Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.
Directory of Open Access Journals (Sweden)
Kattina Zavala
Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.
Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).
Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq
2017-08-01
Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.
Ghosh, Subhabrata; Mandi, Swati Sen
2015-07-25
Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content. Copyright © 2015 Elsevier B.V. All rights reserved.
Lunkenbein, S.; Coiner, H.; Vos, de C.H.; Schaart, J.G.; Boone, M.J.; Krens, F.A.; Schwab, W.; Salentijn, E.M.J.
2006-01-01
An octaploid (Fragaria × ananassa cv. Calypso) genotype of strawberry was transformed with an antisense chalcone synthase (CHS) gene construct using a ripening related CHS cDNA from Fragaria × ananassa cv. Elsanta under the control of the constitutive CaMV 35S promoter via Agrobacterium tumefaciens.
DEFF Research Database (Denmark)
Le Gall, G.; Metzdorff, Stine Broeng; Pedersen, Jan W.
2005-01-01
A metabolite profiling study has been carried out on Arabidopsis thaliana (L.) Heynh. ecotype Wassilewskija and a series of transgenic lines of the ecotype transformed with a CHS (chalcone synthase) antisense construct. Compound identifications by LC/MS and H-1 NMR are discussed. The glucosinolate...
International Nuclear Information System (INIS)
Staiger, D.; Kaulen, H.; Schell, J.
1989-01-01
In the chalcone synthase gene of Antirrhinum majus (snapdragon), 150 base pairs of the 5' flanking region contain cis-acting signals for UV light-induced expression. A nuclear factor, designated CG-1, specifically recognizes a hexameric motif with internal dyad symmetry, CACGTG, located within this light-responsive sequence. Binding of CG-1 is influenced by C-methylation of the CpG dinucleotide in the recognition sequence. CG-1 is a factor found in a variety of dicotyledonous plant species including Nicotiana tabacum, A. majus, Petunia hybrida, Arabidopsis thaliana, and Glycine max. CACGTG motifs contained within trans-acting factor recognition sites in various other plant promoters can interact with CG-1. In addition, the binding site of the human adenovirus major late transcription factor USF can compete for CG-1 binding to the chalcone synthase promoter. This suggests an evolutionary conservation of trans-acting factor recognition sites involved in divergent mechanisms of gene control. (author)
Schröder, J; Raiber, S; Berger, T; Schmidt, A; Schmidt, J; Soares-Sello, A M; Bardshiri, E; Strack, D; Simpson, T J; Veit, M; Schröder, G
1998-06-09
Heterologous screening of a cDNA library from Pinusstrobus seedlings identified clones for two chalcone synthase (CHS) related proteins (PStrCHS1 and PStrCHS2, 87.6% identity). Heterologous expression in Escherichia coli showed that PStrCHS1 performed the typical CHS reaction, that it used starter CoA-esters from the phenylpropanoid pathway, and that it performed three condensation reactions with malonyl-CoA, followed by the ring closure to the chalcone. PstrCHS2 was completely inactive with these starters and also with linear CoA-esters. Activity was detected only with a diketide derivative (N-acetylcysteamine thioester of 3-oxo-5-phenylpent-4-enoic acid) that corresponded to the CHS reaction intermediate postulated after the first condensation reaction. PstrCHS2 performed only one condensation, with 6-styryl-4-hydroxy-2-pyrone derivatives as release products. The enzyme preferred methylmalonyl-CoA against malonyl-CoA, if only methylmalonyl-CoA was available. These properties and a comparison with the CHS from Pinus sylvestris suggested for PstrCHS2 a special function in the biosynthesis of secondary products. In contrast to P. sylvestris, P. strobus contains C-methylated chalcone derivatives, and the methyl group is at the position predicted from a chain extension with methylmalonyl-CoA in the second condensation of the biosynthetic reaction sequence. We propose that PstrCHS2 specifically contributes the condensing reaction with methylmalonyl-CoA to yield a methylated triketide intermediate. We discuss a model that the biosynthesis of C-methylated chalcones represents the simplest example of a modular polyketide synthase.
International Nuclear Information System (INIS)
Ohl, S.; Hahlbrock, K.; Schäfer, E.
1989-01-01
Run-off transcription assays were used to demonstrate that both the ultraviolet (UV)-B and blue-light receptors control transcription rates for chalcone-synthase mRNA in the course of light-induced flavonoid synthesis in parsley (Petroselinum crispum Miller (A.W. Hill)) cell-suspension cultures. Blue and red light alone, presumably acting via a blue-light receptor and active phytochrome (far-red absorbing form) respectively, can induce accumulation of chalcone-synthase mRNA. The extent of the response is however considerably smaller than that obtained when these wavebands are applied in combination with UV light. A preirradiation with blue light strongly increases the response to a subsequent UV pulse and this modulating effect of blue light is stable for at least 20 h. The modulating effect is abolished by a UV induction but can be reestablished by a second irradiation with blue light. (author)
Yang, Ji; Gu, Hongya; Yang, Ziheng
2004-01-01
Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication.
Comparative study of Chalcone synthase promoters across plant families
Directory of Open Access Journals (Sweden)
Francisco Buitrago
2009-07-01
Full Text Available En la era post-genómica, el entendimiento de la regulación génica se ha convertido en un reto y una prioridad de investigación. En este trabajo realizamos un estudio comparativo de las secuencias reguladoras del gen de la chalcón sintetasa de varias familias botánicas. Veintidós secuencias de promotores de Chalcone Synthase fueron comparados teniendo en cuenta tres elementos Cis reguladores: Caja-G, Caja-H y Caja-TATA, que podrían estar actuando como una sola unidad cooperativa. Nuestra comparación muestra que estos elementos puede que se conserven en algunas especies e inclusive que se conserven a nivel de familia. Sin embargo, en algunas especies no todos los elementos Cis fueron encontrados, mostrando que no todas las especies se regulan bajo los mismos parámetros. Adicionalmente, una comparación entre promotores de una misma especie con una familia de multigenes Chs, mostró que los genes duplicados son variables en la composición del elemento Cis, sugiriendo que estos genes pueden estarse expresando de maneras diferentes.
El-Garhy, Hoda A S; Khattab, Salah; Moustafa, Mahmoud M A; Abou Ali, Rania; Abdel Azeiz, Ahmed Z; Elhalwagi, Abeer; El Sherif, Fadia
2016-11-01
Silymarin, a Silybum marianum seed extract containing a mixture of flavonolignans including silybin, is being used as an antihepatotoxic therapy for liver diseases. In this study, the enhancing effect of gamma irradiation on plant growth parameters of S. marianum under salt stress was investigated. The effect of gamma irradiation, either as a single elicitor or coupled with salinity, on chalcone synthase (CHS) gene expression and silybin A + B yield was also evaluated. The silybin A + B content in S. marianum fruits was estimated by liquid chromatography-mass spectrometry (LC-MS/MS). An increase in silybin content was accompanied by up-regulation of the CHS1, CHS2 and CHS3 genes, which are involved in the silybin biosynthetic pathway. The highest silybin A + B production (0.77 g/100 g plant DW) and transcript levels of the three studied genes (100.2-, 91.9-, and 24.3-fold increase, respectively) were obtained with 100GY gamma irradiation and 4000 ppm salty water. The CHS2 and CHS3 genes were partially sequenced and submitted to the NCBI database under the accession numbers KT252908.1 and KT252909.1, respectively. Developing new approaches to stimulate silybin biosynthetic pathways could be a useful tool to potentiate the use of plants as renewable resources of medicinal compounds. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan
2016-01-01
The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124
In situ localization of chalcone synthase mRNA in pea root nodule development.
Yang, W.C.; Canter Cremers, H.C.J.; Hogendijk, P.; Katinakis, P.; Wijffelman, C.A.; Franssen, H.J.; Kammen, van A.; Bisseling, T.
1992-01-01
In this paper studies on the role of flavonoids in pea root nodule development are reported. Flavonoid synthesis was followed by localizing chalcone synthase (CHS) mRNA in infected pea roots and in root nodules. In a nodule primordium, CHS mRNA is present in all cells of the primordium. Therefore it
Enzymatic Properties and Mutational Studies of Chalcone Synthase from Physcomitrella patens
Directory of Open Access Journals (Sweden)
Mahiran Basri
2012-08-01
Full Text Available PpCHS is a member of the type III polyketide synthase family and catalyses the synthesis of the flavonoid precursor naringenin chalcone from p-coumaroyl-CoA. Recent research reports the production of pyrone derivatives using either hexanoyl-CoA or butyryl-CoA as starter molecule. The Cys-His-Asn catalytic triad found in other plant chalcone synthase predicted polypeptides is conserved in PpCHS. Site directed mutagenesis involving these amino acids residing in the active-site cavity revealed that the cavity volume of the active-site plays a significant role in the selection of starter molecules as well as product formation. Substitutions of Cys 170 with Arg and Ser amino acids decreased the ability of the PpCHS to utilize hexanoyl-CoA as a starter molecule, which directly effected the production of pyrone derivatives (products. These substitutions are believed to have a restricted number of elongations of the growing polypeptide chain due to the smaller cavity volume of the mutant’s active site.
International Nuclear Information System (INIS)
Christie, J.M.; Jenkins, G.I.
1996-01-01
UV and blue light control the expression of flavonoid biosynthesis genes in a range of higher plants. To investigate the signal transduction processes involved in the induction of chalcone synthase (CHS) gene expression by UV-B and UV-A/blue light, we examined the, effects of specific agonists and inhibitors of known signaling components in mammalian systems in a photomixotrophic Arabidopsis cell suspension culture. CHS expression is induced specifically by these wavelengths in the cell culture, in a manner similar to that in mature Arabidopsis leaf tissue. Both the UV-B and UV-A/blue phototransduction processes involve calcium, although the elevation of cytosolic calcium is insufficient on its own to stimulate CHS expression. The UV-A/blue light induction of CHS expression does not appear to involve calmodulin, whereas the UV-B response does; this difference indicates that the signal transduction pathways are, at least in part, distinct. We provide evidence that both pathways involve reversible protein phosphorylation and require protein synthesis. The UV-B and UV-A/blue light signaling pathways are therefore different from the phytochrome signal transduction pathway regulating CHS expression in other species
Directory of Open Access Journals (Sweden)
Deqiang Tai
Full Text Available Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, 'Royalty' and 'Flame', have dark red and white petals respectively, while the intermediate cultivar 'Radiant' has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in 'Radiant'. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple.
Molecular characterization and expression analysis of chalcone ...
African Journals Online (AJOL)
Chalcone synthase (CHS, EC: 2.3.1.74) is a key enzyme in the flavonoid and anthocyanin biosynthesis pathway. In order to investigate the role of CHS in tree peony flower coloration mechanism, we isolated and characterized the CHS gene from Paeonia suffruticosa cv. Yu Ji Yan Zhuang and analyzed its spatial and ...
International Nuclear Information System (INIS)
Haussühl, K.; Rohde, W.; Weissenböck, G.
1996-01-01
Four chalcone synthase (CHS; EC 2.3.1.74) clones from rye were isolated and characterized. Two of these clones were used for analysis of CHS gene activities in response to ultraviolet and visible radiation in the coleoptile and the primary leaf of the rye seedling. The time-dependence of CHS gene activation and the spatial distribution of CHS were studied by investigation of enzyme activities and CHS mRNA levels, including in situ RNA hybridization. In the primary leaf strong induction of CHS gene activity was localized in the epidermal layers and only marginally found in the mesophyll. The coleoptile showed an even higher response to UV irradiation, but CHS gene activity was evenly distributed throughout the tissues. It is suggested that, in addition to its function as a mechanical protection for the primary leaf during seed germination and seedling emergence through the soil, the coleoptile may also protect the emerging seedling from harmful radiation
Dare, Andrew P; Tomes, Sumathi; Jones, Midori; McGhie, Tony K; Stevenson, David E; Johnson, Ross A; Greenwood, David R; Hellens, Roger P
2013-05-01
We have identified in apple (Malus × domestica) three chalcone synthase (CHS) genes. In order to understand the functional redundancy of this gene family RNA interference knockout lines were generated where all three of these genes were down-regulated. These lines had no detectable anthocyanins and radically reduced concentrations of dihydrochalcones and flavonoids. Surprisingly, down-regulation of CHS also led to major changes in plant development, resulting in plants with shortened internode lengths, smaller leaves and a greatly reduced growth rate. Microscopic analysis revealed that these phenotypic changes extended down to the cellular level, with CHS-silenced lines showing aberrant cellular organisation in the leaves. Fruit collected from one CHS-silenced line was smaller than the 'Royal Gala' controls, lacked flavonoids in the skin and flesh and also had changes in cell morphology. Auxin transport experiments showed increased rates of auxin transport in a CHS-silenced line compared with the 'Royal Gala' control. As flavonoids are well known to be key modulators of auxin transport, we hypothesise that the removal of almost all flavonoids from the plant by CHS silencing creates a vastly altered environment for auxin transport to occur and results in the observed changes in growth and development. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.
DEFF Research Database (Denmark)
Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo
2016-01-01
identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...
Morita, Yasumasa; Saito, Ryoko; Ban, Yusuke; Tanikawa, Natsu; Kuchitsu, Kazuyuki; Ando, Toshio; Yoshikawa, Manabu; Habu, Yoshiki; Ozeki, Yoshihiro; Nakayama, Masayoshi
2012-06-01
The natural bicolor floral traits of the horticultural petunia (Petunia hybrida) cultivars Picotee and Star are caused by the spatial repression of the chalcone synthase A (CHS-A) gene, which encodes an anthocyanin biosynthetic enzyme. Here we show that Picotee and Star petunias carry the same short interfering RNA (siRNA)-producing locus, consisting of two intact CHS-A copies, PhCHS-A1 and PhCHS-A2, in a tandem head-to-tail orientation. The precursor CHS mRNAs are transcribed from the two CHS-A copies throughout the bicolored petals, but the mature CHS mRNAs are not found in the white tissues. An analysis of small RNAs revealed the accumulation of siRNAs of 21 nucleotides that originated from the exon 2 region of both CHS-A copies. This accumulation is closely correlated with the disappearance of the CHS mRNAs, indicating that the bicolor floral phenotype is caused by the spatially regulated post-transcriptional silencing of both CHS-A genes. Linkage between the tandemly arranged CHS-A allele and the bicolor floral trait indicates that the CHS-A allele is a necessary factor to confer the trait. We suppose that the spatially regulated production of siRNAs in Picotee and Star flowers is triggered by another putative regulatory locus, and that the silencing mechanism in this case may be different from other known mechanisms of post-transcriptional gene silencing in plants. A sequence analysis of wild Petunia species indicated that these tandem CHS-A genes originated from Petunia integrifolia and/or Petunia inflata, the parental species of P. hybrida, as a result of a chromosomal rearrangement rather than a gene duplication event. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.
Transactivation of Ds by Ac-transposase gene fusions in tobacco
Rommens, Caius M.T.; Haaren, Mark J.J. van; Buchel, Annemarie S.; Mol, Joseph N.M.; Tunen, Arjen J. van; Nijkamp, H. John J.; Hille, Jacques
1992-01-01
To study regulation of the (Ds) transposition process in heterologous plant species, the transposase gene of Ac was fused to several promoters that are active late during plant development. These promoters are the flower-specific chalcone synthase A promoter (CHS A), the anther-specific chalcone
International Nuclear Information System (INIS)
Koes, R.E.; Spelt, C.E.; Mol, J.N.M.
1989-01-01
We have analysed the expression of the 8-10 members of the gene family encoding the flavonoid biosynthetic enzyme chalcone synthase (CHS) from Petunia hybrida. During normal plant development only two members of the gene family (CHS-A and CHS-J) are expressed. Their expression is restricted to floral tissues mainly. About 90% of the total CHS mRNA pool is transcribed from CHS-A, wheares CHS-J delivers about 10% in flower corolla, tube and anthers. Expression of CHS-A and CHS-J during flower development is coordinated and (red) light-dependent. In young seedlings and cell suspension cultures expression of CHS-A and CHS-J can be induced with UV light. In addition to CHS-A and CHS-J, expression of another two CHS genes (CHS-B and CHS-G) is induced in young seedlings by UV light, albeit at a low level. In contrast to CHS genes from Leguminoseae, Petunia CHS genes are not inducible by phytopathogen-derived elicitors. Expression of CHS-A and CHS-J is reduced to a similar extent in a regulatory CHS mutant, Petunia hybrida Red Star, suggesting that both genes are regulated by the same trans-acting factors. Comparison of the promoter sequences of CHS-A and CHS-J reveals some striking homologies, which might represent cis-acting regulatory sequences. (author)
International Nuclear Information System (INIS)
Bruns, B.; Hahlbrock, K.; Schäfer, E.
1986-01-01
The fluence dependence of the time course of accumulation of chalcone synthase mRNA in ultraviolet (UV)-light-irradiated cell suspension cultures of parsley (Petroselinum crispum) and the additional effects of blue and far-red light have been investigated. Variations of the UV fluence had no detectable influence on the initial rate of increase in mRNA amount or translational activity, nor on the preceding lag period of approximately 3 h, but strongly influenced the duration of the transient increase. The effects were the same whether the fluence rate or the time of irradiation was varied to obtain a given fluence. Blue-light pretreatment of the cells resulted in increased amounts of mRNA and abolished the apparent lag period. This effect remained cryptic without the subsequent UV-light treatment. Irradiation with long-wavelength far-red light following UV-light pulses shortened the duration of the mRNA accumulation period. This effect was not altered by a preceding blue-light treatment. Thus, three photoreceptors, a UV-B receptor, a blue-light receptor and phytochrome, participate in the regulation of chalcone synthase mRNA accumulation in this system
Directory of Open Access Journals (Sweden)
Caroline J. Sepiol
2017-12-01
Full Text Available Soybean (Glycine max [L.] Merr is one of the main grain legumes worldwide. Soybean farmers lose billions of dollars’ worth of yield annually due to root and stem rot disease caused by the oomycete Phytophthora sojae. Many strategies have been developed to combat the disease, however, these methods have proven ineffective in the long term. A more cost effective and durable approach is to select a trait naturally found in soybean that can increase resistance. One such trait is the increased production of phytoalexin glyceollins in soybean. Glyceollins are isoflavonoids, synthesized via the legume-specific branch of general phenylpropanoid pathway. The first key enzyme exclusively involved in glyceollin synthesis is chalcone reductase (CHR which coacts with chalcone synthase for the production of isoliquiritigenin, the precursor for glyceollin biosynthesis. Here we report the identification of 14 putative CHR genes in soybean where 11 of them are predicted to be functional. Our results show that GmCHRs display tissue-specific gene expression, and that only root-specific GmCHRs are induced upon P. sojae infection. Among 4 root-specific GmCHRs, GmCHR2A is located near a QTL that is linked to P. sojae resistance suggesting GmCHR2A as a novel locus for partial resistance that can be utilized for resistance breeding.
Analysis of the parsley chalcone-synthase promoter in response to different light qualities
International Nuclear Information System (INIS)
Merkle, T.; Frohnmeyer, H.; Schulze-Lefert, P.; Dangl, J.L.; Hahlbrock, K.; Schaefer, E.
1994-01-01
We examined the chalcone synthase (chs) promoter from parsley [Petroselinum crispum Miller (A.W. Hill)] for the existence of separate promoter elements responsible for transcriptional activation of the chs gene by UV-B and by blue light. A combination of in-vivo foot-printing in parsley cells and light-induced transient expression assays with different chs promoter constructs in parsley protoplasts was used. Dark controls and blue-light-irradiated cells gave identical in-vivo footprints on the chs promoter. Pre-irradiation with blue light prior to a UV-B-light pulse is known to cause a shift in the timing of UV-B-light-induced increase in chs transcription rates. This shift was also manifested on the DNA template, since UV-B-light-induced in-vivo footprints in cells pretreated with blue light were detected earlier than in cells which had been irradiated with a UV-B-light pulse only. Although there was a clear shift in the timing of footprint appearance, the patterns of foot printing did not change. Light-induced transient-expression assays revealed that the shortest tested chs promoter which retained any light responsiveness, was sufficient for mediating both induction by UV light and the blue-light-mediated kinetic shift. These findings argue against a spatial separation of UV-B- and blue-light-responsive elements on the chs promoter. We interpret these data by postulating that the signal transduction pathways originating from the excitation of UV-B- and blue-light receptors merge at the chs promoter, or somewhere between light perception and protein-DNA interaction. (author)
Kasai, Megumi; Matsumura, Hideo; Yoshida, Kentaro; Terauchi, Ryohei; Taneda, Akito; Kanazawa, Akira
2013-01-30
Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these silencing systems especially in the
Chalcone synthase genes from milk thistle (Silybum marianum)
Indian Academy of Sciences (India)
... the identification of encoding genes in milk thistle plant can be of great importance. In the current research, fragments of genes were amplified using degenerate primers based on the conserved parts of Asteraceae genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced ...
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Chalcone synthase genes from milk thistle (Silybum marianum ...
Indian Academy of Sciences (India)
In the current research, fragments of CHS genes were amplified ... transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the ..... First strand cDNA was amplified by 1 μg of.
Schneider, Lizette M; Adamski, Nikolai M; Christensen, Caspar Elo; Stuart, David B; Vautrin, Sonia; Hansson, Mats; Uauy, Cristobal; von Wettstein-Knowles, Penny
2016-03-09
Aliphatic compounds on plant surfaces, called epicuticular waxes, are the first line of defense against pathogens and pests, contribute to reducing water loss and determine other important phenotypes. Aliphatics can form crystals affecting light refraction, resulting in a color change and allowing identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase and Cer-u is a P450 enzyme. All were highly expressed in pertinent leaf sheath tissue of wild type. A physical map revealed the order Cer-c, Cer-u, Cer-q with the flanking genes 101kb apart, confirming they are a gene cluster, Cer-cqu. Homology-based modeling suggests that many of the mutant alleles affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
The Tomato Terpene Synthase Gene Family1[W][OA
Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran
2011-01-01
Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655
Polyketide synthases from poison hemlock (Conium maculatum L.).
Hotti, Hannu; Seppänen-Laakso, Tuulikki; Arvas, Mikko; Teeri, Teemu H; Rischer, Heiko
2015-11-01
Coniine is a toxic alkaloid, the biosynthesis of which is not well understood. A possible route, supported by evidence from labelling experiments, involves a polyketide formed by the condensation of one acetyl-CoA and three malonyl-CoAs catalysed by a polyketide synthase (PKS). We isolated PKS genes or their fragments from poison hemlock (Conium maculatum L.) by using random amplification of cDNA ends (RACE) and transcriptome analysis, and characterized three full-length enzymes by feeding different starter-CoAs in vitro. On the basis of our in vitro experiments, two of the three characterized PKS genes in poison hemlock encode chalcone synthases (CPKS1 and CPKS2), and one encodes a novel type of PKS (CPKS5). We show that CPKS5 kinetically favours butyryl-CoA as a starter-CoA in vitro. Our results suggest that CPKS5 is responsible for the initiation of coniine biosynthesis by catalysing the synthesis of the carbon backbone from one butyryl-CoA and two malonyl-CoAs. © 2015 FEBS.
Directory of Open Access Journals (Sweden)
Ikuro eAbe
2012-03-01
Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.
Beta-Glucan Synthase Gene Expression in Pleurotus sp
International Nuclear Information System (INIS)
Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)
International Nuclear Information System (INIS)
Strid, A.
1993-01-01
Alterations in the amounts of mRNA for different types of defence genes after exposure of peas to supplementary ultraviolet-B radiation are demonstrated. The expression of the genes which encode the chalcone synthase of the flavonoid biosynthetic pathway and glutathione reductase was induced, while a decrease was found for the chloroplastic radical-scavenging enzyme, superoxide dismutase. (author)
Sequence analysis of cereal sucrose synthase genes and isolation ...
African Journals Online (AJOL)
SERVER
2007-10-18
Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.
Wang, Yu; Dou, Ying; Wang, Rui; Guan, Xuelian; Hu, Zenghui; Zheng, Jian
2017-11-30
The flower color of Syringa oblata Lindl., which is often modulated by the flavonoid content, varies and is an important ornamental feature. Chalcone synthase (CHS) catalyzes the first key step in the flavonoid biosynthetic pathway. However, little is known about the role of S. oblata CHS (SoCHS) in flavonoid biosynthesis in this species. Here, we isolate and analyze the cDNA (SoCHS1) that encodes CHS in S. oblata. We also sought to analyzed the molecular characteristics and function of flavonoid metabolism by SoCHS1. We successfully isolated the CHS-encoding genomic DNA (gDNA) in S. oblata (SoCHS1), and the gene structural analysis indicated it had no intron. The opening reading frame (ORF) sequence of SoCHS1 was 1170bp long and encoded a 389-amino acid polypeptide. Multiple sequence alignment revealed that both the conserved CHS active site residues and CHS signature sequence were in the deduced amino acid sequence of SoCHS1. Crystallographic analysis revealed that the protein structure of SoCHS1 is highly similar to that of FnCHS1 in Freesia hybrida. The quantitative real-time polymerase chain reaction (PCR) performed to detect the SoCHS1 transcript expression levels in flowers, and other tissues revealed the expression was significantly correlated with anthocyanin accumulation during flower development. The ectopic expression results of Nicotiana tabacum showed that SoCHS1 overexpression in transgenic tobacco changed the flower color from pale pink to pink. In conclusion, these results suggest that SoCHS1 plays an essential role in flavonoid biosynthesis in S. oblata, and could be used to modify flavonoid components in other plant species. Copyright © 2017. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Ehsan Karimi
2012-11-01
Full Text Available The effect of foliar application of salicylic acid (SA at different concentrations (10−3 M and 10−5 M was investigated on the production of secondary metabolites (flavonoids, chalcone synthase (CHS activity, antioxidant activity and anticancer activity (against breast cancer cell lines MCF-7 and MDA-MB-231 in two varieties of Malaysian ginger, namely Halia Bentong and Halia Bara. The results of high performance liquid chromatography (HPLC analysis showed that application of SA induced the synthesis of anthocyanin and fisetin in both varieties. Anthocyanin and fisetin were not detected in the control plants. Accordingly, the concentrations of some flavonoids (rutin and apigenin decreased significantly in plants treated with different concentrations of SA. The present study showed that SA enhanced the chalcone synthase (CHS enzyme activity (involving flavonoid synthesis and recorded the highest activity value of 5.77 nkat /mg protein in Halia Bara with the 10−5 M SA treatment. As the SA concentration was decreased from 10−3 M to 10−5 M, the free radical scavenging power (FRAP increased about 23% in Halia Bentong and 10.6% in Halia Bara. At a concentration of 350 μg mL−1, the DPPH antioxidant activity recorded the highest value of 58.30%–72.90% with the 10−5 M SA treatment followed by the 10−3 M SA (52.14%–63.66% treatment. The lowest value was recorded in the untreated control plants (42.5%–46.7%. These results indicate that SA can act not only as an inducer but also as an inhibitor of secondary metabolites. Meanwhile, the highest anticancer activity against MCF-7 and MDA-MB-231 cell lines was observed for H. Bara extracts treated with 10−5 M SA with values of 61.53 and 59.88%, respectively. The results suggest that the high anticancer activity in these varieties may be related to the high concentration of potent anticancer components including fisetin and anthocyanin. The results thus indicate that the synthesis of
Directory of Open Access Journals (Sweden)
Wei Sun
Full Text Available Chalcone synthase (CHS catalyzes the first committed step in the flavonoid biosynthetic pathway. In this study, the cDNA (FhCHS1 encoding CHS from Freesia hybrida was successfully isolated and analyzed. Multiple sequence alignments showed that both the conserved CHS active site residues and CHS signature sequence were found in the deduced amino acid sequence of FhCHS1. Meanwhile, crystallographic analysis revealed that protein structure of FhCHS1 is highly similar to that of alfalfa CHS2, and the biochemical analysis results indicated that it has an enzymatic role in naringenin biosynthesis. Moreover, quantitative real-time PCR was performed to detect the transcript levels of FhCHS1 in flowers and different tissues, and patterns of FhCHS1 expression in flowers showed significant correlation to the accumulation patterns of anthocyanin during flower development. To further characterize the functionality of FhCHS1, its ectopic expression in Arabidopsis thaliana tt4 mutants and Petunia hybrida was performed. The results showed that overexpression of FhCHS1 in tt4 mutants fully restored the pigmentation phenotype of the seed coats, cotyledons and hypocotyls, while transgenic petunia expressing FhCHS1 showed flower color alteration from white to pink. In summary, these results suggest that FhCHS1 plays an essential role in the biosynthesis of flavonoid in Freesia hybrida and may be used to modify the components of flavonoids in other plants.
Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B
2015-01-01
A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Significant losses in maize production are due to damage by insects and ear rot fungi. A gene designated as chalcone-isomerase-like, located in a quantitative trait locus for resistance to Fusarium ear rot fungi, was cloned from a Fusarium ear rot resistant inbred and transgenically expressed in mai...
Transcriptome analysis and anthocyanin-related genes in red leaf lettuce.
Zhang, Y Z; Xu, S Z; Cheng, Y W; Ya, H Y; Han, J M
2016-01-29
This study aimed to analyze the transcriptome profile of red lettuce and identify the genes involved in anthocyanin accumulation. Red leaf lettuce is a popular vegetable and popular due to its high anthocyanin content. However, there is limited information available about the genes involved in anthocyanin biosynthesis in this species. In this study, transcriptomes of 15-day-old seedlings and 40-day-old red lettuce leaves were analyzed using an Illuminia HiseqTM 2500 platform. A total of 10.6 GB clean data were obtained and de novo assembled into 83,333 unigenes with an N50 of 1067. After annotation against public databases, 51,850 unigene sequences were identified, among which 46,087 were annotated in the NCBI non-redundant protein database, and 41,752 were annotated in the Swiss-Prot database. A total of 9125 unigenes were mapped into 163 pathways using the Kyoto Encyclopedia of Genes and Genomes database. Thirty-four structural genes were found to cover the main steps of the anthocyanin pathway, including chalcone synthase, chalcone isomerase, flavanone 3-hydroxylase, flavonoid 3'-hydroxylase, flavonoid 3',5'-hydroxylase, dihydroflavonol 4-reductase, and anthocyanidin synthase. Seven MYB, three bHLH, and two WD40 genes, considered anthocyanin regulatory genes, were also identified. In addition, 3607 simple sequence repeat (SSR) markers were identified from 2916 unigenes. This research uncovered the transcriptomic characteristics of red leaf lettuce seedlings and mature plants. The identified candidate genes related to anthocyanin biosynthesis and the detected SSRs provide useful tools for future molecular breeding studies.
Phosphorus starvation induces post-transcriptional CHS gene silencing in Petunia corolla.
Hosokawa, Munetaka; Yamauchi, Takayoshi; Takahama, Masayoshi; Goto, Mariko; Mikano, Sachiko; Yamaguchi, Yuki; Tanaka, Yoshiyuki; Ohno, Sho; Koeda, Sota; Doi, Motoaki; Yazawa, Susumu
2013-05-01
The corolla of Petunia 'Magic Samba' exhibits unstable anthocyanin expression depending on its phosphorus content. Phosphorus deficiency enhanced post-transcriptional gene silencing of chalcone synthase - A in the corolla. Petunia (Petunia hybrida) 'Magic Samba' has unstable red-white bicolored corollas that respond to nutrient deficiency. We grew this cultivar hydroponically using solutions that lacked one or several nutrients to identify the specific nutrient related to anthocyanin expression in corolla. The white area of the corolla widened under phosphorus (P)-deficient conditions. When the P content of the corolla grown under P-deficient conditions dropped to 40 corollas until the plants died. Other elemental deficiencies had no clear effects on anthocyanin suppression in the corolla. After phosphate was resupplied to the P-deficient plants, anthocyanin was restored in the corollas. The expression of chalcone synthase-A (CHS-A) was suppressed in the white area that widened under P-suppressed conditions, whereas the expression of several other genes related to anthocyanin biosynthesis was enhanced more in the white area than in the red area. Reddish leaves and sepals developed under the P-deficient condition, which is a typical P-deficiency symptom. Two genes related to anthocyanin biosynthesis were enhanced in the reddish organs. Small interfering RNA analysis of CHS-A showed that the suppression resulted from post-transcriptional gene silencing (PTGS). Thus, it was hypothesized that the enhancement of anthocyanin biosynthetic gene expression due to P-deficiency triggered PTGS of CHS-A, which resulted in white corolla development.
Toxicity Assessments of Chalcone and Some Synthetic Chalcone Analogues in a Zebrafish Model
Directory of Open Access Journals (Sweden)
Ya-Ting Lee
2014-01-01
Full Text Available The aim of this study was to investigate the in vivo toxicities of some novel synthetic chalcones. Chalcone and four chalcone analogues 1a–d were evaluated using zebrafish embryos following antibody staining to visualize their morphological changes and muscle fiber alignment. Results showed that embryos treated with 3'-hydroxychalcone (compound 1b displayed a high percentage of muscle defects (96.6%, especially myofibril misalignment. Ultrastructural analysis revealed that compound 1b-treated embryos displayed many muscle defect phenotypes, including breakage and collapse of myofibrils, reduced cell numbers, and disorganized thick (myosin and thin (actin filaments. Taken together, our results provide in vivo evidence of the myotoxic effects of the synthesized chalcone analogues on developing zebrafish embryos.
Endothelial nitric oxide synthase gene polymorphisms associated ...
African Journals Online (AJOL)
STORAGESEVER
2010-05-24
May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.
Directory of Open Access Journals (Sweden)
Tatiana Takahasi Komoto
2015-01-01
Full Text Available Trichophyton rubrum is the most common causative agent of dermatomycoses worldwide, causing infection in the stratum corneum, nails, and hair. Despite the high prevalence of these infections, little is known about the molecular mechanisms involved in the fungal-host interaction, particularly during antifungal treatment. The aim of this work was to evaluate the gene expression of T. rubrum cocultured with keratinocytes and treated with the flavonoid trans-chalcone and the glycoalkaloid α-solanine. Both substances showed a marked antifungal activity against T. rubrum strain CBS (MIC = 1.15 and 17.8 µg/mL, resp.. Cytotoxicity assay against HaCaT cells produced IC50 values of 44.18 to trans-chalcone and 61.60 µM to α-solanine. The interaction of keratinocytes with T. rubrum conidia upregulated the expression of genes involved in the glyoxylate cycle, ergosterol synthesis, and genes encoding proteases but downregulated the ABC transporter TruMDR2 gene. However, both antifungals downregulated the ERG1 and ERG11, metalloprotease 4, serine proteinase, and TruMDR2 genes. Furthermore, the trans-chalcone downregulated the genes involved in the glyoxylate pathway, isocitrate lyase, and citrate synthase. Considering the urgent need for more efficient and safer antifungals, these results contribute to a better understanding of fungal-host interactions and to the discovery of new antifungal targets.
PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila
International Nuclear Information System (INIS)
Enan, M. R.; Bashandy, S.A.
2006-01-01
Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)
Characteristics of chalcone isomerase promoter in crabapple leaves ...
African Journals Online (AJOL)
Anthocyanins are secondary metabolites found in higher plants that contribute to the colors of plants and chalcone isomerase (CHI) is one of the key enzymes in anthocyanin biosynthetic pathway. What characteristic is CHI promoter known as the regulation sequence of CHI gene, has been rarely investigated. We isolated A ...
Chalcone: A Privileged Structure in Medicinal Chemistry.
Zhuang, Chunlin; Zhang, Wen; Sheng, Chunquan; Zhang, Wannian; Xing, Chengguo; Miao, Zhenyuan
2017-06-28
Privileged structures have been widely used as an effective template in medicinal chemistry for drug discovery. Chalcone is a common simple scaffold found in many naturally occurring compounds. Many chalcone derivatives have also been prepared due to their convenient synthesis. These natural products and synthetic compounds have shown numerous interesting biological activities with clinical potentials against various diseases. This review aims to highlight the recent evidence of chalcone as a privileged scaffold in medicinal chemistry. Multiple aspects of chalcone will be summarized herein, including the isolation of novel chalcone derivatives, the development of new synthetic methodologies, the evaluation of their biological properties, and the exploration of the mechanisms of action as well as target identification. This review is expected to be a comprehensive, authoritative, and critical review of the chalcone template to the chemistry community.
Directory of Open Access Journals (Sweden)
Shicheng Zhao
2014-10-01
Full Text Available Kenaf (Hibiscus cannabinus is cultivated worldwide for its fiber; however, the medicinal properties of this plant are currently attracting increasing attention. In this study, we investigated the expression levels of genes involved in the biosynthesis of kaempferitrin, a compound with many biological functions, in different kenaf organs. We found that phenylalanine ammonia lyase (HcPAL was more highly expressed in stems than in other organs. Expression levels of cinnamate 4-hydroxylase (HcC4H and 4-coumarate-CoA ligase (Hc4CL were highest in mature leaves, followed by stems and young leaves, and lowest in roots and mature flowers. The expression of chalcone synthase (HcCHS, chalcone isomerase (HcCHI, and flavone 3-hydroxylase (HcF3H was highest in young flowers, whereas that of flavone synthase (HcFLS was highest in leaves. An analysis of kaempferitrin accumulation in the different organs of kenaf revealed that the accumulation of this compound was considerably higher (>10-fold in leaves than in other organs. On the basis of a comparison of kaempferitrin contents with the expression levels of different genes in different organs, we speculate that HcFLS plays an important regulatory role in the kaempferitrin biosynthetic pathway in kenaf.
Zhao, Shicheng; Li, Xiaohua; Cho, Dong Ha; Arasu, Mariadhas Valan; Al-Dhabi, Naif Abdullah; Park, Sang Un
2014-10-23
Kenaf (Hibiscus cannabinus) is cultivated worldwide for its fiber; however, the medicinal properties of this plant are currently attracting increasing attention. In this study, we investigated the expression levels of genes involved in the biosynthesis of kaempferitrin, a compound with many biological functions, in different kenaf organs. We found that phenylalanine ammonia lyase (HcPAL) was more highly expressed in stems than in other organs. Expression levels of cinnamate 4-hydroxylase (HcC4H) and 4-coumarate-CoA ligase (Hc4CL) were highest in mature leaves, followed by stems and young leaves, and lowest in roots and mature flowers. The expression of chalcone synthase (HcCHS), chalcone isomerase (HcCHI), and flavone 3-hydroxylase (HcF3H) was highest in young flowers, whereas that of flavone synthase (HcFLS) was highest in leaves. An analysis of kaempferitrin accumulation in the different organs of kenaf revealed that the accumulation of this compound was considerably higher (>10-fold) in leaves than in other organs. On the basis of a comparison of kaempferitrin contents with the expression levels of different genes in different organs, we speculate that HcFLS plays an important regulatory role in the kaempferitrin biosynthetic pathway in kenaf.
Endothelial nitric oxide synthase gene polymorphisms associated ...
African Journals Online (AJOL)
Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...
Directory of Open Access Journals (Sweden)
Mirian Perez Maluf
2009-01-01
Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.
Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance
DEFF Research Database (Denmark)
Huang, Laurence; Crothers, Kristina; Atzori, Chiara
2004-01-01
in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...
A Green Synthesis of Chalcones As an Antioxidant and Anticancer
Susanti VH, Elfi; Agustina Eko Setyowati, Widiastuti
2018-01-01
Three chalcones (4’-amino-4-methoxy chalcone, 4’-amino-3,4-dimethoxy chalcone and 4’-amino-3,4,5-trimethoxy chalcone) has been synthesized by a green chemistry approach using grinding technique. Antioxidant activity of the chalcones were assessed using 1,1-biphenyl-2-picrylhydrazyl (DPPH) radical scavenging method. Cytotoxicity of chalcones sythesized was evaluated using a tetrazolium (MTT) colorimetric assay against cervical cancer cell line, HeLa. The antioxidant activity test showed that 4’-amino-4-methoxy chalcone had a stronger activity than the 4’-amino-3,4-dimethoxy chalcone and 4’-amino-3,4,5-trimethoxy chalcone, respectively with IC50 58.85, 64.79 and 210.3 μg/mL. These results indicate that there is a relationship between the structure of chalcone with antioxidant activity, the more methoxy groups in the ring B of the chalcone, antioxidant activity is getting smaller. The chalcone synthesized showed cytotoxicity against HeLa cell line with IC50 value of 31.75, 36.65, 49.04 μg/mL, respectively. It was observed that the highest cytotoxic activity was found at 4’-amino-4-methoxy chalcone (IC50 31.75 μg/mL). Lower activity was showed by 4’-amino-3,4,5-trimethoxy chalcone with IC50 value of 49,04 μg/mL. There is a relationship cytotoxicity with chalcone structure, the more the number of methoxy groups in ring B chalcone, will decrease the activity of cytotoxicity.
Regulation of Flavonoid Biosynthetic Genes in Germinating Arabidopsis Seedlings.
Kubasek, WL; Shirley, BW; McKillop, A; Goodman, HM; Briggs, W; Ausubel, FM
1992-01-01
Many higher plants, including Arabidopsis, transiently display purple anthocyanin pigments just after seed germination. We observed that steady state levels of mRNAs encoded by four flavonoid biosynthetic genes, PAL1 (encoding phenylalanine ammonia-lyase 1), CHS (encoding chalcone synthase), CHI (encoding chalcone isomerase), and DFR (encoding dihydroflavonol reductase), were temporally regulated, peaking in 3-day-old seedlings grown in continuous white light. Except for the case of PAL1 mRNA, mRNA levels for these flavonoid genes were very low in seedlings grown in darkness. Light induction studies using seedlings grown in darkness showed that PAL1 mRNA began to accumulate before CHS and CHI mRNAs, which, in turn, began to accumulate before DFR mRNA. This order of induction is the same as the order of the biosynthetic steps in flavonoid biosynthesis. Our results suggest that the flavonoid biosynthetic pathway is coordinately regulated by a developmental timing mechanism during germination. Blue light and UVB light induction experiments using red light- and dark-grown seedlings showed that the flavonoid biosynthetic genes are induced most effectively by UVB light and that blue light induction is mediated by a specific blue light receptor. PMID:12297632
Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants
Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE
2007-07-10
Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.
Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako
2009-02-01
Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.
Directory of Open Access Journals (Sweden)
Bechard Matthew E.
2003-01-01
Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.
Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.
2003-01-01
Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.
Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.
Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica
2017-10-01
Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T
2017-01-01
Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.
Directory of Open Access Journals (Sweden)
Yan Yang
2017-04-01
Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.
Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model
Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.
Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants
Energy Technology Data Exchange (ETDEWEB)
Somerville, Chris R.; Scieble, Wolf
2000-10-11
Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
DEFF Research Database (Denmark)
von Wettstein, Penny
2017-01-01
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...
Nitric oxide synthase gene G298 allele
International Nuclear Information System (INIS)
Nagib El-Kilany, Galal E.; Nayel, Ehab; Hazzaa, Sahar
2004-01-01
Background: Nitric oxide (NO) has an important effect on blood pressure, arterial wall, and the basal release of endothelial NO in hypertension (HPN) may be reduced. Until now, there is no solid data revealing the potential role of the polymorphism of the nitric oxide synthase gene (NOS) in patients with HPN and microvascular angina. Aim: The aim of the present study is to investigate the gene of endothelial nitric oxide synthase (eNOS), as the polymorphism of this gene may be a putative candidate for HPN and initiate the process of atherosclerosis. Methods: Sixty participants were recruited for this study; 50 were hypertensive patients complaining of chest pain [30 of them have electrocardiogram (EKG) changes of ischemia], 20 had isolated HPN, and 10 healthy volunteers served as control. All patients underwent stress myocardial perfusion imaging (MPI) and coronary angiography. Genotyping of eNOS for all patients and controls was performed. The linkages between HPN, microvascular angina and eNOS gene polymorphism were investigated. Results: MPI and coronary angiography revealed that 15 patients had chest pain with true ischemia and reversible myocardial perfusion defects (multiple and mild) but normal epicardial coronary arteries (microvascular angina), while 15 patients had significant coronary artery disease (CAD), and 20 hypertensive patients showed normal perfusion scan and coronary angiography. The prevalence of the NOS G 298 allele was higher in the hypertensive group with microvascular angina (documented by MPI) than it was among the control participants (P<.005). The eNOS allele was significantly higher in the hypertensive group than in the control participants, but there was no significant difference in homozygote mutants among hypertensive participants, x-syndrome and patients with CAD. Conclusion: eNOS gene polymorphism is proved to be an important etiology in microvascular angina (x-syndrome) among hypertensive patients. In addition, the eNOS mutant
International Nuclear Information System (INIS)
Schnitzler, J.P.; Jungblut, T.P.; Heller, W.; Köfferlein, M.; Hutzler, P.; Heinzmann, U.; Schmelzer, E.; Ernst, D.; Langebartels, C.; Sandermann, H. Jr.
1996-01-01
Epidermal tissue was isolated from Scots pine (Pinus sylvestris L.) needles by enzymatic digestion in order to study tissue distribution of u.v.-B-screening pigments. Up to 90% of the needle content of a group of diacylated flavonol glycosides that were structurally closely related was found in the epidermal layer. Among these metabolites, 3'',6''-di-para-coumaroyl-isoquercitrin and 3'',6''-di-para-coumaroyl-astragalin were the main u.v.-B-induced compounds in cotyledons and primary needles, respectively. However, catechin and astragalin (kaempferol 3-glucoside), two non-acylated flavonoid metabolites, were only observed in total needle extracts, and at levels independent of u.v.-B treatment. According to this metabolite distribution, the mRNA of chalcone synthase, the key enzyme to flavonoids, was found in epidermal and mesophyll as well as vascular tissues. The major alkaliextractable wall-bound phenolic metabolites, astragalin, 4-coumaric acid, and ferulic acid, a minor component of the cell wall, were also found exclusively in the epidermal layer. These compounds were not stimulated by u.v.-B irradiation within the experimental period. Staining of needle cross sections and epidermal layer preparations with Naturstoffreagenz A confirmed the specific localization of wall-bound astragalin in the outer wall of the epidermal layer. Model calculations of u.v.-B absorptions at 300 nm of soluble and cell-wall-bound metabolites of the epidermal layer revealed an almost complete shielding of the mesophyll tissue from u.v.-B radiation
Chromosomal localization of the human and mouse hyaluronan synthase genes
Energy Technology Data Exchange (ETDEWEB)
Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others
1997-05-01
We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.
The Eucalyptus terpene synthase gene family.
Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J
2015-06-11
Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.
von Wettstein-Knowles, Penny
2017-07-10
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.
Genes up-regulated during red coloration in UV-B irradiated lettuce leaves.
Park, Jong-Sug; Choung, Myoung-Gun; Kim, Jung-Bong; Hahn, Bum-Soo; Kim, Jong-Bum; Bae, Shin-Chul; Roh, Kyung-Hee; Kim, Yong-Hwan; Cheon, Choong-Ill; Sung, Mi-Kyung; Cho, Kang-Jin
2007-04-01
Molecular analysis of gene expression differences between green and red lettuce leaves was performed using the SSH method. BlastX comparisons of subtractive expressed sequence tags (ESTs) indicated that 7.6% of clones encoded enzymes involved in secondary metabolism. Such clones had a particularly high abundance of flavonoid-metabolism proteins (6.5%). Following SSH, 566 clones were rescreened for differential gene expression using dot-blot hybridization. Of these, 53 were found to overexpressed during red coloration. The up-regulated expression of six genes was confirmed by Northern blot analyses. The expression of chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), and dihydroflavonol 4-reductase (DFR) genes showed a positive correlation with anthocyanin accumulation in UV-B-irradiated lettuce leaves; flavonoid 3',5'-hydroxylase (F3',5'H) and anthocyanidin synthase (ANS) were expressed continuously in both samples. These results indicated that the genes CHS, F3H, and DFR coincided with increases in anthocyanin accumulation during the red coloration of lettuce leaves. This study show a relationship between red coloration and the expression of up-regulated genes in lettuce. The subtractive cDNA library and EST database described in this study represent a valuable resource for further research for secondary metabolism in the vegetable crops.
Isolation and expression of the Pneumocystis carinii thymidylate synthase gene
DEFF Research Database (Denmark)
Edman, U; Edman, J C; Lundgren, B
1989-01-01
The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...
African Journals Online (AJOL)
Items 7301 - 7350 of 11090 ... Vol 10, No 8 (2011), Molecular characterization and expression analysis of chalcone synthase gene during flower development in tree peony (Paeonia suffruticosa), Abstract PDF ... Vol 11, No 72 (2012), Molecular characterization and functional analysis of plant WRKY genes, Abstract PDF.
Overexpression of maize anthocyanin regulatory gene Lc affects rice fertility.
Li, Yuan; Zhang, Tao; Shen, Zhong-Wei; Xu, Yu; Li, Jian-Yue
2013-01-01
Seventeen independent transgenic rice plants with the maize anthocyanin regulatory gene Lc under control of the CaMV 35S promoter were obtained and verified by molecular identification. Ten plants showed red spikelets during early development of florets, and the degenerate florets were still red after heading. Additionally, these plants exhibited intense pigmentation on the surface of the anther and the bottom of the ovary. They were unable to properly bloom and were completely sterile. Following pollination with normal pollen, these plants yielded red caryopses but did not mature normally. QRT-PCR analysis indicated that mRNA accumulation of the CHS-like gene encoding a chalcone synthase-related protein was increased significantly in the sterile plant. This is the first report to suggest that upregulation of the CHS gene expression may result in rice sterility and affect the normal development of rice seeds.
Energy Technology Data Exchange (ETDEWEB)
Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)
2014-03-07
Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.
International Nuclear Information System (INIS)
Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko
2014-01-01
Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes
Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un
2016-12-01
Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.
RNAi: A Novel Approach for Plant Disease Management
African Journals Online (AJOL)
Shahnawaz
2013-05-01
May 1, 2013 ... purple colour by introducing a chalcone synthase gene in. Petunia under a strong promoter. Contrary to their expectations, the pigmentation in the flowers of transformed plants was not enhanced. Instead, the flowers were de-pigmented and endogenous gene mRNA transcript levels were greatly reduced ...
A New Geranylated Chalcone from Andrographis lobelioides.
Sumalatha, Manne; Rammohan, Aluru; Gunasekar, Duvvuru; Deville, Alexandre; Bodo, Bernard
2016-01-01
A new O-geranylated chalcone, 2'-hydroxy-2-methoxy-4'-O-[(E)-3,7-dimethyl-2,6-octadienyl] chalcone (1), together with three known flavones, 5-hydroxy-7,2'-dimethoxyflavone (2), skullcapflavone I (3) and echioidin (4), were isolated from the leaves of Andrographis lobelioides. The structure of 1 and the known compounds (2-4) were achieved by extensive 1D and 2D NMR spectral and chemical studies.
Energy Technology Data Exchange (ETDEWEB)
Nicholas C Carpita
2009-04-20
Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.
Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A
2015-12-01
Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Energy Technology Data Exchange (ETDEWEB)
Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin; Kato, Ryohei [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Wanibuchi, Kiyofumi; Noguchi, Hiroshi [School of Pharmaceutical Sciences, University of Shizuoka and the COE21 Program, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro [School of Pharmaceutical Sciences, University of Shizuoka and the COE21 Program, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)
2007-07-01
An acridone-producing novel type III polyketide synthase from H. serrata has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.0 Å. Polyketide synthase 1 (PKS1) from Huperzia serrata is a plant-specific type III polyketide synthase that shows an unusually versatile catalytic potential, producing various aromatic tetraketides, including chalcones, benzophenones, phlorogulucinols and acridones. Recombinant H. serrata PKS1 expressed in Escherichia coli was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 73.3, b = 85.0, c = 137.7 Å, α = β = γ = 90.0°. Diffraction data were collected to 2.0 Å resolution using synchrotron radiation at BL24XU of SPring-8.
Directory of Open Access Journals (Sweden)
Manasi Jiwrajka
2016-01-01
Full Text Available Chalcones are plant metabolites with potential for therapeutic exploitation as antioxidant, anti-inflammatory, and antiproliferative agents. Here we explored the neuroprotective effects of 2,2′,5′-trihydroxychalcone (225THC, a potent antioxidant with radical-scavenging properties. 225THC was found to be a potent inhibitor of apoptosis in stimulated primary rat neuronal cultures. This was likely mediated by an anti-inflammatory effect on microglial cells since 225THC inhibited LPS-stimulated TNF-α and IL-6 secretion from primary rat microglia and modulated the cytokine/chemokine profile of BV2 microglial cells. Additionally, 225THC inhibited LPS-evoked inducible nitric oxide synthase expression but did not influence endogenous superoxide generation. Microglial flow cytometric analyses indicated the 225THC treatment induced a shift from an M1-like phenotype to a more downregulated microglial profile. Taken together these data suggest that the chalcone 2,2′,5′-trihydroxychalcone can modulate neuroinflammatory activation in brain-derived microglia and holds promise as a therapeutic in neuroinflammatory conditions.
Cloning and characterization of ATP synthase CF1 α gene from ...
African Journals Online (AJOL)
ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...
Directory of Open Access Journals (Sweden)
Vannozzi Alessandro
2012-08-01
Full Text Available Abstract Background Plant stilbenes are a small group of phenylpropanoids, which have been detected in at least 72 unrelated plant species and accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals. Stilbenes are formed via the phenylalanine/polymalonate-route, the last step of which is catalyzed by the enzyme stilbene synthase (STS, a type III polyketide synthase (PKS. Stilbene synthases are closely related to chalcone synthases (CHS, the key enzymes of the flavonoid pathway, as illustrated by the fact that both enzymes share the same substrates. To date, STSs have been cloned from peanut, pine, sorghum and grapevine, the only stilbene-producing fruiting-plant for which the entire genome has been sequenced. Apart from sorghum, STS genes appear to exist as a family of closely related genes in these other plant species. Results In this study a complete characterization of the STS multigenic family in grapevine has been performed, commencing with the identification, annotation and phylogenetic analysis of all members and integration of this information with a comprehensive set of gene expression analyses including healthy tissues at differential developmental stages and in leaves exposed to both biotic (downy mildew infection and abiotic (wounding and UV-C exposure stresses. At least thirty-three full length sequences encoding VvSTS genes were identified, which, based on predicted amino acid sequences, cluster in 3 principal groups designated A, B and C. The majority of VvSTS genes cluster in groups B and C and are located on chr16 whereas the few gene family members in group A are found on chr10. Microarray and mRNA-seq expression analyses revealed different patterns of transcript accumulation between the different groups of VvSTS family members and between VvSTSs and VvCHSs. Indeed, under certain conditions the transcriptional response of VvSTS and VvCHS genes appears to be
Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.
2003-01-01
Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...
Cocetta, Giacomo; Rossoni, Mara; Gardana, Claudio; Mignani, Ilaria; Ferrante, Antonio; Spinardi, Anna
2015-02-01
Blueberry (Vaccinium corymbosum) is a fruit very much appreciated by consumers for its antioxidant potential and health-promoting traits. Its beneficial potential properties are mainly due to a high content of anthocyanins and their amount can change after elicitation with methyl jasmonate. The aim of this work is to evaluate the changes in expression of several genes, accumulation of phenolic compounds and alterations in antioxidant potential in two different blueberry cultivars ('Duke' and 'Blueray') in response to methyl jasmonate (0.1 mM). Results showed that 9 h after treatment, the expression of phenylalanine ammonium lyase, chalcone synthase and anthocyanidin synthase genes was stimulated more in the 'Blueray' variety. Among the phenols measured an increase was recorded also for epicatechin and anthocyanin concentrations. 'Duke' is a richer sourche of anthocyanins compared to 'Blueray', treatment with methyl jasmonate promoted in 'Blueray' an increase in pigments as well as in the antioxidant potential, especially in fully ripe berries, but treated 'Duke' berries had greater levels, which were not induced by methyl jasmonate treatment. In conclusion, methyl jasmonate was, in some cases, an effective elicitor of phenolic metabolism and gene expression in blueberry, though with different intensity between cultivars. © 2014 Scandinavian Plant Physiology Society.
Annadana, S.; Beekwilder, M.J.; Kuipers, G.; Visser, P.B.; Outchkourov, N.; Pereira, A.; Udayakumar, M.; Jongsma, M.A.
2002-01-01
To attain high transgene expression in petal tissue of ray florets of chrysanthemum an endogenous ubiquitin extension protein (UEP1) promoter was cloned and tested with the β-glucuronidase (GUS) reporter gene. Expression levels were compared with four heterologous promoters: chalcone synthase
Productivity and biochemical properties of green tea in response to ...
Indian Academy of Sciences (India)
The expression of three homologues of the expansin genes, which regulate plant cell growth, and the CsCHS gene encoding a tea chalcone synthase, which critically regulates the biosynthesis of catechols, were induced in germinal leaves of tea plants following treatment with HpaG1–94 or HpaGXooc. Higher levels of ...
Energy Technology Data Exchange (ETDEWEB)
VH, Elfi Susanti, E-mail: elsantivh@yahoo.com; Redjeki, Tri, E-mail: tri-redjeki@yahoo.com [Universitas Sebelas Maret, Ir Sutami 36A Surakarta Indonesia, 57126 (Indonesia); Matsjeh, Sabirin, E-mail: sabirin-mara@yahoo.com; Wahyuningsih, Tutik Dwi, E-mail: mustofajogya@yahoo.co.id [Department of Chemistry FMJPA Universitas Gadjah Mada, Jl Sekip Utara, Yogyakarta Indonesia 55281 (Indonesia); Mustofa, E-mail: tutikdw@hotmail.com [Faculty of Medicine, Universitas Gadjah Mada, Yogyakarta Jl. Sekip Utara Yogyakarta Indonesia, 55281 (Indonesia)
2016-02-08
Four chalcones derivatives have been synthesized from 3,4-dimethoxybenzaldehyde and acetophenone derivatives (2-hydroxy acetophenone, 2,4-dihydroxy acetophenone, 2,5-dihydroxy acetophenone and 2,6-dihydroxy acetophenone). The synthesis of these chalcones were conducted by Claisen-Schmidt condensation using grinding techniques at room temperature in the absence of solvents. The chalcones were prepared by grinding together equivalent amount of the approriate hydroxyacetophenone and 3,4-dimethoxybenzaldehyde in the presence of solid sodium hydroxide. Grinding techniques for synthesis of the chalcones derivatives is simple, efficient and environmentally benign compared to conventional methods. Then, the four chalcones derivatives undergo cyclization reactions to produce four flavones after reacted with iodine. The synthesized compounds were characterized by spectrometry (IR, {sup 1}H-NMR, {sup 13}C-NMR and MS)
International Nuclear Information System (INIS)
Rothenberg, M.; Hanson, M.R.
1988-01-01
A novel ATP synthase subunit 9 gene (atp9) was identified in the mitochondrial genome of a Petunia somatic hybrid line (13-133) which was produced from a fusion between Petunia lines 3688 and 3704. The novel gene was generated by intergenomic recombination between atp9 genes from the two parental plant lines. The entire atp9 coding region is represented on the recombinant gene. Comparison of gene sequences using electrophoresis and autoradiography, indicate that the 5' transcribed region is contributed by an atp9 gene from 3704 and the 3' transcribed region is contributed by an atp9 gene from 3688. The recombinant atp9 gene is transcriptionally active. The location of the 5' and 3' transcript termini are conserved with respect to the parental genes, resulting in the production of hybrid transcripts
Creelman, R A; Tierney, M L; Mullet, J E
1992-06-01
Jasmonic acid (JA) and its methyl ester, methyl jasmonate (MeJA), are plant lipid derivatives that resemble mammalian eicosanoids in structure and biosynthesis. These compounds are proposed to play a role in plant wound and pathogen responses. Here we report the quantitative determination of JA/MeJA in planta by a procedure based on the use of [13C,2H3]MeJA as an internal standard. Wounded soybean (Glycine max [L] Merr. cv. Williams) stems rapidly accumulated MeJA and JA. Addition of MeJA to soybean suspension cultures also increased mRNA levels for three wound-responsive genes (chalcone synthase, vegetative storage protein, and proline-rich cell wall protein) suggesting a role for MeJA/JA in the mediation of several changes in gene expression associated with the plants' response to wounding.
Cascini, Fidelia; Passerotti, Stella; Martello, Simona
2012-04-10
In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw
Directory of Open Access Journals (Sweden)
Yanjing Su
2012-06-01
Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.
Mateeva, Nelly; Eyunni, Suresh V K; Redda, Kinfe K; Ononuju, Ucheze; Hansberry, Tony D; Aikens, Cecilia; Nag, Anita
2017-06-01
Flavonoids, stilbenes, and chalcones are plant secondary metabolites that often possess diverse biological activities including anti-inflammatory, anti-cancer, and anti-viral activities. The wide range of bioactivities poses a challenge to identify their targets. Here, we studied a set of synthetically generated flavonoids and chalcones to evaluate for their biological activity, and compared similarly substituted flavonoids and chalcones. Substituted chalcones, but not flavonoids, showed inhibition of viral translation without significantly affecting viral replication in cells infected with hepatitis C virus (HCV). We suggest that the chalcones used in this study inhibit mammalian target of rapamycin (mTOR) pathway by ablating phosphorylation of ribosomal protein 6 (rps6), and also the kinase necessary for phosphorylating rps6 in Huh7.5 cells (pS6K1). In addition, selected chalcones showed inhibition of growth in Ishikawa, MCF7, and MDA-MB-231 cells resulting an IC 50 of 1-6µg/mL. When similarly substituted flavonoids were used against the same set of cancer cells, we did not observe any inhibitory effect. Together, we report that chalcones show potential for anti-viral and anti-cancer activities compared to similarly substituted flavonoids. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Yong-Zan Wei
Full Text Available Litchi has diverse fruit color phenotypes, yet no research reflects the biochemical background of this diversity. In this study, we evaluated 12 litchi cultivars for chromatic parameters and pigments, and investigated the effects of abscisic acid, forchlorofenron (CPPU, bagging and debagging treatments on fruit coloration in cv. Feizixiao, an unevenly red cultivar. Six genes encoding chalcone synthase (CHS, chalcone isomerase (CHI, flavanone 3-hydroxylase (F3H, dihydroflavonol 4-reductase (DFR, anthocyanidin synthase (ANS and UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT were isolated from the pericarp of the fully red litchi cv. Nuomici, and their expression was analyzed in different cultivars and under the above mentioned treatments. Pericarp anthocyanin concentration varied from none to 734 mg m(-2 among the 12 litchi cultivars, which were divided into three coloration types, i.e. non-red ('Kuixingqingpitian', 'Xingqiumili', 'Yamulong'and 'Yongxing No. 2', unevenly red ('Feizixiao' and 'Sanyuehong' and fully red ('Meiguili', 'Baila', Baitangying' 'Guiwei', 'Nuomici' and 'Guinuo'. The fully red type cultivars had different levels of anthocyanin but with the same composition. The expression of the six genes, especially LcF3H, LcDFR, LcANS and LcUFGT, in the pericarp of non-red cultivars was much weaker as compared to those red cultivars. Their expression, LcDFR and LcUFGT in particular, was positively correlated with anthocyanin concentrations in the pericarp. These results suggest the late genes in the anthocyanin biosynthetic pathway were coordinately expressed during red coloration of litchi fruits. Low expression of these genes resulted in absence or extremely low anthocyanin accumulation in non-red cultivars. Zero-red pericarp from either immature or CPPU treated fruits appeared to be lacking in anthocyanins due to the absence of UFGT expression. Among these six genes, only the expression of UFGT was found significantly correlated
In vitro structure-toxicity relationship of chalcones in human hepatic stellate cells
Zenger, Katharina; Dutta, Subhajit; Wolff, Horst; Genton, Marc G.; Kraus, Birgit
2015-01-01
Xanthohumol (XN), the major prenylated chalcone from hops (Humulus lupulus L.), has received much attention within the last years, due to its multiple pharmacological activities including anti-proliferative, anti-inflammatory, antioxidant, pro-apoptotic, anti-bacterial and anti-adhesive effects. However, there exists a huge number of metabolites and structurally-related chalcones, which can be expected, or are already known, to exhibit various effects on cells. We have therefore analyzed the effects of XN and 18 other chalcones in a panel, consisting of multiple cell-based assays. Readouts of these assays addressed distinct aspects of cell-toxicity, like proliferation, mitochondrial health, cell cycle and other cellular features. Besides known active structural elements of chalcones, like the Michael system, we have identified several moieties that seem to have an impact on specific effects and toxicity in human liver cells in vitro. Based on these observations, we present a structure-toxicity model, which will be crucial to understand the molecular mechanisms of wanted effects and unwanted side-effects of chalcones.
In vitro structure-toxicity relationship of chalcones in human hepatic stellate cells
Zenger, Katharina
2015-07-19
Xanthohumol (XN), the major prenylated chalcone from hops (Humulus lupulus L.), has received much attention within the last years, due to its multiple pharmacological activities including anti-proliferative, anti-inflammatory, antioxidant, pro-apoptotic, anti-bacterial and anti-adhesive effects. However, there exists a huge number of metabolites and structurally-related chalcones, which can be expected, or are already known, to exhibit various effects on cells. We have therefore analyzed the effects of XN and 18 other chalcones in a panel, consisting of multiple cell-based assays. Readouts of these assays addressed distinct aspects of cell-toxicity, like proliferation, mitochondrial health, cell cycle and other cellular features. Besides known active structural elements of chalcones, like the Michael system, we have identified several moieties that seem to have an impact on specific effects and toxicity in human liver cells in vitro. Based on these observations, we present a structure-toxicity model, which will be crucial to understand the molecular mechanisms of wanted effects and unwanted side-effects of chalcones.
Apoptotic effect of chalcone derivatives of 2-acetylthiophene in human breast cancer cells.
Fogaça, Tatiana B; Martins, Rosiane M; Begnini, Karine R; Carapina, Caroline; Ritter, Marina; de Pereira, Claudio M P; Seixas, Fabiana K; Collares, Tiago
2017-02-01
A variety of chalcones have demonstrated cytotoxic activity toward several cancer cell lines. This study aimed to investigate the cytotoxicity of four chalcones derivatives of 2-acetylthiophene in human breast cancer cell lines. MCF-7 and MDA-MB-231 cells were treated with synthesized chalcones and the cytotoxicity was evaluated by tetrazolium dye (MTT), live/dead, and DAPI assays. Chalcones significantly decreased MCF-7 and MDA-MB-231 cells viability in vitro in a dose dependent manner. After 48h treatment, the IC 50 values ranging from 5.52 to 34.23μM. Chalcone 3c displayed the highest cytotoxic activity from all the tested compounds. Cytotoxic effects of compounds were confirmed in the live/dead assay. In addition, DAPI staining revealed that these compounds induce death by apoptosis. The data speculate that chalcone derivatives of 2-acetylthiophene may represent a source of therapeutic agents for human breast cancer. Copyright © 2016 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics. MOHSEN EBRAHIMI. Articles written in Journal of Genetics. Volume 94 Issue 4 December 2015 pp 611-617 Research Article. Chalcone synthase genes from milk thistle (Silybum marianum): isolation and expression analysis · Sepideh Sanjari Zahra Sadat Shobbar Mohsen Ebrahimi ...
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics. YASHBIR S. BEDI. Articles written in Journal of Genetics. Volume 95 Issue 3 September 2016 pp 647-657 RESEARCH ARTICLE. Cloning and expression analysis of chalcone synthase gene from Coleus forskohlii · PRAVEEN AWASTHI VIDUSHI MAHAJAN VIJAY LAKSHMI JAMWAL ...
Alkharouf, Nadim W; Klink, Vincent P; Chouikha, Imed B; Beard, Hunter S; MacDonald, Margaret H; Meyer, Susan; Knap, Halina T; Khan, Rana; Matthews, Benjamin F
2006-09-01
Changes in gene expression within roots of Glycine max (soybean), cv. Kent, susceptible to infection by Heterodera glycines (the soybean cyst nematode [SCN]), at 6, 12, and 24 h, and 2, 4, 6, and 8 days post-inoculation were monitored using microarrays containing more than 6,000 cDNA inserts. Replicate, independent biological samples were examined at each time point. Gene expression was analyzed statistically using T-tests, ANOVA, clustering algorithms, and online analytical processing (OLAP). These analyses allow the user to query the data in several ways without importing the data into third-party software. RT-PCR confirmed that WRKY6 transcription factor, trehalose phosphate synthase, EIF4a, Skp1, and CLB1 were differentially induced across most time-points. Other genes induced across most timepoints included lipoxygenase, calmodulin, phospholipase C, metallothionein-like protein, and chalcone reductase. RT-PCR demonstrated enhanced expression during the first 12 h of infection for Kunitz trypsin inhibitor and sucrose synthase. The stress-related gene, SAM-22, phospholipase D and 12-oxophytodienoate reductase were also induced at the early time-points. At 6 and 8 dpi there was an abundance of transcripts expressed that encoded genes involved in transcription and protein synthesis. Some of those genes included ribosomal proteins, and initiation and elongation factors. Several genes involved in carbon metabolism and transport were also more abundant. Those genes included glyceraldehyde 3-phosphate dehydrogenase, fructose-bisphosphate aldolase and sucrose synthase. These results identified specific changes in gene transcript levels triggered by infection of susceptible soybean roots by SCN.
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-01-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...
Flynn, Christopher M; Schmidt-Dannert, Claudia
2018-06-01
The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide
The antileishmanial activity of novel oxygenated chalcones and their mechanism of action
DEFF Research Database (Denmark)
Zhai, L; Chen, M; Blom, J
1999-01-01
Our previous studies have shown that licochalcone A, an oxygenated chalcone, has antileishmanial and antimalarial activities, and alters the ultrastructure and function of the mitochondria of Leishmania spp. parasites. The present study was designed to investigate the antileishmanial activity...... resulted in a significant reduction of parasite load in the liver and the spleen compared with untreated control animals. The oxygenated chalcones also inhibited the respiration of the parasite and the activity of mitochondrial dehydrogenases. Electron microscopic studies illustrated that they altered...... the ultrastructure of the mitochondria of L. major promastigote. The data clearly indicate that this group of oxygenated chalcones has a strong antileishmanial activity and might be developed into a new antileishmanial drug. The antileishmanial activity of oxygenated chalcones might be the result of interference...
DEFF Research Database (Denmark)
Vestergaard, H; Lund, S; Bjørbaek, C
1995-01-01
We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....
In vitro structure-toxicity relationship of chalcones in human hepatic stellate cells.
Zenger, Katharina; Dutta, Subhajit; Wolff, Horst; Genton, Marc G; Kraus, Birgit
2015-10-02
Xanthohumol (XN), the major prenylated chalcone from hops (Humulus lupulus L.), has received much attention within the last years, due to its multiple pharmacological activities including anti-proliferative, anti-inflammatory, antioxidant, pro-apoptotic, anti-bacterial and anti-adhesive effects. However, there exists a huge number of metabolites and structurally-related chalcones, which can be expected, or are already known, to exhibit various effects on cells. We have therefore analyzed the effects of XN and 18 other chalcones in a panel, consisting of multiple cell-based assays. Readouts of these assays addressed distinct aspects of cell-toxicity, like proliferation, mitochondrial health, cell cycle and other cellular features. Besides known active structural elements of chalcones, like the Michael system, we have identified several moieties that seem to have an impact on specific effects and toxicity in human liver cells in vitro. Based on these observations, we present a structure-toxicity model, which will be crucial to understand the molecular mechanisms of wanted effects and unwanted side-effects of chalcones. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Catalina Sanz
Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.
Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection.
Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming
2016-04-15
The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection. Copyright © 2016 Elsevier Inc. All rights reserved.
SYNTHESIS AND CYTOTOXIC ACTIVITY OF CHALCONE DERIVATIVES ON HUMAN BREAST CANCER CELL LINES
Directory of Open Access Journals (Sweden)
Nuraini Harmastuti
2012-12-01
Full Text Available Chalcone, an α,β-unsaturated ketone, has been shown have many biological activities such as anticancer and antifungi. This research was conducted to synthesize the chalcone derivatives and to obtain their cytotoxic activity on human cervix cancer cell lines. Synthesis of chalcone and its derivatives, 4II-methylchalcone, 4II-methoxychalcone, and 3II,4II-dichlorochalcone was carried out using starting materials of benzaldehide and acetofenon, p-methylacetophenone, p-methoxyacetophenone, as well as m,p-dichloroacetophenone through Claisen Schmidt condensation catalized by NaOH in ethanol at 15 °C. The purity of synthesized compounds were analyzed by thin layer chromatography, melting range, and gas chromatography. Structure elucidations were conducted by UV spectrophotometer, IR spectrometer, 1H-NMR spectrometer, as well as mass spectrometer. Cytotoxic activities were determined by 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT microculture tetrazolium viability assay. The results showed that chalcone and derivatives compounds have been able to be synthesized and purified and had the same structure as a predicted structure. Chalcone had highest cytotoxic activity compared to that of its derivatives, with the IC50 values of chalcone, 4II-methylchalcone, 4II-methoxychalcone, and 3II,4II-dichlorochalcone were 9.49, 14.79, 11.48, and 24.26 µg/mL respectively. It was concluded that methyl, methoxy as well as chlorine substitution at 3 II and 4II position decrease the cytotoxic activity of chalcone.
Solvent-dependent regioselective oxidation of trans-chalcones using aqueous hydrogen peroxide
Energy Technology Data Exchange (ETDEWEB)
Peng, Wang; Jiabin, Yang; Lushen, Li, E-mail: jimin@seu.edu.cn [Southeast University, Nanjing (China). School of Biological Science and Medical Engineering; Jin, Cai; Chunlong, Sun; Min, Ji [Southeast University, Nanjing (China). School of Chemistry and Chemical Engineering
2013-03-15
A novel method for regioselective oxidation of trans-chalcones with hydrogen peroxide in acetonitrile to afford cinnamic acids is reported. Only trans-b-arylacrylic acids were observed. A wide range of functionalized products can be effectively produced from various chalcones in good to excellent yields. (author)
DEFF Research Database (Denmark)
Nielsen, S F; Kharazmi, A; Christensen, S B
1998-01-01
Methods for selective alkylation of chalcones in the alpha- or beta-position and for selective reduction of the alpha,beta-double bond have been developed. The antiparasitic potencies of the alpha,beta-double bond modified chalcones only differ marginally from the potencies of the parent chalcones...
Directory of Open Access Journals (Sweden)
R. Vasudevan
2014-06-01
Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.
Directory of Open Access Journals (Sweden)
Xiudao Yu
2013-10-01
Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.
Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine
2013-03-01
Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.
Boris, K V; Kochieva, E Z; Kudryavtsev, A M
2014-12-01
The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.
Design and synthesis of chalcone-based macrocyclic polyethers
Directory of Open Access Journals (Sweden)
Subrata Jana
2015-12-01
Full Text Available A series of chalcone-based macrocyclic ethers have been synthesized. These macrocyclic ethers contain polyether as well as extended conjugation to the benzene ring to function as fluorescent sensor for cations. The modeling studies show that the chalcone part of the receptors remains partially out of plane from the polyether part and the keto moiety of the receptors always directed outwardly in the receptor itself. This may be changed during the recognition of metal ions. The tendency of the fluorophore, to be out of plane, increases with increasing the ring size.
Directory of Open Access Journals (Sweden)
Kaili Chen
2017-06-01
Full Text Available Anthocyanins are responsible for the different colors of ornamental plants. Grape hyacinth (Muscari armeniacum, a monocot plant with bulbous flowers, is popular for its fascinating blue color. In the present study, we functionally characterized an R2R3-MYB transcription factor gene MaAN2 from M. armeniacum. Our results indicated that MaAN2 participates in controlling anthocyanin biosynthesis. Sequence alignment and phylogenetic analysis suggested that MaAN2 belonged to the R2R3-MYB family AN2 subgroup. The anthocyanin accumulation of grape hyacinth flowers was positively correlated with the expression of MaAN2. And the transcriptional expression of MaAN2 was also consistent with that of M. armeniacum dihydroflavonol 4-reductase (MaDFR and M. armeniacum anthocyanidin synthase (MaANS in flowers. A dual luciferase transient expression assay indicated that when MaAN2 was co-inflitrated with Arabidopsis thaliana TRANSPARENT TESTA8 (AtTT8, it strongly activated the promoters of MaDFR and MaANS, but not the promoters of M. armeniacum chalcone synthase (MaCHS, M. armeniacum chalcone isomerase (MaCHI, and M. armeniacum flavanone 3-hydroxylase (MaF3H. Bimolecular fluorescence complementation assay confirmed that MaAN2 interacted with AtTT8 in vivo. The ectopic expression of MaAN2 in Nicotiana tabacum resulted in obvious red coloration of the leaves and much redder flowers. Almost all anthocyanin biosynthetic genes were remarkably upregulated in the leaves and flowers of the transgenic tobacco, and NtAn1a and NtAn1b (two basic helix–loop–helix anthocyanin regulatory genes were highly expressed in the transformed leaves, compared to the empty vector transformants. Collectively, our results suggest that MaAN2 plays a role in anthocyanin biosynthesis.
IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT
Directory of Open Access Journals (Sweden)
Mariateresa eVolpicella
2016-03-01
Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.
[Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].
Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V
2014-01-01
Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.
Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne
2004-01-01
The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...
Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W
2012-06-01
Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.
Directory of Open Access Journals (Sweden)
Piotr Szymczyk
2016-09-01
Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.
DEFF Research Database (Denmark)
Bernal Giraldo, Adriana Jimena; Yoo, Cheol-Min; Mutwil, Marek
2008-01-01
A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from that pre......A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from...... for insertions in these genes were partially rescued by reduced temperature growth. However, this was not the case for a double mutant homozygous for insertions in both CSLD2 and CSLD3, suggesting that there may be partial redundancy in the functions of these genes. Mutants in CSLD1 and CSLD4 had a defect...
Cloning and expression analysis of chalcone synthase gene from ...
Indian Academy of Sciences (India)
Expression analysis of CfCHS in different tissues and elicitor treatments showed that methyl jasmonate ... Journal of Genetics, DOI 10.1007/s12041-016-0680-8, Vol. 95, No. ... leaf of C. forskohlii. Quantitative real time RT-PCR was used ..... SGG acknowledges the financial support for this work from CSIR. 12th FYP project ...
Directory of Open Access Journals (Sweden)
Zamri Zainal
2012-02-01
Full Text Available P. minus is an aromatic plant, the leaf of which is widely used as a food additive and in the perfume industry. The leaf also accumulates secondary metabolites that act as active ingredients such as flavonoid. Due to limited genomic and transcriptomic data, the biosynthetic pathway of flavonoids is currently unclear. Identification of candidate genes involved in the flavonoid biosynthetic pathway will significantly contribute to understanding the biosynthesis of active compounds. We have constructed a standard cDNA library from P. minus leaves, and two normalized full-length enriched cDNA libraries were constructed from stem and root organs in order to create a gene resource for the biosynthesis of secondary metabolites, especially flavonoid biosynthesis. Thus, large‑scale sequencing of P. minus cDNA libraries identified 4196 expressed sequences tags (ESTs which were deposited in dbEST in the National Center of Biotechnology Information (NCBI. From the three constructed cDNA libraries, 11 ESTs encoding seven genes were mapped to the flavonoid biosynthetic pathway. Finally, three flavonoid biosynthetic pathway-related ESTs chalcone synthase, CHS (JG745304, flavonol synthase, FLS (JG705819 and leucoanthocyanidin dioxygenase, LDOX (JG745247 were selected for further examination by quantitative RT-PCR (qRT-PCR in different P. minus organs. Expression was detected in leaf, stem and root. Gene expression studies have been initiated in order to better understand the underlying physiological processes.
Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong
2016-02-10
In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. Copyright © 2015 Elsevier B.V. All rights reserved.
Synthesis and Biological Evaluation of Some New Chalcones Containing 2,5-Dimethylfuran Moiety
Directory of Open Access Journals (Sweden)
S. Sridhar
2011-01-01
Full Text Available A series of new chalcones (3a-g were prepared by Claisen-Schmidt condensation of 3-acetyl-2,5-dimethylfuran with various substituted aromatic aldehydes in presence of aqueous solution of potassium hydroxide and ethanol at room temperature. The synthesized chalcones were characterized by means of their IR, 1H NMR spectral data and elemental analyses. When these chalcones were evaluated for antimicrobial and anti-inflammatory activities, some of them were found to possess significant activity, when compared to standard drugs.
International Nuclear Information System (INIS)
Tsurudome, Koji; Tokizawa, Takayuki
2000-05-01
The method of evaluating genetic effects and the measuring method of radiation dose distribution were studied. DNA was extracted from the arabidopsis thaliana (L.) Heynh (A. thaliana) grow in mine soil. The sequence of chalcone synthase gene and cinnamate-4-hydroxylase gene were analysed. No gene mutation was observed. Radiation dose distribution was studied by using x-ray films and imaging plates. No biologically concentrated region was observed in plants. (A. Yamamoto)
Directory of Open Access Journals (Sweden)
Mariela V Catone
Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.
Chalcones from Chinese liquorice inhibit proliferation of T cells and production of cytokines
DEFF Research Database (Denmark)
Barfod, Lea; Kemp, Kåre; Hansen, Majbritt
2002-01-01
Licochalcone A (LicA), an oxygenated chalcone, has been shown to inhibit the growth of both parasites and bacteria. In this study, we investigated the effect of LicA and four synthetic analogues on the activity of human peripheral blood mononuclear cell proliferation and cytokine production. Four...... out of five chalcones tested inhibited the proliferation of lymphocytes measured by thymidine incorporation and by flow cytometry. The production of pro- and anti-inflammatory cytokines from monocytes and T cells was also inhibited by four of five chalcones. Furthermore, intracellular detection...... of cytokines revealed that the chalcones inhibited the production rather than the release of the cytokines. Taken together, these results indicate that LicA and some analogues may have immunomodulatory effects, and may thus be candidates not only as anti-microbial agents, but also for the treatment of other...
Directory of Open Access Journals (Sweden)
Monika Mahajan
Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless
Semi-synthesis and NMR spectral assignments of flavonoid and chalcone derivatives.
Kumar, Rohitesh; Lu, Yuting; Elliott, Alysha G; Kavanagh, Angela M; Cooper, Matthew A; Davis, Rohan A
2016-11-01
Previous investigations of the aerial parts of the Australian plant Eremophila microtheca and Syzygium tierneyanum resulted in the isolation of the antimicrobial flavonoid jaceosidin (4) and 2',6'-dihydroxy-4'-methoxy-3',5'-dimethyl chalcone (7), respectively. In this current study, compounds 4 and 7 were derivatized by acetylation, pivaloylation, and methylation reactions. The final products, 5,7,4'-triacetoxy jaceosidin (10), 5,7,4'-tripivaloyloxy jaceosidin (11), 5,7,4'-trimethoxy jaceosidin (12), 2',6'-diacetoxy-4'-methoxy-3',5'-dimethyl chalcone (13), 2'-hydroxy-4'-methoxy-6'-pivaloyloxy-3',5'-dimethyl chalcone (14), and 2'-hydroxy-4',6'-dimethoxy-3',5'-dimethyl chalcone (15) were all fully characterized by NMR and MS. Derivatives 10 and 13 have been previously reported but were only partially characterized. This is the first reported synthesis of 11 and 14. The natural products and their derivatives were evaluated for their antibacterial and antifungal properties, and the natural product, jaceosidin (4) and the acetylated derivative, 5,7,4'-triacetoxy jaceosidin (10), showed modest antibacterial activity (32-128 µg/ml) against Staphylococcus aureus strains. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing
2016-03-01
Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Bua-In Saowaluck
2014-01-01
Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.
Directory of Open Access Journals (Sweden)
Leila ePazouki
2015-03-01
Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.
Galinousky, Dmitry; Padvitski, Tsimafei; Bayer, Galina; Pirko, Yaroslav; Pydiura, Nikolay; Anisimova, Natallia; Nikitinskaya, Tatyana; Khotyleva, Liubov; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav
2017-08-09
Fiber flax is an important source of natural fiber and a comprehensive model for the plant fiber biogenesis studies. Cellulose-synthase (CesA) and cytoskeletal genes are known to be important for the cell wall biogenesis in general and for the biogenesis of flax fibers in particular. Currently, knowledge about activity of these genes during the plant growth is limited. In this study, we have investigated flax fiber biogenesis by measuring expression of CesA and cytoskeletal genes at two stages of the flax development (seedlings and stems at the rapid growth stage) in several flax subspecies (elongatum, mediterraneum, crepitans). RT-qPCR has been used to quantify the expression of LusСesA1, LusСesA4, LusСesA7, LusСesA6, Actin, and α-Tubulin genes in plant samples. We report that CesA genes responsible for the secondary cell wall synthesis (LusCesA4, LusCesA7) have different expression pattern compared with CesA genes responsible for the primary cell wall synthesis (LusCesA1, LusCesA6): an average expression of LusCesA4 and LusCesA7 genes is relatively high in seedlings and further increases in stems at the rapid growth stage, whereas an average expression of LusCesA1 and LusCesA6 genes decreases. Interestingly, LusCesA1 is the only studied gene with different expression dynamics between the flax subspecies: its expression decreases by 5.2-10.7 folds in elongatum and mediterraneum but does not change in crepitans subspecies when the rapid growth stage and seedlings are compared. The expression of cytoskeleton genes (coding actin and α-tubulin) is relatively stable and significantly higher than the expression of cellulose-synthase genes in all the studied samples. © 2017 International Federation for Cell Biology.
Novel chalcone-based fluorescent human histamine H3 receptor ligands as pharmacological tools
Directory of Open Access Journals (Sweden)
Holger eStark
2012-03-01
Full Text Available Novel fluorescent chalcone-based ligands at human histamine H3 receptors (hH3R have been designed, synthesized and characterized. Compounds described are non-imidazole analogues of ciproxifan with a tetralone motif. Tetralones as chemical precursors and related fluorescent chalcones exhibit affinities at hH3R in the same concentration range like that of the reference antagonist ciproxifan (hH3R pKi value of 7.2. Fluorescence characterization of our novel ligands shows emission maxima about 570 nm for yellow fluorescent chalcones and ≥600 nm for the red fluorescent derivatives. Interferences to cellular autofluorescence could be excluded. All synthesized chalcone compounds could be taken to visualize hH3R proteins in stably transfected HEK-293 cells using confocal laser scanning fluorescence microscopy. These novel fluorescent ligands possess high potential to be used as pharmacological tools for hH3R visualization in different tissues.
Xie, Yang; Zhang, Wei; Wang, Yan; Xu, Liang; Zhu, Xianwen; Muleke, Everlyne M; Liu, Liwang
2016-09-01
Microsporogenesis is an indispensable period for investigating microspore development and cytoplasmic male sterility (CMS) occurrence. Radish CMS line plays a critical role in elite F1 hybrid seed production and heterosis utilization. However, the molecular mechanisms of microspore development and CMS occurrence have not been thoroughly uncovered in radish. In this study, a comparative analysis of radish floral buds from a CMS line (NAU-WA) and its maintainer (NAU-WB) was conducted using next generation sequencing (NGS) technology. Digital gene expression (DGE) profiling revealed that 3504 genes were significantly differentially expressed between NAU-WA and NAU-WB library, among which 1910 were upregulated and 1594 were downregulated. Gene ontology (GO) analysis showed that these differentially expressed genes (DEGs) were mainly enriched in extracellular region, catalytic activity, and response to stimulus. KEGG enrichment analysis revealed that the DEGs were predominantly associated with flavonoid biosynthesis, glycolysis, and biosynthesis of secondary metabolites. Real-time quantitative PCR analysis showed that the expression profiles of 13 randomly selected DEGs were in high agreement with results from Illumina sequencing. Several candidate genes encoding ATP synthase, auxin response factor (ARF), transcription factors (TFs), chalcone synthase (CHS), and male sterility (MS) were responsible for microsporogenesis. Furthermore, a schematic diagram for functional interaction of DEGs from NAU-WA vs. NAU-WB library in radish plants was proposed. These results could provide new information on the dissection of the molecular mechanisms underlying microspore development and CMS occurrence in radish.
An Update on Antitumor Activity of Naturally Occurring Chalcones
Directory of Open Access Journals (Sweden)
En-Hui Zhang
2013-01-01
Full Text Available Chalcones, which have characteristic 1,3-diaryl-2-propen-1-one skeleton, are mainly produced in roots, rhizomes, heartwood, leaves, and seeds of genera Angelica, Sophora, Glycyrrhiza, Humulus, Scutellaria, Parartocarpus, Ficus, Dorstenia, Morus, Artocarpus, and so forth. They have become of interest in the research and development of natural antitumor agents over the past decades due to their broad range of mechanisms including anti-initiation, induction of apoptosis, antiproliferation, antimetastasis, antiangiogenesis, and so forth. This review summarizes the studies on the antitumor activity of naturally occurring chalcones and their underlying mechanisms in detail during the past decades.
Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao
2011-10-01
Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.
Holler, Jes Gitz; Slotved, Hans-Christian; Mølgaard, Per; Olsen, Carl Erik; Christensen, Søren Brøgger
2012-07-15
A library of 117 chalcones was screened for efflux pump inhibitory (EPI) activity against NorA mediated ethidium bromide efflux. Five of the chalcones (5-7, 9, and 10) were active and two chalcones (9 and 10) were equipotent to reserpine with IC(50)-values of 9.0 and 7.7 μM, respectively. Twenty chalcones were subsequently proved to be inhibitors of the NorA efflux pump in everted membrane vesicles. Compounds 5, 7, and 9 synergistically increased the effect of ciprofloxacin on Staphylococcus aureus. Our results suggest that chalcones might be developed into drugs for overcoming multidrug resistance based on efflux transporters of microorganisms. Copyright © 2012 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Liepman, Aaron H; Nairn, C Joseph; Willats, William G T
2007-01-01
from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...
Directory of Open Access Journals (Sweden)
Gnanasambandan Ramanathan
2017-01-01
Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.
Stompor, Monika; Kałużny, Mateusz; Żarowska, Barbara
2016-10-01
Microbial strains of the genera Dietzia, Micrococcus, Pseudomonas, Rhodococcus, Gordonia, Streptomyces, Pseudomonas, Bacillus, Penicillium, Rhodotorula and Lactobacillus were screened for the ability to convert chalcones. Synthesis of chalcones was performed by the Claisen-Schmidt reaction. There were three groups of chalcones obtained as the products, which included the derivatives containing 4-substituted chalcone, 2'-hydroxychalcone and 4'-methoxychalcone. The B ring of the chalcones was substituted in the para position with different groups, such as halide, hydroxyl, nitro, methyl, ethyl and ethoxy one. The structure-activity relationship of the tested chalcones in biotransformation processes was studied. It has been proven that Gram-positive bacterial strains Rhodococcus and Lactobacillus catalyzed reduction of C=C bond in the chalcones to give respective dihydrochalcones. The strain Rhodotorula rubra AM 82 transformed chalcones into dihydrochalcones and respective secondary alcohols. These results suggest that the probiotic strain of Lactobacillus can be used for biotransformations of chalcones, which has not been described before. The structure of new metabolites 14a and 15b were established as 4-ethoxy-4'-methoxydihydrochalcone and 3-(4-bromophenyl)-1-(4'-O-methylphenyl)-2-propan-1-ol, respectively, which was confirmed by (1)H NMR and (13)C NMR analysis.
Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh
2016-06-01
Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.
Valcarcel, Jesus; Reilly, Kim; Gaffney, Michael; O'Brien, Nora M
2016-02-01
In addition to their high carbohydrate content, potatoes are also an important dietary source of vitamin C and bioactive secondary metabolites, including phenolic compounds and carotenoids, which have been suggested to play a role in human health. The expression of genes encoding key enzymes involved in the synthesis of these compounds was assessed by reverse transcription-quantitative polymerase chain reaction and compared to the accumulation of the corresponding product in seven potato varieties showing contrasting levels of metabolite accumulation. Strong positive correlations were found between phenolic content in the flesh of tubers and transcript levels of phenylalanine ammonia lyase (PAL) and chalcone synthase (CHS) genes. The expression of PAL and CHS was also related to that of AN1, a transcription factor involved in the synthesis of anthocyanins, suggesting that these genes are regulated in a coordinated manner. No clear relationship was found between transcript levels of phytoene synthase (PSY) or L-galactono-1,4-lactone dehydrogenase (GLDH) genes and total carotenoid or vitamin C accumulation, respectively. Data indicate that levels of total phenolic and flavonoid compounds in potato are controlled primarily by PAL and CHS gene expression. Transcript levels of PSY and GLDH did not control accumulation of carotenoids or vitamin C. © 2015 Society of Chemical Industry.
Directory of Open Access Journals (Sweden)
Ismiyarto Ismiyarto
2010-06-01
Full Text Available Synthesis of flavanoid compounds of chalcone and flavanone groups have been conducted. Flavanoid Is one of the group natural products which is mostly found in plants and have been proved to have physiological activity as drug. In this research, chalcone proup compounds that being synthesized are: chalcone, 3,4-dimethoxychalcone, 2'-hidroxy-3,4-dimethoxychalcone where as compound of flavanone group that being synthesized is 3',4'-dimethoxyflavanone. The synthesis of chalcone group are carried out based on Claisen-Schmidt reaction by using raw material of aromatic aldehydes and aromatic ketones. The synthesis in carried out by stirring at the room temperature using alkali solution as catalyst and ethanol as solvent. The synthesis of 3',4'-dimethoxyflanone is made based on the nucleophilic 1,4 addition of the unsaturated α,β ketone. The synthesis is made by refluxing 2'-hydroxy-3,4-dimethoxychalcone in alkali condition for 12 hours. The identification of flavanoid compound is carried out by using spectroscopic IR, GC-MS and 1H-NMR methods. The result of each synthesis chalcone group are follows: chalcone as yellowish solid with m.p= 50 °C and the yield is 83.39%; 3,4-dimethoxychalcone as yellow solid with m.p= 57°C and the yield is 76.00% ; 2'-hydroxy-3,4-dimethoxychalcone as orange solid with m.p= 90 °C and the yield is 74.29%, for 3',4'-dimethoxyflavanone as pale yellow solid with m.p= 80 °C and the yield is 72.00%.
van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.
1991-01-01
Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.
Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori
2016-11-18
Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins. Copyright © 2016 Elsevier Inc. All rights reserved.
Biological and structure-activity evaluation of chalcone derivatives against bacteria and fungi
Energy Technology Data Exchange (ETDEWEB)
Silva, Wender A.; Andrade, Carlos Kleber Z.; Napolitano, Hamilton B., E-mail: wender@unb.br, E-mail: ckleber@unb.br [Universidade de Brasilia (LaQMOS/UnB), DF (Brazil). Inst. de Quimica; Vencato, Ivo; Castro, Miriam R.C. de; Camargo, Ademir J. [Universidade Estadual de Goias (UEG), Anapolis, GO (Brazil). Ciencias Exatas e Tecnologicas; Lariucci, Carlito [Universidade Estadual de Goias (UEG), Goiania, GO (Brazil). Inst. de Fisica
2013-01-15
The present work describes the antibacterial and antifungal activities of several chalcones obtained by a straight Claisen-Schmidt aldol condensation determined by the minimal inhibitory concentration against different microorganisms (Gram-positive and Gram-negative bacteria and fungi). Solid state crystal structures of seven chalcones were determined by X-ray diffraction (XRD) analysis. Chemometric studies were carried out in order to identify a potential structure activity relationship. (author)
Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui
2015-09-01
In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.
Jeknić, Zoran; Morré, Jeffrey T.; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H.H.
2012-01-01
The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-de...
Eungwanichayapant, P D; Popluechai, S
2009-02-01
Catechins are a group of polyphenols found in tea (Camellia sinensis var. sinensis) at high levels. They are beneficial for health. From the study on accumulation of catechins in shoots and mature leaves of a tea cultivar, Oolong No. 17, using high-performance liquid chromatography (HPLC), it was found that the amounts of most catechins in the shoots were higher than those in the mature leaves, with an exception of catechins gallate (CG) that was found in trace amounts in both the shoots and mature leaves. mRNA accumulation of genes involved in catechin synthesis was studied using reverse transcriptase-polymerase chain reaction (RT-PCR). The results showed that the mRNA accumulation of the genes were higher in the shoots than in the mature leaves. These genes included genes of phenylalanine ammonia-lyase 1 (PAL1; EC 4.3.1.5), chalcone synthase (CHS; EC 2.3.1.74), dihydroflavonol 4-reductase (DFR; EC 1.1.1.219), leucoanthocyanidin reductase (LCR; EC 1.17.1.3), and flavanone 3-hydroxylase (F3H; EC 1.14.11.9).
Directory of Open Access Journals (Sweden)
Zala Zorenc
Full Text Available Relative expressions of structural genes and a number of transcription factors of the anthocyanin pathway relevant in Vaccinium species, and related key enzyme activities were compared with the composition and content of metabolites in skins of ripe fruits of wild albino and blue bilberry (Vaccinium myrtillus found in Slovenia. Compared to the common blue type, the albino variant had a 151-fold lower total anthocyanin and a 7-fold lower total phenolic content in their berry skin, which correlated with lower gene expression of flavonoid 3-O-glycosyltransferase (FGT; 33-fold, flavanone 3-hydroxylase (FHT; 18-fold, anthocyanidin synthase (ANS; 11-fold, chalcone synthase (CHS, 7.6-fold and MYBPA1 transcription factor (22-fold. The expression of chalcone isomerase (CHI, dihydroflavonol 4-reductase (DFR, leucoanthocyanidin reductase (LAR, anthocyanidin reductase (ANR and MYBC2 transcription factor was reduced only by a factor of 1.5-2 in the albino berry skins, while MYBR3 and flavonoid 3',5'-hydroxylase (F3'5'H were increased to a similar extent. Expression of the SQUAMOSA class transcription factor TDR4, in contrast, was independent of the color type and does therefore not seem to be correlated with anthocyanin formation in this variant. At the level of enzymes, significantly lower FHT and DFR activities, but not of phenylalanine ammonia-lyase (PAL and CHS/CHI, were observed in the fruit skins of albino bilberries. A strong increase in relative hydroxycinnamic acid derivative concentrations indicates the presence of an additional bottleneck in the general phenylpropanoid pathway at a so far unknown step between PAL and CHS.
DEFF Research Database (Denmark)
Costa, M C; Helweg-Larsen, J; Lundgren, Bettina
2003-01-01
The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...
Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes
Directory of Open Access Journals (Sweden)
Bin Wang
2010-07-01
Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.
Anand, Namrata; Singh, Priyanka; Sharma, Anindra; Tiwari, Sameer; Singh, Vandana; Singh, Diwakar K; Srivastava, Kishore K; Singh, B N; Tripathi, Rama Pati
2012-09-01
A synthetic strategy to access small libraries of triazolylmethoxy chalcones 4{1-20}, triazolylmethoxy flavanones 5{1-10} and triazolylmethoxy aminopyrimidines 6{1-17} from a common substrate 4-propargyloxy-2-hydroxy acetophenone using a set of different reactions has been developed. The chalcones and flavanones were screened against mycobacterial FAS-II pathway using a recombinant mycobacterial strain, against which the most potent compound showed ∼88% inhibition in bacterial growth and substantially induction of reporter gene activity at 100 μM concentration. The triazolylmethoxy aminopyrimdines were screened against PknG of Mycobaceterium tuberculosis displaying moderate to good activity (23-53% inhibition at 100 μM), comparable to the action of a standard inhibitor. Copyright © 2012 Elsevier Ltd. All rights reserved.
Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S
2013-03-01
Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.
Bioinformatics analysis of the phytoene synthase gene in cabbage (Brassica oleracea var. capitata)
Sun, Bo; Jiang, Min; Xue, Shengling; Zheng, Aihong; Zhang, Fen; Tang, Haoru
2018-04-01
Phytoene Synthase (PSY) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata PSY (BocPSY) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocPSY1, BocPSY2 and BocPSY3 genes mapped to chromosomes 2,3 and 9, and contains an open reading frame of 1,248 bp, 1,266 bp and 1,275 bp that encodes a 415, 421, 424 amino acid protein, respectively. Subcellular localization predicted all BocPSY genes were in the chloroplast. The conserved domain of the BocPSY protein is PLN02632. Homology analysis indicates that the levels of identity among BocPSYs were all more than 85%, and the PSY protein is apparently conserved during plant evolution. The findings of the present study provide a molecular basis for the elucidation of PSY gene function in cabbage.
Metabolic changes in Arabidopsis thaliana plants overexpressing chalcone synthase
Dao, Thi Thanh Hien
2010-01-01
The study has shown that it is possible to introduce the heterologous CHS gene in Arabidopsis thaliana and common multicopies of transgenes containing plants were obtained. Analysis of the change in metabolome of CHS transgenic plants, high expression transgenic lines can be identified by markers
Directory of Open Access Journals (Sweden)
Meng eWang
2013-05-01
Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.
Liu, Xiao-Jing; Chuang, Yao-Nung; Chiou, Chung-Yi; Chin, Dan-Chu; Shen, Fu-Quan; Yeh, Kai-Wun
2012-08-01
The anthocyanin-biosynthetic pathway was studied in flowers of Oncidium Gower Ramsey with yellow floral color and mosaic red anthocyanin in lip crests, sepals and petals, and compared with the anthocyanin biosynthesis in flowers of Oncidium Honey Dollp, a natural somatoclone derived from tissue culture of Gower Ramsey, with a yellow perianth without red anthocyanins in floral tissues. HPLC analysis revealed that the red anthocyanin in lip crests of the Gower Ramsey cultivar comprised peonidin-3-O-glucoside, delphinidin-3-O-glucoside and cyanidin-3-O-glucoside, whereas Honey Dollp was devoid of anthocyanin compounds. Among the five anthocyanin-biosynthetic genes, OgCHS was actively expressed in lip crests of Gower Ramsey flowers, but no transcripts of OgCHS were detected in Honey Dollp floral tissues. Transient expression of OgCHS by bombardment confirmed that recovery of the OgCHS gene expression completed the anthocyanin pathway and produced anthocyanin compounds in lip crests of Honey Dollp flowers. Transcription factor genes regulating anthocyanin biosynthesis showed no distinctive differences in the expression level of OgMYB1, OgbHLH and OgWD40 between the two cultivars. A methylation assay revealed that the promoter of OgCHS was not methylated in Gower Ramsey, while a positive methylation effect was present in the upstream promoter region of OgCHS in Honey Dollp. Overall, our results suggest that the failure of anthocyanin accumulation in Honey Dollp floral tissues may be attributed to inactivation of the OgCHS gene resulting from the epigenetic methylation of 5'-upstream promoter region.
Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey
2015-12-01
Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Characteristics of chalcone isomerase promoter in crabapple leaves ...
African Journals Online (AJOL)
Administrator
2011-09-05
Sep 5, 2011 ... in flavonoid biosynthetic pathway, can convert chalcone to (2S)-naringenin in the ... Construction of expression vectors with McCHI promoter fragment ... Each sample was bombarded three times with tungsten particles coated ...
Directory of Open Access Journals (Sweden)
Xingwen Zhou
2017-09-01
Full Text Available The golden camellia, Camellia nitidissima Chi., is a well-known ornamental plant that is known as “the queen of camellias” because of its golden yellow flowers. The principal pigments in the flowers are carotenoids and flavonol glycosides. Understanding the biosynthesis of the golden color and its regulation is important in camellia breeding. To obtain a comprehensive understanding of flower development in C. nitidissima, a number of cDNA libraries were independently constructed during flower development. Using the Illumina Hiseq2500 platform, approximately 71.8 million raw reads (about 10.8 gigabase pairs were obtained and assembled into 583,194 transcripts and 466, 594 unigenes. A differentially expressed genes (DEGs and co-expression network was constructed to identify unigenes correlated with flower color. The analysis of DEGs and co-expressed network involved in the carotenoid pathway indicated that the biosynthesis of carotenoids is regulated mainly at the transcript level and that phytoene synthase (PSY, β -carotene 3-hydroxylase (CrtZ, and capsanthin synthase (CCS1 exert synergistic effects in carotenoid biosynthesis. The analysis of DEGs and co-expressed network involved in the flavonoid pathway indicated that chalcone synthase (CHS, naringenin 3-dioxygenase (F3H, leucoanthocyanidin dioxygenase(ANS, and flavonol synthase (FLS play critical roles in regulating the formation of flavonols and anthocyanidin. Based on the gene expression analysis of the carotenoid and flavonoid pathways, and determinations of the pigments, we speculate that the high expression of PSY and CrtZ ensures the production of adequate levels of carotenoids, while the expression of CHS, FLS ensures the production of flavonols. The golden yellow color is then the result of the accumulation of carotenoids and flavonol glucosides in the petals. This study of the mechanism of color formation in golden camellia points the way to breeding strategies that exploit gene
Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.
Noar, Roslyn D; Daub, Margaret E
2016-01-01
Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode
Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.
Directory of Open Access Journals (Sweden)
Roslyn D Noar
Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that
Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng
2018-03-06
Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
El-Sayed, Yusif S.; Gaber, M.
2015-02-01
The chalcone 3-[4‧-dimethylaminophenyl]-1-(2-pyridyl) prop-2-en-1-one (DMAPP) and 3-(4‧-diethylaminophenyl)-1-(2-pyridinyl) prop-2-en-1-one abbreviated as DEAPP have been synthesized and characterized with IR, 1H NMR, 13C NMR spectroscopic techniques as described previously (El-Daly et al., 2008; Gaber et al., 2009; El-Sayed, 2013). By using UV visible spectroscopy method the mole fraction ratio for copper with DMAPP and DEAPP complexes were determined and it was found to be 1:1. The stability constants of this complex have been determined by Job's method. The stability constant (Kf) of copper with DMAPP and DEAPP complexes in universal buffer pH = 3.2 was determined to be 9.9 × 104 and 5.2 × 104 respectively. The effect of Cu(II) ion on the emission spectrum of the free chalcone is also assigned. Adherence to Beer's law and Ringbom optimum concentration ranges are determined. The thermal decomposition of the metal complexes is studied by TGA technique. The kinetic parameters like activation energy, pre-exponential factor and entropy of activation are estimated. The structure of complexes was energetically optimized through molecular mechanics applying MM+ force field coupled with molecular dynamics simulation. The bond lengths and bond angles have been calculated to confirm the geometry of the ligands and their Cu(II) complexes. The mode of interaction of the chalcone to copper nanoparticles was studied. The apparent association constants of the colloidal copper nanoparticles:chalcone complexes in solution were evaluated using the spectral method and compared with the formation constant of the Cu(II) chalcone complexes. Antioxidant activity of these chalcones was evaluated by using 1,1‧-diphenyl-2-picrylhydrazyl (DPPHrad) radicals scavenging method, which showed that the antioxidant activity of DMAPP has higher value than the DEAPP. Semi-empirical study results showed that DMAPP have higher dipole moment than DEAPP [1].
Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.
2015-01-01
Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891
Molecular cloning of allelopathy related genes and their relation to HHO in Eupatorium adenophorum.
Guo, Huiming; Pei, Xixiang; Wan, Fanghao; Cheng, Hongmei
2011-10-01
In this study, conserved sequence regions of HMGR, DXR, and CHS (encoding 3-hydroxy-3-methylglutaryl-CoA reductase, 1-deoxyxylulose-5-phosphate reductoisomerase and chalcone synthase, respectively) were amplified by reverse transcriptase (RT)-PCR from Eupatorium adenophorum. Quantitative real-time PCR showed that the expression of CHS was related to the level of HHO, an allelochemical isolated from E. adenophorum. Semi-quantitative RT-PCR showed that there was no significant difference in expression of genes among three different tissues, except for CHS. Southern blotting indicated that at least three CHS genes are present in the E. adenophorum genome. A full-length cDNA from CHS genes (named EaCHS1, GenBank ID: FJ913888) was cloned. The 1,455 bp cDNA contained an open reading frame (1,206 bp) encoding a protein of 401 amino acids. Preliminary bioinformatics analysis of EaCHS1 revealed that EaCHS1 was a member of CHS family, the subcellular localization predicted that EaCHS1 was a cytoplasmic protein. To the best of our knowledge, this is the first report of conserved sequences of these genes and of a full-length EaCHS1 gene in E. adenophorum. The results indicated that CHS gene is related to allelopathy of E. adenophorum.
Early phenylpropanoid biosynthetic steps in Cannabis sativa: link between genes and metabolites.
Docimo, Teresa; Consonni, Roberto; Coraggio, Immacolata; Mattana, Monica
2013-06-28
Phenylalanine ammonia-lyase (PAL), Cinnamic acid 4-hydroxylase (C4H) and 4-Coumarate: CoA ligase (4CL) catalyze the first three steps of the general phenylpropanoid pathway whereas chalcone synthase (CHS) catalyzes the first specific step towards flavonoids production. This class of specialized metabolites has a wide range of biological functions in plant development and defence and a broad spectrum of therapeutic activities for human health. In this study, we report the isolation of hemp PAL and 4CL cDNA and genomic clones. Through in silico analysis of their deduced amino acid sequences, more than an 80% identity with homologues genes of other plants was shown and phylogenetic relationships were highlighted. Quantitative expression analysis of the four above mentioned genes, PAL and 4CL enzymatic activities, lignin content and NMR metabolite fingerprinting in different Cannabis sativa tissues were evaluated. Furthermore, the use of different substrates to assay PAL and 4CL enzymatic activities indicated that different isoforms were active in different tissues. The diversity in secondary metabolites content observed in leaves (mainly flavonoids) and roots (mainly lignin) was discussed in relation to gene expression and enzymatic activities data.
Early Phenylpropanoid Biosynthetic Steps in Cannabis sativa: Link between Genes and Metabolites
Directory of Open Access Journals (Sweden)
Immacolata Coraggio
2013-06-01
Full Text Available Phenylalanine ammonia-lyase (PAL, Cinnamic acid 4-hydroxylase (C4H and 4-Coumarate: CoA ligase (4CL catalyze the first three steps of the general phenylpropanoid pathway whereas chalcone synthase (CHS catalyzes the first specific step towards flavonoids production. This class of specialized metabolites has a wide range of biological functions in plant development and defence and a broad spectrum of therapeutic activities for human health. In this study, we report the isolation of hemp PAL and 4CL cDNA and genomic clones. Through in silico analysis of their deduced amino acid sequences, more than an 80% identity with homologues genes of other plants was shown and phylogenetic relationships were highlighted. Quantitative expression analysis of the four above mentioned genes, PAL and 4CL enzymatic activities, lignin content and NMR metabolite fingerprinting in different Cannabis sativa tissues were evaluated. Furthermore, the use of different substrates to assay PAL and 4CL enzymatic activities indicated that different isoforms were active in different tissues. The diversity in secondary metabolites content observed in leaves (mainly flavonoids and roots (mainly lignin was discussed in relation to gene expression and enzymatic activities data.
Directory of Open Access Journals (Sweden)
Resnanti Utami Handayani
2014-07-01
Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.
Strains for the production of flavonoids from glucose
Energy Technology Data Exchange (ETDEWEB)
Stephanopoulos, Gregory; Santos, Christine; Koffas, Mattheos
2015-11-13
The invention relates to the production of flavonoids and flavonoid precursors in cells through recombinant expression of tyrosine ammonia lyase (TAL), 4-coumarate:CoA ligase (4CL), chalcone synthase (CHS), and chalcone isomerase (CHI).
International Nuclear Information System (INIS)
Li, Y.; Li, F.; Chen, X.; Shen, W.
2016-01-01
Hesperidin methyl chalcone (HMC) was a semisynthetic derivative of hesperidin, which owned antiviral and antimicrobial activities. Owing these properties, it can be applied in pharmaceutical industry. However low stability had become a barrier to its application. In order to overcome this problem, an inclusion complex of hesperidin methyl chalcone and hydroxypropyl-beta-cyclodextrin (HP-beta-CD) were prepared by freeze-drying, using some analytical techniques to characterize the inclusion complex, including ultraviolet-visible spectroscopy (UV), Fourier transform infrared spectroscopy (FT-IR), scanning electron microscopy (SEM), X-ray diffractometry (XRD) and differential scanning calorimetry (DSC). The results of these analytical techniques indicated that the hesperidin methyl chalcone has been dispersed completely in the HP-beta-CD without a new compound formed, but entrapped inside the cavity of HP-beta-CD. (author)
Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi
2014-10-01
Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.
Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika
2017-12-01
An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.
Light quality affects flavonoid production and related gene expression in Cyclocarya paliurus.
Liu, Yang; Fang, Shengzuo; Yang, Wanxia; Shang, Xulan; Fu, Xiangxiang
2018-02-01
Understanding the responses of plant growth and secondary metabolites to differential light conditions is very important to optimize cultivation conditions of medicinal woody plants. As a highly valued and multiple function tree species, Cyclocarya paliurus is planted and managed for timber production and medical use. In this study, LED-based light including white light (WL), blue light (BL), red light (RL), and green light (GL) were used to affect leaf biomass production, flavonoid accumulation and related gene expression of one-year C. paliurus seedlings in controlled environments. After the treatments of 60 days, the highest leaf biomass appeared in the treatment of WL, while the lowest leaf biomass was found under GL. Compared to WL, the total flavonoid contents of C. paliurus leaves were significantly higher in BL, RL, and GL, but the highest values of selected flavonoids (kaempferol, isoquercitrin and quercetin) were observed under BL. Furthermore, the greatest yields of total and selected flavonoids in C. paliurus leaves per seedling were also achieved under BL, indicating that blue light was effective for inducing the production of flavonoids in C. paliurus leaves. Pearson's correlation analysis showed that there were significantly positive correlations between leaf flavonoid content and relative gene expression of key enzymes (phenylalanine ammonia lyase, PAL; 4-coumaroyl CoA-ligase, 4CL; and chalcone synthase, CHS) in the upstream, which converting phenylalanine into the flavonoid skeleton of tetrahydroxy chalcone. It is concluded that manipulating light quality may be potential mean to achieve the highest yields of flavonoids in C. paliurus cultivation, however this needs to be further verified by more field trials. Copyright © 2018 Elsevier B.V. All rights reserved.
Design, synthesis, and biological evaluation of prenylated chalcones as 5-LOX inhibitors.
Reddy, Nimmanapalli P; Aparoy, Polamarasetty; Reddy, T Chandra Mohan; Achari, Chandrani; Sridhar, P Ramu; Reddanna, Pallu
2010-08-15
Ten novel mono- and di-O-prenylated chalcone derivatives were designed on the basis of a homology derived molecular model of 5-lipoxygenase (5-LOX). The compounds were docked into 5-LOX active site and the binding characteristics were quantified using LUDI. To verify our theoretical assumption, the molecules were synthesized and tested for their 5-LOX inhibitory activities. The synthesis was carried out by Claisen-Schmidt condensation reaction of mono- and di-O-prenylated acetophenones with appropriate aldehydes. 5-LOX in vitro inhibition assay showed higher potency of di-O-prenylated chalcones than their mono-O-prenylated chalcone analogs. Compound 5e exhibited good inhibition with an IC(50) at 4 microM. The overall trend for the binding energies calculated and LUDI score was in good qualitative agreement with the experimental data. Further, the compound 5e showed potent anti-proliferative effects (GI(50) at 9 microM) on breast cancer cell line, MCF-7. Copyright 2010 Elsevier Ltd. All rights reserved.
Gasque, Laura; Álvarez-Idaboy, J. Raul; Flores-Álamo, Marcos; Guzmán-Méndez, Óscar; Campos-Cerón, Juan M.
2018-04-01
The condensation of 1‧-hydroxy-2‧-acetonaphthone with 1- or 2-naphthaldehyde produced the corresponding stable chalcones: C1 or C2. However, the condensation product of either naphthaldehyde with 2‧-hydroxy-1‧-acetonaphthone yielded chalcones that convert to flavanones- F1 and F2- upon recrystallization. Crystal structures for C1, F1 and F2 are described. Transition state theory estimated rate constants, based on the calculated DFT M052X/6-311 + G(d,p) Gibbs Free energies, show that the rate delimiting step is the cyclization of the chalconate in protic polar solvent. The thermodynamically preferred product is always the flavanone, therefore, the yielding of one or other product is kinetically controlled.
An antileishmanial chalcone from Chinese licorice roots
DEFF Research Database (Denmark)
Christensen, S B; Ming, C; Andersen, L
1994-01-01
A bioassay guided fractionation of an extract of Chinese licorice roots led to the isolation of (E)-1-[2,4-dihydroxy-3-(3-methyl-2-butenyl)phenyl]-3-[4- hydroxy-3-(3-methyl-2-butenyl]phenyl-2-propen-1-one, which in vitro showed potent antileishmanial activity. In addition, the novel chalcone (E)-...
Żyszka, Beata; Anioł, Mirosław; Lipok, Jacek
2017-08-04
Chalcones are the biogenetic precursors of all known flavonoids, which play an essential role in various metabolic processes in photosynthesizing organisms. The use of whole cyanobacteria cells in a two-step, light-catalysed regioselective bio-reduction of chalcone, leading to the formation of the corresponding dihydrochalcone, is reported. The prokaryotic microalgae cyanobacteria are known to produce phenolic compounds, including flavonoids, as natural components of cells. It seems logical that organisms producing such compounds possess a suitable "enzymatic apparatus" to carry out their biotransformation. Therefore, determination of the ability of whole cells of selected cyanobacteria to carry out biocatalytic transformations of chalcone, the biogenetic precursor of all known flavonoids, was the aim of our study. Chalcone was found to be converted to dihydrochalcone by all examined cyanobacterial strains; however, the effectiveness of this process depends on the strain with biotransformation yields ranging from 3% to >99%. The most effective biocatalysts are Anabaena laxa, Aphanizomenon klebahnii, Nodularia moravica, Synechocystis aquatilis (>99% yield) and Merismopedia glauca (92% yield). The strains Anabaena sp. and Chroococcus minutus transformed chalcone in more than one way, forming a few products; however, dihydrochalcone was the dominant product. The course of biotransformation shed light on the pathway of chalcone conversion, indicating that the process proceeds through the intermediate cis-chalcone. The scaled-up process, conducted on a preparative scale and by using a mini-pilot photobioreactor, fully confirmed the high effectiveness of this bioconversion. Moreover, in the case of the mini-pilot photobioreactor batch cultures, the optimization of culturing conditions allowed the shortening of the process conducted by A. klebahnii by 50% (from 8 to 4 days), maintaining its >99% yield. This is the first report related to the use of whole cells of
Directory of Open Access Journals (Sweden)
Dullat Harpreet K
2011-03-01
Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.
Directory of Open Access Journals (Sweden)
Łucja ePrzysiecka
2015-04-01
Full Text Available Lupins, like other legumes, have a unique biosynthesis scheme of 5-deoxy-type flavonoids and isoflavonoids. A key enzyme in this pathway is chalcone isomerase (CHI, a member of CHI-fold protein family, encompassing subfamilies of CHI1, CHI2, CHI-like (CHIL, and fatty acid-binding (FAP proteins. Here, two Lupinus angustifolius (narrow-leafed lupin CHILs, LangCHIL1 and LangCHIL2, were identified and characterized using DNA fingerprinting, cytogenetic and linkage mapping, sequencing and expression profiling. Clones carrying CHIL sequences were assembled into two contigs. Full gene sequences were obtained from these contigs, and mapped in two L. angustifolius linkage groups by gene-specific markers. Bacterial artificial chromosome fluorescence in situ hybridization approach confirmed the localization of two LangCHIL genes in distinct chromosomes. The expression profiles of both LangCHIL isoforms were very similar. The highest level of transcription was in the roots of the third week of plant growth; thereafter, expression declined. The expression of both LangCHIL genes in leaves and stems was similar and low. Comparative mapping to reference legume genome sequences revealed strong syntenic links; however, LangCHIL2 contig had a much more conserved structure than LangCHIL1. LangCHIL2 is assumed to be an ancestor gene, whereas LangCHIL1 probably appeared as a result of duplication. As both copies are transcriptionally active, questions arise concerning their hypothetical functional divergence. Screening of the narrow-leafed lupin genome and transcriptome with CHI-fold protein sequences, followed by Bayesian inference of phylogeny and cross-genera synteny survey, identified representatives of all but one (CHI1 main subfamilies. They are as follows: two copies of CHI2, FAPa2 and CHIL, and single copies of FAPb and FAPa1. Duplicated genes are remnants of whole genome duplication which is assumed to have occurred after the divergence of Lupinus, Arachis
International Nuclear Information System (INIS)
Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.
2008-01-01
Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)
Chemopreventive effect of chalcone derivative, L2H17, in colon cancer development
International Nuclear Information System (INIS)
Xu, Shanmei; Chen, Minxiao; Chen, Wenbo; Hui, Junguo; Ji, Jiansong; Hu, Shuping; Zhou, Jianmin; Wang, Yi; Liang, Guang
2015-01-01
Colon cancer is the third most commonly diagnosed cancer and the second leading cause of cancer mortality worldwide. Chalcone and its derivatives are reported to exhibit anti-cancer effects in several cancer cell lines, including colon cancer cells. In addition, chalcones have advantages such as poor interaction with DNA and low risk of mutagenesity. In our previous study, a group of chalcone derivatives were synthesized and exhibited strong anti-inflammatory activities. In this study, we evaluated the anti-cancer effects of the chalcone derivative, L2H17, in colon cancer cells. The cytotoxicities of L2H17 on various colon cancer cell lines were investigated by MTT and clonogenic assay. Cell cycle and apoptosis analysis were performed to evaluate the molecular mechanism of L2H17-mediated inhibition of tumor growth. Also, scratch wound and matrigel invasion experiments were performed to estimate the cell migration and invasion after L2H17 treatment. Finally, we observed the anti-colon cancer effects of L2H17 in vivo. Our data show that compound L2H17 exhibited selective cytotoxic effect on colon cancer cells, via inducing G0/G1 cell cycle arrest and apoptosis in CT26.WT cells. Furthermore, L2H17 treatment decreased cell migration and invasion of CT26.WT cells. In addition, L2H17 possessed marked anti-tumor activity in vivo. The molecular mechanism of L2H17-mediated inhibition of tumor promotion and progression were function through inactivated NF-κB and Akt signaling pathways. All these findings show that L2H17 might be a potential growth inhibitory chalcones derivative for colon cancer cells
Merkulov, S.; Assema, van F.; Springer, J.; Carmen, del A.F.; Mooibroek, H.
2000-01-01
The squalene synthase (SQS) gene encodes a key regulatory enzyme, farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21), in sterol biosynthesis. The SQS1 gene was isolated from a subgenomic library of the industrially important yeast Yarrowia lipolytica, using PCR-generated probes. Probes were
International Nuclear Information System (INIS)
Marwani, Hadi M.; Asiri, Abdullah M.; Khan, Salman A.
2013-01-01
The main focus of this study was to investigate spectroscopic properties, stoichiometric ratios, physicochemical parameters, polarity and photostability behaviors of newly synthesized chalcone dye in organized media. The chalcone dye, 1-(2,5-Dimethyl-thiophen-3-yl)-3-(9-etnyl-9H-carbazol-3-yl)-propenone (DTEP), was prepared by the reaction of carbazole aldehyde with 3-acetyl-2,5-dimethythiophene. Data obtained from FT-IR, 1 H-–NMR, 13 C-NMR and elemental analysis were consistent with chemical structure of newly prepared DTEP. Increases in fluorescence intensities of DTEP with cetyltrimethyl ammonium bromide (CTAB) were observed. In comparison of fluorescence intensities for DTEP with CTAB, reductions in fluorescence intensities for DTEP with sodium dodecyl sulfate (SDS) were noticed under the same experimental and instrumental conditions. Additionally, Benesi–Hildebrand method was applied to determine stoichiometric ratios and association constants of DTEP with CTAB and SDS. Stern–Volmer plot was used in order to further confirm the stoichiometric ratio and association constant of DTEP with SDS. Physicochemical parameters such as singlet absorption, molar absorptivity, oscillator strength, dipole moment and fluorescence quantum yield of DTEP were also determined. Fluorescence polarity study displayed that DTEP was sensitive to the polarity of the microenvironment provided by different solvents. Finally, fluorescence steady-state measurements revealed that DTEP has high photostability against photobleaching. -- Highlights: ► Mechanistic understanding of molecular structure of newly synthesized chalcone dye. ► Exploring spectral behaviors and physicochemical parameters of chalcone dye. ► Determination of stoichiometric ratios and association constants of chalcone dye. ► Determination of fluorescence quantum yield in different solvents. ► High photostability against photobleaching of chalcone dye was observed
Selection of Suitable Reference Genes for Quantitative Real-time PCR in Sapium sebiferum
Directory of Open Access Journals (Sweden)
Xue Chen
2017-05-01
Full Text Available Chinese tallow (Sapium sebiferum L. is a promising landscape and bioenergy plant. Measuring gene expression by quantitative real-time polymerase chain reaction (qRT-PCR can provide valuable information on gene function. Stably expressed reference genes for normalization are a prerequisite for ensuring the accuracy of the target gene expression level among different samples. However, the reference genes in Chinese tallow have not been systematically validated. In this study, 12 candidate reference genes (18S, GAPDH, UBQ, RPS15, SAND, TIP41, 60S, ACT7, PDF2, APT, TBP, and TUB were investigated with qRT-PCR in 18 samples, including those from different tissues, from plants treated with sucrose and cold stresses. The data were calculated with four common algorithms, geNorm, BestKeeper, NormFinder, and the delta cycle threshold (ΔCt. TIP41 and GAPDH were the most stable for the tissue-specific experiment, GAPDH and 60S for cold treatment, and GAPDH and UBQ for sucrose stresses, while the least stable genes were 60S, TIP41, and 18S respectively. The comprehensive results showed APT, GAPDH, and UBQ to be the top-ranked stable genes across all the samples. The stability of 60S was the lowest during all experiments. These selected reference genes were further validated by comparing the expression profiles of the chalcone synthase gene in Chinese tallow in different samples. The results will help to improve the accuracy of gene expression studies in Chinese tallow.
Lane, Courtney E; Benton, Michael G
2015-12-01
A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.
Ober, Dietrich; Hartmann, Thomas
1999-01-01
Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289
Zhang, Jian; Zhu, Liuyang; Chen, Haoyu; Li, Min; Zhu, Xiaojuan; Gao, Qiang; Wang, Depei; Zhang, Ying
2016-12-28
The polyketide synthase gene An15g07920 was known in Aspergillus niger CBS 513.88 as putatively involved in the production of ochratoxin A (OTA). Genome resequencing analysis revealed that the gene An15g07920 is also present in the ochratoxin-producing A. niger strain 1062. Disruption of An15g07920 in A. niger 1062 removed its capacity to biosynthesize ochratoxin β (OTβ), ochratoxin α (OTα), and OTA. These results indicate that the polyketide synthase encoded by An15g07920 is a crucial player in the biosynthesis of OTA, in the pathway prior to the phenylalanine ligation step. The gene An15g07920 reached its maximum transcription level before OTA accumulation reached its highest level, confirming that gene transcription precedes OTA production. These findings will not only help explain the mechanism of OTA production in A. niger but also provide necessary information for the development of effective diagnostic, preventive, and control strategies to reduce the risk of OTA contamination in foods.
Directory of Open Access Journals (Sweden)
Mohammed Rayees Ahmad
2016-09-01
Full Text Available Chalcones are abundant in edible plants and are considered to be the precursors of flavonoids and isoflavonoids. Chalcones belong to an important class of flavonoids, which may be prepared by Claisen–Schmidt condensation. They possess a wide range of biological activities and industrial applications. The cytotoxicity against tumour cell lines may be the result of disruption of the cell cycle, inhibition of angiogenesis, interference with p53-MDM2 interaction, mitochondrial uncoupling or induction of apoptosis. Chalcones are synthesized by conventional and microwave assisted synthesis methods. By microwave assisted synthesis, a considerable increase in the reaction rate has been observed and that too, with better yields. The compounds have been screened for cytotoxic activity and antioxidant activity.
International Nuclear Information System (INIS)
Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.
2006-01-01
The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)
Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T
2016-12-01
Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger
Energy Technology Data Exchange (ETDEWEB)
Rinker, Torri E.; Baker, Scott E.
2007-01-29
Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.
Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians
DEFF Research Database (Denmark)
Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh
2008-01-01
of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...
Zhou, Xiaojin; Li, Suzhen; Zhao, Qianqian; Liu, Xiaoqing; Zhang, Shaojun; Sun, Cheng; Fan, Yunliu; Zhang, Chunyi; Chen, Rumei
2013-01-01
Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families ...
Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei
2017-02-01
Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Ali Ghasemzadeh
2014-10-01
Full Text Available In the current study, changes in secondary metabolite synthesis and the pharmaceutical quality of sabah snake grass leaves and buds were considered in relation to plant age (1 month, 6 months, and 1 year old. The activity of the enzyme chalcone synthase (CHS, EC 2.3.1.74 was measured, as it is a key enzyme for flavonoid production. Significant differences in total flavonoid (TF production were observed between the three plant growth periods and the different plant parts. The highest contents of TF (6.32 mg/g dry weight [DW] and total phenolic (TP (18.21 mg/g DW were recorded in 6-month-old buds. Among the flavonoids isolated in this study the most important ones based on concentration were from high to low as follows: catechin > quercetin > kaempferol > luteolin. Production of phenolic acids increased from 1 to 6 months, but after 6 months up to 1 year of age, they decreased significantly. The highest contents of caffeic acid (0.307 mg/g DW and gallic acid (5.96 mg/g DW were recorded in 1-year and 6-month-old buds, respectively. The lowest and highest activity of CHS was recorded in 1-month and 6-month-old buds with values of 3.6 and 9.5 nkat/mg protein, respectively. These results indicate that the increment in flavonoids and phenolic acids in 6-month-old buds can be attributed to an increase in CHS activity. The highest 1,1-diphenyl-2-picrylhydrazyl (DPPH activity was observed in the extract of 1-year-old buds followed by 6-month-old buds, with 50% of free radical scavenging (IC50 values of 64.6 and 73.5 µg/mL, respectively. Interestingly, a ferric reducing antioxidant power (FRAP assay showed a higher activity in 6-month-old buds (488 μM of Fe(II/g than in 1-year-old buds (453 μM of Fe(II/g, in contrast to the DPPH result. Significant correlations (p < 0.05 were observed between CHS enzyme activity and FRAP activity, TF, catechin, and kaempferol content. Extracts of 6-month-old bud exhibited a significant in vitro anticancer activity
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-10-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.
DEFF Research Database (Denmark)
Ramachandran, Roshni; Bhatt, Deepak Kumar; Ploug, Kenneth Beri
2014-01-01
BACKGROUND AND AIM: Infusion of glyceryltrinitrate (GTN), a nitric oxide (NO) donor, in awake, freely moving rats closely mimics a universally accepted human model of migraine and responds to sumatriptan treatment. Here we analyse the effect of nitric oxide synthase (NOS) and calcitonin gene-rela...
International Nuclear Information System (INIS)
Hwang, Kijun; Kim, Hoseok; Kim, Beomtae; Han, Incheol
2012-01-01
A series of heterocyclic chalcone derivatives bearing heterocycles such as thiophene or furan ring as an isostere of benzene ring were carefully prepared, and the influence of heterocycles on 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activities was systematically investigated. Structure-activity relationships (SAR) analysis showed that the activities of thiophene ring-containing chalcones were higher than those of furan ring containing chalcones, and the presence of methyl substituent of heterocyclic ring distinctly affected the activities compared with non-substituted heterocycles in an opposite manner, with the 4'-methyl group of thiophene ring increasing activity and the 3'-methyl group of the furan ring decreasing activity. The distinct isosteric effect of heterocycles (i.e., thiophene or furan ring) on radical scavenging activities of heterocyclic chalcones was distinctly demonstrated in our work
Antivascular and antitumor properties of the tubulin-binding chalcone TUB091.
Canela, María-Dolores; Noppen, Sam; Bueno, Oskía; Prota, Andrea E; Bargsten, Katja; Sáez-Calvo, Gonzalo; Jimeno, María-Luisa; Benkheil, Mohammed; Ribatti, Domenico; Velázquez, Sonsoles; Camarasa, María-José; Díaz, J Fernando; Steinmetz, Michel O; Priego, Eva-María; Pérez-Pérez, María-Jesús; Liekens, Sandra
2017-02-28
We investigated the microtubule-destabilizing, vascular-targeting, anti-tumor and anti-metastatic activities of a new series of chalcones, whose prototype compound is (E)-3-(3''-amino-4''-methoxyphenyl)-1-(5'-methoxy-3',4'-methylendioxyphenyl)-2-methylprop-2-en-1-one (TUB091). X-ray crystallography showed that these chalcones bind to the colchicine site of tubulin and therefore prevent the curved-to-straight structural transition of tubulin, which is required for microtubule formation. Accordingly, TUB091 inhibited cancer and endothelial cell growth, induced G2/M phase arrest and apoptosis at 1-10 nM. In addition, TUB091 displayed vascular disrupting effects in vitro and in the chicken chorioallantoic membrane (CAM) assay at low nanomolar concentrations. A water-soluble L-Lys-L-Pro derivative of TUB091 (i.e. TUB099) showed potent antitumor activity in melanoma and breast cancer xenograft models by causing rapid intratumoral vascular shutdown and massive tumor necrosis. TUB099 also displayed anti-metastatic activity similar to that of combretastatin A4-phosphate. Our data indicate that this novel class of chalcones represents interesting lead molecules for the design of vascular disrupting agents (VDAs). Moreover, we provide evidence that our prodrug approach may be valuable for the development of anti-cancer drugs.
Steven Steven; Yoni F Syukriani; Julius B Dewanto
2016-01-01
Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...
El-Hashash, Maher A; Rizk, Sameh A; Atta-Allah, Saad R
2015-12-10
A number of novel heterocyclic chalcone derivatives can be synthesized by thermal and microwave tools. Treatment of 4-(4-Acetylamino- and/or 4-bromo-phenyl)-4-oxobut-2-enoic acids with hydrogen peroxide in alkaline medium were afforded oxirane derivatives 2. Reaction of the epoxide 2 with 2-amino-5-aryl-1,3,4-thiadiazole derivatives yielded chalcone of imidazo[2,1-b]thiadiazole derivative 4 via two thermal routes. In one pot reaction of 4-bromoacetophenone, diethyloxalate, and 2-amino-5-aryl-1,3,4-thiadiazole derivatives in MW irradiation (W 250 and T 150 °C) under eco-friendly conditions afforded an unsuitable yield of the desired chalcone 4d. The chalcone derivatives 4 were used as a key starting material to synthesize some new spiroheterocyclic compounds via Michael and aza-Michael adducts. The chalcone 4f was similar to the aryl-oxo-vinylamide derivatives for the inhibition of tyrosine kinase and cancer cell growth. The electron-withdrawing substituents, such as halogens, and 2-amino-1,3,4-thiadiazole moeity decreasing the electron density, thereby decreasing the energy of HOMO, and the presence of imidazothiadiazole moiety should improve the antibacterial activity. Thus, the newly synthesized compounds were evaluated for their anti-bacterial activity against (ATCC 25923), (ATCC 10987), (ATCC 274,) and (SM514). The structure of the newly synthesized compounds was confirmed by elemental analysis and spectroscopic data.
Botelho, Marco Antonio; Rao, Vietla Satyanarayana; Montenegro, Danusa; Bandeira, Mary Anne Menezes; Fonseca, Said Gonçalves Cruz; Nogueira, Nadia Accioly Pinto; Ribeiro, Ronaldo Albuquerque; Brito, Gerly Anne Castro
2008-04-01
Carvacrol and dimeric chalcones are the respective bioactive components of Lippia sidoides and Myracrodruon urundeuva, popular medicinal plants of Northeastern Brazil with proven antimicrobial and antiinflammatory properties. Periodontal disease is associated with inflammation and microbiological proliferation, thus the study aimed to investigate the effect of a topical gel based on carvacrol and chalcones in the experimental periodontal disease (EPD) in rats. Animals were treated with carvacrol and/or chalcones gel, immediately after EPD induction, three times a day for 11 days. Appropriate controls were included in the study. Animals were weighed daily. They were killed on day 11, the mandibles dissected and alveolar bone loss was measured. The periodontium were examined at histopathology and the neutrophil influx into the gingiva was assayed using myeloperoxidase activity. The bacterial flora were assessed through culture of the gingival tissue. Alveolar bone loss was significantly (p < 0.05) inhibited by combined carvacrol and chalcones gel, compared with the vehicle and non-treated groups. The treatment with the combined gel reduced tissue lesion at histopathology, decreased myeloperoxidase activity in gingival tissue and inhibited the growth of oral microorganisms as well as the weight loss. Carvacrol and chalcones combination gel has a beneficial effect upon EPD in this model. (c) 2008 John Wiley & Sons, Ltd.
Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).
Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes
2012-03-01
Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.
Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W
2015-03-31
Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.
Xiang, Lin; Zhao, Kaige; Chen, Longqing
2010-01-01
Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-01-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043
Schindler, Daniel; Nowrousian, Minou
2014-07-01
Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Correa, Marivaldo J.C.; Nunes, Fatima M.; Bitencourt, Heriberto R.; Borges, Fabio C.; Guilhon, Giselle M.S.P.; Arruda, Mara S.P.; Marinho, Andrey M. R.; Santos, Alberdan S.; Alves, Claudio N.; Santos, Lourivaldo S., E-mail: lss@ufpa.b [Universidade Federal do Para (IQ/FEQ/UFPA), Belem, PA (Brazil). Inst. de Tecnologia. Faculdade de Engenharia Quimica; Brasil, Davi S.B. [Universidade Federal do Para (PPGQ/IQ/UFPA), Belem, PA (Brazil). Inst. de Quimica. Programa de Pos-Graduacao em Quimica
2011-07-01
The fungus Aspergillus flavus isolated as endophytic of the plant Paspalum maritimum Trin. was evaluated for its potential application in biotransformation reactions. The compounds chalcone (1), 3,4,5-trimethoxychalcone (2) and 2,3,4,4'-tetramethoxy chalcone (3) were biotransformed, respectively, in dihydrochalcone (4), 3,4,5-trimethoxydihydrochalcone (5) and 2,3,4,4'-tetramethoxydihydrochalcone (6). The structures were elucidated by spectroscopic methods including 1D and 2D NMR techniques, and MS analysis. The dihydrochalcones 5 and 6 are new compounds. (author)
International Nuclear Information System (INIS)
Correa, Marivaldo J.C.; Nunes, Fatima M.; Bitencourt, Heriberto R.; Borges, Fabio C.; Guilhon, Giselle M.S.P.; Arruda, Mara S.P.; Marinho, Andrey M. R.; Santos, Alberdan S.; Alves, Claudio N.; Santos, Lourivaldo S.; Brasil, Davi S.B.
2011-01-01
The fungus Aspergillus flavus isolated as endophytic of the plant Paspalum maritimum Trin. was evaluated for its potential application in biotransformation reactions. The compounds chalcone (1), 3,4,5-trimethoxychalcone (2) and 2,3,4,4'-tetramethoxy chalcone (3) were biotransformed, respectively, in dihydrochalcone (4), 3,4,5-trimethoxydihydrochalcone (5) and 2,3,4,4'-tetramethoxydihydrochalcone (6). The structures were elucidated by spectroscopic methods including 1D and 2D NMR techniques, and MS analysis. The dihydrochalcones 5 and 6 are new compounds. (author)
Inhibition of fumarate reductase in Leishmania major and L. donovani by chalcones
DEFF Research Database (Denmark)
Chen, M; Zhai, L; Christensen, S B
2001-01-01
Our previous studies have shown that chalcones exhibit potent antileishmanial and antimalarial activities in vitro and in vivo. Preliminary studies showed that these compounds destroyed the ultrastructure of Leishmania parasite mitochondria and inhibited the respiration and the activity...... of mitochondrial dehydrogenases of Leishmania parasites. The present study was designed to further investigate the mechanism of action of chalcones, focusing on the parasite respiratory chain. The data show that licochalcone A inhibited the activity of fumarate reductase (FRD) in the permeabilized Leishmania major...... promastigote and in the parasite mitochondria, and it also inhibited solubilized FRD and a purified FRD from L. donovani. Two other chalcones, 2,4-dimethoxy-4'-allyloxychalcone (24m4ac) and 2,4-dimethoxy-4'-butoxychalcone (24mbc), also exhibited inhibitory effects on the activity of solubilized FRD in L. major...
Directory of Open Access Journals (Sweden)
Ro Dae-Kyun
2009-07-01
Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes
Role of Spironolactone Chalcone in the Prevention of Peritoneal ...
African Journals Online (AJOL)
Purpose: The study was designed to investigate the effects of a novel spironolactone chalcone in the prevention of peritoneal fibrosis. Methods: Wistar rats (n = 30) were randomly assigned to 3 groups: bacteria (B), spironolactone amide treatment (S), and control (C) groups. C group received only dextran beads while S and ...
Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean
Good, Laura Lee
2001-01-01
The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...
Plant terpene synthase genes (TPSs) have roles in diverse biological processes. Here we report the functional characterization of one member of the soybean TP S gene family, which was designated GmAFS. Recombinant GmAFS produced in E.coli catalyzed the formation of a sesquiterpene (E,E)-a-farnesene....
Park, Sun-Ha; Lee, Chang Woo; Cho, Sung Mi; Lee, Hyoungseok; Park, Hyun; Lee, Jungeun; Lee, Jun Hyuck
2018-01-01
Chalcone isomerase (CHI) is an important enzyme for flavonoid biosynthesis that catalyzes the intramolecular cyclization of chalcones into (S)-flavanones. CHIs have been classified into two types based on their substrate specificity. Type I CHIs use naringenin chalcone as a substrate and are found in most of plants besides legumes, whereas type II CHIs in leguminous plants can also utilize isoliquiritigenin. In this study, we found that the CHI from the Antarctic plant Deschampsia antarctica (DaCHI1) is of type I based on sequence homology but can use type II CHI substrates. To clarify the enzymatic mechanism of DaCHI1 at the molecular level, the crystal structures of unliganded DaCHI1 and isoliquiritigenin-bound DaCHI1 were determined at 2.7 and 2.1 Å resolutions, respectively. The structures revealed that isoliquiritigenin binds to the active site of DaCHI1 and induces conformational changes. Additionally, the activity assay showed that while DaCHI1 exhibits substrate preference for naringenin chalcone, it can also utilize isoliquiritigenin although the catalytic activity was relatively low. Based on these results, we propose that DaCHI1 uses various substrates to produce antioxidant flavonoids as an adaptation to oxidative stresses associated with harsh environmental conditions.
Directory of Open Access Journals (Sweden)
Sun-Ha Park
Full Text Available Chalcone isomerase (CHI is an important enzyme for flavonoid biosynthesis that catalyzes the intramolecular cyclization of chalcones into (S-flavanones. CHIs have been classified into two types based on their substrate specificity. Type I CHIs use naringenin chalcone as a substrate and are found in most of plants besides legumes, whereas type II CHIs in leguminous plants can also utilize isoliquiritigenin. In this study, we found that the CHI from the Antarctic plant Deschampsia antarctica (DaCHI1 is of type I based on sequence homology but can use type II CHI substrates. To clarify the enzymatic mechanism of DaCHI1 at the molecular level, the crystal structures of unliganded DaCHI1 and isoliquiritigenin-bound DaCHI1 were determined at 2.7 and 2.1 Å resolutions, respectively. The structures revealed that isoliquiritigenin binds to the active site of DaCHI1 and induces conformational changes. Additionally, the activity assay showed that while DaCHI1 exhibits substrate preference for naringenin chalcone, it can also utilize isoliquiritigenin although the catalytic activity was relatively low. Based on these results, we propose that DaCHI1 uses various substrates to produce antioxidant flavonoids as an adaptation to oxidative stresses associated with harsh environmental conditions.
DEFF Research Database (Denmark)
Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J
1999-01-01
Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth...... biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP....
Role of Spironolactone Chalcone in the Prevention of Peritoneal ...
African Journals Online (AJOL)
Results: Spironolactone chalcone treatment at a dose of 30 mg/kg body ... fibrosis in PD patients using various drugs and ... Rockville, Maryland, USA) cultures in a brain– ... mL blood samples were collected from the vena .... The transport barrier in intraperitoneal therapy. Am J Physiol Renal Physiol 2005; 288: F433-. 442.
SOCl 2 catalyzed cyclization of chalcones: Synthesis and spectral ...
African Journals Online (AJOL)
Some aryl-aryl 1H pyrazoles have been synthesised by cyclization of aryl chalcones and hydrazine hydrate in the presence of SOCl2. The yields of the pyrazoles are more than 85%. These pyrazoles are characterized by their physical constants and spectral data. The infrared, NMR spectral group frequencies of these ...
International Nuclear Information System (INIS)
Franchi, Nicola; Piccinni, Ester; Ferro, Diana; Basso, Giuseppe; Spolaore, Barbara; Santovito, Gianfranco; Ballarin, Loriano
2014-01-01
Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal
Energy Technology Data Exchange (ETDEWEB)
Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)
2014-07-01
Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.
Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.
Directory of Open Access Journals (Sweden)
Praveen Balabaskaran Nina
2010-07-01
Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a
Najid, Najihah Mohd; Zain, Che Radziah Che Mohd; Zainal, Zamri
2016-11-01
Ficus deltoidea (moraceae) is a herbal plant with medicinal values. Previous studies reported that the F. deltoidea contains a high level of bioactive compounds such as flavonoids. A cDNA encodes for chalcone isomerase was identified from F. deltoidea, designated as FdCHI, which involved in the isomerization of naringenin chalcone to naringenin. Naringenin is a key branch point for the synthesis of rutin, which is believed involved in defense mechanism in the plant. Therefore, we hypothesized that there might be a direct relationship between FdCHI expression level and rutin production in leaves of F. deltoidea var. deltoidea (FDD) and F. deltoidea var. angustifolia (FDA). Our result showed that expression level of FdCHI in leaves FDD was greater than FDA. Analysis of High Performance Liquid Chromatography (HPLC) revealed that rutin was only detected in FDA leaves. Based on the results between FdCHI expression and rutin production, this study concluded that there is no relationship between FdCHI expression and rutin production in leaves of FDA and FDD.
Design and synthesis of novel chalcones as potent selective monoamine oxidase-B inhibitors.
Hammuda, Arwa; Shalaby, Raed; Rovida, Stefano; Edmondson, Dale E; Binda, Claudia; Khalil, Ashraf
2016-05-23
A novel series of substituted chalcones were designed and synthesized to be evaluated as selective human MAO-B inhibitors. A combination of either methylsulfonyl or trifluoromethyl substituents on the aromatic ketone moiety with a benzodioxol ring on the other end of the chalcone scaffold was investigated. The compounds were tested for their inhibitory activities on both human MAO-A and B. All compounds appeared to be selective MAO-B inhibitors with Ki values in the micromolar to submicromolar range. Molecular modeling studies have been performed to get insight into the binding mode of the synthesized compounds to human MAO-B active site. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.
Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M
2008-07-01
Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.
Effect of trans-chalcone on hepatic IL-8 through the regulation of miR-451 in male rats
Directory of Open Access Journals (Sweden)
Karimi-Sales Elham
2018-01-01
Full Text Available Objective. Trans-chalcone is a chalcone with hepatoprotective and anti-inflammatory effects. However, the mechanism of these positive effects, especially on miR-451 as an inflammatory regulator, is poorly understood. In this regard, this microRNA (miRNA acts by inhibition of hepatic interleukin-8 (IL-8 production in the liver which is one of the main proinflammatory cytokines. Th is study for the first time examined the effect of trans-chalcone on miR-451/IL-8 pathway. Methods. In present study, 21 male rats were randomly divided into 3 groups (n=7 per each group: control which received solvent (NS, groups 2 (N2T and 3 (N6T, which received transchalcone for 2 and 6 weeks, respectively. Hepatic level of miR-451 was measured by qRT-PCR. Serum levels of alanine aminotransferase (ALT and aspartate aminotransferase (AST as well as hepatic level of IL-8 protein were measured. Results. Trans-chalcone decreased hepatic level of IL-8 protein and serum level of ALT aft er 2 weeks of treatment without significant change in hepatic miR-451. Moreover, it increased hepatic level of miR-451 and reduced hepatic IL-8 as well as AST and ALT aft er 6 weeks. Conclusion. Based on the results of present study, miR-451/IL-8 pathway is a possible mechanism for hepatoprotective action of trans-chalcone in long-term.
Directory of Open Access Journals (Sweden)
Emilia Wilmowicz
2016-03-01
Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.
Wilson, Richard A.; Wang, Zheng-Yi; Kershaw, Michael J.; Talbot, Nicholas J.
2013-01-01
The filamentous fungus Magnaporthe oryzae is the causal agent of rice blast disease. Here we show that glycogen metabolic genes play an important role in plant infection by M. oryzae. Targeted deletion of AGL1 and GPH1, which encode amyloglucosidase and glycogen phosphorylase, respectively, prevented mobilisation of glycogen stores during appressorium development and caused a significant reduction in the ability of M. oryzae to cause rice blast disease. By contrast, targeted mutation of GSN1, which encodes glycogen synthase, significantly reduced the synthesis of intracellular glycogen, but had no effect on fungal pathogenicity. We found that loss of AGL1 and GPH1 led to a reduction in expression of TPS1 and TPS3, which encode components of the trehalose-6-phosphate synthase complex, that acts as a genetic switch in M. oryzae. Tps1 responds to glucose-6-phosphate levels and the balance of NADP/NADPH to regulate virulence-associated gene expression, in association with Nmr transcriptional inhibitors. We show that deletion of the NMR3 transcriptional inhibitor gene partially restores virulence to a Δagl1Δgph1 mutant, suggesting that glycogen metabolic genes are necessary for operation of the NADPH-dependent genetic switch in M. oryzae. PMID:24098112
The Birth of a Black Rice Gene and Its Local Spread by Introgression.
Oikawa, Tetsuo; Maeda, Hiroaki; Oguchi, Taichi; Yamaguchi, Takuya; Tanabe, Noriko; Ebana, Kaworu; Yano, Masahiro; Ebitani, Takeshi; Izawa, Takeshi
2015-09-01
The origin and spread of novel agronomic traits during crop domestication are complex events in plant evolution. Wild rice (Oryza rufipogon) has red grains due to the accumulation of proanthocyanidins, whereas most cultivated rice (Oryza sativa) varieties have white grains induced by a defective allele in the Rc basic helix-loop-helix (bHLH) gene. Although the events surrounding the origin and spread of black rice traits remain unknown, varieties with black grains due to anthocyanin accumulation are distributed in various locations throughout Asia. Here, we show that the black grain trait originated from ectopic expression of the Kala4 bHLH gene due to rearrangement in the promoter region. Both the Rc and Kala4 genes activate upstream flavonol biosynthesis genes, such as chalcone synthase and dihydroflavonol-4-reductase, and downstream genes, such as leucoanthocyanidin reductase and leucoanthocyanidin dioxygenase, to produce the respective specific pigments. Genome analysis of 21 black rice varieties as well as red- and white-grained landraces demonstrated that black rice arose in tropical japonica and its subsequent spread to the indica subspecies can be attributed to the causal alleles of Kala4. The relatively small size of genomic fragments of tropical japonica origin in some indica varieties indicates that refined introgression must have occurred by natural crossbreeding in the course of evolution of the black trait in rice. © 2015 American Society of Plant Biologists. All rights reserved.
A chalcone isomerase-like protein enhances flavonoid production and flower pigmentation.
Morita, Yasumasa; Takagi, Kyoko; Fukuchi-Mizutani, Masako; Ishiguro, Kanako; Tanaka, Yoshikazu; Nitasaka, Eiji; Nakayama, Masayoshi; Saito, Norio; Kagami, Takashi; Hoshino, Atsushi; Iida, Shigeru
2014-04-01
Flavonoids are major pigments in plants, and their biosynthetic pathway is one of the best-studied metabolic pathways. Here we have identified three mutations within a gene that result in pale-colored flowers in the Japanese morning glory (Ipomoea nil). As the mutations lead to a reduction of the colorless flavonoid compound flavonol as well as of anthocyanins in the flower petal, the identified gene was designated enhancer of flavonoid production (EFP). EFP encodes a chalcone isomerase (CHI)-related protein classified as a type IV CHI protein. CHI is the second committed enzyme of the flavonoid biosynthetic pathway, but type IV CHI proteins are thought to lack CHI enzymatic activity, and their functions remain unknown. The spatio-temporal expression of EFP and structural genes encoding enzymes that produce flavonoids is very similar. Expression of both EFP and the structural genes is coordinately promoted by genes encoding R2R3-MYB and WD40 family proteins. The EFP gene is widely distributed in land plants, and RNAi knockdown mutants of the EFP homologs in petunia (Petunia hybrida) and torenia (Torenia hybrida) had pale-colored flowers and low amounts of anthocyanins. The flavonol and flavone contents in the knockdown petunia and torenia flowers, respectively, were also significantly decreased, suggesting that the EFP protein contributes in early step(s) of the flavonoid biosynthetic pathway to ensure production of flavonoid compounds. From these results, we conclude that EFP is an enhancer of flavonoid production and flower pigmentation, and its function is conserved among diverse land plant species. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.
Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K
1999-03-01
The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.
Directory of Open Access Journals (Sweden)
Dragana D Bozic
2014-01-01
Interpretation & conclusions: o0 ur study demonstrated that three newly-synthesized chalcones exhibited significant anti-MRSA effect and synergism with non-β-lactam antibiotics. The most effective compound was 1,3-Bis-(2-hydroxy-phenyl-propenone. Our results provide useful information for future research of possible application of chalcones in combination with conventional anti-MRSA therapy as promising new antimicrobial agents.
Directory of Open Access Journals (Sweden)
Lin-Hui Gao
2018-01-01
Full Text Available Objective: To clone and investigate two dehydrodolichyl diphosphate synthase genes of Tripterygium wilfordii by bioinformatics and tissue expression analysis. Materials and Methods: According to the T. wifordii transcriptome database, specific primers were designed to clone the TwDHDDS1 and TwDHDDS2 genes via PCR. Based on the cloned sequences, protein structure prediction, multiple sequence alignment and phylogenetic tree construction were performed. The expression levels of the genes in different tissues of T. wilfordii were measured by real-time quantitative PCR. Results: The TwDHDDS1 gene encompassed a 873 bp open reading frame (ORF and encoded a protein of 290 amino acids. The calculated molecular weight of the translated protein was about 33.46 kDa, and the theoretical isoelectric point (pI was 8.67. The TwDHDDS2 encompassed a 768 bp ORF, encoding a protein of 255 amino acids with a calculated molecular weight of about 21.19 kDa, and a theoretical isoelectric point (pI of 7.72. Plant tissue expression analysis indicated that TwDHDDS1 and TwDHDDS2 both have relatively ubiquitous expression in all sampled organ tissues, but showed the highest transcription levels in the stems. Conclusions: The results of this study provide a basis for further functional studies of TwDHDDS1 and TwDHDDS2. Most importantly, these genes are promising genetic targets for the regulation of the biosynthetic pathways of important bioactive terpenoids such as triptolide.
Lievers, K.J.; Kluijtmans, L.A.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraay-Emmerzaal, van D.; Heijer, den M.; Trijbels, F.J.M.; Blom, H.J.
2001-01-01
Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine -synthase (CBS) deficiency has been excluded as a major
International Nuclear Information System (INIS)
Srinivasulu, P.V.; Adinarayana, M.; Sethuram, B.; Rao, T.N.
1985-01-01
Kinetics of OsOsub(4) catalyzed oxidation of chalcones by Cesup(4+) was studied in aqueous acetic-sulfuric acid medium in the temperature range 313 to 338 K. The order in oxidant is zero while the order with respect to substrate and catalyst are each fractional. The rate of the reaction decreased with increase in percentage of acetic acid while [Hsup(+)] had practically no effect on the rate. The rates of various substituted chalcones are given. A mechanism in which formation of a cyclic ester between chalcone and OsOsub(4) in a fast step followed by its decomposition in a rate-determining step is envisaged. (author)
Directory of Open Access Journals (Sweden)
Parvaiz Ahmad
2016-11-01
Full Text Available The present experiment was designed to assess the effects of seed soaking with 24-epibrassinolide (EBR on the physiology of Brassica juncea L. seedlings grown under imidacloprid (IMI toxicity. Application of EBR increased the length of seedlings, dry weight, and pigment contents, polyphenols, total phenols and organic acids under IMI toxicity. The expression of genes coding key enzymes of pigment, phenols, polyphenols and organic acid biosynthetic pathways was also studied including CHLASE (chlorophyllase, PSY (phytoene synthase, CHS (chalcone synthase and PAL (phenylalanine ammonialyase, CS (citrate synthase, SUCLG1 (succinyl Co-A ligase,, SDH (succinate dehydrogenase, FH (fumarate hydratase, MS (malate synthase. Multiple linear regression analysis revealed that IMI application regressed negatively on seedling length, dry weight and total chlorophyll content. However, EBR seed treatment regressed positively on all of the parameters studied. Moreover, interaction between IMI and EBR showed positive regression for growth parameters, content of pigments, total polyphenol, total phenol and malate, and expression of PSY and PAL. Negative interactions were noticed for the contents of fumarate, succinate and citrate, and expression of CHS and all genes studied related to organic acid metabolism. In conclusion, EBR enhanced the growth and contents of all studied metabolites by regulating the gene expression of B. juncea seedlings under IMI stress.
Directory of Open Access Journals (Sweden)
Smrati Mishra
Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.
Directory of Open Access Journals (Sweden)
T. Angeline
2011-01-01
Full Text Available The objective of the study is to find out whether the endothelial nitric oxide synthase (eNOS G894T single-nucleotide polymorphism is associated with type 2 diabetes mellitus in South Indian (Tamil population. A total number of 260 subjects comprising 100 type 2 diabetic mellitus patients and 160 healthy individuals with no documented history of diabetes were included for the study. DNA was isolated, and eNOS G894T genotyping was performed using the polymerase chain reaction followed by restriction enzyme analysis using Ban II. The genotype distribution in patients and controls were compatible with the Hardy-Weinberg expectations (P>0.05. Odds ratio indicates that the occurrence of mutant genotype (GT/TT was 7.2 times (95% CI = 4.09–12.71 more frequent in the cases than in controls. Thus, the present study demonstrates that there is an association of endothelial nitric oxide synthase gene (G894T polymorphism with diabetes mellitus among South Indians.
Lievers, K.J.; Kluijtmans, L.A.J.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraaij-Emmerzaal, D. van; Heijer, M. den; Trijbels, J.M.F.; Blom, H.J.
2001-01-01
Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine beta-synthase (CBS) deficiency has been excluded as a major
Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling
2016-01-01
Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Cloning and sequence analysis of putative type II fatty acid synthase ...
Indian Academy of Sciences (India)
Prakash
Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.
Directory of Open Access Journals (Sweden)
Patrick C Y Woo
Full Text Available BACKGROUND: The genome of P. marneffei, the most important thermal dimorphic fungus causing respiratory, skin and systemic mycosis in China and Southeast Asia, possesses 23 polyketide synthase (PKS genes and 2 polyketide synthase nonribosomal peptide synthase hybrid (PKS-NRPS genes, which is of high diversity compared to other thermal dimorphic pathogenic fungi. We hypothesized that the yellow pigment in the mold form of P. marneffei could also be synthesized by one or more PKS genes. METHODOLOGY/PRINCIPAL FINDINGS: All 23 PKS and 2 PKS-NRPS genes of P. marneffei were systematically knocked down. A loss of the yellow pigment was observed in the mold form of the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants. Sequence analysis showed that PKS11 and PKS12 are fungal non-reducing PKSs. Ultra high performance liquid chromatography-photodiode array detector/electrospray ionization-quadruple time of flight-mass spectrometry (MS and MS/MS analysis of the culture filtrates of wild type P. marneffei and the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants showed that the yellow pigment is composed of mitorubrinic acid and mitorubrinol. The survival of mice challenged with the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants was significantly better than those challenged with wild type P. marneffei (P<0.05. There was also statistically significant decrease in survival of pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants compared to wild type P. marneffei in both J774 and THP1 macrophages (P<0.05. CONCLUSIONS/SIGNIFICANCE: The yellow pigment of the mold form of P. marneffei is composed of mitorubrinol and mitorubrinic acid. This represents the first discovery of PKS genes responsible for mitorubrinol and mitorubrinic acid biosynthesis. pks12 and pks11 are probably responsible for sequential use in the biosynthesis of mitorubrinol and mitorubrinic acid
Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution
International Nuclear Information System (INIS)
Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi
2010-01-01
The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.
Transgene-induced gene silencing is not affected by a change in ploidy level.
Directory of Open Access Journals (Sweden)
Daniela Pignatta
Full Text Available BACKGROUND: Whole genome duplication, which results in polyploidy, is a common feature of plant populations and a recurring event in the evolution of flowering plants. Polyploidy can result in changes to gene expression and epigenetic instability. Several epigenetic phenomena, occurring at the transcriptional or post-transcriptional level, have been documented in allopolyploids (polyploids derived from species hybrids of Arabidopsis thaliana, yet findings in autopolyploids (polyploids derived from the duplication of the genome of a single species are limited. Here, we tested the hypothesis that an increase in ploidy enhances transgene-induced post-transcriptional gene silencing using autopolyploids of A. thaliana. METHODOLOGY/PRINCIPAL FINDINGS: Diploid and tetraploid individuals of four independent homozygous transgenic lines of A. thaliana transformed with chalcone synthase (CHS inverted repeat (hairpin constructs were generated. For each line diploids and tetraploids were compared for efficiency in post-transcriptional silencing of the endogenous CHS gene. The four lines differed substantially in their silencing efficiency. Yet, diploid and tetraploid plants derived from these plants and containing therefore identical transgene insertions showed no difference in the efficiency silencing CHS as assayed by visual scoring, anthocyanin assays and quantification of CHS mRNA. CONCLUSIONS/SIGNIFICANCE: Our results in A. thaliana indicated that there is no effect of ploidy level on transgene-induced post-transcriptional gene silencing. Our findings that post-transcriptional mechanisms were equally effective in diploids and tetraploids supports the use of transgene-driven post-transcriptional gene silencing as a useful mechanism to modify gene expression in polyploid species.
Ashihara, Hiroshi; Deng, Wei-Wei; Mullen, William; Crozier, Alan
2010-04-01
The distribution of phenolic compounds in young and developing leaves, stems, main and lateral roots and cotyledons of 8-week-old tea (Camellia sinensis) seedlings was investigated using HPLC-MS(2). Fourteen compounds, flavan-3-ols, chlorogenic acids, and kaempferol-O-glycosides, were identified on the basis of their retention time, absorbance spectrum, and MS fragmentation pattern. The major phenolics were (-)-epigallocatechin-3-O-gallate and (-)-epicatechin-3-O-gallate, located principally in the green parts of the seedlings. Considerable amounts of radioactivity from [ring-(14)C]phenylalanine were incorporated in (-)-epicatechin, (-)-epigallocatechin, (-)-epicatechin-3-O-gallate and (-)-epigallocatechin-3-O-gallate, by tissues of young and developing leaves and stems. Expression of genes encoding enzymes involved in flavan-3-ol biosynthesis, CHS, CHI, F3H, F3'5'H, DFR, ANS, ANR and LAR was investigated. Transcripts of all genes, except LAR, were more abundant in leaves and stems than in roots and cotyledons. No significant difference was found in the amount of transcript of LAR. These findings indicate that in tea seedlings flavan-3-ols are produced by a naringenin-chalcone-->naringenin-->dihydrokaempferol pathway. Dihydrokaempferol is a branch point in the synthesis of (-)-epigallocatechin-3-O-gallate and other flavan-3-ols which can be formed by routes beginning with either a flavonoid 3'-hydroxylase mediated conversion of the flavonol to dihydroquercetin or a flavonoid 3',5'-hydroxylase-catalysed conversion to dihydromyricetin with subsequent steps involving sequential reactions catalysed by dihydroflavanol 4-reductase, anthocyanidin synthase, anthocyanidin reductase and flavan-3-ol gallate synthase. Copyright 2010 Elsevier Ltd. All rights reserved.
Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk
2014-02-01
Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Yahyaa, Mosaab; Matsuba, Yuki; Brandt, Wolfgang; Doron-Faigenboim, Adi; Bar, Einat; McClain, Alan; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim; Pichersky, Eran; Ibdah, Mwafaq
2015-01-01
Bay laurel (Laurus nobilis) is an agriculturally and economically important dioecious tree in the basal dicot family Lauraceae used in food and drugs and in the cosmetics industry. Bay leaves, with their abundant monoterpenes and sesquiterpenes, are used to impart flavor and aroma to food, and have also drawn attention in recent years because of their potential pharmaceutical applications. To identify terpene synthases (TPSs) involved in the production of these volatile terpenes, we performed RNA sequencing to profile the transcriptome of L. nobilis leaves. Bioinformatic analysis led to the identification of eight TPS complementary DNAs. We characterized the enzymes encoded by three of these complementary DNAs: a monoterpene synthase that belongs to the TPS-b clade catalyzes the formation of mostly 1,8-cineole; a sesquiterpene synthase belonging to the TPS-a clade catalyzes the formation of mainly cadinenes; and a diterpene synthase of the TPS-e/f clade catalyzes the formation of geranyllinalool. Comparison of the sequences of these three TPSs indicated that the TPS-a and TPS-b clades of the TPS gene family evolved early in the evolution of the angiosperm lineage, and that geranyllinalool synthase activity is the likely ancestral function in angiosperms of genes belonging to an ancient TPS-e/f subclade that diverged from the kaurene synthase gene lineages before the split of angiosperms and gymnosperms. PMID:26157114
Directory of Open Access Journals (Sweden)
Hongxia Miao
Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.
Liu, Weixin; Xu, Biyu; Jin, Zhiqiang
2014-01-01
Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384
Functional Characterization of Sesquiterpene Synthase from Polygonum minus
Directory of Open Access Journals (Sweden)
Su-Fang Ee
2014-01-01
Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.
Joung, Jae-youl; Kasthuri, G Mangai; Park, Ji-young; Kang, Won-jin; Kim, Hyun-soon; Yoon, Bong-sik; Joung, Hyouk; Jeon, Jae-heung
2003-03-28
We isolated the chalcone reductase (pl-chr) gene of Pueraria montana var. lobata by using a PCR strategy from cDNA pools of storage roots. A high level of expression of RNA was found in both stems and roots. The genomic Southern blot result suggests that pl-chr exists as a member of a small gene family. By introducing a pl-chr gene under the control of the 35S CaMV promoter into the pink-flowering Xanthi line of Nicotiana tabacum, the flower color was changed from pink to white-to-pink. The contents of anthocyanin in the flowers of the transgenic lines were dramatically decreased by 40%, but the total UV absorption compounds remained unchanged. The production of liquiritigenin in pl-chr overexpressed transgenic tobacco lines was confirmed by HPLC and MS analysis. The introduction of pl-chr gene provides a method to redirect the flavonoid pathway into 5'-deoxyflavonoid production in non-legume crops, in order to manipulate the phenylpropanoid pathway for isoflavonoid production.
Transcriptome analysis of a petal anthocyanin polymorphism in the arctic mustard, Parrya nudicaulis.
Directory of Open Access Journals (Sweden)
Timothy Butler
Full Text Available Angiosperms are renown for their diversity of flower colors. Often considered adaptations to pollinators, the most common underlying pigments, anthocyanins, are also involved in plants' stress response. Although the anthocyanin biosynthetic pathway is well characterized across many angiosperms and is composed of a few candidate genes, the consequences of blocking this pathway and producing white flowers has not been investigated at the transcriptome scale. We take a transcriptome-wide approach to compare expression differences between purple and white petal buds in the arctic mustard, Parrya nudicaulis, to determine which genes' expression are consistently correlated with flower color. Using mRNA-Seq and de novo transcriptome assembly, we assembled an average of 722 bp per gene (49.81% coding sequence based on the A. thaliana homolog for 12,795 genes from the petal buds of a pair of purple and white samples. Our results correlate strongly with qRT-PCR analysis of nine candidate genes in the anthocyanin biosynthetic pathway where chalcone synthase has the greatest difference in expression between color morphs (P/W = ∼7×. Among the most consistently differentially expressed genes between purple and white samples, we found 3× more genes with higher expression in white petals than in purple petals. These include four unknown genes, two drought-response genes (CDSP32, ERD5, a cold-response gene (GR-RBP2, and a pathogen defense gene (DND1. Gene ontology analysis of the top 2% of genes with greater expression in white relative to purple petals revealed enrichment in genes associated with stress responses including cold, drought and pathogen defense. Unlike the uniform downregulation of chalcone synthase that may be directly involved in the loss of petal anthocyanins, the variable expression of several genes with greater expression in white petals suggest that the physiological and ecological consequences of having white petals may be
Directory of Open Access Journals (Sweden)
Elfi Susanti VH
2014-07-01
Full Text Available 5-hydroxy-3',4'-dimethoxy flavone can be efficiently synthesized in two steps via the formation of 2',6'-dihydroxy-3,4-dimethoxy chalcone with good results. 2',6'-dihydroxy-3,4-dimethoxy chalcone as reactants for synthesis of flavones was prepared through Claisen-Schmidt condensation reaction between 2,6-dihydroxyacetophenones,3,4-dimethoxybenzaldehyde and solid NaOH in mortar for 15 min. The yield of the product (70% is higher than conventional method (65%. This chalcone then oxidatively cyclized with iodine to form 5-hydroxy-3',4'-dimethoxy flavone (yield 62%. Compounds synthesized were characterized by spectroscopic (IR, 1H-NMR, and 13C-NMR.
Directory of Open Access Journals (Sweden)
Sándor B. Ötvös
2016-03-01
Full Text Available Flow chemistry-based syntheses of deuterium-labeled analogs of important antidiabetic chalcones were achieved via highly controlled partial C≡C bond deuteration of the corresponding 1,3-diphenylalkynones. The benefits of a scalable continuous process in combination with on-demand electrolytic D2 gas generation were exploited to suppress undesired over-reactions and to maximize reaction rates simultaneously. The novel deuterium-containing chalcone derivatives may have interesting biological effects and improved metabolic properties as compared with the parent compounds.
Cloning and expression of pineapple sucrose- phosphate synthase ...
African Journals Online (AJOL)
hope&shola
2010-12-06
Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.
Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei
Directory of Open Access Journals (Sweden)
Yue Ming
2009-06-01
Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.
Choi, D H
2002-01-01
Photocrosslinkable soluble polyimide and polymethacrylate compound were synthesized for studying the optically induced anisotropy of the thin films. Chalcone group was introduced into the side chain unit of two polymers. We observed a photodimerization behavior between the double bonds in the chalcone group and an optical anisotropy of these materials by irradiation of a linearly polarized UV light (LPL). Optical anisotropy of the thin film was also investigated by using polarized UV absorption spectroscopy.The dynamic property of optical anisotropy in photoreactive polyimide was compared to that in polymethacrylate containing chalcone group in the side chain.
Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V
2010-01-01
Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.
Kar, Swayamsiddha; Mishra, Rohit Kumar; Pathak, Ashutosh; Dikshit, Anupam; Golakoti, Nageswara Rao
2018-03-01
In the recent times, the common diseases like food poisoning, pneumonia, diarrhea etc. have been observed to be drug resistant. The present study deals with the synthesis of known chalcone derivatives using the Claisen-Schmidt condensation and further characterization using UV-vis, IR, 1H NMR, 13C NMR and mass spectrometry. These derivatives were first simulated for their anti-bacterial efficacy in silico and consequently confirmed in vitro to confirm the findings. One of the chalcones, 4-NDM-2‧-HC showed excellent in-vitro antibacterial activity with an IC90 0.43 mg/mL against Vibrio cholerae as compared to commercially available antibiotic gentamicin as the standard. Further, all these tested chalcone derivatives fulfill Lipinski's parameters and show tremendous drug likeness score, confirming their potential as antibacterial leads.
Thomson, Errol M; Kumarathasan, Prem; Calderón-Garcidueñas, Lilian; Vincent, Renaud
2007-10-01
Recent work suggests that air pollution is a risk factor for cerebrovascular and neurodegenerative disease. Effects of inhaled pollutants on the production of vasoactive factors such as endothelin (ET) and nitric oxide (NO) in the brain may be relevant to disease pathogenesis. Inhaled pollutants increase circulating levels of ET-1 and ET-3, and the pituitary is a potential source of plasma ET, but the effects of pollutants on the expression of ET and NO synthase genes in the brain and pituitary are not known. In the present study, Fischer-344 rats were exposed by nose-only inhalation to particles (0, 5, 50mg/m3 EHC-93), ozone (0, 0.4, 0.8 ppm), or combinations of particles and ozone for 4 h. Real-time reverse transcription polymerase chain reaction was used to measure mRNA levels in the cerebral hemisphere and pituitary 0 and 24 h post-exposure. Ozone inhalation significantly increased preproET-1 but decreased preproET-3 mRNAs in the cerebral hemisphere, while increasing mRNA levels of preproET-1, preproET-3, and the ET-converting enzyme (ECE)-1 in the pituitary. Inducible NO synthase (iNOS) was initially decreased in the cerebral hemisphere after ozone inhalation, but increased 24 h post-exposure. Particles decreased tumour necrosis factor (TNF)-alpha mRNA in the cerebral hemisphere, and both particles and ozone decreased TNF-alpha mRNA in the pituitary. Our results show that ozone and particulate matter rapidly modulate the expression of genes involved in key vasoregulatory pathways in the brain and pituitary, substantiating the notion that inhaled pollutants induce cerebrovascular effects.
Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.
2013-01-01
Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150
New eco-friendly animal bone meal catalysts for preparation of chalcones and aza-Michael adducts
Directory of Open Access Journals (Sweden)
Riadi Yassine
2012-06-01
Full Text Available Abstract Two efficient reactions were successfully carried out using Animal Bone Meal (ABM and potassium fluoride or sodium nitrate doped ABMs as new heterogeneous catalysts under very mild conditions. After preparation and characterization of the catalysts, we first report their use in a simple and convenient synthesis of various chalcones by Claisen–Schmidt condensation and then in an aza-Michael addition involving several synthesized chalcones with aromatic amines. All the reactions were carried out at room temperature in methanol; the chalcone synthesis was also achieved in water environment under microwave irradiation. Doping ABM enhances the rate and yield at each reaction. Catalytic activities are discussed and the ability to re-use the ABM is demonstrated. Results For Claisen–Schmidt the use of ABM alone, yields never exceeded 17%. In each entry, KF/ABM and NaNO3/ABM (79-97% gave higher yields than using ABM alone under thermic condition. Also the reaction proceeded under microwave irradiation in good yields (72-94% for KF/ABM and 81-97% for NaNO3/ABM and high purity. For aza-Michael addition the use of ABM doped with KF or NaNO3 increased the catalytic activity remarkably. The very high yields could be noted (84-95% for KF/ABM and 81-94% for NaNO3/ABM. Conclusion The present method is an efficient and selective procedure for the synthesis of chalcones an aza-Michael adducts. The ABM and doped ABMs are a new, inexpensive and attractive solid supports which can contribute to the development of catalytic processes and reduced environmental problems.
Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng
2017-02-01
Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.
Synthesis and Antimicrobial Activity of SomeNovel Benzimidazolyl Chalcones
Directory of Open Access Journals (Sweden)
B. A. Baviskar
2009-01-01
Full Text Available Some novel benzimidazolyl chalcones were synthesized by condensation of N-(4-(1H-benzo[d]imidazol-2-ylphenylacetamide with aromatic aldehydes in presence of aqueous potassium hydroxide solution at room temperature. All the synthesized compounds were characterized on the basis of their IR, 1H NMR spectroscopic data and elemental analysis. All the compounds have been screened for antimicrobial activity by the cup-plate method.
Analysis of genetic variation of inducible nitric oxide synthase and ...
African Journals Online (AJOL)
The genetic diversity of 100 Malaysian native chickens was investigated using polymerase chain reaction-restriction fragment polymorphism (PCR-RFLP) for two candidate genes: inducible nitric oxide synthase (INOS) and natural resistance-associated macrophage protein 1 (NRAMP1). The two genes were selected ...
Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.
Jain, Parul; Tar'an, Bunyamin
2014-11-01
Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.
Mesenzani, Ornella; Massarotti, Alberto; Giustiniano, Mariateresa; Pirali, Tracey; Bevilacqua, Valentina; Caldarelli, Antonio; Canonico, Pierluigi; Sorba, Giovanni; Novellino, Ettore; Genazzani, Armando A; Tron, Gian Cesare
2011-01-15
In the chalcone scaffold, it is thought that the double bond is an important structural linker but it is likely not essential for the interaction with tubulin. Yet, it may be a potential site of metabolic degradation and interaction with biological nucleophiles. In this letter, we have replaced this olefinic portion of chalcones with two metabolically stable and chemically inert heterocyclic rings, namely triazole or tetrazole. Yet, our biologic data suggest that, unlike in other antitubulinic structures, the olephinic ring might not be merely a structural linker. Copyright © 2010 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Toguri, T.; Umemoto, N.; Kobayashi, O.; Ohtani, T.
1993-01-01
Eggplant seedlings (Solanum melongena) grown under red light irradiation showed a normal morphology with green, fully expanded cotyledons. When the seedlings grown under red light were irradiated with ultraviolet-containing white light, anthocyanin synthesis was induced in the hypocotyl tissues, especially when a UV light supplement was added. The accumulation of pigments was closely associated with the expression of genes involved in flavonoid synthesis. These genes include chalcone synthase (CHS) and dihydroflavonol 4-reductase (DFR). Using subtracted probes, which had been enriched for the accumulated mRNA, one white light-responsive cDNA was identified as being a P450 gene by comparison with database sequences. The maximal amino acid homology this cDNA had with other P450s was 36%. This was with CYP71 from avocado (Persea americana). Thus it represents a new P-450 family, which has been named CYP75. The mRNA of this gene was localized in the hypocotyl tissues of eggplant seedlings, which had been white light-irradiated. The transcript was accumulated by changing the light source, as in the case of other flavonoid biosynthesis genes. In delphinidin producing petunia plants, the mRNAs corresponding to the eggplant P-450 and flavonoid biosynthesis genes such as CHS and DFR were most abundant during the mid stage of flower bud development, but could not be detected in leaf tissues. These results suggest that this P-450 gene encodes a hydroxylating enzyme involved in flavonoid biosynthesis. (author)
Cloning and Expression of the PHA Synthase Gene From a Locally Isolated Chromobacterium sp. USM2
Directory of Open Access Journals (Sweden)
Bhubalan, K.
2010-01-01
Full Text Available Chromobacterium sp. USM2, a locally isolated bacterium was found to synthesize poly(3-hydroxybutyrate-co-3-hydroxyvalerate, P(3HB-co-3HV copolymer with high 3HV monomer composition. The PHA synthase gene was cloned and expressed in Cupriavidus necator PHB¯4 to investigate the possibilities of incorporating other monomer. The recombinant successfully incorporated 3-hydroxyhexanoate (3HHx monomer when fed with crude palm kernel oil (CPKO as the sole carbon source. Approximately 63 ± 2 wt% of P(3HB-co-3HHx copolymer with 4 mol% of 3HHx was synthesized from 5 g/L of oil after 48 h of cultivation. In addition, P(3HB-co-3HV-co-3HHx terpolymer with 9 mol% 3HV and 4 mol% 3HHx could be synthesized with a mixture of CPKO and sodium valerate. The presence of 3HV and 3HHx monomers in the copolymer and terpolymer was further confirmed with +H-NMR analysis. This locally isolated PHA synthase has demonstrated its ability to synthesize P(3HB-co-3HHx copolymer from a readily available and renewable carbon source; CPKO, without the addition of 3HHx precursors.
Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling
2014-01-13
Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.
Logemann, Elke; Tavernaro, Annette; Schulz, Wolfgang; Somssich, Imre E.; Hahlbrock, Klaus
2000-01-01
The UV light-induced synthesis of UV-protective flavonoids diverts substantial amounts of substrates from primary metabolism into secondary product formation and thus causes major perturbations of the cellular homeostasis. Results from this study show that the mRNAs encoding representative enzymes from various supply pathways are coinduced in UV-irradiated parsley cells (Petroselinum crispum) with two mRNAs of flavonoid glycoside biosynthesis, encoding phenylalanine ammonia-lyase and chalcone synthase. Strong induction was observed for mRNAs encoding glucose 6-phosphate dehydrogenase (carbohydrate metabolism, providing substrates for the shikimate pathway), 3-deoxyarabinoheptulosonate 7-phosphate synthase (shikimate pathway, yielding phenylalanine), and acyl-CoA oxidase (fatty acid degradation, yielding acetyl-CoA), and moderate induction for an mRNA encoding S-adenosyl-homocysteine hydrolase (activated methyl cycle, yielding S-adenosyl-methionine for B-ring methylation). Ten arbitrarily selected mRNAs representing various unrelated metabolic activities remained unaffected. Comparative analysis of acyl-CoA oxidase and chalcone synthase with respect to mRNA expression modes and gene promoter structure and function revealed close similarities. These results indicate a fine-tuned regulatory network integrating those functionally related pathways of primary and secondary metabolism that are specifically required for protective adaptation to UV irradiation. Although the response of parsley cells to UV light is considerably broader than previously assumed, it contrasts greatly with the extensive metabolic reprogramming observed previously in elicitor-treated or fungus-infected cells. PMID:10677554
Energy Technology Data Exchange (ETDEWEB)
Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)
1995-08-28
Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.
Isolation of developing secondary xylem specific cellulose synthase ...
Indian Academy of Sciences (India)
The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from .... the First strand cDNA synthesis kit (Fermentas, Pittsburgh,. USA). .... ing height of the rooted cutting, girth of the stem, leaf area.
International Nuclear Information System (INIS)
Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.
2017-01-01
Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)
Methods for transient assay of gene function in floral tissues
Directory of Open Access Journals (Sweden)
Pathirana Nilangani N
2007-01-01
Full Text Available Abstract Background There is considerable interest in rapid assays or screening systems for assigning gene function. However, analysis of gene function in the flowers of some species is restricted due to the difficulty of producing stably transformed transgenic plants. As a result, experimental approaches based on transient gene expression assays are frequently used. Biolistics has long been used for transient over-expression of genes of interest, but has not been exploited for gene silencing studies. Agrobacterium-infiltration has also been used, but the focus primarily has been on the transient transformation of leaf tissue. Results Two constructs, one expressing an inverted repeat of the Antirrhinum majus (Antirrhinum chalcone synthase gene (CHS and the other an inverted repeat of the Antirrhinum transcription factor gene Rosea1, were shown to effectively induce CHS and Rosea1 gene silencing, respectively, when introduced biolistically into petal tissue of Antirrhinum flowers developing in vitro. A high-throughput vector expressing the Antirrhinum CHS gene attached to an inverted repeat of the nos terminator was also shown to be effective. Silencing spread systemically to create large zones of petal tissue lacking pigmentation, with transmission of the silenced state spreading both laterally within the affected epidermal cell layer and into lower cell layers, including the epidermis of the other petal surface. Transient Agrobacterium-mediated transformation of petal tissue of tobacco and petunia flowers in situ or detached was also achieved, using expression of the reporter genes GUS and GFP to visualise transgene expression. Conclusion We demonstrate the feasibility of using biolistics-based transient RNAi, and transient transformation of petal tissue via Agrobacterium infiltration to study gene function in petals. We have also produced a vector for high throughput gene silencing studies, incorporating the option of using T-A cloning to
Ultrasound accelerated Claisen-Schmidt condensation: A green route to chalcones
International Nuclear Information System (INIS)
Calvino, V.; Picallo, M.; Lopez-Peinado, A.J.; Martin-Aranda, R.M.; Duran-Valle, C.J.
2006-01-01
Chalcones have been synthesized under sonochemical irradiation by Claisen-Schmidt condensation between benzaldehyde and acetophenone. Two basic activated carbons (Na and Cs-Norit) have been used as catalysts. The effect of the ultrasound activation has been studied. A substantial enhancing effect in the yield was observed when the carbon catalyst was activated under ultrasonic waves. This 'green' method (combination of alkaline-doped carbon catalyst and ultrasound waves) has been applied to the synthesis of several chalcones with antibacterial properties achieving, in all cases, excellent activities and selectivities. A comparative study under non-sonic activation has showed that the yields are lower in silent conditions, indicating that the sonication exerts a positive effect on the activity of the catalyst. Cs-doped carbon is presented as the optimum catalyst, giving excellent activity for this type of condensation. Cs-Norit carbon catalyst can compete with the traditional NaOH/EtOH when the reaction is carried out under ultrasounds. The role of solvent in this reaction was studied with ethanol. High conversion was obtained in absence of solvent. The carbons were characterized by thermal analysis, nitrogen adsorption and X-ray photoelectron spectroscopy
Directory of Open Access Journals (Sweden)
Bin Tang
2018-01-01
Full Text Available The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS and trehalose-6-phosphate phosphatase (TPP pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects.
Zhu, Yueming; Zhang, Jun; Wei, Dongsheng; Wang, Yufan; Chen, Xiaoyun; Xing, Laijun; Li, Mingchun
2008-08-01
A slightly thermophilic strain, CBS-01, producing trehalose synthase (TreS), was isolated from geothermal water in this study. According to the phenotypic characteristics and phylogenetic analysis of the 16s rRNA gene sequence, it was identified as Meiothermus ruber. The trehalose synthase gene of Meiothermus ruber CBS-01 was cloned by polymerase chain reaction and sequenced. The TreS gene consisted of 2,895 nucleotides, which specified a 964-amino-acid protein. This novel TreS catalyzed reversible interconversion of maltose and trehalose.
Synthesis and evaluation of modified chalcone based p53 stabilizing agents
Iftikhar, Sunniya; Khan, Sardraz; Bilal, Aishah; Manzoor, Safia; Abdullah, Muhammad; Emwas, Abdul-Hamid M.; Sioud, Salim; Gao, Xin; Chotana, Ghayoor Abbas; Faisal, Amir; Saleem, Rahman Shah Zaib
2017-01-01
Tumor suppressor protein p53 induces cell cycle arrest and apoptotic cell death in response to various cellular stresses thereby preventing cancer development. Activation and stabilization of p53 through small organic molecules is, therefore, an attractive approach for the treatment of cancers retaining wild-type p53. In this context, a series of nineteen chalcones with various substitution patterns of functional groups including chloro, fluoro, methoxy, nitro, benzyloxy, 4-methyl benzyloxy was prepared using Claisen-Schmidt condensation. The compounds were characterized using NMR, HRMS, IR and melting points. Evaluation of synthesized compounds against human colorectal (HCT116) and breast (Cal-51) cancer cell lines revealed potent antiproliferative activities. Nine compounds displayed GI50 values in the low micromolar to submicromolar range; for example (E)-1-phenyl-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (SSE14108) showed GI50 of 0.473 ± 0.043 µM against HCT116 cells. Further analysis of these compounds revealed that (E)-3-(4-chlorophenyl)-1-phenylprop-2-en-1-one (SSE14105) and (E)-3-(4-methoxyphenyl)-1-phenylprop-2-en-1-one (SSE14106) caused rapid (4 and 8-hour post-treatment) accumulation of p53 in HCT116 cells similar to its induction by positive control, Nutlin-3. Such activities were absent in 3-(4-methoxyphenyl)propiophenone (SSE14106H2) demonstrating the importance of conjugated ketone for antiproliferative and p53 stabilizing activity of the chalcones. We further evaluated p53 levels in the presence of cycloheximide (CHX) and the results showed that the p53 stabilization was regulated at post-translational level through blockage of its degradation. These chalcones can, therefore, act as fragment leads for further structure optimization to obtain more potent p53 stabilizing agents with enhanced anti-proliferative activities.
Synthesis and evaluation of modified chalcone based p53 stabilizing agents
Iftikhar, Sunniya
2017-07-15
Tumor suppressor protein p53 induces cell cycle arrest and apoptotic cell death in response to various cellular stresses thereby preventing cancer development. Activation and stabilization of p53 through small organic molecules is, therefore, an attractive approach for the treatment of cancers retaining wild-type p53. In this context, a series of nineteen chalcones with various substitution patterns of functional groups including chloro, fluoro, methoxy, nitro, benzyloxy, 4-methyl benzyloxy was prepared using Claisen-Schmidt condensation. The compounds were characterized using NMR, HRMS, IR and melting points. Evaluation of synthesized compounds against human colorectal (HCT116) and breast (Cal-51) cancer cell lines revealed potent antiproliferative activities. Nine compounds displayed GI50 values in the low micromolar to submicromolar range; for example (E)-1-phenyl-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (SSE14108) showed GI50 of 0.473 ± 0.043 µM against HCT116 cells. Further analysis of these compounds revealed that (E)-3-(4-chlorophenyl)-1-phenylprop-2-en-1-one (SSE14105) and (E)-3-(4-methoxyphenyl)-1-phenylprop-2-en-1-one (SSE14106) caused rapid (4 and 8-hour post-treatment) accumulation of p53 in HCT116 cells similar to its induction by positive control, Nutlin-3. Such activities were absent in 3-(4-methoxyphenyl)propiophenone (SSE14106H2) demonstrating the importance of conjugated ketone for antiproliferative and p53 stabilizing activity of the chalcones. We further evaluated p53 levels in the presence of cycloheximide (CHX) and the results showed that the p53 stabilization was regulated at post-translational level through blockage of its degradation. These chalcones can, therefore, act as fragment leads for further structure optimization to obtain more potent p53 stabilizing agents with enhanced anti-proliferative activities.
Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele
2015-08-01
Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Berta Alquézar
2017-08-01
Full Text Available Citrus aroma and flavor, chief traits of fruit quality, are derived from their high content in essential oils of most plant tissues, including leaves, stems, flowers, and fruits. Accumulated in secretory cavities, most components of these oils are volatile terpenes. They contribute to defense against herbivores and pathogens, and perhaps also protect tissues against abiotic stress. In spite of their importance, our understanding of the physiological, biochemical, and genetic regulation of citrus terpene volatiles is still limited. The availability of the sweet orange (Citrus sinensis L. Osbeck genome sequence allowed us to characterize for the first time the terpene synthase (TPS family in a citrus type. CsTPS is one of the largest angiosperm TPS families characterized so far, formed by 95 loci from which just 55 encode for putative functional TPSs. All TPS angiosperm families, TPS-a, TPS-b, TPS-c, TPS-e/f, and TPS-g were represented in the sweet orange genome, with 28, 18, 2, 2, and 5 putative full length genes each. Additionally, sweet orange β-farnesene synthase, (Z-β-cubebene/α-copaene synthase, two β-caryophyllene synthases, and three multiproduct enzymes yielding β-cadinene/α-copaene, β-elemene, and β-cadinene/ledene/allo-aromandendrene as major products were identified, and functionally characterized via in vivo recombinant Escherichia coli assays.
International Nuclear Information System (INIS)
Ge Shimei; Xie Baoen; Chen Sanfeng
2006-01-01
The previous report from our laboratory has recently identified a new trpE gene (termed trpE 2 ) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE 1 (G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE 1 (G) while these sequence features did not exist in front of trpE 2 . The β-galactosidase activity of an A. brasilense strain carrying a trpE 2 -lacZ fusion remained constant at different tryptophan concentrations, but the β-galactosidase activity of the same strain carrying a trpE 1 (G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE 1 (G) is regulated at the transcriptional level by attenuation while trpE 2 is constantly expressed. The anthranilate synthase assays with trpE 1 (G) - and trpE 2 - mutants demonstrated that TrpE 1 (G) fusion protein is feedback inhibited by tryptophan while TrpE 2 protein is not. We also found that both trpE 1 (G) and trpE 2 gene products were involved in IAA synthesis
Crystal structure determination from powder diffraction data of the coumarin vanillin chalcone
Czech Academy of Sciences Publication Activity Database
Ghouili, A.; Rohlíček, Jan; Ayed, T.B.; Hassen, R.B.
2014-01-01
Roč. 29, č. 4 (2014), s. 361-365 ISSN 0885-7156 Grant - others:AV ČR(CZ) Praemium Academiae Institutional support: RVO:68378271 Keywords : chalcone * absorption spectra * powder diffraction * crystal structure determination * coumarin derivatives Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.636, year: 2014
Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep
2015-10-01
GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.
Valerophenone synthase-like chalcone synthase homologues in Humulus lupulus
Czech Academy of Sciences Publication Activity Database
Novák, Petr; Matoušek, Jaroslav; Bříza, Jindřich
2003-01-01
Roč. 46, - (2003), s. 375-381 ISSN 0006-3134 R&D Projects: GA ČR GA521/99/1591 Institutional research plan: CEZ:AV0Z5051902 Keywords : plant genetic Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.919, year: 2003
Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H
2004-01-01
The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed
Directory of Open Access Journals (Sweden)
Hiroaki Iwasaka
2018-04-01
Full Text Available Labyrinthulomycetes have been regarded as a promising industrial source of xanthophylls, including astaxanthin and canthaxanthin, polyunsaturated fatty acids such as docosahexaenoic acid and docosapentaenoic acid, ω-3 oils, and terpenic hydrocarbons, such as sterols and squalene. A Thraustochytrid, Aurantiochytrium sp. KH105 produces carotenoids, including astaxanthin, with strong antioxidant activity. To gain genomic insights into this capacity, we decoded its 97-Mbp genome and characterized genes for enzymes involved in carotenoid biosynthesis. Interestingly, all carotenogenic genes, as well as other eukaryotic genes, appeared duplicated, suggesting that this strain is diploid. In addition, among the five genes involved in the pathway from geranylgeranyl pyrophosphate to astaxanthin, geranylgeranyl phytoene synthase (crtB, phytoene desaturase (crtI and lycopene cyclase (crtY were fused into single gene (crtIBY with no internal stop codons. Functionality of the trifunctional enzyme, CrtIBY, to catalyze the reaction from geranylgeranyl diphosphate to β-carotene was confirmed using a yeast assay system and mass spectrometry. Furthermore, analyses of differential gene expression showed characteristic up-regulation of carotenoid biosynthetic genes during stationary and starvation phases under these culture conditions. This suggests genetic engineering events to promote more efficient production of carotenoids. We also showed an occurrence of crtIBY in other Thraustochytrid species.
Han, Xuerong; Satoh, Yasuharu; Kuriki, Yumi; Seino, Teruyuki; Fujita, Shinji; Suda, Takanori; Kobayashi, Takanori; Tajima, Kenji
2014-11-01
We successfully isolated one microorganism (UMI-21) from Ulva, a green algae that contains starch. The strain UMI-21 can produce polyhydroxyalkanoate (PHA) from starch, maltotriose, or maltose as a sole carbon source. Taxonomic studies and 16S rDNA sequence analysis revealed that strain UMI-21 was phylogenetically related to species of the genus Massilia. The PHA content under the cultivation condition using a 10-L jar fermentor was 45.5% (w/w). This value was higher than that obtained after cultivation in a flask, suggesting the possibility of large-scale PHA production by UMI-21 from starch. A major issue for the industrial production of microbial PHAs is the very high production cost. Starch is a relatively inexpensive substrate that is also found in abundant seaweeds such as Ulva. Therefore, the strain isolated in this study may be very useful for producing PHA from seaweeds containing polysaccharides such as starch. In addition, a 3.7-kbp DNA fragment containing the whole PHA synthase gene (phaC) was obtained from the strain UMI-21. The results of open reading frame (ORF) analysis suggested that the DNA fragment contained two ORFs, which were composed of 1740 (phaC) and 564 bp (phaR). The deduced amino acid sequence of PhaC from strain UMI-21 shared high similarity with PhaC from Ralstonia eutropha, which is a representative PHA-producing bacterium with a class I PHA synthase. This is the first report for the cloning of the PHA synthase gene from Massilia species. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar
2016-04-01
Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.
A Chalcone Glycoside from the Fruits of Sorbus commixta Hedl.
Directory of Open Access Journals (Sweden)
Kyu Yun Chai
2009-12-01
Full Text Available Sorbus commixta Hedl. (Rosaceae has been traditionally used in oriental countries for the treatment of asthma and other bronchial disorders. In this study, a chalcone glycoside was isolated from the ethyl acetate extract of the fruits of this plant. The compound was identified as neosakuranin based on the spectroscopic analysis and comparion with literature data. This is the first report of isolation of neosakuranin from Sorbus commixta.
Gupta, Dinesh; Ip, Tina; Summers, Michael L; Basu, Chhandak
2015-01-01
Phytol is a diterpene alcohol of medicinal importance and it also has potential to be used as biofuel. We found over production of phytol in Nostoc punctiforme by expressing a 2-Methyl-3-buten-2-ol (MBO) synthase gene. MBO synthase catalyzes the conversion of dimethylallyl pyrophosphate (DMAPP) into MBO, a volatile hemiterpene alcohol, in Pinus sabiniana. The result of enhanced phytol production in N. punctiforme, instead of MBO, could be explained by one of the 2 models: either the presence of a native prenyltransferase enzyme with a broad substrate specificity, or appropriation of a MBO synthase metabolic intermediate by a native geranyl diphosphate (GDP) synthase. In this work, an expression vector with an indigenous petE promoter for gene expression in the cyanobacterium N. punctiforme was constructed and MBO synthase gene expression was successfully shown using reverse transcriptase (RT)-PCR and SDS-PAGE. Gas chromatography--mass spectrophotometry (GC-MS) was performed to confirm phytol production from the transgenic N. punctiforme strains. We conclude that the expression of MBO synthase in N. punctiforme leads to overproduction of an economically important compound, phytol. This study provides insights about metabolic channeling of isoprenoids in cyanobacteria and also illustrates the challenges of bioengineering non-native hosts to produce economically important compounds.
DEFF Research Database (Denmark)
Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny
2007-01-01
Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...
Directory of Open Access Journals (Sweden)
Carolina Ribeiro E Silva
Full Text Available Chalcones present several biological activities and sulfonamide chalcone derivatives have shown important biological applications, including antitumor activity. In this study, genotoxic, cytotoxic, antigenotoxic, and anticytotoxic activities of the sulfonamide chalcone N-{4-[3-(4-nitrophenylprop-2-enoyl]phenyl} benzenesulfonamide (CPN were assessed using the Salmonella typhimurium reverse mutation test (Ames test and the mouse bone marrow micronucleus test. The results showed that CPN caused a small increase in the number of histidine revertant colonies in S. typhimurium strains TA98 and TA100, but not statistically significant (p > 0.05. The antimutagenicity test showed that CPN significantly decreased the number of His+ revertants in strain TA98 at all doses tested (p 0.05. Additionally, CPN co-administered with MMC significantly increased PCE/NCE ratio at all doses tested, demonstrating its anticytotoxic effect. In summary, CPN presented genotoxic, cytotoxic, antigenotoxic, and anticytotoxic properties.
Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).
Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian
2013-12-01
Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Yonghai Fan
2017-12-01
Full Text Available Galactinol synthase (GolS is a key enzyme in raffinose family oligosaccharide (RFO biosynthesis. The finding that GolS accumulates in plants exposed to abiotic stresses indicates RFOs function in environmental adaptation. However, the evolutionary relationships and biological functions of GolS family in rapeseed (Brassica napus and tobacco (Nicotiana tabacum remain unclear. In this study, we identified 20 BnGolS and 9 NtGolS genes. Subcellular localization predictions showed that most of the proteins are localized to the cytoplasm. Phylogenetic analysis identified a lost event of an ancient GolS copy in the Solanaceae and an ancient duplication event leading to evolution of GolS4/7 in the Brassicaceae. The three-dimensional structures of two GolS proteins were conserved, with an important DxD motif for binding to UDP-galactose (uridine diphosphate-galactose and inositol. Expression profile analysis indicated that BnGolS and NtGolS genes were expressed in most tissues and highly expressed in one or two specific tissues. Hormone treatments strongly induced the expression of most BnGolS genes and homologous genes in the same subfamilies exhibited divergent-induced expression. Our study provides a comprehensive evolutionary analysis of GolS genes among the Brassicaceae and Solanaceae as well as an insight into the biological function of GolS genes in hormone response in plants.
Directory of Open Access Journals (Sweden)
Jianrong Wang
2014-12-01
Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.
Energy Technology Data Exchange (ETDEWEB)
Zhou, Lei; Mu, Bo-Zhong [University of Science and Technology (China)], email: bzmu@ecust.edu.cn; Gu, Ji-Dong [The University of Hong Kong (China)], email: jdgu@hkucc.hku.hk
2011-07-01
Petroleum reservoirs represent a special ecosystem consisting of specific temperature, pressure, salt concentration, oil, gas, water, microorganisms and, enzymes among others. This paper presents the characterization of microbial community and the alkyl succinate synthase genes in petroleum reservoir fluids in China. A few samples were analyzed and the physical and chemical characteristics are given in a tabular form. A flow chart shows the methods and procedures for microbial activities. Six petroleum reservoirs were studied using an archaeal 16S rRNA gene-based approach to establish the presence of archaea and the results are given. The correlation of archaeal and bacterial communities with reservoir conditions and diversity of the arachaeal community in water-flooding petroleum reservoirs at different temperatures is also shown. From the study, it can be summarized that, among methane producers, CO2-reducing methanogens are mostly found in oil reservoir ecosystems and as more assA sequences are revealed, more comprehensive molecular probes can be designed to track the activity of anaerobic alkane-degrading organisms in the environment.
Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui
2017-07-01
Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.
Synthesis and anticonvulsant activity of certain chalcone based pyrazoline compounds
Directory of Open Access Journals (Sweden)
Sudhakara Rao Gerapati
2015-09-01
Full Text Available Convulsions are involuntary, violent, spasmodic and prolonged contractions of skeletal muscles. That means a patient may have epilepsy without convulsions and vice versa. Epilepsy is a common neurological abnormality affecting about 1% of the world population. The primary objectives of these synthesized compounds are to suppress seizures and provide neuroprotection by minimizing the effects from seizure attacks. Here some of the chalcones and chalcone based various pyrazolines were evaluated for anticonvulsant activity. Their structures have been elucidated on the basis of elemental analyses and spectroscopic studies (IR, 1H-NMR & Mass spectroscopy. A preliminary evaluation of the prepared compounds has indicated that some of them exhibit moderate to significant anticonvulsant activity compared to a diazepam standard1-3. All compounds were tested for their anticonvulsant activity using maximal electroshock induced convulsions (MES in mice at a dose level of 4 mg/kg.b.w. The compounds Ph1, Ph2 , Py2 ,Py3 and Py4 have shown to good anticonvulsant activity when doses are administered as 25mg/ kg.b.w , reduced the phases of seizures severity and found to be active and also increased survival rate. Remaining compounds are less efficacious.
DEFF Research Database (Denmark)
Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P
1994-01-01
To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...
Directory of Open Access Journals (Sweden)
Sankappa Rai U.
2015-05-01
Full Text Available Synthesis and characterization of new heterocyclic pyrazole chalcones (4a–e and diamide (6a–e derivatives are described. Pyrazole chalcones were synthesized by the reaction of pyrazole aldehydes and suitable aromatic ketones. Diamides were synthesized by the reaction of phthalic acid and amines. Newly synthesized compounds were characterized by spectral studies and their biological activity was assessed in vitro using MCF-7 (human breast adenocarcinoma and HeLa (human cervical tumor cells cell lines. Few of the synthesized molecules inhibited the growth of the human breast cancer cell lines and human cervical tumor cell lines at low micromolar to nanomolar concentrations.
Gas-Pascual, Elisabet; Berna, Anne; Bach, Thomas J; Schaller, Hubert
2014-01-01
The plant sterol pathway exhibits a major biosynthetic difference as compared with that of metazoans. The committed sterol precursor is the pentacyclic cycloartenol (9β,19-cyclolanost-24-en-3β-ol) and not lanosterol (lanosta-8,24-dien-3β-ol), as it was shown in the late sixties. However, plant genome mining over the last years revealed the general presence of lanosterol synthases encoding sequences (LAS1) in the oxidosqualene cyclase repertoire, in addition to cycloartenol synthases (CAS1) and to non-steroidal triterpene synthases that contribute to the metabolic diversity of C30H50O compounds on earth. Furthermore, plant LAS1 proteins have been unambiguously identified by peptidic signatures and by their capacity to complement the yeast lanosterol synthase deficiency. A dual pathway for the synthesis of sterols through lanosterol and cycloartenol was reported in the model Arabidopsis thaliana, though the contribution of a lanosterol pathway to the production of 24-alkyl-Δ(5)-sterols was quite marginal (Ohyama et al. (2009) PNAS 106, 725). To investigate further the physiological relevance of CAS1 and LAS1 genes in plants, we have silenced their expression in Nicotiana benthamiana. We used virus induced gene silencing (VIGS) based on gene specific sequences from a Nicotiana tabacum CAS1 or derived from the solgenomics initiative (http://solgenomics.net/) to challenge the respective roles of CAS1 and LAS1. In this report, we show a CAS1-specific functional sterol pathway in engineered yeast, and a strict dependence on CAS1 of tobacco sterol biosynthesis.
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2017-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2016-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
Synthesis, Antiviral Bioactivity of Novel 4-Thioquinazoline Derivatives Containing Chalcone Moiety
Directory of Open Access Journals (Sweden)
Zhihua Wan
2015-06-01
Full Text Available A series of novel 4-thioquinazoline derivatives containing chalcone moiety were designed, synthesized and systematically evaluated for their antiviral activity against TMV. The bioassay results showed that most of these compounds exhibited moderate to good anti-TMV activity. In particular, compounds M2 and M6 possessed appreciable protection activities against TMV in vivo, with 50% effective concentration (EC50 values of 138.1 and 154.8 μg/mL, respectively, which were superior to that of Ribavirin (436.0 μg/mL. The results indicated that chalcone derivatives containing 4-thioquinazoline moiety could effectively control TMV. Meanwhile, the structure-activity relationship (SAR of the target compounds, studied using the three-dimensional quantitative structure-activity relationship (3D-QSAR method of comparative molecular field analysis (CoMFA based on the protection activities against TMV, demonstrated that the CoMFA model exhibited good predictive ability with the cross-validated q2 and non-cross-validated r2 values of 0.674 and 0.993, respectively. Meanwhile, the microscale thermophoresis (MST experimental showed that the compound M6 may interaction with the tobacco mosaic virus coat protein (TMV CP.
Electronic memory devices based on the chalcone with negative electrostatic potential regions
International Nuclear Information System (INIS)
Yan, Bao-Long; Sun, Ru; Ge, Jian-Feng; Wang, Dong; Li, Hua; Lu, Jian-Mei
2013-01-01
The molecular electrostatic potential (ESP) properties were used for the explanation of organic electric memory ability. Several chalcone compounds, owning a negative ESP region locates at the oxygen atom, were selected in this paper to validate the selection of compounds for organic memory materials. The synthesis, characterization, fabrication of the organic memory devices and the electrical properties for them were reported, and they were shown as WORM (write once read many times) type memory devices. The molecular geometries were optimized by the addition of a changeable electric field in the x direction inside the molecules using FF-DFT (Finite Field-Density Functionary Theory) method. The relationship between ESP of the molecules under different electric field and the property was discussed, and the mechanisms associated with the memory effect were also elucidated from DFT calculation results. - Highlights: • The molecular electrostatic potential (ESP) properties were used. • The chalcone compounds were used for the WORM type device. • The molecular geometries were optimized by the addition of a changeable electric field in the x direction. • The structure–property relationship was discussed
Effects and mechanism of acid rain on plant chloroplast ATP synthase.
Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua
2016-09-01
Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.
Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle
DEFF Research Database (Denmark)
Højlund, Kurt; Beck-Nielsen, Henning
2006-01-01
Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...
Directory of Open Access Journals (Sweden)
Tao Zhou
2015-01-01
Full Text Available The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides.
Hof, van den K.; Berg, van den R.G.; Gravendeel, B.
2008-01-01
Phylogenetic relationships among and within the subsections of the genus Viola are still far from resolved. We present the first organismal phylogeny of predominantly western European species of subsection Rostratae based on the plastid trnS¿trnG intron and intergenic spacer and the nuclear low-copy
DEFF Research Database (Denmark)
Müller, Christian; Hjort, C.M.; Hansen, K.
2002-01-01
In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...
Blue and ultraviolet-B light photoreceptors in parsley cells
International Nuclear Information System (INIS)
Ensminger, P.A.; Schaefer, E.
1992-01-01
The authors studied UV-B photoreception in parsley cell cultures with physiological experiments involving temperature shifts and examined the possible role of flavin in blue and UV-B light photo-reception. Cells irradiated with UV-B light (0.5-15 min) at 2 o C have the same fluence requirement for chalcone synthase and flavonoid induction as controls irradiated at 25 o C. This is indicative of a purely photochemical reaction. Cells fed with riboflavin and irradiated with 6 h of UV-containing white light synthesize higher levels of chalcone synthase and flavonoid than unfed controls. This effect did not occur with blue light. These results indicate that flavin-sensitization requires excitation of flavin and the UV-B light photoreceptor. (author)
Directory of Open Access Journals (Sweden)
Lydia J R Hunter
Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus
Bua-In Saowaluck; Paisooksantivatana Yingyong; Weimer Bart C.; Chowpongpang Srimek
2014-01-01
Cassumunar ginger (Zingiber montanum (Koenig) Link ex Dietr.) is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant an...
Directory of Open Access Journals (Sweden)
Arase Sachiko
2012-03-01
Full Text Available Abstract Background Cytosine methylation is involved in epigenetic control of gene expression in a wide range of organisms. An increasing number of examples indicate that changing the frequency of cytosine methylation in the genome is a feasible tool to engineer novel traits in plants. Although demethylating effects of compounds have been analyzed in human cultured cells in terms of suppressing cancer, their effect in plant cells has not been analyzed extensively. Here, we developed in planta assay systems to detect inhibition of cytosine methylation using plants that contain a transgene transcriptionally silenced by an epigenetic mechanism. Results Seeds of two transgenic plants were used: a petunia line that has been identified as a revertant of the co-suppression of the chalcone synthase-A (CHS-A gene and contains CHS-A transgenes whose transcription is repressed; Nicotiana benthamiana plants that contain the green fluorescent protein (GFP reporter gene whose transcription is repressed through virus-induced transcriptional gene silencing. Seeds of these plants were sown on a medium that contained a demethylating agent, either 5-azacytidine or trichostatin A, and the restoration of the transcriptionally active state of the transgene was detected in seedlings. Using these systems, we found that genistein, a major isoflavonoid compound, inhibits cytosine methylation, thus restoring transgene transcription. Genistein also restored the transcription of an epigenetically silenced endogenous gene in Arabidopsis plants. Conclusions Our assay systems allowed us to assess the inhibition of cytosine methylation, in particular of maintenance of methylation, by compounds in plant cells. These results suggest a novel role of flavonoids in plant cells and that genistein is useful for modifying the epigenetic state of plant genomes.
International Nuclear Information System (INIS)
Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua
2013-01-01
1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)
Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd.
Jin, Mei Lan; Lee, Woo Moon; Kim, Ok Tae
2017-11-15
Oxidosqualene cyclases (OSCs) are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA), RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated) were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG) values calculated by fragments per kilobase million (FPKM). In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1 , and PtCAS2 , were found, in addition to the PtBS (β-amyrin synthase) gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia . All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.
Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd
Directory of Open Access Journals (Sweden)
Mei Lan Jin
2017-11-01
Full Text Available Oxidosqualene cyclases (OSCs are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA, RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG values calculated by fragments per kilobase million (FPKM. In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1, and PtCAS2, were found, in addition to the PtBS (β-amyrin synthase gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia. All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.
Molecular characterization of two alkylresorcylic acid synthases from Sordariomycetes fungi
DEFF Research Database (Denmark)
Ramakrishnan, Dhivya; Tiwari, Manish Kumar; Manoharan, Gomathi
2018-01-01
Two putative type III polyketide synthase genes (PKS) were identified from Sordariomycetes fungi. These two type III PKS genes from Sordaria macrospora (SmPKS) and Chaetomium thermophilum (CtPKS), shared 59.8% sequence identity. Both, full-length and truncated versions of type III PKSs were...
Directory of Open Access Journals (Sweden)
Kawamukai Makoto
2004-11-01
Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.
Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.
2017-01-01
Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...
HAEM SYNTHASE AND COBALT PORPHYRIN SYNTHASE IN VARIOUS MICRO-ORGANISMS.
PORRA, R J; ROSS, B D
1965-03-01
1. The preparation of a crude extract of Clostridium tetanomorphum containing cobalt porphyrin synthase but little haem-synthase activity is described. 2. The properties of cobalt porphyrin synthase in the clostridial extracts is compared with the properties of a haem synthase present in crude extracts of the yeast Torulopsis utilis. 3. Cobalt porphyrin synthase in extracts of C. tetanomorphum inserts Co(2+) ions into the following dicarboxylic porphyrins in descending order of rate of insertion: meso-, deutero- and proto-porphyrins. Esterification renders meso- and deutero-porphyrins inactive as substrates. Neither the tetracarboxylic (coproporphyrin III) nor the octacarboxylic (uroporphyrin III) compounds are converted into cobalt porphyrins by the extract, but the non-enzymic incorporation of Co(2+) ions into these two porphyrins is rapid. These extracts are unable to insert Mn(2+), Zn(2+), Mg(2+) or Cu(2+) ions into mesoporphyrin. 4. Crude extracts of T. utilis readily insert both Co(2+) and Fe(2+) ions into deutero-, meso, and proto-porphyrins. Unlike the extracts of C. tetanomorphum, these preparations catalyse the insertion of Co(2+) ions into deuteroporphyrin more rapidly than into mesoporphyrin. This parallels the formation of haems by the T. utilis extract. 5. Cobalt porphyrin synthase is present in the particulate fraction of the extracts of C. tetanomorphum but requires a heat-stable factor present in the soluble fraction. This soluble factor can be replaced by GSH. 6. Cobalt porphyrin synthase in the clostridial extract is inhibited by iodoacetamide and to a smaller extent by p-chloromercuribenzoate and N-ethylmaleimide. The haem synthases of T. utilis and Micrococcus denitrificans are also inhibited by various thiol reagents.
Citric acid production and citrate synthase genes in distinct strains of ...
African Journals Online (AJOL)
SAM
2014-05-28
May 28, 2014 ... synthase in lactic acid production by A. niger and with the ... A number of microorganisms, including both bacteria and fungi, possess the capacity ..... citric acid production by solid-state fermentation from cassava bagasse and ...
Genome-wide identification, functional and evolutionary analysis of terpene synthases in pineapple.
Chen, Xiaoe; Yang, Wei; Zhang, Liqin; Wu, Xianmiao; Cheng, Tian; Li, Guanglin
2017-10-01
Terpene synthases (TPSs) are vital for the biosynthesis of active terpenoids, which have important physiological, ecological and medicinal value. Although terpenoids have been reported in pineapple (Ananas comosus), genome-wide investigations of the TPS genes responsible for pineapple terpenoid synthesis are still lacking. By integrating pineapple genome and proteome data, twenty-one putative terpene synthase genes were found in pineapple and divided into five subfamilies. Tandem duplication is the cause of TPS gene family duplication. Furthermore, functional differentiation between each TPS subfamily may have occurred for several reasons. Sixty-two key amino acid sites were identified as being type-II functionally divergence between TPS-a and TPS-c subfamily. Finally, coevolution analysis indicated that multiple amino acid residues are involved in coevolutionary processes. In addition, the enzyme activity of two TPSs were tested. This genome-wide identification, functional and evolutionary analysis of pineapple TPS genes provide a new insight into understanding the roles of TPS family and lay the basis for further characterizing the function and evolution of TPS gene family. Copyright © 2017 Elsevier Ltd. All rights reserved.
Santos-Lobato, Bruno Lopes; Borges, Vanderci; Ferraz, Henrique Ballalai; Mata, Ignacio Fernandez; Zabetian, Cyrus P; Tumas, Vitor
2018-04-01
Levodopa-induced dyskinesia (LID) is a common complication of advanced Parkinson's disease (PD). PD physiopathology is associated with dopaminergic and non-dopaminergic pathways, including the nitric oxide system. The present study aims to examine the association of a neuronal nitric oxide synthase gene (NOS1) single nucleotide polymorphism (rs2682826) with LID in PD patients. We studied 186 PD patients using levodopa. The presence of LID was defined as a MDS-UPDRS Part IV score ≥1 on item 4.1. We tested for association between NOS1 rs2682826 and the presence, daily frequency, and functional impact of LID using regression models, adjusting for important covariates. There was no significant association between genotype and any of the LID-related variables examined. Our results suggest that this NOS1 polymorphism does not contribute to LID susceptibility or severity. However, additional studies that include a comprehensive set of NOS1 variants will be needed to fully define the role of this gene in LID. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.
1991-01-01
Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate
Long, Qin; Yue, Fang; Liu, Ruochen; Song, Shuiqing; Li, Xianbi; Ding, Bo; Yan, Xingying; Pei, Yan
2018-05-11
Cotton fibers are the most important natural raw material used in textile industries world-wide. Fiber length, strength, and fineness are the three major traits which determine the quality and economic value of cotton. It is known that exogenous application of phosphatidylinositols (PtdIns), important structural phospholipids, can promote cotton fiber elongation. Here, we sought to increase the in planta production of PtdIns to improve fiber traits. Transgenic cotton plants were generated in which the expression of a cotton phosphatidylinositol synthase gene (i.e., GhPIS) was controlled by the fiber-specific SCFP promoter element, resulting in the specific up-regulation of GhPIS during cotton fiber development. We demonstrate that PtdIns content was significantly enhanced in transgenic cotton fibers and the elevated level of PtdIns stimulated the expression of genes involved in PtdIns phosphorylation as well as promoting lignin/lignin-like phenolic biosynthesis. Fiber length, strength and fineness were also improved in the transgenic plants as compared to the wild-type cotton, with no loss in overall fiber yield. Our data indicate that fiber-specific up-regulation of PtdIns synthesis is a promising strategy for cotton fiber quality improvement.
González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2015-01-01
Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.
Directory of Open Access Journals (Sweden)
Juan Manuel Talia
2011-06-01
Full Text Available Staphylococcus aureus, the most virulent Staphylococcus species, is also the prevalent pathogen isolated from hospitalized patients and the second most common from patients in outpatient settings. In general, bacteria have the genetic ability to transmit and acquire resistance to drugs, which are utilized as therapeutic agents. Related studies of antimicrobial activity indicate that crude extracts containing flavonoids, triterpenes and steroids have showed significative activity against several Staphylococcus aureus strains. Combination effects between flavonoids and antibiotics also have been reported. The aim of the present work was to investigate in vitro synergism between several chalcones substituted in combination with oxacillin, an antibiotic used conventionally against S. aureus ATCC 43 300 that is resistant to meticillin, using the kinetic turbidimetric method developed earlier. The results were satisfactory for all assayed combinations and in accordance with the mechanism of bacteriostatic inhibition previously proposed, except for 2´,4´-dihydroxy-3´-methoxychalcone - oxacillin. The best combination was 2´,3´-dihydroxychalcone - oxacillin (MIC: 11.2 μg/mL. Further investigations are needed to characterize the interaction mechanism with antibiotics. Thus, chalcones - oxacillin combination could lead to the development of new antibiotics against methicillin resistant S. aureus infection.
van der Leij, Feike R.; VISSER, RGF; Ponstein, Anne S.; Jacobsen, Evert; Feenstra, Willem
The genomic sequence of the potato gene for starch granule-bound starch synthase (GBSS; "waxy protein") has been determined for the wild-type allele of a monoploid genotype from which an amylose-free (amf) mutant was derived, and for the mutant part of the amf allele. Comparison of the wild-type
Directory of Open Access Journals (Sweden)
Junjun Wu
Full Text Available Due to increasing concerns about food safety and environmental issues, bio-based production of flavonoids from safe, inexpensive, and renewable substrates is increasingly attracting attention. Here, the complete biosynthetic pathway, consisting of 3-deoxy-D-arabinoheptulosonate 7-phosphate synthase (DAHPS, chorismate mutase/prephenate dehydrogenase (CM/PDH, tyrosine ammonia lyase (TAL, 4-coumarate:CoA ligase (4CL, chalcone synthase (CHS, chalcone isomerase (CHI, malonate synthetase, and malonate carrier protein, was constructed using pre-made modules to overproduce (2S-naringenin from D-glucose. Modular pathway engineering strategies were applied to the production of the flavonoid precursor (2S-naringenin from L-tyrosine to investigate the metabolic space for efficient conversion. Modular expression was combinatorially tuned by modifying plasmid gene copy numbers and promoter strengths to identify an optimally balanced pathway. Furthermore, a new modular pathway from D-glucose to L-tyrosine was assembled and re-optimized with the identified optimal modules to enable de novo synthesis of (2S-naringenin. Once this metabolic balance was achieved, the optimum strain was capable of producing 100.64 mg/L (2S-naringenin directly from D-glucose, which is the highest production titer from D-glucose in Escherichia coli. The fermentation system described here paves the way for the development of an economical process for microbial production of flavonoids.
Directory of Open Access Journals (Sweden)
Wenjun Huang
2016-07-01
Full Text Available Flavonols as plant secondary metabolites with vital roles in plant development and defense against UV light, have been demonstrated to be the main bioactive components in the genus Epimedium plants, several species of which are used as materials for Herba Epimedii, an important traditional Chinese medicine. The flavonol biosynthetic pathway genes had been already isolated from E. sagittatum, but a R2R3-MYB transcription factor regulating the flavonol synthesis has not been functionally characterized so far in Epimedium plants. In this study, we isolated and characterized the R2R3-MYB transcription factor EsMYBF1 involved in regulation of the flavonol biosynthetic pathway from E. sagittatum. Sequence analysis indicated that EsMYBF1 belongs to the subgroup 7 of R2R3-MYB family which contains the flavonol-specific MYB regulators identified to date. Transient reporter assay showed that EsMYBF1 strongly activated the promoters of EsF3H (flavanone 3-hydroxylase and EsFLS (flavonol synthase, but not the promoters of EsDFRs (dihydroflavonol 4-reductase and EsANS (anthocyanidin synthase in transiently transformed Nicotiana benthamiana leaves. Both yeast two-hybrid assay and transient reporter assay validated EsMYBF1 to be independent of EsTT8, or AtTT8 bHLH regulators of the flavonoid pathway as cofactors. Ectopic expression of EsMYBF1 in transgenic tobacco resulted in the increased flavonol content and the decreased anthocyanin content in flowers. Correspondingly, the structural genes involved in flavonol synthesis were upregulated in the EsMYBF1 overexpression lines, including NtCHS (chalcone synthase, NtCHI (chalcone isomerase, NtF3H and NtFLS, whereas the late biosynthetic genes of the anthocyanin pathway (NtDFR and NtANS were remarkably downregulated, compared to the controls. These results suggest that EsMYBF1 is a flavonol-specific R2R3-MYB regulator, and involved in regulation of the biosynthesis of the flavonol-derived bioactive components in E
Kaur, Simerjeet; Dhugga, Kanwarpal S; Beech, Robin; Singh, Jaswinder
2017-11-03
Hemicelluloses are a diverse group of complex, non-cellulosic polysaccharides, which constitute approximately one-third of the plant cell wall and find use as dietary fibres, food additives and raw materials for biofuels. Genes involved in hemicellulose synthesis have not been extensively studied in small grain cereals. In efforts to isolate the sequences for the cellulose synthase-like (Csl) gene family from wheat, we identified 108 genes (hereafter referred to as TaCsl). Each gene was represented by two to three homeoalleles, which are named as TaCslXY_ZA, TaCslXY_ZB, or TaCslXY_ZD, where X denotes the Csl subfamily, Y the gene number and Z the wheat chromosome where it is located. A quarter of these genes were predicted to have 2 to 3 splice variants, resulting in a total of 137 putative translated products. Approximately 45% of TaCsl genes were located on chromosomes 2 and 3. Sequences from the subfamilies C and D were interspersed between the dicots and grasses but those from subfamily A clustered within each group of plants. Proximity of the dicot-specific subfamilies B and G, to the grass-specific subfamilies H and J, respectively, points to their common origin. In silico expression analysis in different tissues revealed that most of the genes were expressed ubiquitously and some were tissue-specific. More than half of the genes had introns in phase 0, one-third in phase 2, and a few in phase 1. Detailed characterization of the wheat Csl genes has enhanced the understanding of their structural, functional, and evolutionary features. This information will be helpful in designing experiments for genetic manipulation of hemicellulose synthesis with the goal of developing improved cultivars for biofuel production and increased tolerance against various stresses.
Directory of Open Access Journals (Sweden)
Linjie Wang
Full Text Available Glycogen synthase kinase 3 (GSK3α and GSK3β are serine/threonine kinases involved in numerous cellular processes and diverse diseases including mood disorders, Alzheimer's disease, diabetes, and cancer. However, in pigs, the information on GSK3 is very limited. Identification and characterization of pig GSK3 are not only important for pig genetic improvement, but also contribute to the understanding and development of porcine models for human disease prevention and treatment.Five different isoforms of GSK3β were identified in porcine different tissues, in which three isoforms are novel. These isoforms had differential expression patterns in the fetal and adult of the porcine different tissues. The mRNA expression level of GSK3β isoforms was differentially regulated during the course of the insulin treatment, suggesting that different GSK3β isoforms may have different roles in insulin signaling pathway. Moreover, GSK3β5 had a different role on regulating the glycogen synthase activity, phosphorylation and the expression of porcine GYS1 and GYS2 gene compared to other GSK3β isoforms.We are the first to report five different isoforms of GSK3β identified from the porcine different tissues. Splice variants of GSK3β exhibit differential activity towards glycogen synthase. These results provide new insight into roles of the GSK3β on regulating glycogen metabolism.
Wang, Feibing; Zhu, Hong; Kong, Weili; Peng, Rihe; Liu, Qingchang; Yao, Quanhong
2016-07-01
A basic helix-loop-helix (bHLH) transcription factor gene from Antirrhinum, AmDEL , increases flavonoids accumulation and enhances salt and drought tolerance via up-regulating flavonoid biosynthesis, proline biosynthesis and ROS scavenging genes in transgenic Arabidopsis. In plants, transcriptional regulation is the most important tools for increasing flavonoid biosynthesis. The AmDEL gene, as a basic helix-loop-helix transcription factor gene from Antirrhinum, has been shown to increase flavonoids accumulation in tomato. However, its role in tolerance to abiotic stresses has not yet been investigated. In this study, the codon-optimized AmDEL gene was chemically synthesized. Subcellular localization analysis in onion epidermal cells indicated that AmDEL protein was localized to the nucleus. Expression analysis in yeast showed that the full length of AmDEL exhibited transcriptional activation. Overexpression of AmDEL significantly increased flavonoids accumulation and enhanced salt and drought tolerance in transgenic Arabidopsis plants. Real-time quantitative PCR analysis showed that overexpression of AmDEL resulted in the up-regulation of genes involved in flavonoid biosynthesis, proline biosynthesis and ROS scavenging under salt and drought stresses. Meanwhile, Western blot and enzymatic analyses showed that the activities of phenylalanine ammonia lyase, chalcone isomerase, dihydroflavonol reductase, pyrroline-5-carboxylate synthase, superoxide dismutase and peroxidase were also increased. Further components analyses indicated that the significant increase of proline and relative water content and the significant reduction of H2O2 and malonaldehyde content were observed under salt and drought stresses. In addition, the rates of electrolyte leakage and water loss were reduced in transgenic plants. These findings imply functions of AmDEL in accumulation of flavonoids and tolerance to salt and drought stresses. The AmDEL gene has the potential to be used to increase
The subcellular localization of yeast glycogen synthase is dependent upon glycogen content
Wilson, Wayne A.; Boyer, Michael P.; Davis, Keri D.; Burke, Michael; Roach, Peter J.
2010-01-01
The budding yeast, Saccharomyces cerevisiae, accumulates the storage polysaccharide glycogen in response to nutrient limitation. Glycogen synthase, the major form of which is encoded by the GSY2 gene, catalyzes the key regulated step in glycogen storage. Here, we utilize Gsy2p fusions to green fluorescent protein (GFP) to determine where glycogen synthase is located within cells. We demonstrate that the localization pattern of Gsy2-GFP depends upon the glycogen content of the cell. When glyco...
Vries, André H.M. de; Feringa, Bernard
1997-01-01
Co(acac)2 in the presence of chiral ligands has been employed as catalyst for the enantioselective conjugate addition of diethylzinc to chalcone. With chiral amino alcohols derived from (+)-camphor, enantioselectivities up to 83% were achieved.
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
International Nuclear Information System (INIS)
Dotson, G.D.; Woodard, R.W.
1994-01-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3 2 H)PEP, (2- 13 C)PEP, and (2- 13 C, 18 O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our 1 H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3- 2 H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3- 2 H)PEP gave predominantly (3S)-(3 2 H)KDO 8-P and (E)-(3- 2 H)PEP gave predominantly (3R)-(3 2 H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2- 13 C, 18 O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both 13 C- and 31 P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the 18 O
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
Energy Technology Data Exchange (ETDEWEB)
Dotson, G.D.; Woodard, R.W. [Univ. of Michigan, Ann Arbor, MI (United States)
1994-12-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.
Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J
2013-12-05
The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.
Niu, Shan-Shan; Xu, Chang-Jie; Zhang, Wang-Shu; Zhang, Bo; Li, Xian; Lin-Wang, Kui; Ferguson, Ian B; Allan, Andrew C; Chen, Kun-Song
2010-03-01
Chinese bayberry (Myrica rubra) is a fruit crop with cultivars producing fruit ranging from white (Shuijing, SJ) to red (Dongkui, DK) and dark red-purple (Biqi, BQ), as a result of different levels of anthocyanin accumulation. Genes encoding the anthocyanin biosynthesis enzymes chalcone synthase, chalcone isomerase, flavanone 3-hydroxylase (F3H), flavonoid 3'-hydroxylase (F3'H), dihydroflavonol 4-reductase (DFR), anthocyanidin synthase (ANS) and UDPglucose: flavonoid 3-O-glucosyltransferase (UFGT), as well as MrMYB1, a R2R3 MYB transcription factor homologous to known activators of anthocyanin biosynthesis, were isolated from ripe fruit of BQ. Differences in mRNA abundance of MrF3H, MrF3'H, MrDFR1, MrANS and MrUFGT were highly correlated with differential accumulation of anthocyanins between cultivars, suggesting coordinated regulation by transcription factors. The transcript level of MrMYB1 was strongly associated with the anthocyanin content in ripe fruit of the three cultivars, as well as different anthocyanin containing tissues of BQ fruit. Fruit bagging strongly inhibited anthocyanin accumulation in fruit as well as the expression of all anthocyanin biosynthetic genes and MrMYB1. Overexpression of MrMYB1 stimulated both anthocyanin accumulation and activated an Arabidopsis-DFR promoter in tobacco (Nicotiana tabacum). MrMYB1d, an allele with a 1 bp deletion at nucleotide 30 of coding sequence, was observed in SJ and DK fruit, suggesting that a nonsense mutation of the MYB1 protein may be responsible for no or low expression of MYB1 in the white and red fruit. These results show that coordinated expression of multiple biosynthetic genes is involved in anthocyanin accumulation in Chinese bayberry fruit, and this is regulated by MrMYB1.
of endothelial nitric oxide synthase gene and serum level of vascular ...
African Journals Online (AJOL)
uwerhiavwe
Davignon and Ganz, 2004). NO is synthe- sized via a reaction that includes the conversion of L- arginine to L-citruline catalyzed by endothelial nitric oxide synthase (eNOS), which is one of the three isoforms of the enzyme (Mayer and Hemmens, 1997) ...
Factors influencing gene silencing of granule-bound starch synthase in potato
Heilersig, H.J.B.
2005-01-01
In the past, antisense RNA technology was used to modify the composition of potato tuber starch. Potato starch comprises amylose and amylopectin, polymers of glucose. Amylose production in potato is completely dependent on the presence of granule-bound starch synthase I (GBSSI). Inhibition of GBSSI
Creelman, R A; Mullet, J E
1991-10-01
Transfer of soybean seedlings to low-water-potential vermiculite (psi w = -0.3 MPa) results in a reversible decrease in hypocotyl growth and modulation of several polysomal mRNAs (Plant Physiol 92: 205-214). We report here the isolation of two cDNA clones (pGE16 and pGE95) which correspond to genes whose mRNA levels are increased, and one cDNA clone (pGE23) which corresponds to a gene whose mRNA level is decreased in the hypocotyl zone of cell elongation by water deficit. In well-watered seedlings mRNAs hybridizing to pGE16 and pGE95 are most abundant in mature regions of the seedling, but in water-deficient seedlings mRNA levels are reduced in mature regions and enhanced in elongating regions. RNA corresponding to soybean proline-rich protein 1 (sbPRP1) shows a similar tissue distribution and response to water deficit. In contrast, in well-watered seedlings, the gene corresponding to pGE23 was highly expressed in the hypocotyl and root growing zones. Transfer of seedlings to low-water-potential vermiculite caused a rapid decrease in mRNA hybridizing to pGE23. Sequence analysis revealed that pGE23 has high homology with beta-tubulin. Water deficit also reduced the level of mRNA hybridizing to JCW1, an auxin-modulated gene, although with different kinetics. Furthermore, mRNA encoding actin, glycine-rich proteins (GRPs), and hydroxyproline-rich glycoproteins (HRGPs) were down-regulated in the hypocotyl zone of elongation of seedlings exposed to water deficit. No effect of water deficit was observed on the expression of chalcone synthase. Decreased expression of beta-tubulin, actin, JCW1, HRGP and GRP and increased expression of sbPRP1, pGE95 and pGE16 in the hypocotyl zone of cell elongation could participate in the reversible growth inhibition observed in water-deficient soybean seedlings.
Role of hydrogen bonds in the reaction mechanism of chalcone isomerase.
Jez, Joseph M; Bowman, Marianne E; Noel, Joseph P
2002-04-23
In flavonoid, isoflavonoid, and anthocyanin biosynthesis, chalcone isomerase (CHI) catalyzes the intramolecular cyclization of chalcones into (S)-flavanones with a second-order rate constant that approaches the diffusion-controlled limit. The three-dimensional structures of alfalfa CHI complexed with different flavanones indicate that two sets of hydrogen bonds may possess critical roles in catalysis. The first set of interactions includes two conserved amino acids (Thr48 and Tyr106) that mediate a hydrogen bond network with two active site water molecules. The second set of hydrogen bonds occurs between the flavanone 7-hydroxyl group and two active site residues (Asn113 and Thr190). Comparison of the steady-state kinetic parameters of wild-type and mutant CHIs demonstrates that efficient cyclization of various chalcones into their respective flavanones requires both sets of contacts. For example, the T48A, T48S, Y106F, N113A, and T190A mutants exhibit 1550-, 3-, 30-, 7-, and 6-fold reductions in k(cat) and 2-3-fold changes in K(m) with 4,2',4'-trihydroxychalcone as a substrate. Kinetic comparisons of the pH-dependence of the reactions catalyzed by wild-type and mutant enzymes indicate that the active site hydrogen bonds contributed by these four residues do not significantly alter the pK(a) of the intramolecular cyclization reaction. Determinations of solvent kinetic isotope and solvent viscosity effects for wild-type and mutant enzymes reveal a change from a diffusion-controlled reaction to one limited by chemistry in the T48A and Y106F mutants. The X-ray crystal structures of the T48A and Y106F mutants support the assertion that the observed kinetic effects result from the loss of key hydrogen bonds at the CHI active site. Our results are consistent with a reaction mechanism for CHI in which Thr48 polarizes the ketone of the substrate and Tyr106 stabilizes a key catalytic water molecule. Hydrogen bonds contributed by Asn113 and Thr190 provide additional
Directory of Open Access Journals (Sweden)
Yao Han
Full Text Available MIGS (miRNA-induced gene silencing is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs. MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase and PDS (phytoene desaturase gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant
Han, Yao; Zhang, Bin; Qin, Xiaoting; Li, Mingyang; Guo, Yulong
2015-01-01
MIGS (miRNA-induced gene silencing) is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs). MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase) and PDS (phytoene desaturase) gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant functions.
Chalcone derivatives cause accumulation of colon cancer cells in the G2/M phase and induce apoptosis
Czech Academy of Sciences Publication Activity Database
Kello, M.; Drutovič, Dávid; Bago Pilátová, M.; Tischlerová, V.; Perjesi, P.; Mojžíš, J.
2016-01-01
Roč. 150, č. 1 (2016), s. 32-38 ISSN 0024-3205 Institutional support: RVO:67985904 Keywords : chalcones * colorectal cancer * antiproliferative Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.936, year: 2016
Directory of Open Access Journals (Sweden)
Fengxia Liu
Full Text Available Rice is a very important food staple that feeds more than half the world's population. Two major Asian cultivated rice (Oryza sativa L. subspecies, japonica and indica, show significant phenotypic variation in their stress responses. However, the molecular mechanisms underlying this phenotypic variation are still largely unknown. A common link among different stresses is that they produce an oxidative burst and result in an increase of reactive oxygen species (ROS. In this study, methyl viologen (MV as a ROS agent was applied to investigate the rice oxidative stress response. We observed that 93-11 (indica seedlings exhibited leaf senescence with severe lesions under MV treatment compared to Nipponbare (japonica. Whole-genome microarray experiments were conducted, and 1,062 probe sets were identified with gene expression level polymorphisms between the two rice cultivars in addition to differential expression under MV treatment, which were assigned as Core Intersectional Probesets (CIPs. These CIPs were analyzed by gene ontology (GO and highlighted with enrichment GO terms related to toxin and oxidative stress responses as well as other responses. These GO term-enriched genes of the CIPs include glutathine S-transferases (GSTs, P450, plant defense genes, and secondary metabolism related genes such as chalcone synthase (CHS. Further insertion/deletion (InDel and regulatory element analyses for these identified CIPs suggested that there may be some eQTL hotspots related to oxidative stress in the rice genome, such as GST genes encoded on chromosome 10. In addition, we identified a group of marker genes individuating the japonica and indica subspecies. In summary, we developed a new strategy combining biological experiments and data mining to study the possible molecular mechanism of phenotypic variation during oxidative stress between Nipponbare and 93-11. This study will aid in the analysis of the molecular basis of quantitative traits.
Directory of Open Access Journals (Sweden)
Maiko Furubayashi
Full Text Available Terpene synthases catalyze the formation of a variety of terpene chemical structures. Systematic mutagenesis studies have been effective in providing insights into the characteristic and complex mechanisms of C-C bond formations and in exploring the enzymatic potential for inventing new chemical structures. In addition, there is growing demand to increase terpene synthase activity in heterologous hosts, given the maturation of metabolic engineering and host breeding for terpenoid synthesis. We have developed a simple screening method for the cellular activities of terpene synthases by scoring their substrate consumption based on the color loss of the cell harboring carotenoid pathways. We demonstrate that this method can be used to detect activities of various terpene synthase or prenyltransferase genes in a high-throughput manner, irrespective of the product type, enabling the mutation analysis and directed evolution of terpene synthases. We also report the possibility for substrate-specific screening system of terpene synthases by taking advantage of the substrate-size specificity of C30 and C40 carotenoid pathways.
Wang, Lei; Albert, Nick W; Zhang, Huaibi; Arathoon, Steve; Boase, Murray R; Ngo, Hanh; Schwinn, Kathy E; Davies, Kevin M; Lewis, David H
2014-11-01
This study confirmed pigment profiles in different colour groups, isolated key anthocyanin biosynthetic genes and established a basis to examine the regulation of colour patterning in flowers of Cymbidium orchid. Cymbidium orchid (Cymbidium hybrida) has a range of flower colours, often classified into four colour groups; pink, white, yellow and green. In this study, the biochemical and molecular basis for the different colour types was investigated, and genes involved in flavonoid/anthocyanin synthesis were identified and characterised. Pigment analysis across selected cultivars confirmed cyanidin 3-O-rutinoside and peonidin 3-O-rutinoside as the major anthocyanins detected; the flavonols quercetin and kaempferol rutinoside and robinoside were also present in petal tissue. β-carotene was the major carotenoid in the yellow cultivars, whilst pheophytins were the major chlorophyll pigments in the green cultivars. Anthocyanin pigments were important across all eight cultivars because anthocyanin accumulated in the flower labellum, even if not in the other petals/sepals. Genes encoding the flavonoid biosynthetic pathway enzymes chalcone synthase, flavonol synthase, flavonoid 3' hydroxylase (F3'H), dihydroflavonol 4-reductase (DFR) and anthocyanidin synthase (ANS) were isolated from petal tissue of a Cymbidium cultivar. Expression of these flavonoid genes was monitored across flower bud development in each cultivar, confirming that DFR and ANS were only expressed in tissues where anthocyanin accumulated. Phylogenetic analysis suggested a cytochrome P450 sequence as that of the Cymbidium F3'H, consistent with the accumulation of di-hydroxylated anthocyanins and flavonols in flower tissue. A separate polyketide synthase, identified as a bibenzyl synthase, was isolated from petal tissue but was not associated with pigment accumulation. Our analyses show the diversity in flower colour of Cymbidium orchid derives not from different individual pigments but from subtle
González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2016-02-01
Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.
Inokuma, H; Brouqui, P; Drancourt, M; Raoult, D
2001-09-01
The sequence of the citrate synthase gene (gltA) of 13 ehrlichial species (Ehrlichia chaffeensis, Ehrlichia canis, Ehrlichia muris, an Ehrlichia species recently detected from Ixodes ovatus, Cowdria ruminantium, Ehrlichia phagocytophila, Ehrlichia equi, the human granulocytic ehrlichiosis [HGE] agent, Anaplasma marginale, Anaplasma centrale, Ehrlichia sennetsu, Ehrlichia risticii, and Neorickettsia helminthoeca) have been determined by degenerate PCR and the Genome Walker method. The ehrlichial gltA genes are 1,197 bp (E. sennetsu and E. risticii) to 1,254 bp (A. marginale and A. centrale) long, and GC contents of the gene vary from 30.5% (Ehrlichia sp. detected from I. ovatus) to 51.0% (A. centrale). The percent identities of the gltA nucleotide sequences among ehrlichial species were 49.7% (E. risticii versus A. centrale) to 99.8% (HGE agent versus E. equi). The percent identities of deduced amino acid sequences were 44.4% (E. sennetsu versus E. muris) to 99.5% (HGE agent versus E. equi), whereas the homology range of 16S rRNA genes was 83.5% (E. risticii versus the Ehrlichia sp. detected from I. ovatus) to 99.9% (HGE agent, E. equi, and E. phagocytophila). The architecture of the phylogenetic trees constructed by gltA nucleotide sequences or amino acid sequences was similar to that derived from the 16S rRNA gene sequences but showed more-significant bootstrap values. Based upon the alignment analysis of the ehrlichial gltA sequences, two sets of primers were designed to amplify tick-borne Ehrlichia and Neorickettsia genogroup Ehrlichia (N. helminthoeca, E. sennetsu, and E. risticii), respectively. Tick-borne Ehrlichia species were specifically identified by restriction fragment length polymorphism (RFLP) patterns of AcsI and XhoI with the exception of E. muris and the very closely related ehrlichia derived from I. ovatus for which sequence analysis of the PCR product is needed. Similarly, Neorickettsia genogroup Ehrlichia species were specifically identified by
International Nuclear Information System (INIS)
Sá-Moura, Bebiana; Albuquerque, Luciana; Empadinhas, Nuno; Costa, Milton S. da; Pereira, Pedro José Barbosa; Macedo-Ribeiro, Sandra
2008-01-01
The enzyme mannosyl-3-phosphoglycerate synthase from R. xylanophilus has been expressed, purified and crystallized. The crystals belong to the hexagonal space group P6 5 22 and diffract to 2.2 Å resolution. Rubrobacter xylanophilus is the only Gram-positive bacterium known to synthesize the compatible solute mannosylglycerate (MG), which is commonly found in hyperthermophilic archaea and some thermophilic bacteria. Unlike the salt-dependent pattern of accumulation observed in (hyper)thermophiles, in R. xylanophilus MG accumulates constitutively. The synthesis of MG in R. xylanophilus was tracked from GDP-mannose and 3-phosphoglycerate, but the genome sequence of the organism failed to reveal any of the genes known to be involved in this pathway. The native enzyme was purified and its N-terminal sequence was used to identify the corresponding gene (mpgS) in the genome of R. xylanophilus. The gene encodes a highly divergent mannosyl-3-phosphoglycerate synthase (MpgS) without relevant sequence homology to known mannosylphosphoglycerate synthases. In order to understand the specificity and enzymatic mechanism of this novel enzyme, it was expressed in Escherichia coli, purified and crystallized. The crystals thus obtained belonged to the hexagonal space group P6 5 22 and contained two protein molecules per asymmetric unit. The structure was solved by SIRAS using a mercury derivative
de Vries, A.H.M.; Feringa, B.L.
1997-01-01
Co(acac)(2) in the presence of chiral ligands has been employed as catalyst for the enantioselective conjugate addition of diethylzinc to chalcone. With chiral amino alcohols derived from (+)-camphor, enantioselectivities up to 83% were achieved. (C) 1997 Elsevier Science Ltd.
Energy Technology Data Exchange (ETDEWEB)
Chavda, Bhavin R., E-mail: chavdabhavin9@gmail.com; Dubey, Rahul P.; Patel, Urmila H. [Department of Physics, Sardar Patel University, Vallabh Vidyanagar-388120, Gujarat (India); Gandhi, Sahaj A. [Bhavan’s Shri I.L. Pandya Arts-Science and Smt. J.M. shah Commerce College, Dakar, Anand -388001, Gujarat, Indian (India); Barot, Vijay M. [P. G. Center in Chemistry, Smt. S. M. Panchal Science College, Talod, Gujarat 383 215 (India)
2016-05-06
The novel chalcone derivatives have widespread applications in material science and medicinal industries. The density functional theory (DFT) is used to optimized the molecular structure of the three chalcone derivatives (M-I, II, III). The observed discrepancies between the theoretical and experimental (X-ray data) results attributed to different environments of the molecules, the experimental values are of the molecule in solid state there by subjected to the intermolecular forces, like non-bonded hydrogen bond interactions, where as isolated state in gas phase for theoretical studies. The lattice energy of all the molecules have been calculated using PIXELC module in Coulomb –London –Pauli (CLP) package and is partitioned into corresponding coulombic, polarization, dispersion and repulsion contributions. Lattice energy data confirm and strengthen the finding of the X-ray results that the weak but significant intermolecular interactions like C-H…O, Π- Π and C-H… Π plays an important role in the stabilization of crystal packing.
Identification of a core set of rhizobial infection genes using data from single cell-types
Directory of Open Access Journals (Sweden)
Da-Song eChen
2015-07-01
Full Text Available Genome-wide expression studies on nodulation have varied in their scale from entire root systems to dissected nodules or root sections containing nodule primordia. More recently efforts have focused on developing methods for isolation of root hairs from infected plants and the application of laser-capture microdissection technology to nodules. Here we analyze two published data sets to identify a core set of infection genes that are expressed in the nodule and in root hairs during infection. Among the genes identified were those encoding phenylpropanoid biosynthesis enzymes including Chalcone-O-Methyltransferase which is required for the production of the potent Nod gene inducer 4’,4-dihydroxy-2-methoxychalcone. A promoter-GUS analysis in transgenic hairy roots for two genes encoding Chalcone-O-Methyltransferase isoforms revealed their expression in rhizobially infected root hairs and the nodule infection zone but not in the nitrogen fixation zone. We also describe a group of Rhizobially Induced Peroxidases whose expression overlaps with the production of superoxide in rhizobially infected root hairs and in nodules and roots. Finally, we identify a cohort of co-regulated transcription factors as candidate regulators of these processes.
Directory of Open Access Journals (Sweden)
Roman eGangl
2015-09-01
Full Text Available Stachyose is among the raffinose family oligosaccharides one of the major water-soluble carbohydrates next to sucrose in seeds of a number of plant species. Especially in leguminous seeds, e.g. chickpea, stachyose is reported as the major component. In contrast to their ambiguous potential as essential source of carbon for germination, raffinose family oligosaccharides are indigestible for humans and can contribute to diverse abdominal disorders.In the genome of Arabidopsis thaliana, six putative raffinose synthase genes are reported, whereas little is known about these putative raffinose synthases and their biochemical characteristics or their contribution to the raffinose family oligosaccharide physiology in A. thaliana.In this paper, we report on the molecular cloning, functional expression in Escherichia coli and purification of recombinant AtRS4 from A. thaliana and the biochemical characterisation of the putative stachyose synthase (AtSTS, At4g01970 as a raffinose and high affinity stachyose synthase (Km for raffinose 259.2 ± 21.15 µM as well as stachyose and galactinol specific galactosylhydrolase. A T-DNA insertional mutant in the AtRS4 gene was isolated. Only sqPCR from WT siliques showed a specific transcriptional AtRS4 PCR product. Metabolite measurements in seeds of ΔAtRS4 mutant plants revealed a total loss of stachyose in ΔAtRS4 mutant seeds. We conclude that AtRS4 is the only stachyose synthase in the genome of A. thaliana that AtRS4 represents a key regulation mechanism in the raffinose family oligosaccharide physiology of A. thaliana due to its multifunctional enzyme activity and that AtRS4 is possibly the second seed specific raffinose synthase beside AtRS5, which is responsible for Raf-accumulation under abiotic stress.
Directory of Open Access Journals (Sweden)
M Najafian
2011-04-01
Full Text Available Introduction & Objective: Alpha amylase is the most important decomposing enzyme in starch. Digestion and absorption of starch in the intestine can be prevented and also the blood sugar levels can be controlled by restrain and control of alpha amylase. The aim of this study was to evaluate the effect of trans-chalcone on amylase activity, blood glucose and lipid levels in diabetic and non diabetic rats. Materials & Methods: This experimental study was conducted in 1388 at Tehran University of Medical Sciences. Sixty rats were randomly divided to ten equal groups: non diabetic control, diabetic control, four non diabetic experiments and four diabetic experiments. Control groups received grape seed oil and experimental groups received 2, 8,16 and 32 mg/kg of body weight in a period of 24 days with a gastric cannula. Blood sugar, every two days, serum insulin levels in days 0,12, and 24 and at the end of the experiment, lipoproteins and alpha amylase activity were measured.The data were analyzed by one way analysis of variance, ANOVA, followed by Turkey,s test with SPSS soft ware . Results: On average Chalcone reduced 25.5% of blood sugar in normal and diabetic rats. IT also decreased the serum insulin level. On average, chalcone decreased 34.9% of alpha amylase activity in normal and diabetic rats. Following disturbances in lipids metabolism caused by diabetes, this drug improved lipoproteins metabolism and reduced water, food and urine volume. Conclusion: This study shows that trans-Chalcone reduces blood sugar and body weight via inhibition of alpha amylas. Moreover, improvement of lipoprotein metabolism may happen via the inhibitory effect of this drug on hydroxyl methyl glutaryl -COA reductase and phosphodiesterase.
Monoterpene synthases from common sage (Salvia officinalis)
Energy Technology Data Exchange (ETDEWEB)
Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)
1999-01-01
cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.
Directory of Open Access Journals (Sweden)
Marquez Rodolfo
2004-09-01
Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.
Yin, Jun-Lin; Wong, Woon-Seng; Jang, In-Cheol; Chua, Nam-Hai
2017-02-01
Monoterpenes are important for plant survival and useful to humans. In addition to their function in plant defense, monoterpenes are also used as flavors, fragrances and medicines. Several metabolic engineering strategies have been explored to produce monoterpene in tobacco but only trace amounts of monoterpenes have been detected. We investigated the effects of Solanum lycopersicum 1-deoxy-d-xylulose-5-phosphate synthase (SlDXS), Arabidopsis thaliana geranyl diphosphate synthase 1 (AtGPS) and Mentha × piperita geranyl diphosphate synthase small subunit (MpGPS.SSU) on production of monoterpene and geranylgeranyl diphosphate (GGPP) diversities, and plant morphology by transient expression in Nicotiana benthamiana and overexpression in transgenic Nicotiana tabacum. We showed that MpGPS.SSU could enhance the production of various monoterpenes such as (-)-limonene, (-)-linalool, (-)-α-pinene/β-pinene or myrcene, in transgenic tobacco by elevating geranyl diphosphate synthase (GPS) activity. In addition, overexpression of MpGPS.SSU in tobacco caused early flowering phenotype and increased shoot branching by elevating contents of GA 3 and cytokinins due to upregulated transcript levels of several plastidic 2-C-methyl-d-erythritol-4-phosphate (MEP) pathway genes, geranylgeranyl diphosphate synthases 3 (GGPPS3) and GGPPS4. Our method would allow the identification of new monoterpene synthase genes using transient expression in N. benthamiana and the improvement of monoterpene production in transgenic tobacco plants. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Mahapatra, Debarshi Kar; Asati, Vivek; Bharti, Sanjay Kumar
2015-03-06
Diabetes Mellitus (DM) is the fastest growing metabolic disorder affecting about 387 million people across the globe and is estimated to affect 592 million people by year 2030. The search for newer anti-diabetic agents is the foremost need to control the accelerating diabetic population. Several natural and (semi) synthetic chalcones deserve the credit of being potential candidates that act by modulating the therapeutic targets PPAR-γ, DPP-4, α-glucosidase, PTP1B, aldose reductase, and stimulate insulin secretion and tissue sensitivity. In this review, a comprehensive study (from January 1977 to October 2014) of anti-diabetic chalcones, their molecular targets, structure activity relationships (SARs), mechanism of actions (MOAs) and patents have been described. The compounds which showed promising activity and have a well-defined MOAs, SARs must be considered as prototype for the design and development of potential anti-diabetic agents. They should be evaluated critically at all clinical stages to ensure their therapeutic and toxicological profile to meet the demand of diabetics. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Muir, S.R.; Collins, G.J.; Robinson, S.; Hughes, S.G.; Bovy, A.G.; Vos, de C.H.R.; Tunen, van A.J.; Verhoeven, M.E.
2001-01-01
Tomatoes are an excellent source of the carotenoid lycopene, a compound that is thought to be protective against prostate cancer. They also contain small amounts of flavonoids in their peel (|[sim]|5–10 mg/kg fresh weight), mainly naringenin chalcone and the flavonol rutin, a quercetin glycoside.
International Nuclear Information System (INIS)
Chaurasia, Neha; Mishra, Yogesh; Rai, Lal Chand
2008-01-01
Phytochelatin synthase (PCS) is involved in the synthesis of phytochelatins (PCs), plays role in heavy metal detoxification. The present study describes for first time the functional expression and characterization of pcs gene of Anabaena sp. PCC 7120 in Escherichia coli in terms of offering protection against heat, salt, carbofuron (pesticide), cadmium, copper, and UV-B stress. The involvement of pcs gene in tolerance to above abiotic stresses was investigated by cloning of pcs gene in expression vector pGEX-5X-2 and its transformation in E. coli BL21 (DE3). The E. coli cells transformed with pGEX-5X-pcs showed better growth than control cells (pGEX-5X-2) under temperature (47 deg. C), NaCl (6% w/v), carbofuron (0.025 mg ml -1 ), CdCl 2 (4 mM), CuCl 2 (1 mM), and UV-B (10 min) exposure. The enhanced expression of pcs gene revealed by RT-PCR analysis under above stresses at different time intervals further advocates its role in tolerance against above abiotic stresses
Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R
1994-01-01
We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E...
DEFF Research Database (Denmark)
Kadziola, Anders; Jepsen, Clemens H; Johansson, Eva
2005-01-01
The prs gene encoding phosphoribosyl diphosphate (PRPP) synthase of the hyperthermophilic autotrophic methanogenic archaeon Methanocaldococcus jannaschii has been cloned and expressed in Escherichia coli. Subsequently, M.jannaschii PRPP synthase has been purified, characterised, crystallised, and...
Directory of Open Access Journals (Sweden)
Tatsuya eKon
2014-11-01
Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.
Lynch, Michael; Manly, Jody Todd; Cicchetti, Dante
2015-11-01
Physiological response to stress has been linked to a variety of healthy and pathological conditions. The current study conducted a multilevel examination of interactions among environmental toxins (i.e., neighborhood crime and child maltreatment) and specific genetic polymorphisms of the endothelial nitric oxide synthase gene (eNOS) and GABA(A) receptor subunit alpha-6 gene (GABRA6). One hundred eighty-six children were recruited at age 4. The presence or absence of child maltreatment as well as the amount of crime that occurred in their neighborhood during the previous year were determined at that time. At age 9, the children were brought to the lab, where their physiological response to a cognitive challenge (i.e., change in the amplitude of the respiratory sinus arrhythmia) was assessed and DNA samples were collected for subsequent genotyping. The results confirmed that complex Gene × Gene, Environment × Environment, and Gene × Environment interactions were associated with different patterns of respiratory sinus arrhythmia reactivity. The implications for future research and evidence-based intervention are discussed.
Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M
2005-06-01
Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.
Schmiderer, Corinna; Grausgruber-Gröger, Sabine; Grassi, Paolo; Steinborn, Ralf; Novak, Johannes
2010-07-01
Common sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants, with antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, composed mainly of the monoterpenes 1,8-cineole, alpha-thujone, beta-thujone and camphor, is responsible for some of these effects. Gibberellins regulate diverse physiological processes in plants, such as seed germination, shoot elongation and cell division. In this study, we analyzed the effect of exogenously applied plant growth regulators, namely gibberellic acid (GA(3)) and daminozide, on leaf morphology and essential oil formation of two leaf stages during the period of leaf expansion. Essential oil content increased with increasing levels of gibberellins and decreased when gibberellin biosynthesis was blocked with daminozide. With increasing levels of gibberellins, 1,8-cineole and camphor contents increased. Daminozide blocked the accumulation of alpha- and beta-thujone. GA(3) at the highest level applied also led to a significant decrease of alpha- and beta-thujone. Monoterpene synthases are a class of enzymes responsible for the first step in monoterpene biosynthesis, competing for the same substrate geranylpyrophosphate. The levels of gene expression of the three most important monoterpene synthases in sage were investigated, 1,8-cineole synthase leading directly to 1,8-cineole, (+)-sabinene synthase responsible for the first step in the formation of alpha- and beta-thujone, and (+)-bornyl diphosphate synthase, the first step in camphor biosynthesis. The foliar application of GA(3) increased, while daminozide significantly decreased gene expression of the monoterpene synthases. The amounts of two of the end products, 1,8-cineole and camphor, were directly correlated with the levels of gene expression of the respective monoterpene synthases, indicating transcriptional control, while the formation of alpha- and beta
Contribution of granule bound starch synthase in kernel modification ...
African Journals Online (AJOL)
The role of gbssI and gbssII genes, encoding granule bound starch synthase enzyme I and II, respectively, in quality protein maize (QPM) were studied at different days after pollination (DAP). Total RNA was used for first strand cDNA synthesis using the ImpromIISriptTM reverse transcriptase. No detectable levels of gbssI ...
Oberding, Lisa K; Gieg, Lisa M
2018-01-01
Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important
Directory of Open Access Journals (Sweden)
M. A. Slugina
2016-01-01
Full Text Available The potato is one of the main strategic crops in the Russian Federation, Belarus and Kazakhstan. Currently, we have achieved significant advances in the understanding of metabolic mechanism of carbohydrate and interconversion «sucrose – starch» in potato tubers. Sucrose synthase (Sus is a key enzyme in the breakdown of sucrose. Sucrose synthase (Sus is catalyzing a reversible reaction of conversion sucrose and UDP into fructose and UDP-glucose. The identification and subsequent characterization of the genes encoding plant sucrose synthase is the first step towards understanding their physiological roles and metabolic mechanism involved in carbohydrate accumulation in potato tubers. In the present work the nucleotide and amino acid polymorphism of the Sus4 gene fragments containing sequences of the sucrose synthase domain were analyzed. Sus4 gene fragments (intron III – exon VI in 9 potato cultivars of Russian, Kazakh and Belarusian breeding were analyzed. The polymorphism of the Sus4 sucrose synthase domain sequences was first examined. The length of analyzed fragment varied from 977 b.p. (cultivars Favorit, Karasaiskii, Miras to 1013 b.p. (cultivars Zorochka, Manifest, Elisaveta, Bashkirskii. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions. The common polymorphism level was 5.82%. It was shown that the examined sequences contained 58 SNPs and 4 indels. The most variable were introns IV (12.4% and V (9.18%. The most variable was exon IV. 7 allelic variants were detected. 6 different amino acid sequences specific to different varieties were also identified.
Köllner, Tobias G; Schnee, Christiane; Gershenzon, Jonathan; Degenhardt, Jörg
2004-05-01
The mature leaves and husks of Zea mays release a complex blend of terpene volatiles after anthesis consisting predominantly of bisabolane-, sesquithujane-, and bergamotane-type sesquiterpenes. The varieties B73 and Delprim release the same volatile constituents but in significantly different proportions. To study the molecular genetic and biochemical mechanisms controlling terpene diversity and distribution in these varieties, we isolated the closely related terpene synthase genes terpene synthase4 (tps4) and tps5 from both varieties. The encoded enzymes, TPS4 and TPS5, each formed the same complex mixture of sesquiterpenes from the precursor farnesyl diphosphate but with different proportions of products. These mixtures correspond to the sesquiterpene blends observed in the varieties B73 and Delprim, respectively. The differences in the stereoselectivity of TPS4 and TPS5 are determined by four amino acid substitutions with the most important being a Gly instead of an Ala residue at position 409 at the catalytic site of the enzyme. Although both varieties contain tps4 and tps5 alleles, their differences in terpene composition result from the fact that B73 has only a single functional allele of tps4 and no functional alleles of tps5, whereas Delprim has only a functional allele of tps5 and no functional alleles of tps4. Lack of functionality was shown to be attributable to frame-shift mutations or amino acid substitutions that greatly reduce the activity of their encoded proteins. Therefore, the diversity of sesquiterpenes in these two maize cultivars is strongly influenced by single nucleotide changes in the alleles of two terpene synthase genes.
Energy Technology Data Exchange (ETDEWEB)
Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail: ozapata@mda.cinvestav.mx
2007-08-01
To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.
Prasad, B. C. Narasimha; Kumar, Vinod; Gururaj, H. B.; Parimalan, R.; Giridhar, P.; Ravishankar, G. A.
2006-01-01
Capsaicin is a unique alkaloid of the plant kingdom restricted to the genus Capsicum. Capsaicin is the pungency factor, a bioactive molecule of food and of medicinal importance. Capsaicin is useful as a counterirritant, antiarthritic, analgesic, antioxidant, and anticancer agent. Capsaicin biosynthesis involves condensation of vanillylamine and 8-methyl nonenoic acid, brought about by capsaicin synthase (CS). We found that CS activity correlated with genotype-specific capsaicin levels. We purified and characterized CS (≈35 kDa). Immunolocalization studies confirmed that CS is specifically localized to the placental tissues of Capsicum fruits. Western blot analysis revealed concomitant enhancement of CS levels and capsaicin accumulation during fruit development. We determined the N-terminal amino acid sequence of purified CS, cloned the CS gene (csy1) and sequenced full-length cDNA (981 bp). The deduced amino acid sequence of CS from full-length cDNA was 38 kDa. Functionality of csy1 through heterologous expression in recombinant Escherichia coli was also demonstrated. Here we report the gene responsible for capsaicin biosynthesis, which is unique to Capsicum spp. With this information on the CS gene, speculation on the gene for pungency is unequivocally resolved. Our findings have implications in the regulation of capsaicin levels in Capsicum genotypes. PMID:16938870
Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer
International Nuclear Information System (INIS)
Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.
2003-01-01
Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement
Koval, S.N.; Miloslavsky, D.K.; Snegurskaya, I.A.; Mysnichenko, O.V.; Penkova, M.Yu.
2017-01-01
Hormonal factors of adrenal origin belong to the pathophysiological mechanisms of the formation and progression of arterial hypertension (AH) and should be considered while developing differentiated approaches to the treatment and prevention of hypertensive states, their primary, secondary and resistant forms. The first thing we should point up is aldosterone (AL), enzyme aldosterone synthase (AS), which takes a direct part in the formation of this hormone, as well as gene polymorphisms of A...
Jeangkhwoa, Pattraporn; Bandhaya, Achirapa; Umpunjun, Puangpaka; Chuenboonngarm, Ngarmnij; Panvisavas, Nathinee
2017-03-01
This study reports a successful application of fluorescence in situ hybridization (FISH) technique in the identification of Cannabis sativa L. cells recovered from fresh and dried powdered plant materials. Two biotin-16-dUTP-labeled FISH probes were designed from the Cannabis-specific tetrahydrocannabinolic acid synthase (THCAS) gene and the ITS region of the 45S rRNA gene. Specificity of probe-target hybridization was tested against the target and 4 non-target plant species, i.e., Humulus lupulus, Mitragyna speciosa, Papaver sp., and Nicotiana tabacum. The 1-kb THCA synthase hybridization probe gave Cannabis-specific hybridization signals, unlike the 700-bp Cannabis-ITS hybridization probe. Probe-target hybridization was also confirmed against 20 individual Cannabis plant samples. The 1-kb THCA synthase and 700-bp Cannabis-ITS hybridization probes clearly showed 2 hybridization signals per cell with reproducibility. The 1-kb THCA synthase probe did not give any FISH signal when tested against H. lupulus, its closely related member of the Canabaceae family. It was also showed that 1-kb THCA synthase FISH probe can be applied to identify small amount of dried powdered Cannabis material with an addition of rehydration step prior to the experimental process. This study provided an alternative identification method for Cannabis trace. Copyright © 2016. Published by Elsevier B.V.
Shimizu, Masanori; Goto, Maki; Hanai, Moeko; Shimizu, Tsutomu; Izawa, Norihiko; Kanamoto, Hirosuke; Tomizawa, Ken-Ichi; Yokota, Akiho; Kobayashi, Hirokazu
2008-08-01
Strategies employed for the production of genetically modified (GM) crops are premised on (1) the avoidance of gene transfer in the field; (2) the use of genes derived from edible organisms such as plants; (3) preventing the appearance of herbicide-resistant weeds; and (4) maintaining transgenes without obstructing plant cell propagation. To this end, we developed a novel vector system for chloroplast transformation with acetolactate synthase (ALS). ALS catalyzes the first step in the biosynthesis of the branched amino acids, and its enzymatic activity is inhibited by certain classes of herbicides. We generated a series of Arabidopsis (Arabidopsis thaliana) mutated ALS (mALS) genes and introduced constructs with mALS and the aminoglycoside 3'-adenyltransferase gene (aadA) into the tobacco (Nicotiana tabacum) chloroplast genome by particle bombardment. Transplastomic plants were selected using their resistance to spectinomycin. The effects of herbicides on transplastomic mALS activity were examined by a colorimetric assay using the leaves of transplastomic plants. We found that transplastomic G121A, A122V, and P197S plants were specifically tolerant to pyrimidinylcarboxylate, imidazolinon, and sulfonylurea/pyrimidinylcarboxylate herbicides, respectively. Transplastomic plants possessing mALSs were able to grow in the presence of various herbicides, thus affirming the relationship between mALSs and the associated resistance to herbicides. Our results show that mALS genes integrated into the chloroplast genome are useful sustainable markers that function to exclude plants other than those that are GM while maintaining transplastomic crops. This investigation suggests that the resistance management of weeds in the field amid growing GM crops is possible using (1) a series of mALSs that confer specific resistance to herbicides and (2) a strategy that employs herbicide rotation.
International Nuclear Information System (INIS)
Hicks, Latorya D.; Fry, Albert J.; Kurzweil, Vanessa C.
2004-01-01
The electron affinities (EAs) of a training set of 29 monosubstituted benzalacetophenones (chalcones) were computed at the ab initio density functional B3LYP/6-31G * level of theory. The EAs and experimental reduction potentials of the training set are highly linearly correlated (correlation coefficient of 0.969 and standard deviation of 10.8 mV). An additional 72 di-, tri-, and tetrasubstituted chalcones were then synthesized. Their reduction potentials were predicted from computed EAs using the linear correlation derived from the training set. Agreement between the experimental and computed reduction potentials is remarkably good, with a standard deviation of less than 22 mV for this very large set of substances whose potentials extend over a range of almost 700 mV
Cheng, Jiujun; Charles, Trevor C
2016-09-01
Bacterially produced biodegradable polyhydroxyalkanoates (PHAs) with versatile properties can be achieved using different PHA synthases (PhaCs). This work aims to expand the diversity of known PhaCs via functional metagenomics and demonstrates the use of these novel enzymes in PHA production. Complementation of a PHA synthesis-deficient Pseudomonas putida strain with a soil metagenomic cosmid library retrieved 27 clones expressing either class I, class II, or unclassified PHA synthases, and many did not have close sequence matches to known PhaCs. The composition of PHA produced by these clones was dependent on both the supplied growth substrates and the nature of the PHA synthase, with various combinations of short-chain-length (SCL) and medium-chain-length (MCL) PHA. These data demonstrate the ability to isolate diverse genes for PHA synthesis by functional metagenomics and their use for the production of a variety of PHA polymer and copolymer mixtures.
Directory of Open Access Journals (Sweden)
Linda Koshy
2008-01-01
Full Text Available Endothelial nitric oxide synthase (eNOS gene polymorphisms have been implicated as predisposing genetic factors that can predict aneurysmal subarachnoid hemorrhage (aSAH, but with controversial results from different populations. Using a case-control study design, we tested the hypothesis whether variants in eNOS gene can increase risk of aSAH among South Indian patients, either independently, or by interacting with other risk factors of the disease. We enrolled 122 patients, along with 224 ethnically matched controls. We screened the intron-4 27-bp VNTR, the promoter T-786C and the exon-7 G894T SNPs in the eNOS gene. We found marked interethnic differences in the genotype distribution of eNOS variants when comparing the South Indian population with the reported frequencies from Caucasian and Japanese populations. Genotype distributions in control and patient populations were found to be in Hardy-Weinberg equilibrium. In patients, the allele, genotype and estimated haplotype frequencies did not differ significantly from the controls. Multiple logistic regression indicated hypertension and smoking as risk factors for the disease, however the risk alleles did not have any interaction with these risk factors. Although the eNOS polymorphisms were not found to be a likely risk factor for aSAH, the role of factors such as ethnicity, gender, smoking and hypertension should be evaluated cautiously to understand the genotype to phenotype conversion.
Xiong, Wangdan; Wei, Qian; Wu, Pingzhi; Zhang, Sheng; Li, Jun; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang
2017-07-01
The β-ketoacyl-acyl carrier protein synthase I (KASI) is involved in de novo fatty acid biosynthesis in many organisms. Two putative KASI genes, JcKASI-1 and JcKASI-2, were isolated from Jatropha curcas. The deduced amino acid sequences of JcKASI-1 and JcKASI-2 exhibit around 83.8% and 72.5% sequence identities with AtKASI, respectively, and both contain conserved Cys-His-Lys-His-Phe catalytic active sites. Phylogenetic analysis indicated that JcKASI-2 belongs to a clade with several KASI proteins from dicotyledonous plants. Both JcKASI genes were expressed in multiple tissues, most strongly in filling stage seeds of J. curcas. Additionally, the JcKASI-1 and JcKASI-2 proteins were both localized to the plastids. Expressing JcKASI-1 in the Arabidopsis kasI mutant rescued the mutant's phenotype and restored the fatty acid composition and oil content in seeds to wild-type, but expressing JcKASI-2 in the Arabidopsis kasI mutant resulted in only partial rescue. This implies that JcKASI-1 and JcKASI-2 exhibit partial functional redundancy and KASI genes play a universal role in regulating fatty acid biosynthesis, growth, and development in plants. Copyright © 2017 Elsevier GmbH. All rights reserved.
Kitta, Ryo; Kuwamoto, Marina; Yamahama, Yumi; Mase, Keisuke; Sawada, Hiroshi
2016-12-01
To elucidate the mechanism for embryonic diapause or the breakdown of diapause in Bombyx mori, we biochemically analyzed nitric oxide synthase (NOS) during the embryogenesis of B. mori. The gene expression and enzyme activity of B. mori NOS (BmNOS) were examined in diapause, non-diapause, and HCl-treated diapause eggs. In the case of HCl-treated diapause eggs, the gene expression and enzyme activity of BmNOS were induced by HCl treatment. However, in the case of diapause and non-diapause eggs during embryogenesis, changes in the BmNOS activity and gene expressions did not coincide except 48-60 h after oviposition in diapause eggs. The results imply that changes in BmNOS activity during the embryogenesis of diapause and non-diapause eggs are regulated not only at the level of transcription but also post-transcription. The distribution and localization of BmNOS were also investigated with an immunohistochemical technique using antibodies against the universal NOS; the localization of BmNOS was observed mainly in the cytoplasm of yolk cells in diapause eggs and HCl-treated diapause eggs. These data suggest that BmNOS has an important role in the early embryonic development of the B. mori. © 2016 Japanese Society of Developmental Biologists.
Zhang, Hao; Li, Xueyan; Zhou, Li; Zhang, Keyong; Zhang, Qi; Li, Jingping; Wang, Ningning; Jin, Ming; Wu, Nan; Cong, Mingyu; Qiu, Changchun
2017-09-01
Low-frequency variants showed that there is more power to detect risk variants than to detect protective variants in complex diseases. Aldosterone plays an important role in the renin-angiotensin-aldosterone system, and aldosterone synthase catalyzes the speed-controlled steps of aldosterone biosynthesis. Polymorphisms of the aldosterone synthase gene (CYP11B2) have been reported to be associated with essential hypertension (EH). CYP11B2 polymorphisms such as -344T/C, have been extensively reported, but others are less well known. This study aimed to assess the association between human CYP11B2 and EH using a haplotype-based case-control study. A total of 1024 EH patients and 956 normotensive controls, which consist of north Han population peasants, were enrolled. Seven single nucleotide polymorphisms (SNPs) (rs28659182, rs10087214, rs73715282, rs542092383, rs4543, rs28491316, and rs7463212) covering the entire human CYP11B2 gene were genotyped as markers using the MassARRAY system. The major allele G frequency of rs542092383 was found to be risk against hypertension [odds ratio (OR) 3.478, 95% confidence interval (95% CI) 1.407-8.597, P = .004]. The AG genotype frequency of SNP rs542092383 was significantly associated with an increased risk of hypertension (OR 4.513, 95% CI 1.426-14.287, P = .010). In the haplotype-based case-control analysis, the frequency of the T-G-T haplotype was higher for EH patients than for controls (OR 5.729, 95% CI 1.889-17.371, P = .000495). All |D'| values of the seven SNPs were >0.9, and r values for rs28659182- rs10087214-rs28491316-rs7463212 SNPs were >0.8 and showed strong linkage intensity. Haplotype T-G-T may therefore be a useful genetic marker for EH.
Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.
Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi
2007-11-01
Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat.
Directory of Open Access Journals (Sweden)
G. V. Matyushin
2017-01-01
Full Text Available Background. The discovery of new genetic predictors of cardiovascular diseases can be used in predicting and diagnosing latent forms of the disease. Wolff-Parkinson-White syndrome (WPW occurs in all age groups and detected in 1-30 people per 10000, it manifests mainly in young age (on average 20 years, and the risk of sudden cardiac death is higher than in general population.Aim. To study the relationship of WPW syndrome with the polymorphism of endothelial nitric synthase gene (NOS3, and to identify genetic predictors of this syndrome.Material and methods. The study included 51 people with ECG proven WPW syndrome and 153 people with no cardiovascular disease. The patients were divided into subgroups according to sex: 21 women, 30 men. All patients underwent a standard cardiac examination (anamnesis, electrocardiography, echocardiography, bicycle ergometry, transesophageal electrical stimulation of the atria, Holter monitoring and blood was taken for molecular genetic testing of DNA.Results. The results showed a statistically significant prevalence of rare genotype 4b\\4b NOS3 gene in the control group of women (16.3%; р<0.05 compared with women from the main group, who did not have this genotype, while there was significant prevalence of genotype 4a\\4a in the main group of women (81.0%; р<0.05 compared with women from the control group. In men this prevalence was not found.Conclusion. The presence of genotype 4b\\4b NOS3 gene reduces the likelihood of WPW syndrome and its symptoms in females. In men, this prevalence is not found, presumably, in connection with some mechanisms of hormonal regulation. The results can be used in the genetic prediction of the course of the disease.
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Energy Technology Data Exchange (ETDEWEB)
Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette, E-mail: annette.rompel@univie.ac.at [Universität Wien, Althanstrasse 14, 1090 Wien (Austria)
2015-05-22
Latent and active aurone synthase purified from petals of C. grandiflora (cgAUS1) were crystallized. The crystal quality of recombinantly expressed latent cgAUS1 was significantly improved by co-crystallization with the polyoxotungstate Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase-separation zone. Aurone synthase (AUS), a member of a novel group of plant polyphenol oxidases (PPOs), catalyzes the oxidative conversion of chalcones to aurones. Two active cgAUS1 (41.6 kDa) forms that differed in the level of phosphorylation or sulfation as well as the latent precursor form (58.9 kDa) were purified from the petals of Coreopsis grandiflora. The differing active cgAUS1 forms and the latent cgAUS1 as well as recombinantly expressed latent cgAUS1 were crystallized, resulting in six different crystal forms. The active forms crystallized in space groups P2{sub 1}2{sub 1}2{sub 1} and P12{sub 1}1 and diffracted to ∼1.65 Å resolution. Co-crystallization of active cgAUS1 with 1,4-resorcinol led to crystals belonging to space group P3{sub 1}21. The crystals of latent cgAUS1 belonged to space group P12{sub 1}1 and diffracted to 2.50 Å resolution. Co-crystallization of recombinantly expressed pro-AUS with the hexatungstotellurate(VI) salt Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase separation zone significantly improved the quality of the crystals compared with crystals obtained without hexatungstotellurate(VI)
Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.
2015-01-01
Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the
O.I. Kadykova; P.P. Kravchun
2016-01-01
The article reviewed the links between polymorphism of endothelial nitric oxide synthase gene (Glu298Asp) and the development and progression of chronic heart failure in patients with ischemic heart disease and obesity. There has been a comprehensive survey of 222 patients with ischemic heart disease. Comparison group consisted of 115 patients with ischemic heart disease with normal body weight. The control group included 35 healthy individuals. G allele and genotype G/G polymorphism of the g...
Erratum Aldosterone synthase C-344T, angiotensin II type 1 receptor ...
Indian Academy of Sciences (India)
Aldosterone synthase C-344T, angiotensin II type 1 receptor A1166C and 11-β hydroxysteroid dehydrogenase G534A gene polymorphisms and essential hypertension in the population of Odisha, India. Manisha Patnaik, Pallabi Pati, Surendra N. Swain, Manoj K. Mohapatra, Bhagirathi Dwibedi, Shantanu K. Kar.
Directory of Open Access Journals (Sweden)
Naoki Ohkura
2015-12-01
Full Text Available Angelica keiskei Koidzumi (Ashitaba is a traditional herbal medicine and it is also regarded in Japan as a health food that might have antithrombotic properties. Ashitaba exudate suppresses lipopolysaccharide (LPS-induced plasma plasminogen activator inhibitor 1 (PAI-1, a risk factor for thrombotic diseases in mice. Xanthoangelol (XA and 4-hydroxyderricin (4-HD comprise > 95% of total chalcones from Ashitaba exudates that also contain trace amounts of other chalcone subtypes. The present study aimed to determine the effects of Ashitaba chalcones including xanthoangelols B (XB, D (XD, E (XE, F (XF and XA as well as 4-HD on PAI-1 levels in the medium of stimulated human EA.hy926 endothelial cells. Xanthoangelol (10 and #61549;M inhibited PAI-1 production at a rate of 77.1%, whereas the inhibition rates of XB, XD, XE and 4-HD were not significant. Xanthoangelol F was highly cytotoxic and thus its ability to inhibit PAI-1 production could not be evaluated. The side hydrocarbon chain of XA played an important role in the excretion of inhibitory activity. Small modifications of the hydrocarbon chain or small functional groups on the A ring measurably influenced the inhibitory activity of xanthoangelols. These findings warrant future research towards an understanding of the mechanism of antithrombotic action of Ashitaba as herbal medicine or antithrombotic health food. [J Intercult Ethnopharmacol 2015; 4(4.000: 355-357
DEFF Research Database (Denmark)
Gojkovic, Zoran; Sandrini, Michael; Piskur, Jure
2001-01-01
no pyrimidine catabolic pathway, it enabled growth on N-carbamyl- beta -alanine as the sole nitrogen source. The D. discoideum and D. melanogaster PYD3 gene products are similar to mammalian beta -alanine synthases. In contrast, the S. kluyveri protein is quite different from these and more similar to bacterial......beta -Alanine synthase (EC 3.5.1.6), which catalyzes the final step of pyrimidine catabolism, has only been characterized in mammals. A Saccharomyces kluyveri pyd3 mutant that is unable to grow on N-carbamy-beta -alanine as the sole nitrogen source and exhibits diminished beta -alanine synthase...... N- carbamyl amidohydrolases. All three beta -alanine synthases are to some degree related to various aspartate transcarbamylases, which catalyze the second step of the de novo pyrimidine biosynthetic pathway. PYD3 expression in yeast seems to be inducible by dihydrouracil and N...
Sitthithaworn, W; Kojima, N; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Noji, M; Saito, K; Niwa, Y; Sankawa, U
2001-02-01
cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene-producing plants, Scoparia dulcis and Croton sublyratus, have been isolated using the homology-based polymerase chain reaction (PCR) method. Both clones contained highly conserved aspartate-rich motifs (DDXX(XX)D) and their N-terminal residues exhibited the characteristics of chloroplast targeting sequence. When expressed in Escherichia coli, both the full-length and truncated proteins in which the putative targeting sequence was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to produce geranylgeranyl diphosphate (GGPP). The structural factors determining the product length in plant GGPPSs were investigated by constructing S. dulcis GGPPS mutants on the basis of sequence comparison with the first aspartate-rich motif (FARM) of plant farnesyl diphosphate synthase. The result indicated that in plant GGPPSs small amino acids, Met and Ser, at the fourth and fifth positions before FARM and Pro and Cys insertion in FARM play essential roles in determination of product length. Further, when a chimeric gene comprised of the putative transit peptide of the S. dulcis GGPPS gene and a green fluorescent protein was introduced into Arabidopsis leaves by particle gun bombardment, the chimeric protein was localized in chloroplasts, indicating that the cloned S. dulcis GGPPS is a chloroplast protein.
Pawar, Sunayna S; Koorbanally, Neil A
2014-06-01
A series of novel pyranochromene chalcones and corresponding flavanones were synthesized. This is the first report on the confirmation of the absolute configuration of chromene-based flavanones using X-ray crystallography. These compounds were characterized by 2D NMR spectroscopy, and their assignments are reported herein. The 3D structure of the chalcone 3b and flavanone 4g was determined by X-ray crystallography, and the structure of the flavanone was confirmed to be in the S configuration at C-2. Copyright © 2014 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Magdalena Dzialo
2017-05-01
Full Text Available Chalcone synthase (CHS has been recognized as an essential enzyme in the phenylpropanoid biosynthesis pathway. Apart from the leading role in the production of phenolic compounds with many valuable biological activities beneficial to biomedicine, CHS is well appreciated in science. Genetic engineering greatly facilitates expanding knowledge on the function and genetics of CHS in plants. The CHS gene is one of the most intensively studied genes in flax. In our study, we investigated engineering of the CHS gene through genetic and epigenetic approaches. Considering the numerous restrictions concerning the application of genetically modified (GM crops, the main purpose of this research was optimization of the plant's modulation via epigenetics. In our study, plants modified through two methods were compared: a widely popular agrotransformation and a relatively recent oligodeoxynucleotide (ODN strategy. It was recently highlighted that the ODN technique can be a rapid and time-serving antecedent in quick analysis of gene function before taking vector-mediated transformation. In order to understand the molecular background of epigenetic variation in more detail and evaluate the use of ODNs as a tool for predictable and stable gene engineering, we concentrated on the integration of gene expression and gene-body methylation. The treatment of flax with a series of short oligonucleotides homologous to a different part of CHS gene isoforms revealed that those directed to regulatory gene regions (5′- and 3′-UTR activated gene expression, directed to non-coding region (introns caused gen activity reduction, while those homologous to a coding region may have a variable influence on its activity. Gene expression changes were accompanied by changes in its methylation status. However, only certain (CCGG motifs along the gene sequence were affected. The analyzed DNA motifs of the CHS flax gene are more accessible for methylation when located within a Cp
Polyketide synthases of Diaporthe helianthi and involvement of DhPKS1 in virulence on sunflower.
Ruocco, Michelina; Baroncelli, Riccardo; Cacciola, Santa Olga; Pane, Catello; Monti, Maurilia Maria; Firrao, Giuseppe; Vergara, Mariarosaria; Magnano di San Lio, Gaetano; Vannacci, Giovanni; Scala, Felice
2018-01-06
The early phases of Diaporthe helianthi pathogenesis on sunflower are characterized by the production of phytotoxins that may play a role in host colonisation. In previous studies, phytotoxins of a polyketidic nature were isolated and purified from culture filtrates of virulent strains of D. helianthi isolated from sunflower. A highly aggressive isolate (7/96) from France contained a gene fragment of a putative nonaketide synthase (lovB) which was conserved in a virulent D. helianthi population. In order to investigate the role of polyketide synthases in D. helianthi 7/96, a draft genome of this isolate was examined. We were able to find and phylogenetically analyse 40 genes putatively coding for polyketide synthases (PKSs). Analysis of their domains revealed that most PKS genes of D. helianthi are reducing PKSs, whereas only eight lacked reducing domains. Most of the identified PKSs have orthologs shown to be virulence factors or genetic determinants for toxin production in other pathogenic fungi. One of the genes (DhPKS1) corresponded to the previously cloned D. helianthi lovB gene fragment and clustered with a nonribosomal peptide synthetase (NRPS) -PKS hybrid/lovastatin nonaketide like A. nidulans LovB. We used DhPKS1 as a case study and carried out its disruption through Agrobacterium-mediated transformation in the isolate 7/96. D. helianthi DhPKS1 deleted mutants were less virulent to sunflower compared to the wild type, indicating a role for this gene in the pathogenesis of the fungus. The PKS sequences analysed and reported here constitute a new genomic resource that will be useful for further research on the biology, ecology and evolution of D. helianthi and generally of fungal plant pathogens.
Energy Technology Data Exchange (ETDEWEB)
Fang, Qilu [Chemical Biology Research Center, School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang (China); Diabetes Center and Department of Endocrinology, the Second Affiliated Hospital of Wenzhou Medical University, Wenzhou, Zhejiang (China); Wang, Jingying; Wang, Lintao; Zhang, Yali [Chemical Biology Research Center, School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang (China); Yin, Haimin [Diabetes Center and Department of Endocrinology, the Second Affiliated Hospital of Wenzhou Medical University, Wenzhou, Zhejiang (China); Li, Yunzhou [Hunter Holmes McGuire VA Medical Center, Richmond, VA 23249 (United States); Tong, Chao [Chemical Biology Research Center, School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang (China); Liang, Guang, E-mail: wzmcliangguang@163.com [Chemical Biology Research Center, School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang (China); Zheng, Chao, E-mail: wallbb_1022@163.com [Chemical Biology Research Center, School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang (China); Diabetes Center and Department of Endocrinology, the Second Affiliated Hospital of Wenzhou Medical University, Wenzhou, Zhejiang (China)
2015-10-15
High glucose-induced inflammatory response in diabetic complications plays an important role in disease occurrence and development. With inflammatory cytokines and signaling pathways as important mediators, targeting inflammation may be a new avenue for treating diabetic complications. Chalcones are a class of natural products with various pharmacological activities. Previously, we identified L2H17 as a chalcone with good anti-inflammatory activity, inhibiting LPS-induced inflammatory response in macrophages. In this study, we examined L2H17's effect on hyperglycemia-induced inflammation both in mouse peritoneal macrophages and a streptozotocin-induced T1D mouse model. Our results indicate that L2H17 exhibits a strong inhibitory effect on the expression of pro-inflammatory cytokines, cell adhesion molecules, chemokines and macrophage adhesion via modulation of the MAPK/NF-κB pathway. Furthermore, in vivo oral administration of L2H17 resulted in a significant decrease in the expression of pro-inflammatory cytokines and cell adhesion molecules, contributing to a reduction of key markers for renal and cardiac dysfunction and improvements in fibrosis and pathological changes in both renal and cardiac tissues of diabetic mice. These findings provide the evidence supporting targeting MAPK/NF-κB pathway may be effective therapeutic strategy for diabetic complications, and suggest that L2H17 may be a promising anti-inflammatory agent with potential as a therapeutic agent in the treatment of renal and cardiac diabetic complications. - Highlights: • Chalcones are a class of natural products with various pharmacological activities. • We identified L2H17 a chalcone with good anti-inflammatory activity. • L2H17 improved histological abnormalities both in diabetic heart and kidney. • L2H17 reduced inflammatory responses in HG-stimulated mouse peritoneal macrophages. • MAPKs/NF-κB pathway may be a promising therapeutic target for diabetic complications.
International Nuclear Information System (INIS)
Fang, Qilu; Wang, Jingying; Wang, Lintao; Zhang, Yali; Yin, Haimin; Li, Yunzhou; Tong, Chao; Liang, Guang; Zheng, Chao
2015-01-01
High glucose-induced inflammatory response in diabetic complications plays an important role in disease occurrence and development. With inflammatory cytokines and signaling pathways as important mediators, targeting inflammation may be a new avenue for treating diabetic complications. Chalcones are a class of natural products with various pharmacological activities. Previously, we identified L2H17 as a chalcone with good anti-inflammatory activity, inhibiting LPS-induced inflammatory response in macrophages. In this study, we examined L2H17's effect on hyperglycemia-induced inflammation both in mouse peritoneal macrophages and a streptozotocin-induced T1D mouse model. Our results indicate that L2H17 exhibits a strong inhibitory effect on the expression of pro-inflammatory cytokines, cell adhesion molecules, chemokines and macrophage adhesion via modulation of the MAPK/NF-κB pathway. Furthermore, in vivo oral administration of L2H17 resulted in a significant decrease in the expression of pro-inflammatory cytokines and cell adhesion molecules, contributing to a reduction of key markers for renal and cardiac dysfunction and improvements in fibrosis and pathological changes in both renal and cardiac tissues of diabetic mice. These findings provide the evidence supporting targeting MAPK/NF-κB pathway may be effective therapeutic strategy for diabetic complications, and suggest that L2H17 may be a promising anti-inflammatory agent with potential as a therapeutic agent in the treatment of renal and cardiac diabetic complications. - Highlights: • Chalcones are a class of natural products with various pharmacological activities. • We identified L2H17 a chalcone with good anti-inflammatory activity. • L2H17 improved histological abnormalities both in diabetic heart and kidney. • L2H17 reduced inflammatory responses in HG-stimulated mouse peritoneal macrophages. • MAPKs/NF-κB pathway may be a promising therapeutic target for diabetic complications.
Synthesis of Chalcones with Anticancer Activities
Directory of Open Access Journals (Sweden)
Syam Mohan
2012-05-01
Full Text Available Several chalcones were synthesized and their in vitro cytotoxicity against various human cell lines, including human breast adenocarcinoma cell line MCF-7, human lung adenocarcinoma cell line A549, human prostate cancer cell line PC3, human adenocarcinoma cell line HT-29 (colorectal cancer and human normal liver cell line WRL-68 was evaluated. Most of the compounds being active cytotoxic agents, four of them with minimal IC50 values were chosen and studied in detail with MCF-7 cells. The compounds 1, 5, 23, and 25 were capable in eliciting apoptosis in MCF-7 cells as shown by multiparameter cytotoxicity assay and caspase-3/7, -8, and -9 activities (p < 0.05. The ROS level showed 1.3-fold increase (p < 0.05 at the low concentrations used and thus it was concluded that the compounds increased the ROS level eventually leading to apoptosis in MCF-7 cells through intrinsic as well as extrinsic pathways.
Cong, Ling; Wang, Cheng; Chen, Ling; Liu, Huijuan; Yang, Guangxiao; He, Guangyuan
2009-09-23
Dietary micronutrient deficiencies, such as the lack of vitamin A, are a major source of morbidity and mortality worldwide. Carotenoids in food can function as provitamin A in humans, while grains of Chinese elite wheat cultivars generally have low carotenoid contents. To increase the carotenoid contents in common wheat endosperm, transgenic wheat has been generated by expressing the maize y1 gene encoding phytoene synthase driven by a endosperm-specific 1Dx5 promoter in the elite wheat (Triticum aestivum L.) variety EM12, together with the bacterial phytoene desaturase crtI gene from Erwinia uredovora under the constitutive CaMV 35S promoter control. A clear increase of the carotenoid content was detected in the endosperms of transgenic wheat that visually showed a light yellow color. The total carotenoids content was increased up to 10.8-fold as compared with the nontransgenic EM12 cultivar. To test whether the variability of total carotenoid content in different transgenic lines was due to differences in the transgene copy number or expression pattern, Southern hybridization and semiquantitative reverse transcriptase polymerase chain reaction analyses were curried out. The results showed that transgene copy numbers and transcript levels did not associate well with carotenoid contents. The expression patterns of endogenous carotenoid genes, such as the phytoene synthases and carotene desaturases, were also investigated in wild-type and transgenic wheat lines. No significant changes in expression levels of these genes were detected in the transgenic endosperms, indicating that the increase in carotenoid transgenic wheat endosperms resulted from the expression of transgenes.
Tomatidine Is a Lead Antibiotic Molecule That Targets Staphylococcus aureus ATP Synthase Subunit C.
Lamontagne Boulet, Maxime; Isabelle, Charles; Guay, Isabelle; Brouillette, Eric; Langlois, Jean-Philippe; Jacques, Pierre-Étienne; Rodrigue, Sébastien; Brzezinski, Ryszard; Beauregard, Pascale B; Bouarab, Kamal; Boyapelly, Kumaraswamy; Boudreault, Pierre-Luc; Marsault, Éric; Malouin, François
2018-06-01
Methicillin-resistant Staphylococcus aureus (MRSA) is a leading cause of deadly hospital-acquired infections. The discovery of anti- Staphylococcus antibiotics and new classes of drugs not susceptible to the mechanisms of resistance shared among bacteria is imperative. We recently showed that tomatidine (TO), a steroidal alkaloid from solanaceous plants, possesses potent antibacterial activity against S. aureus small-colony variants (SCVs), the notoriously persistent form of this bacterium that has been associated with recurrence of infections. Here, using genomic analysis of in vitro -generated TO-resistant S. aureus strains to identify mutations in genes involved in resistance, we identified the bacterial ATP synthase as the cellular target. Sequence alignments were performed to highlight the modified sequences, and the structural consequences of the mutations were evaluated in structural models. Overexpression of the atpE gene in S. aureus SCVs or introducing the mutation found in the atpE gene of one of the high-level TO-resistant S. aureus mutants into the Bacillus subtilis atpE gene provided resistance to TO and further validated the identity of the cellular target. FC04-100, a TO derivative which also possesses activity against non-SCV strains, prevents high-level resistance development in prototypic strains and limits the level of resistance observed in SCVs. An ATP synthesis assay allowed the observation of a correlation between antibiotic potency and ATP synthase inhibition. The selectivity index (inhibition of ATP production by mitochondria versus that of bacterial ATP synthase) is estimated to be >10 5 -fold for FC04-100. Copyright © 2018 American Society for Microbiology.
Ancient horizontal gene transfer from bacteria enhances biosynthetic capabilities of fungi.
Directory of Open Access Journals (Sweden)
Imke Schmitt
Full Text Available Polyketides are natural products with a wide range of biological functions and pharmaceutical applications. Discovery and utilization of polyketides can be facilitated by understanding the evolutionary processes that gave rise to the biosynthetic machinery and the natural product potential of extant organisms. Gene duplication and subfunctionalization, as well as horizontal gene transfer are proposed mechanisms in the evolution of biosynthetic gene clusters. To explain the amount of homology in some polyketide synthases in unrelated organisms such as bacteria and fungi, interkingdom horizontal gene transfer has been evoked as the most likely evolutionary scenario. However, the origin of the genes and the direction of the transfer remained elusive.We used comparative phylogenetics to infer the ancestor of a group of polyketide synthase genes involved in antibiotic and mycotoxin production. We aligned keto synthase domain sequences of all available fungal 6-methylsalicylic acid (6-MSA-type PKSs and their closest bacterial relatives. To assess the role of symbiotic fungi in the evolution of this gene we generated 24 6-MSA synthase sequence tags from lichen-forming fungi. Our results support an ancient horizontal gene transfer event from an actinobacterial source into ascomycete fungi, followed by gene duplication.Given that actinobacteria are unrivaled producers of biologically active compounds, such as antibiotics, it appears particularly promising to study biosynthetic genes of actinobacterial origin in fungi. The large number of 6-MSA-type PKS sequences found in lichen-forming fungi leads us hypothesize that the evolution of typical lichen compounds, such as orsellinic acid derivatives, was facilitated by the gain of this bacterial polyketide synthase.
Multi-substrate terpene synthases: their occurrence and physiological significance
Directory of Open Access Journals (Sweden)
Leila Pazouki
2016-07-01
Full Text Available Terpene synthases are responsible for synthesis of a large number of terpenes in plants using substrates provided by two distinct metabolic pathways, the mevalonate-dependent pathway that is located in cytosol and has been suggested to be responsible for synthesis of sesquiterpenes (C15, and 2-C-methyl-D-erythritol-4-phosphate pathway located in plastids and suggested to be responsible for the synthesis of hemi- (C5, mono- (C10 and diterpenes (C20. Recent advances in characterization of genes and enzymes responsible for substrate and end product biosynthesis as well as efforts in metabolic engineering have demonstrated existence of a number of multi-substrate terpene synthases. This review summarizes the progress in the characterization of such multi-substrate terpene synthases and suggests that the presence of multi-substrate use might have been significantly underestimated. Multi-substrate use could lead to important changes in terpene product profiles upon substrate profile changes under perturbation of metabolism in stressed plants as well as under certain developmental stages. We therefore argue that multi-substrate use can be significant under physiological conditions and can result in complicate modifications in terpene profiles.
2013-01-01
Background The mountain pine beetle (MPB, Dendroctonus ponderosae) epidemic has affected lodgepole pine (Pinus contorta) across an area of more than 18 million hectares of pine forests in western Canada, and is a threat to the boreal jack pine (Pinus banksiana) forest. Defence of pines against MPB and associated fungal pathogens, as well as other pests, involves oleoresin monoterpenes, which are biosynthesized by families of terpene synthases (TPSs). Volatile monoterpenes also serve as host recognition cues for MPB and as precursors for MPB pheromones. The genes responsible for terpene biosynthesis in jack pine and lodgepole pine were previously unknown. Results We report the generation and quality assessment of assembled transcriptome resources for lodgepole pine and jack pine using Sanger, Roche 454, and Illumina sequencing technologies. Assemblies revealed transcripts for approximately 20,000 - 30,000 genes from each species and assembly analyses led to the identification of candidate full-length prenyl transferase, TPS, and P450 genes of oleoresin biosynthesis. We cloned and functionally characterized, via expression of recombinant proteins in E. coli, nine different jack pine and eight different lodgepole pine mono-TPSs. The newly identified lodgepole pine and jack pine mono-TPSs include (+)-α-pinene synthases, (-)-α-pinene synthases, (-)-β-pinene synthases, (+)-3-carene synthases, and (-)-β-phellandrene synthases from each of the two species. Conclusion In the absence of genome sequences, transcriptome assemblies are important for defence gene discovery in lodgepole pine and jack pine, as demonstrated here for the terpenoid pathway genes. The product profiles of the functionally annotated mono-TPSs described here can account for the major monoterpene metabolites identified in lodgepole pine and jack pine. PMID:23679205
Hall, Dawn E; Yuen, Macaire M S; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet K; Li, Maria; Henderson, Hannah; Arango-Velez, Adriana; Liao, Nancy Y; Docking, Roderick T; Chan, Simon K; Cooke, Janice Ek; Breuil, Colette; Jones, Steven Jm; Keeling, Christopher I; Bohlmann, Jörg
2013-05-16
The mountain pine beetle (MPB, Dendroctonus ponderosae) epidemic has affected lodgepole pine (Pinus contorta) across an area of more than 18 million hectares of pine forests in western Canada, and is a threat to the boreal jack pine (Pinus banksiana) forest. Defence of pines against MPB and associated fungal pathogens, as well as other pests, involves oleoresin monoterpenes, which are biosynthesized by families of terpene synthases (TPSs). Volatile monoterpenes also serve as host recognition cues for MPB and as precursors for MPB pheromones. The genes responsible for terpene biosynthesis in jack pine and lodgepole pine were previously unknown. We report the generation and quality assessment of assembled transcriptome resources for lodgepole pine and jack pine using Sanger, Roche 454, and Illumina sequencing technologies. Assemblies revealed transcripts for approximately 20,000 - 30,000 genes from each species and assembly analyses led to the identification of candidate full-length prenyl transferase, TPS, and P450 genes of oleoresin biosynthesis. We cloned and functionally characterized, via expression of recombinant proteins in E. coli, nine different jack pine and eight different lodgepole pine mono-TPSs. The newly identified lodgepole pine and jack pine mono-TPSs include (+)-α-pinene synthases, (-)-α-pinene synthases, (-)-β-pinene synthases, (+)-3-carene synthases, and (-)-β-phellandrene synthases from each of the two species. In the absence of genome sequences, transcriptome assemblies are important for defence gene discovery in lodgepole pine and jack pine, as demonstrated here for the terpenoid pathway genes. The product profiles of the functionally annotated mono-TPSs described here can account for the major monoterpene metabolites identified in lodgepole pine and jack pine.
Ylstra, B.; Busscher, J.; Franken, J.; Hollman, P.C.H.; Mol, J.N.M.; Tunen, van A.J.
1995-01-01
Flavonols form an important class of flavonoids which serve an essential function during plant reproduction. Flavonoid biosynthesis is initiated by the enzyme chalcone synthase (CHS). A high abundance of flavonols and chs mRNA was demonstrated in male and female reproductive organs of Petunia
Jiang, Lingxi; Yang, Litao; Zhang, Haibo; Guo, Jinchao; Mazzara, Marco; Van den Eede, Guy; Zhang, Dabing
2009-05-13
One rice ( Oryza sativa ) gene, sucrose phosphate synthase (SPS), has been proven to be a suitable endogenous reference gene for genetically modified (GM) rice detection in a previous study. Herein are the reported results of an international collaborative ring trial for validation of the SPS gene as an endogenous reference gene and its optimized qualitative and quantitative polymerase chain reaction (PCR) systems. A total of 12 genetically modified organism (GMO) detection laboratories from seven countries participated in the ring trial and returned their results. The validated results confirmed the species specificity of the method through testing 10 plant genomic DNAs, low heterogeneity, and a stable single-copy number of the rice SPS gene among 7 indica varieties and 5 japonica varieties. The SPS qualitative PCR assay was validated with a limit of detection (LOD) of 0.1%, which corresponded to about 230 copies of haploid rice genomic DNA, while the limit of quantification (LOQ) for the quantitative PCR system was about 23 copies of haploid rice genomic DNA, with acceptable PCR efficiency and linearity. Furthermore, the bias between the test and true values of eight blind samples ranged from 5.22 to 26.53%. Thus, we believe that the SPS gene is suitable for use as an endogenous reference gene for the identification and quantification of GM rice and its derivates.
Czech Academy of Sciences Publication Activity Database
Ghouili, A.; Dušek, Michal; Petříček, Václav; Ben Ayed, T.; Ben Hassen, R.
2014-01-01
Roč. 75, č. 2 (2014), s. 188-193 ISSN 0022-3697 Grant - others:AV ČR(CZ) Praemium Academiae Institutional support: RVO:68378271 Keywords : coumarin chalcone * fluorescence * structure determination Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.853, year: 2014
Isolation and Characterization of Three New Monoterpene Synthases from Artemisia annua
Ruan, Ju-Xin; Li, Jian-Xu; Fang, Xin; Wang, Ling-Jian; Hu, Wen-Li; Chen, Xiao-Ya; Yang, Chang-Qing
2016-01-01
Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5, and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography–mass spectrometry detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate, salicylic acid, and gibberellin, suggesting a role of these monoterpene synthases in plant–environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant. PMID:27242840
Isolation and characterization of three new monoterpene synthases from Artemisia annua
Directory of Open Access Journals (Sweden)
Ju-Xin eRuan
2016-05-01
Full Text Available Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography-mass spectrometry (GC-MS detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate (MeJA, salicylic acid (SA and gibberellin (GA, suggesting a role of these monoterpene synthases in plant-environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant.
Kracht, Octavia Natascha; Ammann, Ann-Christin; Stockmann, Julia; Wibberg, Daniel; Kalinowski, Jörn; Piotrowski, Markus; Kerr, Russell; Brück, Thomas; Kourist, Robert
2017-04-01
Plant terpenoids are a large and highly diverse class of metabolites with an important role in the immune defense. They find wide industrial application as active pharmaceutical ingredients, aroma and fragrance compounds. Several Eremophila sp. derived terpenoids have been documented. To elucidate the terpenoid metabolism, the transcriptome of juvenile and mature Eremophila serrulata (A.DC.) Druce (Scrophulariaceae) leaves was sequenced and a transcript library was generated. We report on the first transcriptomic dataset of an Eremophila plant. IlluminaMiSeq sequencing (2 × 300 bp) revealed 7,093,266 paired reads, which could be assembled to 34,505 isogroups. To enable detection of terpene biosynthetic genes, leaves were separately treated with methyl jasmonate, a well-documented inducer of plant secondary metabolites. In total, 21 putative terpene synthase genes were detected in the transcriptome data. Two terpene synthase isoenzymatic genes, termed ES01 and ES02, were successfully expressed in E. coli. The resulting proteins catalyzed the conversion of geranyl pyrophosphate, the universal substrate of monoterpene synthases to myrcene and Z-(b)-ocimene, respectively. The transcriptomic data and the discovery of the first terpene synthases from Eremophila serrulata are the initial step for the understanding of the terpene metabolism in this medicinally important plant genus. Copyright © 2017 Elsevier Ltd. All rights reserved.
Misiak, Blazej; Krolik, Marta; Kukowka, Anna; Lewera, Anna; Leszczynski, Przemyslaw; Stankiewicz-Olczyk, Joanna; Slezak, Ryszard
2011-01-01
Background. Extensive evidence, arising from models of endothelial nitric oxide synthase gene (NOS3)-knockout mice supports the role of endothelial malfunction in the pathogenesis of the metabolic syndrome (MS). Aims. The aim of this study was to evaluate the role of −786T/C polymorphism in the etiology of MS and assess previously reported interaction with cigarette smoking. Methods. Based on International Diabetes Federation 2005 criteria, we recruited randomly 152 subjects with MS and 75 su...
Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook
2008-01-01
FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402
Weterings, Koen; Pezzotti, Mario; Cornelissen, Marc; Mariani, Celestina
2002-11-01
In flowering plants, pollination of the stigma sets off a cascade of responses in the distal flower organs. Ethylene and its biosynthetic precursor 1-aminocyclopropane-1-carboxylate (ACC) play an important role in regulating these responses. Because exogenous application of ethylene or ACC does not invoke the full postpollination syndrome, the pollination signal probably consists of a more complex set of stimuli. We set out to study how and when the pollination signal moves through the style of tobacco (Nicotiana tabacum) by analyzing the expression patterns of pistil-expressed ACC-synthase and -oxidase genes. Results from this analysis showed that pollination induces high ACC-oxidase transcript levels in all cells of the transmitting tissue. ACC-synthase mRNA accumulated only in a subset of transmitting tract cells and to lower levels as compared with ACC-oxidase. More significantly, we found that although ACC-oxidase transcripts accumulate to uniform high levels, the ACC-synthase transcripts accumulate in a wave-like pattern in which the peak coincides with the front of the ingrowing pollen tube tips. This wave of ACC-synthase expression can also be induced by incongruous pollination and (partially) by wounding. This indicates that wounding-like features of pollen tube invasion might be part of the stimuli evoking the postpollination response and that these stimuli are interpreted differently by the regulatory mechanisms of the ACC-synthase and -oxidase genes.
In silicio expression analysis of PKS genes isolated from Cannabis sativa L.
Directory of Open Access Journals (Sweden)
Isvett J. Flores-Sanchez
2010-01-01
Full Text Available Cannabinoids, flavonoids, and stilbenoids have been identified in the annual dioecious plant Cannabis sativa L. Of these, the cannabinoids are the best known group of this plant's natural products. Polyketide synthases (PKSs are responsible for the biosynthesis of diverse secondary metabolites, including flavonoids and stilbenoids. Biosynthetically, the cannabinoids are polyketide substituted with terpenoid moiety. Using an RT-PCR homology search, PKS cDNAs were isolated from cannabis plants. The deduced amino acid sequences showed 51%-73% identity to other CHS/STS type sequences of the PKS family. Further, phylogenetic analysis revealed that these PKS cDNAs grouped with other non-chalcone-producing PKSs. Homology modeling analysis of these cannabis PKSs predicts a 3D overall fold, similar to alfalfa CHS2, with small steric differences on the residues that shape the active site of the cannabis PKSs.
Induction of resveratrol biosynthesis in skins of three grape cultivars by ultraviolet irradiation
International Nuclear Information System (INIS)
Takayanagi, Tsutomu; Okuda, Tohru; Mine, Yohei; Yokotsuka, Koki
2004-01-01
Resveratrol production and expression of the genes related to resveratrol biosynthesis were investigated in the skins of three Vitis vinifera cultivars Chardonnay, Koshu and an American hybrid grape, Muscat Bailey A (Bailey x Muscat Hamburg). Resveratrol concentration in the skins of all the grapes increased significantly when exposed to ultraviolet (UV-C, 254 nm) irradiation. The UV-induced resveratrol concentration in the grape skins was lower after veraison (onset of ripening) than before it. The maximum concentration of the UV-induced resveratrol in 'Muscat Bailey A' was higher than those in the other two cultivars. The relative mRNA expression levels of stilebene synthase (STS), phenylalanine ammonia-lyase (PAL) and chalcone synthase (CHS) genes in grape skins 8 hr after UV irradiation were determined by quantitative reverse transcription-polymerase chain reaction (RT-PCR). The results revealed that STS- and PAL-mRNA expressions were significantly increased by UV irradiation. STS-mRNA expressions in 'Muscat Bailey A' were higher than those in 'Chardonnay' throughout berry development. The UV-induced CHS-mRNA expression in the grape skins decreased before veraison and subsequently increased. (author)
Kumar, Hitesh; Singh, Kashmir; Kumar, Sanjay
2012-12-01
Stevia [Stevia rebaudiana (Bertoni)] is a perennial herb which accumulates sweet diterpenoid steviol glycosides (SGs) in its leaf tissue. SGs are synthesized by 2C-methyl-D-erythritol 4-phosphate (MEP) pathway. Of the various enzymes of the MEP pathway, 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS) (encoded by MDS) catalyzes the cyclization of 4-(cytidine 5' diphospho)-2C-methyl-D-erythritol 2-phosphate into 2C-methyl-D-erythritol 2,4-cyclodiphosphate. Complementation of the MDS knockout mutant strain of Escherichia coli, EB370 with putative MDS of stevia (SrMDS) rescued the lethal mutant, suggesting SrMDS to be a functional gene. Experiments conducted in plant growth chamber and in the field suggested SrMDS to be a light regulated gene. Indole 3-acetic acid (IAA; 50, 100 μM) down-regulated the expression of SrMDS at 4 h of the treatment, whereas, abscisic acid did not modulate its expression. A high expression of SrMDS was observed during the light hours of the day as compared to the dark hours. The present work established functionality of SrMDS and showed the role of light and IAA in regulating expression of SrMDS.
Chee, Marcus Jenn Yang; Lycett, Grantley W; Khoo, Teng-Jin; Chin, Chiew Foan
2017-01-01
Production of vanillin by bioengineering has gained popularity due to consumer demand toward vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive to produce compared to its synthetic counterpart. Current bioengineering works mainly involve microbial biotechnology. Therefore, alternative means to the current approaches are constantly being explored. This work describes the use of vanillin synthase (VpVAN), to bioconvert ferulic acid to vanillin in a plant system. The VpVAN enzyme had been shown to directly convert ferulic acid and its glucoside into vanillin and its glucoside, respectively. As the ferulic acid precursor and vanillin were found to be the intermediates in the phenylpropanoid biosynthetic pathway of Capsicum species, this work serves as a proof-of-concept for vanillin production using Capsicum frutescens (C. frutescens or hot chili pepper). The cells of C. frutescens were genetically transformed with a codon optimized VpVAN gene via biolistics. Transformed explants were selected and regenerated into callus. Successful integration of the gene cassette into the plant genome was confirmed by polymerase chain reaction. High-performance liquid chromatography was used to quantify the phenolic compounds detected in the callus tissues. The vanillin content of transformed calli was 0.057% compared to 0.0003% in untransformed calli.
Energy Technology Data Exchange (ETDEWEB)
Richard L. Blanton
2004-02-19
OAK-B135 The major accomplishments of this project were: (1) the initial characterization of dcsA, the gene for the putative catalytic subunit of cellulose synthase in the cellular slime mold Dictyostelium discoideum; (2) the detection of a developmentally regulated event (unidentified, but perhaps a protein modification or association with a protein partner) that is required for cellulose synthase activity (i.e., the dcsA product is necessary, but not sufficient for cellulose synthesis); (3) the continued exploration of the developmental context of cellulose synthesis and DcsA; (4) the isolation of a GFP-DcsA-expressing strain (work in progress); and (5) the identification of Dictyostelium homologues for plant genes whose products play roles in cellulose biosynthesis. Although our progress was slow and many of our results negative, we did develop a number of promising avenues of investigation that can serve as the foundation for future projects.
Sauge-Merle, Sandrine; Cuiné, Stéphan; Carrier, Patrick; Lecomte-Pradines, Catherine; Luu, Doan-Trung; Peltier, Gilles
2003-01-01
Phytochelatins (PCs) are metal-binding cysteine-rich peptides, enzymatically synthesized in plants and yeasts from glutathione in response to heavy metal stress by PC synthase (EC 2.3.2.15). In an attempt to increase the ability of bacterial cells to accumulate heavy metals, the Arabidopsis thaliana gene encoding PC synthase (AtPCS) was expressed in Escherichia coli. A marked accumulation of PCs was observed in vivo together with a decrease in the glutathione cellular content. When bacterial cells expressing AtPCS were placed in the presence of heavy metals such as cadmium or the metalloid arsenic, cellular metal contents were increased 20- and 50-fold, respectively. We discuss the possibility of using genes of the PC biosynthetic pathway to design bacterial strains or higher plants with increased abilities to accumulate toxic metals, and also arsenic, for use in bioremediation and/or phytoremediation processes. PMID:12514032
International Nuclear Information System (INIS)
Monostory, Katalin; Tamasi, Viola; Vereczkey, Laszlo; Perjesi, Pal
2003-01-01
In vivo investigation of E-2-(4'-methoxybenzylidene)-1-benzosuberone (4a) on the 7,12-dimethylbenz[a]anthracene (DMBA)-induced onco/tumor suppressor gene expressions suggested that inhibition of metabolic activation of DMBA might play a role in the observed activity of the compound. In order to explore this possible biological action we have investigated whether 4a and some of its structurally related analogues had inhibitory effects on the CYP1A enzymes. During our study 7-ethoxyresorufin O-dealkylation activity of CYP1A isoenzymes was measured in liver microsomes prepared from 3-methylcholanthrene treated male rats. Inhibition constants (K i values) were determined by using different concentrations of 7-ethoxyresorufin and the investigated chalcones (1), E-2-benzylidene-1-indanones (2), -tetralones (3) and -benzosuberones (4). Each compound was found to be a strong competitive inhibitor of the CYP1A enzymes. Their inhibitory activity was comparable with or even higher than that of 7,8-benzoflavone, the known strong CYP1A inhibitor used as reference substance. By proper selection of the substituents on the benzylidene moiety we investigated how the inhibitory activity (K i value) of 1-4 varied as a function of the ring size (n=0, 5, 6, 7) carbon atoms, and the nature as well as the position of the substituents. To test applicability of the previously set structural requirements for binding of xenobiotics to the CYP1A enzymes we compared some topological, physico-chemical and quantum mechanical parameters of 1-4 with 7-ethoxyresorufin and 7,8-benzoflavone, the investigated CYP1A substrate and inhibitor, respectively
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1999-01-01
Four cDNAs encoding phosphoribosyl diphosphate (PRPP) synthase were isolated from a spinach (Spinacia oleracea) cDNA library by complementation of an Escherichia coli Δprs mutation. The four gene products produced PRPP in vitro from ATP and ribose-5-phosphate. Two of the enzymes (isozymes 1 and 2...
International Nuclear Information System (INIS)
Páez, David; Salazar, Juliana; Paré, Laia; Pertriz, Lourdes; Targarona, Eduardo; Rio, Elisabeth del; Barnadas, Agusti; Marcuello, Eugenio; Baiget, Montserrat
2011-01-01
Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5′UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The ∗3/∗3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in ∗3/∗3 vs. 35% in ∗2/∗2 and ∗2/∗3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the ∗3/∗3 patients and 84 months for the ∗2/∗2 and ∗2/∗3 patients (p = .039). For XRCC1 Arg399Gln SNP, the median progression-free survival was 101 months for the G/G, 78 months for the G/A, and 31 months for the A/A patients (p = .048). Conclusions: The thymidylate
Energy Technology Data Exchange (ETDEWEB)
Paez, David, E-mail: dpaez@santpau.cat [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Salazar, Juliana; Pare, Laia [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Pertriz, Lourdes [Department of Radiotherapy, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Targarona, Eduardo [Department of Surgery, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Rio, Elisabeth del [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Barnadas, Agusti; Marcuello, Eugenio [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Baiget, Montserrat [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain)
2011-12-01
Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5 Prime UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The Asterisk-Operator 3/ Asterisk-Operator 3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in Asterisk-Operator 3/ Asterisk-Operator 3 vs. 35% in Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk-Operator 3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the Asterisk-Operator 3/ Asterisk-Operator 3 patients and 84 months for the Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk
Directory of Open Access Journals (Sweden)
Gürkan Yerli
2012-01-01
Full Text Available In this study, a series of novel β-mercapto carbonyl derivatives (3-(2-hydroxyethylthio-1,3-diarylpropan-1-one (5a-i were prepared by addition of 2-mercaptoethanol (4 to chalcones (3a-i in the presence of catalytic amount of iodine (10 mol % in CH 2Cl 2.
Energy Technology Data Exchange (ETDEWEB)
Han, Jae Yun [College of Pharmacy, Chosun University, Gwangju 501-759 (Korea, Republic of); Cho, Seung Sik [College of Pharmacy, Mokpo National University, Muan, Jeonnam 535-729 (Korea, Republic of); Yang, Ji Hye; Kim, Kyu Min; Jang, Chang Ho [College of Pharmacy, Chosun University, Gwangju 501-759 (Korea, Republic of); Park, Da Eon [College of Pharmacy, Mokpo National University, Muan, Jeonnam 535-729 (Korea, Republic of); Bang, Joon Seok [Graduate School of Clinical Pharmacy, Sookmyung Women' s University, Seoul (Korea, Republic of); Jung, Young Suk [College of Pharmacy, Pusan National University, Busan (Korea, Republic of); Ki, Sung Hwan, E-mail: shki@chosun.ac.kr [College of Pharmacy, Chosun University, Gwangju 501-759 (Korea, Republic of)
2015-08-15
The chalcone compound isosalipurposide (ISPP) has been successfully isolated from the native Korean plant species Corylopsis coreana Uyeki (Korean winter hazel). However, the therapeutic efficacy of ISPP remains poorly understood. This study investigated whether ISPP has the capacity to activate NF-E2-related factor (Nrf2)-antioxidant response element (ARE) signaling and induce its target gene expression, and to determined the protective role of ISPP against oxidative injury of hepatocytes. In HepG2 cells, nuclear translocation of Nrf2 is augmented by ISPP treatment. Consistently, ISPP increased ARE reporter gene activity and the protein levels of glutamate cysteine ligase (GCL) and hemeoxygenase (HO-1), resulting in increased intracellular glutathione levels. Cells pretreated with ISPP were rescued from tert-butylhydroperoxide-induced reactive oxygen species (ROS) production and glutathione depletion and consequently, apoptotic cell death. Moreover, ISPP ameliorated the mitochondrial dysfunction and apoptosis induced by rotenone which is an inhibitor of complex 1 of the mitochondrial respiratory chain. The specific role of Nrf2 activation by ISPP was demonstrated using an ARE-deletion mutant plasmid and Nrf2-knockout cells. Finally, we observed that extracellular signal-regulated kinase (ERK) and AMP-activated protein kinase (AMPK), but not protein kinase C (PKC)-δ or other mitogen-activated protein kinases (MAPKs), are involved in the activation of Nrf2 by ISPP. Taken together, our results demonstrate that ISPP has a cytoprotective effect against oxidative damage mediated through Nrf2 activation and induction of its target gene expression in hepatocytes. - Highlights: • We investigated the effect of ISPP on Nrf2 activation. • ISPP increased Nrf2 activity and its target gene expression. • ISPP inhibited the mitochondrial dysfunction and ROS production. • Nrf2 activation by ISPP is dependent on ERK1/2 and AMPK phosphorylation. • ISPP may be a promising
International Nuclear Information System (INIS)
Han, Jae Yun; Cho, Seung Sik; Yang, Ji Hye; Kim, Kyu Min; Jang, Chang Ho; Park, Da Eon; Bang, Joon Seok; Jung, Young Suk; Ki, Sung Hwan
2015-01-01
The chalcone compound isosalipurposide (ISPP) has been successfully isolated from the native Korean plant species Corylopsis coreana Uyeki (Korean winter hazel). However, the therapeutic efficacy of ISPP remains poorly understood. This study investigated whether ISPP has the capacity to activate NF-E2-related factor (Nrf2)-antioxidant response element (ARE) signaling and induce its target gene expression, and to determined the protective role of ISPP against oxidative injury of hepatocytes. In HepG2 cells, nuclear translocation of Nrf2 is augmented by ISPP treatment. Consistently, ISPP increased ARE reporter gene activity and the protein levels of glutamate cysteine ligase (GCL) and hemeoxygenase (HO-1), resulting in increased intracellular glutathione levels. Cells pretreated with ISPP were rescued from tert-butylhydroperoxide-induced reactive oxygen species (ROS) production and glutathione depletion and consequently, apoptotic cell death. Moreover, ISPP ameliorated the mitochondrial dysfunction and apoptosis induced by rotenone which is an inhibitor of complex 1 of the mitochondrial respiratory chain. The specific role of Nrf2 activation by ISPP was demonstrated using an ARE-deletion mutant plasmid and Nrf2-knockout cells. Finally, we observed that extracellular signal-regulated kinase (ERK) and AMP-activated protein kinase (AMPK), but not protein kinase C (PKC)-δ or other mitogen-activated protein kinases (MAPKs), are involved in the activation of Nrf2 by ISPP. Taken together, our results demonstrate that ISPP has a cytoprotective effect against oxidative damage mediated through Nrf2 activation and induction of its target gene expression in hepatocytes. - Highlights: • We investigated the effect of ISPP on Nrf2 activation. • ISPP increased Nrf2 activity and its target gene expression. • ISPP inhibited the mitochondrial dysfunction and ROS production. • Nrf2 activation by ISPP is dependent on ERK1/2 and AMPK phosphorylation. • ISPP may be a promising
Berman, Judit; Sheng, Yanmin; Gómez Gómez, Lourdes; Veiga, Tania; Ni, Xiuzhen; Farré, Gemma; Capell, Teresa; Guitián, Javier; Guitián, Pablo; Sandmann, Gerhard; Christou, Paul; Zhu, Changfu
2016-01-01
Flower color is an important characteristic that determines the commercial value of ornamental plants. Gentian flowers occur in a limited range of colors because this species is not widely cultivated as a cut flower. Gentiana lutea L. var. aurantiaca (abbr, aurantiaca) is characterized by its orange flowers, but the specific pigments responsible for this coloration are unknown. We therefore investigated the carotenoid and flavonoid composition of petals during flower development in the orange-flowered gentian variety of aurantiaca and the yellow-flowered variety of G. lutea L. var. lutea (abbr, lutea). We observed minor varietal differences in the concentration of carotenoids at the early and final stages, but only aurantiaca petals accumulated pelargonidin glycosides, whereas these compounds were not found in lutea petals. We cloned and sequenced the anthocyanin biosynthetic gene fragments from petals, and analyzed the expression of these genes in the petals of both varieties to determine the molecular mechanisms responsible for the differences in petal color. Comparisons of deduced amino acid sequences encoded by the isolated anthocyanin cDNA fragments indicated that chalcone synthase (CHS), chalcone isomerase (CHI), anthocyanidin synthase 1 (ANS1) and ANS2 are identical in both aurantiaca and lutea varieties whereas minor amino acid differences of the deduced flavonone 3-hydroxylase (F3H) and dihydroflavonol 4-reductase (DFR) between both varieties were observed. The aurantiaca petals expressed substantially higher levels of transcripts representing CHS, F3H, DFR, ANS and UDP-glucose:flavonoid-3-O-glucosyltransferase genes, compared to lutea petals. Pelargonidin glycoside synthesis in aurantiaca petals therefore appears to reflect the higher steady-state levels of pelargonidin synthesis transcripts. Moreover, possible changes in the substrate specificity of DFR enzymes may represent additional mechanisms for producing red pelargonidin glycosides in petals of
Gómez Gómez, Lourdes; Veiga, Tania; Ni, Xiuzhen; Farré, Gemma; Capell, Teresa; Guitián, Javier; Guitián, Pablo; Sandmann, Gerhard; Christou, Paul
2016-01-01
Flower color is an important characteristic that determines the commercial value of ornamental plants. Gentian flowers occur in a limited range of colors because this species is not widely cultivated as a cut flower. Gentiana lutea L. var. aurantiaca (abbr, aurantiaca) is characterized by its orange flowers, but the specific pigments responsible for this coloration are unknown. We therefore investigated the carotenoid and flavonoid composition of petals during flower development in the orange-flowered gentian variety of aurantiaca and the yellow-flowered variety of G. lutea L. var. lutea (abbr, lutea). We observed minor varietal differences in the concentration of carotenoids at the early and final stages, but only aurantiaca petals accumulated pelargonidin glycosides, whereas these compounds were not found in lutea petals. We cloned and sequenced the anthocyanin biosynthetic gene fragments from petals, and analyzed the expression of these genes in the petals of both varieties to determine the molecular mechanisms responsible for the differences in petal color. Comparisons of deduced amino acid sequences encoded by the isolated anthocyanin cDNA fragments indicated that chalcone synthase (CHS), chalcone isomerase (CHI), anthocyanidin synthase 1 (ANS1) and ANS2 are identical in both aurantiaca and lutea varieties whereas minor amino acid differences of the deduced flavonone 3-hydroxylase (F3H) and dihydroflavonol 4-reductase (DFR) between both varieties were observed. The aurantiaca petals expressed substantially higher levels of transcripts representing CHS, F3H, DFR, ANS and UDP-glucose:flavonoid-3-O-glucosyltransferase genes, compared to lutea petals. Pelargonidin glycoside synthesis in aurantiaca petals therefore appears to reflect the higher steady-state levels of pelargonidin synthesis transcripts. Moreover, possible changes in the substrate specificity of DFR enzymes may represent additional mechanisms for producing red pelargonidin glycosides in petals of
Directory of Open Access Journals (Sweden)
Judit Berman
Full Text Available Flower color is an important characteristic that determines the commercial value of ornamental plants. Gentian flowers occur in a limited range of colors because this species is not widely cultivated as a cut flower. Gentiana lutea L. var. aurantiaca (abbr, aurantiaca is characterized by its orange flowers, but the specific pigments responsible for this coloration are unknown. We therefore investigated the carotenoid and flavonoid composition of petals during flower development in the orange-flowered gentian variety of aurantiaca and the yellow-flowered variety of G. lutea L. var. lutea (abbr, lutea. We observed minor varietal differences in the concentration of carotenoids at the early and final stages, but only aurantiaca petals accumulated pelargonidin glycosides, whereas these compounds were not found in lutea petals. We cloned and sequenced the anthocyanin biosynthetic gene fragments from petals, and analyzed the expression of these genes in the petals of both varieties to determine the molecular mechanisms responsible for the differences in petal color. Comparisons of deduced amino acid sequences encoded by the isolated anthocyanin cDNA fragments indicated that chalcone synthase (CHS, chalcone isomerase (CHI, anthocyanidin synthase 1 (ANS1 and ANS2 are identical in both aurantiaca and lutea varieties whereas minor amino acid differences of the deduced flavonone 3-hydroxylase (F3H and dihydroflavonol 4-reductase (DFR between both varieties were observed. The aurantiaca petals expressed substantially higher levels of transcripts representing CHS, F3H, DFR, ANS and UDP-glucose:flavonoid-3-O-glucosyltransferase genes, compared to lutea petals. Pelargonidin glycoside synthesis in aurantiaca petals therefore appears to reflect the higher steady-state levels of pelargonidin synthesis transcripts. Moreover, possible changes in the substrate specificity of DFR enzymes may represent additional mechanisms for producing red pelargonidin glycosides in
An R2R3-type MYB transcription factor, GmMYB29, regulates isoflavone biosynthesis in soybean.
Directory of Open Access Journals (Sweden)
Shanshan Chu
2017-05-01
Full Text Available Isoflavones comprise a group of secondary metabolites produced almost exclusively by plants in the legume family, including soybean [Glycine max (L. Merr.]. They play vital roles in plant defense and have many beneficial effects on human health. Isoflavone content is a complex quantitative trait controlled by multiple genes, and the genetic mechanisms underlying isoflavone biosynthesis remain largely unknown. Via a genome-wide association study (GWAS, we identified 28 single nucleotide polymorphisms (SNPs that are significantly associated with isoflavone concentrations in soybean. One of these 28 SNPs was located in the 5'-untranslated region (5'-UTR of an R2R3-type MYB transcription factor, GmMYB29, and this gene was thus selected as a candidate gene for further analyses. A subcellular localization study confirmed that GmMYB29 was located in the nucleus. Transient reporter gene assays demonstrated that GmMYB29 activated the IFS2 (isoflavone synthase 2 and CHS8 (chalcone synthase 8 gene promoters. Overexpression and RNAi-mediated silencing of GmMYB29 in soybean hairy roots resulted in increased and decreased isoflavone content, respectively. Moreover, a candidate-gene association analysis revealed that 11 natural GmMYB29 polymorphisms were significantly associated with isoflavone contents, and regulation of GmMYB29 expression could partially contribute to the observed phenotypic variation. Taken together, these results provide important genetic insights into the molecular mechanisms underlying isoflavone biosynthesis in soybean.
Chatsuriyawong, Siriporn; Gozal, David; Kheirandish-Gozal, Leila; Bhattacharjee, Rakesh; Khalyfa, Ahamed A; Wang, Yang; Sukhumsirichart, Wasana; Khalyfa, Abdelnaby
2013-09-06
Obstructive sleep apnea (OSA) is associated with adverse and interdependent cognitive and cardiovascular consequences. Increasing evidence suggests that nitric oxide synthase (NOS) and endothelin family (EDN) genes underlie mechanistic aspects of OSA-associated morbidities. We aimed to identify single nucleotide polymorphisms (SNPs) in the NOS family (3 isoforms), and EDN family (3 isoforms) to identify potential associations of these SNPs in children with OSA. A pediatric community cohort (ages 5-10 years) enriched for snoring underwent overnight polysomnographic (NPSG) and a fasting morning blood draw. The diagnostic criteria for OSA were an obstructive apnea-hypopnea Index (AHI) >2/h total sleep time (TST), snoring during the night, and a nadir oxyhemoglobin saturation DNA from peripheral blood was extracted and allelic frequencies were assessed for, NOS1 (209 SNPs), NOS2 (122 SNPs), NOS3 (50 SNPs), EDN1 (43 SNPs), EDN2 (48 SNPs), EDN3 (14 SNPs), endothelin receptor A, EDNRA, (27 SNPs), and endothelin receptor B, EDNRB (23 SNPs) using a custom SNPs array. The relative frequencies of NOS-1,-2, and -3, and EDN-1,-2,-3,-EDNRA, and-EDNRB genotypes were evaluated in 608 subjects [128 with OSA, and 480 without OSA (NOSA)]. Furthermore, subjects with OSA were divided into 2 subgroups: OSA with normal endothelial function (OSA-NEF), and OSA with endothelial dysfunction (OSA-ED). Linkage disequilibrium was analyzed using Haploview version 4.2 software. For NOSA vs. OSA groups, 15 differentially distributed SNPs for NOS1 gene, and 1 SNP for NOS3 emerged, while 4 SNPs for EDN1 and 1 SNP for both EDN2 and EDN3 were identified. However, in the smaller sub-group for whom endothelial function was available, none of the significant SNPs was retained due to lack of statistical power. Differences in the distribution of polymorphisms among NOS and EDN gene families suggest that these SNPs could play a contributory role in the pathophysiology and risk of OSA-induced cardiovascular
Krill, Christian; Barrow, Russell A.; Chen, Shasha; Trengove, Robert; Oliver, Richard P.; Solomon, Peter S.
2014-01-01
Parastagonospora nodorum is a pathogen of wheat that affects yields globally. Previous transcriptional analysis identified a partially reducing polyketide synthase (PR-PKS) gene, SNOG_00477 (SN477), in P. nodorum that is highly upregulated during infection of wheat leaves. Disruption of the corresponding SN477 gene resulted in the loss of production of two compounds, which we identified as (R)-mellein and (R)-O-methylmellein. Using a Saccharomyces cerevisiae yeast heterologous expression system, we successfully demonstrated that SN477 is the only enzyme required for the production of (R)-mellein. This is the first identification of a fungal PKS that is responsible for the synthesis of (R)-mellein. The P. nodorum ΔSN477 mutant did not show any significant difference from the wild-type strain in its virulence against wheat. However, (R)-mellein at 200 μg/ml inhibited the germination of wheat (Triticum aestivum) and barrel medic (Medicago truncatula) seeds. Comparative sequence analysis identified the presence of mellein synthase (MLNS) homologues in several Dothideomycetes and two sodariomycete genera. Phylogenetic analysis suggests that the MLNSs in fungi and bacteria evolved convergently from fungal and bacterial 6-methylsalicylic acid synthases. PMID:25326302
African Journals Online (AJOL)
Items 9701 - 9750 of 11090 ... MO Oke, SO Awonorin, OJ Oyelade, JO Olajide, GO Olaniyan, PO Sobukola. Vol 10, No 3 (2011), Sonicated date syrup media preparation for microbial culture, Abstract PDF. SH Nazari. Vol 10, No 56 (2011), Sonication assisted Agrobacterium-mediated transformation of chalcone synthase (CHS) ...
Directory of Open Access Journals (Sweden)
P.V. Sri Ramya
2018-01-01
Full Text Available A simple and efficient protocol has been demonstrated for the preparation of densely functionalized 3-aroylimidazo[1,2-a]pyridines from 2-aminopyridines and chalcones using RuCl3·H2O/I2 catalytic system. The advantages, such as low catalyst loading, broad substrate scope with respect to substitutions on aminopyridines as well as chalcones, stability of heterocycles such as thiophene under the reaction conditions, operationally simple procedure and higher yields makes this approach remarkable for synthetic applications.
Lee, Sang-Hoon; Park, Yun-Ji; Park, Sang Un; Lee, Sang-Won; Kim, Seong-Cheol; Jung, Chan-Sik; Jang, Jae-Ki; Hur, Yoonkang; Kim, Yeon Bok
2017-05-30
Members of the genus Ixeris have long been used in traditional medicines as stomachics, sedatives, and diuretics. Phenylalanine ammonia-lyase (PAL), cinnamate-4-hydroxylase (C4H), 4-coumarate: coenzyme-A (CoA) ligase (4CL), chalcone synthase (CHS), and dihydroflavonol 4-reductase (DFR) are important enzymes in the phenylpropanoid pathway. In this study, we analyzed seven genes from Ixeris dentata var. albiflora that are involved in phenylpropanoid biosynthesis, using an Illumina/Solexa HiSeq 2000 platform. The amino acid sequence alignments for IdPAL s, IdC4H, Id4CL s, IdCHS , and IdDFR showed high identity to sequences from other plants. We also investigated transcript levels using quantitative real-time PCR, and analyzed the accumulation of phenylpropanoids in different organs of I. dentata var. albiflora using high-performance liquid chromatography. The transcript levels of IdC4H, Id4CL1 , IdCHS , and IdDFR were highest in the leaf. The catechin, chlorogenic acid, ferulic acid, and quercetin contents were also highest in the leaf. We suggest that expression of IdC4H, Id4CL1 , IdCHS , and IdDFR is associated with the accumulation of phenylpropanoids. Our results may provide baseline information for elucidating the mechanism of phenylpropanoid biosynthesis in different organs of I. dentata var. albiflora .
Giampietro, Letizia; D'Angelo, Alessandra; Giancristofaro, Antonella; Ammazzalorso, Alessandra; De Filippis, Barbara; Di Matteo, Mauro; Fantacuzzi, Marialuigia; Linciano, Pasquale; Maccallini, Cristina; Amoroso, Rosa
2014-01-01
In an effort to develop safe and efficacious compounds for the treatment of metabolic disorders, new compounds based on a combination of clofibric acid, the active metabolite of clofibrate, and trans-stilbene, chalcone, and other lipophilic groups were synthesized. They were evaluated for PPARα transactivation activity; all branched derivatives showed an increase of the transcriptional activity of receptor compared to the linear ones. Noteworthy, stilbene and benzophenone branched derivatives activated the PPARα better than clofibric acid.
Directory of Open Access Journals (Sweden)
Mu eLi
2016-02-01
Full Text Available Chitin synthases (CHSs are key enzymes in the biosynthesis of chitin, an important structural component of fungal cell walls that can trigger innate immune responses in host plants and animals. Members of CHS gene family perform various functions in fungal cellular processes. Previous studies focused primarily on classifying diverse CHSs into different classes, regardless of their functional diversification, or on characterizing their functions in individual fungal species. A complete and systematic comparative analysis of CHS genes based on their orthologous relationships will be valuable for elucidating the evolution and functions of different CHS genes in fungi. Here, we identified and compared members of the CHS gene family across the fungal tree of life, including 18 divergent fungal lineages. Phylogenetic analysis revealed that the fungal CHS gene family is comprised of at least 10 ancestral orthologous clades, which have undergone multiple independent duplications and losses in different fungal lineages during evolution. Interestingly, one of these CHS clades (class III was expanded in plant or animal pathogenic fungi belonging to different fungal lineages. Two clades (classes VIb and VIc identified for the first time in this study occurred mainly in plant pathogenic fungi from Sordariomycetes and Dothideomycetes. Moreover, members of classes III and VIb were specifically up-regulated during plant infection, suggesting important roles in pathogenesis. In addition, CHS-associated networks conserved among plant pathogenic fungi are involved in various biological processes, including sexual reproduction and plant infection. We also identified specificity-determining sites, many of which are located at or adjacent to important structural and functional sites that are potentially responsible for functional divergence of different CHS classes. Overall, our results provide new insights into the evolution and function of members of CHS gene
Zhu, J J; Luo, J; Sun, Y T; Shi, H B; Li, J; Wu, M; Yu, K; Haile, A B; Loor, J J
2015-05-01
The role of fatty acid synthase (FASN) on de novo fatty acid synthesis has been well established. In monogastrics, unlike acetyl-coenzyme A carboxylase, FASN is primarily controlled at the transcriptional level. However, no data exist on ruminant mammary cells evaluating effects of FASN knockdown on mRNA expression of lipogenic genes. Inhibition of FASN in mammary cells by C75-mediated interference, a synthetic inhibitor of FASN activity, and short hairpin RNA-mediated interference markedly reduced cellular triglyceride content at least in part by decreasing the expression of genes related to triglyceride synthesis (GPAT, AGPAT6, and DGAT2) and enhancing the expression of lipolysis-related genes (ATGL and HSL). Consistent with the markedly lower expression of genes related to lipid droplet formation and secretion (TIP47, ADFP, BTN1A1, and XDH), cellular lipid droplets also were reduced sharply after incubation with C75 or adenovirus-short-hairpin-RNA. The results underscored the essential role of FASN in the overall process of milk-fat formation in goat mammary epithelial cells. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Zhong, Weiqiang; Zhou, Tian-Biao; Jiang, Zongpei
2015-04-01
Association between endothelial nitric oxide synthase (eNOS) gene polymorphism and Henoch-Schönlein purpura (HSP)/Henoch-Schönlein purpura nephritis (HSPN) risk is still controversial. A meta-analysis was performed to evaluate the association between eNOS gene polymorphism and HSP/HSPN susceptibility. A predefined literature search and selection of eligible relevant studies were performed to collect data from electronic database. Three articles were identified for the analysis of association between eNOS gene polymorphism and HSPN/HSP risk. eNOS G894T gene polymorphism was not associated with HSPN susceptibility and the risk of patients with HSP developing into HSPN. Interestingly, eNOS G894T T allele and GG genotype were associated with HSP susceptibility, but not the TT genotype. eNOS T786C TT genotype was associated with HSPN susceptibility, but not C allele and CC genotype. Furthermore, eNOS T786C gene polymorphism was not associated with HSP risk and the risk of patients with HSP developing into HSPN. In conclusion, eNOS T786C TT genotype was associated with and eNOS G894T T allele and GG genotype were associated with HSP susceptibility. However, more studies should be performed in the future.
Directory of Open Access Journals (Sweden)
Anne K. Braczynski
2015-01-01
Full Text Available TMEM70 is involved in the biogenesis of mitochondrial ATP synthase and mutations in the TMEM70 gene impair oxidative phosphorylation. Herein, we report on pathology and treatment of ATP synthase deficiency in four siblings. A consanguineous family of Roma (Gipsy ethnic origin gave birth to 6 children of which 4 were affected presenting with dysmorphic features, failure to thrive, cardiomyopathy, metabolic crises, and 3-methylglutaconic aciduria as clinical symptoms. Genetic testing revealed a homozygous mutation (c.317-2A>G in the TMEM70 gene. While light microscopy was unremarkable, ultrastructural investigation of muscle tissue revealed accumulation of swollen degenerated mitochondria with lipid crystalloid inclusions, cristae aggregation, and exocytosis of mitochondrial material. Biochemical analysis of mitochondrial complexes showed an almost complete ATP synthase deficiency. Despite harbouring the same mutation, the clinical outcome in the four siblings was different. Two children died within 60 h after birth; the other two had recurrent life-threatening metabolic crises but were successfully managed with supplementation of anaplerotic amino acids, lipids, and symptomatic treatment during metabolic crisis. In summary, TMEM70 mutations can cause distinct ultrastructural mitochondrial degeneration and almost complete deficiency of ATP synthase but are still amenable to treatment.
Dubey, Amit; Biswas, Sanjay Kumar; Sinha, Ekata; Chakma, Joy Kumar; Kamal, Raj; Arora, Mamta; Sagar, Harish; Natarajan, Mohan; Bhagyawant, Sameer S; Mohanty, Keshar Kunja
2017-07-01
The pathogen Mycobacterium leprae causes leprosy that affects mainly skin and nerves. Polymorphisms of certain genes are substantiated to be associated with the susceptibility/resistance to leprosy. The present investigation addressed the association of Nitric Oxide Synthase2 gene polymorphisms and leprosy in a population from northern part of India. A total of 323 leprosy cases and 288 healthy controls were genotyped for four NOS2 promoter variants (rs1800482, rs2779249, rs8078340 and rs2301369) using FRET technology in Real Time PCR. None of these SNPs in promoter sites was associated with susceptibility/resistance to leprosy. NOS2 rs1800482 was found to be monomorphic with GG genotype. However, NOS2-1026T allele was observed to be in higher frequency with leprosy cases (BL and LL) who were not suffering from any reactional episodes compared to cases with ENL reaction {OR=0.30, 95% CI (0.10-0.86), p=0.024}. NOS2-1026GT genotype was more prevalent in cases without reaction (BT, BB and BL) compared to RR reactional patients {OR=0.38, 95% CI (0.17-0.86), p=0.02}. Although haplotype analysis revealed that no haplotype was associated with leprosy susceptibility/resistance with statistical significance, GTG haplotype was noted to be more frequent in healthy controls. These SNPs are observed to be in linkage disequilibrium. Although, these SNPs are not likely to influence leprosy vulnerability, -1026G>T SNP was indicated to have noteworthy role in leprosy reactions. Copyright © 2017 Elsevier B.V. All rights reserved.
Ampomah-Dwamena, Charles; Driedonks, Nicky; Lewis, David; Shumskaya, Maria; Chen, Xiuyin; Wurtzel, Eleanore T; Espley, Richard V; Allan, Andrew C
2015-07-28
Carotenoid compounds play essential roles in plants such as protecting the photosynthetic apparatus and in hormone signalling. Coloured carotenoids provide yellow, orange and red colour to plant tissues, as well as offering nutritional benefit to humans and animals. The enzyme phytoene synthase (PSY) catalyses the first committed step of the carotenoid biosynthetic pathway and has been associated with control of pathway flux. We characterised four PSY genes found in the apple genome to further understand their involvement in fruit carotenoid accumulation. The apple PSY gene family, containing six members, was predicted to have three functional members, PSY1, PSY2, and PSY4, based on translation of the predicted gene sequences and/or corresponding cDNAs. However, only PSY1 and PSY2 showed activity in a complementation assay. Protein localisation experiments revealed differential localization of the PSY proteins in chloroplasts; PSY1 and PSY2 localized to the thylakoid membranes, while PSY4 localized to plastoglobuli. Transcript levels in 'Granny Smith' and 'Royal Gala' apple cultivars showed PSY2 was most highly expressed in fruit and other vegetative tissues. We tested the transient activation of the apple PSY1 and PSY2 promoters and identified potential and differential regulation by AP2/ERF transcription factors, which suggested that the PSY genes are controlled by different transcriptional mechanisms. The first committed carotenoid pathway step in apple is controlled by MdPSY1 and MdPSY2, while MdPSY4 play little or no role in this respect. This has implications for apple breeding programmes where carotenoid enhancement is a target and would allow co-segregation with phenotypes to be tested during the development of new cultivars.
Mbah, Nneka E; Overmeyer, Jean H; Maltese, William A
2017-06-01
Methuosis is a form of non-apoptotic cell death involving massive vacuolization of macropinosome-derived endocytic compartments, followed by a decline in metabolic activity and loss of membrane integrity. To explore the induction of methuosis as a potential therapeutic strategy for killing cancer cells, we have developed small molecules (indole-based chalcones) that trigger this form of cell death in glioblastoma and other cancer cell lines. Here, we report that in addition to causing fusion and expansion of macropinosome compartments, the lead compound, 3-(5-methoxy-2-methyl-1H-indol-3-yl)-1-(4-pyridinyl)-2-propen-1-one (MOMIPP), disrupts vesicular trafficking at the lysosomal nexus, manifested by impaired degradation of EGF and LDL receptors, defective processing of procathepsins, and accumulation of autophagosomes. In contrast, secretion of the ectodomain derived from a prototypical type-I membrane glycoprotein, β-amyloid precursor protein, is increased rather than diminished. A closely related MOMIPP analog, which causes substantial vacuolization without reducing cell viability, also impedes cathepsin processing and autophagic flux, but has more modest effects on receptor degradation. A third analog, which causes neither vacuolization nor loss of viability, has no effect on endolysosomal trafficking. The results suggest that differential cytotoxicity of structurally similar indole-based chalcones is related, at least in part, to the severity of their effects on endolysosomal trafficking pathways.
Kudo, Fumitaka; Matsuura, Yasunori; Hayashi, Takaaki; Fukushima, Masayuki; Eguchi, Tadashi
2016-07-01
Sordarin is a glycoside antibiotic with a unique tetracyclic diterpene aglycone structure called sordaricin. To understand its intriguing biosynthetic pathway that may include a Diels-Alder-type [4+2]cycloaddition, genome mining of the gene cluster from the draft genome sequence of the producer strain, Sordaria araneosa Cain ATCC 36386, was carried out. A contiguous 67 kb gene cluster consisting of 20 open reading frames encoding a putative diterpene cyclase, a glycosyltransferase, a type I polyketide synthase, and six cytochrome P450 monooxygenases were identified. In vitro enzymatic analysis of the putative diterpene cyclase SdnA showed that it catalyzes the transformation of geranylgeranyl diphosphate to cycloaraneosene, a known biosynthetic intermediate of sordarin. Furthermore, a putative glycosyltransferase SdnJ was found to catalyze the glycosylation of sordaricin in the presence of GDP-6-deoxy-d-altrose to give 4'-O-demethylsordarin. These results suggest that the identified sdn gene cluster is responsible for the biosynthesis of sordarin. Based on the isolated potential biosynthetic intermediates and bioinformatics analysis, a plausible biosynthetic pathway for sordarin is proposed.
Ju, Yunfeng; Mizutani, Tetsuya; Imamichi, Yoshitaka; Yazawa, Takashi; Matsumura, Takehiro; Kawabe, Shinya; Kanno, Masafumi; Umezawa, Akihiro; Kangawa, Kenji; Miyamoto, Kaoru
2012-11-01
5-Aminolevulinic acid synthase 1 (ALAS1) is a rate-limiting enzyme for heme biosynthesis in mammals. Heme is essential for the catalytic activities of P450 enzymes including steroid metabolic enzymes. Nuclear receptor 5A (NR5A) family proteins, steroidogenic factor-1 (SF-1), and liver receptor homolog-1 (LRH-1) play pivotal roles in regulation of steroidogenic enzymes. Recently, we showed that expression of SF-1/LRH-1 induces differentiation of mesenchymal stem cells into steroidogenic cells. In this study, genome-wide analysis revealed that ALAS1 was a novel SF-1-target gene in differentiated mesenchymal stem cells. Chromatin immunoprecipitation and reporter assays revealed that SF-1/LRH-1 up-regulated ALAS1 gene transcription in steroidogenic cells via binding to a 3.5-kb upstream region of ALAS1. The ALAS1 gene was up-regulated by overexpression of SF-1/LRH-1 in steroidogenic cells and down-regulated by knockdown of SF-1 in these cells. Peroxisome proliferator-activated receptor-γ coactivator-1α, a coactivator of nuclear receptors, also strongly coactivated expression of NR5A-target genes. Reporter analysis revealed that peroxisome proliferator-activated receptor-γ coactivator-1α strongly augmented ALAS1 gene transcription caused by SF-1 binding to the 3.5-kb upstream region. Finally knockdown of ALAS1 resulted in reduced progesterone production by steroidogenic cells. These results indicate that ALAS1 is a novel NR5A-target gene and participates in steroid hormone production.
Methionine synthase A2756G and reduced folate carrier1 A80G ...
African Journals Online (AJOL)
Background: Polymorphisms of genes encoding enzymes involved in folate metabolism have long been hypothesized to be maternal risk factors for Down syndrome, however, results are conflicting and inconclusive. Aim of the study: To analyze the effect of methionine synthase (MTR) A2756G, and reduced folate carrier ...
Directory of Open Access Journals (Sweden)
Raúl González
2015-08-01
Full Text Available Hepatocellular carcinoma develops in cirrhotic liver. The nitric oxide (NO synthase type III (NOS-3 overexpression induces cell death in hepatoma cells. The study developed gene therapy designed to specifically overexpress NOS-3 in cultured hepatoma cells, and in tumors derived from orthotopically implanted tumor cells in fibrotic livers. Liver fibrosis was induced by CCl4 administration in mice. Hepa 1-6 cells were used for in vitro and in vivo experiments. The first generation adenovirus was designed to overexpress NOS-3 (or GFP and luciferase cDNA under the regulation of murine alpha-fetoprotein (AFP and Rous Sarcoma Virus (RSV promoters, respectively. Both adenoviruses were administered through the tail vein two weeks after orthotopic tumor cell implantation. AFP-NOS-3/RSV-Luciferase increased oxidative-related DNA damage, p53, CD95/CD95L expression and caspase-8 activity in cultured Hepa 1-6 cells. The increased expression of CD95/CD95L and caspase-8 activity was abolished by l-NAME or p53 siRNA. The tail vein infusion of AFP-NOS- 3/RSV-Luciferase adenovirus increased cell death markers, and reduced cell proliferation of established tumors in fibrotic livers. The increase of oxidative/nitrosative stress induced by NOS-3 overexpression induced DNA damage, p53, CD95/CD95L expression and cell death in hepatocellular carcinoma cells. The effectiveness of the gene therapy has been demonstrated in vitro and in vivo.
Energy Technology Data Exchange (ETDEWEB)
Pejcha, Robert; Ludwig, Martha L. (Michigan)
2010-03-08
Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.
International Nuclear Information System (INIS)
Pejcha, Robert; Ludwig, Martha L.
2005-01-01
Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (βα) 8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys) 3 Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E · Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.
Directory of Open Access Journals (Sweden)
Robert Pejchal
2005-02-01
Full Text Available Cobalamin-independent methionine synthase (MetE catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH, both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (betaalpha(8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys(3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E.Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.
Directory of Open Access Journals (Sweden)
Aarón Barraza
2016-11-01
Full Text Available Legumes form symbioses with rhizobia, producing nitrogen-fixing nodules on the roots of the plant host. The network of plant signaling pathways affecting carbon metabolism may determine the final number of nodules. The trehalose biosynthetic pathway regulates carbon metabolism and plays a fundamental role in plant growth and development, as well as in plant-microbe interactions. The expression of genes for trehalose synthesis during nodule development suggests that this metabolite may play a role in legume-rhizobia symbiosis. In this work, PvTPS9, which encodes a Class II trehalose-6-phosphate synthase (TPS of common bean (Phaseolus vulgaris, was silenced by RNA interference in transgenic nodules. The silencing of PvTPS9 in root nodules resulted in a reduction of 85% (± 1% of its transcript, which correlated with a 30% decrease in trehalose contents of transgenic nodules and in untransformed leaves. Composite transgenic plants with PvTPS9 silenced in the roots showed no changes in nodule number and nitrogen fixation, but a severe reduction in plant biomass and altered transcript profiles of all Class II TPS genes. Our data suggest that PvTPS9 plays a key role in modulating trehalose metabolism in the symbiotic nodule and, therefore, in the whole plant.
Yamamura, Y; Mizuguchi, Y; Taura, F; Kurosaki, F
2014-10-01
A cDNA clone, designated SdGGPPS2, was isolated from young seedlings of Scoparia dulcis. The putative amino acid sequence of the translate of the gene showed high homology with geranylgeranyl diphosphate synthase (GGPPS) from various plant sources, and the N-terminal residues exhibited the characteristics of chloroplast targeting sequence. An appreciable increase in the transcriptional level of SdGGPPS2 was observed by exposure of the leaf tissues of S. dulcis to methyl jasmonate, yeast extract or Ca(2+) ionophore A23187. In contrast, SdGGPPS1, a homologous GGPPS gene of the plant, showed no or only negligible change in the expression level upon treatment with these stimuli. The truncated protein heterologously expressed in Escherichia coli in which the putative targeting domain was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to liberate geranylgeranyl diphosphate. These results suggested that SdGGPPS2 plays physiological roles in methyl jasmonate and yeast extract-induced metabolism in the chloroplast of S. dulcis cells.
DEFF Research Database (Denmark)
Heo, Min-Ji; Jung, Hwi-Min; Um, Jaeyong
2017-01-01
Genome editing using CRISPR/Cas9 was successfully demonstrated in Esherichia coli to effectively produce n-butanol in a defined medium under microaerobic condition. The butanol synthetic pathway genes including those encoding oxygen-tolerant alcohol dehydrogenase were overexpressed in metabolically...... prediction program, UTR designer, and modified using the CRISPR/Cas9 genome editing method to reduce its expression level. E. coli strains with decreased citrate synthase expression produced more butanol and the citrate synthase activity was correlated with butanol production. These results demonstrate...
Souza-Moreira, Tatiana M.; Alves, Thaís B.; Pinheiro, Karina A.; Felippe, Lidiane G.; de Lima, Gustavo M. A.; Watanabe, Tatiana F.; Barbosa, Cristina C.; Santos, Vânia A. F. F. M.; Lopes, Norberto P.; Valentini, Sandro R.; Guido, Rafael V. C.; Furlan, Maysa; Zanelli, Cleslei F.
2016-11-01
Among the biologically active triterpenes, friedelin has the most-rearranged structure produced by the oxidosqualene cyclases and is the only one containing a cetonic group. In this study, we cloned and functionally characterized friedelin synthase and one cycloartenol synthase from Maytenus ilicifolia (Celastraceae). The complete coding sequences of these 2 genes were cloned from leaf mRNA, and their functions were characterized by heterologous expression in yeast. The cycloartenol synthase sequence is very similar to other known OSCs of this type (approximately 80% identity), although the M. ilicifolia friedelin synthase amino acid sequence is more related to β-amyrin synthases (65-74% identity), which is similar to the friedelin synthase cloned from Kalanchoe daigremontiana. Multiple sequence alignments demonstrated the presence of a leucine residue two positions upstream of the friedelin synthase Asp-Cys-Thr-Ala-Glu (DCTAE) active site motif, while the vast majority of OSCs identified so far have a valine or isoleucine residue at the same position. The substitution of the leucine residue with valine, threonine or isoleucine in M. ilicifolia friedelin synthase interfered with substrate recognition and lead to the production of different pentacyclic triterpenes. Hence, our data indicate a key role for the leucine residue in the structure and function of this oxidosqualene cyclase.
Formation of wood secondary cell wall may involve two type cellulose synthase complexes in Populus.
Xi, Wang; Song, Dongliang; Sun, Jiayan; Shen, Junhui; Li, Laigeng
2017-03-01
Cellulose biosynthesis is mediated by cellulose synthases (CesAs), which constitute into rosette-like cellulose synthase complexe (CSC) on the plasma membrane. Two types of CSCs in Arabidopsis are believed to be involved in cellulose synthesis in the primary cell wall and secondary cell walls, respectively. In this work, we found that the two type CSCs participated cellulose biosynthesis in differentiating xylem cells undergoing secondary cell wall thickening in Populus. During the cell wall thickening process, expression of one type CSC genes increased while expression of the other type CSC genes decreased. Suppression of different type CSC genes both affected the wall-thickening and disrupted the multilaminar structure of the secondary cell walls. When CesA7A was suppressed, crystalline cellulose content was reduced, which, however, showed an increase when CesA3D was suppressed. The CesA suppression also affected cellulose digestibility of the wood cell walls. The results suggest that two type CSCs are involved in coordinating the cellulose biosynthesis in formation of the multilaminar structure in Populus wood secondary cell walls.
Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata
2017-08-01
Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.
Komonyi, Orban; Schauer, Tamas; Papai, Gabor; Deak, Peter; Boros, Imre M
2009-03-15
Although telomere formation occurs through a different mechanism in Drosophila compared with other organisms, telomere associations result from mutations in homologous genes, indicating the involvement of similar pathways in chromosome end protection. We report here that mutations of the Drosophila melanogaster gene CG31241 lead to high frequency chromosome end fusions. CG31241 is a bicistronic gene that encodes trimethylguanosine synthase (TGS1), which forms the m3G caps of noncoding small RNAs, and a novel protein, DTL. We show that although TGS1 has no role in telomere protection, DTL is localized at specific sites, including the ends of polytene chromosomes, and its loss results in telomere associations. Mutations of ATM- and Rad3-related (ATR) kinase suppress telomere fusions in the absence of DTL. Thus, genetic interactions place DTL in an ATR-related pathway in telomere protection. In contrast to ATR kinase, mutations of ATM (ataxia telangiectasia mutated) kinase, which acts in a partially overlapping pathway of telomere protection, do not suppress formation of telomere associations in the absence of DTL. Thus, uncovering the role of DTL will help to dissect the evolutionary conserved pathway(s) controlling ATM-ATR-related telomere protection.
Directory of Open Access Journals (Sweden)
Vandana Sharma
2009-01-01
Full Text Available A series of 3,5-diaryl-1-benzothiazolopyrazoline derivatives were synthesized by the reaction of appropriately substituted chalcones and 2-hydrazinobenzothiazole in ethanol. The synthesized heterocycles have been characterized on the basis of their chemical properties and spectroscopic data. These compounds were tested for biological activity against a variety of test organisms.
Bacharaju, Keerthana; Jambula, Swathi Reddy; Sivan, Sreekanth; Jyostnatangeda, Saritha; Manga, Vijjulatha
2012-05-01
A series of novel dithiocarbamates with benzimidazole and chalcone scaffold have been designed synthesised and evaluated for their antimitotic activity. Compounds 4c and 9d display the most promising antimitotic activity with IC(50) of 1.66 μM and 1.52 μM respectively. Copyright © 2012 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Vandana Sharma
2010-01-01
Full Text Available A series of 3-aryl-5-styrylisoxazoline/ 3,5-diarylisoxazoline derivatives were synthesized by the reaction of appropriately substituted chalcones and hydroxylamine hydrochloride in presence of alkali in ethanol. The synthesized heterocycles have been characterized on the basis of their chemical properties and spectroscopic data. These compounds were tested for biological activity against a variety of test organisms
Chandra Shekhara Shetty, T.; Chidan Kumar, C. S.; Gagan Patel, K. N.; Chia, Tze Shyang; Dharmaprakash, S. M.; Ramasami, Ponnadurai; Umar, Yunusa; Chandraju, Siddegowda; Quah, Ching Kheng
2017-09-01
Two new chalcones namely, (2E)-1-(3-fluoro-4-methoxyphenyl)-3-(4-methoxyphenyl) prop-2-en-1-one and (2E)-3-(4-chlorophenyl)-1-(3-fluoro-4-methoxyphenyl)prop-2-en-1-one were synthesized and grown as single crystals by slow evaporation technique in methanol. The FTIR spectrum recorded confirms the presence of functional groups in these materials. The molecular conformation of the compounds was achieved by single crystal X-ray diffraction studies. The thermal stability of the crystals was determined from TGA/DSC curve. The third order optical nonlinearity of the chalcone compounds in DMF solution has been carried out using an Nd:YAG laser at 532 nm as the source of excitation. The nonlinear optical response was characterized by measuring the intensity dependent refractive index n2 of the medium using Z-scan technique. It is seen that the molecules exhibit a negative (defocusing) nonlinearity and large nonlinear refractive index of the order of -1.8 × 10-11 esu. The third-order nonlinearity of the studied chalcones is dominated by nonlinear refraction, which leads to strong optical limiting of laser. The result reveals that these two new chalcone molecules would be a promising material for optical limiting applications. In addition, the optimized molecular geometry, vibrational frequencies in gas, and the Molecular Electrostatic Potential (MEP) surface parameters of the two molecules were calculated using DFT/B3LYP method with 6-311++G(d,p) basis set in ground state. All the theoretical calculations were found in good agreement with experimental data.
Basyuni, M.; Sulistiyono, N.; Wati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Cloning of Kandelia obovata KcCAS gene (previously known as Kandelia candel) and Rhizophora stylosa RsCAS have already have been reported and encoded cycloartenol synthases. In this study, the predicted KcCAS and RsCAS protein were analyzed using online software of Phyre2 and Swiss-model. The protein modelling for KcCAS and RsCAS cycloartenol synthases was determined using Pyre2 had similar results with slightly different in sequence identity. By contrast, the Swiss-model for KcCAS slightly had higher sequence identity (47.31%) and Qmean (0.70) compared to RsCAS. No difference of ligands binding site which is considered as modulators for both cycloartenol synthases. The range of predicted protein derived from 91-757 amino acid residues with coverage sequence similarities 0.86, respectively from template model of lanosterol synthase from the human. Homology modelling revealed that 706 residues (93% of the amino acid sequence) had been modelled with 100.0% confidence by the single highest scoring template for both KcCAS and RsCAS using Phyre2. This coverage was more elevated than swiss-model predicted (86%). The present study suggested that both genes are responsible for the genesis of cycloartenol in these mangrove plants.
Wan, Huihua; Zhang, Jie; Song, Tingting; Tian, Ji; Yao, Yuncong
2015-01-01
Flavonoids are secondary metabolites that play important roles in plant physiology. Despite numerous studies examined the effects of available carbon (C) or nitrogen (N) on flavonoid biosynthesis, the mechanism of C/N interactive effects on flavonoid metabolism is still unclear. In this study, we analyzed the composition of flavonoids and the expression levels of flavonoid-related genes in leaves and calli of crabapple (Malus sp.) cultivars with different leaf colors grown on media with different C/N ratios. Our results show that high C/N ratios induce anthocyanin pigmentation in leaves of the ever-red cultivar 'Royalty' and the spring-red cultivar 'Prairifire,' as well as in three types of calli derived from the ever-green cultivar 'Spring Snow,' but not in the leaves of the ever-green cultivar 'Flame.' This phenomenon therefore correlated with anthocyanin content in these different samples. In addition, high C/N ratios in the growth media resulted in an increase in the concentration of flavones and flavonols in the leaves of the three crabapple cultivars. The transcript levels of the general flavonoid pathway genes [from chalcone synthase (CHS) to uridine diphosphat-glucose: flavonoid 3-O-glycosyltransferase (UFGT) and flavonol synthase (FLS)] increased in response to high C/N ratios, and this in turn was correlated with the concentration of anthocyanins, flavones and flavonols in the leaves and calli. Expression of the late flavonoid/anthocyanin biosynthetic genes, anthocyanidin synthase (ANS), UFGT and FLS in particular, was more strongly influenced by C/N ratios than other structural genes, and the increased expression of the structural genes under high C/N ratios coincided with a coordinated increase in transcript levels of a MYB transcription factor, MYB10. These results are likely to be useful for future generation of plants with an optimized flavonoid/anthocyanin content or desirable organ coloration.
Directory of Open Access Journals (Sweden)
Huihua eWan
2015-09-01
Full Text Available Flavonoids are secondary metabolites that play important roles in plant physiology. Despite numerous studies examined the effects of available carbon (C or nitrogen (N on flavonoid biosynthesis, the mechanism of C/N interactive effects on flavonoid metabolism is still unclear. In this study, we analyzed the composition of flavonoids and the expression levels of flavonoid-related genes in leaves and calli of crabapple (Malus spp. cultivars with different leaf colors grown on media with different C/N ratios. Our results show that high C/N ratios induce anthocyanin pigmentation in leaves of the ever-red cultivar ‘Royalty’ and the spring-red cultivar ‘Prairifire’, as well as in three types of calli derived from the ever-green cultivar ‘Spring Snow’, but not in the leaves of the ever-green cultivar ‘Flame’. This phenomenon therefore correlated with anthocyanin content in these different samples. In addition, high C/N ratios in the growth media resulted in an increase in the concentration of flavones and flavonols in the leaves of the three crabapple cultivars. The transcript levels of the general flavonoid pathway genes [from chalcone synthase (CHS to uridine diphosphate (UDP-glucose: flavonoid 3-O-glycosyltransferase (UFGT and flavonol synthase (FLS] increased in response to high C/N ratios, and this in turn was correlated with the concentration of anthocyanin, flavone and flavonol in the leaves and calli. Expression of the late flavonoid/anthocyanin biosynthetic genes, anthocyanidin synthase (ANS, UFGT and FLS in particular, was more strongly influenced by C/N ratios than other structural genes, and the increased expression of the structural genes under high C/N ratios coincided with a coordinated increase in transcript levels of a MYB transcription factor, MYB10. These results are likely to be useful for future generation of plants with an optimized flavonoid/anthocyanin content or desirable organ coloration.
Endler, Anne; Schneider, Rene; Kesten, Christopher; Lampugnani, Edwin R.; Persson, Staffan
2016-01-01
Cellulose is a cell wall constituent that is essential for plant growth and development, and an important raw material for a range of industrial applications. Cellulose is synthesized at the plasma membrane by massive cellulose synthase (CesA) complexes that track along cortical microtubules in elongating cells of Arabidopsis through the activity of the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1). In a recent study we identified another family of proteins that also are associated with the ...
DEFF Research Database (Denmark)
Bernal Giraldo, Adriana Jimena; Jensen, Jacob Krüger; Harholt, Jesper
2007-01-01
Members of a large family of cellulose synthase-like genes (CSLs) are predicted to encode glycosyl transferases (GTs) involved in the biosynthesis of plant cell walls. The CSLA and CSLF families are known to contain mannan and glucan synthases, respectively, but the products of other CSLs...... are unknown. Here we report the effects of disrupting ATCSLD5 expression in Arabidopsis. Both stem and root growth were significantly reduced in ATCSLD5 knock-out plants, and these plants also had increased susceptibility to the cellulose synthase inhibitor isoxaben. Antibody and carbohydrate-binding module...
de Castro, Clarissa C B; Costa, Poliana S; Laktin, Gisele T; de Carvalho, Paulo H D; Geraldo, Reinaldo B; de Moraes, Josué; Pinto, Pedro L S; Couri, Mara R C; Pinto, Priscila de F; Da Silva Filho, Ademar A
2015-09-15
Schistosomiasis is one of the world's major public health problems, and praziquantel (PZQ) is the only available drug to treat this neglected disease with an urgent demand for new drugs. Recent studies indicated that extracts from Piper aduncum L. (Piperaceae) are active against adult worms of Schistosoma mansoni, the major etiological agent of human schistosomiasis. We investigated the in vitro schistosomicidal activity of cardamonin, a chalcone isolated from the crude extract of P. aduncum. Also, this present work describes, for the first time, the S. mansoni ATP diphosphohydrolase inhibitory activity of cardamonin, as well as, its molecular docking with S. mansoni ATPDase1, in order to investigate its mode of inhibition. In vitro schistosomicidal assays and confocal laser scanning microscopy were used to evaluate the effects of cardamonin on adult schistosomes. Cell viability was measured by MTT assay, and the S. mansoni ATPase activity was determined spectrophotometrically. Identification of the cardamonin binding site and its interactions on S. mansoni ATPDase1 were made by molecular docking experiments. A bioguided fractionation of the crude extract of P. aduncum was carried out, leading to identification of cardamonin as the active compound, along with pinocembrin and uvangoletin. Cardamonin (25, 50, and 100 µM) caused 100% mortality, tegumental alterations, and reduction of oviposition and motor activity of all adult worms of S. mansoni, without affecting mammalian cells. Confocal laser scanning microscopy showed tegumental morphological alterations and changes on the numbers of tubercles of S. mansoni worms in a dose-dependent manner. Cardamonin also inhibited S. mansoni ATP diphosphohydrolase (IC50 of 23.54 µM). Molecular docking studies revealed that cardamonin interacts with the Nucleotide-Binding of SmATPDase 1. The nature of SmATPDase 1-cardamonin interactions is mainly hydrophobic and hydrogen bonding. This report provides evidence for the in vitro
Chalcone-imidazolone conjugates induce apoptosis through DNA damage pathway by affecting telomeres
Directory of Open Access Journals (Sweden)
Kamal Ahmed
2011-04-01
Full Text Available Abstract Background Breast cancer is one of the most prevalent cancers in the world and more than one million women are diagnosed leading to 410,000 deaths every year. In our previous studies new chalcone-imidazolone conjugates were prepared and evaluated for their anticancer activity in a panel of 53 human tumor cell lines and the lead compounds identified were 6 and 8. This prompted us to investigate the mechanism of apoptotic event. Results Involvement of pro-apoptotic protein (Bax, active caspase-9 and cleavage of retinoblastoma protein was studied. Interestingly, the compounds caused upregulation of p21, check point proteins (Chk1, Chk2 and as well as their phosphorylated forms which are known to regulate the DNA damage pathway. Increased p53BP1 foci by immunolocalisation studies and TRF1 suggested the possible involvement of telomere and associated proteins in the apoptotic event. The telomeric protein such as TRF2 which is an important target for anticancer therapy against human breast cancer was extensively studied along with proteins involved in proper functioning of telomeres. Conclusions The apoptotic proteins such as Bax, active caspase-9 and cleaved RB are up-regulated in the compound treated cells revealing the apoptotic nature of the compounds. Down regulation of TRF2 and upregulation of the TRF1 as well as telomerase assay indicated the decrease in telomeric length revealing telomeric dysfunction and thereby controlling the rapid rate of cell proliferation. In summary, chalcone-imidazolone conjugates displayed significant DNA damage activity particularly at telomeres and caused both apoptosis and senescence-like growth arrest which suggested that these compounds have potential activity against breast carcinoma.
DEFF Research Database (Denmark)
Maile, C A; Hingst, Janne Rasmuss; Mahalingan, K K
2017-01-01
BACKGROUND: Equine type 1 polysaccharide storage myopathy (PSSM1) is associated with a missense mutation (R309H) in the glycogen synthase (GYS1) gene, enhanced glycogen synthase (GS) activity and excessive glycogen and amylopectate inclusions in muscle. METHODS: Equine muscle biochemical...... had significantly higher glycogen content than control horse muscle despite no difference in GS expression. GS activity was significantly higher in muscle from homozygous mutants than from heterozygote and control horses, in the absence and presence of the allosteric regulator, glucose 6 phosphate (G6...
Directory of Open Access Journals (Sweden)
Chun-Hsien eHung
2016-01-01
Full Text Available Phosphatidylglycerol (PG and cardiolipin (CL are two essential classes of phospholipid in plants and algae. Phosphatidylglycerophosphate synthase (PGPS and cardiolipin synthase (CLS involved in the biosynthesis of PG and CL belong to CDP-alcohol phosphotransferase and share overall amino acid sequence homology. However, it remains elusive whether PGPS and CLS are functionally distinct in vivo. Here, we report identification of a gene encoding CLS in Chlamydomonas reinhardtii, CrCLS1, and its functional compatibility. Whereas CrCLS1 did not complement the growth phenotype of a PGPS mutant of Synechocystis sp. PCC 6803, it rescued the temperature-sensitive growth phenotype, growth profile with different carbon sources, phospholipid composition and enzyme activity of ∆crd1, a CLS mutant of Saccharomyces cerevisiae. These results suggest that CrCLS1 encodes a functional CLS of C. reinhardtii as the first identified algal CLS, whose enzyme function is distinct from that of PGPSs from C. reinhardtii. Comparison of CDP-alcohol phosphotransferase motif between PGPS and CLS among different species revealed a possible additional motif that might define the substrate specificity of these closely related enzymes.
Gaber, Mohamed; Awad, Mohamed K.; Atlam, Faten M.
2018-05-01
The ligation behavior of two chalcone ligands namely, (E)-3-(4-chlorophenyl)-1-(pyridin-2-yl)prop-2-en-1-one (L1) and (E)-3-(4-methoxyphenyl)-1-(pyridin-2-yl)prop-2-en-1-one (L2), towards the Pd(II) ion is determined. The structures of the complexes are elucidated by elemental analysis, spectral methods (IR, electronic and NMR spectra) as well as the conductance measurements and thermal analysis. The metal complexes exhibit a square planar geometrical arrangement. The kinetic and thermodynamic parameters for some selected decomposition steps have been calculated. The antimicrobial, antioxidant and anticancer activities of the chalcones and their Pd(II) complexes have been evaluated. Molecular orbital computations are performed using DFT at B3LYP level with 6-31 + G(d) and LANL2DZ basis sets to access reliable results to the experimental values. The calculations are performed to obtain the optimized molecular geometry, charge density distribution, extent of distortion from regular geometry. Thermodynamic parameters for the investigated compounds are also studied. The calculations confirm that the investigated complexes have square planner geometry, which is in a good agreement with the experimental observation.
Directory of Open Access Journals (Sweden)
Michelle F. Valentine
2017-05-01
Full Text Available Soybean [Glycine max (L. Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2, to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets.
Valentine, Michelle F.; De Tar, Joann R.; Mookkan, Muruganantham; Firman, Jeffre D.; Zhang, Zhanyuan J.
2017-01-01
Soybean [Glycine max (L.) Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2), to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME) in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets. PMID:28559898
Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan
2015-01-01
The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.
International Nuclear Information System (INIS)
Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen; Liang, Yu-He; Su, Xiao-Dong
2006-01-01
Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni 2+ -chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution. The crystal belongs to space group P2 1 , with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°
Directory of Open Access Journals (Sweden)
Boon Chin Tan
2015-01-01
Full Text Available The distribution patterns of flavonoids and cyclohexenyl chalcone derivatives in conventional propagated (CP and in vitro-derived (CPA field-grown plants of an important medicinal ginger, Boesenbergia rotunda, are described. A total of eight compounds were extracted from six organs (rootlet, rhizome, shoot base, maroon stem, stalk, and leaf of the CP and CPA plants. Five major chromatographic peaks, namely, alpinetin, pinocembrin, pinostrobin, 4-hydroxypanduratin A, and panduratin A, were consistently observed by high performance liquid chromatography. Nonaerial organs had higher levels of flavonoids than the aerial ones for all types of samples. Among the compounds detected, pinostrobin and 4-hydroxypanduratin A were the most abundant flavonoid and cyclohexenyl chalcone derivative, respectively. The distribution and abundance of the bioactive compounds suggested that the shoot base could be more potentially useful for medicinal application than other organs of the plant and may be the site of storage or occurrence of biosynthetic enzymatic activities.
Shankarishan, Priyanka; Borah, Prasanta Kumar; Ahmed, Giasuddin; Mahanta, Jagadish
2011-01-01
Background & objectives Endothelial nitric oxide is a potent vasodilator and impairment of its generation brought about by gene polymorphism is considered a major predictor for several diseases. A single nucleotide polymorphism G894T within exon 7 of endothelial nitric oxide synthase (eNOS-7) gene, resulting in a replacement of glutamic acid by aspartic acid, has been studied as a putative candidate gene for cardiovascular diseases. The pattern of eNOS-7 Glu298Asp variant in the Indian population is poorly known. The present study was planned to determine the prevalence of the variant of this gene among tea garden community in Assam, North-East India with high prevalence of hypertension. Methods Study participants of both sex aged ≥18 yr were recruited randomly from temporary field clinics established in tea gardens of Dibrugarh, Assam. Genomic DNA was extracted from 409 subjects by the conventional phenol-chloroform method. The prevalence of the eNOS exon 7 Glu298Asp variant was determined by polymerase chain reaction and restriction fragment length polymorphism analysis. Results The study population was in Hardy-Weinberg Equilibrium. The frequency of the eNOS GG, GT and TT genotypes was found to be 75, 22 and 3 per cent respectively and did not show any significant difference in gender wise analysis. Interpretation & conclusions Our results showed that the prevalence of the homozygous GG genotype was high (75%) and the rare mutant genotype (homozygous, TT) was 3 per cent in a population at risk with cardiovascular disease. Such population-based data on various polymorphisms can ultimately be exploited in pharmacogenomics. PMID:21623032
Xu, Yingchun; Wang, Yanjie; Mattson, Neil; Yang, Liu; Jin, Qijiang
2017-12-01
Trehalose-6-phosphate synthase (TPS) serves important functions in plant desiccation tolerance and response to environmental stimuli. At present, a comprehensive analysis, i.e. functional classification, molecular evolution, and expression patterns of this gene family are still lacking in Solanum tuberosum (potato). In this study, a comprehensive analysis of the TPS gene family was conducted in potato. A total of eight putative potato TPS genes (StTPSs) were identified by searching the latest potato genome sequence. The amino acid identity among eight StTPSs varied from 59.91 to 89.54%. Analysis of d N /d S ratios suggested that regions in the TPP (trehalose-6-phosphate phosphatase) domains evolved faster than the TPS domains. Although the sequence of the eight StTPSs showed high similarity (2571-2796 bp), their gene length is highly differentiated (3189-8406 bp). Many of the regulatory elements possibly related to phytohormones, abiotic stress and development were identified in different TPS genes. Based on the phylogenetic tree constructed using TPS genes of potato, and four other Solanaceae plants, TPS genes could be categorized into 6 distinct groups. Analysis revealed that purifying selection most likely played a major role during the evolution of this family. Amino acid changes detected in specific branches of the phylogenetic tree suggests relaxed constraints might have contributed to functional divergence among groups. Moreover, StTPSs were found to exhibit tissue and treatment specific expression patterns upon analysis of transcriptome data, and performing qRT-PCR. This study provides a reference for genome-wide identification of the potato TPS gene family and sets a framework for further functional studies of this important gene family in development and stress response.
Costa, G M; Endo, E H; Cortez, D A G; Nakamura, T U; Nakamura, C V; Dias Filho, B P
2016-09-01
Three chalcones, 2'-hydroxy-4,4',6'-trimethoxychalcone, 2'-hydroxy-4,4',6'-tetramethoxychalcone, and 3,2'-dihydroxy-4,4',6'-trimethoxychalcone, were isolated from the leaves of Piper hispidum in a bioguided fractionation of crude extract. The antimicrobial activity of crude extract of P. hispidum leaves was determined against bacteria Escherichia coli, Pseudomonas aeruginosa, Bacillus subtilis, Staphylococcus aureus and yeasts Candida albicans, C. parapsilosis and C. tropicalis. Fractions and chalcones were tested against C. albicans and S. aureus. The checkerboard assay was performed to assess synergic interactions between extract and antifungal drugs, and the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) reduction assay was used to evaluate anti-biofilm effects of extract. The extract was active against yeasts, S. aureus and B. subtilis with MIC values between 15.6 and 62.5μg/mL. Synergistic effects of extract associated with fluconazole and nystatin were observed against C. albicans, with fractional inhibitory concentration indices of 0.37 and 0.24, respectively. The extract was also effective against C. albicans and S. aureus biofilm cells at concentrations of 62.5 and 200μg/mL, respectively. Thus, P. hispidum may be a possible source of bioactive substances with antimicrobial properties. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Synthesis of Novel Chalcones as Acetylcholinesterase Inhibitors
Directory of Open Access Journals (Sweden)
Thanh-Dao Tran
2016-07-01
Full Text Available A new series of benzylaminochalcone derivatives with different substituents on ring B were synthesized and evaluated as inhibitors of acetylcholinesterase. The study is aimed at identification of novel benzylaminochalcones capable of blocking acetylcholinesterase activity for further development of an approach to Alzheimer’s disease treatment. These compounds were produced in moderate to good yields via Claisen-Schmidt condensation and subjected to an in vitro acetylcholinesterase inhibition assay, using Ellman’s method. The in silico docking procedure was also employed to identify molecular interactions between the chalcone compounds and the enzyme. Compounds with ring B bearing pyridin-4-yl, 4-nitrophenyl, 4-chlorophenyl and 3,4-dimethoxyphenyl moieties were discovered to exhibit significant inhibitory activities against acetylcholinesterase, with IC50 values ranging from 23 to 39 µM. The molecular modeling studies are consistent with the hypothesis that benzylaminochalcones could exert their effects as dual-binding-site acetylcholinesterase inhibitors, which might simultaneously enhance cholinergic neurotransmission and inhibit β-amyloid aggregation through binding to both catalytic and peripheral sites of the enzyme. These derivatives could be further developed to provide novel leads for the discovery of new anti-Alzheimer drugs in the future.
DEFF Research Database (Denmark)
Nielsen, S F; Christensen, S B; Cruciani, G
1998-01-01
of high quality (lymphocyte-suppressing model, R2 = 0. 90, Q2 = 0.80; antileishmanial model, R2 = 0.73, Q2 = 0.63). The coefficient plots indicate that steric interactions between the chalcones and the target are of major importance for the potencies of the compounds. A comparison of the coefficient plots......) of the compounds for the training sets and 9 compounds as an external validation set were performed by using the GRID/GOLPE methodology. The Smart Region Definition procedure with subsequent region selection as implemented in GOLPE reduced the number of variables to approximately 1300 yielding 3D-QSAR models...
Xu, Jinkun; Ai, Ying; Wang, Jianhui; Xu, Jingwei; Zhang, Yongkang; Yang, Dong
2017-05-01
S-limonene synthase is a model monoterpene synthase that cyclizes geranyl pyrophosphate (GPP) to form S-limonene. It is a relatively specific enzyme as the majority of its products are composed of limonene. In this study, we converted it to pinene or phellandrene synthases after introducing N345A/L423A/S454A or N345I mutations. Further studies on N345 suggest the polarity of this residue plays a critical role in limonene production by stabilizing the terpinyl cation intermediate. If it is mutated to a non-polar residue, further cyclization or hydride shifts occurs so the carbocation migrates towards the pyrophosphate, leading to the production of pinene or phellandrene. On the other hand, mutant enzymes that still possess a polar residue at this position produce limonene as the major product. N345 is not the only polar residue that may stabilize the terpinyl cation because it is not strictly conserved among limonene synthases across species and there are also several other polar residues in this area. These residues could form a "polar pocket" that may collectively play this stabilizing role. Our study provides important insights into the catalytic mechanism of limonene synthases. Furthermore, it also has wider implications on the evolution of terpene synthases. Copyright © 2017 Elsevier Ltd. All rights reserved.
Development of a Rickettsia bellii-Specific TaqMan Assay Targeting the Citrate Synthase Gene.
Hecht, Joy A; Allerdice, Michelle E J; Krawczak, Felipe S; Labruna, Marcelo B; Paddock, Christopher D; Karpathy, Sandor E
2016-11-01
Rickettsia bellii is a rickettsial species of unknown pathogenicity that infects argasid and ixodid ticks throughout the Americas. Many molecular assays used to detect spotted fever group (SFG) Rickettsia species do not detect R. bellii, so that infection with this bacterium may be concealed in tick populations when assays are used that screen specifically for SFG rickettsiae. We describe the development and validation of a R. bellii-specific, quantitative, real-time PCR TaqMan assay that targets a segment of the citrate synthase (gltA) gene. The specificity of this assay was validated against a panel of DNA samples that included 26 species of Rickettsia, Orientia, Ehrlichia, Anaplasma, and Bartonella, five samples of tick and human DNA, and DNA from 20 isolates of R. bellii, including 11 from North America and nine from South America. A R. bellii control plasmid was constructed, and serial dilutions of the plasmid were used to determine the limit of detection of the assay to be one copy per 4 µl of template DNA. This assay can be used to better determine the role of R. bellii in the epidemiology of tick-borne rickettsioses in the Western Hemisphere. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by US Government employees and is in the public domain in the US.