Luo
2014-07-01
Full Text Available Voltage-gated sodium channels (VGSCs; NaV1.1–NaV1.9 have been proven to be critical in controlling the function of excitable cells, and human genetic evidence shows that aberrant function of these channels causes channelopathies, including epilepsy, arrhythmia, paralytic myotonia, and pain. The effects of peptide toxins, especially those isolated from spider venom, have shed light on the structure–function relationship of these channels. However, most of these toxins have not been analyzed in detail. In particular, the bioactive faces of these toxins have not been determined. Jingzhaotoxin (JZTX-V (also known as β-theraphotoxin-Cj2a is a 29-amino acid peptide toxin isolated from the venom of the spider Chilobrachys jingzhao. JZTX-V adopts an inhibitory cysteine knot (ICK motif and has an inhibitory effect on voltage-gated sodium and potassium channels. Previous experiments have shown that JZTX-V has an inhibitory effect on TTX-S and TTX-R sodium currents on rat DRG cells with IC50 values of 27.6 and 30.2 nM, respectively, and is able to shift the activation and inactivation curves to the depolarizing and the hyperpolarizing direction, respectively. Here, we show that JZTX-V has a much stronger inhibitory effect on NaV1.4, the isoform of voltage-gated sodium channels predominantly expressed in skeletal muscle cells, with an IC50 value of 5.12 nM, compared with IC50 values of 61.7–2700 nM for other heterologously expressed NaV1 subtypes. Furthermore, we investigated the bioactive surface of JZTX-V by alanine-scanning the effect of toxin on NaV1.4 and demonstrate that the bioactive face of JZTX-V is composed of three hydrophobic (W5, M6, and W7 and two cationic (R20 and K22 residues. Our results establish that, consistent with previous assumptions, JZTX-V is a Janus-faced toxin which may be a useful tool for the further investigation of the structure and function of sodium channels.
International Nuclear Information System (INIS)
Cao Jin-Wen; Huang He-Ji; Pan Wen-Xia
2014-01-01
Fluctuations of cathode cavity pressure and arc voltage are observed experimentally in a dc plasma torch with a long inter-electrode channel. The results show that they have the same frequency of around 4 kHz under typical experimental conditions. The observed phase difference between the pressure and the voltage, which is influenced by the path length between the pressure sensor and the cathode cavity, varies with different input powers. Combined with numerical simulation, the position of the pressure perturbation origin is estimated, and the results show that it is located at 0.01–0.05 m upstream of the inter-electrode channel outlet
Cyrus S.H. Ho; Roger C.M. Ho; Amy M.L. Quek
2018-01-01
Heavy metal poisoning is a rare but important cause of encephalopathy. Manganese (Mn) toxicity is especially rare in the modern world, and clinicians’ lack of recognition of its neuropsychiatric manifestations can lead to misdiagnosis and mismanagement. We describe the case of a man who presented with recurrent episodes of confusion, psychosis, dystonic limb movement and cognitive impairment and was initially diagnosed with anti-voltage-gated potassium channel (VGKC) complex limbic ence...
Langille, Megan M.; Desai, Jay
2015-01-01
Encephalitis due to antibodies to voltage gated potassium channel (VGKC) typically presents with limbic encephalitis and medial temporal lobe involvement on neuroimaging. We describe a case of 13 year girl female with encephalitis due to antibodies to VGKC with signal changes in the cerebellar dentate nuclei bilaterally and clinical features that suggested predominant cerebellar involvement. These have never been reported previously in the literature. Our case expands the phenotypic spectrum ...
Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi
2017-11-01
A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.
Wang, Junlin; Xia, Jing; Zhang, Xichao; Zhao, G. P.; Ye, Lei; Wu, Jing; Xu, Yongbing; Zhao, Weisheng; Zou, Zhigang; Zhou, Yan
2018-05-01
Magnetic skyrmions have potential applications in next-generation spintronic devices with ultralow energy consumption. In this work, the current-driven skyrmion motion in a narrow ferromagnetic nanotrack with voltage-controlled magnetic anisotropy (VCMA) is studied numerically. By utilizing the VCMA effect, the transport of skyrmion can be unidirectional in the nanotrack, leading to a one-way information channel. The trajectory of the skyrmion can also be modulated by periodically located VCMA gates, which protects the skyrmion from destruction by touching the track edge. In addition, the location of the skyrmion can be controlled by adjusting the driving pulse length in the presence of the VCMA effect. Our results provide guidelines for practical realization of the skyrmion-based information channel, diode, and skyrmion-based electronic devices such as racetrack memory.
Metaflumizone is a novel sodium channel blocker insecticide.
Salgado, V L; Hayashi, J H
2007-12-15
Metaflumizone is a novel semicarbazone insecticide, derived chemically from the pyrazoline sodium channel blocker insecticides (SCBIs) discovered at Philips-Duphar in the early 1970s, but with greatly improved mammalian safety. This paper describes studies confirming that the insecticidal action of metaflumizone is due to the state-dependent blockage of sodium channels. Larvae of the moth Spodoptera eridania injected with metaflumizone became paralyzed, concomitant with blockage of all nerve activity. Furthermore, tonic firing of abdominal stretch receptor organs from Spodoptera frugiperda was blocked by metaflumizone applied in the bath, consistent with the block of voltage-dependent sodium channels. Studies on native sodium channels, in primary-cultured neurons isolated from the CNS of the larvae of the moth Manduca sexta and on Para/TipE sodium channels heterologously expressed in Xenopus (African clawed frog) oocytes, confirmed that metaflumizone blocks sodium channels by binding selectively to the slow-inactivated state, which is characteristic of the SCBIs. The results confirm that metaflumizone is a novel sodium channel blocker insecticide.
Voltage dependency of transmission probability of aperiodic DNA molecule
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Sirsi, Deepa; Dolce, Alison; Greenberg, Benjamin M; Thodeson, Drew
2016-01-01
There is expanding knowledge about the phenotypic variability of patients with voltage gated potassium channel complex (VGKC) antibody mediated neurologic disorders. The phenotypes are diverse and involve disorders of the central and peripheral nervous systems. The central nervous system manifestations described in the literature include limbic encephalitis, status epilepticus, and acute encephalitis. We report a 4.5 year-old boy who presented with intractable Myoclonic Astatic Epilepsy (MAE) or Doose syndrome and positive VGKC antibodies in serum. Treatment with steroids led to resolution of seizures and electrographic normalization. This case widens the spectrum of etiologies for MAE to include autoimmunity, in particular VGKC auto-antibodies and CNS inflammation, as a primary or contributing factor. There is an evolving understanding of voltage gated potassium channel complex mediated autoimmunity in children and the role of inflammation and autoimmunity in MAE and other intractable pediatric epilepsy syndromes remains to be fully defined. A high index of suspicion is required for diagnosis and appropriate management of antibody mediated epilepsy syndromes.
Bao, Lan
2015-09-30
Voltage-gated sodium channels (Navs) comprise at least nine pore-forming α subunits. Of these, Nav1.6, Nav1.7, Nav1.8 and Nav1.9 are the most frequently studied in primary sensory neurons located in the dorsal root ganglion and are mainly localized to the cytoplasm. A large pool of intracellular Navs raises the possibility that changes in Nav trafficking could alter channel function. The molecular mediators of Nav trafficking mainly consist of signals within the Navs themselves, interacting proteins and extracellular factors. The surface expression of Navs is achieved by escape from the endoplasmic reticulum and proteasome degradation, forward trafficking and plasma membrane anchoring, and it is also regulated by channel phosphorylation and ubiquitination in primary sensory neurons. Axonal transport and localization of Navs in afferent fibers involves the motor protein KIF5B and scaffold proteins, including contactin and PDZ domain containing 2. Localization of Nav1.6 to the nodes of Ranvier in myelinated fibers of primary sensory neurons requires node formation and the submembrane cytoskeletal protein complex. These findings inform our understanding of the molecular and cellular mechanisms underlying Nav trafficking in primary sensory neurons.
Dysfunctional Hyperpolarization-Activated Cyclic Nucleotide-gated Ion Channels in Cardiac Diseases
Directory of Open Access Journals (Sweden)
Xiaoqi Zhao
Full Text Available Abstract Hyperpolarization-activated cyclic nucleotide-gated (HCN channels are reverse voltage-dependent, and their activation depends on the hyperpolarization of the membrane and may be directly or indirectly regulated by the cyclic adenosine monophosphate (cAMP or other signal-transduction cascades. The distribution, quantity and activation states of HCN channels differ in tissues throughout the body. Evidence exhibits that HCN channels play critical roles in the generation and conduction of the electrical impulse and the physiopathological process of some cardiac diseases. They may constitute promising drug targets in the treatment of these cardiac diseases. Pharmacological treatment targeting HCN channels is of benefit to these cardiac conditions.
In vivo potency of different ligands on voltage-gated sodium channels.
Safrany-Fark, Arpad; Petrovszki, Zita; Kekesi, Gabriella; Liszli, Peter; Benedek, Gyorgy; Keresztes, Csilla; Horvath, Gyongyi
2015-09-05
The Ranvier nodes of thick myelinated nerve fibers contain almost exclusively voltage-gated sodium channels (Navs), while the unmyelinated fibers have several receptors (e.g., cannabinoid, transient receptor potential vanilloid receptor 1), too. Therefore, a nerve which contains only motor fibers can be an appropriate in vivo model for selective influence of Navs. The goals were to evaluate the potency of local anesthetic drugs on such a nerve in vivo; furthermore, to investigate the effects of ligands with different structures (arachidonic acid, anandamide, capsaicin and nisoxetine) that were proved to inhibit Navs in vitro with antinociceptive properties. The marginal mandibular branch of the facial nerve was explored in anesthetized Wistar rats; after its stimulation, the electrical activity of the vibrissae muscles was registered following the perineural injection of different drugs. Lidocaine, bupivacaine and ropivacaine evoked dose-dependent decrease in electromyographic activity, i.e., lidocaine had lower potency than bupivacaine or ropivacaine. QX-314 did not cause any effect by itself, but its co-application with lidocaine produced a prolonged inhibition. Nisoxetine had a very low potency. While anandamide and capsaicin in high doses caused about 50% decrease in the amplitude of action potential, arachidonic acid did not influence the responses. We proved that the classical local anesthetics have high potency on motor nerves, suggesting that this method might be a reliable model for selective targeting of Navs in vivo circumstances. It is proposed that the effects of these endogenous lipids and capsaicin on sensory fibers are not primarily mediated by Navs. Copyright © 2015 Elsevier B.V. All rights reserved.
Hansen, P B L
2013-04-01
Calcium channel blockers are widely used to treat hypertension because they inhibit voltage-gated calcium channels that mediate transmembrane calcium influx in, for example, vascular smooth muscle and cardiomyocytes. The calcium channel family consists of several subfamilies, of which the L-type is usually associated with vascular contractility. However, the L-, T- and P-/Q-types of calcium channels are present in the renal vasculature and are differentially involved in controlling vascular contractility, thereby contributing to regulation of kidney function and blood pressure. In the preglomerular vascular bed, all the three channel families are present. However, the T-type channel is the only channel in cortical efferent arterioles which is in contrast to the juxtamedullary efferent arteriole, and that leads to diverse functional effects of L- and T-type channel inhibition. Furthermore, by different mechanisms, T-type channels may contribute to both constriction and dilation of the arterioles. Finally, P-/Q-type channels are involved in the regulation of human intrarenal arterial contractility. The calcium blockers used in the clinic affect not only L-type but also P-/Q- and T-type channels. Therefore, the distinct effect obtained by inhibiting a given subtype or set of channels under experimental settings should be considered when choosing a calcium blocker for treatment. T-type channels seem to be crucial for regulating the GFR and the filtration fraction. Use of blockers is expected to lead to preferential efferent vasodilation, reduction of glomerular pressure and proteinuria. Therefore, renovascular T-type channels might provide novel therapeutic targets, and may have superior renoprotective effects compared to conventional calcium blockers. Acta Physiologica © 2013 Scandinavian Physiological Society.
Tüzün, E; Kürtüncü, M; Lang, B; Içöz, S; Akman-Demir, G; Eraksoy, M; Vincent, A
2010-10-01
GQ1b antibody (GQ1b-Ab) is detected in approximately two-thirds of sera of patients with Bickerstaffs encephalitis (BE). Whilst some of the remaining patients have antibodies to other gangliosides, many patients with BE are reported to be seronegative. Voltage-gated potassium channel antibody (VGKC-Ab) at high titer was detected during the diagnostic work-up of one patient with BE. Sera of an additional patient with BE and nine patients with Miller Fisher syndrome (MF) (all GQ1b-Ab positive) were investigated for VGKC-Ab and other anti-neuronal antibodies by radioimmunoprecipitation using 125I-dendrotoxin-VGKC and immunohistochemistry, respectively. Two patients with MF exhibited moderate titer VGKC-Abs. Regardless of positivity for VGKC or GQ1b antibodies, serum IgG of all patients with BE and MF reacted with the molecular layer and Purkinje cells of the cerebellum in a distinctive pattern. Voltage-gated potassium channel antibodies might be involved in some cases of BE or MF. The common staining pattern despite different antibody results suggests that there might be other, as yet unidentified, antibodies associated with BE and MF.
Global versus local mechanisms of temperature sensing in ion channels.
Arrigoni, Cristina; Minor, Daniel L
2018-05-01
Ion channels turn diverse types of inputs, ranging from neurotransmitters to physical forces, into electrical signals. Channel responses to ligands generally rely on binding to discrete sensor domains that are coupled to the portion of the channel responsible for ion permeation. By contrast, sensing physical cues such as voltage, pressure, and temperature arises from more varied mechanisms. Voltage is commonly sensed by a local, domain-based strategy, whereas the predominant paradigm for pressure sensing employs a global response in channel structure to membrane tension changes. Temperature sensing has been the most challenging response to understand and whether discrete sensor domains exist for pressure and temperature has been the subject of much investigation and debate. Recent exciting advances have uncovered discrete sensor modules for pressure and temperature in force-sensitive and thermal-sensitive ion channels, respectively. In particular, characterization of bacterial voltage-gated sodium channel (BacNa V ) thermal responses has identified a coiled-coil thermosensor that controls channel function through a temperature-dependent unfolding event. This coiled-coil thermosensor blueprint recurs in other temperature sensitive ion channels and thermosensitive proteins. Together with the identification of ion channel pressure sensing domains, these examples demonstrate that "local" domain-based solutions for sensing force and temperature exist and highlight the diversity of both global and local strategies that channels use to sense physical inputs. The modular nature of these newly discovered physical signal sensors provides opportunities to engineer novel pressure-sensitive and thermosensitive proteins and raises new questions about how such modular sensors may have evolved and empowered ion channel pores with new sensibilities.
Teisseyre, Andrzej; Gąsiorowska, Justyna; Michalak, Krystyna
2015-01-01
Voltage-gated potassium channels, Kv1.3, which were discovered in 1984, are integral membrane proteins which are activated ("open") upon change of the cell membrane potential, enabling a passive flux of potassium ions across the cell membrane. The channels are expressed in many different tissues, both normal and cancer. Since 2005 it has been known that the channels are expressed not only in the plasma membrane, but also in the inner mitochondrial membrane. The activity of Kv1.3 channels plays an important role, among others, in setting the cell resting membrane potential, cell proliferation, apoptosis and volume regulation. For some years, these channels have been considered a potentially new molecular target in both the diagnostics and therapy of some cancer diseases. This review article focuses on: 1) changes of expression of the channels in cancer disorders with special regard to correlations between the channels' expression and stage of the disease, 2) influence of inhibitors of Kv1.3 channels on proliferation and apoptosis of cancer cells, 3) possible future applications of Kv1.3 channels' inhibitors in therapy of some cancer diseases. In the last section, the results of studies performed in our Laboratory of Bioelectricity on the influence of selected biologically active plant-derived compounds from the groups of flavonoids and stilbenes and their natural and synthetic derivatives on the activity of Kv1.3 channels in normal and cancer cells are reviewed. A possible application of some compounds from these groups to support therapy of cancer diseases, such as breast, colon and lymph node cancer, and melanoma or chronic lymphocytic leukemia (B-CLL), is announced.
Langille, Megan M; Desai, Jay
2015-01-01
Encephalitis due to antibodies to voltage gated potassium channel (VGKC) typically presents with limbic encephalitis and medial temporal lobe involvement on neuroimaging. We describe a case of 13 year girl female with encephalitis due to antibodies to VGKC with signal changes in the cerebellar dentate nuclei bilaterally and clinical features that suggested predominant cerebellar involvement. These have never been reported previously in the literature. Our case expands the phenotypic spectrum of this rare condition.
Flow reversal at low voltage and low frequency in a microfabricated ac electrokinetic pump
DEFF Research Database (Denmark)
Gregersen, Misha Marie; Olesen, Laurits Højgaard; Brask, Anders
2007-01-01
measured in a regime, where both the applied voltage and the frequency are low, Vrms1.5 V and f20 kHz, compared to previously investigated parameter ranges. The impedance spectrum has been thoroughly measured and analyzed in terms of an equivalent circuit diagram to rule out trivial circuit explanations......Microfluidic chips have been fabricated in Pyrex glass to study electrokinetic pumping generated by a low-voltage ac bias applied to an in-channel asymmetric metallic electrode array. A measurement procedure has been established and followed carefully resulting in a high degree of reproducibility...... of the measurements over several days. A large coverage fraction of the electrode array in the microfluidic channels has led to an increased sensitivity allowing for pumping measurements at low bias voltages. Depending on the ionic concentration a hitherto unobserved reversal of the pumping direction has been...
O'Reilly, Andrias O; Williamson, Martin S; González-Cabrera, Joel; Turberg, Andreas; Field, Linda M; Wallace, B A; Davies, T G Emyr
2014-03-01
The pyrethroid insecticides are a very successful group of compounds that target invertebrate voltage-gated sodium channels and are widely used in the control of insects, ticks and mites. It is well established that some pyrethroids are good insecticides whereas others are more effective as acaricides. This species specificity is advantageous for controlling particular pest(s) in the presence of another non-target invertebrate, for example controlling the Varroa mite in honeybee colonies. We applied in silico techniques to compare the voltage-gated sodium channels of insects versus ticks and mites and their interactions with a range of pyrethroids and DDT analogues. We identified a single amino acid difference within the pyrethroid binding pocket of ticks/mites that may have significant impact on the effectiveness of pyrethroids as acaricides. Other individual amino acid differences within the binding pocket in distinct tick and mite species may provide a basis for future acaricidal selectivity. Three-dimensional modelling of the pyrethroid/DDT receptor site has led to a new hypothesis to explain the preferential binding of acaricidal pyrethroids to the sodium channels of ticks/mites. This is important for understanding pyrethroid selectivity and the potential effects of mutations that can give rise to resistance to pyrethroids in commercially-important pest species. © 2013 Society of Chemical Industry.
Electro-chemical coupling in the voltage-dependent phosphatase Ci-VSP
Kohout, Susy C.; Bell, Sarah C.; Liu, Lijun; Xu, Qiang; Minor, Daniel L.; Isacoff, Ehud Y.
2010-01-01
In the voltage sensing phosphatase, Ci-VSP, a voltage sensing domain (VSD) controls a lipid phosphatase domain (PD). The mechanism by which the domains are allosterically coupled is not well understood. Using an in vivo assay, we find that the inter-domain linker that connects the VSD to the PD is essential for coupling the full-length protein. Biochemical assays show that the linker is also needed for activity in the isolated PD. We identify a late step of VSD motion in the full-length protein that depends on the linker. Strikingly, this VSD motion is found to require PI(4,5)P2, a substrate of Ci-VSP. These results suggest that the voltage-driven motion of the VSD turns the enzyme on by rearranging the linker into an activated conformation, and that this activated conformation is stabilized by PI(4,5)P2. We propose that Ci-VSP activity is self-limited because its decrease of PI(4,5)P2 levels decouples the VSD from the enzyme. PMID:20364128
Patel, R; Rutten, K; Valdor, M; Schiene, K; Wigge, S; Schunk, S; Damann, N; Christoph, T; Dickenson, A H
2015-06-25
Prialt, a synthetic version of Ca(v)2.2 antagonist ω-conotoxin MVIIA derived from Conus magus, is the first clinically approved voltage-gated calcium channel blocker for refractory chronic pain. However, due to the narrow therapeutic window and considerable side effects associated with systemic dosing, Prialt is only administered intrathecally. N-triazole oxindole (TROX-1) is a novel use-dependent and activation state-selective small-molecule inhibitor of Ca(v)2.1, 2.2 and 2.3 calcium channels designed to overcome the limitations of Prialt. We have examined the neurophysiological and behavioral effects of blocking calcium channels with TROX-1. In vitro, TROX-1, in contrast to state-independent antagonist Prialt, preferentially inhibits Ca(v)2.2 currents in rat dorsal root ganglia (DRG) neurons under depolarized conditions. In vivo electrophysiology was performed to record from deep dorsal horn lamina V/VI wide dynamic range neurons in non-sentient spinal nerve-ligated (SNL) and sham-operated rats. In SNL rats, spinal neurons exhibited reduced responses to innocuous and noxious punctate mechanical stimulation of the receptive field following subcutaneous administration of TROX-1, an effect that was absent in sham-operated animals. No effect was observed on neuronal responses evoked by dynamic brushing, heat or cold stimulation in SNL or sham rats. The wind-up response of spinal neurons following repeated electrical stimulation of the receptive field was also unaffected. Spinally applied TROX-1 dose dependently inhibited mechanically evoked neuronal responses in SNL but not sham-operated rats, consistent with behavioral observations. This study confirms the pathological state-dependent actions of TROX-1 through a likely spinal mechanism and reveals a modality selective change in calcium channel function following nerve injury. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
The Importance of the Dissociation Rate in Ion Channel Blocking
Directory of Open Access Journals (Sweden)
Hugo Zeberg
2018-02-01
Full Text Available Understanding the relationships between the rates and dynamics of current wave forms under voltage clamp conditions is essential for understanding phenomena such as state-dependence and use-dependence, which are fundamental for the action of drugs used as anti-epileptics, anti-arrhythmics, and anesthetics. In the present study, we mathematically analyze models of blocking mechanisms. In previous experimental studies of potassium channels we have shown that the effect of local anesthetics can be explained by binding to channels in the open state. We therefore here examine models that describe the effect of a blocking drug that binds to a non-inactivating channel in its open state. Such binding induces an inactivation-like current decay at higher potential steps. The amplitude of the induced peak depends on voltage and concentration of blocking drug. In the present study, using analytical methods, we (i derive a criterion for the existence of a peak in the open probability time evolution for a model with an arbitrary number of closed states, (ii derive formula for the relative height of the peak amplitude, and (iii determine the voltage dependence of the relative peak height. Two findings are apparent: (1 the dissociation (unbinding rate constant is important for the existence of a peak in the current waveform, while the association (binding rate constant is not, and (2 for a peak to exist it suffices that the dissociation rate must be smaller than the absolute value of all eigenvalues to the kinetic matrix describing the model.
Directory of Open Access Journals (Sweden)
Mohamad Khairul Anuar
2017-01-01
Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.
Directory of Open Access Journals (Sweden)
John C Williams
Full Text Available Channelrhodospin-2 (ChR2, a light-sensitive ion channel, and its variants have emerged as new excitatory optogenetic tools not only in neuroscience, but also in other areas, including cardiac electrophysiology. An accurate quantitative model of ChR2 is necessary for in silico prediction of the response to optical stimulation in realistic tissue/organ settings. Such a model can guide the rational design of new ion channel functionality tailored to different cell types/tissues. Focusing on one of the most widely used ChR2 mutants (H134R with enhanced current, we collected a comprehensive experimental data set of the response of this ion channel to different irradiances and voltages, and used these data to develop a model of ChR2 with empirically-derived voltage- and irradiance- dependence, where parameters were fine-tuned via simulated annealing optimization. This ChR2 model offers: 1 accurate inward rectification in the current-voltage response across irradiances; 2 empirically-derived voltage- and light-dependent kinetics (activation, deactivation and recovery from inactivation; and 3 accurate amplitude and morphology of the response across voltage and irradiance settings. Temperature-scaling factors (Q10 were derived and model kinetics was adjusted to physiological temperatures. Using optical action potential clamp, we experimentally validated model-predicted ChR2 behavior in guinea pig ventricular myocytes. The model was then incorporated in a variety of cardiac myocytes, including human ventricular, atrial and Purkinje cell models. We demonstrate the ability of ChR2 to trigger action potentials in human cardiomyocytes at relatively low light levels, as well as the differential response of these cells to light, with the Purkinje cells being most easily excitable and ventricular cells requiring the highest irradiance at all pulse durations. This new experimentally-validated ChR2 model will facilitate virtual experimentation in neural and
Vandendriessche, Thomas; Abdel-Mottaleb, Yousra; Maertens, Chantal; Cuypers, Eva; Sudau, Alexander; Nubbemeyer, Udo; Mebs, Dietrich; Tytgat, Jan
2008-03-01
Certain amphibians provide themselves with a chemical defense by accumulating lipophilic alkaloids into skin glands from dietary arthropods. Examples of such alkaloids are pumiliotoxins (PTXs). In general, PTXs are known as positive modulators of voltage-gated sodium channels (VGSCs). Unlike other PTXs, PTX 251D does not share this characteristic. However, mice and insect studies showed that PTX 251D is highly toxic and to date the basis of its toxicity remains unknown. In this work, we searched for the possible target of PTX 251D. The toxin was therefore made synthetically and tested on four VGSCs (mammalian rNa(v)1.2/beta(1), rNa(v)1.4/beta(1), hNa(v)1.5/beta(1) and insect Para/tipE) and five voltage-gated potassium channels (VGPCs) (mammalian rK(v)1.1-1.2, hK(v)1.3, hK(v)11.1 (hERG) and insect Shaker IR) expressed heterologously in Xenopus laevis oocytes, using the two-electrode voltage clamp technique. PTX 251D not only inhibited the Na(+) influx through the mammalian VGSCs but also affected the steady-state activation and inactivation. Interestingly, in the insect ortholog, the inactivation process was dramatically affected. Additionally, PTX 251D inhibited the K(+) efflux through all five tested VGPCs and slowed down the deactivation kinetics of the mammalian VGPCs. hK(v)1.3 was the most sensitive channel, with an IC(50) value 10.8+/-0.5 microM. To the best of our knowledge this is the first report of a PTX affecting VGPCs.
Holtkamp, Dominik; Opitz, Thoralf; Niespodziany, Isabelle; Wolff, Christian; Beck, Heinz
2017-01-01
In human epilepsy, pharmacoresistance to antiepileptic drug therapy is a major problem affecting ~30% of patients with epilepsy. Many classical antiepileptic drugs target voltage-gated sodium channels, and their potent activity in inhibiting high-frequency firing has been attributed to their strong use-dependent blocking action. In chronic epilepsy, a loss of use-dependent block has emerged as a potential cellular mechanism of pharmacoresistance for anticonvulsants acting on voltage-gated sodium channels. The anticonvulsant drug lacosamide (LCM) also targets sodium channels, but has been shown to preferentially affect sodium channel slow inactivation processes, in contrast to most other anticonvulsants. We used whole-cell voltage clamp recordings in acutely isolated cells to investigate the effects of LCM on transient Na + currents. Furthermore, we used whole-cell current clamp recordings to assess effects on repetitive action potential firing in hippocampal slices. We show here that LCM exerts its effects primarily via shifting the slow inactivation voltage dependence to more hyperpolarized potentials in hippocampal dentate granule cells from control and epileptic rats, and from patients with epilepsy. It is important to note that this activity of LCM was maintained in chronic experimental and human epilepsy. Furthermore, we demonstrate that the efficacy of LCM in inhibiting high-frequency firing is undiminished in chronic experimental and human epilepsy. Taken together, these results show that LCM exhibits maintained efficacy in chronic epilepsy, in contrast to conventional use-dependent sodium channel blockers such as carbamazepine. They also establish that targeting slow inactivation may be a promising strategy for overcoming target mechanisms of pharmacoresistance. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.
DEFF Research Database (Denmark)
Lundby, Alicia; Akemann, Walther; Knöpfel, Thomas
2010-01-01
A voltage sensitive phosphatase was discovered in the ascidian Ciona intestinalis. The phosphatase, Ci-VSP, contains a voltage-sensing domain homologous to those known from voltage-gated ion channels, but unlike ion channels, the voltage-sensing domain of Ci-VSP can reside in the cell membrane...... as a monomer. We fused the voltage-sensing domain of Ci-VSP to a pair of fluorescent reporter proteins to generate a genetically encodable voltage-sensing fluorescent probe, VSFP2.3. VSFP2.3 is a fluorescent voltage probe that reports changes in membrane potential as a FRET (fluorescence resonance energy....... Neutralization of an arginine in S4, previously suggested to be a sensing charge, and measuring associated sensing currents indicate that this charge is likely to reside at the membrane-aqueous interface rather than within the membrane electric field. The data presented give us insights into the voltage-sensing...
Computer controlled high voltage system
Energy Technology Data Exchange (ETDEWEB)
Kunov, B; Georgiev, G; Dimitrov, L [and others
1996-12-31
A multichannel computer controlled high-voltage power supply system is developed. The basic technical parameters of the system are: output voltage -100-3000 V, output current - 0-3 mA, maximum number of channels in one crate - 78. 3 refs.
Xiao, Yucheng; Blumenthal, Kenneth; Jackson, James O; Liang, Songping; Cummins, Theodore R
2010-12-01
The voltage-gated sodium channel Na(v)1.7 plays a crucial role in pain, and drugs that inhibit hNa(v)1.7 may have tremendous therapeutic potential. ProTx-II and huwentoxin-IV (HWTX-IV), cystine knot peptides from tarantula venoms, preferentially block hNa(v)1.7. Understanding the interactions of these toxins with sodium channels could aid the development of novel pain therapeutics. Whereas both ProTx-II and HWTX-IV have been proposed to preferentially block hNa(v)1.7 activation by trapping the domain II voltage-sensor in the resting configuration, we show that specific residues in the voltage-sensor paddle of domain II play substantially different roles in determining the affinities of these toxins to hNa(v)1.7. The mutation E818C increases ProTx-II's and HWTX-IV's IC(50) for block of hNa(v)1.7 currents by 4- and 400-fold, respectively. In contrast, the mutation F813G decreases ProTx-II affinity by 9-fold but has no effect on HWTX-IV affinity. It is noteworthy that we also show that ProTx-II, but not HWTX-IV, preferentially interacts with hNa(v)1.7 to impede fast inactivation by trapping the domain IV voltage-sensor in the resting configuration. Mutations E1589Q and T1590K in domain IV each decreased ProTx-II's IC(50) for impairment of fast inactivation by ~6-fold. In contrast mutations D1586A and F1592A in domain-IV increased ProTx-II's IC(50) for impairment of fast inactivation by ~4-fold. Our results show that whereas ProTx-II and HWTX-IV binding determinants on domain-II may overlap, domain II plays a much more crucial role for HWTX-IV, and contrary to what has been proposed to be a guiding principle of sodium channel pharmacology, molecules do not have to exclusively target the domain IV voltage-sensor to influence sodium channel inactivation.
Complete low power controller for high voltage power systems
International Nuclear Information System (INIS)
Sumner, R.; Blanar, G.
1997-01-01
The MHV100 is a custom CMOS integrated circuit, developed for the AMS experiment. It provides complete control for a single channel high voltage (HV) generator and integrates all the required digital communications, D to A and A to D converters, the analog feedback loop and output drivers. This chip has been designed for use in both distributed high voltage systems or for low cost single channel high voltage systems. The output voltage and current range is determined by the external components
Directory of Open Access Journals (Sweden)
Jason Wu
2017-11-01
Full Text Available Piezo proteins form mechanically activated ion channels that are responsible for our sense of light touch, proprioception, and vascular blood flow. Upon activation by mechanical stimuli, Piezo channels rapidly inactivate in a voltage-dependent manner through an unknown mechanism. Inactivation of Piezo channels is physiologically important, as it modulates overall mechanical sensitivity, gives rise to frequency filtering of repetitive mechanical stimuli, and is itself the target of numerous human disease-related channelopathies that are not well understood mechanistically. Here, we identify the globular C-terminal extracellular domain as a structure that is sufficient to confer the time course of inactivation and a single positively charged lysine residue at the adjacent inner pore helix as being required for its voltage dependence. Our results are consistent with a mechanism for inactivation that is mediated through voltage-dependent conformations of the inner pore helix and allosteric coupling with the C-terminal extracellular domain.
Directory of Open Access Journals (Sweden)
Megan M Langille
2015-01-01
Full Text Available Encephalitis due to antibodies to voltage gated potassium channel (VGKC typically presents with limbic encephalitis and medial temporal lobe involvement on neuroimaging. We describe a case of 13 year girl female with encephalitis due to antibodies to VGKC with signal changes in the cerebellar dentate nuclei bilaterally and clinical features that suggested predominant cerebellar involvement. These have never been reported previously in the literature. Our case expands the phenotypic spectrum of this rare condition.
Findeisen, Felix; Rumpf, Christine; Minor, Daniel L.
2013-01-01
In neurons, binding of calmodulin (CaM) or calcium-binding protein 1 (CaBP1) to the CaV1 (L-type) voltage-gated calcium channel IQ domain endows the channel with diametrically opposed properties. CaM causes calcium-dependent inactivation (CDI) and limits calcium entry, whereas CaBP1 blocks CDI and allows sustained calcium influx. Here, we combine isothermal titration calorimetry (ITC) with cell-based functional measurements and mathematical modeling to show that these calcium sensors behave in a competitive manner that is explained quantitatively by their apo-state binding affinities for the IQ domain. This competition can be completely blocked by covalent tethering of CaM to the channel. Further, we show that Ca2+/CaM has a sub-picomolar affinity for the IQ domain that is achieved without drastic alteration of calcium binding properties. The observation that the apo-forms of CaM and CaBP1 compete with each other demonstrates a simple mechanism for direct modulation of CaV1 function and suggests a means by which excitable cells may dynamically tune CaV activity. PMID:23811053
Gregorio-Teruel, Lucia; Valente, Pierluigi; González-Ros, José Manuel; Fernández-Ballester, Gregorio; Ferrer-Montiel, Antonio
2014-03-01
The transient receptor potential vanilloid receptor subtype I (TRPV1) channel acts as a polymodal sensory receptor gated by chemical and physical stimuli. Like other TRP channels, TRPV1 contains in its C terminus a short, conserved domain called the TRP box, which is necessary for channel gating. Substitution of two TRP box residues-I696 and W697-with Ala markedly affects TRPV1's response to all activating stimuli, which indicates that these two residues play a crucial role in channel gating. We systematically replaced I696 and W697 with 18 native l-amino acids (excluding cysteine) and evaluated the effect on voltage- and capsaicin-dependent gating. Mutation of I696 decreased channel activation by either voltage or capsaicin; furthermore, gating was only observed with substitution of hydrophobic amino acids. Substitution of W697 with any of the 18 amino acids abolished gating in response to depolarization alone, shifting the threshold to unreachable voltages, but not capsaicin-mediated gating. Moreover, vanilloid-activated responses of W697X mutants showed voltage-dependent gating along with a strong voltage-independent component. Analysis of the data using an allosteric model of activation indicates that mutation of I696 and W697 primarily affects the allosteric coupling constants of the ligand and voltage sensors to the channel pore. Together, our findings substantiate the notion that inter- and/or intrasubunit interactions at the level of the TRP box are critical for efficient coupling of stimulus sensing and gate opening. Perturbation of these interactions markedly reduces the efficacy and potency of the activating stimuli. Furthermore, our results identify these interactions as potential sites for pharmacological intervention.
Everett, Katy L.; Cooper, Dermot M. F.
2013-01-01
Here we describe an improved sensor with reduced pH sensitivity tethered to adenylyl cyclase (AC) 8. The sensor was used to study cAMP dynamics in the AC8 microdomain of MIN6 cells, a pancreatic β-cell line. In these cells, AC8 was activated by Ca2+ entry through L-type voltage-gated channels following depolarisation. This activation could be reconstituted in HEK293 cells co-expressing AC8 and either the α1C or α1D subunit of L-type voltage-gated Ca2+ channels. The development of this improved sensor opens the door to the study of cAMP microdomains in excitable cells that have previously been challenging due to the sensitivity of fluorescent proteins to pH changes. PMID:24086669
Directory of Open Access Journals (Sweden)
Katy L Everett
Full Text Available Here we describe an improved sensor with reduced pH sensitivity tethered to adenylyl cyclase (AC 8. The sensor was used to study cAMP dynamics in the AC8 microdomain of MIN6 cells, a pancreatic β-cell line. In these cells, AC8 was activated by Ca(2+ entry through L-type voltage-gated channels following depolarisation. This activation could be reconstituted in HEK293 cells co-expressing AC8 and either the α1C or α1D subunit of L-type voltage-gated Ca(2+ channels. The development of this improved sensor opens the door to the study of cAMP microdomains in excitable cells that have previously been challenging due to the sensitivity of fluorescent proteins to pH changes.
International Nuclear Information System (INIS)
Zhao Huidong; Hei Yong; Qiao Shushan; Ye Tianchun
2012-01-01
An optimized channel estimation algorithm based on a time-spread structure in OFDM low-voltage power line communication (PLC) systems is proposed to achieve a lower bit error rate (BER). This paper optimizes the best maximum multi-path delay of the linear minimum mean square error (LMMSE) algorithm in time-domain spread OFDM systems. Simulation results indicate that the BER of the improved method is lower than that of conventional LMMSE algorithm, especially when the signal-to-noise ratio (SNR) is lower than 0 dB. Both the LMMSE algorithm and the proposed algorithm are implemented and fabricated in CSMC 0.18 μm technology. This paper analyzes and compares the hardware complexity and performance of the two algorithms. Measurements indicate that the proposed channel estimator has better performance than the conventional estimator.
Blockade of voltage-gated K+ currents in rat mesenteric arterial smooth muscle cells by MK801
Directory of Open Access Journals (Sweden)
Jeong Min Kim
2015-01-01
Full Text Available MK801 (dizocilpine, a phencyclidine (PCP derivative, is a potent noncompetitive antagonist of the N-Methyl-D-aspartate receptor (NMDAr. Another PCP derivative, ketamine, was reported to block voltage-gated K+ (Kv channels, which was independent of NMDAr function. Kv currents are major regulators of the membrane potential (Em and excitability of muscles and neurons. Here, we investigated the effect of MK801 on the Kv channels and Em in rat mesenteric arterial smooth muscle cells (RMASMCs. We used the whole-cell patch clamp technique to analyze the effect of MK801 enantiomers on Kv channels and Em. (+MK801 inhibited Kv channels in a concentration-dependent manner (IC50 of 89.1 ± 13.1 μM, Hill coefficient of 1.05 ± 0.08. The inhibition was voltage- and state- independent. (+MK801 didn't influence steady-state activation and inactivation of Kv channels. (+MK801 treatment depolarized Em in a concentration-dependent manner and concomitantly decreased membrane conductance. (−MK801 also similarly inhibited the Kv channels (IC50 of 134.0 ± 17.5 μM, Hill coefficient of 0.87 ± 0.09. These results indicate that MK801 directly inhibits the Kv channel in a state-independent manner in RMASMCs. This MK801-mediated inhibition of Kv channels should be considered when assessing the various pharmacological effects produced by MK801, such as schizophrenia, neuroprotection, and hypertension.
Cai, Tianfu; Luo, Ji; Meng, Er; Ding, Jiuping; Liang, Songping; Wang, Sheng; Liu, Zhonghua
2015-06-01
Peptide toxins often have pharmacological applications and are powerful tools for investigating the structure-function relationships of voltage-gated sodium channels (VGSCs). Although a group of potential VGSC inhibitors have been reported from tarantula venoms, little is known about the mechanism of their interaction with VGSCs. In this study, we showed that hainantoxin-IV (β-TRTX-Hn2a, HNTX-IV in brief), a 35-residue peptide from Ornithoctonus hainana venom, preferentially inhibited rNav1.2, rNav1.3 and hNav1.7 compared with rNav1.4 and hNav1.5. hNav1.7 was the most sensitive to HNTX-IV (IC50∼21nM). In contrast to many other tarantula toxins that affect VGSCs, HNTX-IV at subsaturating concentrations did not alter activation and inactivation kinetics in the physiological range of voltages, while very large depolarization above +70mV could partially activate toxin-bound hNav1.7 channel, indicating that HNTX-IV acts as a gating modifier rather than a pore blocker. Site-directed mutagenesis indicated that the toxin bound to site 4, which was located on the extracellular S3-S4 linker of hNav1.7 domain II. Mutants E753Q, D816N and E818Q of hNav1.7 decreased toxin affinity for hNav1.7 by 2.0-, 3.3- and 130-fold, respectively. In silico docking indicated that a three-toed claw substructure formed by residues with close contacts in the interface between HNTX-IV and hNav1.7 domain II stabilized the toxin-channel complex, impeding movement of the domain II voltage sensor and inhibiting hNav1.7 activation. Our data provide structural details for structure-based drug design and a useful template for the design of highly selective inhibitors of a specific subtype of VGSCs. Copyright © 2014 Elsevier Inc. All rights reserved.
Mechanism of μ-conotoxin PIIIA binding to the voltage-gated Na+ channel NaV1.4.
Directory of Open Access Journals (Sweden)
Rong Chen
Full Text Available Several subtypes of voltage-gated Na+ (NaV channels are important targets for pain management. μ-Conotoxins isolated from venoms of cone snails are potent and specific blockers of different NaV channel isoforms. The inhibitory effect of μ-conotoxins on NaV channels has been examined extensively, but the mechanism of toxin specificity has not been understood in detail. Here the known structure of μ-conotoxin PIIIA and a model of the skeletal muscle channel NaV1.4 are used to elucidate elements that contribute to the structural basis of μ-conotoxin binding and specificity. The model of NaV1.4 is constructed based on the crystal structure of the bacterial NaV channel, NaVAb. Six different binding modes, in which the side chain of each of the basic residues carried by the toxin protrudes into the selectivity filter of NaV1.4, are examined in atomic detail using molecular dynamics simulations with explicit solvent. The dissociation constants (Kd computed for two selected binding modes in which Lys9 or Arg14 from the toxin protrudes into the filter of the channel are within 2 fold; both values in close proximity to those determined from dose response data for the block of NaV currents. To explore the mechanism of PIIIA specificity, a double mutant of NaV1.4 mimicking NaV channels resistant to μ-conotoxins and tetrodotoxin is constructed and the binding of PIIIA to this mutant channel examined. The double mutation causes the affinity of PIIIA to reduce by two orders of magnitude.
Conduction channels of an InAs-Al nanowire Josephson weak link
International Nuclear Information System (INIS)
Goffman, M F; Urbina, C; Pothier, H; Nygård, J; Marcus, C M; Krogstrup, P
2017-01-01
We present a quantitative characterization of an electrically tunable Josephson junction defined in an InAs nanowire proximitized by an epitaxially-grown superconducting Al shell. The gate-dependence of the number of conduction channels and of the set of transmission coefficients are extracted from the highly nonlinear current–voltage characteristics. Although the transmissions evolve non-monotonically, the number of independent channels can be tuned, and configurations with a single quasi-ballistic channel achieved. (fast track communication)
Nicorandil directly and cyclic GMP-dependently opens K+ channels in human bypass grafts
Directory of Open Access Journals (Sweden)
Marija Marinko
2015-06-01
Full Text Available As we previously demonstrated the role of different K+ channels in the action of nicorandil on human saphenous vein (HSV and human internal mammary artery (HIMA, this study aimed to analyse the contribution of the cGMP pathway in nicorandil-induced vasorelaxation and to determine the involvement of cGMP in the K+ channel-activating effect of nicorandil. An inhibitor of soluble guanylate cyclase (GC, ODQ, significantly inhibited nicorandil-induced relaxation, while ODQ plus glibenclamide, a selective ATP-sensitive K+ (KATP channel inhibitor, produced a further inhibition of both vessels. In HSV, ODQ in combination with 4-aminopyridine, a blocker of voltage-gated K+ (KV channels, did not modify the concentration-response to nicorandil compared with ODQ, whereas in HIMA, ODQ plus iberiotoxin, a selective blocker of large-conductance Ca2+-activated K+ (BKCa channels, produced greater inhibition than ODQ alone. We showed that the cGMP pathway plays a significant role in the vasorelaxant effect of nicorandil on HSV and HIMA. It seems that nicorandil directly opens KATP channels in both vessels and BKCa channels in HIMA, although it is possible that stimulation of GC contributes to KATP channels activation in HIMA. Contrary, the activation of KV channels in HSV is probably due to GC activation and increased levels of cGMP.
Dalsgaard, Thomas; Bonev, Adrian D.; Nelson, Mark T.
2016-01-01
Key points Increase in endothelial cell (EC) calcium activates calcium‐sensitive intermediate and small conductance potassium (IK and SK) channels, thereby causing hyperpolarization and endothelium‐dependent vasodilatation.Endothelial cells express inward rectifier potassium (Kir) channels, but their role in endothelium‐dependent vasodilatation is not clear.In the mesenteric arteries, only ECs, but not smooth muscle cells, displayed Kir currents that were predominantly mediated by the Kir2.1 isoform.Endothelium‐dependent vasodilatations in response to muscarinic receptor, TRPV4 (transient receptor potential vanilloid 4) channel and IK/SK channel agonists were highly attenuated by Kir channel inhibitors and by Kir2.1 channel knockdown.These results point to EC Kir channels as amplifiers of vasodilatation in response to increases in EC calcium and IK/SK channel activation and suggest that EC Kir channels could be targeted to treat endothelial dysfunction, which is a hallmark of vascular disorders. Abstract Endothelium‐dependent vasodilators, such as acetylcholine, increase intracellular Ca2+ through activation of transient receptor potential vanilloid 4 (TRPV4) channels in the plasma membrane and inositol trisphosphate receptors in the endoplasmic reticulum, leading to stimulation of Ca2+‐sensitive intermediate and small conductance K+ (IK and SK, respectively) channels. Although strong inward rectifier K+ (Kir) channels have been reported in the native endothelial cells (ECs) their role in EC‐dependent vasodilatation is not clear. Here, we test the idea that Kir channels boost the EC‐dependent vasodilatation of resistance‐sized arteries. We show that ECs, but not smooth muscle cells, of small mesenteric arteries have Kir currents, which are substantially reduced in EC‐specific Kir2.1 knockdown (EC‐Kir2.1 −/−) mice. Elevation of extracellular K+ to 14 mm caused vasodilatation of pressurized arteries, which was prevented by endothelial
Sonkusare, Swapnil K; Dalsgaard, Thomas; Bonev, Adrian D; Nelson, Mark T
2016-06-15
Increase in endothelial cell (EC) calcium activates calcium-sensitive intermediate and small conductance potassium (IK and SK) channels, thereby causing hyperpolarization and endothelium-dependent vasodilatation. Endothelial cells express inward rectifier potassium (Kir) channels, but their role in endothelium-dependent vasodilatation is not clear. In the mesenteric arteries, only ECs, but not smooth muscle cells, displayed Kir currents that were predominantly mediated by the Kir2.1 isoform. Endothelium-dependent vasodilatations in response to muscarinic receptor, TRPV4 (transient receptor potential vanilloid 4) channel and IK/SK channel agonists were highly attenuated by Kir channel inhibitors and by Kir2.1 channel knockdown. These results point to EC Kir channels as amplifiers of vasodilatation in response to increases in EC calcium and IK/SK channel activation and suggest that EC Kir channels could be targeted to treat endothelial dysfunction, which is a hallmark of vascular disorders. Endothelium-dependent vasodilators, such as acetylcholine, increase intracellular Ca(2+) through activation of transient receptor potential vanilloid 4 (TRPV4) channels in the plasma membrane and inositol trisphosphate receptors in the endoplasmic reticulum, leading to stimulation of Ca(2+) -sensitive intermediate and small conductance K(+) (IK and SK, respectively) channels. Although strong inward rectifier K(+) (Kir) channels have been reported in the native endothelial cells (ECs) their role in EC-dependent vasodilatation is not clear. Here, we test the idea that Kir channels boost the EC-dependent vasodilatation of resistance-sized arteries. We show that ECs, but not smooth muscle cells, of small mesenteric arteries have Kir currents, which are substantially reduced in EC-specific Kir2.1 knockdown (EC-Kir2.1(-/-) ) mice. Elevation of extracellular K(+) to 14 mm caused vasodilatation of pressurized arteries, which was prevented by endothelial denudation and Kir channel
Blockade of the voltage-gated potassium channel Kv1.3 inhibits immune responses in vivo.
Koo, G C; Blake, J T; Talento, A; Nguyen, M; Lin, S; Sirotina, A; Shah, K; Mulvany, K; Hora, D; Cunningham, P; Wunderler, D L; McManus, O B; Slaughter, R; Bugianesi, R; Felix, J; Garcia, M; Williamson, J; Kaczorowski, G; Sigal, N H; Springer, M S; Feeney, W
1997-06-01
The voltage activated K+ channel (Kv1.3) has recently been identified as the molecule that sets the resting membrane potential of peripheral human T lymphoid cells. In vitro studies indicate that blockage of Kv1.3 inhibits T cell activation, suggesting that Kv1.3 may be a target for immunosuppression. However, despite the in vitro evidence, there has been no in vivo demonstration that blockade of Kv1.3 will attenuate an immune response. The difficulty is due to species differences, as the channel does not set the membrane potential in rodent peripheral T cells. In this study, we show that the channel is present on peripheral T cells of miniswine. Using the peptidyl Kv1.3 inhibitor, margatoxin, we demonstrate that Kv1.3 also regulates the resting membrane potential, and that blockade of Kv1.3 inhibits, in vivo, both a delayed-type hypersensitivity reaction and an Ab response to an allogeneic challenge. In addition, prolonged Kv1.3 blockade causes reduced thymic cellularity and inhibits the thymic development of T cell subsets. These results provide in vivo evidence that Kv1.3 is a novel target for immunomodulation.
Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification
Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo
2013-01-01
In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...
Hoch, D H; Romero-Mira, M; Ehrlich, B E; Finkelstein, A; DasGupta, B R; Simpson, L L
1985-01-01
The heavy chains of both botulinum neurotoxin type B and tetanus toxin form channels in planar bilayer membranes. These channels have pH-dependent and voltage-dependent properties that are remarkably similar to those previously described for diphtheria toxin. Selectivity experiments with anions and cations show that the channels formed by the heavy chains of all three toxins are large; thus, these channels could serve as "tunnel proteins" for translocation of active peptide fragments. These f...
Clinical utility of seropositive voltage-gated potassium channel-complex antibody.
Jammoul, Adham; Shayya, Luay; Mente, Karin; Li, Jianbo; Rae-Grant, Alexander; Li, Yuebing
2016-10-01
Antibodies against voltage-gated potassium channel (VGKC)-complex are implicated in the pathogenesis of acquired neuromyotonia, limbic encephalitis, faciobrachial dystonic seizure, and Morvan syndrome. Outside these entities, the clinical value of VGKC-complex antibodies remains unclear. We conducted a single-center review of patients positive for VGKC-complex antibodies over an 8-year period. Among 114 patients positive for VGKC-complex antibody, 11 (9.6%) carrying the diagnosis of limbic encephalitis (n = 9) or neuromyotonia (n = 2) constituted the classic group, and the remaining 103 cases of various neurologic and non-neurologic disorders comprised the nonclassic group. The median titer for the classic group was higher than the nonclassic group ( p 0.25 nM) VGKC-complex antibody levels ( p VGKC-complex antibody titers are more likely found in patients with classically associated syndromes and other autoimmune conditions. Low-level VGKC-complex antibodies can be detected in nonspecific and mostly nonautoimmune disorders. The presence of VGKC-complex antibody, rather than its level, may serve as a marker of malignancy.
Kollarik, M; Sun, H; Herbstsomer, R A; Ru, F; Kocmalova, M; Meeker, S N; Undem, B J
2018-04-15
The action potential initiation in the nerve terminals and its subsequent conduction along the axons of afferent nerves are not necessarily dependent on the same voltage-gated sodium channel (Na V 1) subunits. The action potential initiation in jugular C-fibres within airway tissues is not blocked by TTX; nonetheless, conduction of action potentials along the vagal axons of these nerves is often dependent on TTX-sensitive channels. This is not the case for nodose airway Aδ-fibres and C-fibres, where both action potential initiation and conduction is abolished by TTX or selective Na V 1.7 blockers. The difference between the initiation of action potentials within the airways vs. conduction along the axons should be considered when developing Na V 1 blocking drugs for topical application to the respiratory tract. The action potential (AP) initiation in the nerve terminals and its subsequent AP conduction along the axons do not necessarily depend on the same subtypes of voltage-gated sodium channels (Na V 1s). We evaluated the role of TTX-sensitive and TTX-resistant Na V 1s in vagal afferent nociceptor nerves derived from jugular and nodose ganglia innervating the respiratory system. Single cell RT-PCR was performed on vagal afferent neurons retrogradely labelled from the guinea pig trachea. Almost all of the jugular neurons expressed the TTX-sensitive channel Na V 1.7 along with TTX-resistant Na V 1.8 and Na V 1.9. Tracheal nodose neurons also expressed Na V 1.7 but, less frequently, Na V 1.8 and Na V 1.9. Na V 1.6 were expressed in ∼40% of the jugular and 25% of nodose tracheal neurons. Other Na V 1 α subunits were only rarely expressed. Single fibre recordings were made from the vagal nodose and jugular nerve fibres innervating the trachea or lung in the isolated perfused vagally-innervated preparations that allowed for selective drug delivery to the nerve terminal compartment (AP initiation) or to the desheathed vagus nerve (AP conduction). AP initiation in
She, Xu; Chokhawala, Rahul Shantilal; Zhou, Rui; Zhang, Di; Sommerer, Timothy John; Bray, James William
2016-12-13
A voltage source converter based high-voltage direct-current (HVDC) transmission system includes a voltage source converter (VSC)-based power converter channel. The VSC-based power converter channel includes an AC-DC converter and a DC-AC inverter electrically coupled to the AC-DC converter. The AC-DC converter and a DC-AC inverter include at least one gas tube switching device coupled in electrical anti-parallel with a respective gas tube diode. The VSC-based power converter channel includes a commutating circuit communicatively coupled to one or more of the at least one gas tube switching devices. The commutating circuit is configured to "switch on" a respective one of the one or more gas tube switching devices during a first portion of an operational cycle and "switch off" the respective one of the one or more gas tube switching devices during a second portion of the operational cycle.
International Nuclear Information System (INIS)
Tang Xiaoyan; Zhang Yimen; Zhang Yuming
2002-01-01
The effect of interface state charges on the threshold voltage and transconductance of 6H-SiC N-channel metal-oxide semiconductor field-effect transistor (MOSFET) is analyzed based on the non-uniformly distributed interface state density in the band gap and incomplete impurity ionization in silicon carbide. The results show that the nonuniform distribution of interface state density cause not only the increment of the threshold voltage but also the degradation of the transconductance of MOSFET so that it is one of the important factors to influence the characteristics of SiC MOSFET
Sensing charges of the Ciona intestinalis voltage-sensing phosphatase.
Villalba-Galea, Carlos A; Frezza, Ludivine; Sandtner, Walter; Bezanilla, Francisco
2013-11-01
Voltage control over enzymatic activity in voltage-sensitive phosphatases (VSPs) is conferred by a voltage-sensing domain (VSD) located in the N terminus. These VSDs are constituted by four putative transmembrane segments (S1 to S4) resembling those found in voltage-gated ion channels. The putative fourth segment (S4) of the VSD contains positive residues that likely function as voltage-sensing elements. To study in detail how these residues sense the plasma membrane potential, we have focused on five arginines in the S4 segment of the Ciona intestinalis VSP (Ci-VSP). After implementing a histidine scan, here we show that four arginine-to-histidine mutants, namely R223H to R232H, mediate voltage-dependent proton translocation across the membrane, indicating that these residues transit through the hydrophobic core of Ci-VSP as a function of the membrane potential. These observations indicate that the charges carried by these residues are sensing charges. Furthermore, our results also show that the electrical field in VSPs is focused in a narrow hydrophobic region that separates the extracellular and intracellular space and constitutes the energy barrier for charge crossing.
Molecular and kinetic determinants of local anaesthetic action on sodium channels.
French, R J; Zamponi, G W; Sierralta, I E
1998-11-23
(1) Local anaesthetics (LA) rely for their clinical actions on state-dependent inhibition of voltage-dependent sodium channels. (2) Single, batrachoxin-modified sodium channels in planar lipid bilayers allow direct observation of drug-channel interactions. Two modes of inhibition of single-channel current are observed: fast block of the open channels and prolongation of a long-lived closed state, some of whose properties resemble those of the inactivated state of unmodified channels. (3) Analogues of different parts of the LA molecule separately mimic each blocking mode: amines--fast block, and water-soluble aromatics--closed state prolongation. (4) Interaction between a mu-conotoxin derivative and diethylammonium indicate an intrapore site of fast, open-state block. (5) Site-directed mutagenesis studies suggest that hydrophobic residues in transmembrane segment 6 of repeat domain 4 of sodium channels are critical for both LA binding and stabilization of the inactivated state.
Computational Tools for Interpreting Ion Channel pH-Dependence.
Sazanavets, Ivan; Warwicker, Jim
2015-01-01
Activity in many biological systems is mediated by pH, involving proton titratable groups with pKas in the relevant pH range. Experimental analysis of pH-dependence in proteins focusses on particular sidechains, often with mutagenesis of histidine, due to its pKa near to neutral pH. The key question for algorithms that predict pKas is whether they are sufficiently accurate to effectively narrow the search for molecular determinants of pH-dependence. Through analysis of inwardly rectifying potassium (Kir) channels and acid-sensing ion channels (ASICs), mutational effects on pH-dependence are probed, distinguishing between groups described as pH-coupled or pH-sensor. Whereas mutation can lead to a shift in transition pH between open and closed forms for either type of group, only for pH-sensor groups does mutation modulate the amplitude of the transition. It is shown that a hybrid Finite Difference Poisson-Boltzmann (FDPB) - Debye-Hückel continuum electrostatic model can filter mutation candidates, providing enrichment for key pH-coupled and pH-sensor residues in both ASICs and Kir channels, in comparison with application of FDPB alone.
Computational Tools for Interpreting Ion Channel pH-Dependence.
Directory of Open Access Journals (Sweden)
Ivan Sazanavets
Full Text Available Activity in many biological systems is mediated by pH, involving proton titratable groups with pKas in the relevant pH range. Experimental analysis of pH-dependence in proteins focusses on particular sidechains, often with mutagenesis of histidine, due to its pKa near to neutral pH. The key question for algorithms that predict pKas is whether they are sufficiently accurate to effectively narrow the search for molecular determinants of pH-dependence. Through analysis of inwardly rectifying potassium (Kir channels and acid-sensing ion channels (ASICs, mutational effects on pH-dependence are probed, distinguishing between groups described as pH-coupled or pH-sensor. Whereas mutation can lead to a shift in transition pH between open and closed forms for either type of group, only for pH-sensor groups does mutation modulate the amplitude of the transition. It is shown that a hybrid Finite Difference Poisson-Boltzmann (FDPB - Debye-Hückel continuum electrostatic model can filter mutation candidates, providing enrichment for key pH-coupled and pH-sensor residues in both ASICs and Kir channels, in comparison with application of FDPB alone.
Hedrich, Rainer
2012-10-01
Since the first recordings of single potassium channel activities in the plasma membrane of guard cells more than 25 years ago, patch-clamp studies discovered a variety of ion channels in all cell types and plant species under inspection. Their properties differed in a cell type- and cell membrane-dependent manner. Guard cells, for which the existence of plant potassium channels was initially documented, advanced to a versatile model system for studying plant ion channel structure, function, and physiology. Interestingly, one of the first identified potassium-channel genes encoding the Shaker-type channel KAT1 was shown to be highly expressed in guard cells. KAT1-type channels from Arabidopsis thaliana and its homologs from other species were found to encode the K(+)-selective inward rectifiers that had already been recorded in early patch-clamp studies with guard cells. Within the genome era, additional Arabidopsis Shaker-type channels appeared. All nine members of the Arabidopsis Shaker family are localized at the plasma membrane, where they either operate as inward rectifiers, outward rectifiers, weak voltage-dependent channels, or electrically silent, but modulatory subunits. The vacuole membrane, in contrast, harbors a set of two-pore K(+) channels. Just very recently, two plant anion channel families of the SLAC/SLAH and ALMT/QUAC type were identified. SLAC1/SLAH3 and QUAC1 are expressed in guard cells and mediate Slow- and Rapid-type anion currents, respectively, that are involved in volume and turgor regulation. Anion channels in guard cells and other plant cells are key targets within often complex signaling networks. Here, the present knowledge is reviewed for the plant ion channel biology. Special emphasis is drawn to the molecular mechanisms of channel regulation, in the context of model systems and in the light of evolution.
Construction and validation of a homology model of the human voltage-gated proton channel hHV1.
Kulleperuma, Kethika; Smith, Susan M E; Morgan, Deri; Musset, Boris; Holyoake, John; Chakrabarti, Nilmadhab; Cherny, Vladimir V; DeCoursey, Thomas E; Pomès, Régis
2013-04-01
The topological similarity of voltage-gated proton channels (H(V)1s) to the voltage-sensing domain (VSD) of other voltage-gated ion channels raises the central question of whether H(V)1s have a similar structure. We present the construction and validation of a homology model of the human H(V)1 (hH(V)1). Multiple structural alignment was used to construct structural models of the open (proton-conducting) state of hH(V)1 by exploiting the homology of hH(V)1 with VSDs of K(+) and Na(+) channels of known three-dimensional structure. The comparative assessment of structural stability of the homology models and their VSD templates was performed using massively repeated molecular dynamics simulations in which the proteins were allowed to relax from their initial conformation in an explicit membrane mimetic. The analysis of structural deviations from the initial conformation based on up to 125 repeats of 100-ns simulations for each system reveals structural features consistently retained in the homology models and leads to a consensus structural model for hH(V)1 in which well-defined external and internal salt-bridge networks stabilize the open state. The structural and electrostatic properties of this open-state model are compatible with proton translocation and offer an explanation for the reversal of charge selectivity in neutral mutants of Asp(112). Furthermore, these structural properties are consistent with experimental accessibility data, providing a valuable basis for further structural and functional studies of hH(V)1. Each Arg residue in the S4 helix of hH(V)1 was replaced by His to test accessibility using Zn(2+) as a probe. The two outermost Arg residues in S4 were accessible to external solution, whereas the innermost one was accessible only to the internal solution. Both modeling and experimental data indicate that in the open state, Arg(211), the third Arg residue in the S4 helix in hH(V)1, remains accessible to the internal solution and is located near the
Voltage-gated potassium channel-complex autoimmunity and associated clinical syndromes.
Irani, Sarosh R; Vincent, Angela
2016-01-01
Voltage-gated potassium channel (VGKC)-complex antibodies are defined by the radioimmunoprecipitation of Kv1 potassium channel subunits from brain tissue extracts and were initially discovered in patients with peripheral nerve hyperexcitability (PNH). Subsequently, they were found in patients with PNH plus psychosis, insomnia, and dysautonomia, collectively termed Morvan's syndrome (MoS), and in a limbic encephalopathy (LE) with prominent amnesia and frequent seizures. Most recently, they have been described in patients with pure epilepsies, especially in patients with the novel and distinctive semiology termed faciobrachial dystonic seizures (FBDS). In each of these conditions, there is a close correlation between clinical measures and antibody levels. The VGKC-complex is a group of proteins that are strongly associated in situ and after extraction in mild detergent. Two major targets of the autoantibodies are leucine-rich glioma-inactivated 1 (LGI1) and contactin-associated protein 2 (CASPR2). The patients with PNH or MoS are most likely to have CASPR2 antibodies, whereas LGI1 antibodies are found characteristically in patients with FBDS and LE. Crucially, each of these conditions has a good response to immunotherapies, often corticosteroids and plasma exchange, although optimal regimes require further study. VGKC-complex antibodies have also been described in neuropathic pain syndromes, chronic epilepsies, a polyradiculopathy in porcine abattoir workers, and some children with status epilepticus. Increasingly, however, the antigenic targets in these patients are not defined and in some cases the antibodies may be secondary rather than the primary cause. Future serologic studies should define all the antigenic components of the VGKC-complex, and further inform mechanisms of antibody pathogenicity and related inflammation. © 2016 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
He, Bingjun [College of Life Sciences, Nankai University, Tianjin 300071 (China); Soderlund, David M., E-mail: dms6@cornell.edu [Department of Entomology, Cornell University, Geneva, NY 14456 (United States)
2016-01-15
We expressed rat Na{sub v}1.6 sodium channels with or without the rat β1 subunit in human embryonic kidney (HEK293) cells and evaluated the effects of the pyrethroid insecticides tefluthrin and deltamethrin on whole-cell sodium currents. In assays with the Na{sub v}1.6 α subunit alone, both pyrethroids prolonged channel inactivation and deactivation and shifted the voltage dependence of channel activation and steady-state inactivation toward hyperpolarization. Maximal shifts in activation were ~ 18 mV for tefluthrin and ~ 24 mV for deltamethrin. These compounds also caused hyperpolarizing shifts of ~ 10–14 mV in the voltage dependence of steady-state inactivation and increased in the fraction of sodium current that was resistant to inactivation. The effects of pyrethroids on the voltage-dependent gating greatly increased the size of sodium window currents compared to unmodified channels; modified channels exhibited increased probability of spontaneous opening at membrane potentials more negative than the normal threshold for channel activation and incomplete channel inactivation. Coexpression of Na{sub v}1.6 with the β1 subunit had no effect on the kinetic behavior of pyrethroid-modified channels but had divergent effects on the voltage-dependent gating of tefluthrin- or deltamethrin-modified channels, increasing the size of tefluthrin-induced window currents but decreasing the size of corresponding deltamethrin-induced currents. Unexpectedly, the β1 subunit did not confer sensitivity to use-dependent channel modification by either tefluthrin or deltamethrin. We conclude from these results that functional reconstitution of channels in vitro requires careful attention to the subunit composition of channel complexes to ensure that channels in vitro are faithful functional and pharmacological models of channels in neurons. - Highlights: • We expressed Na{sub v}1.6 sodium channels with or without β1 subunits in HEK293 cells. • Tefluthrin and deltamethrin
Simple Ion Channels: From Structure to Electrophysiology and Back
Pohorille, Andrzej
2018-01-01
A reliable way to establish whether our understanding of a channel is satisfactory is to reproduce its measured ionic conductance over a broad range of applied voltages in computer simulations. In molecular dynamics (MD), this can be done by way of applying an external electric field to the system and counting the number of ions that traverse the channel per unit time. Since this approach is computationally very expensive, we have developed a markedly more efficient alternative in which MD is combined with the electrodiffusion (ED) equation. In this approach, the assumptions of the ED equation can be rigorously tested, and the precision and consistency of the calculated conductance can be determined. We have demonstrated that the full current/voltage dependence and the underlying free energy profile for a simple channel can be reliably calculated from equilibrium or non-equilibrium MD simulations at a single voltage. To carry out MD simulations, a structural model of a channel has to be assumed, which is an important constraint, considering that high-resolution structures are available for only very few simple channels. If the comparison of calculated ionic conductance with electrophysiological data is satisfactory, it greatly increases our confidence that the structure and the function are described sufficiently accurately. We examined the validity of the ED for several channels embedded in phospholipid membranes - four naturally occurring channels: trichotoxin, alamethicin, p7 from hepatitis C virus (HCV) and Vpu from the HIV-1 virus, and a synthetic, hexameric channel, formed by a 21-residue peptide that contains only leucine and serine. All these channels mediate transport of potassium and chloride ions. It was found that the ED equation is satisfactory for these systems. In some of them experimental and calculated electrophysiological properties are in good agreement, whereas in others there are strong indications that the structural models are incorrect.
Tiwari, Vishal A.; Divakaruni, Rama; Hook, Terence B.; Nair, Deleep R.
2016-04-01
Silicon-germanium is considered as an alternative channel material to silicon p-type FET (pFET) for the development of energy efficient high performance transistors for 28 nm and beyond in a high-k metal gate technology because of its lower threshold voltage and higher mobility. However, gate-induced drain leakage (GIDL) is a concern for high threshold voltage device design because of tunneling at reduced bandgap. In this work, the trap-assisted tunneling and band-to-band tunneling (BTBT) effects on GIDL is analyzed and modeled for SiGe pFETs. Experimental results and Monte Carlo simulation results reveal that the pre-halo germanium pre-amorphization implant used to contain the short channel effects contribute to GIDL at the drain sidewall in addition to GIDL due to BTBT in SiGe devices. The results are validated by comparing the experimental observations with the numerical simulation and a set of calibrated models are used to describe the GIDL mechanisms for various drain and gate bias.
Voltage-Gated Calcium Channel Antagonists and Traumatic Brain Injury
Directory of Open Access Journals (Sweden)
Bruce Lyeth
2013-06-01
Full Text Available Traumatic brain injury (TBI is a leading cause of death and disability in the United States. Despite more than 30 years of research, no pharmacological agents have been identified that improve neurological function following TBI. However, several lines of research described in this review provide support for further development of voltage gated calcium channel (VGCC antagonists as potential therapeutic agents. Following TBI, neurons and astrocytes experience a rapid and sometimes enduring increase in intracellular calcium ([Ca2+]i. These fluxes in [Ca2+]i drive not only apoptotic and necrotic cell death, but also can lead to long-term cell dysfunction in surviving cells. In a limited number of in vitro experiments, both L-type and N-type VGCC antagonists successfully reduced calcium loads as well as neuronal and astrocytic cell death following mechanical injury. In rodent models of TBI, administration of VGCC antagonists reduced cell death and improved cognitive function. It is clear that there is a critical need to find effective therapeutics and rational drug delivery strategies for the management and treatment of TBI, and we believe that further investigation of VGCC antagonists should be pursued before ruling out the possibility of successful translation to the clinic.
Cantí, C.; Nieto-Rostro, M.; Foucault, I.; Heblich, F.; Wratten, J.; Richards, M. W.; Hendrich, J.; Douglas, L.; Page, K. M.; Davies, A.; Dolphin, A. C.
2005-01-01
All auxiliary α2δ subunits of voltage-gated Ca2+ (CaV) channels contain an extracellular Von Willebrand factor-A (VWA) domain that, in α2δ-1 and -2, has a perfect metal-ion-dependent adhesion site (MIDAS). Modeling of the α2δ-2 VWA domain shows it to be highly likely to bind a divalent cation. Mutating the three key MIDAS residues responsible for divalent cation binding resulted in a MIDAS mutant α2δ-2 subunit that was still processed and trafficked normally when it was expressed alone. However, unlike WT α2δ-2, the MIDAS mutant α2δ-2 subunit did not enhance and, in some cases, further diminished CaV1.2, -2.1, and -2.2 currents coexpressed with β1b by using either Ba2+ or Na+ as a permeant ion. Furthermore, expression of the MIDAS mutant α2δ-2 reduced surface expression and strongly increased the perinuclear retention of CaVα1 subunits at the earliest time at which expression was observed in both Cos-7 and NG108–15 cells. Despite the presence of endogenous α2δ subunits, heterologous expression of α2δ-2 in differentiated NG108–15 cells further enhanced the endogenous high-threshold Ca2+ currents, whereas this enhancement was prevented by the MIDAS mutations. Our results indicate that α2δ subunits normally interact with the CaVα1 subunit early in their maturation, before the appearance of functional plasma membrane channels, and an intact MIDAS motif in the α2δ subunit is required to promote trafficking of the α1 subunit to the plasma membrane by an integrin-like switch. This finding provides evidence for a primary role of a VWA domain in intracellular trafficking of a multimeric complex, in contrast to the more usual roles in binding extracellular ligands in other exofacial VWA domains. PMID:16061813
Syeda, Ruhma; Santos, Jose S; Montal, Mauricio
2016-02-05
KCNQ (voltage-gated K(+) channel family 7 (Kv7)) channels control cellular excitability and underlie the K(+) current sensitive to muscarinic receptor signaling (the M current) in sympathetic neurons. Here we show that the novel anti-epileptic drug retigabine (RTG) modulates channel function of pore-only modules (PMs) of the human Kv7.2 and Kv7.3 homomeric channels and of Kv7.2/3 heteromeric channels by prolonging the residence time in the open state. In addition, the Kv7 channel PMs are shown to recapitulate the single-channel permeation and pharmacological specificity characteristics of the corresponding full-length proteins in their native cellular context. A mutation (W265L) in the reconstituted Kv7.3 PM renders the channel insensitive to RTG and favors the conductive conformation of the PM, in agreement to what is observed when the Kv7.3 mutant is heterologously expressed. On the basis of the new findings and homology models of the closed and open conformations of the Kv7.3 PM, we propose a structural mechanism for the gating of the Kv7.3 PM and for the site of action of RTG as a Kv7.2/Kv7.3 K(+) current activator. The results validate the modular design of human Kv channels and highlight the PM as a high-fidelity target for drug screening of Kv channels. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Mesbahus Saleheen
2016-05-01
Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.
Sensing voltage across lipid membranes
Swartz, Kenton J.
2009-01-01
The detection of electrical potentials across lipid bilayers by specialized membrane proteins is required for many fundamental cellular processes such as the generation and propagation of nerve impulses. These membrane proteins possess modular voltage-sensing domains, a notable example being the S1-S4 domains of voltage-activated ion channels. Ground-breaking structural studies on these domains explain how voltage sensors are designed and reveal important interactions with the surrounding lipid membrane. Although further structures are needed to fully understand the conformational changes that occur during voltage sensing, the available data help to frame several key concepts that are fundamental to the mechanism of voltage sensing. PMID:19092925
DEFF Research Database (Denmark)
Kurtz, A; Skott, O; Chegini, S
1990-01-01
in patch-clamped nor in intact Furaester-loaded cells. Moreover, basal renin secretion from a preparation enriched in mouse juxtaglomerular cells and from rat glomeruli with attached juxtaglomerular cells was not inhibited when extracellular potassium was isoosmotically increased to 56 mmol/l. In mouse...... kidney slices, however, depolarizing potassium concentrations caused a delayed inhibition at 56 mmol/l and a delayed stimulation of renin secretion at 110 mmol/l. Taken together, our study does not provide direct evidence for a role of voltage-activated calcium channels in the regulation of calcium...
Cardiac voltage gated calcium channels and their regulation by β-adrenergic signaling.
Kumari, Neema; Gaur, Himanshu; Bhargava, Anamika
2018-02-01
Voltage-gated calcium channels (VGCCs) are the predominant source of calcium influx in the heart leading to calcium-induced calcium release and ultimately excitation-contraction coupling. In the heart, VGCCs are modulated by the β-adrenergic signaling. Signaling through β-adrenergic receptors (βARs) and modulation of VGCCs by β-adrenergic signaling in the heart are critical signaling and changes to these have been significantly implicated in heart failure. However, data related to calcium channel dysfunction in heart failure is divergent and contradictory ranging from reduced function to no change in the calcium current. Many recent studies have highlighted the importance of functional and spatial microdomains in the heart and that may be the key to answer several puzzling questions. In this review, we have briefly discussed the types of VGCCs found in heart tissues, their structure, and significance in the normal and pathological condition of the heart. More importantly, we have reviewed the modulation of VGCCs by βARs in normal and pathological conditions incorporating functional and structural aspects. There are different types of βARs, each having their own significance in the functioning of the heart. Finally, we emphasize the importance of location of proteins as it relates to their function and modulation by co-signaling molecules. Its implication on the studies of heart failure is speculated. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Stephan eKratzer
2013-07-01
Full Text Available Corticotropin-releasing hormone (CRH plays an important role in a substantial number of patients with stress-related mental disorders, such as anxiety disorders and depression. CRH has been shown to increase neuronal excitability in the hippocampus, but the underlying mechanisms are poorly understood. The effects of CRH on neuronal excitability were investigated in acute hippocampal brain slices. Population spikes (PS and field excitatory postsynaptic potentials (fEPSP were evoked by stimulating Schaffer-collaterals and recorded simultaneously from the somatic and dendritic region of CA1 pyramidal neurons. CRH was found to increase PS amplitudes (mean Standard error of the mean; 231.8 31.2% of control; n=10 while neither affecting fEPSPs (104.3 ± 4.2%; n=10 nor long-term potentiation (LTP. However, when Schaffer-collaterals were excited via action potentials (APs generated by stimulation of CA3 pyramidal neurons, CRH increased fEPSP amplitudes (119.8 ± 3.6%; n=8 and the magnitude of LTP in the CA1 region. Experiments in slices from transgenic mice revealed that the effect on PS amplitude is mediated exclusively by CRH receptor 1 (CRHR1 expressed on glutamatergic neurons. The effects of CRH on PS were dependent on phosphatase-2B, L- and T-type calcium channels and voltage-gated potassium channels but independent on intracellular Ca2+-elevation. In patch-clamp experiments, CRH increased the frequency and decay times of APs and decreased currents through A-type and delayed-rectifier potassium channels. These results suggest that CRH does not affect synaptic transmission per se, but modulates voltage-gated ion currents important for the generation of APs and hence elevates by this route overall neuronal activity.
International Nuclear Information System (INIS)
Eriguchi, Koji; Ohta, Hiroaki; Ono, Kouichi; Wei Zhiqiang; Takagi, Takeshi
2009-01-01
Constant voltage stress (CVS) was applied to Fe-O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (t r ) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. From a polarity-dependent resistance increase determined by a time-zero measurement, the voltage and polarity-dependent t r were discussed on the basis of field- and structure-enhanced thermochemical reaction mechanisms
Directory of Open Access Journals (Sweden)
Xu Wen
2010-08-01
Full Text Available Abstract Background Temporomandibular disorders (TMDs are characterized by persistent orofacial pain and have diverse etiologic factors that are not well understood. It is thought that central sensitization leads to neuronal hyperexcitability and contributes to hyperalgesia and spontaneous pain. Nonsteroidal anti-inflammatory drugs (NSAIDs are currently the first choice of drug to relieve TMD pain. NSAIDS were shown to exhibit anticonvulsant properties and suppress cortical neuron activities by enhancing neuronal voltage-gated potassium KCNQ/Kv7 channels (M-current, suggesting that specific activation of M-current might be beneficial for TMD pain. Results In this study, we selected a new anticonvulsant drug retigabine that specifically activates M-current, and investigated the effect of retigabine on inflammation of the temporomandibular joint (TMJ induced by complete Freund's adjuvant (CFA in rats. The results show that the head withdrawal threshold for escape from mechanical stimulation applied to facial skin over the TMJ in inflamed rats was significantly lower than that in control rats. Administration of centrally acting M-channel opener retigabine (2.5 and 7.5 mg/kg can dose-dependently raise the head withdrawal threshold of mechanical allodynia, and this analgesic effect can be reversed by the specific KCNQ channel blocker XE991 (3 mg/kg. Food intake is known to be negatively associated with TMJ inflammation. Food intake was increased significantly by the administration of retigabine (2.5 and 7.5 mg/kg, and this effect was reversed by XE991 (3 mg/kg. Furthermore, intracerebralventricular injection of retigabine further confirmed the analgesic effect of central retigabine on inflammatory TMJ. Conclusions Our findings indicate that central sensitization is involved in inflammatory TMJ pain and pharmacological intervention for controlling central hyperexcitability by activation of neuronal KCNQ/M-channels may have therapeutic potential for
[Ion-dependency of the GABA-potentiating effects of benzodiazepine tranquilizers and harmane].
Abramets, I I; Komissarov, I V
1984-06-01
Experiments on an isolated spinal cord of 8-15-day-old rats have shown that one of the possible mechanisms of the GABA-potentiating action of the benzodiazepine tranquilizer, chlorodiazepoxide, may be a decrease in the intraneuronal concentration of Ca2+. This is evidenced by the enhancement of the GABA-potentiating action of chlorodiazepoxide under Ca2+ deficiency in the medium and in the presence of the blockers of the voltage-dependent Ca2+ ionic channels--Mn2+ and Co2+, and by the reduction of the effect in question under Ca2+ excess in the medium and in the presence of the K+ channels blockers--tetraethylammonium and 4-aminopyridine. The GABA-potentiating action of harmane is likely to be related to the blockade of the voltage-dependent K+ channels and elevation of the intracellular concentration of Ca2+.
Targeted deletion of Kcne2 impairs HCN channel function in mouse thalamocortical circuits.
Directory of Open Access Journals (Sweden)
Shui-Wang Ying
Full Text Available Hyperpolarization-activated, cyclic nucleotide-gated (HCN channels generate the pacemaking current, I(h, which regulates neuronal excitability, burst firing activity, rhythmogenesis, and synaptic integration. The physiological consequence of HCN activation depends on regulation of channel gating by endogenous modulators and stabilization of the channel complex formed by principal and ancillary subunits. KCNE2 is a voltage-gated potassium channel ancillary subunit that also regulates heterologously expressed HCN channels; whether KCNE2 regulates neuronal HCN channel function is unknown.We investigated the effects of Kcne2 gene deletion on I(h properties and excitability in ventrobasal (VB and cortical layer 6 pyramidal neurons using brain slices prepared from Kcne2(+/+ and Kcne2(-/- mice. Kcne2 deletion shifted the voltage-dependence of I(h activation to more hyperpolarized potentials, slowed gating kinetics, and decreased I(h density. Kcne2 deletion was associated with a reduction in whole-brain expression of both HCN1 and HCN2 (but not HCN4, although co-immunoprecipitation from whole-brain lysates failed to detect interaction of KCNE2 with HCN1 or 2. Kcne2 deletion also increased input resistance and temporal summation of subthreshold voltage responses; this increased intrinsic excitability enhanced burst firing in response to 4-aminopyridine. Burst duration increased in corticothalamic, but not thalamocortical, neurons, suggesting enhanced cortical excitatory input to the thalamus; such augmented excitability did not result from changes in glutamate release machinery since miniature EPSC frequency was unaltered in Kcne2(-/- neurons.Loss of KCNE2 leads to downregulation of HCN channel function associated with increased excitability in neurons in the cortico-thalamo-cortical loop. Such findings further our understanding of the normal physiology of brain circuitry critically involved in cognition and have implications for our understanding of
Tveito, Aslak; Lines, Glenn T; Edwards, Andrew G; McCulloch, Andrew
2016-07-01
Markov models are ubiquitously used to represent the function of single ion channels. However, solving the inverse problem to construct a Markov model of single channel dynamics from bilayer or patch-clamp recordings remains challenging, particularly for channels involving complex gating processes. Methods for solving the inverse problem are generally based on data from voltage clamp measurements. Here, we describe an alternative approach to this problem based on measurements of voltage traces. The voltage traces define probability density functions of the functional states of an ion channel. These probability density functions can also be computed by solving a deterministic system of partial differential equations. The inversion is based on tuning the rates of the Markov models used in the deterministic system of partial differential equations such that the solution mimics the properties of the probability density function gathered from (pseudo) experimental data as well as possible. The optimization is done by defining a cost function to measure the difference between the deterministic solution and the solution based on experimental data. By evoking the properties of this function, it is possible to infer whether the rates of the Markov model are identifiable by our method. We present applications to Markov model well-known from the literature. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Propylparaben reduces the excitability of hippocampal neurons by blocking sodium channels.
Lara-Valderrábano, Leonardo; Rocha, Luisa; Galván, Emilio J
2016-12-01
Propylparaben (PPB) is an antimicrobial preservative widely used in food, cosmetics, and pharmaceutics. Virtual screening methodologies predicted anticonvulsant activity of PPB that was confirmed in vivo. Thus, we explored the effects of PPB on the excitability of hippocampal neurons by using standard patch clamp techniques. Bath perfusion of PPB reduced the fast-inactivating sodium current (I Na ) amplitude, causing a hyperpolarizing shift in the inactivation curve of the I Na, and markedly delayed the sodium channel recovery from the inactivation state. Also, PPB effectively suppressed the riluzole-sensitive, persistent sodium current (I NaP ). PPB perfusion also modified the action potential kinetics, and higher concentrations of PPB suppressed the spike activity. Nevertheless, the modulatory effects of PPB did not occur when PPB was internally applied by whole-cell dialysis. These results indicate that PPB reduces the excitability of CA1 pyramidal neurons by modulating voltage-dependent sodium channels. The mechanistic basis of this effect is a marked delay in the recovery from inactivation state of the voltage-sensitive sodium channels. Our results indicate that similar to local anesthetics and anticonvulsant drugs that act on sodium channels, PPB acts in a use-dependent manner. Copyright © 2016 Elsevier B.V. All rights reserved.
Ca2+-dependent phospholipid scrambling by a reconstituted TMEM16 ion channel.
Malvezzi, Mattia; Chalat, Madhavan; Janjusevic, Radmila; Picollo, Alessandra; Terashima, Hiroyuki; Menon, Anant K; Accardi, Alessio
2013-01-01
Phospholipid (PL) scramblases disrupt the lipid asymmetry of the plasma membrane, externalizing phosphatidylserine to trigger blood coagulation and mark apoptotic cells. Recently, members of the TMEM16 family of Ca(2+)-gated channels have been shown to be involved in Ca(2+)-dependent scrambling. It is however controversial whether they are scramblases or channels regulating scrambling. Here we show that purified afTMEM16, from Aspergillus fumigatus, is a dual-function protein: it is a Ca(2+)-gated channel, with characteristics of other TMEM16 homologues, and a Ca(2+)-dependent scramblase, with the expected properties of mammalian PL scramblases. Remarkably, we find that a single Ca(2+) site regulates separate transmembrane pathways for ions and lipids. Two other purified TMEM16-channel homologues do not mediate scrambling, suggesting that the family diverged into channels and channel/scramblases. We propose that the spatial separation of the ion and lipid pathways underlies the evolutionary divergence of the TMEM16 family, and that other homologues, such as TMEM16F, might also be dual-function channel/scramblases.
Tu, Huiyin; Liu, Jinxu; Zhu, Zhen; Zhang, Libin; Pipinos, Iraklis I; Li, Yu-Long
2012-01-01
Our previous study has shown that chronic heart failure (CHF) reduces expression and activation of voltage-gated sodium (Na(v)) channels in baroreceptor neurons, which are involved in the blunted baroreceptor neuron excitability and contribute to the impairment of baroreflex in the CHF state. The present study examined the role of mitochondria-derived superoxide in the reduced Na(v) channel function in coronary artery ligation-induced CHF rats. CHF decreased the protein expression and activity of mitochondrial complex enzymes and manganese SOD (MnSOD) and elevated the mitochondria-derived superoxide level in the nodose neurons compared with those in sham nodose neurons. Adenoviral MnSOD (Ad.MnSOD) gene transfection (50 multiplicity of infection) into the nodose neurons normalized the MnSOD expression and reduced the elevation of mitochondrial superoxide in the nodose neurons from CHF rats. Ad.MnSOD also partially reversed the reduced protein expression and current density of the Na(v) channels and the suppressed cell excitability (the number of action potential and the current threshold for inducing action potential) in aortic baroreceptor neurons from CHF rats. Data from the present study indicate that mitochondrial dysfunction, including decreased protein expression and activity of mitochondrial complex enzymes and MnSOD and elevated mitochondria-derived superoxide, contributes to the reduced Na(v) channel activation and cell excitability in the aortic baroreceptor neurons in CHF rats.
High frequency relay protection channels on super high voltage lines
Energy Technology Data Exchange (ETDEWEB)
Mikutskii, G V
1964-08-01
General aspects of high voltage transmission line design are discussed. The relationships between line voltage and length and line dimensions and power losses are explained. Electrical interference in the line is classified under three headings: interference under normal operating conditions, interference due to insulation faults, and interference due to variations in operating conditions of the high-voltage network.
Ren, Wei; Yuan, Lin; Li, Jun; Huang, Xian-Ju; Chen, Su; Zou, Da-Jiang; Liu, Xiangming; Yang, Xin-Zhou
2012-01-01
Aconiti Brachypodi Radix, belonging to the genus of Aconitum (Family Ranunculaceae), are used clinically as anti-rheumatic, anti-inflammatory and anti-nociceptive in traditional medicine of China. However, its mechanism and influence on nociceptive threshold are unknown and need further investigation. The analgesic effects of ethanolic extract of Aconiti Brachypodi Radix (EABR) were thus studied in vivo and in vitro. Three pain models in mice were used to assess the effect of EABR on nociceptive threshold. In vitro study was conducted to clarify the modulation of the extract on the tetrodotoxin-sensitive (TTX-S) sodium currents in rat's dorsal root ganglion (DRG) neurons using whole-cell patch clamp technique. The results showed that EABR (5-20 mg/kg, i.g.) could produce dose-dependent analgesic effect on hot-plate tests as well as writhing response induced by acetic acid. In addition, administration of 2.5-10 mg/kg EABR (i.g.) caused significant decrease in pain responses in the first and second phases of formalin test without altering the PGE₂ production in the hind paw of the mice. Moreover, EABR (10 µg/ml -1 mg/ml) could suppress TTX-S voltage-gated sodium currents in a dose-dependent way, indicating the underlying electrophysiological mechanism of the analgesic effect of the folk plant medicine. Collectively, our results indicated that EABR has analgesic property in three pain models and useful influence on TTX-S sodium currents in DRG neurons, suggesting that the interference with pain messages caused by the modulation of EABR on TTX-S sodium currents in DRG neurones may explain some of its analgesic effect.
Directory of Open Access Journals (Sweden)
Filip Touska
2017-08-01
Full Text Available Ciguatoxins (CTXs are marine toxins that cause ciguatera fish poisoning, a debilitating disease dominated by sensory and neurological disturbances that include cold allodynia and various painful symptoms as well as long-lasting pruritus. Although CTXs are known as the most potent mammalian sodium channel activator toxins, the etiology of many of its neurosensory symptoms remains unresolved. We recently described that local application of 1 nM Pacific Ciguatoxin-1 (P-CTX-1 into the skin of human subjects induces a long-lasting, painful axon reflex flare and that CTXs are particularly effective in releasing calcitonin-gene related peptide (CGRP from nerve terminals. In this study, we used mouse and rat skin preparations and enzyme-linked immunosorbent assays (ELISA to study the molecular mechanism by which P-CTX-1 induces CGRP release. We show that P-CTX-1 induces CGRP release more effectively in mouse as compared to rat skin, exhibiting EC50 concentrations in the low nanomolar range. P-CTX-1-induced CGRP release from skin is dependent on extracellular calcium and sodium, but independent from the activation of various thermosensory transient receptor potential (TRP ion channels. In contrast, lidocaine and tetrodotoxin (TTX reduce CGRP release by 53–75%, with the remaining fraction involving L-type and T-type voltage-gated calcium channels (VGCC. Using transgenic mice, we revealed that the TTX-resistant voltage-gated sodium channel (VGSC NaV1.9, but not NaV1.8 or NaV1.7 alone and the combined activation of the TTX-sensitive VGSC subtypes NaV1.7 and NaV1.1 carry the largest part of the P-CTX-1-caused CGRP release of 42% and 34%, respectively. Given the contribution of CGRP to nociceptive and itch sensing pathways, our findings contribute to a better understanding of sensory symptoms of acute and chronic ciguatera that may help in the identification of potential therapeutics.
Touska, Filip; Sattler, Simon; Malsch, Philipp; Lewis, Richard J.; Zimmermann, Katharina
2017-01-01
Ciguatoxins (CTXs) are marine toxins that cause ciguatera fish poisoning, a debilitating disease dominated by sensory and neurological disturbances that include cold allodynia and various painful symptoms as well as long-lasting pruritus. Although CTXs are known as the most potent mammalian sodium channel activator toxins, the etiology of many of its neurosensory symptoms remains unresolved. We recently described that local application of 1 nM Pacific Ciguatoxin-1 (P-CTX-1) into the skin of human subjects induces a long-lasting, painful axon reflex flare and that CTXs are particularly effective in releasing calcitonin-gene related peptide (CGRP) from nerve terminals. In this study, we used mouse and rat skin preparations and enzyme-linked immunosorbent assays (ELISA) to study the molecular mechanism by which P-CTX-1 induces CGRP release. We show that P-CTX-1 induces CGRP release more effectively in mouse as compared to rat skin, exhibiting EC50 concentrations in the low nanomolar range. P-CTX-1-induced CGRP release from skin is dependent on extracellular calcium and sodium, but independent from the activation of various thermosensory transient receptor potential (TRP) ion channels. In contrast, lidocaine and tetrodotoxin (TTX) reduce CGRP release by 53–75%, with the remaining fraction involving L-type and T-type voltage-gated calcium channels (VGCC). Using transgenic mice, we revealed that the TTX-resistant voltage-gated sodium channel (VGSC) NaV1.9, but not NaV1.8 or NaV1.7 alone and the combined activation of the TTX-sensitive VGSC subtypes NaV1.7 and NaV1.1 carry the largest part of the P-CTX-1-caused CGRP release of 42% and 34%, respectively. Given the contribution of CGRP to nociceptive and itch sensing pathways, our findings contribute to a better understanding of sensory symptoms of acute and chronic ciguatera that may help in the identification of potential therapeutics. PMID:28867800
Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui
2018-01-01
Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.
Sodium channels as targets for volatile anesthetics
Directory of Open Access Journals (Sweden)
Karl F. Herold
2012-03-01
Full Text Available The molecular mechanisms of modern inhaled anesthetics although widely used in clinical settings are still poorly understood. Considerable evidence supports effects on membrane proteins such as ligand- and voltage-gated ion channels of excitable cells. Na+ channels are crucial to action potential initiation and propagation, and represent potential targets for volatile anesthetics. Inhibition of presynaptic Na+ channels leads to reduced neurotransmitter release at the synapse and could therefore contribute to the mechanisms by which volatile anesthetics produce their characteristic effects: amnesia, unconsciousness, and immobility. Early studies on crayfish and squid giant axon showed inhibition of Na+ currents by volatile anesthetics. Subsequent studies using native neuronal preparations and heterologous expression systems with various mammalian Na+ channel isoforms implicated inhibition of presynaptic Na+ channels in anesthetic actions. Volatile anesthetics reduce peak Na+ current and shift the voltage of half-maximal steady-state inactivation towards more negative potentials, thus stabilizing the fast-inactivated state. Furthermore recovery from fast-inactivation is slowed together with an enhanced use-dependent block during pulse train protocols. These effects can reduce neurotransmitter release by depressing presynaptic excitability, depolarization and Ca entry, and ultimately transmitter release. This reduction in transmitter release is more portent for glutamatergic vs. GABAergic terminals. Involvement of Na+ channel inhibition in mediating the immobility caused by volatile anesthetics has been demonstrated in animal studies, in which intrathecal infusion of the Na+ channel blocker tetrodotoxin increases volatile anesthetic potency, whereas infusion of the Na+ channels agonist veratridine reduces anesthetic potency. These studies indicate that inhibition of presynaptic Na+ channels by volatile anesthetics is involved in mediating some of
Effects of channel noise on firing coherence of small-world Hodgkin-Huxley neuronal networks
Sun, X. J.; Lei, J. Z.; Perc, M.; Lu, Q. S.; Lv, S. J.
2011-01-01
We investigate the effects of channel noise on firing coherence of Watts-Strogatz small-world networks consisting of biophysically realistic HH neurons having a fraction of blocked voltage-gated sodium and potassium ion channels embedded in their neuronal membranes. The intensity of channel noise is determined by the number of non-blocked ion channels, which depends on the fraction of working ion channels and the membrane patch size with the assumption of homogeneous ion channel density. We find that firing coherence of the neuronal network can be either enhanced or reduced depending on the source of channel noise. As shown in this paper, sodium channel noise reduces firing coherence of neuronal networks; in contrast, potassium channel noise enhances it. Furthermore, compared with potassium channel noise, sodium channel noise plays a dominant role in affecting firing coherence of the neuronal network. Moreover, we declare that the observed phenomena are independent of the rewiring probability.
Directory of Open Access Journals (Sweden)
Zhirui Liu
2012-01-01
Full Text Available Voltage-gated sodium channels (VGSCs are important membrane protein carrying on the molecular basis for action potentials (AP in neuronal firings. Even though the structure-function studies were the most pursued spots, the posttranslation modification processes, such as glycosylation, phosphorylation, and alternative splicing associating with channel functions captured less eyesights. The accumulative research suggested an interaction between the sialic acids chains and ion-permeable pores, giving rise to subtle but significant impacts on channel gating. Sodium channel-specific neurotoxic toxins, a family of long-chain polypeptides originated from venomous animals, are found to potentially share the binding sites adjacent to glycosylated region on VGSCs. Thus, an interaction between toxin and glycosylated VGSC might hopefully join the campaign to approach the role of glycosylation in modulating VGSCs-involved neuronal network activity. This paper will cover the state-of-the-art advances of researches on glycosylation-mediated VGSCs function and the possible underlying mechanisms of interactions between toxin and glycosylated VGSCs, which may therefore, fulfill the knowledge in identifying the pharmacological targets and therapeutic values of VGSCs.
A recently published review (Soderlund et al., 2002, Toxicology 171, 3-59.) of the mechanisms of acute neurotoxicity of pyrethroid compounds postulated that voltage-sensitive calcium channels (VSCC) may be a target of some pyrethroid compounds and that effects on VSCC may contrib...
Voltage-Gated Potassium Channel Antibodies in Slow-Progression Motor Neuron Disease.
Godani, Massimiliano; Zoccarato, Marco; Beronio, Alessandro; Zuliani, Luigi; Benedetti, Luana; Giometto, Bruno; Del Sette, Massimo; Raggio, Elisa; Baldi, Roberta; Vincent, Angela
2017-01-01
The spectrum of autoimmune neurological diseases associated with voltage-gated potassium channel (VGKC)-complex antibodies (Abs) ranges from peripheral nerve disorders to limbic encephalitis. Recently, low titers of VGKC-complex Abs have also been reported in neurodegenerative disorders, but their clinical relevance is unknown. The aim of the study was to explore the prevalence of VGKC-complex Abs in slow-progression motor neuron disease (MND). We compared 11 patients affected by slow-progression MND with 9 patients presenting typical progression illness. Sera were tested for VGKC-complex Abs by radioimmunoassay. The distribution of VGKC-complex Abs was analyzed with the Mann-Whitney U test. The statistical analysis showed a significant difference between the mean values in the study and control groups. A case with long-survival MND harboring VGKC-complex Abs and treated with intravenous immunoglobulins is described. Although VGKC-complex Abs are not likely to be pathogenic, these results could reflect the coexistence of an immunological activation in patients with slow disease progression. © 2016 S. Karger AG, Basel.