Directory of Open Access Journals (Sweden)
Tuti Susanti Legiastuti
2013-04-01
Full Text Available Yellow leaf curl disease, caused by a member of Begomovirus (Geminiviridae, is one of important diseases of chilli pepper in Indonesia. Exploration of endophytic fungi was initiated in order to find biological control agents for an alternative control strategies of this disease. Isolates of endophytic fungi were collected from chilli pepper growing area in Sleman, Yogyakarta and further identification using molecular technique involving polymerase chain reaction (PCR and DNA sequencing was performed. DNA fragments of ±500 bp were successfully amplified from 10 fungal isolates by PCR using primer pair ITS1/ITS4, but only 8 DNA sequences was obtained for further genetic analysis. Based on BLASTN analysis the endophytic fungi were identified as having the highest similarity with Pleosporaceae sp. (98% for H1 isolate, Cercospora nicotianae (100% for H5 isolate, ercospora piaropi (98% for H11 isolate, Guignardia mangiferae (99% for H16 isolate, Geomyces pannorum 95% for H17 isolate, Diaporthe phaseoloru (99% for H18 isolate, Dothideomycete sp. (100% for K3 isolate, and Alternaria longissima (99% for K10 isolate. Key words: Begomovirus, chillipepper, DNA sequencing, polymerase chain reaction
Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique
İLHAK, O. İrfan; ARSLAN, Ali
2014-01-01
The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...
Estimation of the reaction efficiency in polymerase chain reaction
Lalam, N.
2006-01-01
Polymerase chain reaction (PCR) is largely used in molecular biology for increasing the copy number of a specific DNA fragment. The succession of 20 replication cycles makes it possible to multiply the quantity of the fragment of interest by a factor of 1 million. The PCR technique has
Fusion chain reaction - a chain reaction with charged particles
International Nuclear Information System (INIS)
Peres, A.; Shvarts, D.
1975-01-01
When a DT-plasma is compressed to very high density, the particles resulting from nuclear reactions give their energy mostly to D and T ions, by nuclear collisions, rather than to electrons as usual. Fusion can thus proceed as a chain reaction, without the need of thermonuclear temperatures. In this paper, we derive relations for the suprathermal ion population created by a fusion reaction. Numerical integration of these equations shows that a chain reaction can proceed in a cold infinite DT-plasma at densities above 8.4x10 27 ions.cm -3 . Seeding the plasma with a small amount of 6 Li reduces the critical density to 7.2x10 27 ions.cm -3 (140000times the normal solid density). (author)
Determining Annealing Temperatures for Polymerase Chain Reaction
Porta, Angela R.; Enners, Edward
2012-01-01
The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…
Chain chemical reactions during matrix devitrification
International Nuclear Information System (INIS)
Barkalov, I.M.
1980-01-01
Investigation results of chain reaction mechanisms, proceeding at devitrification of glass-like matrices under the effect of γ-irradiation are summarized. Peculiarities of kinetics and mechanism of chain reactions proceeding at devitrification are considered: hydrocarbon chlorination, polymerization of vinyl monomers, copolymerization and graft polymerization. Possible application aspects of the chain reaction conducting during matrix devitrification are also considered
Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.
Ragheb, Suzan Mohammed; Jimenez, Luis
Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.
Nuclear chain reaction: forty years later
International Nuclear Information System (INIS)
Sachs, R.G.
1984-01-01
The proceedings from a 1982 symposium 40 years after the first controlled nuclear chain reaction took place in Chicago covers four sessions and public discussion. The session covered the history of the chain reaction; peaceful uses in technology, medicine, and biological science; peaceful uses in power generation; and nuclear weapons control. Among the speakers were Eugene Wigner, Glenn Seaborg, Alvin Weinberg, and others who participated in the first chain reaction experiments. The proceedings reflect differences of opinion among the scientists as well as the general public. References, slides, and tables used to illustrate the individual talks are included with the papers
Method of identification of unbranched chain reaction with cross termination of chain
International Nuclear Information System (INIS)
Poluehktov, V.A.; Begishev, I.R.
1977-01-01
Gas-phase chlorination of unsymmetrical difluoroethane initiated by gamma quanta of Co 60 has been studied. At decreased temperatures the only hydrogen is replaced by a chlorine atom. Over a wide range of ratios of the initial reagents, the reaction occurs with a chain rupture. An analysis of the kinetics of such a reaction provides a method for identification of an unbranched chain reaction with a cross-rupture of the chain
Bruisten, S. M.; Koppelman, M. H.; Roos, M. T.; Loeliger, A. E.; Reiss, P.; Boucher, C. A.; Huisman, H. G.
1993-01-01
OBJECTIVE: To develop a competitive polymerase chain reaction technique with which to evaluate the usefulness of HIV-1 level as a marker of response to antiviral treatment. DESIGN: HIV-1 sequences were assessed by competitive polymerase chain reaction in four subjects participating in a double-blind
DEFF Research Database (Denmark)
Østergaard, Lars; Traulsen, J; Birkelund, Svend
1991-01-01
the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....
DEFF Research Database (Denmark)
Østergaard, Lars; Traulsen, J; Birkelund, Svend
1993-01-01
the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....
Directory of Open Access Journals (Sweden)
CUNHA Regina Ayr Florio da
1998-01-01
Full Text Available The objective of the present study was to determine the prevalence of certain mycoplasma species, i.e., Mycoplasma hominis, Ureaplasma urealyticum and Mycoplasma penetrans, in urethral swabs from HIV-1 infected patients compared to swabs from a control group. Mycoplasmas were detected by routine culture techniques and by the Polymerase Chain Reaction (PCR technique, using 16SrRNA generic primers of conserved region and Mycoplasma penetrans specific primers. The positivity rates obtained with the two methods were comparable. Nevertheless, PCR was more sensitive, while the culture techniques allowed the quantification of the isolates. The results showed no significant difference (p < 0.05 in positivity rates between the methods used for mycoplasma detection.
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...
Pathogen detection by the polymerase chain reaction
Energy Technology Data Exchange (ETDEWEB)
Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)
1994-05-01
In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.
LENUS (Irish Health Repository)
O'Connor, T M
2012-02-03
BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.
International Nuclear Information System (INIS)
John C. Fisher
2000-01-01
Although helium atoms do not form molecules, a sufficiently large number will bind into a stable liquid droplet. A comparable situation is expected for neutrons, with a sufficiently large number binding into a stable droplet of neutron matter. Such polyneutron droplets can be viewed as isotopes of an element with nuclear charge Z=0, tentatively denoted neutrium, symbol Nt. Because of the relatively weak binding of neutrons compared with that of a mix of neutrons and protons, the minimum number of neutrons required for stability of a droplet is fairly large. Early estimates of ∼60 may be reduced to a dozen or so by the BCS pairing interaction. The Nt entries with N≥12 are new to the table of isotopes. Because all of them are beta-unstable, none is expected to persist as a free particle. Yet, some may occasionally be produced by means to be described below, and it is of interest to examine their decay chains and their interactions with charged nuclei to ascertain how their presence might be revealed. Although these reactions are interesting, they cannot be taken seriously without identifying a source for the initial Nt isotope that begins the chain. Here, we consider possible interactions between 16 O and A Nt. Although there is no strong interaction between them, we can expect a very weak residual attraction that can form a loosely bound 16 O A Nt nuclear molecule. This is not a compound nucleus in the usual sense because, considered as fluids, the 16 O and A Nt droplets are immiscible. For a droplet with fewer than about 60 neutrons, beta decay of A Nt is prevented by the buildup of Coulomb energy associated with transforming A Nt into A H in close proximity to 16 O. Thus, it is possible that 16 O A Nt molecules can persist indefinitely and that a few of them may be present in ordinary water as supermassive oxygen nuclei. Because the binding of these molecules is weak, the A Nt component can tunnel to an adjacent nucleus, and if the adjacent nucleus is 18 O, a
DEFF Research Database (Denmark)
Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels
1992-01-01
We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes....... Four heterozygotes could not be unequivocally typed with the PCR-RFLP method. The HLA-DPB1 typing results obtained with the PCR-RFLP method were compared with the typing results obtained with PCR allele-specific oligonucleotides (PCR-ASO) in 50 individuals. The results obtained with the two methods...
Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions
Zhang, Hefeng
2015-05-01
We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b-polystyrenyllithium (PI-. b-PSLi), to the main chain and subsequently to the branches in a divergent way. PI segment is short and serves as a precursor for multifunctional branching unit. The grafting reaction involves two successive steps: i) epoxidation of internal double bonds of PI segments, either in main chain or side chains; ii) ring-opening addition to the resulting epoxy group by the living PI-. b-PSLi. Repeating the two steps affords a series of cylindrical polymer brushes with up to 3rd generation and extremely high molecular weight. The branching multiplicity depends on the average number of oxirane groups per PI segment, usually ca. 8 in the present work. The high branching multiplicity leads to tremendous increase in molecular weights of the cylindrical products with generation growth. Several series of cylindrical polymer brushes with tunable aspect ratios are prepared using backbones and branches with controlled lengths. Shape anisotropy is investigated in dilute solution using light scattering technique. Worm-like single molecular morphology with large persistence length is observed on different substrates by atomic force microscopy.
Tangled nonlinear driven chain reactions of all optical singularities
Vasil'ev, V. I.; Soskin, M. S.
2012-03-01
Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.
The first nuclear chain reaction
International Nuclear Information System (INIS)
Zinn, W.H.
1989-01-01
The author offers his recollections of the experimental efforts beginning in 1939 which culminated in the Chain Reaction in the squash court on December 2, 1942. Recalled are Columbia University experiments which did much to establish the feasibility of the chain in natural uranium and which stimulated the creation of the Manhattan District. The Columbia group moved to the University of Chicago, where, in early summer of 1942, construction and analysis of a number of subcritical reactors (piles) gave assurance with a high probability that only a reasonable amount of uranium and moderator would be required
Reverse transcription and polymerase chain reaction: principles and applications in dentistry.
Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth
2004-03-01
Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.
Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...
Polymerase chain reaction to search for Herpes viruses in uveitic ...
African Journals Online (AJOL)
Objective: To analyse aqueous polymerase chain reaction (PCR) results in patients diagnosed with undifferentiated uveitis ... Cite as: Laaks D, Smit DP, Harvey J. Polymerase chain reaction to search for Herpes viruses in uveitic and healthy eyes: a South African ... may be mild and patients do not seek medical attention.
Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.
Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T
1997-09-01
In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.
Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol
2010-01-01
Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic ...
Nasarabadi, Shanavaz [Livermore, CA
2011-01-11
A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.
Bi, Sai; Yue, Shuzhen; Zhang, Shusheng
2017-07-17
Developing powerful, simple and low-cost DNA amplification techniques is of great significance to bioanalysis and biomedical research. Thus far, many signal amplification strategies have been developed, such as polymerase chain reaction (PCR), rolling circle amplification (RCA), and DNA strand displacement amplification (SDA). In particular, hybridization chain reaction (HCR), a type of toehold-mediated strand displacement (TMSD) reaction, has attracted great interest because of its enzyme-free nature, isothermal conditions, simple protocols, and excellent amplification efficiency. In a typical HCR, an analyte initiates the cross-opening of two DNA hairpins, yielding nicked double helices that are analogous to alternating copolymers. As an efficient amplification platform, HCR has been utilized for the sensitive detection of a wide variety of analytes, including nucleic acids, proteins, small molecules, and cells. In recent years, more complicated sets of monomers have been designed to develop nonlinear HCR, such as branched HCR and even dendritic systems, achieving quadratic and exponential growth mechanisms. In addition, HCR has attracted enormous attention in the fields of bioimaging and biomedicine, including applications in fluorescence in situ hybridization (FISH) imaging, live cell imaging, and targeted drug delivery. In this review, we introduce the fundamentals of HCR and examine the visualization and analysis techniques for HCR products in detail. The most recent HCR developments in biosensing, bioimaging, and biomedicine are subsequently discussed with selected examples. Finally, the review provides insight into the challenges and future perspectives of HCR.
Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...
Nuclear fission, chain reaction and criticality
International Nuclear Information System (INIS)
Reuss, Paul
2016-01-01
Criticality is, notably for nuclear reactors, the status which separates the case of a fission chain reaction which inexorably decays, from that of a reaction which grows faster and faster until a counter-reaction occurs. If this status is an objective in nuclear reactors, it must not be reached or exceeded in any case in other types of installations in which fissile materials are handled (fabrication, transports, nuclear fuel processing). The author proposes an insight into this notion of criticality, discusses elements of neutron science which allow the multiplication factor to be assessed, analyses accidental scenarios which may happen, and presents associated experiments and computation codes
Early detection of typhoid by polymerase chain reaction
International Nuclear Information System (INIS)
Haque, A.; Qureshi, Javed A.; Ahmed, J.
1999-01-01
Typhoid is a common problem in developing countries. Cultivation ofbacteria and serology (especially Widal test) gives unacceptable levels offalse-negative and false-positive results respectively. In this study, arecently introduced polymerase chain reaction based technique (which has 100%specificity for Salmonella typhi) was compared with blood culture and Widaltest during the first week of illness of 82 suspected cases of typhoid. Therespective figures of positivity for PCR, blood culture and Widal test were71.95%, 34.1% and 36.5%. A control group of 20 healthy persons gave figuresof 0%, 0% and 33.3%, respectively. We conclude that this PCR-based techniqueis not only absolutely specific, but also very sensitive and therefore muchsuperior to blood culture and, Widal test for the early diagnosis of typhoid.(author)
Fan, Hongxin; Robetorye, Ryan S
2013-01-01
Although well-established diagnostic criteria exist for mature B-cell neoplasms, a definitive diagnosis of a B-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because B-cell malignancies contain identically rearranged immunoglobulin heavy chain genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal B-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal immunoglobulin heavy chain (IGH) variable and joining region (VH-JH) gene rearrangements (IGH VH-JH PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol involves the use of three separate master mix tubes that target the conserved framework (FR1, FR2, and FR3) and joining (J) regions of the IGH gene. Analysis of these three framework regions can detect approximately 88% of clonal IGH gene rearrangements.
Thermally multiplexed polymerase chain reaction.
Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R
2015-07-01
Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.
The role of chain carriers in fusion reaction kinetics
International Nuclear Information System (INIS)
Harms, A.A.; Krenciglowa, E.M.
1980-01-01
The role of chain carriers as contributors to multiplicative closed cycles in advanced fusion fuels is examined. Emphasis is placed on rate processes which can be used to characterize critical/supercritical/subcritical tendencies of arbitrary closed fusion cycles. Temporal trajectories for the chain carriers which describe both increasing and decreasing multiplicative processes have been found to exist and identified according to their fusion fuel cycle characteristics. Practical criteria to ensure the attainment of steady-state fusion reaction processes have been formulated in terms of fusion reaction rate relationships. (author)
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
zino
2014-02-05
Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).
Polymerase chain reaction versus enzyme-linked immunosorbent ...
African Journals Online (AJOL)
Polymerase chain reaction versus enzyme-linked immunosorbent assay in detection of Chlamydia trachomatis infection among gynaecological patients in southwestern Nigeria. ... Socio-demographic bio-data and gynaecological history were obtained with questionnaire; data was analyzed using SPSS version 20.0.
Interaction of gold nanoparticles with Pfu DNA polymerase and effect on polymerase chain reaction.
Sun, L-P; Wang, S; Zhang, Z-W; Ma, Y-Y; Lai, Y-Q; Weng, J; Zhang, Q-Q
2011-03-01
The interaction of gold nanoparticles with Pfu DNA polymerase has been investigated by a number of biological, optical and electronic spectroscopic techniques. Polymerase chain reaction was performed to show gold nanoparticles' biological effect. Ultraviolet-visible and circular dichroism spectra analysis were applied to character the structure of Pfu DNA polymerase after conjugation with gold nanoparticles. X-ray photoelectron spectroscopy was used to investigate the bond properties of the polymerase-gold nanoparticles complex. The authors demonstrate that gold nanoparticles do not affect the amplification efficiency of polymerase chain reaction using Pfu DNA polymerase, and Pfu DNA polymerase displays no significant changes of the secondary structure upon interaction with gold nanoparticles. The adsorption of Pfu DNA polymerase to gold nanoparticles is mainly through Au-NH(2) bond and electrostatic interaction. These findings may have important implications regarding the safety issue as gold nanoparticles are widely used in biomedical applications.
International Nuclear Information System (INIS)
Leone, S.R.
1990-01-01
Recent progress is described resulting from the past three years of DOE support for studies of combustion-related photofragmentation dynamics, energy transfer, and reaction processes using a time-resolved Fourier transform infrared (FTIR) emission technique. The FTIR is coupled to a high repetition rate excimer laser which produces radicals by photolysis to obtain novel, high resolution measurements on vibrational and rotational state dynamics. The results are important for the study of numerous radical species relevant to combustion processes. The method has been applied to the detailed study of photofragmentation dynamics in systems such as acetylene, which produces C 2 H; chlorofluoroethylene to study the HF product channel; vinyl chloride and dichloroethylene, which produce HCl; acetone, which produces CO and CH 3 ; and ammonia, which produces NH 2 . In addition, we have recently demonstrated use of the FTIR technique for preliminary studies of energy transfer events under near single collision conditions, radical-radical reactions, and laser-initiated chain reaction processes
DEFF Research Database (Denmark)
Blair, D.; Waycott, M.; Byrne, L.
2006-01-01
This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...
The application of polymerase chain reaction-denaturing gradient ...
African Journals Online (AJOL)
Jane
2011-05-23
May 23, 2011 ... dominance in microbial ecology if the corresponding environment samples had been provided. This ... yeast peptone dextrose; PCR, polymerase chain reaction. method, DGGE method ..... Two nuclear mutations that block.
International Nuclear Information System (INIS)
Balogh, Brian.
1991-01-01
Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)
MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS
Wigner, E.P.; Weinberg, A.M.
1961-01-24
A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)
Rapid establishment of polymerase chain reaction-restriction ...
African Journals Online (AJOL)
2012-03-30
Mar 30, 2012 ... genome using polymerase chain reaction (PCR) has made it possible to explore organelle DNA diversity for taxonomic and phylogenetic purposes. Because of its uniparental mode of inheritance and its low mutation rate related to the nuclear genome, chloroplast DNA (cpDNA) is considered to be an ideal ...
Comparison of polymerase chain reaction (PCR) and loop-mediated ...
African Journals Online (AJOL)
Comparison of polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) for diagnosis of Fusarium solani in human immunodeficiency virus (HIV) positive patients. ... The test was carried out in 1 h reaction at 65°C in a heater block. The specificity of the test was 100% and its sensitivity was a ...
Theory and applications of the polymerase chain reaction.
Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A
1990-04-01
The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.
Investigating radical cation chain processes in the electrocatalytic Diels-Alder reaction.
Imada, Yasushi; Okada, Yohei; Chiba, Kazuhiro
2018-01-01
Single electron transfer (SET)-triggered radical ion-based reactions have proven to be powerful options in synthetic organic chemistry. Although unique chain processes have been proposed in various photo- and electrochemical radical ion-based transformations, the turnover number, also referred to as catalytic efficiency, remains unclear in most cases. Herein, we disclose our investigations of radical cation chain processes in the electrocatalytic Diels-Alder reaction, leading to a scalable synthesis. A gram-scale synthesis was achieved with high current efficiency of up to 8000%. The reaction monitoring profiles showed sigmoidal curves with induction periods, suggesting the involvement of intermediate(s) in the rate determining step.
Bordetella pertussis diagnosed by polymerase chain reaction
DEFF Research Database (Denmark)
Birkebaek, N H; Heron, I; Skjødt, K
1994-01-01
The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...... in 25 patients in whose nasopharyngeal secretions BP had been demonstrated after 4-7 days of culture. The detection limit of PCR in aqueous solution was 1-2 BP bacteria per reaction tube. PCR was 100% specific for BP, showing no response with other Bordetella species or other bacteria known to colonize...
Directory of Open Access Journals (Sweden)
Wen-Pin Chou
2017-02-01
Full Text Available Polymerase chain reaction (PCR has been one of the principal techniques of molecular biology and diagnosis for decades. Conventional PCR platforms, which work by rapidly heating and cooling the whole vessel, need complicated hardware designs, and cause energy waste and high cost. On the other hand, partial heating on the various locations of vessels to induce convective solution flows by buoyancy have been used for DNA amplification in recent years. In this research, we develop a new convective PCR platform, capillary loop convective polymerase chain reaction (clcPCR, which can generate one direction flow and make the PCR reaction more stable. The U-shaped loop capillaries with 1.6 mm inner diameter are designed as PCR reagent containers. The clcPCR platform utilizes one isothermal heater for heating the bottom of the loop capillary and a CCD device for detecting real-time amplifying fluorescence signals. The stable flow was generated in the U-shaped container and the amplification process could be finished in 25 min. Our experiments with different initial concentrations of DNA templates demonstrate that clcPCR can be applied for precise quantification. Multiple sample testing and real-time quantification will be achieved in future studies.
Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays
Energy Technology Data Exchange (ETDEWEB)
Frank F. Roberto
2008-08-01
Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.
Competing irreversible cooperative reactions on polymer chains
International Nuclear Information System (INIS)
Evans, J.W.; Hoffman, D.K.; Burgess, D.R.
1984-01-01
We analyze model processes involving competition between several irreversible reactions at the sites of a 1D, infinite, uniform polymer chain. These reactions can be cooperative, i.e., the corresponding rates depend on the state of the surrounding sites. An infinite hierarchy of rate equations is readily derived for the probabilities of various subconfigurations. By exploiting a shielding property of suitable blocks of unreacted sites, we show how exact hierarchy truncation and solution is sometimes possible. The behavior of solutions is illustrated in several cases by plotting families of ''reaction trajectories'' for varying ratios of reactant concentrations. As a specific application, we consider competition between coordination of ZnCl 2 to pairs of oxygen atoms and to single oxygen atoms in poly(propylene oxide). The observed glass transition temperature behavior is eludicated
Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.
Lorenz, Todd C
2012-05-22
In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling
Polymerase chain reaction: A molecular diagnostic tool in periodontology
Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam
2016-01-01
This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822
Directory of Open Access Journals (Sweden)
Carroll Bernie
2010-03-01
Full Text Available Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII. The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Results Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90% were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8% and the lowest in fibroblastic DNA (92.3%, P ≤ 0.05. Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P ≤ 0.05. Conclusions The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic
Culture-Negative Endocarditis Diagnosed Using 16S DNA Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Stephen Duffett
2012-01-01
Full Text Available 16S DNA polymerase chain reaction (PCR is a molecular amplification technique that can be used to identify bacterial pathogens in culture-negative endocarditis. Bacterial DNA can be isolated from surgically excised valve tissue or from blood collected in EDTA vials. Use of this technique is particularly helpful in identifying the bacterial pathogen in cases of culture-negative endocarditis. A case involving a 48-year-old man who presented with severe aortic regurgitation and a four-month prodrome of low-grade fever is reported. Blood and valve tissue cultures following valve replacement were negative. A valve tissue sample was sent for investigation with 16S DNA PCR, which successfully identified Streptococcus salivarius and was interpreted as the true diagnosis. A review of the literature suggests that 16S DNA PCR from valve tissue is a more sensitive diagnostic test than culture. It is also extremely specific, based on a sequence match of at least 500 base pairs.
The polymerase chain reaction and its application to clinical plastic surgery.
LENUS (Irish Health Repository)
Rea, S
2012-02-03
Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.
Theoretical study of chain transfer to solvent reactions of alkyl acrylates.
Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud
2014-07-24
This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.
A Double Polymerase Chain Reaction Method for Detecting African ...
African Journals Online (AJOL)
Keywords: African swine fever, Swine vesicular disease, Polymerase chain reaction, Recombinant plasmids ... included 5 μL of 10×Pfu DNA polymerase buffer,. 1 μL of Pfu DNA .... Garcia-Barreno B, Sanz A, Nogal ML, Vinuela E,. Enjuanes L.
Cornelissen, M. T.; van den Tweel, J. G.; Struyk, A. P.; Jebbink, M. F.; Briët, M.; van der Noordaa, J.; ter Schegget, J. T.
1989-01-01
The localization of human papillomavirus type 16 (HPV-16) DNA throughout the cervix uteri of women with cervical intraepithelial neoplasia (CIN) was studied by utilizing the polymerase chain reaction technique directly on histologically defined sections of paraffin-embedded cervical tissue obtained
Directory of Open Access Journals (Sweden)
JANNOTTI-PASSOS Liana Konovaloff
2000-01-01
Full Text Available In order to determine Schistosoma mansoni infection rates in Biomphalaria tenagophila and B. straminea, low stringency polymerase chain reaction (LS-PCR technique was used as a complementary method to light exposure technique. LS-PCR has already been standardized in our laboratory to detect the trematode DNA in B. glabrata. Higher S. mansoni infection rates were detected using conventional method and LS-PCR. The parasite DNA profile was detected in both species after 7-day exposure to miracidia, using LS-PCR. This technique enables early detection of schistosomiasis transmission focuses, in endemic areas, before the beginning of cercariae shedding.
Directory of Open Access Journals (Sweden)
Laurent Dacheux
2016-07-01
Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for
Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve
2016-07-01
The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus
Directory of Open Access Journals (Sweden)
Andriani .
2013-08-01
Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.
Vangroenweghe, Frédéric; Karriker, Locke; Main, Rodger; Christianson, Eric; Marsteller, Thomas; Hammen, Kristin; Bates, Jessica; Thomas, Paul; Ellingson, Josh; Harmon, Karen; Abate, Sarah; Crawford, Kimberly
2015-09-01
The swine industry currently lacks validated antemortem methods of detecting baseline herd prevalence of Mycoplasma hyopneumoniae. The focus of our study was to evaluate alternative antemortem detection techniques and to determine baseline litter prevalence in preweaned pig populations utilizing the selected technique and a real-time polymerase chain reaction (qPCR) assay. Preliminary data was analyzed on weaned piglets with evidence of respiratory disease (n = 32). Five sample types (antemortem nasal swab, tracheobronchial mucus, postmortem deep airway swab, bronchoalveolar lavage, and lung tissue) were collected from each pig. Individual samples were tested for M. hyopneumoniae using qPCR. Compared to nasal swabs, tracheobronchial mucus demonstrated higher test sensitivity (P hyopneumoniae. Two out of 180 litters revealed a positive result (1.1%). Individual qPCR assays were run on the samples collected from sow farm 4. Five out of 30 samples revealed a positive result (16.7%). Tracheobronchial mucus collection in combination with qPCR is a sensitive antemortem sampling technique that can be used to estimate the prevalence of M. hyopneumoniae in preweaned pigs, thus providing insight into the infection dynamics across the entire farrow-to-finish process. © 2015 The Author(s).
Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G
The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,
The Ripple Effect: Citation Chain Reactions of a Nobel Prize
DEFF Research Database (Denmark)
Faber Frandsen, Tove; Nicolaisen, Jeppe
2013-01-01
This paper explores the possible citation chain reactions of a Nobel Prize using the mathematician Robert J. Aumann as a case example. The results show that the award of the Nobel Prize in 2005 affected not only the citations to his work, but also affected the citations to the references in his s...... citation network. The effect is discussed using innovation decision process theory as a point of departure to identify the factors that created a bandwagon effect leading to the reported observations....... scientific oeuvre. The results indicate that the spillover effect is almost as powerful as the effect itself. We are consequently able to document a ripple effect in which the awarding of the Nobel Prize ignites a citation chain reaction to Aumann's scientific ouvre and to the references in its nearest...
Principles and applications of polymerase chain reaction in medical diagnostic fields: a review.
Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio
2009-01-01
Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances.
DEFF Research Database (Denmark)
Andresen, K; Gaafar, A; El-Hassan, A M
1996-01-01
We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed by microscopi......We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed......%, respectively. The PCR should be considered as a valuable and sensitive diagnostic tool in the diagnosis of cutaneous leishmaniasis; it has the added advantage of identification of the species of Leishmania causing the lesion....
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Critical analysis: use of polymerase chain reaction to diagnose leprosy
Directory of Open Access Journals (Sweden)
Flaviane Granero Maltempe
Full Text Available ABSTRACT Leprosy is a neglected tropical disease and an important public health problem, especially in developing countries. It is a chronic infectious disease that is caused by Mycobacterium leprae, which has a predilection for the skin and peripheral nerves. Although it has low sensitivity, slit-skin smear (SSS remains the conventional auxiliary laboratory technique for the clinical diagnosis of leprosy. Polymerase chain reaction (PCR is a molecular biology technique that holds promise as a simple and sensitive diagnostic tool. In the present study, the performance of two PCR methods, using different targets, PCR-LP and PCR-P, were compared with SSS with regard to leprosy diagnosis in a reference laboratory. M. leprae DNA was extracted from 106 lymph samples of 40 patients who had clinical suspicion of leprosy. The samples were subjected to both PCR techniques and SSS. Amplification of the human b-globin gene was used as PCR inhibitor control. The specificity of both PCR techniques was 100%, and sensitivity was 0.007 and 0.015 µg/ml for PCR-LP and PCR-P, respectively. No significant difference was found between either the PCR-LP or PCR-P results and SSS results (p > 0.05. Although PCR is not yet a replacement for SSS in the diagnosis of leprosy, this technique may be used as an efficient auxiliary tool for early detection of the disease, especially in endemic regions. This strategy may also be useful in cases in which SSS results are negative (e.g., in paucibacillary patients and cases in which skin biopsy cannot be performed.
Andosova, L D; Kontorshchikova, K N; Blatova, O L; Kudel'kina, S Iu; Kuznetsova, I A; Belov, A V; Baĭkova, R A
2011-07-01
The polymerase chain reaction technique was applied in "real time" format to evaluate the occurrence rate and infection ratio of various genotypes of human papilloma of high carcinogenic risk in virus-positive women and contact persons. The examination sampling consisted of 738 women aged of 17-50 years. The examination results permitted to establish high percentage of infection of 546 patients (74%) by carcinogenic papilloma viruses. The analysis of detection rate of various genotypes of human papilloma of high carcinogenic risk established that the 56th and 16th types of high carcinogenic risk are revealed more often than others--in 33% and 15.4% correspondingly. In males, first place in occurrence rate is for those types of virus of human papilloma: the 56th n = 10 (33.3%), 16th n = 3 (10%), 45th n = 3 (10%), 51th n = 3 (10%). The rest of genotypes are detected in 3-7% cases.
Polymerase chain reaction for the detection of Mycobacterium leprae
Hartskeerl, R. A.; de Wit, M. Y.; Klatser, P. R.
1989-01-01
A polymerase chain reaction (PCR) using heat-stable Taq polymerase is described for the specific detection of Mycobacterium leprae, the causative agent of leprosy. A set of primers was selected on the basis of the nucleotide sequence of a gene encoding the 36 kDa antigen of M. leprae. With this set
Transformational leadership: a cascading chain reaction.
Murphy, Lorraine
2005-03-01
Historical influences still permeate contemporary nursing practise. These are mirrored in organizational philosophies, transactional and autocratic leadership styles and disempowered staff. Whilst there is disparity amongst the theorists' definitions of leadership, there is consensus pertaining to the attributes necessary to realize effective leadership. Transformational leadership is heralded as new criterion for nurse managers, and can be achieved through training, education and professional development in key leadership competencies. To achieve a chain reaction, charismatic transformational leaders espouse intellectual stimulation and individual consideration to empower staff and enhance patient care. Nurse managers that develop and foster transformational leadership can surmount oppressive traditions and confidently navigate a complex and rapidly changing health care environment.
DCHAIN: A user-friendly computer program for radioactive decay and reaction chain calculations
International Nuclear Information System (INIS)
East, L.V.
1994-05-01
A computer program for calculating the time-dependent daughter populations in radioactive decay and nuclear reaction chains is described. Chain members can have non-zero initial populations and be produced from the preceding chain member as the result of radioactive decay, a nuclear reaction, or both. As presently implemented, chains can contain up to 15 members. Program input can be supplied interactively or read from ASCII data files. Time units for half-lives, etc. can be specified during data entry. Input values are verified and can be modified if necessary, before used in calculations. Output results can be saved in ASCII files in a format suitable for including in reports or other documents. The calculational method, described in some detail, utilizes a generalized form of the Bateman equations. The program is written in the C language in conformance with current ANSI standards and can be used on multiple hardware platforms
Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo
2018-06-01
Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.
Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage
International Nuclear Information System (INIS)
Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M.; Savva, D.; Walker, C.
1998-01-01
The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)
Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage
Energy Technology Data Exchange (ETDEWEB)
Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M. [University of Plymouth (United Kingdom). Environmental Research Centre; Child, P. [ADAS Boxworth (United Kingdom); Savva, D.; Walker, C. [University of Reading (United Kingdom). School of Animal and Microbial Sciences
1998-07-01
The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)
Use of polymerase chain reaction for detection of Chlamydia trachomatis
DEFF Research Database (Denmark)
Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna
1990-01-01
A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...
Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction
Energy Technology Data Exchange (ETDEWEB)
Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Sharma, Shyam Sundar [Govt. women Engineering College, Ajmer (India); Agrawal, Kailash [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Department of Botany, University of Rajasthan, Jaipur 302004 (India)
2016-05-06
An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.
Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Toshiaki Higashi
2012-04-01
Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.
Role of Polymerase Chain Reaction (PCR) in the detection of ...
African Journals Online (AJOL)
Background: Staphylococcus aureus is mainly acquired from hospital infections and demonstrated the ability of developing resistance to many antibiotics. Polymerase Chain Reaction (PCR) was used to identify antibiotic-resistant isolates. This study was conducted in Al-Mujtahed, Al-Mouwasat and the Children Hospitals in ...
ÖZKUL, Aykut
2002-01-01
In this study, the detection of canine parvovirus (CPV) in a fecal sample from a dog with enteritis was performed for the first time using the polymerase chain reaction (PCR) in Turkey. The final PCR product was analyzed using the restriction fragment length polymorphysm (RFLP) technique. RFLP analysis using Apa LI and Eco RV restriction endonucleases revealed homology in the nucleotide sequence in at least the VP2 coding region of the virus DNAs detected in the fecal specimen and prepared fr...
Model Checking Markov Chains: Techniques and Tools
Zapreev, I.S.
2008-01-01
This dissertation deals with four important aspects of model checking Markov chains: the development of efficient model-checking tools, the improvement of model-checking algorithms, the efficiency of the state-space reduction techniques, and the development of simulation-based model-checking
The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.
Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W
2006-07-01
We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.
Directory of Open Access Journals (Sweden)
Shahrzad Azizi
2014-11-01
Full Text Available Leptospirosis is a worldwide zoonotic disease that is caused by Gram-negative spirochaetes, Leptospira species. Affected animals excrete the organism in the urine into the environment and act as a source of infection. Cattle are maintenance hosts for some serovars of leptospirosis and are important in the transmission of the infection to humans. At post mortem examination, affected cattle show white spots in their kidneys but these are not specific for leptospirosis. Sometimes it is necessary that leptospirosis be diagnosed in the carcass. Different direct methods, including polymerase chain reaction (PCR, Warthin-Starry silver stain (WS, immunofluorescence (IF and immunohistochemistry (IHC can be used in order to diagnose leptospirosis in the affected tissues, such as kidney. The main advantage of the WS technique is direct visualisation of the bacteria in the tissue samples. Silver staining is useful for retrospective studies on formalin-fixed and paraffin-embedded samples but little information is available on the sensitivity and specificity of the technique. The present study aimed to find a simple and inexpensive method that can be used in any laboratory and that also, if clinical samples are not available, can detect Leptospira in tissue samples post mortem. This study was performed on 19 paraffin-embedded kidneys of slaughtered cows that grossly had focal to multifocal white spots. Leptospirosis was confirmed in these samples with PCR based on the LipL32 gene. Out of 19 PCR positive kidneys, Leptospira was identified in 13 stained samples by WS. The kidneys revealed different grades of interstitial nephritis. No relationship was found between severity of lesions and presence of leptospires in the kidneys. The PCR results on the urine and blood were consistent with matching WS stained kidneys. Out of 13 kidneys that were positive with silver staining, 7 matching blood and 10 matching urine samples were confirmed positive for leptospirosis
Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions
Zhang, Hefeng; Qu, Chengke; He, Junpo
2015-01-01
We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b
Polymerase Chain Reaction (PCR) provides a superior tool for the ...
African Journals Online (AJOL)
Polymerase Chain Reaction (PCR) provides a superior tool for the diagnosis of Pneumococcal Infection in Burkina Faso. Y Chaibou, M Congo/Ouedraogo, I Sanou, H Somlare, K Ouattara, CM Kienou, H Belem, E Sampo, SA Traore, R Traore/Ouedraogo, C Hatcher, L Mayer, X Wang, L Sangare ...
Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats.
Lorch, Jeffrey M; Gargas, Andrea; Meteyer, Carol Uphoff; Berlowski-Zier, Brenda M; Green, D Earl; Shearn-Bochsler, Valerie; Thomas, Nancy J; Blehert, David S
2010-03-01
A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.
Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats
Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.
2010-01-01
A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.
Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M
2013-03-28
This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.
International Nuclear Information System (INIS)
Leone, S.R.
1988-03-01
Pulsed lasers were used in this work to photofragment molecules or to initiate chain reactions. One of the major advances was the availability of high-powered rare gas halide excimer lasers. In addition, pulsed Nd:YAG lasers and dye lasers were used throughout. Results include: generalized kinetic formulations of the problem of laser-initiated chain reactions. Several studies were carried out to explore the details of chain combustion phenomena, slow chain reactions, chain branching behavior, and vibrational temperatures of combusting mixtures. A method to determine the rotational temperature of nitrogen molecules by laser multiphoton ionization was shown. The chain reaction methodology was applied to complex polyatomic systems, in which complete infrared spectra of the emitting species were obtained. Systems studied included, chlorine + HBr, HI, methane, hydrogen, ethane, propane, butane, cyclopropane, and cyclohexane. Photofragmentation studies involved the production and analysis of radical species, such as methyl, CH 2 I, and CCH. Molecules studied included methylene iodide, methyl iodide, dimethyl mercury, acetone, acetylene, vinyl chloride, dichloroethylene, and fluorochloroethylene. The first infrared characterization of a highly vibrationally excited radical was shown. Reactions of methyl radicals were studied in detail, in which a new method for obtaining absolute values of the methyl radical reaction rates were obtained
Evaluation of a new HTLV-I/II polymerase chain reaction
Vrielink, H.; Zaaijer, H. L.; Cuypers, H. T.; van der Poel, C. L.; Woerdeman, M.; Lelie, P. N.; Winkel, C.; Reesink, H. W.
1997-01-01
AIM: Evaluation of a qualitative HTLV-I/II DNA polymerase chain reaction (PCR) test for the detection of HTLV-I/II DNA (Roche Diagnostic Systems, Branchburg, N.J., USA) in various panels. METHODS: The panels consisted of fresh EDTA blood samples from blood donors who were anti-HTLV-I/II ELISA
Exploiting Fission Chain Reaction Dynamics to Image Fissile Materials
Chapman, Peter Henry
Radiation imaging is one potential method to verify nuclear weapons dismantlement. The neutron coded aperture imager (NCAI), jointly developed by Oak Ridge National Laboratory (ORNL) and Sandia National Laboratories (SNL), is capable of imaging sources of fast (e.g., fission spectrum) neutrons using an array of organic scintillators. This work presents a method developed to discriminate between non-multiplying (i.e., non-fissile) neutron sources and multiplying (i.e., fissile) neutron sources using the NCAI. This method exploits the dynamics of fission chain-reactions; it applies time-correlated pulse-height (TCPH) analysis to identify neutrons in fission chain reactions. TCPH analyzes the neutron energy deposited in the organic scintillator vs. the apparent neutron time-of-flight. Energy deposition is estimated from light output, and time-of-flight is estimated from the time between the neutron interaction and the immediately preceding gamma interaction. Neutrons that deposit more energy than can be accounted for by their apparent time-of-flight are identified as fission chain-reaction neutrons, and the image is reconstructed using only these neutron detection events. This analysis was applied to measurements of weapons-grade plutonium (WGPu) metal and 252Cf performed at the Nevada National Security Site (NNSS) Device Assembly Facility (DAF) in July 2015. The results demonstrate it is possible to eliminate the non-fissile 252Cf source from the image while preserving the fissileWGPu source. TCPH analysis was also applied to additional scenes in which theWGPu and 252Cf sources were measured individually. The results of these separate measurements further demonstrate the ability to remove the non-fissile 252Cf source and retain the fissileWGPu source. Simulations performed using MCNPX-PoliMi indicate that in a one hour measurement, solid spheres ofWGPu are retained at a 1sigma level for neutron multiplications M -˜ 3.0 and above, while hollowWGPu spheres are
International Nuclear Information System (INIS)
Andreeva, Tamara L; Kuznetsova, S V; Maslov, Aleksandr I; Sorokin, Vadim N
2009-01-01
The scheme of chemical processes proceeding in the active medium of a pulsed chemical oxygen-iodine laser (COIL) is analysed. Based on the analysis performed, the complete system of differential equations corresponding to this scheme is replaced by a simplified system of equations describing in dimensionless variables the chain dark decomposition of iodides - atomic iodine donors, in the COIL active medium. The procedure solving this system is described, the basic parameters determining the development of the chain reaction are found and its specific time intervals are determined. The initial stage of the reaction is analysed and criteria for the development of the branching chain decomposition reaction of iodide in the COIL active medium are determined. (active media)
Jawad, Nisreen; Ahemd, Asmat; Abdullah, Aminah
2018-04-01
The aim of this study was to investigate the presence of Bacillus cereus and detection of enterotoxigenic genes in food samples by utilizing a Polymerase Chain Reaction technique (PCR). In this study the providence of B. cereus was carried out to food samples. The B. cereus isolates were investigated for enterotoxigenic gene. The cooked seafood, and raw milk samples were purchased from several restaurants and market in the area of (Bangi, Kajang, Serdang and UKM) Selangor, Malaysia. A total of 60 samples have been analyzed. B. cereus contamination has been formed between 1.4×105 - 3×105 cfu/mL of cooked seafood and raw milk samples. Five colonies have been detected as B. cereus using biochemical test. All B. cereus isolates named BC1 to BC27, were characterized for haemolytic enterotoxin (HBL) complex encoding genes (hblA), non-haemolytic enterotoxin encoding gene (NheA). 10 isolates have been reported to be positive towards hblA and 12 isolates were positive towards NheA. The presence of B. cereus and their enterotoxigenic genes in cooked seafood and raw milk from to food samples obtained may pose a potential risk for public health.
Supply chain management under fuzziness recent developments and techniques
Öztayşi, Başar
2014-01-01
Supply Chain Management Under Fuzziness presents recently developed fuzzy models and techniques for supply chain management. These include: fuzzy PROMETHEE, fuzzy AHP, fuzzy ANP, fuzzy VIKOR, fuzzy DEMATEL, fuzzy clustering, fuzzy linear programming, and fuzzy inference systems. The book covers both practical applications and new developments concerning these methods. This book offers an excellent resource for researchers and practitioners in supply chain management and logistics, and will provide them with new suggestions and directions for future research. Moreover, it will support graduate students in their university courses, such as specialized courses on supply chains and logistics, as well as related courses in the fields of industrial engineering, engineering management and business administration.
Felice, A. E.; Alshinawi, C.
1996-01-01
The product of the Polymerase Chain Reaction (PCR) may be generically suitable for four types of investigations: Discovery PCR, Analytical PCR, Modification by PCR, and Synthetic PCR. Despite the potential problem of contamination with extraneous DNA, PCR is relatively simple and inexpensive, and
Real-time TaqMan polymerase chain reaction to quantify the effects ...
African Journals Online (AJOL)
TaqMan polymerase chain reaction was developed to quantify the number of Bifidobacterium. We used this assay to detect genomic DNA of Bifidobacterium in the intestinal tract digesta of piglets, including duodenum, jejunum, ileum, cecum and colon. Our results indicated that, developed new real-time quantitative PCR ...
International Nuclear Information System (INIS)
Fanaro, G.B.; Aquino, S.; Guedes, R.L.; Crede, R.G.; Sabundjian, I.T.; Ruiz, M.O.; Villavicencio, A.L.C.H.
2005-01-01
Today Brazil, as the largest soy exporter in the world, has undergone the consequences of the contamination of these crops by the Asian dust fungus, being harmed since the plantation up to the harvest, with losses in its productivity ranging 10-80%. As it is a new disease in the Americas, there are not any resistant species to this fungus attack. The grains contamination harms the exportation for countries which do not want to have their crops contaminated, affecting therefore the international commerce and agro-business relationship with those countries Brazil has trade with. The Asian dust is caused by the fungus Phakopsora pachyrhizi and its dissemination is of difficult control, since occurs through the wind dispersion. The P. pachyrhizi is an Asian fungus and was recently found in South Africa, Paraguay, Argentina and Brazil. As an alternative process to minimize these losses is the process to preserve the grains by radiation, the use of the electron accelerator was indicated, since its advantage for the grains exportation industry is fundamental. Besides the possibility of being disconnected when not in use, this source does not need to be recharged, is easily available and has high dose rate, streamlining the process and reducing logistics costs. The present work aims to identify, by the Polymerase Chain Reaction technique (PCR), the P. pachyrhizi fungus presence in the irradiated soy grains, at doses 1 and 2 kGy, at the IPEN-CNEN electron Accelerator, a Dynamitron Machine (Radiation Dynamics Co. model JOB, New York, USA), with 1.5 MeV power and 2.5 mA electrical current. (author)
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
The effect of composition of mixture on rate of radiation initiation of chain reactions
International Nuclear Information System (INIS)
Poluehktov, V.A.; Begishev, I.R.; Podkhalyuzin, A.T.; Babkina, Eh.I.; Morozov, V.A.; Shapovalov, V.V.
1977-01-01
The effect of the composition of starting components on the rate of a number of chain liquid-phase reactions initiated by γ-quanta of Co 60 has been investigated at constant temperature and dosage rate. In regard to 1,1-difluoroethane chlorination, cyclohexene phosphorylation and adamantane alkylation with hexafluoropropylene reactions, abnormal effect of the reagent compositions on reaction rates has been discovered. The possible radical - starting molecule complexing reaction and molecular complexing from the starting components have been considered
DEFF Research Database (Denmark)
Kalia, A.; Jalava, T.; Nieminen, P.
1992-01-01
Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...
Case Report:False-negative HIV-1 polymerase chain reaction in a ...
African Journals Online (AJOL)
Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. However, when clinical manifestations are not consistent with laboratory results, additional investigation is required. We report a 15-month-old HIV-exposed boy referred to our hospital after he had ...
Bounding spectral gaps of Markov chains: a novel exact multi-decomposition technique
International Nuclear Information System (INIS)
Destainville, N
2003-01-01
We propose an exact technique to calculate lower bounds of spectral gaps of discrete time reversible Markov chains on finite state sets. Spectral gaps are a common tool for evaluating convergence rates of Markov chains. As an illustration, we successfully use this technique to evaluate the 'absorption time' of the 'Backgammon model', a paradigmatic model for glassy dynamics. We also discuss the application of this technique to the 'contingency table problem', a notoriously difficult problem from probability theory. The interest of this technique is that it connects spectral gaps, which are quantities related to dynamics, with static quantities, calculated at equilibrium
Directory of Open Access Journals (Sweden)
PD Andrade
2013-01-01
Full Text Available BACKGROUND: Human cytomegalovirus is an important cause of morbidity and mortality in immunocompromised patients. Qualitative polymerase chain reaction (PCR has proven to be a sensitive and effective technique in defining active cytomegalovirus infection, in addition to having low cost and being a useful test for situations in which there is no need for quantification. Real-time PCR has the advantage of quantification; however, the high cost of this methodology makes it impractical for routine use.
Using Soft Systems Methodology to Address Supply Chain Management Problems
Directory of Open Access Journals (Sweden)
Gulender Gencoglu
2002-05-01
Full Text Available This paper reports an investigation of if, and how, Soft Systems Methodology (SSM might.be used to facilitate better management of industry supply chains. In two workshops involving supply chain managers from the Textile Clothing and Footwear (TCF industry and industry facilitators, ways in which SSM techniques might supplement existing Supply Chain Management (SCM workshop approaches have been explored. Specifically, the placement of SSM techniques within a workshop setting, reactions to the techniques, perceived reasons for using SSM, together with strengths and difficulties encountered, have been examined.
Polymerase chain reaction for detection of Mycobacterium leprae in nasal swab specimens
de Wit, M. Y.; Douglas, J. T.; McFadden, J.; Klatser, P. R.
1993-01-01
The polymerase chain reaction based on the selective amplification of a 531-bp fragment of the gene encoding the proline-rich antigen of Mycobacterium leprae was applied to nasal swab specimens from leprosy patients, occupational contacts, and endemic and nonendemic controls. To prevent
DEFF Research Database (Denmark)
Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang
2018-01-01
Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...
Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data
Ramakers, Christian; Ruijter, Jan M.; Deprez, Ronald H. Lekanne; Moorman, Antoon F. M.
2003-01-01
Quantification of mRNAs using real-time polymerase chain reaction (PCR) by monitoring the product formation with the fluorescent dye SYBR Green I is being extensively used in neurosciences, developmental biology, and medical diagnostics. Most PCR data analysis procedures assume that the PCR
Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk
Directory of Open Access Journals (Sweden)
V.K. Jain
2010-02-01
Full Text Available In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in mastitic milk, a polymerase chain reaction assay was developed using target sequence of 16S to 23S rRNA spacer region. This test can be performed within hours and avoids cumbersome and lengthy steps involved in microbiological culture of milk and biochemical tests. Polymerase chain reaction assay can be used as a screening test for a large herd to detect Staphylococcus aureus in milk.
Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics
Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David
2014-02-01
Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.
Bounding spectral gaps of Markov chains: a novel exact multi-decomposition technique
Energy Technology Data Exchange (ETDEWEB)
Destainville, N [Laboratoire de Physique Theorique - IRSAMC, CNRS/Universite Paul Sabatier, 118, route de Narbonne, 31062 Toulouse Cedex 04 (France)
2003-04-04
We propose an exact technique to calculate lower bounds of spectral gaps of discrete time reversible Markov chains on finite state sets. Spectral gaps are a common tool for evaluating convergence rates of Markov chains. As an illustration, we successfully use this technique to evaluate the 'absorption time' of the 'Backgammon model', a paradigmatic model for glassy dynamics. We also discuss the application of this technique to the 'contingency table problem', a notoriously difficult problem from probability theory. The interest of this technique is that it connects spectral gaps, which are quantities related to dynamics, with static quantities, calculated at equilibrium.
Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis.
Shoughy, Samir S; Alkatan, Hind M; Al-Abdullah, Abdulelah A; El-Khani, Albarah; de Groot-Mijnes, Jolanda Df; Tabbara, Khalid F
2015-01-01
Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis. A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein-Barr virus, and rubella virus. There were six male and six female patients. The mean age was 43 years, with an age range of 11-82 years. All 12 cases presented with unilateral anterior uveitis. In four (33%) patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein-Barr virus. Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis.
On fusion/fission chain reactions in the Fleischmann-Pons cold fusion experiment
International Nuclear Information System (INIS)
Anghaie, S.; Froelich, P.; Monkhorst, H.J.
1990-01-01
In this paper the possibility of fusion/fission chain reactions following d-d source reactions in electrochemical cold fusion experiments have been investigated. The recycling factors for the charged particles in fusion reactions with consumable nuclei deuteron, 6 Li nd 7 Li, are estimated. It is concluded that, based on the established nuclear fusion cross sections and electronic stopping power, the recycling factor is four to five orders of magnitude less than required for close to critical conditions. It is argued that the cross generation of charged particles by neutrons does not play a significant role in this process, even if increased densities at the surface of electrodes do occur
Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H
2007-03-01
A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.
2009-01-01
On 18 March, beam commissioning started in the first ‘link’ of the accelerator chain – LINAC 2. This marks the start of what will be the longest period of beam operations in CERN’s history, with the accelerator complex remaining operational throughout the winter to supply the LHC. The Bulletin finds out what is being done to make sure the whole chain is ready for this historic run.
Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.
2004-01-01
We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5×104 cells per 0.25 g material or 1.9×103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.
False-negative HIV-1 polymerase chain reaction in a 15-month-old ...
African Journals Online (AJOL)
Corresponding author: S Korsman (stephen.korsman@nhls.ac.za). Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. ... mismatches relative to the consensus are shown as coloured blocks. Nucleic acid numbering relative to consensus C gag p24 is ...
Pérez Urquiza, M.; Acatzi Silva, A. I.
2014-02-01
Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.
Kinetics of the Br2-CH3CHO Photochemical Chain Reaction
Nicovich, J. M.; Shackelford, C. J.; Wine, P. H.
1997-01-01
Time-resolved resonance fluorescence spectroscopy was employed in conjunction with laser flash photolysis of Br2 to study the kinetics of the two elementary steps in the photochemical chain reaction nBr2 + nCH3CHO + hv yields nCH3CBrO + nHBr. In the temperature range 255-400 K, the rate coefficient for the reaction Br((sup 2)P(sub 3/2)) + CH3CHO yields CH3CO + HBr is given by the Arrhenius expression k(sub 6)(T) = (1.51 +/- 0.20) x 10(exp -11) exp(-(364 +/- 41)/T)cu cm/(molecule.s). At 298 K, the reaction CH3CO + Br2 yields CH3CBrO + Br proceeds at a near gas kinetic rate, k(sub 7)(298 K) = (1.08 +/- 0.38) x 10(exp -10)cu cm/(molecule.s).
New technique of uterine body carcinoma brachytherapy. Pt. 1. Radium chain
Energy Technology Data Exchange (ETDEWEB)
Rattka, P.; Jedrus, S. (Instytut Onkologii, Gliwice (Poland))
1980-01-01
A simple technique of uterine cavity tamponade with radium charges arranged in a chain has been evolved, establishing at the same time an optimal dose on the basis of computer calculations. Own experiences with the use of this technique in 31 patients are presented.
MODESTY, Statistical Reaction Cross-Sections and Particle Spectra in Decay Chain
International Nuclear Information System (INIS)
Mattes, W.
1977-01-01
1 - Nature of the physical problem solved: Code MODESTY calculates all energetically possible reaction cross sections and particle spectra within a nuclear decay chain. 2 - Method of solution: It is based on the statistical nuclear model following the method of Uhl (reference 1) where the optical model is used in the calculation of partial widths and the Blatt-Weisskopf single particle model for gamma rays
Directory of Open Access Journals (Sweden)
Achmad Himawan, Yohanes Berchmans umardiyono, Susamto Somowiyarjo, Yohanes Andi Trisyono & Andrew Beattie.
2011-11-01
Full Text Available Detection using PCR (Polymerase Chain Reaction Candidatus Liberibacter asiaticus, Huanglongbing causal Organism on Siem Mandarin with different types of symptoms. Huanglongbing (HLB or Citrus Vein Phloem Degeration (CVPD is one of major diseases on Siem mandarin in Indonesia. HLB is caused by bacteria Candidatus liberibacter asiatus (LAS. The bacteria only live in the phloem cells of host tree and only recently it was reported to be successfully cultured on agar medium. Early detection method of LAS is needed to support healthy Siem mandarin cultivation program. This research was conducted to detect LAS in different types of HLB leaf symptoms based on Polymerase Chain Reaction (PCR method with specific primer forward MHO 353 and reverse MHO 354. The results suggested that 8 types of HLB leaf symptoms were found on the samples used in this experiment. LAS was detected at 60% on the leaves without any symptom followed by the leaves with completely chlorosis symptom at 66%. The leaves with unevenly yellow showing higher percentage of LAS detection ranged from 80-86%. PCR technique successfully amplified DNA of LAS with the size target of 600 bp.
National Research Council Canada - National Science Library
McAvin, James C; Escamilla, Elizabeth M; Blow, James A; Turell, Micahel J; Quintana, Miguel; Bowles, David E; Swaby, James A; Barnes, William J; Huff, William B; Lahman, Kenton L
2005-01-01
...) reverse transcription-polymerase chain reaction assays were developed for screening and seroype identification of infected mosquito vectors and human sera using a field-deployable, fluorometric thermocycler...
International Nuclear Information System (INIS)
Nakagawa, Seiko
2015-01-01
Methanol and 2-propanol solutions of 1,2-dibromotetrafluoroethane and 1,1,2-trichlorotrifluoroethane were irradiated with γ-rays after perfect de-oxygenation. The product, formed by the substitution of one of the bromine or chlorine atoms with a hydrogen atom, was observed by radiation-induced degradation and the product was also de-halogenated. The G-value of de-halogenation was more than a thousand times higher than G(e solv − ) and increased with the decreasing dose rate, meaning that a chain reaction is involved in the process. The efficiency of the degradation in 2-propanol was several times higher than that in methanol. It is concluded that the charge transfer from an alcohol radical will be the trigger of the chain reaction the same as in the degradation of hexachloroethane in alcohol solutions (Sawai et al., 1978). - Highlights: • Halone2402 and Furon113 were de-halogenated by radiation-induced chain reaction in pure alcohol. • The efficiency of the degradation in 2-propanol was several times higher than that in methanol. • The charge transfer from an alcohol radical will be the trigger of the chain reaction
Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms
International Nuclear Information System (INIS)
Liu Jinfeng; Xing Da; Shen Xingyan; Zhu Debin
2005-01-01
With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency
DEFF Research Database (Denmark)
Pattison, D I; Davies, Michael Jonathan
2001-01-01
, absolute second-order rate constants for the reactions of HOCl with protein side chains, model compounds, and backbone amide (peptide) bonds have been determined at physiological pH values. The reactivity of HOCl with potential reactive sites in proteins is summarized by the series: Met (3.8 x 10(7) M(-1......Hypochlorous acid (HOCl) is a potent oxidant, which is produced in vivo by activated phagocytes. This compound is an important antibacterial agent, but excessive or misplaced production has been implicated in a number of human diseases, including atherosclerosis, arthritis, and some cancers....... Proteins are major targets for this oxidant, and such reaction results in side-chain modification, backbone fragmentation, and cross-linking. Despite a wealth of qualitative data for such reactions, little absolute kinetic data is available to rationalize the in vitro and in vivo data. In this study...
Chain reaction. History of the atomic bomb
International Nuclear Information System (INIS)
Mania, Hubert
2010-01-01
Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)
Polymerase chain reaction methods (PCR in agrobiotechnology
Directory of Open Access Journals (Sweden)
Taški-Ajduković Ksenija
2006-01-01
Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.
Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A
2008-12-01
One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.
Alvarez, J; Mar, J; Varela-Ledo, E; Garea, M; Matinez-Lamas, L; Rodriguez, J; Regueiro, B
2012-11-01
Antibiotic treatment for septic shock is generally prescribed on an empirical basis using broad-spectrum antibiotics. Molecular diagnostic techniques can detect the presence of microbial DNA in blood within a few hours and facilitate early, targeted treatment. The aim of this study was to evaluate the economic impact of a real-time polymerase chain reaction technique, LightCycler SeptiFast (LSC), in patients with sepsis. A cost-minimisation study was carried out in patients admitted with a diagnosis of severe sepsis or septic shock to the intensive care unit of a university hospital. The stay in the intensive care unit, hospital admission, 28-day and six-month mortality, and the economic cost of the clinical process were also evaluated. The study involved 48 patients in the LSC group and 54 patients in the control group. The total cost was €42,198 in the control group versus €32,228 in the LCS group with statistically significant differences (P average net saving of €9970 per patient. The mortality rate was similar in both groups. The main finding of this study was the significant economic saving afforded by the use of the LCS technique, due to the shortening of intensive care unit stay and the use of fewer antibiotics.
Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing
2016-10-01
The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T.
1989-01-01
Current efforts to map the human genome are focused on individual chromosomes or smaller regions and frequently rely on the use of somatic cell hybrids. The authors report the application of the polymerase chain reaction to direct amplification of human DNA from hybrid cells containing regions of the human genome in rodent cell backgrounds using primers directed to the human Alu repeat element. They demonstrate Alu-directed amplification of a fragment of the human HPRT gene from both hybrid cell and cloned DNA and identify through sequence analysis the Alu repeats involved in this amplification. They also demonstrate the application of this technique to identify the chromosomal locations of large fragments of the human X chromosome cloned in a yeast artificial chromosome and the general applicability of the method to the preparation of DNA probes from cloned human sequences. The technique allows rapid gene mapping and provides a simple method for the isolation and analysis of specific chromosomal regions
Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes
Denisov, E. T.; Shestakov, A. F.
2018-05-01
Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.
DEFF Research Database (Denmark)
Hougs, L; Barington, T; Madsen, HO
1993-01-01
reaction (PCR) using in addition a degenerate kappa light chain signal peptide region primer. The PCR product was cloned into the M13mp18 phage. The cloning efficiency was 100-600 clones/ml of blood. Of the 86 clones sequenced, 90% represented rearranged kappa light chain genes from different antibody...... of the B lymphocytes activated in vivo. Here, we present a method for rapid analysis of the rearranged kappa light chain genes used by human circulating antigen-specific B lymphocytes. After vaccination with Haemophilus influenzae type b capsular polysaccharide (HibCP) conjugated with protein, the Hib...
Tabachnick, W J; MacLachlan, N J; Thompson, L H; Hunt, G J; Patton, J F
1996-05-01
Cattle bloods containing only polymerase chain reaction (PCR)--detectable bluetongue-10 viral nucleic acid, but as determined by virus isolation techniques, not bluetongue-10 virus, were incapable of infecting intrathoracically inoculated Culicoides variipennis sonorensis. These insects also failed to transmit bluetongue-10 virus when fed on sheep. Cattle whose blood contain only PCR-detectable bluetongue viral nucleic acid, but no infectious virus, are unlikely to play a role in the epidemiology of bluetongue. The biological significance of PCR-based detection assays and their effect on animal health regulations on the international trade of livestock and livestock germplasm is discussed. Bluetongue virus infection provides a very useful model with which to study arthropod-transmitted RNA virus infections of humans and other animals.
International Nuclear Information System (INIS)
Sawyers, C.L.; Timson, L.; Clark, S.S.; Witte, O.N.; Champlin, R.; Kawasaki, E.S.
1990-01-01
Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction
Directory of Open Access Journals (Sweden)
Carlos Alberto Scrideli
2001-09-01
Full Text Available CONTEXT: The CDR-3 region of heavy-chain immunoglobulin has been used as a clonal marker in the study of minimal residual disease in children with acute lymphoblastic leukemia. Southern blot and polymerase chain reaction studies have demonstrated the occurrence of bi/oligoclonality in a variable number of cases of B-lineage acute lymphoblastic leukemia, a fact that may strongly interfere with the detection of minimal residual disease. Oligoclonality has also been associated with a poorer prognosis and a higher chance of relapse. OBJECTIVES: To correlate bi/oligoclonality, detected by polymerase chain reaction in Brazilian children with B-lineage acute lymphoblastic leukemia with a chance of relapse, with immunophenotype, risk group, and disease-free survival. DESIGN: Prospective study of patients’ outcome. SETTING: Pediatric Oncology Unit of the University Hospital, Faculty of Medicine of Ribeirão Preto, University of São Paulo. PARTICIPANTS: 47 children with acute lymphoblastic leukemia DIAGNOSTIC TEST: Polymerase chain reaction using consensus primers for the CDR-3 region of heavy chain immunoglobulin (FR3A, LJH and VLJH for the detection of clonality. RESULTS: Bi/oligoclonality was detected in 15 patients (31.9%. There was no significant difference between the groups with monoclonality and biclonality in terms of the occurrence of a relapse (28.1% versus 26.1%, presence of CALLA+ (81.2% versus 80% or risk group (62.5% versus 60%. Disease-free survival was similar in both groups, with no significant difference (p: 0.7695. CONCLUSIONS: We conclude that bi/oligoclonality was not associated with the factors investigated in the present study and that its detection in 31.9% of the patients may be important for the study and monitoring of minimal residual disease.
International Nuclear Information System (INIS)
Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping
2013-01-01
Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling
Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)
Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.
1999-01-01
Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal
Polymerase chain reaction for detection of invasive Shigella flexneri in food.
Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E
1990-01-01
The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the in...
Renormalization group decimation technique for disordered binary harmonic chains
International Nuclear Information System (INIS)
Wiecko, C.; Roman, E.
1983-10-01
The density of states of disordered binary harmonic chains is calculated using the Renormalization Group Decimation technique on the displacements of the masses from their equilibrium positions. The results are compared with numerical simulation data and with those obtained with the current method of Goncalves da Silva and Koiller. The advantage of our procedure over other methods is discussed. (author)
Directory of Open Access Journals (Sweden)
Norbert Haider
1998-01-01
Full Text Available The preparation of a series of new 3-(alkynyl-X-substituted 4-pyridazinecarbonitriles 2-5 (X = O, NH is described. The compounds are shown to undergo thermally induced intramolecular Diels-Alder reactions with inverse electron demand, affording the fused benzonitriles 6-8. Incorporation of a 1,2-phenylene unit into the side chain, as in the case of compounds 10 and 13, results in a more favorable conformation of the dienophilic substructure and thus to a pronounced acceleration of the [4+2] cycloaddition reaction.
Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.
Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti
2015-08-01
This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
International Nuclear Information System (INIS)
Garrison, W.M.
1983-11-01
The major emphasis in radiation biology at the molecular level has been on the nucleic acid component of the nucleic acid-protein complex because of its primary genetic importance. But there is increasing evidence that radiation damage to the protein component also has important biological implications. Damage to capsid protein now appears to be a major factor in the radiation inactivation of phage and other viruses. And, there is increasing evidence that radiation-chemical change in the protein component of chromation leads to changes in the stability of the repressor-operator complexes involved in gene expression. Knowledge of the radiation chemistry of protein is also of importance in other fields such as the application of radiation sterilization to foods and drugs. Recent findings that a class of compounds, the α,α'-diaminodicarboxylic acids, not normally present in food proteins, are formed in protein radiolysis is of particular significance since certain of their peptide derivatives have been showing to exhibit immunological activity. The purpose of this review is to bring together and to correlate our present knowledge of products and mechanisms in the radiolysis of peptides, polypeptides and proteins both aqueous and solid-state. In part 1 we presented a discussion of the radiation-induced reactions of the peptide main-chain in model peptide and polypeptide systems. Here in part 2 the emphasis is on the competing radiation chemistry at side-chain loci of peptide derivatives of aliphatic, aromatic-unsaturated and sulfur-containing amino acids in similar systems. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis, and ESR spectroscopy are included
Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction
Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka
2005-01-01
AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152
Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E
1993-01-01
Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...
A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification
Directory of Open Access Journals (Sweden)
Luiz Tadeu M Figueiredo
1997-05-01
Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique
Reaction of oxygen with the respiratory chain in cells and tissues.
Chance, B
1965-09-01
This paper considers the way in which the oxygen reaction described by Dr. Nicholls and the ADP control reactions described by Dr. Racker could cooperate to establish a purposeful metabolic control phenomenon in vivo. This has required an examination of the kinetic properties of the respiratory chain with particular reference to methods for determinations of oxygen affinity (K(m)). The constant parameter for tissue respiration is k(1), the velocity constant for the reaction of oxygen with cytochrome oxidase. Not only is this quantity a constant for a particular tissue or mitochondria; it appears to vary little over a wide range of biological material, and for practical purposes a value of 5 x 10(7) at 25 degrees close to our original value (20) is found to apply with adequate accuracy for calculation of K(m) for mammalia. The quantity which will depend upon the tissue and its metabolic state is the value of K(m) itself, and K(m) may be as large as 0.5 microM and may fall to 0.05 microM or less in resting, controlled, or inhibited states. The control characteristic for ADP may depend upon the electron flux due to the cytochrome chain (40); less ADP is required to activate the slower electron transport at lower temperatures than at higher temperatures. The affinity constants for ADP control appear to be less dependent upon substrate supplied to the system. The balance of ADP and oxygen control in vivo is amply demonstrated experimentally and is dependent on the oxygen concentration as follows. In the presence of excess oxygen, control may be due to the ADP or phosphate (or substrate), and the kinetics of oxygen utilization will be independent of the oxygen concentration. As the oxygen concentration is diminished, hemoglobin becomes disoxygenated, deep gradients of oxygen concentration develop in the tissue, and eventually cytochrome oxidase becomes partially and then completely reduced. DPN at this point will become reduced and the electron flow diminished. The rate
Reaction mechanisms in the radiolysis of peptides, polypeptides and proteins
International Nuclear Information System (INIS)
Garrison, W.M.
1985-01-01
The purpose of this review is to bring together and to correlate the wide variety of experimental studies that provide information on the reaction products and reaction mechanisms involved in the radiolysis of peptides, polypeptides and proteins (including chromosomal proteins) in both aqueous and solid-state systems. The comparative radiation chemistry of these systems is developed in terms of specific reactions of the peptide main-chain and the aliphatic, aromatic-unsaturated and sulfur-containing side-chains. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis and ESR spectroscopy is included. 147 refs
Reaction mechanisms in the radiolysis of peptides, polypeptides and proteins
Energy Technology Data Exchange (ETDEWEB)
Garrison, W.M.
1985-01-01
The purpose of this review is to bring together and to correlate the wide variety of experimental studies that provide information on the reaction products and reaction mechanisms involved in the radiolysis of peptides, polypeptides and proteins (including chromosomal proteins) in both aqueous and solid-state systems. The comparative radiation chemistry of these systems is developed in terms of specific reactions of the peptide main-chain and the aliphatic, aromatic-unsaturated and sulfur-containing side-chains. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis and ESR spectroscopy is included. 147 refs.
STUDY OF UROGENITAL TRACT MICROFLORA OF DNEPROPETROVSK FEMALES BY POLYMERASE CHAIN REACTION
Directory of Open Access Journals (Sweden)
Honcharova S.Y.
2015-08-01
Full Text Available We isolated and identified the pathogens from the urogenital tract in 100 women of 26-55 years in Diagnostic Center of Dnepropetrovsk Medical Academy by polymerase chain reaction. It was found that all investigated microflora was represented by HPV of high and low cancer risk - HSV type 1+2, Ureaplasma urealyticum, Chlamydia trachomatis, Trichomonas vaginalis, Mycoplasma hominis, and Candida yeast species. The most abundant pathogens from the urogenital tract were HPV, Ureaplasma urealyticum, and Chlamydia trachomatis.
Directory of Open Access Journals (Sweden)
Aline Lavado Tolardo
2016-06-01
Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.
International Nuclear Information System (INIS)
Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.
1991-01-01
A Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene using microtomed sections from paraffin-embedded radiation-induced and spontaneous tumors as the DNA source. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons) were analyzed. Tumors in six neutron-irradiated mice also had no mRb deletions. However, one of six tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene
Detection of Salmonella typhi by nested polymerase chain reaction in blood, urine, and stool samples
Hatta, Mochammad; Smits, Henk L.
2007-01-01
A nested polymerase chain reaction (PCR) specific for Salmonella enterica serovar Typhi was used for the detection of the pathogen in blood, urine, and stool samples from 131 patients with clinical suspicion of typhoid fever. The sensitivity of blood culture, the PCRs with blood, urine, and feces,
Susan Maphilindawati Noor; Pratiwi Pujilestari Sudarmono; Asmarani Kusumawati; Anis Karuniawati
2014-01-01
Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR) is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4), B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle...
Maedi in slaughtered sheep: a pathology and polymerase chain reaction study in southwestern Iran.
Azizi, Shahrzad; Tajbakhsh, Elahe; Fathi, Farzad; Oryan, Ahmad; Momtaz, Hassan; Goodarzi, Mehdi
2012-01-01
Maedi-visna (MV) is an important slow viral disease of sheep leading to a progressive lymphoproliferative disease. It affects multiple organs primarily the lungs, where it causes interstitial pneumonia (maedi). In this study, the lungs of 1,000 sheep carcasses were grossly inspected and those suspected to have maedi were studied at histopathological and molecular levels. A polymerase chain reaction (PCR) technique that amplified a 291-base pair DNA in the long terminal repeat (LTR) sequence of MV provirus was conducted on all the 50 suspected lungs together with 10 normal appearing lungs as controls. Amplicons of the expected size were detected in 11 (n=11/50) suspected sheep, and one of the 10 control sheep. Histopathologic study of the pulmonary lesions of all 11 (n=11/11) positive sheep showed MV lesions, including hyperplasia of the perivascular and peribronchiolar lymphoid cells, interstitial lymphoplasmacytic infiltration and smooth muscle hyperplasia and the histopathologic findings were correlated with PCR results. In contrast, the tissue sections of control animals were almost normal at histopathological level; however, PCR technique demonstrated that one of them was affected by maedi. This study showed that the LTR-PCR had high specificity and sensitivity in diagnosis of this viral infection. This study is the first to evaluate the prevalence of MV virus infection in sheep in Iran.
Trends and advances in food analysis by real-time polymerase chain reaction.
Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin
2016-05-01
Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.
Silvar, C; Díaz, J; Merino, F
2005-12-01
ABSTRACT Reliable and sensitive quantification of Phytophthora capsici in pepper plants is of crucial importance in managing the multiple syndromes caused by this pathogen. A real-time polymerase chain reaction (PCR) assay was developed for the determination of P. capsici in pepper tissues. DNA levels of a highly virulent and a less virulent isolate were measured in different pepper genotypes with varying degrees of resistance. Using SYBR Green and specific primers for P. capsici, the minimal amount of pathogen DNA quantified was 10 pg. Pathogen DNA was recorded as early as 8 h postinoculation. Thereafter, the increase was rapid in susceptible cultivars and slower in resistant ones. The amount of pathogen DNA quantified in each pepper genotype correlated with susceptibility to Phytophthora root rot. Likewise, there was a relationship between the virulence of the pathogen and the degree of colonization. Differences also were found in oomycete amount among pepper tissues, with maximal pathogen biomass occurring in stems. The real-time PCR technique developed in this study was sensitive and robust enough to assess both pathogen development and resistance to Phytophthora root rot in different pepper genotypes.
Wongbutdee, Jaruwan; Jittimanee, Jutharat
2016-01-01
Leptospirosis, a zoonotic disease caused by Leptospira, has been a health problem in Thailand for several years. Rats are a major reservoir host for Leptospira, and the people who are usually in contact with environments contaminated with rats' urine are at risk of infection. The prevalence rate of Leptospira infection in rats may result in the spread of leptospirosis in humans. This study aimed to determine the prevalence rate ofLeptospira infection in a total of 28 rats and develop a spatial database for leptospirosis surveillance in Phraroj village in Muang Sam Sip District, Ubon Ratchathani Province. The positions of the households and the rat-trapping area were tagged by using of a Global Positioning System (GPS). DNA samples were isolated fromn rats' kidneys. The polymerase chain reaction (PCR) technique was used for the detection of 16s rRNA and LipL32 genes specific to genus and pathogenic Leptospira respectively. All of the data were used to develop a geo-data base by the connection of spatial data and attributed data to be used for query and retrieval. A map of the positions of the households and the rat-trapping area in Phraroj village was created. No rats were found to be infected in the Leptospira survey. There was no trapped rat infected with Leptospira in Phraroj village. This result may involve unreported leptospirosis in patients in this village. The Leptospira survey in rats and the geo-database will be used as a primary resource to support and make decisions about surveillance, prevention, and control of leptospirosis.
Effects of medium-chain triacylglycerols on Maillard reaction in bread baking.
Toyosaki, Toshiyuki
2018-06-01
To investigate the relationship between the fatty acid composition of medium-chain triacylglycerols (MCTs) and the Maillard reaction induced during bread baking, a comparison with various fatty acids was conducted. Saturated fatty acids had a remarkable inhibitory effect on the amount of advanced glycation end products (AGEs) generated from the Maillard reaction in bread baking compared to unsaturated fatty acids. The amount of AGEs produced by each fatty acid (mg kg -1 ) was as follows: C18:0, 18.7; C12:0, 35.2; C16:0, 21.4; C18:0, 38.2; C18:1, 68.7; C18:2, 80.1; C20:4, 80.8; C22:4, 89.8. Saturated fatty acids were possibly involved in the Maillard reaction and, as a result, acted to inhibit it. In the case of unsaturated fatty acids, amounts of AGEs during the Maillard reaction in baking tended to increase as the degree of unsaturation increased. In other words, there was a positive correlation between the degree of unsaturation and the amount of AGEs. It was also confirmed that the air pore distribution in baked bread was closely related to AGEs. These results led us to conclude that the fatty acid composition of the added lipids also influences properties that determine the tastiness of bread. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Markov chain aggregation and its applications to combinatorial reaction networks.
Ganguly, Arnab; Petrov, Tatjana; Koeppl, Heinz
2014-09-01
We consider a continuous-time Markov chain (CTMC) whose state space is partitioned into aggregates, and each aggregate is assigned a probability measure. A sufficient condition for defining a CTMC over the aggregates is presented as a variant of weak lumpability, which also characterizes that the measure over the original process can be recovered from that of the aggregated one. We show how the applicability of de-aggregation depends on the initial distribution. The application section is devoted to illustrate how the developed theory aids in reducing CTMC models of biochemical systems particularly in connection to protein-protein interactions. We assume that the model is written by a biologist in form of site-graph-rewrite rules. Site-graph-rewrite rules compactly express that, often, only a local context of a protein (instead of a full molecular species) needs to be in a certain configuration in order to trigger a reaction event. This observation leads to suitable aggregate Markov chains with smaller state spaces, thereby providing sufficient reduction in computational complexity. This is further exemplified in two case studies: simple unbounded polymerization and early EGFR/insulin crosstalk.
[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].
Harano, K; Harano, T; Kushida, Y; Ueda, S
1991-08-01
Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.
Campbell, J; Lowe, J; Walz, S; Ezzell, J
1993-01-01
We developed a 4-h nested polymerase chain reaction assay that detected a region of the plasminogen activator gene of Yersinia pestis in 100% of 43 Y. pestis strains isolated from humans, rats, and fleas yet was unreactive with the closely related species Yersinia enterocolitica and Yersinia pseudotuberculosis.
Introduction;Commemorating the first self-sustaining nuclear chain reaction on 2 December 1942
Energy Technology Data Exchange (ETDEWEB)
Eklund, S [International Atomic Energy Agency, Vienna (Austria)
1962-12-02
On the occasion of the 20th anniversary of the conducting of the first self-sustaining nuclear chain reaction and following development of nuclear reactors, the article reviews the work and scientific development behind this achievement. The impact of atomic energy on economics, benefits of nuclear reactors for electricity production and the by-product - radio isotopes, used in different areas such as industry, medicine, agriculture etc. are pointed out
Directory of Open Access Journals (Sweden)
Ahmed L Osman
2014-01-01
All children participating in the study were subjected to the Mantoux test after obtaining appropriate consent injected by 5 tuberculin units of tuberculin purified protein derivative, and the results were recorded after three days. Specimens were decontaminated and inoculated on Lowenstein–Jensen media according to the modified Petroff's method. Two smears were prepared and stained by Ziehl–Neelsen stain and Auramine fluorescent dye; bacterial DNA was extracted from each specimen by using phenol chloroform method, and then the Polymerase Chain Reaction technique was adopted to detect Insertion Sequence IS6110 gene of MTB in these specimens. This study showed that the positive results for TST, ZN, Auramine, Culture and PCR were 86 (43.7%, 16 (8.1%, 22 (11.2%, 32 (16.2% and 35(17.8%, respectively. The study concluded that the PCR technique is the most sensitive and specific technique for a quick identification of MTB in gastric lavage and sputum from children who are unable to expectorate a good quality sputum sample or who are diagnosed as negative using conventional diagnostic methods.
Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions
Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory
1989-04-01
The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.
DEFF Research Database (Denmark)
Abdulmawjood, A.; Bulte, M.; Roth, S.
2004-01-01
A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select...
DEFF Research Database (Denmark)
Zornhagen, K. W.; Kristensen, A. T.; Hansen, Anders Elias
2015-01-01
Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours....... The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm...
DEFF Research Database (Denmark)
Hansen, K K; Vestbo, Jørgen; Benfield, T
1997-01-01
Bronchoalveolar lavage (BAL) fluids and serum samples from 153 patients with pulmonary symptoms who were infected with human immunodeficiency virus (HIV) and underwent BAL were examined for the presence of cytomegalovirus (CMV) by conventional culture and by polymerase chain reaction (PCR...... technique than conventional culture. Detection of CMV DNA in BAL fluid or serum predicted subsequent development of extrapulmonary CMV disease but not death for HIV-infected patients with pulmonary symptoms....
Live-Cell MicroRNA Imaging through MnO2 Nanosheet-Mediated DD-A Hybridization Chain Reaction.
Ou, Min; Huang, Jin; Yang, Xiaohai; He, Xiaoxiao; Quan, Ke; Yang, Yanjing; Xie, Nuli; Li, Jing; Wang, Kemin
2018-01-18
Innovative techniques to visualize native microRNAs (miRNAs) in live cells can dramatically impact current research on the roles of miRNA in biology and medicine. Here, we report a novel approach for live-cell miRNA imaging using a biodegradable MnO 2 nanosheet-mediated DD-A FRET hybridization chain reaction (HCR). The MnO 2 nanosheets can adsorb DNA hairpin probes and deliver them into live cells. After entering cells, the MnO 2 nanosheets are degraded by cellular GSH. Then, the target miR-21 triggers cascaded assembly of the liberated hairpin probes into long dsDNA polymers, which brings each two FAMs (donor) and one TAMRA (acceptor) into close proximity to generate significantly enhanced DD-A FRET signals, which was discovered and proven by our previous report. We think the developed approach can serve as an excellent intracellular miRNAs detection tool, which promises the potential for biological and disease studies. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Harmey, Judith H.; Harmey, Matthew A.
1993-01-01
We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...
International Nuclear Information System (INIS)
Sudrajat, Dadang; R, Maria Lina; Suhadi, F.
2000-01-01
A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
Goorhuis, A.; van der Kooi, T.; Vaessen, N.; Dekker, F. W.; van den Berg, R.; Harmanus, C.; van den Hof, S.; Notermans, D. W.; Kuijper, E. J.
2007-01-01
After reports of emerging outbreaks in Canada and the United States, Clostridium difficile-associated disease (CDAD) due to polymerase chain reaction ribotype 027 was detected in 2 medium-to-large hospitals in The Netherlands in 2005. National surveillance was initiated to investigate the spread and
Application of radioanalytical techniques in the study of the products of heavy-ion reactions
International Nuclear Information System (INIS)
Hoffman, D.C.
1989-01-01
The use of heavy ions to induce nuclear reactions was reported as early as 1950. Since then it has been one of the most active areas of nuclear research. Intense beams of ions as heavy as uranium with energies high enough to overcome the Coulomb barriers of even the heaviest elements are available. The large variety of possible reactions gives rise to a multitude of products, which have been studied by many chemical and physical techniques. Chemical techniques have been of special value for the separation and unequivocal identification of low-yield species from the plethora of other nuclides present. Heavy-ion reactions have been essential for the production of the transmendelevium elements and a host of new isotopes. The systematics of compound nucleus reactions, transfer reactions and deeply inelastic reactions have been elucidated using chemical techniques. The variety of chemical procedures and techniques which have been developed for the study of heavy-ion reactions and their products has been examined. The determination of the chemical properties of the transmendelevium elements, which are very short-lived and can only be produced an ''atom at a time'' via heavy-ion reactions, is discussed. (author)
Bjerregaard, Henriette; Pedersen, Shona; Kristensen, Søren Risom; Marcussen, Niels
2011-12-01
Differentiation between malignant renal cell carcinoma and benign oncocytoma is of great importance to choose the optimal treatment. Accurate preoperative diagnosis of renal tumor is therefore crucial; however, existing imaging techniques and histologic examinations are incapable of providing an optimal differentiation profile. Analysis of gene expression of molecular markers is a new possibility but relies on appropriate standardization to compare different samples. The aim of this study was to identify stably expressed reference genes suitable for the normalization of results extracted from gene expression analysis of renal tumors. Expression levels of 8 potential reference genes (ATP5J, HMBS, HPRT1, PPIA, TBP, 18S, GAPDH, and POLR2A) were examined by real-time reverse transcription polymerase chain reaction in tumor and normal tissue from removed kidneys from 13 patients with renal cell carcinoma and 5 patients with oncocytoma. The expression levels of genes were compared by gene stability value M, average gene stability M, pairwise variation V, and coefficient of variation CV. More candidates were not suitable for the purpose, but a combination of HMBS, PPIA, ATP5J, and TBP was found to be the best combination with an average gene stability value M of 0.9 and a CV of 0.4 in the 18 tumors and normal tissues. A combination of 4 genes, HMBS, PPIA, ATP5J, and TBP, is a possible reference in renal tumor gene expression analysis by reverse transcription polymerase chain reaction. A combination of four genes, HMBS, PPIA, ATP5J and TBP, being stably expressed in tissues from RCC is possible reference genes for gene expression analysis.
Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu
2016-04-01
A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.
Identification of aflatoxigenic fungi using polymerase chain reaction-based assay
Directory of Open Access Journals (Sweden)
Šošo Vladislava M.
2014-01-01
Full Text Available As the aflatoxins represent a health-risk for humans because of their proven carcinogenicity, food-borne fungi that produce them as secondary metabolites, mainly Aspergillus flavus and Aspergillus parasiticus, have to be isolated and identified. The best argument for identifying problem fungi is that it indicates control points within the food system as part of a hazard analysis critical control point (HACCP approach. This assumes there is a close link between fungus and toxin. Conventional methods for isolation and identification of fungi are time consuming and require admirably dedicated taxonomists. Hence, it is imperative to develop methodologies that are relatively rapid, highly specific and as an alternative to the existing methods. The polymerase chain reaction (PCR facilitates the in vitro amplification of the target sequence. The main advantages of PCR is that organisms need not be cultured, at least not for a long time, prior to their detection, target DNA can be detected even in a complex mixture, no radioactive probes are required, it is rapid, sensitive and highly versatile. The gene afl-2 has been isolated and shown to regulate aflatoxin biosynthesis in A. flavus. Also, the PCR reaction was targeted against aflatoxin synthesis regulatory gene (aflR1 since these genes are nearly identical in A. flavus and A. parasiticus in order to indicate the possibility of detection of both the species with the same PCR system (primers/reaction. [Projekat Ministarstva nauke Republike Srbije, br. III46009
International Nuclear Information System (INIS)
Shen Cenchao; Yang Wenjuan; Ji Qiaoli; Zhang Zhizhou; Maki, Hisaji; Dong Anjie
2009-01-01
Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.
Directory of Open Access Journals (Sweden)
U. Pagnini
2010-02-01
Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.
DEFF Research Database (Denmark)
Pedersen, Ken Steen; Stege, Helle; Jensen, Tim Kåre
2013-01-01
Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L. intrace......Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L...
[REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].
Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A
2015-01-01
Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.
Directory of Open Access Journals (Sweden)
Camila Ximenes
2014-12-01
Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.
CHAINS-PC, Decay Chain Atomic Densities
International Nuclear Information System (INIS)
1994-01-01
1 - Description of program or function: CHAINS computes the atom density of members of a single radioactive decay chain. The linearity of the Bateman equations allows tracing of interconnecting chains by manually accumulating results from separate calculations of single chains. Re-entrant loops can be treated as extensions of a single chain. Losses from the chain are also tallied. 2 - Method of solution: The Bateman equations are solved analytically using double-precision arithmetic. Poles are avoided by small alterations of the loss terms. Multigroup fluxes, cross sections, and self-shielding factors entered as input are used to compute the effective specific reaction rates. The atom densities are computed at any specified times. 3 - Restrictions on the complexity of the problem: Maxima of 100 energy groups, 100 time values, 50 members in a chain
Outcome of polymerase chain reaction (PCR) analysis in 100 suspected cases of infectious uveitis.
Kharel Sitaula, Ranju; Janani, M K; Madhavan, H N; Biswas, Jyotirmay
2018-01-10
Polymerase chain reaction (PCR) analysis is an important tool in the diagnosis of infectious uveitis. A retrospective, interventional study of PCR analysis of ocular fluid in suspected infectious uveitis cases between January 2014 to July 2016 was done. Nested, real-time and broad range PCR was performed for detection of the genome of Mycobacterium tuberculosis, herpes virus family, Chikungunya virus, Toxoplasma gondii, fungus, eubacterium and propionibacterium acne. Total of 100 cases included, mean age was 39.2 ± 15.4 years. Uveitis was unilateral in 82% and granulomatous in 40%. Mean visual acuity at the initial visit and final visit was 0.73 logMar and 0.63 logMar respectively. PCR analysis confirmed the clinical diagnosis in 70.1% patients. The sensitivity, specificity, positive predictive value and negative predictive value of PCR analysis was 90.2%, 93.9%, 93.9% and 90.2% respectively. The quantitative value of real-time M. tb. Positive PCR ranged from 32c/ml to 2722 c/ml. PCR assay is an accurate technique with high sensitivity and specificity to diagnose the DNA genome in infectious uveitis.
Goorhuis, Abraham; Bakker, Dennis; Corver, Jeroen; Debast, Sylvia B.; Harmanus, Celine; Notermans, Daan W.; Bergwerff, Aldert A.; Dekker, Frido W.; Kuijper, Ed J.
2008-01-01
Since 2005, an increase in the prevalence of Clostridium difficile infection (CDI) due to polymerase chain reaction ribotype 078 has been noticed in The Netherlands. This strain has also been identified as the predominant strain in pigs and calves. CDI caused by type 078 was studied in relation to
Directory of Open Access Journals (Sweden)
Caldeira Roberta L
2001-01-01
Full Text Available Biomphalaria glabrata, B. tenagophila and B. straminea are intermediate hosts of Schistosoma mansoni, in Brazil. The latter is of epidemiological importance in the northwest of Brazil and, due to morphological similarities, has been grouped with B. intermedia and B. kuhniana in a complex named B. straminea. In the current work, we have standardized the simple sequence repeat anchored polymerase chain reaction (SSR-PCR technique, using the primers (CA8RY and K7, to study the genetic variability of these species. The similarity level was calculated using the Dice coefficient and genetic distance using the Nei and Li coefficient. The trees were obtained by the UPGMA and neighbor-joining methods. We have observed that the most related individuals belong to the same species and locality and that individuals from different localities, but of the same species, present clear heterogeneity. The trees generated using both methods showed similar topologies. The SSR-PCR technique was shown to be very efficient in intrapopulational and intraspecific studies of the B. straminea complex snails.
Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology
Directory of Open Access Journals (Sweden)
Kordo B. A. Saeed
2013-11-01
Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.
Zhang, Yinfeng; Luo, Haining; Zhang, Yunshan
2015-12-01
To establish a novel HLA genotyping method for preimplantation genetic diagnonis (PGD) using multiple displacement amplification-polymerase chain reaction-sequencing based technique (MDA-PCR-SBT). Peripheral blood samples and 76 1PN, 2PN, 3PN discarded embryos from 9 couples were collected. The alleles of HLA-A, B, DR loci were detected from the MDA product with the PCR-SBT method. The HLA genotypes of the parental peripheral blood samples were analyzed with the same protocol. The genotypes of specific HLA region were evaluated for distinguishing the segregation of haplotypes among the family members, and primary HLA matching was performed between the embryos. The 76 embryos were subjected to MDA and 74 (97.4%) were successfully amplified. For the 34 embryos from the single blastomere group, the amplification rate was 94.1%, and for the 40 embryos in the two blastomeres group, the rate was 100%. The dropout rates for DQ allele and DR allele were 1.3% and 0, respectively. The positive rate for MDA in the single blastomere group was 100%, with the dropout rates for DQ allele and DR allele being 1.5% and 0, respectively. The positive rate of MDA for the two blastomere group was 100%, with the dropout rates for both DQ and DR alleles being 0. The recombination rate of fetal HLA was 20.2% (30/148). Due to the improper classification and abnormal fertilized embryos, the proportion of matched embryos HLA was 20.3% (15/74),which was lower than the theoretical value of 25%. PGD with HLA matching can facilitate creation of a HLA-identical donor (saviour child) for umbilical cord blood or bone marrow stem cells for its affected sibling with a genetic disease. Therefore, preimplantation HLA matching may provide a tool for couples desiring to conceive a potential donor progeny for transplantation for its sibling with a life-threatening disorder.
Determination of the number of radicals in the initial chain reactions by mathematical methods
Directory of Open Access Journals (Sweden)
Pejović Branko B.
2009-01-01
Full Text Available Starting from the fact that the real mechanism in a chemical equation takes places through a certain number of radicals which participate in simultaneous reactions and initiate chain reactions according to a particular pattern, the aim of this study is to determine their number in the first couple of steps of the reaction. Based on this, the numbers of radicals were determined in the general case, in the form of linear difference equations, which, by certain mathematical transformations, were reduced to one equation that satisfies a particular numeric series, entirely defined if its first members are known. The equation obtained was solved by a common method developed in the theory of numeric series, in which its solutions represent the number of radicals in an arbitrary step of the reaction observed, in the analytical form. In the final part of the study, the method was tested and verified using two characteristic examples from general chemistry. The study also gives a suggestion of a more efficient procedure by reducing the difference equation to a lower order.
Energy Technology Data Exchange (ETDEWEB)
Muscillo, M; La Rosa, G [Istituto Superiore di Sanita, Rome (Italy). Lab. di Igiene Ambientale
1995-12-01
A variety of human infectious diseases are associated with the pollution of water by enteric viruses. The epidemiological data on cases associated with drinking and recreational water show Norwalk, hepatitis A and E viruses, rotavirus and enteroviruses as the etiological agents. The polymerase chain reaction (PCR) is certainly the most reliable technique available for the rapid identification of these viruses in water samples.
Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.
2018-05-01
It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.
International Nuclear Information System (INIS)
Snieckus, Darius
2000-01-01
'Logic' (Leading Oil and Gas Industry Competitiveness) is a government-industry supply chain management initiative which aims to improve the competitiveness of the UK's North Sea business by 1 billion UK pounds by 2002 and its export performance by 50% inside 5 years. Much of the article is devoted to the background and views of Logic's chief executive Chris. Freeman. Freeman makes clear that 'unlike Crine, we are not a cost-reduction initiative: that may be one of the outcomes, but we are really focusing on the co-operation side of things'. Logic aims to change the culture of the UK offshore industry through example. Freeman believes that the creation of collaborative success will flag up industry and give credence to Logics objectives
Kiss, S; Zsikla, V; Frank, A; Willi, N; Cathomas, G
2016-04-01
Helicobacter-negative gastritis has been increasingly reported. Molecular techniques as the polymerase chain reaction (PCR) may detect bacterial DNA in histologically negative gastritis. To evaluate of Helicobacter PCR in gastric biopsies for the daily diagnostics of Helicobacter-negative gastritis. Over a 5-year period, routine biopsies with chronic gastritis reminiscent of Helicobacter infection, but negative by histology, were tested by using a H. pylori specific PCR. Subsequently, PCR-negative samples were re-evaluated using PCR for other Helicobacter species. Of the 9184 gastric biopsies, 339 (3.7%) with histological-negative gastritis and adequate material were forwarded to PCR analysis for H. pylori and 146 (43.1%) revealed a positive result. In 193 H. pylori DNA-negative biopsies, re-analysis using PCR primers for other Helicobacter species, revealed further 23 (11.9%) positive biopsies, including 4 (2.1%) biopsies with H. heilmannii sensu lato. PCR-positive biopsies showed a higher overall inflammatory score, more lymphoid follicles/aggregates and neutrophils (P gastritis. © 2016 John Wiley & Sons Ltd.
Chang, Hye-Sook; Mizukami, Keijiro; Yabuki, Akira; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Arai, Toshiro; Yamato, Osamu
2010-09-01
Collie eye anomaly (CEA) is a canine inherited ocular disease that shows a wide variety of manifestations and severity of clinical lesions. Recently, a CEA-associated mutation was reported, and a DNA test that uses conventional polymerase chain reaction (PCR) has now become available. The objective of the current study was to develop a novel rapid genotyping technique by using SYBR Green-based real-time PCR for future large-scale surveys as a key part in the strategy to eradicate CEA by selective breeding. First, a SYBR Green-based real-time PCR assay for genotyping of CEA was developed and evaluated by using purified DNA samples from normal, carrier, and affected Border Collies in which genotypes had previously been determined by conventional PCR. This real-time PCR assay demonstrated appropriate amplifications in all genotypes, and the results were consistent with those of conventional PCR. Second, the availability of Flinders Technology Associates filter paper (FTA card) as DNA templates for the real-time PCR assay was evaluated by using blood and saliva specimens to determine suitability for CEA screening. DNA-containing solution prepared from a disc of blood- or saliva-spotted FTA cards was available directly as templates for the real-time PCR assay when the volume of solution was 2.5% of the PCR mixture. In conclusion, SYBR Green-based real-time PCR combined with FTA cards is a rapid genotyping technique for CEA that can markedly shorten the overall time required for genotyping as well as simplify the sample preparation. Therefore, this newly developed technique suits large-scale screening in breeding populations of Collie-related breeds.
Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis
Directory of Open Access Journals (Sweden)
Shoughy SS
2015-12-01
Full Text Available Samir S Shoughy,1 Hind M Alkatan,2,4 Abdulelah A Al-Abdullah,2 Albarah El-Khani,2 Jolanda DF de Groot-Mijnes,3 Khalid F Tabbara1,4,5 1Department of Ophthalmology, The Eye Center and The Eye Foundation for Research in Ophthalmology, 2Department of Pathology & Laboratory Medicine and Uveitis Division, King Khaled Eye Specialist Hospital, Riyadh, Saudi Arabia; 3Department of Virology and Ophthalmology, University Medical Center Utrecht, Utrecht, the Netherlands; 4Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 5The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USA Background and objectives: Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis.Patients and methods: A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein–Barr virus, and rubella virus.Results: There were six male and six female patients. The mean age was 43 years, with an age range of 11–82 years. All 12 cases presented with unilateral anterior uveitis. In four (33% patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein–Barr virus.Conclusion: Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis. Keywords: viral anterior uveitis, PCR, herpes simplex virus, cytomegalovirus, diffuse keratic precipitates, anterior chamber
Fan, Hongxin; Robetorye, Ryan S
2013-01-01
Although established diagnostic criteria exist for mature T-cell neoplasms, a definitive diagnosis of a T-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because T-cell malignancies contain identically rearranged T-cell receptor gamma (TCRG) and/or beta (TCRB) genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal T-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal TCRB and TCRG gene rearrangements (TCRB and TCRG PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol for the TCRB assay involves the use of three separate multiplex master mix tubes. Tubes A and B target the framework regions within the variable and joining regions of the TCRB gene, and Tube C targets the diversity and joining regions of the TCRB gene. The core protocol for the TCRG assay utilizes two multiplex master mix tubes (Tubes A and B) that target the variable and joining regions of the TCRG gene. Use of the five BIOMED-2 TCRB and TCRG PCR multiplex tubes in parallel can detect approximately 94% of clonal TCR gene rearrangements.
DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.
Guthrie, J N; Moriarty, D J; Blackall, L L
2000-12-15
A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.
Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor
International Nuclear Information System (INIS)
Liu Dayu; Liang Guangtie; Lei Xiuxia; Chen Bin; Wang Wei; Zhou Xiaomian
2012-01-01
Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil–water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: ► Droplet formation in a capillary. ► Transport the droplet using oscillation-flow. ► Oscillation droplet PCR. ► Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil–water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 μL) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to 89.5% and a detection limit of 10 DNA copies. The miniature PCR protocol developed in the current
Directory of Open Access Journals (Sweden)
Mohammad Rubayet Hasan
2014-01-01
Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.
Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein
2017-09-01
The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species
Polymerase chain reaction: Theory, practice and application: A review
Directory of Open Access Journals (Sweden)
S E Atawodi
2010-01-01
Full Text Available Polymerase Chain Reaction (PCR is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension of the annealed primers by DNA polymerase, result in the exponential accumulation of a specific fragment whose termini are defined by 5′ end of the primers. The primer extension products synthesized in one cycle can serve as a template in the next. Hence the number of target DNA copies approximately doubles at every cycle. Since its inception, PCR has had an enormous impact in both basic and diagnostic aspects of molecular biology. Like the PCR itself, the number of applications has been accumulating exponentially. It is therefore recommended that relevant scientists and laboratories in developing countries like Nigeria should acquire this simple and relatively inexpensive, but rather robust technology.
International Nuclear Information System (INIS)
Aquino, Simone
2003-01-01
The aim of this present study was to verify the effects of gamma radiation on the growth of Aspergillus flavus Link aflatoxins producer; to demonstrate the application of Polymerase Chain Reaction (PCR) technique in the diagnostic of A. Flavus, as well to verify the effect of radiation in the profile of DNA bands. Twenty samples of grains maize with 200 g each were individually irradiated with 20 kGy, to eliminate the microbial contamination. In following, the samples were inoculated with an toxigenic A. flavus (1x10 6 spores/ml), incubated for 15 days at 25 deg C with a relative humidity of around 97,5% and irradiated with 0, 2; 5 and 10 kGy. The samples, 5 to each dose of irradiation, were individually analyzed for the number of fungal cells, water activity, viability test (fluorescein diacetate and ethidium bromide), PCR and aflatoxins (AFB) detection. The results showed that the doses used were effective in reducing the number of Colony Forming Units (CFU/g) mainly the doses of 5 and 10 kGy. In addition, the viability test showed a decrease of viable cells with increase of irradiation doses. The reduction of AFB 1 and AFB-2, was more efficient with the use of 2 kGy in comparison with the dose of 5 kGy, while the dose of 10 kGy, degraded the aflatoxins. Thereby, it was observed that AFB2 showed to be more radiosensitive. The use of PCR technique showed the presence of DNA bands, in all samples. (author)
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedure recommended for... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... tracheal swabs in PBS or 1 mL of broth culture by a non-phenolic procedure. Centrifuge samples at 14,000 x...
Directory of Open Access Journals (Sweden)
Людмила Мар’янівна Іщенко
2016-11-01
Full Text Available Approbation of diagnostic tests for species identification of beef, pork and chicken by real time polymerase chain reaction method was done. Meat food, including heat treated and animal feed, was used for research. The fact of inconsistencies was revealed for product composition of some meat products that is marked by manufacturer
Directory of Open Access Journals (Sweden)
Thiago Leite Fraga
2010-05-01
Full Text Available The diagnosis of visceral leishmaniasis (VL generally requires the use of invasive tests for the collection of infected tissue (aspirates of bone marrow, spleen, liver or lymph nodes. This difficulty has led to the search for safer and less painful techniques to confirm the occurrence of the disease in children. Polymerase chain reaction (PCR is a method that is advantageous in that it allows the use of peripheral blood samples for diagnosis. This paper reports the utilisation of PCR on peripheral blood samples to diagnose VL in 45 children in Mato Grosso do Sul, Brazil. This technique is compared with methods carried out using tissue collected by invasive procedures, including direct microscopy, culture and detection of Leishmania DNA by PCR in bone marrow aspirates. The results show that PCR of peripheral blood provides great sensitivity (95.6% that is similar to that from the PCR of bone marrow aspirates (91.1% and higher than that achieved with microscopy (80% or culture (26.7% methods. PCR of peripheral blood proved to be a suitable tool for the diagnosis of VL in children because it is highly sensitive and safe, with tissue collection being less invasive than in traditional tests.
Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun
2014-09-01
The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.
LENUS (Irish Health Repository)
Drew, Richard J
2012-03-01
Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.
The effect of chain flexibility and chain mobility on radiation crosslinking reactions of polymers
International Nuclear Information System (INIS)
Sun Jiazhen
2003-01-01
Flexibility of polymer chains is an important factor to effects of radiation crosslinking of the polymer. Polymers with flexible chains are easier to be crosslinked, with lower dose of gelation, than polymers with more rigid chains. And it is known that most polymers with abnormal rigidity can be radiation-crosslinked only at high temperatures when the molecular chains get enough mobility. The flexibility of polymer chains also influences the relationship between degree of degradation and radiation dose. A chain flexibility factor β has been introduced to modify the Charlesby-Pinner equation of sol-fraction and radiation dose. The new relationship equation applies to a wider range of polymers in radiation crosslinking. Studies also show that for flexible polymers with lower T g and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in H type, whereas for rigid polymers with higher T g and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in T type
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedures recommended for... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Development of the polymerase chain reaction for diagnosis of chancroid.
Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R
1993-01-01
The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959
Directory of Open Access Journals (Sweden)
Amanda Mahoney
2012-01-01
Full Text Available Setting. Tanzania. Objective. To compare microscopy as conducted in direct observation of treatment, short course centers to pouched rats as detectors of Mycobacterium tuberculosis. Design. Ten pouched rats were trained to detect tuberculosis in sputum using operant conditioning techniques. The rats evaluated 910 samples previously evaluated by smear microscopy. All samples were also evaluated through culturing and multiplex polymerase chain reaction was performed on culture growths to classify the bacteria. Results. The patientwise sensitivity of microscopy was 58.0%, and the patient-wise specificity was 97.3%. Used as a group of 10 with a cutoff (defined as the number of rat indications to classify a sample as positive for Mycobacterium tuberculosis of 1, the rats increased new case detection by 46.8% relative to microscopy alone. The average samplewise sensitivity of the individual rats was 68.4% (range 61.1–73.8%, and the mean specificity was 87.3% (range 84.7–90.3%. Conclusion. These results suggest that pouched rats are a valuable adjunct to, and may be a viable substitute for, sputum smear microscopy as a tuberculosis diagnostic in resource-poor countries.
Reaction pathway towards formation of cobalt single chain magnets and nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Balaji, G.; Desilva, Rohini M.; Palshin, V. [Center for Advanced Microstructures and Devices, Louisiana State University, 6980 Jefferson Highway, Baton Rouge, LA 70806 (United States); Desilva, N. [Department of Chemistry, Louisiana State University, Baton Rouge, LA 70803 (United States); Palmer, G. [Department of Biochemistry and Cell Biology, Rice University, MS 140, 6100 Main street, Houston, TX 77251 (United States); Kumar, Challa S.S.R., E-mail: ckumar1@lsu.ed [Center for Advanced Microstructures and Devices, Louisiana State University, 6980 Jefferson Highway, Baton Rouge, LA 70806 (United States)
2010-03-15
With the advent of molecular magnets the quest for suitable high density magnetic storage materials has fuelled further research in this area. Here in this report, we present a detailed mechanistic investigation of thermal decomposition of cyclopentadienyl cobalt [CoCp(CO){sub 2}] precursor where Cp is the cyclopentadienyl moiety. The reaction revealed the formation of cobalt nanoparticles (Co-NPs) through an isolable reaction intermediate characterized as a Single Chain Magnet (SCM), [Co(Cp){sub 2}]{sub 2}CoCl{sub 4} (1). The SQUID magnetic measurements showed the presence of very strong antiferromagnetic interactions between Co{sup 2+} ions. The zero-field cooled (ZFC) and field cooled (FC) magnetization curves branch out below 5 K and there is evidence for frequency dependent complex susceptibility along with a maximum observed around 2.5 K. The optical studies indicated that the Co{sup 2+} d-d transition is influenced by the polarity of the solvents. The cobalt nanoparticles (Co-NPs) were obtained, either directly from 1 or from its precursor. They are spherical in shape with a mean size 15 nm, have fcc crystal structure and were found to be ferromagnetic at room temperature.
International Nuclear Information System (INIS)
Yuan, Yi; Liu, Zheming; Liu, Zhenyang; Peng, Lan; Li, Yongjie; Tang, Aiwei
2017-01-01
Highlights: • CsPbBr_3 perovskite nanocrystals have been synthesized in the presence of organic amines with different hydrocarbon length. • The photoluminescence of the CsPbBr_3 nanocrystals is affected by the varying the carbon length of the organic amines. • The lower reaction temperature and hydrocarbon chain length of the organic ligands play a significant role in the self-assembly of CsPbBr_3 nanocrystals. - Abstract: All-inorganic halide perovskites have become one of the most prospective materials for lightening and display technology due to their color-tunable and narrow-band emission. Herein, we have systematically studied the effects of organic amines with different hydrocarbon chain length on the optical properties and morphology as well as the crystal structure of colloidal CsPbBr_3 nanocrystals (NCs), which were synthesized in the presence of oleic acid (OA) and organic amines by using a simple hot-injection approach. The hydrocarbon chain length has shown an independent correlation to the morphology and crystal structure of the as-obtained CsPbBr_3 NCs at 160 °C, but their optical properties can be affected to some extent. The photoluminescence quantum yields (PLQYs) of the CsPbBr_3 NCs synthesized in the presence of organic amines with long carbon chain length are generally in the range of 55–80% for different reaction time, but the PLQYs of less than 20% are obtained for the products synthesized in the presence of octylamine (OTAm) with short carbon chain length. The effects of the reaction temperature on the optical properties, size and crystal structure of the CsPbBr_3 NCs synthesized in the presence of cetylamine (CTAm) are studied. Interestingly, some nanoplates also appear in these CsPbBr_3 NCs obtained at relatively low temperatures (120 and 140 °C), which have a strong tendency to self-assemble into face-to-face nanostructures. Such a similar self-assembly behavior is also observed in the product synthesized in the presence of
Energy Technology Data Exchange (ETDEWEB)
Yuan, Yi; Liu, Zheming; Liu, Zhenyang; Peng, Lan; Li, Yongjie; Tang, Aiwei, E-mail: awtang@bjtu.edu.cn
2017-05-31
Highlights: • CsPbBr{sub 3} perovskite nanocrystals have been synthesized in the presence of organic amines with different hydrocarbon length. • The photoluminescence of the CsPbBr{sub 3} nanocrystals is affected by the varying the carbon length of the organic amines. • The lower reaction temperature and hydrocarbon chain length of the organic ligands play a significant role in the self-assembly of CsPbBr{sub 3} nanocrystals. - Abstract: All-inorganic halide perovskites have become one of the most prospective materials for lightening and display technology due to their color-tunable and narrow-band emission. Herein, we have systematically studied the effects of organic amines with different hydrocarbon chain length on the optical properties and morphology as well as the crystal structure of colloidal CsPbBr{sub 3} nanocrystals (NCs), which were synthesized in the presence of oleic acid (OA) and organic amines by using a simple hot-injection approach. The hydrocarbon chain length has shown an independent correlation to the morphology and crystal structure of the as-obtained CsPbBr{sub 3} NCs at 160 °C, but their optical properties can be affected to some extent. The photoluminescence quantum yields (PLQYs) of the CsPbBr{sub 3} NCs synthesized in the presence of organic amines with long carbon chain length are generally in the range of 55–80% for different reaction time, but the PLQYs of less than 20% are obtained for the products synthesized in the presence of octylamine (OTAm) with short carbon chain length. The effects of the reaction temperature on the optical properties, size and crystal structure of the CsPbBr{sub 3} NCs synthesized in the presence of cetylamine (CTAm) are studied. Interestingly, some nanoplates also appear in these CsPbBr{sub 3} NCs obtained at relatively low temperatures (120 and 140 °C), which have a strong tendency to self-assemble into face-to-face nanostructures. Such a similar self-assembly behavior is also observed in the
Simple model of inhibition of chain-branching combustion processes
Babushok, Valeri I.; Gubernov, Vladimir V.; Minaev, Sergei S.; Miroshnichenko, Taisia P.
2017-11-01
A simple kinetic model has been suggested to describe the inhibition and extinction of flame propagation in reaction systems with chain-branching reactions typical for hydrocarbon systems. The model is based on the generalised model of the combustion process with chain-branching reaction combined with the one-stage reaction describing the thermal mode of flame propagation with the addition of inhibition reaction steps. Inhibitor addition suppresses the radical overshoot in flame and leads to the change of reaction mode from the chain-branching reaction to a thermal mode of flame propagation. With the increase of inhibitor the transition of chain-branching mode of reaction to the reaction with straight-chains (non-branching chain reaction) is observed. The inhibition part of the model includes a block of three reactions to describe the influence of the inhibitor. The heat losses are incorporated into the model via Newton cooling. The flame extinction is the result of the decreased heat release of inhibited reaction processes and the suppression of radical overshoot with the further decrease of the reaction rate due to the temperature decrease and mixture dilution. A comparison of the results of modelling laminar premixed methane/air flames inhibited by potassium bicarbonate (gas phase model, detailed kinetic model) with the results obtained using the suggested simple model is presented. The calculations with the detailed kinetic model demonstrate the following modes of combustion process: (1) flame propagation with chain-branching reaction (with radical overshoot, inhibitor addition decreases the radical overshoot down to the equilibrium level); (2) saturation of chemical influence of inhibitor, and (3) transition to thermal mode of flame propagation (non-branching chain mode of reaction). The suggested simple kinetic model qualitatively reproduces the modes of flame propagation with the addition of the inhibitor observed using detailed kinetic models.
Tang, Min; Zhao, Xiao-Gang; Gu, Y. John; Chen, Chang-Zhi
The accurate temperature control of a polymerase chain reaction (PCR) thermocycler was exploited in developing an in vitro model to study neutrophil activation during cardiopulmonary bypass. Neutrophils from 12 volunteers underwent temperature changes in a PCR thermocycler (37 degrees C for 30
Brucella contamination in raw milk by polymerase chain reaction
Directory of Open Access Journals (Sweden)
Mohammad Khalili
2016-10-01
Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. Brucella organisms, which are small aerobic, facultative intracellular coccobacilli, localize in the reproductive organs of host animals, causing abortions and sterility. They are shed in large numbers in the animal’s urine, milk, placental fluid, and other fluids. Dairy product from raw milk are a potential threat to public health in endemic developing countries. The gold standard for the diagnosis of brucellosis is isolation of Brucella species. However, isolation Brucella species is time consuming and needed to level 3 biocontainment facilities and highly skilled technical personnel to handle samples and live bacteria for eventual identification. Handling Brucella species increase risk of laboratory infection. Polymerase chain reaction (PCR with high sensitivity and specifity overcomed to these disadvantages. The aim of this study was to detect Brucella species in milk from dairy cattle farms in Kerman province, Iran by PCR technique. Methods: Forty and eight bulk tank milk (BTM were collected from October 2015 to March 2016 from 48 dairy cattle farm including 4200 cows. DNA of milk samples extracted by lysis buffer and proteinase K method. All milk samples were examined by PCR to detect Brucella-specific DNA targeting IS 711. Positive samples must be showed 317 bp amplified, corresponding to the expected size of the IS 711 genome region in all Brucella species. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp. from 48 BTM samples in this area. Conclusion: The results indicate that brucellosis by Brucella species is endemic in the Kerman province dairy farms. Consumption of raw milk dairy products by individual farmers operating under poor hygienic conditions represents an high risk to public health. The need for implementing control measures and raising public awareness on zoonotic transmission of
Saed, Mohand O.; Torbati, Amir H.; Nair, Devatha P.; Yakacki, Christopher M.
2016-01-01
This study presents a novel two-stage thiol-acrylate Michael addition-photopolymerization (TAMAP) reaction to prepare main-chain liquid-crystalline elastomers (LCEs) with facile control over network structure and programming of an aligned monodomain. Tailored LCE networks were synthesized using routine mixing of commercially available starting materials and pouring monomer solutions into molds to cure. An initial polydomain LCE network is formed via a self-limiting thiol-acrylate Michael-addi...
Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G
The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial
Furutani, Shunsuke; Hagihara, Yoshihisa; Nagai, Hidenori
2017-09-01
Correct labeling of foods is critical for consumers who wish to avoid a specific meat species for religious or cultural reasons. Therefore, gene-based point-of-care food analysis by real-time Polymerase Chain Reaction (PCR) is expected to contribute to the quality control in the food industry. In this study, we perform rapid identification of meat species by our portable rapid real-time PCR system, following a very simple DNA extraction method. Applying these techniques, we correctly identified beef, pork, chicken, rabbit, horse, and mutton in processed foods in 20min. Our system was sensitive enough to detect the interfusion of about 0.1% chicken egg-derived DNA in a processed food sample. Our rapid real-time PCR system is expected to contribute to the quality control in food industries because it can be applied for the identification of meat species, and future applications can expand its functionality to the detection of genetically modified organisms or mutations. Copyright © 2017 Elsevier Ltd. All rights reserved.
Saed, Mohand O; Torbati, Amir H; Nair, Devatha P; Yakacki, Christopher M
2016-01-19
This study presents a novel two-stage thiol-acrylate Michael addition-photopolymerization (TAMAP) reaction to prepare main-chain liquid-crystalline elastomers (LCEs) with facile control over network structure and programming of an aligned monodomain. Tailored LCE networks were synthesized using routine mixing of commercially available starting materials and pouring monomer solutions into molds to cure. An initial polydomain LCE network is formed via a self-limiting thiol-acrylate Michael-addition reaction. Strain-to-failure and glass transition behavior were investigated as a function of crosslinking monomer, pentaerythritol tetrakis(3-mercaptopropionate) (PETMP). An example non-stoichiometric system of 15 mol% PETMP thiol groups and an excess of 15 mol% acrylate groups was used to demonstrate the robust nature of the material. The LCE formed an aligned and transparent monodomain when stretched, with a maximum failure strain over 600%. Stretched LCE samples were able to demonstrate both stress-driven thermal actuation when held under a constant bias stress or the shape-memory effect when stretched and unloaded. A permanently programmed monodomain was achieved via a second-stage photopolymerization reaction of the excess acrylate groups when the sample was in the stretched state. LCE samples were photo-cured and programmed at 100%, 200%, 300%, and 400% strain, with all samples demonstrating over 90% shape fixity when unloaded. The magnitude of total stress-free actuation increased from 35% to 115% with increased programming strain. Overall, the two-stage TAMAP methodology is presented as a powerful tool to prepare main-chain LCE systems and explore structure-property-performance relationships in these fascinating stimuli-sensitive materials.
Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.
Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P
1999-08-02
Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.
The generation of radiolabeled DNA and RNA probes with polymerase chain reaction
International Nuclear Information System (INIS)
Schowalter, D.B.; Sommer, S.S.
1989-01-01
By including a radioactive triphosphate during polymerase chain reaction (PCR), probes of very high specific activity can be generated. The advantages of PCR labeling include (1) uniform labeling with a specific activity of 5 X 10(9) cpm/micrograms or higher (sensitivity of detection: 0.028 pg of target DNA per 24 h); (2) ease of regulation of both the specific activity and the amount of labeled probe produced; (3) efficient labeling of fragments less than 500 bp; (4) efficient incorporation over a wide range of input DNA template; (5) labeling with subnanogram amounts of input DNA; and (6) direct labeling of genomic DNA. The minimal amount of input DNA allows a virtually unlimited number of PCR labeling reactions to be performed on DNA generated by one amplification under the previously described nonlabeling conditions. This obviates the need for CsCl gradients or other large scale methods of DNA preparation. The above advantages except for the very high specific activity can also be achieved by transcript labeling after an amplification where one or both of PCR primers contain a phage promoter sequence
Pierce, Kenneth E; Wangh, Lawrence J
2007-01-01
Accurate detection of gene sequences in single cells is the ultimate challenge to polymerase chain reaction (PCR) sensitivity. Unfortunately, commonly used conventional and real-time PCR techniques are often too unreliable at that level to provide the accuracy needed for clinical diagnosis. Here we provide details of linear-after-the-exponential-PCR (LATE-PCR), a method similar to asymmetric PCR in the use of primers at different concentrations, but with novel design criteria to ensure high efficiency and specificity. Compared with conventional PCR, LATE-PCR increases the signal strength and allele discrimination capability of oligonucleotide probes such as molecular beacons and reduces variability among replicate samples. The analysis of real-time kinetics of LATE-PCR signals provides a means for improving the accuracy of single cell genetic diagnosis.
Directory of Open Access Journals (Sweden)
Sefrita Tri Utami
2014-01-01
Full Text Available ABSTRACTLeptospirosis is a zoonotic disease, which is caused by leptospira. Leptospirosis cases often show no specificclinical symptoms and is difficult to diagnose without testing samples in the laboratory. Testing using PCR(Polymerase Chain Reaction is considered more accurate than the other methods. Components required in theexamination Leptospira bacteria in human blood samples using PCR method is DNA template, DNA polymeraseenzyme, forward primer (PU1 and SU1 and reverse primer (Lep R1, nuclease free water, Mg 2 +, and dNTPs.Examination of Leptospira bacteria in human blood samples include sampling, DNA isolation, examination byPCR, and electrophoresis running.Key words: leptospirosis, Leptospira, PCR methodsABSTRAKLeptospirosis adalah penyakit zoonosis yang disebabkan oleh bakteri Leptospira. Kasus leptospirosis seringtidak menunjukkan gejala klinis yang spesifik dan sulit didiagnosis tanpa pengujian sampel di laboratorium.Pengujian dengan menggunakan metode PCR (Polymerase Chain Reaction dinilai lebih akurat dibandingkandengan metode yang lain. Komponen-komponen yang dibutuhkan dalam pemeriksaan bakteri Leptospira padasampel darah manusia menggunakan metode PCR adalah DNA template, enzim polymerase, Primer PU 1 danPrimer SU 1, Primer Lep R1, air, Mg2+ , dan dNTP. Pemeriksaan bakteri Leptospira pada sampel darah manusiameliputi pengambilan sampel, isolasi DNA, pemeriksaan dengan metode PCR, dan running elektroforesis.Kata kunci: leptospirosis, Leptospira, metode PCR
DEFF Research Database (Denmark)
Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline
2015-01-01
BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma hae...
Directory of Open Access Journals (Sweden)
Dominique Rainteau
Full Text Available BACKGROUND: Phospholipases D (PLD are major components of signalling pathways in plant responses to some stresses and hormones. The product of PLD activity is phosphatidic acid (PA. PAs with different acyl chains do not have the same protein targets, so to understand the signalling role of PLD it is essential to analyze the composition of its PA products in the presence and absence of an elicitor. METHODOLOGY/PRINCIPAL FINDINGS: Potential PLD substrates and products were studied in Arabidopsis thaliana suspension cells treated with or without the hormone salicylic acid (SA. As PA can be produced by enzymes other than PLD, we analyzed phosphatidylbutanol (PBut, which is specifically produced by PLD in the presence of n-butanol. The acyl chain compositions of PBut and the major glycerophospholipids were determined by multiple reaction monitoring (MRM mass spectrometry. PBut profiles of untreated cells or cells treated with SA show an over-representation of 160/18:2- and 16:0/18:3-species compared to those of phosphatidylcholine and phosphatidylethanolamine either from bulk lipid extracts or from purified membrane fractions. When microsomal PLDs were used in in vitro assays, the resulting PBut profile matched exactly that of the substrate provided. Therefore there is a mismatch between the acyl chain compositions of putative substrates and the in vivo products of PLDs that is unlikely to reflect any selectivity of PLDs for the acyl chains of substrates. CONCLUSIONS: MRM mass spectrometry is a reliable technique to analyze PLD products. Our results suggest that PLD action in response to SA is not due to the production of a stress-specific molecular species, but that the level of PLD products per se is important. The over-representation of 160/18:2- and 16:0/18:3-species in PLD products when compared to putative substrates might be related to a regulatory role of the heterogeneous distribution of glycerophospholipids in membrane sub-domains.
Accuracy of real-time polymerase chain reaction for Toxoplasma gondii in amniotic fluid.
Wallon, Martine; Franck, Jacqueline; Thulliez, Philippe; Huissoud, Cyril; Peyron, François; Garcia-Meric, Patricia; Kieffer, François
2010-04-01
To provide clinicians with information about the accuracy of real-time polymerase chain reaction (PCR) analysis of amniotic fluid for the prenatal diagnosis of congenital Toxoplasma infection. This was a prospective cohort study of women with Toxoplasma infection identified by prenatal screening in three centers routinely carrying out real-time PCR for the detection of Toxoplasma gondii in amniotic fluid. The data available were gestational age at maternal infection, types and dates of maternal treatment, results of amniocentesis and neonatal work-up and definitive infectious status of the child. We estimated sensitivity, specificity and positive and negative predictive values both overall and per trimester of pregnancy at the time of maternal infection. Polymerase chain reaction analysis was carried out on amniotic fluid for 261 of the 377 patients included (69%). It was accurate with the exception of four negative results in children who were infected. Overall sensitivity and negative predictive value were 92.2% (95% confidence interval [CI] 81-98%) and 98.1% (95% CI 95-99.5%), respectively. There was no significant association with the trimester of pregnancy during which maternal infection occurred. Specificity and positive predictive values of 100% were obtained for all trimesters. Real-time PCR analysis significantly improves the detection of T. gondii on amniotic fluid. It provides an accurate tool to predict fetal infection and to decide on appropriate treatment and surveillance. However, postnatal follow-up remains necessary in the first year of life to fully exclude infection in children for whom PCR results were negative. III.
Directory of Open Access Journals (Sweden)
Caldeira Roberta Lima
1998-01-01
Full Text Available The freshwater snails Biomphalaria straminea, B. intermedia, B. kuhniana and B. peregrina, are morphologically similar; based on this similarity the first three species were therefore grouped in the complex B. straminea. The morphological identification of these species is based on characters such as vaginal wrinkling, relation between prepuce: penial sheath:deferens vas and number of muscle layers in the penis wall. In this study the polymerase chain reaction restriction fragment length polymorphism technique was used for molecular identification of these molluscs. This technique is based on the amplification of the internal transcribed spacer regions ITS1 e ITS2 of the ribosomal RNA gene and subsequent digestion of these fragments by restriction enzymes. Six enzymes were tested: Dde I, Mnl I, Hae III, Rsa I, Hpa II e Alu I. The restriction patterns obtained with DdeI presented the best profile for separation of the four species of Biomphalaria. The profiles obtained with all the enzymes were used to estimate the genetic distances among the species through analysis of common banding patterns.
International Nuclear Information System (INIS)
Tamer, Gulden S.; Turk, M.; Dagci, H.; Pektas, B.; Guruz, Adnan Y.; Uner, A.; Guy, E.C.
2007-01-01
Objective was to verify the incidence of cryptosporidiosis among Turkish elementary school students. The study was conducted in the Dept. of Parasitology, Faculty of Medicine, Ege University, Turkey during a 3-month period in 2006. We assessed the fecal samples of 707 children using modified acid-fast and phenol-auramine staining followed by modified Ritchie concentration method. All cryptosporidium species isolates were analysed by nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) to differentiate genotypes of the isolates. After the coprological examination, 4 samples were found to be positive for cryptosporidium species oocysts. In the present study, all 4 oocysts were of zoonotic origin and belonged to cryptoporodium parvum genotype 2 indicating that in Turkey the potential sources of human cryptosporidiosis is from animals. The application of genotyping to clinical isolates of cryptosporidium has significantly increased our knowledge and understanding of the distribution and epidemiology of this parasite. The PCR and RFLP techniques represent a more rapid and simple method of genotyping to support epidemiological and clinical investigations than conventional analytical DNA techniques. (author)
Yuan, Yi; Liu, Zheming; Liu, Zhenyang; Peng, Lan; Li, Yongjie; Tang, Aiwei
2017-05-01
All-inorganic halide perovskites have become one of the most prospective materials for lightening and display technology due to their color-tunable and narrow-band emission. Herein, we have systematically studied the effects of organic amines with different hydrocarbon chain length on the optical properties and morphology as well as the crystal structure of colloidal CsPbBr3 nanocrystals (NCs), which were synthesized in the presence of oleic acid (OA) and organic amines by using a simple hot-injection approach. The hydrocarbon chain length has shown an independent correlation to the morphology and crystal structure of the as-obtained CsPbBr3 NCs at 160 °C, but their optical properties can be affected to some extent. The photoluminescence quantum yields (PLQYs) of the CsPbBr3 NCs synthesized in the presence of organic amines with long carbon chain length are generally in the range of 55-80% for different reaction time, but the PLQYs of less than 20% are obtained for the products synthesized in the presence of octylamine (OTAm) with short carbon chain length. The effects of the reaction temperature on the optical properties, size and crystal structure of the CsPbBr3 NCs synthesized in the presence of cetylamine (CTAm) are studied. Interestingly, some nanoplates also appear in these CsPbBr3 NCs obtained at relatively low temperatures (120 and 140 °C), which have a strong tendency to self-assemble into face-to-face nanostructures. Such a similar self-assembly behavior is also observed in the product synthesized in the presence of oleylamine (OLAm), but only flat nanoplates are observed in the products in the presence of OTAm at 120 °C. The results indicate that the lower reaction temperature and hydrocarbon chain length of the organic ligands play a significant role in the self-assembly of CsPbBr3 NCs. This work opens up an alternative approach to controllable-synthesis of perovskite NCs through varying the carbon chain length of organic surfactants, and enlightens
Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes.
Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry
2012-11-16
The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.
Evidence of simian retrovirus type D by polymerase chain reaction.
Hwa, Christian Z R; Tsai, Sheung Pun; Yee, JoAnn L; Van Rompay, Koen K; Roberts, Jeffrey A
2017-06-01
Over the past few years, there have been reports of finding Simian retrovirus type D (SRV) in macaque colonies where some animals were characterized as antibody positive but virus negative raising questions about how SRV was transmitted or whether there is a variant strain detected by antibody but not polymerase chain reaction (PCR) in current use. We developed a three-round nested PCR assay using degenerate primers targeting the pol gene to detect for SRV serotypes 1-5 and applied this newly validated PCR assay to test macaque DNA samples collected in China from 2010 to 2015. Using the nested PCR assay validated in this study, we found 0.15% of the samples archived on FTA ® cards were positive. The source of SRV infection identified within domestic colonies might have originated from imported macaques. The multiplex nested PCR assay developed here may supplement the current assays for SRV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Ferlet-Cavrois, V.; Fel, N.; Gaillardin, M.; Baggio, J.; Girard, S.; Flament, O.; Paillet, P.; McMorrow, D.; Melinger, J. S.; Kobayashi, D.; Hirose, K.; Saito, H.; Pouget, V.; Essely, F.; Schwank, J. R.; Flores, R. S.; Dodd, P. E.; Shaneyfelt, M. R.
2009-01-01
A new technique is developed to measure precisely and accurately the width of propagating voltage transients induced by irradiation of inverter chains. The technique is based on measurement of the supply current in a detection inverter, and permits a direct determination of the transient width with a 50 GHz bandwidth. (authors)
Farr, W. M.; Mandel, I.; Stevens, D.
2015-01-01
Selection among alternative theoretical models given an observed dataset is an important challenge in many areas of physics and astronomy. Reversible-jump Markov chain Monte Carlo (RJMCMC) is an extremely powerful technique for performing Bayesian model selection, but it suffers from a fundamental difficulty and it requires jumps between model parameter spaces, but cannot efficiently explore both parameter spaces at once. Thus, a naive jump between parameter spaces is unlikely to be accepted in the Markov chain Monte Carlo (MCMC) algorithm and convergence is correspondingly slow. Here, we demonstrate an interpolation technique that uses samples from single-model MCMCs to propose intermodel jumps from an approximation to the single-model posterior of the target parameter space. The interpolation technique, based on a kD-tree data structure, is adaptive and efficient in modest dimensionality. We show that our technique leads to improved convergence over naive jumps in an RJMCMC, and compare it to other proposals in the literature to improve the convergence of RJMCMCs. We also demonstrate the use of the same interpolation technique as a way to construct efficient ‘global’ proposal distributions for single-model MCMCs without prior knowledge of the structure of the posterior distribution, and discuss improvements that permit the method to be used in higher dimensional spaces efficiently. PMID:26543580
Cancilla, M R; Powell, I B; Hillier, A J; Davidson, B E
1992-01-01
Arbitrarily primed polymerase chain reaction, with incorporation of either radioactive or fluorescent labels, was used as a rapid and sensitive method for obtaining genomic fingerprints of strains of Lactococcus lactis. Closely related strains produced almost identical fingerprints. Fingerprints of other strains showed only some similarities.
Directory of Open Access Journals (Sweden)
Jennifer A. Scoble
2013-10-01
Full Text Available A late preterm neonate born by cesarean section with intact membranes presented at 9 days of life with shock and liver failure. Surface cultures were negative but whole blood polymerase chain reaction was positive for herpes simplex virus type 2, underscoring the value of this test in early diagnosis of perinatally acquired disseminated herpes simplex virus infection without skin lesions.
Diagnostic value of polymerase chain reaction analysis of skin biopsies in purpura fulminans.
Beau, Caroline; Vlassova, Natalia; Sarlangue, Jean; Brissaud, Olivier; Léauté-Labrèze, Christine; Boralevi, Franck
2013-01-01
Even though prompt diagnosis and treatment of purpura fulminans (PF) is essential to reduce mortality, early administration of antibiotics may preclude identification of the causative agent by standard bacterial cultures and thus render definitive diagnosis impossible. Here we present a case of an infant with PF and negative bacterial cultures for whom polymerase chain reaction (PCR) analysis of a cutaneous biopsy specimen obtained 4 days after initiation of antibiotics identified the genomic sequence of Neisseria meningitidis genogroup C. When bacterial cultures fail to provide useful information, PCR of skin biopsy specimens can be a valuable diagnostic tool in PF. © 2013 Wiley Periodicals, Inc.
Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat
Directory of Open Access Journals (Sweden)
Carla Bertechini Faria
2012-03-01
Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.
Efficient Synthesis of Single-Chain Polymer Nanoparticles via Amide Formation
Directory of Open Access Journals (Sweden)
Ana Sanchez-Sanchez
2015-01-01
Full Text Available Single-chain technology (SCT allows the transformation of individual polymer chains to folded/collapsed unimolecular soft nanoparticles. In this work we contribute to the enlargement of the SCT toolbox by demonstrating the efficient synthesis of single-chain polymer nanoparticles (SCNPs via intrachain amide formation. In particular, we exploit cross-linking between active methylene groups and isocyanate moieties as powerful “click” chemistry driving force for SCNP construction. By employing poly(methyl methacrylate- (PMMA- based copolymers bearing β-ketoester units distributed randomly along the copolymer chains and bifunctional isocyanate cross-linkers, SCNPs were successfully synthesized at r.t. under appropriate reaction conditions. Characterization of the resulting SCNPs was carried out by means of a combination of techniques including size exclusion chromatography (SEC, infrared (IR spectroscopy, proton nuclear magnetic resonance (1H NMR spectroscopy, dynamic light scattering (DLS, and elemental analysis (EA.
Directory of Open Access Journals (Sweden)
Trioso Purnawarman
2014-04-01
Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.
Faggioli, F; Pasquini, G; Barba, M
1998-09-01
The diagnosis of plum pox virus (PPV) is still considered one of the most important aspects of the "sharka" problem. In fact, different studies demonstrated an uneven distribution of the virus in infected trees due to a high variability in virus concentration. These aspects complicate the PPV diagnosis. To date, biological, serological and molecular assays have been successively developed in order to obtain sensitive and efficient PPV detection techniques. In particular, the polymerase chain reaction (PCR) technique seems to be promising and can be considered the most sensitive and reliable one. Preparation of viral RNA is still a fundamental step in reverse transcription-PCR (RT-PCR) technique, especially when applied to large scale testing, i.e., for certification purposes. In order to find the most rapid and efficient procedure, we have compared three different procedures of extraction of viral RNA to be processed RT-PCR. Their common characteristics is their capacity to extract the RNA from a small amount of plant tissue without organic solvents in the extraction fluid. The procedures were as follows: an immuno-capture (IC) method using a specific antiserum, a silica-capture (SC) method using a non-specific matrix, and a simple and rapid RNA extraction (RE) method. They all were followed by one-tube RT-PCR. The obtained results show that all the three techniques allowed a successful amplification and detection of PPV in tested samples except the SC-PCR method which proved less effective. In fact, the IC-PCR and RE-PCR methods amplified and detected PPV in all isolates tested, while the SC-PCR method was able to reveal the presence of the virus in apricot and infected control samples only.
Directory of Open Access Journals (Sweden)
Gusti Ayu Yuniati Kencana
2013-07-01
Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.
Identifying of meat species using polymerase chain reaction (PCR)
International Nuclear Information System (INIS)
Foong, Chow Ming; Sani, Norrakiah Abdullah
2013-01-01
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing
Identifying of meat species using polymerase chain reaction (PCR)
Energy Technology Data Exchange (ETDEWEB)
Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)
2013-11-27
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.
A primer on on-demand polymerase chain reaction technology.
Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise
2015-10-01
Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie
2005-01-01
Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...
Rahpaya, Sayed Samim; Tsuchiaka, Shinobu; Kishimoto, Mai; Oba, Mami; Katayama, Yukie; Nunomura, Yuka; Kokawa, Saki; Kimura, Takashi; Kobayashi, Atsushi; Kirino, Yumi; Okabayashi, Tamaki; Nonaka, Nariaki; Mekata, Hirohisa; Aoki, Hiroshi; Shiokawa, Mai; Umetsu, Moeko; Morita, Tatsushi; Hasebe, Ayako; Otsu, Keiko; Asai, Tetsuo; Yamaguchi, Tomohiro; Makino, Shinji; Murata, Yoshiteru; Abi, Ahmad Jan; Omatsu, Tsutomu; Mizutani, Tetsuya
2018-05-31
Bovine abortion, diarrhea, and respiratory disease complexes, caused by infectious agents, result in high and significant economic losses for the cattle industry. These pathogens are likely transmitted by various vectors and reservoirs including insects, birds, and rodents. However, experimental data supporting this possibility are scarce. We collected 117 samples and screened them for 44 bovine abortive, diarrheal, and respiratory disease complex pathogens by using Dembo polymerase chain reaction (PCR), which is based on TaqMan real-time PCR. Fifty-seven samples were positive for at least one pathogen, including bovine viral diarrhea virus, bovine enterovirus, Salmonella enterica ser. Dublin, Salmonella enterica ser. Typhimurium, and Neospora caninum ; some samples were positive for multiple pathogens. Bovine viral diarrhea virus and bovine enterovirus were the most frequently detected pathogens, especially in flies, suggesting an important role of flies in the transmission of these viruses. Additionally, we detected the N. caninum genome from a cockroach sample for the first time. Our data suggest that insects (particularly flies), birds, and rodents are potential vectors and reservoirs of abortion, diarrhea, and respiratory infectious agents, and that they may transmit more than one pathogen at the same time.
International Nuclear Information System (INIS)
Kuznetsov, Yu L; Kalchenko, V V; Astaf'eva, N G; Meglinski, I V
2014-01-01
The capability of using the laser speckle contrast imaging technique with a long exposure time for visualisation of primary acute skin vascular reactions caused by a topical application of a weak contact allergen is considered. The method is shown to provide efficient and accurate detection of irritant-induced primary acute vascular reactions of skin. The presented technique possesses a high potential in everyday diagnostic practice, preclinical studies, as well as in the prognosis of skin reactions to the interaction with potentially allergenic materials. (laser biophotonics)
Energy Technology Data Exchange (ETDEWEB)
Kuznetsov, Yu L; Kalchenko, V V [Department of Veterinary Resources, Weizmann Institute of Science, Rehovot, 76100 (Israel); Astaf' eva, N G [V.I.Razumovsky Saratov State Medical University, Saratov (Russian Federation); Meglinski, I V [N.G. Chernyshevsky Saratov State University, Saratov (Russian Federation)
2014-08-31
The capability of using the laser speckle contrast imaging technique with a long exposure time for visualisation of primary acute skin vascular reactions caused by a topical application of a weak contact allergen is considered. The method is shown to provide efficient and accurate detection of irritant-induced primary acute vascular reactions of skin. The presented technique possesses a high potential in everyday diagnostic practice, preclinical studies, as well as in the prognosis of skin reactions to the interaction with potentially allergenic materials. (laser biophotonics)
DEFF Research Database (Denmark)
Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld
2007-01-01
Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage,......, and this feature is relevant in investigating RHD mosaicism and chimerism....
Comparison of isoelectric focusing and polymerase chain reaction for the detection of β-lactamases
Directory of Open Access Journals (Sweden)
Sharma J
2010-01-01
Full Text Available Extended spectrum β-lactamases (ESBLs have been observed in virtually all the species of family Enterobacteriaceae. Threat posed by antibiotic resistance because of ESBLs is more serious as a number of technical problems are associated with the detection of these enzymes. Although a number of detection methods have been designed for ESBLs, every method has its own benefits and shortcomings as well. In earlier days, isoelectric focusing (IEF was used as the gold standard for ESBL detection. This study was undertaken to compare IEF with polymerase chain reaction, a method which has been extensively used for ESBL detection these days.
Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo
2018-04-01
Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.
Directory of Open Access Journals (Sweden)
Sánchez A.
2004-01-01
Full Text Available Due to the widely supported theory of bovine spongiform encephalopathy (BSE spread in cattle by contaminated animal feeds, screening of feed products has become essential. For many years, manufacturers have used blood and plasma proteins as high quality ingredients of foods for both pets and farm animals. However, in Europe, the Commission Regulation 1234/2003/EC temporally bans the use of processed animal proteins, including blood-derivative products, in feedstuffs for all farm animals which are fattened or bred for the production of food. This regulation has some exceptions, such as the use of non ruminant blood products into the feed of farm fish. Authorization of the re-introduction of these proteins into animal feed formulations, especially non ruminant proteins into the feed for non ruminant farm animals, is expected when adequate control methods to discriminate ruminant proteins exist. Currently, the number of validated methods to differentiate the species of origin for most of the animal by-products is limited. Here we report the development of a rapid and sensitive polymerase chain reaction (PCR-based assay, which allows detection of bovine or porcine specific mitochondrial DNAfrom spray-dried blood derivate products (plasma, whole blood and red cells, as a marker for bovine contamination in porcine products. Sample extracts, suitable for PCR, were easily and quickly obtained with the commercial PrepManTM Ultra reagent (Applied Biosystems. To confirm the porcine origin of the samples, primers targeting a specific region of 134 bp of the porcine cytochrome b coding sequence were designed (cytbporc1-F and cytbporc2-R. Previously published PCR primers (L8129 and H8357, specific for a 271 bp fragment of the bovine mitochondrial ATPase 8-ATPase 6 genes, were chosen to accomplish amplification of bovine DNA. The limit of detection (LOD of the bovine PCR assay was at least of 0.05% (v/v of bovine inclusion in spray-dried porcine plasma or red
Directory of Open Access Journals (Sweden)
J. C. Santos
2008-06-01
Full Text Available The determination of conversion during suspension polymerization reactions is not an easy task due to the heterogeneity of the reaction medium and the tendency of particles to agglomerate rapidly when stirring is stopped. Usually, bulk polymerization in ampoules is employed to study the kinetics of suspension polymerization reactions. In this work, a comparison of different techniques for the determination of conversion during suspension polymerization reactions is presented. Results showed a good agreement between the conversion obtained by gravimetry during styrene suspension polymerization and on-line conversion monitoring data using fiber-optic based Raman Spectroscopy. Nevertheless, the polymerization rate of styrene bulk polymerization carried out in ampoules was higher than the real reaction rate of styrene suspension polymerization due to slightly higher reaction temperatures. Simulation results using the experimental temperature data in a mathematical model confirmed these results.
Directory of Open Access Journals (Sweden)
Natalie M. Hughes
2014-01-01
Full Text Available We reviewed 153 peer-reviewed sources to provide identification of modern supply chain management techniques and exploration of supply chain modeling, to offer decision support to managers. Ultimately, the review is intended to assist member-companies of supply chains, mainly producers, improve their current management approaches, by directing them to studies that may be suitable for direct application to their supply chains and value chains for improved efficiency and profitability. We found that information on supply chain management and modeling techniques in general is available. However, few Canadian-based published studies exist regarding a demand-driven modeling approach to value/supply chain management for wood pellet production. Only three papers were found specifically on wood pellet value chain analysis. We propose that more studies should be carried out on the value chain of wood pellet manufacturing, as well as demand-driven management and modeling approaches with improved demand forecasting methods.
Directory of Open Access Journals (Sweden)
Goutsias John
2010-05-01
Full Text Available Abstract Background Sensitivity analysis is an indispensable tool for the analysis of complex systems. In a recent paper, we have introduced a thermodynamically consistent variance-based sensitivity analysis approach for studying the robustness and fragility properties of biochemical reaction systems under uncertainty in the standard chemical potentials of the activated complexes of the reactions and the standard chemical potentials of the molecular species. In that approach, key sensitivity indices were estimated by Monte Carlo sampling, which is computationally very demanding and impractical for large biochemical reaction systems. Computationally efficient algorithms are needed to make variance-based sensitivity analysis applicable to realistic cellular networks, modeled by biochemical reaction systems that consist of a large number of reactions and molecular species. Results We present four techniques, derivative approximation (DA, polynomial approximation (PA, Gauss-Hermite integration (GHI, and orthonormal Hermite approximation (OHA, for analytically approximating the variance-based sensitivity indices associated with a biochemical reaction system. By using a well-known model of the mitogen-activated protein kinase signaling cascade as a case study, we numerically compare the approximation quality of these techniques against traditional Monte Carlo sampling. Our results indicate that, although DA is computationally the most attractive technique, special care should be exercised when using it for sensitivity analysis, since it may only be accurate at low levels of uncertainty. On the other hand, PA, GHI, and OHA are computationally more demanding than DA but can work well at high levels of uncertainty. GHI results in a slightly better accuracy than PA, but it is more difficult to implement. OHA produces the most accurate approximation results and can be implemented in a straightforward manner. It turns out that the computational cost of the
Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.
2015-07-01
Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.
Siqueira, José F; Rôças, Isabela N
2003-08-01
Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and
Angers, M; Cloutier, J F; Castonguay, A; Drouin, R
2001-08-15
Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.
DEFF Research Database (Denmark)
Alifrangis, Michael; Enosse, Sonia; Pearce, Richard
2005-01-01
Single nucleotide polymorphisms (SNPs) in the Plasmodium falciparum dihydrofolate reductase (dhfr), and dihydropteroate synthetase (dhps), and chloroquine resistance transporter (Pfcrt) genes are used as molecular markers of P. falciparum resistance to sulfadoxine/pyrimethamine and chloroquine....... However, to be a practical tool in the surveillance of drug resistance, simpler methods for high-throughput haplotyping are warranted. Here we describe a quick and simple technique that detects dhfr, dhps, and Pfcrt SNPs using polymerase chain reaction (PCR)- and enzyme-linked immunosorbent assay (ELISA...
International Nuclear Information System (INIS)
Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.
1994-01-01
A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma gene using histological sections from radiation-induced and spontaneous tumors as the DNA source. Six mouse Rb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mouse Rb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (5.69 Gy 60 Co γ rays or 0.6 Gy JANUS neutrons, which have been found to have approximately equal radiobiological effectiveness) were analyzed for mouse Rb deletions. Tumors in 6 neutron-irradiated mice had no mouse Rb deletions. However, 1 of 6 tumors from γ-irradiated mice (17%) and 6 of 18 spontaneous tumors from unirradiated mice (33%) showed a deletion in one or both mouse Rb alleles. All deletions detected were in the 5' region of the mouse Rb gene. 36 refs., 2 figs., 2 tabs
Directory of Open Access Journals (Sweden)
Maria Cesarina Abete
2013-04-01
Full Text Available Lifting of the ban on the use of processed animal proteins (PAPs from non-ruminants in non-ruminant feed is in the wind, avoiding intraspecies recycling. Discrimination of species will be performed through polymerase chain reaction (PCR, which is at a moment a merely qualitative method. Nevertheless, quantification of PAPs in feed is needed. The aim of this study was to approach the quantitative determination of PAPs in feed through Real Time (RT-PCR technique; three different protocols picked up from the literature were tested. Three different kind of matrices were examined: pure animal meals (bovine, chicken and pork; one feed sample certified by the European reference laboratory on animal proteins (EURL AP in feed spiked with 0.1% bovine meal; and genomic DNAs from bovine, chicken and pork muscles. The limit of detection (LOD of the three protocols was set up. All the results obtained from the three protocols considered failed in the quantification process, most likely due to the uncertain copy numbers of the analytical targets chosen. This preliminary study will allow us to address further investigations, with the purpose of developing a RT-PCR quantitative method.
Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis
Directory of Open Access Journals (Sweden)
Anupam Berwal
2017-01-01
Full Text Available Tuberculous meningitis (TBM is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1% patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM.
Grases, F; Forteza, R; March, J G; Cerda, V
1985-02-01
A very simple reaction-rate thermometric technique is used for determination of iodide (5-20 ng ml ), based on its catalytic action on the cerium(IV)-arsenic(III) reaction, and for determination of mercury(II) (1.5-10 ng ml ) and silver(I) (2-10 ng ml ), based on their inhibitory effect on this reaction. The reaction is followed by measuring the rate of temperature increase. The method suffers from very few interferences and is applied to determination of iodide in biological and inorganic samples, and Hg(II) and Ag(I) in pharmaceutical products.
DEFF Research Database (Denmark)
Helmig, Sarah Wendelbo; Gothelf, Kurt Vesterager
2017-01-01
transfer between two connected DNA nanostructures, using the hybridization chain reaction (HCR). Two sets of metastable DNA hairpins - of which one is immobilized in specific points along tracks on DNA origami structures - are polymerized to form a continuous DNA duplex, which is visible using atomic force...... microscopy (AFM). Upon addition of a designed initiator, the initiation signal is efficiently transferred >200 nm from a specific location on one origami structure to an end point on another origami structure. The system shows no significant loss of signal when crossing from one nanostructure to another...
γ-Particle coincidence technique for the study of nuclear reactions
Zagatto, V. A. B.; Oliveira, J. R. B.; Allegro, P. R. P.; Chamon, L. C.; Cybulska, E. W.; Medina, N. H.; Ribas, R. V.; Seale, W. A.; Silva, C. P.; Gasques, L. R.; Zahn, G. S.; Genezini, F. A.; Shorto, J. M. B.; Lubian, J.; Linares, R.; Toufen, D. L.; Silveira, M. A. G.; Rossi, E. S.; Nobre, G. P.
2014-06-01
The Saci-Perere γ ray spectrometer (located at the Pelletron AcceleratorLaboratory - IFUSP) was employed to implement the γ-particle coincidence technique for the study of nuclear reaction mechanisms. For this, the 18O+110Pd reaction has been studied in the beam energy range of 45-54 MeV. Several corrections to the data due to various effects (energy and angle integrations, beam spot size, γ detector finite size and the vacuum de-alignment) are small and well controlled. The aim of this work was to establish a proper method to analyze the data and identify the reaction mechanisms involved. To achieve this goal the inelastic scattering to the first excited state of 110Pd has been extracted and compared to coupled channel calculations using the São Paulo Potential (PSP), being reasonably well described by it.
γ-Particle coincidence technique for the study of nuclear reactions
Energy Technology Data Exchange (ETDEWEB)
Zagatto, V.A.B., E-mail: vinicius.zagatto@gmail.com [Instituto de Física da Universidade de São Paulo (Brazil); Oliveira, J.R.B.; Allegro, P.R.P.; Chamon, L.C.; Cybulska, E.W.; Medina, N.H.; Ribas, R.V.; Seale, W.A.; Silva, C.P.; Gasques, L.R. [Instituto de Física da Universidade de São Paulo (Brazil); Zahn, G.S.; Genezini, F.A.; Shorto, J.M.B. [Instituto de Pesquisas Energéticas e Nucleares (Brazil); Lubian, J.; Linares, R. [Instituto de Física da Universidade Federal Fluminense (Brazil); Toufen, D.L. [Instituto Federal de Educação, Ciência e Tecnologia (Brazil); Silveira, M.A.G. [Centro Universitário da FEI (Brazil); Rossi, E.S. [Centro Universitário FIEO – UNIFIEO (Brazil); Nobre, G.P. [Lawrence Livermore National Laboratory (United States)
2014-06-01
The Saci-Perere γ ray spectrometer (located at the Pelletron AcceleratorLaboratory – IFUSP) was employed to implement the γ-particle coincidence technique for the study of nuclear reaction mechanisms. For this, the {sup 18}O+{sup 110}Pd reaction has been studied in the beam energy range of 45–54 MeV. Several corrections to the data due to various effects (energy and angle integrations, beam spot size, γ detector finite size and the vacuum de-alignment) are small and well controlled. The aim of this work was to establish a proper method to analyze the data and identify the reaction mechanisms involved. To achieve this goal the inelastic scattering to the first excited state of {sup 110}Pd has been extracted and compared to coupled channel calculations using the São Paulo Potential (PSP), being reasonably well described by it.
DNA polymorphism of butyrophilin gene by PCR-RFLP technique ...
African Journals Online (AJOL)
We used the polymerase chain reaction-restriction fragment length polymorphism (PCRRFLP) technique to screen for DNA polymorphism in 109 cattle. In all cattle, we amplified an 863 fragment consisting of part of exon 8. The amplified fragment digested with HaeIII restriction endonuclease and subjected to electrophoretic ...
Directory of Open Access Journals (Sweden)
Valdes R. Bollela
1999-06-01
Full Text Available OBJETIVO: Padronizar reação em cadeia da polimerase para diagnóstico de tuberculose pulmonar, comparando os resultados obtidos com as técnicas microbiológicas clássicas, e analisar seu uso numa região de alta prevalência da tuberculose. MÉTODOS: Foram descontaminadas, após a baciloscopia, 42 amostras de escarro de pacientes. Em seguida, procedeu-se ao cultivo em Lowenstein-Jensen e à reação em cadeia da polimerase com "primers" que amplificam um fragmento de 123 pares de base do genoma do Mycobacterium tuberculosis. RESULTADOS: Das 42 amostras de escarro, 10 apresentaram cultura positiva para M. tuberculosis. Dez foram positivas à baciloscopia e 16 mostraram-se positivas na reação em cadeia da polimerase. A sensibilidade e especificidade do teste em relação à cultura foi de 90% e 81%, respectivamente. CONCLUSÕES: A reação em cadeia da polimerase tem sensibilidade comparável à da cultura e pode ser realizada em apenas um dia, resultando em tratamento precoce e melhor controle da doença. A padronização e avaliação de técnicas de biologia molecular no diagnóstico da tuberculose no Brasil é imprescindível na discussão da implantação deste exame na rotina diagnóstica em centros de referência.INTRODUCTION: The recent increase in the number of tuberculosis cases has called the world's attention once again to a perennial health problem, especially prevalent in developing countries. The time elapsed between the diagnosis and the institution of therapy is an obstacle to tuberculosis control and there is an urgent need for the development of techniques for the disease's rapid diagnosis. To achieve this goal, molecular biology techniques have been exhaustively investigated. This work describes the use of a polymerase chain reaction for rapid diagnosis of tuberculosis in a developing country. The sensitivity and specificity of this technique is compared to standard techniques used in the microbiology laboratory. METHODS
Performance of an HF chain-reaction laser with high initiation efficiency
International Nuclear Information System (INIS)
Whittier, J.S.; Kerber, R.L.
1974-01-01
Output-pulse observations are presented for a transverse electrically initiated, helium-diluted HF laser pumped by the H 2 + F 2 chain reaction. Performance of this laser is studied over a wide range of the gas composition and for initial pressures between 0.1 and 0.5 atm. The gas mixture was stabilized by premixing O 2 , F 2 , and He and flowing this mixture into a cold trap (84 0 K) before mixing with H 2 . Optimum conversion of electrical-initiation energy into laser energy was found for a 240-torr mixture with a mole ratio 1 F 2 :0.23 H 2 :0.08 O 2 :12 He which, when initiated with a 25-kV, 333-pF discharge, gave a pulse energy of 0.150 J. This corresponds to a ratio of laser output energy to electrical input energy of 144 percent. After unnecessary losses are taken into account, this ratio becomes 160 percent. (U.S.)
Detecting beef meatball contamination with polymerase chain reaction
Directory of Open Access Journals (Sweden)
Hoda A.
2017-10-01
Full Text Available The objective of the study was to describe how much rat and swine primer developed from cytochrome b could detect rat and pork in processed beef products sold in North Maluku. The settings of the study were the traditional markets and supermarkets in several cities in North Maluku such as Ternate, Tidore Kepulauan, West Halmahera, North Halmahera, Central Halmahera, South Halmahera, East Halmahera, Sula Island and Morotai Island. The data collection lasted between May and June, 2015. The samples were analyzed in the Biotechnology Lab of Unkhair in July, 2015. To detect rat and swine DNA, the researchers used the PCR (Polymerase Chain Reaction method with Top Taq master mix Kit kit (250 (Catalog no. 200403 Swine Primer: Forward: 5'CTA CAT AAG ATAT ATC CAC CAC A 3 'Reverse: 5' ACA TTG TGG GAT CTT CTA GGT 3 'Product size: 290 bp. Rat Primer: forward SIM (5'-GACCTCCCAGCTCCATCAAACATCTCATCTTGATGAAA-3'. Reverse (5'GAATGGGATTTT GTTGGAGTTT-3 '. Out of 41 samples, sample 3, 4 and 5 taken in Jailolo contained rat DNA (positive; the samples were amplified with 499 base pair length (bp. In addition, sample 2, 7, 8 and 10 from Ternate as well as sample 4 from Morotai Island was also found positive (containing rat DNA. In terms of swine DNA, all of the samples came back negative. The amplification showed that none of the meatball samples contained pork. No pig DNA was amplified in the gel.
Normalised quantitative polymerase chain reaction for diagnosis of tuberculosis-associated uveitis.
Barik, Manas Ranjan; Rath, Soveeta; Modi, Rohit; Rana, Rajkishori; Reddy, Mamatha M; Basu, Soumyava
2018-05-01
Polymerase chain reaction (PCR)-based diagnosis of tuberculosis-associated uveitis (TBU) in TB-endemic countries is challenging due to likelihood of latent mycobacterial infection in both immune and non-immune cells. In this study, we investigated normalised quantitative PCR (nqPCR) in ocular fluids (aqueous/vitreous) for diagnosis of TBU in a TB-endemic population. Mycobacterial copy numbers (mpb64 gene) were normalised to host genome copy numbers (RNAse P RNA component H1 [RPPH1] gene) in TBU (n = 16) and control (n = 13) samples (discovery cohort). The mpb64:RPPH1 ratios (normalised value) from each TBU and control sample were tested against the current reference standard i.e. clinically-diagnosed TBU, to generate Receiver Operating Characteristic (ROC) curves. The optimum cut-off value of mpb64:RPPH1 ratio (0.011) for diagnosing TBU was identified from the highest Youden index. This cut-off value was then tested in a different cohort of TBU and controls (validation cohort, 20 cases and 18 controls), where it yielded specificity, sensitivity and diagnostic accuracy of 94.4%, 85.0%, and 89.4% respectively. The above values for conventional quantitative PCR (≥1 copy of mpb64 per reaction) were 61.1%, 90.0%, and 74.3% respectively. Normalisation markedly improved the specificity and diagnostic accuracy of quantitative PCR for diagnosis of TBU. Copyright © 2018 Elsevier Ltd. All rights reserved.
Lalam, N.; Jacob, C.
2007-01-01
The aim of Quantitative Polymerase Chain Reaction is to determine the initial amount X0 of specific nucleic acids from an observed trajectory of the amplification process, the amplification being achieved through successive replication cycles. This process depends on the efficiency fpngn of
Wu, Jinbo
2012-11-20
Microdroplets offer unique compartments for accommodating a large number of chemical and biological reactions in tiny volume with precise control. A major concern in droplet-based microfluidics is the difficulty to address droplets individually and achieve high throughput at the same time. Here, we have combined an improved cartridge sampling technique with a microfluidic chip to perform droplet screenings and aggressive reaction with minimal (nanoliter-scale) reagent consumption. The droplet composition, distance, volume (nanoliter to subnanoliter scale), number, and sequence could be precisely and digitally programmed through the improved sampling technique, while sample evaporation and cross-contamination are effectively eliminated. Our combined device provides a simple model to utilize multiple droplets for various reactions with low reagent consumption and high throughput. © 2012 American Chemical Society.
Lower-Order Compensation Chain Threshold-Reduction Technique for Multi-Stage Voltage Multipliers.
Dell' Anna, Francesco; Dong, Tao; Li, Ping; Wen, Yumei; Azadmehr, Mehdi; Casu, Mario; Berg, Yngvar
2018-04-17
This paper presents a novel threshold-compensation technique for multi-stage voltage multipliers employed in low power applications such as passive and autonomous wireless sensing nodes (WSNs) powered by energy harvesters. The proposed threshold-reduction technique enables a topological design methodology which, through an optimum control of the trade-off among transistor conductivity and leakage losses, is aimed at maximizing the voltage conversion efficiency (VCE) for a given ac input signal and physical chip area occupation. The conducted simulations positively assert the validity of the proposed design methodology, emphasizing the exploitable design space yielded by the transistor connection scheme in the voltage multiplier chain. An experimental validation and comparison of threshold-compensation techniques was performed, adopting 2N5247 N-channel junction field effect transistors (JFETs) for the realization of the voltage multiplier prototypes. The attained measurements clearly support the effectiveness of the proposed threshold-reduction approach, which can significantly reduce the chip area occupation for a given target output performance and ac input signal.
Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Radji, M.
2010-01-01
Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.
Ayatollahi, Hossein; Fani, Azar; Ghayoor Karimiani, Ehsan; Homaee, Fateme; Shajiei, Arezoo; Sheikh, Maryam; Shakeri, Sepideh; Shams, Seyyede Fatemeh
2017-01-01
The assessment of human epidermal growth factor receptor 2 (HER2) status has become of great importance in the diagnosis of breast cancer. The aim of this study was to investigate the diagnostic value of quantitative Polymerase Chain Reaction (qPCR) and Chromogenic In Situ Hybridization (CISH) to assess HER2 status of biopsy specimens. To elucidate the status of HER2 gene amplification, biopsies of breast carcinoma from 120 patients with 2+ IHC status were analyzed by qPCR and CISH. The results of the two experiments were compared, and it was depicted that the concordance rate between CISH and qPCR assays was 88.1%.The quantification of HER2 gene with CISH and qPCR showed that there was a significant correlation (p value= 0.0001 and r= 0.808). The results of this research support the idea that qPCR is a precise and reproducible technique, which can be employed as a supplementary method to evaluate HER2 status.
Campos, Ivón M.; Uribe, Mary L.; Cuesta, Carolina; Franco-Gallego, Alexander; Carmona-Fonseca, Jaime; Maestre, Amanda
2011-01-01
The technical capability of different methods to diagnose Plasmodium in maternal peripheral blood, placenta, and umbilical cord blood has not been assessed in Colombia and seldom explored in other malaria-endemic regions. We designed a study to compare the technical and the operational-economical performances of light microscopy (LM), nested polymerase chain reaction (nPCR), and histopathology (HP). In maternal blood, LM had 41% sensitivity and 100% specificity and in placental blood, 35% and 100%, respectively, compared with nPCR. In placental tissue, LM had 33% sensitivity and 95% specificity; and nPCR 47% and 77%, respectively; compared with HP. Light microscopy had the best operational-economical qualification. We concluded that nPCR and HP performed better compared with LM, but field implementation of these two techniques remains a problem. Therefore, LM is recommended as the gold standard for diagnosis of gestational malaria and placental blood infection in the field. PMID:21633030
Real-time ligation chain reaction for DNA quantification and identification on the FO-SPR.
Knez, Karel; Spasic, Dragana; Delport, Filip; Lammertyn, Jeroen
2015-05-15
Different assays have been developed in the past years to meet point-of-care diagnostic tests requirements for fast and sensitive quantification and identification of targets. In this paper, we developed the ligation chain reaction (LCR) assay on the Fiber Optic Surface Plasmon Resonance (FO-SPR) platform, which enabled simultaneous quantification and cycle-to-cycle identification of DNA during amplification. The newly developed assay incorporated FO-SPR DNA melting assay, previously developed by our group. This required establishment of several assay parameters, including buffer ionic strength and thermal ramping speed as these parameters both influence the ligation enzyme performance and the hybridization yield of the gold nanoparticles (Au NPs) on the FO-SPR sensor. Quantification and identification of DNA targets was achieved over a wide concentration range with a calibration curve spanning 7 orders of magnitude and LOD of 13.75 fM. Moreover, the FO-SPR LCR assay could discriminate single nucleotide polymorphism (SNPs) without any post reaction analysis, featuring thus all the essential requirements of POC tests. Copyright © 2014 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Efunshile, Michael A; Ngwu, Bethrand A F; Kurtzhals, Jørgen A L
2015-01-01
Diarrhea remains the second largest killer of children worldwide, and Nigeria ranks number two on the list of global deaths attributable to diarrhea. Meanwhile, prevalence studies on potentially diarrheagenic protozoa in asymptomatic carriers using molecular detection methods remain scarce in sub......-Saharan countries. To overcome sensitivity issues related to microscopic detection and identification of cysts in stool concentrates, real-time polymerase chain reaction (PCR) was used to analyze genomic DNAs extracted from stool samples from 199 healthy school children for Entamoeba histolytica, E. dispar, Giardia...
Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.
The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of
DEFF Research Database (Denmark)
Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen
2011-01-01
Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...
Ma, Yanlin; Deng, Yang; Xu, Zhenbo; Liu, Junyan; Dong, Jianjun; Yin, Hua; Yu, Junhong; Chang, Zongming; Wang, Dongfeng
The spoilage of beer by bacteria is of great concern to the brewer as this can lead to turbidity and abnormal flavors. The polymerase chain reaction (PCR) method for detection of beer-spoilage bacteria is highly specific and provides results much faster than traditional microbiology techniques. However, one of the drawbacks is the inability to differentiate between live and dead cells. In this paper, the combination of propidium monoazide (PMA) pretreatment and conventional PCR had been described. The established PMA-PCR identified beer spoilage Lactobacillus brevis based not on their identity, but on the presence of horA gene which we show to be highly correlated with the ability of beer spoilage LAB to grow in beer. The results suggested that the use of 30μg/mL or less of PMA did not inhibit the PCR amplification of DNA derived from viable L. brevis cells. The minimum amount of PMA to completely inhibit the PCR amplification of DNA derived from dead L. brevis cells was 2.0μg/mL. The detection limit of PMA-PCR assay described here was found to be 10 colony forming units (CFU)/reaction for the horA gene. Moreover, the horA-specific PMA-PCR assays were subjected to 18 reference isolates, representing 100% specificity with no false positive amplification observed. Overall the use of horA-specific PMA-PCR allows for a substantial reduction in the time required for detection of potential beer spoilage L. brevis and efficiently differentiates between viable and nonviable cells. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Directory of Open Access Journals (Sweden)
Herintha Coeto Neitzke-Abreu
Full Text Available Cutaneous leishmaniasis (CL can occur in skin and mucosa, causing disfiguring lesions. The laboratory diagnosis of CL involves immunological methods and optical detection of the parasite, al of which have limitations. There is a need for more effective diagnostic methods for CL which wil allow treatment to be initiated more promptly in order to help prevent the development of severe forms of mucosal disease, and to estimate the prognosis of the infection. The polymerase chain reaction (PCR has been widely used to diagnose CL, because of its higher sensitivity. This study estimated the accuracy and compared PCRs of samples from lesion scarification (PCR-L and blood sample-enriched leukocytes (PCR-B with three conventional diagnostic techniques: parasite direct search (DS, Montenegro skin test (MST, and indirect immunofluorescence reaction (IIF. The study included 276 patients under suspicion of CL. We conducted a cross-sectional study, in which patients were selected by convenience sampling. We used MP3H/MP1L primers to generate a Leishmania (Viannia (minicircle kDNA fragment of 70-bp. Of 106 patients with CL, 83.87%, 51.67%, 64.52%, 85.71%, or 96.10% tested positive by PCR-L, PCR-B, DS, IIF, or MST, respectively. Five patients tested positive only by PCR-L, and two other patients only by PCR-B. PCR-L is indicated for use in patients with chronic lesions or Leishmania reinfection, which may progress to mucosal lesion. PCR-B is indicated for use in patients with negative results in conventional tests or for patients with no apparent lesion. PCR is not only useful in diagnosing CL but also helps to identify the infecting species.
Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V
2000-12-01
ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.
Directory of Open Access Journals (Sweden)
Yuny Erwanto
2014-10-01
Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.
Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul
2014-10-01
This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.
Directory of Open Access Journals (Sweden)
Dastur P
2004-01-01
Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.
Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D
1995-06-01
A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.
Single-molecule detection of dihydroazulene photo-thermal reaction using break junction technique
Huang, Cancan; Jevric, Martyn; Borges, Anders; Olsen, Stine T.; Hamill, Joseph M.; Zheng, Jue-Ting; Yang, Yang; Rudnev, Alexander; Baghernejad, Masoud; Broekmann, Peter; Petersen, Anne Ugleholdt; Wandlowski, Thomas; Mikkelsen, Kurt V.; Solomon, Gemma C.; Brøndsted Nielsen, Mogens; Hong, Wenjing
2017-05-01
Charge transport by tunnelling is one of the most ubiquitous elementary processes in nature. Small structural changes in a molecular junction can lead to significant difference in the single-molecule electronic properties, offering a tremendous opportunity to examine a reaction on the single-molecule scale by monitoring the conductance changes. Here, we explore the potential of the single-molecule break junction technique in the detection of photo-thermal reaction processes of a photochromic dihydroazulene/vinylheptafulvene system. Statistical analysis of the break junction experiments provides a quantitative approach for probing the reaction kinetics and reversibility, including the occurrence of isomerization during the reaction. The product ratios observed when switching the system in the junction does not follow those observed in solution studies (both experiment and theory), suggesting that the junction environment was perturbing the process significantly. This study opens the possibility of using nano-structured environments like molecular junctions to tailor product ratios in chemical reactions.
Chain reaction. History of the atomic bomb; Kettenreaktion. Die Geschichte der Atombombe
Energy Technology Data Exchange (ETDEWEB)
Mania, Hubert
2010-07-01
Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)
Oyarzún, Bernardo; Mognetti, Bortolo Matteo
2018-03-01
We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.
Rapid establishment of polymerase chain reaction-restriction ...
African Journals Online (AJOL)
RFLP) optimization reaction system for cpDNA in tea [Camellia sinensis (L.) O. Kuntze] was rapidly established. Results show that the optimal PCR reaction system was 100 ng template DNA, 200 μmolL-1 dNTPs, 1.5 mmolL-1 MgCl2, 50 ng primer, ...
Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada
2009-01-01
A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.
DEFF Research Database (Denmark)
Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard
2015-01-01
Background. Isolation of patients suspected for pulmonary tuberculosis is guided by serial sputum smears. This can result in isolation for days for patients with noncontagious tuberculosis. To determine whether a single sample negative for Mycobacterium tuberculosis complex at polymerase chain...... reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days...... before or after the initial culture-positive sample. We repeated the process for those with ≥2 samples within 28 days. The primary outcome was PCR-negative, smear-positive patients. Results. We included 53 533 sputum samples from 20 928 individuals; 1636 had culture-confirmed tuberculosis. Of these, 856...
Hughes, Natalie M.; Shahi, Chander; Pulkki, Reino
2014-01-01
We reviewed 153 peer-reviewed sources to provide identification of modern supply chain management techniques and exploration of supply chain modeling, to offer decision support to managers. Ultimately, the review is intended to assist member-companies of supply chains, mainly producers, improve their current management approaches, by directing them to studies that may be suitable for direct application to their supply chains and value chains for improved efficiency and profitability. We found...
The Forward-Reverse Algorithm for Stochastic Reaction Networks
Bayer, Christian
2015-01-07
In this work, we present an extension of the forward-reverse algorithm by Bayer and Schoenmakers [2] to the context of stochastic reaction networks (SRNs). We then apply this bridge-generation technique to the statistical inference problem of approximating the reaction coefficients based on discretely observed data. To this end, we introduce a two-phase iterative inference method in which we solve a set of deterministic optimization problems where the SRNs are replaced by the classical ODE rates; then, during the second phase, the Monte Carlo version of the EM algorithm is applied starting from the output of the previous phase. Starting from a set of over-dispersed seeds, the output of our two-phase method is a cluster of maximum likelihood estimates obtained by using convergence assessment techniques from the theory of Markov chain Monte Carlo.
Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui
2016-05-01
In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.
Kinetics of the chain uranium decay
International Nuclear Information System (INIS)
Zel'dovich, Ya.B.; Khariton, Yu.B.
1984-01-01
The development of chain reaction in uranium mass, when passing through the mass critical value, is studied. It is shown that thermal expanson is a powerful regulating factor, making the limit passing quite safe. The case of convergence of two uranium masses of precritical dimensions is considered in particular. The critical mass value is assessed and it is shown that its gradual increase above the critical value results in the reaction vibrational regime with the period inversely proportional to the square root of uranium supply rate. The role of delaying neutrons in the fission chain reaction development is pointed out
Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon
2014-01-01
The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069
Khan, S; Miah, M R; Khatun, S
2015-12-01
A nested polymerase chain reaction (PCR) specific for Salmonella enterica subspecies enteric serovar Typhi was used for the detection of the pathogen, in blood. This study was done during the period of March 2013 to February 2014. A total of 80 clinically suspected cases of typhoid fever were included in the study. Blood was collected from all participating individuals. Nested PCR targeting the flagellin gene (fliC) of Salmonella Typhi & blood culture were done for each of the cases. The positivity rate of PCR & blood culture was 70%& 20% respectively. The positivity rate of PCR was significantly higher than blood culture (Ptyphoid fever cases on the basis of clinical features but with negative cultures. We conclude that the PCR technique could be used as a novel diagnostic method of typhoid fever, particularly in culture-negative cases in an endemic country like Bangladesh.
Alexander, C L; Shankland, G S; Carman, W; Williams, C
2011-05-01
Dermatophytes are the major cause of superficial mycoses in samples submitted to Clinical Mycology, Glasgow. The most prevalent species is Trichophyton rubrum as identified classically by microscopy and culture. Recent advances in polymerase chain reaction (PCR) technology were examined for the feasibility of introducing a T. rubrum real-time PCR assay into a routine diagnostic service. To improve the diagnostic mycology service by the introduction of a real-time PCR test for T. rubrum. The DNA from 4972 nail and skin samples was obtained using the Qiagen QIAsymphony automated extractor. This DNA was subjected to real-time PCR using T. rubrum-specific primers and a probe. During phase 1 of the study, 862 samples were analysed; 446 of 470 specimens that grew T. rubrum were detected by PCR. Out of 4110 samples analysed during phase 2, 753 T. rubrum infections were diagnosed and reported within 72 h. A total of 3357 samples were negative for a fungal infection by PCR and microscopy; these were also reported within 72 h. A vast reduction in the turnaround times can be achieved using this technique as opposed to classical methods. Samples which are PCR negative but microscopy positive are still subjected to culture. Screening samples for their suitability for PCR prior to processing eliminates the application of PCR for T. rubrum on inappropriate samples such those from the scalp or pityriasis versicolor. © 2011 The Authors. BJD © 2011 British Association of Dermatologists.
Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom
2015-01-01
This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449
Ourailidou, Maria E; Dockerty, Paul; Witte, Martin; Poelarends, Gerrit J; Dekker, Frank J
2015-01-01
The detection of protein lysine acylations remains a challenge due to lack of specific antibodies for acylations with various chain lengths. This problem can be addressed by metabolic labeling techniques using carboxylates with reactive functionalities. Subsequent chemoselective reactions with a
Kakitani, Yoshinori; Fujii, Ritsuko; Hayakawa, Yoshihiro; Kurahashi, Masahiro; Koyama, Yasushi; Harada, Jiro; Shimada, Keizo
2007-06-19
Rubrivivax gelatinosus having both the spheroidene and spirilloxanthin biosynthetic pathways produces carotenoids (Cars) with a variety of conjugated chains, which consist of different numbers of conjugated double bonds (n), including the C=C (m) and C=O (o) bonds. When grown under anaerobic conditions, the wild type produces Cars for which n = m = 9-13, whereas under semiaerobic conditions, it additionally produces Cars for which n = m + o = 10 + 1, 13 + 1, and 13 + 2. On the other hand, a mutant, in which the latter pathway is genetically blocked, produces only Cars for which n = 9 and 10 under anaerobic conditions and n = 9, 10, and 10 + 1 under semianaerobic conditions. Those Cars that were extracted from the LH2 complex (LH2) and the reaction center (RC), isolated from the wild-type and the mutant Rvi. gelatinosus, were analyzed by HPLC, and their structures were determined by mass spectrometry and 1H NMR spectroscopy. The selective binding of Cars to those pigment-protein complexes has been characterized as follows. (1) Cars with a shorter conjugated chain are selectively bound to LH2 whereas Cars with a longer conjugated chain to the RC. (2) Shorter chain Cars with a hydroxyl group are bound to LH2 almost exclusively. This rule holds either in the absence or in the presence of the keto group. The natural selection of shorter chain Cars by LH2 and longer chain Cars by the RC is discussed, on the basis of the results now available, in relation to the light-harvesting and photoprotective functions of Cars.
Functional size of photosynthetic electron transport chain determined by radiation inactivation
International Nuclear Information System (INIS)
Pan, R.S.; Chen, L.F.; Wang, M.Y.; Tsal, M.Y.; Pan, R.L.; Hsu, B.D.
1987-01-01
Radiation inactivation technique was employed to determine the functional size of photosynthetic electron transport chain of spinach chloroplasts. The functional size for photosystem I+II(H 2 O to methylviologen) was 623 +/- 37 kilodaltons; for photosystem II (H 2 O to dimethylquinone/ferricyanide), 174 +/- 11 kilodaltons; and for photosystem I (reduced diaminodurene to methylviologen), 190 +/- 11 kilodaltons. The difference between 364 +/- 22 (the sum of 174 +/- 11 and 190 +/- 11) kilodaltons and 623 +/- 37 kilodaltons is partially explained to be due to the presence of two molecules of cytochrome b 6 /f complex of 280 kilodaltons. The molecular mass for other partial reactions of photosynthetic electron flow, also measured by radiation inactivation, is reported. The molecular mass obtained by this technique is compared with that determined by other conventional biochemical methods. A working hypothesis for the composition, stoichiometry, and organization of polypeptides for photosynthetic electron transport chain is proposed
Lower-Order Compensation Chain Threshold-Reduction Technique for Multi-Stage Voltage Multipliers
Directory of Open Access Journals (Sweden)
Francesco Dell’ Anna
2018-04-01
Full Text Available This paper presents a novel threshold-compensation technique for multi-stage voltage multipliers employed in low power applications such as passive and autonomous wireless sensing nodes (WSNs powered by energy harvesters. The proposed threshold-reduction technique enables a topological design methodology which, through an optimum control of the trade-off among transistor conductivity and leakage losses, is aimed at maximizing the voltage conversion efficiency (VCE for a given ac input signal and physical chip area occupation. The conducted simulations positively assert the validity of the proposed design methodology, emphasizing the exploitable design space yielded by the transistor connection scheme in the voltage multiplier chain. An experimental validation and comparison of threshold-compensation techniques was performed, adopting 2N5247 N-channel junction field effect transistors (JFETs for the realization of the voltage multiplier prototypes. The attained measurements clearly support the effectiveness of the proposed threshold-reduction approach, which can significantly reduce the chip area occupation for a given target output performance and ac input signal.
Directory of Open Access Journals (Sweden)
Kosuke Nakamura
2016-06-01
Real-time polymerase chain reaction (PCR detection method for unauthorized genetically modified (GM papaya (Carica papaya L. line PRSV-YK (PRSV-YK detection method was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976. Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.
DEFF Research Database (Denmark)
Skøt, J; Lerche, A G; Kolmos, H J
1995-01-01
To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....
DEFF Research Database (Denmark)
Andresen, K; Gasim, S; Elhassan, A M
1997-01-01
We have evaluated the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool for Leishmania donovani using blood, bone marrow and lymph node samples from Sudanese patients with a confirmed infection. Forty patients were diagnosed by microscopic examination of bone marrow or lymph...
Ieven, M; Ursi, D; Van Bever, H; Quint, W; Niesters, H G; Goossens, H
Mycoplasma pneumoniae and viruses in acute respiratory tract infections in children were studied during the winter of 1992-1993 in Antwerp, Belgium. M. pneumoniae was diagnosed in nasopharyngeal aspirates by culture and polymerase chain reaction (PCR). For this, amplification of a fragment of the PI
Sleeve reaction chamber system
Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA
2009-08-25
A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.
Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals
Directory of Open Access Journals (Sweden)
Mayara C. Lombardi
2014-12-01
Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.
International Nuclear Information System (INIS)
Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B.; Wunder, J.S.; Andrulis, I.L.; Gazdar, A.F.; Willman, C.L.; Griffith, B.; Von Hoff, D.D.
1990-01-01
The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy
David E. Schreiber; Karen J. Garner; James M. Slavicek
1997-01-01
Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...
Directory of Open Access Journals (Sweden)
Susan Maphilindawati Noor
2014-10-01
Full Text Available Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4, B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle in Java (Jakarta andBandung, South Sulawesi (Maros, East Nusa Tenggara (Kupang and Belu were used in this study. TheDNA bands were observed by agarose gel in the presence of ethidium bromide. Identification was performedbased on the size and number of DNA products amplified by PCR from each isolates. The results showedthat the 50 isolates were of B. abortus field strains. This finding showed that the cause of bovine brucellosisin Indonesia is B. abortus field strains.
New paradigm for simplified combustion modeling of energetic solids: Branched chain gas reaction
Energy Technology Data Exchange (ETDEWEB)
Brewster, M.Q.; Ward, M.J. [Univ. of Illinois, Urbana, IL (United States); Son, S.F. [Los Alamos National Lab., NM (United States)
1997-09-01
Two combustion models with simple but rational chemistry are compared: the classical high gas activation energy (E{sub g}/RT {much_gt} 1) Denison-Baum-Williams (DBW) model, and a new low gas activation energy (E{sub g}/RT {much_lt} 1) model recently proposed by Ward, Son, and Brewster (WSB). Both models make the same simplifying assumptions of constant properties, Lewis number unity, single-step, second order gas phase reaction, and single-step, zero order, high activation energy condensed phase decomposition. The only difference is in the gas reaction activation energy E{sub g} which is asymptotically large for DBW and vanishingly small for WSB. For realistic parameters the DBW model predicts a nearly constant temperature sensitivity {sigma}{sub p} and a pressure exponent n approaching 1. The WSB model predicts generally observed values of n = 0.7 to 0.9 and {sigma}{sub p}(T{sub o},P) with the generally observed variations with temperature (increasing) and pressure (decreasing). The WSB temperature profile also matches measured profiles better. Comparisons with experimental data are made using HMX as an illustrative example (for which WSB predictions for {sigma}{sub p}(T{sub o},P) are currently more accurate than even complex chemistry models). WSB has also shown good agreement with NC/NG double base propellant and HNF, suggesting that at the simplest level of combustion modeling, a vanishingly small gas activation energy is more realistic than an asymptotically large one. The authors conclude from this that the important (regression rate determining) gas reaction zone near the surface has more the character of chain branching than thermal decomposition.
Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao
2016-04-01
An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. © The Author(s) 2016.
Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo
2013-01-01
Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334
Li, Y; Saxena, D; Barnes, V M; Trivedi, H M; Ge, Y; Xu, T
2006-10-01
Clinical evaluation of oral microbial reduction after a standard prophylactic treatment has traditionally been based on bacterial cultivation methods. However, not all microbes in saliva or dental plaque can be cultivated. Polymerase chain reaction-based denaturing gradient gel electrophoresis (PCR-DGGE) is a cultivation-independent molecular fingerprinting technique that allows the assessment of the predominant bacterial species present in the oral cavity. This study sought to evaluate the oral microbial changes that occurred after a standard prophylactic treatment with a conventional oral care product using PCR-DGGE. Twelve healthy adults participated in the study. Pooled plaque samples were collected at baseline, 24 h after prophylaxis (T1), and 4 days after toothbrushing with fluoride toothpaste (T4). The total microbial genomic DNA of the plaque was isolated. PCR was performed with a set of universal bacterial 16S rDNA primers. The PCR-amplified 16S rDNA fragments were separated by DGGE. The effects of the treatment and of dental brushing were assessed by comparing the PCR-DGGE fingerprinting profiles. The mean numbers of detected PCR amplicons were 22.3 +/- 6.1 for the baseline group, 13.0 +/- 3.1 for the T1 group, and 13.5 +/- 4.3 for the T4 group; the differences among the three groups were statistically significant (P < 0.01). The study also found a significant difference in the mean similarities of microbial profiles between the baseline and the treatment groups (P < 0.001). PCR-based DGGE has been shown to be an excellent means of rapidly and accurately assessing oral microbial changes in this clinical study.
DEFF Research Database (Denmark)
Juul, L; Hougs, L; Andersen, V
1997-01-01
The expressed human kappa light chain gene repertoire utilized by healthy individuals was studied by two different single-sided specific PCR techniques to avoid bias for certain V genes. A total of 103 rearranged kappa sequences from peripheral blood mononuclear cells from healthy individuals were...
Building supply chain communication systems: a review of methods and techniques
Directory of Open Access Journals (Sweden)
A F Cutting-Decelle
2006-06-01
Full Text Available With the increasing importance of computer-based communication technologies, communication networks are becoming crucial in supply chain management. Given the objectives of the supply chain, supply chain management is situated at the intersection of different professional sectors, each of them with its own vocabulary, its own knowledge and rules. This paper provides a review of the main approaches to supply chain communications through the analysis of different ways of modelling a supply chain and the presentation of new semantic-based approaches that have been and are being developed to improve the quality of the information exchanges within the supply chain.
DEFF Research Database (Denmark)
Skøt, J; Lerche, A G; Kolmos, H J
1995-01-01
was performed. The sensitivity and specificity were 85 and 100% 934/40 and 77/77) respectively. A non-radioactive labelling system BluGENE was evaluated on all specimens, and found to be as effective as P32-labelling. To increase the speed and convenience of detection, a dot blot system was tested......To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....
Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo
2014-03-01
The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.
The influence of cricket fast bowlers' front leg technique on peak ground reaction forces.
Worthington, Peter; King, Mark; Ranson, Craig
2013-01-01
High ground reaction forces during the front foot contact phase of the bowling action are believed to be a major contributor to the high prevalence of lumbar stress fractures in fast bowlers. This study aimed to investigate the influence of front leg technique on peak ground reaction forces during the delivery stride. Three-dimensional kinematic data and ground reaction forces during the front foot contact phase were captured for 20 elite male fast bowlers. Eight kinematic parameters were determined for each performance, describing run-up speed and front leg technique, in addition to peak force and time to peak force in the vertical and horizontal directions. There were substantial variations between bowlers in both peak forces (vertical 6.7 ± 1.4 body weights; horizontal (braking) 4.5 ± 0.8 body weights) and times to peak force (vertical 0.03 ± 0.01 s; horizontal 0.03 ± 0.01 s). These differences were found to be linked to the orientation of the front leg at the instant of front foot contact. In particular, a larger plant angle and a heel strike technique were associated with lower peak forces and longer times to peak force during the front foot contact phase, which may help reduce the likelihood of lower back injuries.
Rubio, J.M.; Post, R.J.; Docters van Leeuwen, W.M.; Henry, M.C.; Lindergard, G.; Hommel, M.
2002-01-01
A simplified protocol for the identification of Plasmodium species by semi-nested multiplex polymerase chain reaction (SnM-PCR) in human blood samples is compared with microscopical examination of thin and thick blood films in 2 field trials in Côte d'Ivoire and Cameroon. Also, dried blood spots or
Singh, Rahul; Kumar, Pawan; Singh, Rajendra; Dhama, Kuldeep; Kumari, Swati; Yadav, Jay Prakash; Kashyap, Gayatri; Singh, Karam Pal; Singh, Vidya; Sahoo, Monalisa
2017-11-01
The small ruminant lentiviruses are known to cause maedi-visna (MV) and caprine arthritis - encephalitis in sheep and goats, typically affecting joints, udder, lungs, and the central nervous system. The diagnosis usually involves serology, clinical signs, immunohistochemistry, and polymerase chain reaction (PCR). In the present study, the histopathologically positive pneumonia cases of MV were confirmed by PCR in lung tissue probably for the first time in India. A total of 888 lungs of adult sheep, aged between 2 and 5 years, were screened during slaughter, of which 121 were found to have pneumonic lesions. The tissues from each pneumonic lung including associated lymph nodes were collected in 10% neutral buffered formalin for histopathology. The frozen tissues of the same were also collected and stored at -20°C for PCR confirmation. Three of 121 cases of pneumonic lungs of sheep revealed gross and histopathological lesions suggestive of maedi or ovine progressive pneumonia infection. These 3 cases were further confirmed by PCR technique that amplified 291-base pair DNA in the long terminal repeat sequence of MV provirus. This study suggests the low occurrence of MV virus (MVV) infection in India in naturally affected sheep based on pathomorphological lesions and using the molecular tool of PCR detection of the virus in tissues. Further, a combination of pathomorphology or/and PCR testing might be optimal for detecting the animals infected with MVV.
The reactions of loaded carbon nanotubes, studied by novel electron microscope techniques
International Nuclear Information System (INIS)
Rawcliffe, A.
1999-01-01
A novel electron microscope technique, controlled environment transmission electron microscopy (CETEM), has been used to investigate the reaction of materials loaded within the internal cavities of carbon nanotubes. CETEM allows the introduction of up to 20 mbar of gas around an electron microscope sample, while maintaining a high resolution imaging capability. The microscope is stable, flexible and reliable under these conditions and high resolution images of encapsulated transmission metal oxide reduction have been recorded at 460 deg. C. Recently discovered carbon nanotubes have in theory many applications, many of which will require controlled reliable loading of the internal cavity. However, at present, there is little experimental evidence to confirm theoretical descriptions of the fundamental mechanisms which govern both the extent of loading and the state in which it is found. Similarly, reaction within the cavity and the effect of encapsulation on the nano-scale particle distribution must also be understood, and CETEM proves to be an ideal technique for the study of these processes. Nanotubes have been loaded from aqueous solution with (NH 4 ) 2 IrCI 6 and with molten MoO 3 or K 2 WO 4 /WO 3 . Bulk samples of the first salt are known to decompose spontaneously in air at 200 deg. C, and the bulk oxides are partially reduced at temperature under hydrogen to give potentially useful conducting phases. Comparing the reaction of these materials it is thus possible to: investigate the effect of loading on their reaction; compare the reaction of these materials in- and out-side the tube cavity; and assess the result of violent loading processes on the tubes themselves. Fortuitously, a spontaneous decomposition, a solid-gas reduction and a phase rearrangement were all recorded, allowing mechanistic implications of encapsulation to be considered for each of these reactions. Perhaps surprisingly, the results can be largely interpreted using the reported bulk
International Nuclear Information System (INIS)
Imshennik, V.S.
2006-01-01
Within the conditions of Heavy-Ion Fusion (HIF) arises a possibility to obtain the fission chain reaction for a cylindrical HIF target. The paper contains the solution interpolated with the diffusion approximation in order to receive the general approximation expressions for the bar critical radius as well as for over-critical state. The obtained critical parameters generalized for uranium envelope are used for rough evaluation of the energy release in HIF hybrid targets [ru
Directory of Open Access Journals (Sweden)
Lulu Arafani
2016-03-01
Full Text Available White spot syndrome virus (WSSV is one of the most threatening diseases in shrimp and othercrustaceans affecting global shrimp farming. Since firstly detected in Taiwan in 1992, the disease hasspread globally and followed with considerable socio-economic consequences. This research was performedto detect the WSSV infection in shrimp farming in Lombok Island’s (West Nusa Tenggara using real-timepolymerase chain reaction. Samples of vaname (Litopenaeus vannamei were collected from several shrimpfarming in Lombok. Results indicated that the spread of WSSV has reached shrimp farms in Lombok,especially in Lendang Jae, West Lombok. Therefore, a biosurveillance program is strongly recommendedto government to avoid and halt the spread of the disease in East Indonesia region .
Directory of Open Access Journals (Sweden)
Dastur R
2003-01-01
Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.
Low-Cost Temperature Logger for a Polymerase Chain Reaction Thermal Cycler
Directory of Open Access Journals (Sweden)
Chan-Young Park
2016-10-01
Full Text Available Polymerase chain reaction (PCR is a method of amplifying DNA which is normally carried out with a thermal cycler. To obtain more accurate and reliable PCR results, the temperature change within the chamber of the thermal cycler needs to be verified and calibrated regularly. Commercially available temperature loggers commonly used for temperature verification tests usually require a graphical user interface (GUI attached to the logger for convenience and straightforward understanding of the device. In this study, a host-local architecture for the temperature logger that significantly reduces the development time and cost is proposed. Employing standard computing devices as the host gives better development environment and user-friendly GUI. This paper presents the hardware and software design of the host-local temperature logger, and demonstrates the use of the local temperature logger connected to a personal computer with a Windows operating system. The probe design, thermistor resistance measurement, temperature filtering, and temperature calibration is described in detail. The thermistor self-heating problem was investigated in particular to determine the reference resistor that was serially connected to the thermistor. The temperature accuracy and temporal precision of the proposed system was 0.1 K.
Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.
Ririe, K M; Rasmussen, R P; Wittwer, C T
1997-02-15
A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.
Directory of Open Access Journals (Sweden)
Eduardus Bimo Aksono
2017-06-01
Full Text Available Legionella pneumophila is a Gram-negative bacillus that causes nosocomial and community-acquired pneumonia. The aim of this research was to detect the presence of bacteria of L. pneumophila species in the swimming pools water of Surabaya city by using nested Polymerase Chain Reaction (PCR assay of a specific gene for L. pneumophila (mip gene. This study used purposive sampling method. A total of 10 water samples were collected from five swimming pools consisting of 200 mL water for each swimming pool. The results showed that of 10 samples tested by nested PCR, one sample was positive for L. pneumophila, and nine samples were negative. L. pneumophila were found in pool water samples with a higher temperature (>30ºC.Serogrouping analysis of positive sample that L. pneumophila bacteria detected in the water sample of swimming pool in Surabaya was L. pneumophila serogroup 9 (98% and serogroup 10 (98%. L. pneumophila detection of bacteria is expected to raise the awareness of physician and microbiologists about the transmission of L. pneumophila and will also be useful for controlling the agents. ABSTRAK Legionella pneumophila adalah bakteri Gram-negatif berbentuk batang yang dapat menyebabkan penyakit nosokomial dan pneumonia. Tujuan penelitian ini adalah untuk mendeteksi keberadaan bakteri L. pneumophila pada air kolam renang di Kota Surabaya dengan menggunakan nested Polymerase Chain Reaction (PCR berbasis gen spesifik L. pneumophila (mip gene. Penelitian ini menggunakan metode purposive sampling. Sebanyak sepuluh sampel diambil dari lima kolam renang. Sampel diambil sebanyak 200 mL dari air kolam renang di setiap lokasi. Hasil dari 10 sampel yang diuji menggunakan nested PCR, satu sampel menunjukkan hasil positif untuk L.pneumophila, dan sembilan sampel menunjukkan hasil negatif. Bakteri L. pneumophila ditemukan pada sampel air kolam dengan suhu yang lebih tinggi (>30ºC. Satu sampel positip tersebut ketika dilanjutkan terhadap analisis serogrup
Directory of Open Access Journals (Sweden)
Silvia Cristina Osaki
2013-06-01
Full Text Available Introduction Cryptosporidium is an important protozoan cause of waterborne disease worldwide of concern to public health authorities. To prevent outbreaks of cryptosporidiosis, the monitoring of this parasite in drinking water is necessary. In the present work, the polymerase chain reaction (PCR and nested-PCR techniques were used to detect Cryptosporidium in raw water from catchment points of four water treatment plants (WTP in Curitiba, Paraná, Brazil. Methods First, DNA extraction techniques were tested in samples containing decreasing amount of oocysts in reagent water, and PCR and nested-PCR with specific primers for 18SSU rDNA of Cryptosporidium were conducted to determine their sensitivity. In reagent water, a commercial extraction kit provided the best analytical sensitivity, and PCR and nested-PCR allowed the detection of five and two oocysts, respectively, with the primers XIAOR/XIAOF and XIAO1F/XIAO2R. Results In the spiking experiments, only the PCR with the primers AWA995F/AWA1206R was successful at detecting concentrations of 0.1 oocysts/mL. Two catchments samples of raw water and/or water sludge from four WTPs were contaminated with Cryptosporidium. Conclusions The application of the techniques to monitor Cryptosporidium in water and detect contamination in water catchments of WTPs in Curitiba are discussed in the present work.
Chase, D.M.; Elliott, D.G.; Pascho, R.J.
2006-01-01
Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.
The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...
International Nuclear Information System (INIS)
Chaudhry, M.A.; Fox, Margaret
1990-01-01
Alterations in the hprt gene of Chinese hamster cells were determined in 71 spontaneous, methylmethane sulphonate (MMS)-and X-ray induced mutants, using the Southern blot hybridization technique. To investigate the possibility of small deletions, MMS-induced mutants were studied with proves derived from exons 3 and 9 but no evidence of specific deletion of these two exons was found. The polymerase chain reaction (PCR) was used to phenotype hprt transcripts in 48 MMS, X-ray and spontaneous Chinese hamster mutants by amplifying the coding region of their cDNA. Among 22 MMS-induced mutants the message was present in 16 instances. An analysis of 20 X-ray-induced mutants showed the presence of hprt mRNA in 11 of them with five having low levels of transcription. Among six spontaneous mutants, four were negative for mRNA on standard Northern blots and in one the message was only detected after PCR amplification. Direct DNA sequencing of 10 mutants revealed the presence of base substitutions in five of them while a 7 bp deletion was found in another. No mutations were found in another four mutants, suggesting the presence of mutation outside the coding region. (author)
Machine learning techniques for gait biometric recognition using the ground reaction force
Mason, James Eric; Woungang, Isaac
2016-01-01
This book focuses on how machine learning techniques can be used to analyze and make use of one particular category of behavioral biometrics known as the gait biometric. A comprehensive Ground Reaction Force (GRF)-based Gait Biometrics Recognition framework is proposed and validated by experiments. In addition, an in-depth analysis of existing recognition techniques that are best suited for performing footstep GRF-based person recognition is also proposed, as well as a comparison of feature extractors, normalizers, and classifiers configurations that were never directly compared with one another in any previous GRF recognition research. Finally, a detailed theoretical overview of many existing machine learning techniques is presented, leading to a proposal of two novel data processing techniques developed specifically for the purpose of gait biometric recognition using GRF. This book · introduces novel machine-learning-based temporal normalization techniques · bridges research gaps concerning the effect of ...
Faham Khamesipour; Esmat Noshadi; Mitra Moradi; Mehdi Raissy
2014-01-01
Shrimp is one of the most important fishery products of the coastal provinces in the Persian Gulf in Iran. Vibriosis has been an important cause of production loss due to bacterial disease in shrimp farms in south Iran in recent years. The objective of this study was to detect the prevalence of Vibrio spp. in shrimp samples from farms in the southern provinces of Iran by polymerase chain reaction (PCR). A total number of 36 shrimp were caught from south coast of Iran and were stud...
Essentials of supply chain management
Hugos, Michael H
2011-01-01
The latest thinking, strategies, developments, and technologies to stay current in supply chain management Presenting the core concepts and techniques of supply chain management in a clear, concise and easily readable style, the Third Edition of Essentials of Supply Chain Management outlines the most crucial tenets and concepts of supply chain management.
Lopez, Karen M; Fleming, Gregory J; Mylniczenko, Natalie D
2016-12-01
Reports of equine herpesvirus (EHV) 1 and EHV-9 causing clinical disease in a wide range of species have been well documented in the literature. It is thought that zebras are the natural hosts of EHV-9 both in the wild and in captive collections. Concerns about potential interspecies transmission of EHV-1 and EHV-9 in a mixed species savannah exhibit prompted serologic and polymerase chain reaction surveys. Eighteen Burchell's zebras ( Equus quagga ), 11 Hartmann's mountain zebras ( Equus zebra hartmannae), and 14 Thomson's gazelles ( Eudorcas thomsonii ) cohabitating the same exhibit were examined for EHV-1 virus neutralization titers, and evidence of virus via EHV 1-5 polymerase chain reactions. None of the animals had previous exposure to vaccination with EHV-1 or EHV-4. All tested zebras had positive EHV-1 titers, ranging from 4 to 384. All zebras and Thomson's gazelles had negative polymerase chain reaction results for all targeted equine herpesviruses. EHV-9-specific assays are not available but EHV-1, EHV-4, and EHV-9 cross-react serologically. Positive serology results indicate a potential latent equine herpesvirus in the zebra population, which prompted initiation of an equine herpesvirus vaccine protocol, changes in pregnant zebra mare management, and equine herpesvirus polymerase chain reaction screening prior to shipment to or from the study site.
Almy, Frederic S.; Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.
2006-01-01
Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic.
International Nuclear Information System (INIS)
Wang Sufan; Smith, Sean C.
2006-01-01
The 'leading coordinate' approach to computing an approximate reaction pathway, with subsequent determination of the true minimum energy profile, is applied to a two-proton chain transfer model based on the chromophore and its surrounding moieties within the green fluorescent protein (GFP). Using an ab initio quantum chemical method, a number of different relaxed energy profiles are found for several plausible guesses at leading coordinates. The results obtained for different trial leading coordinates are rationalized through the calculation of a two-dimensional relaxed potential energy surface (PES) for the system. Analysis of the 2-D relaxed PES reveals that two of the trial pathways are entirely spurious, while two others contain useful information and can be used to furnish starting points for successful saddle-point searches. Implications for selection of trial leading coordinates in this class of proton chain transfer reactions are discussed, and a simple diagnostic function is proposed for revealing whether or not a relaxed pathway based on a trial leading coordinate is likely to furnish useful information
Microfabricated sleeve devices for chemical reactions
Northrup, M. Allen
2003-01-01
A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.
Directory of Open Access Journals (Sweden)
Zhouli Wang
Full Text Available A combination of immunomagnetic separation (IMS and polymerase chain reaction (PCR was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agarose gel electrophoresis results of 20 different strains showed that the IMS-PCR procedure presented high specificity to the A. acidoterrestris. The sensitivity of the IMS-PCR was 2×10(1 CFU/mL and the total detection time was 3 to 4 h. Of the 78 naturally contaminated apple juice samples examined, the sensitivity, specificity and accuracy of IMS-PCR compared with the standardized pour plate method were 90.9%, 97.0% and 96.2%, respectively. The results exhibited that the developed IMS-PCR method will be a valuable tool for detecting A. acidoterrestris and improving food quality in juice samples.
Energy Technology Data Exchange (ETDEWEB)
Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest; Singh, Anup K.
2017-10-31
Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required for PCR.
International Nuclear Information System (INIS)
Nie Leng; Gao Lizeng; Yan Xiyun; Wang Taihong
2007-01-01
Functionalized tetrapodal ZnO nanostructures are tested in plasmid DNA experiments (1) as a solid-phase adsorbent for plasmid DNA purification (2) as improving reagents in a polymerase chain reaction (PCR) and (3) as novel carriers for gene delivery. The amino-modification, the tetrapod-like shape of the nanostructure and its high biocompatibility all contribute to measurements showing promise for applications. A sol-gel method is used for silica coating and amino-modification. Plasmid DNA is purified through reversible conjugations of amino-modified ZnO tetrapods with DNA. Also, as additional reagents, functionalized tetrapods are shown to improve the amount of PCR product. For transfection, ZnO tetrapods provide some protection against deoxyribonuclease cleavage of plasmid DNA and deliver plasmid DNA into cells with little cytotoxicity
A Micro Polymerase Chain Reaction Module for Integrated and Portable DNA Analysis Systems
Directory of Open Access Journals (Sweden)
Elisa Morganti
2011-01-01
Full Text Available This work deals with the design, fabrication, and thermal characterization of a disposable miniaturized Polymerase Chain Reaction (PCR module that will be integrated in a portable and fast DNA analysis system. It is composed of two independent parts: a silicon substrate with embedded heater and thermometers and a PDMS (PolyDiMethylSiloxane chamber reactor as disposable element; the contact between the two parts is assured by a mechanical clamping obtained using a Plastic Leaded Chip Carrier (PLCC. This PLCC is also useful, avoid the PCR mix evaporation during the thermal cycles. Finite Element Analysis was used to evaluate the thermal requirements of the device. The thermal behaviour of the device was characterized revealing that the temperature can be controlled with a precision of ±0.5°C. Different concentrations of carbon nanopowder were mixed to the PDMS curing agent in order to increase the PDMS thermal conductivity and so the temperature control accuracy.
Gbedo, Yémalin Gabin; Mangin-Brinet, Mariane
2017-07-01
We present a new procedure to determine parton distribution functions (PDFs), based on Markov chain Monte Carlo (MCMC) methods. The aim of this paper is to show that we can replace the standard χ2 minimization by procedures grounded on statistical methods, and on Bayesian inference in particular, thus offering additional insight into the rich field of PDFs determination. After a basic introduction to these techniques, we introduce the algorithm we have chosen to implement—namely Hybrid (or Hamiltonian) Monte Carlo. This algorithm, initially developed for Lattice QCD, turns out to be very interesting when applied to PDFs determination by global analyses; we show that it allows us to circumvent the difficulties due to the high dimensionality of the problem, in particular concerning the acceptance. A first feasibility study is performed and presented, which indicates that Markov chain Monte Carlo can successfully be applied to the extraction of PDFs and of their uncertainties.
International Nuclear Information System (INIS)
Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.
1995-01-01
Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs
Solcà, Manuela da Silva; Guedes, Carlos Eduardo Sampaio; Nascimento, Eliane Gomes; Oliveira, Geraldo Gileno de Sá; dos Santos, Washington Luis Conrado; Fraga, Deborah Bittencourt Mothé; Veras, Patrícia Sampaio Tavares
2012-03-23
Because infected dogs are widely considered to be the main domestic reservoir for Leishmania infantum (syn Leishmania chagasi) parasites in Brazil, the diagnosis of canine visceral leishmaniasis (CVL) must be made both accurately and promptly. The present study attempted to standardize a conventional polymerase chain reaction (cPCR) protocol for the detection of L. infantum DNA in canine spleen samples. Quantitative PCR (qPCR) technique was used to confirm the presence of Leishmania DNA in the canine spleen fragments. A comparison was made between the efficacies of these molecular diagnostic techniques and conventional parasitological and serological methods. cPCR protocols for spleen samples were standardized using primers that amplify a 145 bp fragment, located at the parasite kinetoplast minicircle. The genus specificity of the cPCR protocol was assessed by its inability to amplify the DNA of other common canine pathogens, such as Ehrlichia canis, Babesia canis, Toxoplasma gondii and Trypanosoma cruzi. cPCR protocol sensitivity was tested by assessing the reaction detection limit, determined to be 10 fg of L. infantum reference strain DNA, which corresponds to a range of 0.03-0.1 parasites per fragment. Standardized cPCR protocol was used to detect the presence of Leishmania in 45 dog spleen samples. Our results showed that 40% of the spleen fragment cultures were positive for Leishmania parasites, 58% of the dog serum samples tested positive using ELISA, and parasite DNA was detected in 44% using qPCR, while 47% of the spleen samples using cPCR. Diagnostic methods performance was assessed and revealed a better degree of ascertainment for cPCR when compared to other diagnostic methods. The sensitivity of ELISA was 83.3%, qPCR was 83.3%, and cPCR was 88.9%; PPV for ELISA was 57.7%, qPCR was 75% and cPCR was 76.2%; the Kappa coefficients were found to be 0.40 (fair) for ELISA, 0.64 (substantial) for qPCR and 0.68 (substantial) for cPCR. In both oligosymptomatic
A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction
Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng
2016-08-01
In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples.
Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.
2006-01-01
Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978
Bartzavali-Louki, Christina; Dimitracopoulos, George; Spiliopoulou, Iris
2003-06-01
Characterization of clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA) and representatives of three MRSA clones from other hospitals was performed by arbitrarily primed polymerase chain reaction (AP-PCR) and antibiotic susceptibility patterns. All isolates were mecA-positive and two main antibiotypes have been characterized. Two major clones were identified with AP-PCR related to the aforementioned antibiotypes. The combination of antibiotypes with AP-PCR patterns successfully identified the two major clones in our hospital, which are identical with the MRSA clones previously characterized in Athens and in Central and North Greece.
Directory of Open Access Journals (Sweden)
João Bortoletti Filho
2013-01-01
Full Text Available A brief report on the nature and epidemiology of T. gondii infection is firstly presented. The importance of the specific IgG avidity test and polymerase chain reaction (PCR for toxoplasmosis is discussed, along with their significance and importance as auxiliary methods for determining the most likely time for the initial infection by this coccidian and for defining the therapeutic strategy. Lastly, practical comments are made in relation to the classical therapeutic regimens, with special attention to the indications for fetal treatment, when this is necessary.
Silicon-based sleeve devices for chemical reactions
Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.
1996-01-01
A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.
Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur
2017-05-17
Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.
Matsumoto, Suzuka; Kanazawa, Arihiro; Kanaoka, Shokyoku; Aoshima, Sadahito
2017-06-14
A unique tandem reaction of sequence-controlled cationic copolymerization and site-specific hetero-Diels-Alder (DA) reaction is demonstrated. In the controlled cationic copolymerization of furfural and 2-acetoxyethyl vinyl ether (AcOVE), only the furan ring adjacent to the propagating carbocation underwent the hetero-DA reaction with the aldehyde moiety of another furfural molecule. A further and equally important feature of the copolymerization is that the obtained copolymers had unprecedented 2:(1 + 1)-type alternating structures of repeating sequences of two VE and one furfural units in the main chain and one furfural unit in the side chain. The specific DA reaction is attributed to the delocalization of the positive charge to the side furan ring.
Directory of Open Access Journals (Sweden)
Daryosh Mohamadi Janaki
2018-08-01
Full Text Available Information Technology (IT plays an essential role on development of effective supply chain planning and it can improve the supply chain performance, either directly or indirectly. As a national industry, the National Iranian Oil Products Distribution Company involves a large number of organizations within its supply chain. Therefore, this descriptive-survey uses information sharing indicators, fuzzy TOPSIS technique based on managers and expert opinions to evaluate and to rank some oil products distribution companies. Data are analyzed and the results show that Oil Products Distribution Company of Chaharmahal and Bakhtiari received the highest rank and Farsan maintained the lowest rank compared with other regional companies.
Bubble-free on-chip continuous-flow polymerase chain reaction: concept and application.
Wu, Wenming; Kang, Kyung-Tae; Lee, Nae Yoon
2011-06-07
Bubble formation inside a microscale channel is a significant problem in general microfluidic experiments. The problem becomes especially crucial when performing a polymerase chain reaction (PCR) on a chip which is subject to repetitive temperature changes. In this paper, we propose a bubble-free sample injection scheme applicable for continuous-flow PCR inside a glass/PDMS hybrid microfluidic chip, and attempt to provide a theoretical basis concerning bubble formation and elimination. Highly viscous paraffin oil plugs are employed in both the anterior and posterior ends of a sample plug, completely encapsulating the sample and eliminating possible nucleation sites for bubbles. In this way, internal channel pressure is increased, and vaporization of the sample is prevented, suppressing bubble formation. Use of an oil plug in the posterior end of the sample plug aids in maintaining a stable flow of a sample at a constant rate inside a heated microchannel throughout the entire reaction, as compared to using an air plug. By adopting the proposed sample injection scheme, we demonstrate various practical applications. On-chip continuous-flow PCR is performed employing genomic DNA extracted from a clinical single hair root sample, and its D1S80 locus is successfully amplified. Also, chip reusability is assessed using a plasmid vector. A single chip is used up to 10 times repeatedly without being destroyed, maintaining almost equal intensities of the resulting amplicons after each run, ensuring the reliability and reproducibility of the proposed sample injection scheme. In addition, the use of a commercially-available and highly cost-effective hot plate as a potential candidate for the heating source is investigated.
Impact of Fungicide Residues on Polymerase Chain Reaction and on Yeast Metabolism
Directory of Open Access Journals (Sweden)
Gildo Almeida da Silva
Full Text Available ABSTRACT The indiscriminate use of pesticides on grape crops is harmful for consumers´ healthin “in natura” consumption and in the ingestion of wine and grape juice. During winemaking, a rapid and efficient fermentation stage is critical to avoid proliferation of contaminating microorganisms and to guarantee the product´s quality. Polymerase chain reaction (PCR has the advantage of detecting these contaminants in the early stages of fermentation. However,this enzymatic reaction may also be susceptible to specific problems, reducing its efficiency. Agricultural practices, such as fungicide treatments, may be a source of PCR inhibiting factors and may also interfere in the normal course of fermentation.The action of the pesticides captan and folpet on PCR and on yeast metabolism was evaluated, once these phthalimide compounds are widely employed in Brazilian vineyards. DNA amplification was only observed at 75 and 37.5 µg/mL of captan concentrations, whereas with folpet, amplification was observed only in the two lowest concentrations tested (42.2 and 21.1µg/mL.Besides the strong inhibition on Taq polymerase activity, phthalimides also inhibited yeast metabolism at all concentrations analyzed.Grape must containing captan and folpet residues could not be transformed into wine due to stuck fermentation caused by the inhibition of yeast metabolism. Non-compliance with the waiting period for phthalimide fungicides may result in financial liabilities to the viticulture sector.The use of yeasts with high fungicide sensitivity should be selected for must fermentation as a strategy for sustainable wine production and to assure that products comply with health and food safety standards.
Particle Markov Chain Monte Carlo Techniques of Unobserved Component Time Series Models Using Ox
DEFF Research Database (Denmark)
Nonejad, Nima
This paper details Particle Markov chain Monte Carlo techniques for analysis of unobserved component time series models using several economic data sets. PMCMC combines the particle filter with the Metropolis-Hastings algorithm. Overall PMCMC provides a very compelling, computationally fast...... and efficient framework for estimation. These advantages are used to for instance estimate stochastic volatility models with leverage effect or with Student-t distributed errors. We also model changing time series characteristics of the US inflation rate by considering a heteroskedastic ARFIMA model where...
Kang, Daoxian; Ran, Yuping; Li, Conghui; Dai, Yaling; Lama, Jebina
2013-01-01
We report a case of Arthroderma vanbreuseghemii (a teleomorph of Trichophyton interdigitale) infection around the nostrils in a 3-year-old girl. The culture was negative, so the pathogenic agent was identified using polymerase chain reaction-based sequencing of the crusts taken from the lesion on the nostril. Treatment with oral itraconazole and topical 1% naftifine/0.25% ketoconazole cream after a topical wash with ketoconazole shampoo was effective. © 2012 Wiley Periodicals, Inc.
Energy Technology Data Exchange (ETDEWEB)
Marteau, C; Gaillard-Cusin, F; James, H [Centre National de la Recherche Scientifique, 45 - Orleans-la-Source (France). Centre de Recherches sur la Chimie de Combustion et des Hautes Temperatures
1978-05-01
Investigation of heterogeneous initiation process of gas phase linear chain reactions is carried out through the study of H/sub 2/-D/sub 2/ exchange reaction. Experimental data under study concern mainly the stationary rate of HD formation and the prestationary proceeding. Steady-state method accounts for the first one of these data; it allows to clearly compare the wall process part to the part played by the homogeneous chain reaction towards HD formation. Activation energy of exchange elementary step between chemisorbed hydrogen (on silica) and gaseous deuterium has been evaluated: Esub(e1)=52+-1 Kcal/mole.
Polymerase chain reaction for detection of invasive Shigella flexneri in food.
Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E
1990-06-01
The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.
Directory of Open Access Journals (Sweden)
Rahul Singh
2017-11-01
Full Text Available Aim: The small ruminant lentiviruses are known to cause maedi-visna (MV and caprine arthritis - encephalitis in sheep and goats, typically affecting joints, udder, lungs, and the central nervous system. The diagnosis usually involves serology, clinical signs, immunohistochemistry, and polymerase chain reaction (PCR. In the present study, the histopathologically positive pneumonia cases of MV were confirmed by PCR in lung tissue probably for the first time in India. Materials and Methods: A total of 888 lungs of adult sheep, aged between 2 and 5 years, were screened during slaughter, of which 121 were found to have pneumonic lesions. The tissues from each pneumonic lung including associated lymph nodes were collected in 10% neutral buffered formalin for histopathology. The frozen tissues of the same were also collected and stored at -20°C for PCR confirmation. Results: Three of 121 cases of pneumonic lungs of sheep revealed gross and histopathological lesions suggestive of maedi or ovine progressive pneumonia infection. These 3 cases were further confirmed by PCR technique that amplified 291-base pair DNA in the long terminal repeat sequence of MV provirus. Conclusion: This study suggests the low occurrence of MV virus (MVV infection in India in naturally affected sheep based on pathomorphological lesions and using the molecular tool of PCR detection of the virus in tissues. Further, a combination of pathomorphology or/and PCR testing might be optimal for detecting the animals infected with MVV.
Singh, Rahul; Kumar, Pawan; Singh, Rajendra; Dhama, Kuldeep; Kumari, Swati; Yadav, Jay Prakash; Kashyap, Gayatri; Singh, Karam Pal; Singh, Vidya; Sahoo, Monalisa
2017-01-01
Aim: The small ruminant lentiviruses are known to cause maedi-visna (MV) and caprine arthritis - encephalitis in sheep and goats, typically affecting joints, udder, lungs, and the central nervous system. The diagnosis usually involves serology, clinical signs, immunohistochemistry, and polymerase chain reaction (PCR). In the present study, the histopathologically positive pneumonia cases of MV were confirmed by PCR in lung tissue probably for the first time in India. Materials and Methods: A total of 888 lungs of adult sheep, aged between 2 and 5 years, were screened during slaughter, of which 121 were found to have pneumonic lesions. The tissues from each pneumonic lung including associated lymph nodes were collected in 10% neutral buffered formalin for histopathology. The frozen tissues of the same were also collected and stored at −20°C for PCR confirmation. Results: Three of 121 cases of pneumonic lungs of sheep revealed gross and histopathological lesions suggestive of maedi or ovine progressive pneumonia infection. These 3 cases were further confirmed by PCR technique that amplified 291-base pair DNA in the long terminal repeat sequence of MV provirus. Conclusion: This study suggests the low occurrence of MV virus (MVV) infection in India in naturally affected sheep based on pathomorphological lesions and using the molecular tool of PCR detection of the virus in tissues. Further, a combination of pathomorphology or/and PCR testing might be optimal for detecting the animals infected with MVV. PMID:29263606
Directory of Open Access Journals (Sweden)
P. D. Luka
2014-10-01
Full Text Available Aim: Formalin fixing and paraffin embedding of tissue samples is one of the techniques for preserving the structural integrity of cells for a very long time. However, extraction and analysis of genomic material from formalin fixed tissue (FFT remains a challenge despite numerous attempts to develop a more effective method. The success of polymerase chain reaction (PCR depends on the quality of DNA extract. Materials and Methods: Here we assessed the conventional method of DNA extraction from FFT for African swine fever virus (ASFV detection. The modified conventional method gave a higher quality DNA when compared with commercially available DNA extraction kits (QIAamp® DNA Mini Kit, DNeasy® Blood and Tissue Kit, and ZR Genomic DNA™ Tissue MiniPrep. Results: An average A260/A280 DNA purity of 0.86-1.68 and 3.22-5.32 μg DNA/mg for formalin fixed and non-fixed tissues, respectively using a conventional method. In a reproducible and three times repeat PCR, the ASFV DNA expected product size of 278 bp was obtained from the DNA extract of the conventional method but not from the DNA extract of the commercial kits. Conclusion: The present study has demonstrated that the conventional method extracts ASFV genome better than commercial kit. In summary, the commercial kit extraction appeared not suitable to purify ASFV DNA from FFT. We, therefore, recommend that the use of the conventional method be considered for African swine fever DNA extraction from FFT.
Directory of Open Access Journals (Sweden)
Boissière-Michot Florence
2009-04-01
Full Text Available Abstract Background Reverse transcription-quantitative polymerase chain reaction (RT-qPCR is the gold standard technique for mRNA quantification, but appropriate normalization is required to obtain reliable data. Normalization to accurately quantitated RNA has been proposed as the most reliable method for in vivo biopsies. However, this approach does not correct differences in RNA integrity. Results In this study, we evaluated the effect of RNA degradation on the quantification of the relative expression of nine genes (18S, ACTB, ATUB, B2M, GAPDH, HPRT, POLR2L, PSMB6 and RPLP0 that cover a wide expression spectrum. Our results show that RNA degradation could introduce up to 100% error in gene expression measurements when RT-qPCR data were normalized to total RNA. To achieve greater resolution of small differences in transcript levels in degraded samples, we improved this normalization method by developing a corrective algorithm that compensates for the loss of RNA integrity. This approach allowed us to achieve higher accuracy, since the average error for quantitative measurements was reduced to 8%. Finally, we applied our normalization strategy to the quantification of EGFR, HER2 and HER3 in 104 rectal cancer biopsies. Taken together, our data show that normalization of gene expression measurements by taking into account also RNA degradation allows much more reliable sample comparison. Conclusion We developed a new normalization method of RT-qPCR data that compensates for loss of RNA integrity and therefore allows accurate gene expression quantification in human biopsies.
Energy Technology Data Exchange (ETDEWEB)
Barelko, E V; Kartashova, L I; Komarov, P N; Proskurnin, M A [Karpov Physico-Chemical Institute, Moscow, Union of Soviet Socialist Republics (Russian Federation)
1960-07-15
This paper describes the results of experiments by the writers with radioinitiation of chain branched reactions of the oxidation of organic compounds. The function of radiation as an initiating agent is described with reference to the oxidation of several unsaturated hydrocarbons and butanol. The reaction is self-accelerating and proceeds spontaneously after radiation has ceased. A detailed investigation was made of a process from oxidizing benzene, which has a high radiation resistance. The writers devised a method of sensitizing the radioinitiation of the oxidation of radiation-resistant substances by chemically inert but non-radiation-resistant substances. The main quantitative features of the process for the radiooxidation of benzene are stated to be the accumulation of various reaction products, and the effect of temperature, pressure, power and radiation dosage on the process of such accumulation. Information was obtained about the mechanism of the process. The design of circulating equipment is described. (author) [French] Dans ce memoire, les auteurs presentent les resultats d'une etude consacree a l'amorcage sous rayonnement de reactions, d'oxydation des composes organiques, par ramification en chaine. Ils montrent le role des rayonnements en tant qu'agents d'amorcage de la reaction, en citant comme exemples l'oxydation de certains hydrocarbures non satures et du butanol. La reaction possede un caractere d'auto-acceleration et continue spontanement lorsque l'action des rayonnements a cesse. La reaction d'oxydation du benzene a ete etudiee en detail; elle est caracterisee par la haute stabilite de la substance vis-a-vis de l'action des rayonnements. Les auteurs formulent les principes de la sensibilisation, par l'action de substances instables vis-a-vis des rayonnements de l'amorcage sous rayonnement de la reaction d'oxydation de substances stables vis-a-vis des rayonnements et chimiquement inertes. Le memoire fournit les caracteristiques quantitatives
van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.
1994-01-01
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
Brüggemann, M.; White, H.; Gaulard, P.; Garcia-Sanz, R.; Gameiro, P.; Oeschger, S.; Jasani, B.; Ott, M.; Delsol, G.; Orfao, A.; Tiemann, M.; Herbst, H.; Langerak, A. W.; Spaargaren, M.; Moreau, E.; Groenen, P. J. T. A.; Sambade, C.; Foroni, L.; Carter, G. I.; Hummel, M.; Bastard, C.; Davi, F.; Delfau-Larue, M.-H.; Kneba, M.; van Dongen, J. J. M.; Beldjord, K.; Molina, T. J.
2007-01-01
Polymerase chain reaction (PCR) assessment of clonal T-cell receptor (TCR) and immunoglobulin (Ig) gene rearrangements is an important diagnostic tool in mature T-cell neoplasms. However, lack of standardized primers and PCR protocols has hampered comparability of data in previous clonality studies.
Ionothermal synthesis and crystal structures of metal phosphate chains
Wragg, D.; Le Ouay, B.; Beale, A.M.; O'Brien, M.G.; Slawin, A.M.Z.; Warren, J.E.; Prior, T.J.; Morris, R.E.
2013-01-01
We have prepared isostructural aluminium and gallium phosphate chains by ionothermal reactions in 1-ethyl-3-methylimidazolium bromide and 1-ethylpyridinium bromide under a variety of conditions. The chains can be prepared as pure phases or along with three dimensional framework phases. The chains
Analysis of Supply Chain Risk Management Strategies: Case Study of Supply Chain Disruptions
Marcelo Dias Carvalho; Leticia Ishikawa
2016-01-01
Supply Chain Risk Management refers to a set of strategies used by companies to avoid supply chain disruption caused by damage at production facilities, natural disasters, capacity issues, inventory problems, incorrect forecasts, and delays. Many companies use the techniques of the Toyota Production System, which in a way goes against a better management of supply chain risks. This paper studies key events in some multinationals to analyze the trade-off between the best supply chain risk mana...
Xu, Yao; Zheng, Zhi
2016-05-15
We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.
Meletiadis, J.; Melchers, W.J.G.; Meis, J.F.G.M.; Hurk, P.J.J.C. van den; Jannes, G.; Verweij, P.E.
2003-01-01
An assay system in which polymerase chain reaction (PCR) amplification of the ITS-1 region of ribosomal DNA (rDNA) is combined with a reverse-hybridization line probe assay (LiPA) was used for the identification of six Candida species and four Aspergillus species in pure cultures of clinical
DEFF Research Database (Denmark)
Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper
2007-01-01
OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR......-BM). METHODS: We applied a PCR that targeted conserved regions of the 16S ribosomal ribonucleic acid gene to cerebrospinal fluid (CSF) samples from patients with external ventricular drainage or a ventriculoperitoneal shunt during the course of VR-BM. We compared the PCR results with CSF cultures. A total...... of 350 routine CSF samples were consecutively collected from 86 patients. The CSF deoxyribonucleic acid was automatically purified and subjected to PCR. Amplicons from the PCR samples that were positive for VR-BM were subsequently deoxyribonucleic acid sequenced for final identification. Clinical data...
A polymerase chain reaction strategy for the diagnosis of camelpox.
Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar
2009-03-01
Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.
Simplification of reversible Markov chains by removal of states with low equilibrium occupancy.
Ullah, Ghanim; Bruno, William J; Pearson, John E
2012-10-21
We present a practical method for simplifying Markov chains on a potentially large state space when detailed balance holds. A simple and transparent technique is introduced to remove states with low equilibrium occupancy. The resulting system has fewer parameters. The resulting effective rates between the remaining nodes give dynamics identical to the original system's except on very fast timescales. This procedure amounts to using separation of timescales to neglect small capacitance nodes in a network of resistors and capacitors. We illustrate the technique by simplifying various reaction networks, including transforming an acyclic four-node network to a three-node cyclic network. For a reaction step in which a ligand binds, the law of mass action implies a forward rate proportional to ligand concentration. The effective rates in the simplified network are found to be rational functions of ligand concentration. Copyright © 2012 Elsevier Ltd. All rights reserved.
Zornhagen, K W; Kristensen, A T; Hansen, A E; Oxboel, J; Kjaer, A
2015-12-01
Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours. The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm was used to analyse the most suitable reference genes. Eight potential reference genes were excluded from this final analysis because of their dissociation curves. β-Glucuronidase (GUSB) and proteasome subunit, beta type, 6 (PSMB6) were most stably expressed with an M value of 0.154 and a CV of 0.053 describing their average stability. We suggest that choice of reference genes should be based on specific testing in every new experimental set-up. © 2014 John Wiley & Sons Ltd.
Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo
2004-01-01
We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...
Zhang, Linqun; Liu, Yuanjian; Li, Ying; Zhao, Yuewu; Wei, Wei; Liu, Songqin
2016-08-24
A mimic-hybridization chain reaction (mimic-HCR) amplified strategy was proposed for sensitive electrochemically detection of DNA methylation and methyltransferase (MTase) activity In the presence of methylated DNA, DNA-gold nanoparticles (DNA-AuNPs) were captured on the electrode by sandwich-type assembly. It then triggered mimic-HCR of two hairpin probes to produce many long double-helix chains for numerous hexaammineruthenium (III) chloride ([Ru(NH3)6](3+), RuHex) inserting. As a result, the signal for electrochemically detection of DNA MTase activity could be amplified. If DNA was non-methylated, however, the sandwich-type assembly would not form because the short double-stranded DNAs (dsDNA) on the Au electrode could be cleaved and digested by restriction endonuclease HpaII (HapII) and exonuclease III (Exo III), resulting in the signal decrement. Based on this, an electrochemical approach for detection of M.SssI MTase activity with high sensitivity was developed. The linear range for M.SssI MTase activity was from 0.05 U mL(-1) to 10 U mL(-1), with a detection limit down to 0.03 U mL(-1). Moreover, this detecting strategy held great promise as an easy-to-use and highly sensitive method for other MTase activity and inhibition detection by exchanging the corresponding DNA sequence. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Bramastha Rosadi
2015-01-01
Full Text Available Background: Benign Prostatic Hyperplasia (BPH has been correlated with chronic prostatitis according recent study. Chronic pelvic pain is the chief complain of BPH followed by prostatitis. The gold standard of the etiological diagnosis is urine culture, but the negativity rate is still high. Multiplex polymerase chain reaction (PCR as a diagnostic tool in search of etiological causes could identify microorganism on DNA level. This research aims to find out the role of multiplex polymerase chain reaction as diagnostic tools on prostatitis patients. Material and Method: A total of 12 samples collected during the TURP procedure in Sanglah General Hospital Denpasar – Bali from February until May 2015. All of the samples has been diagnosed prostatitis clinically and perform urine culture test. The prostate specimen taken was sent to the Pathological anatomy for histopathology diagnostic and underwent multiplex PCR for etiologic diagnostic. Result: 12 samples have been declared as prostatitis based on histopathology examination, and then were analyzed using multiplex PCR. 10 samples were positive (6 were E. coli, 2 were C. trachomatis, the rest were N. gonorrhea and P. aeruginosa. The urine culture revealed 9 positive, within the result 6 were E. coli, and the others were P. aeruginosa, M. morganii and A. haemolyticus. Conclusion: In prostatitis patient, the etiological diagnostic was important. Multiplex PCR as diagnostic tools could detect the microorganism on a negative urine culture. The combination of the urine culture test and multiplex PCR revealed a better result on etiologic diagnosis which leads to a better management of the disease.
DEFF Research Database (Denmark)
Høgdall, Estrid; Vuust, Jens; Lind, Peter
2000-01-01
of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...
Rana, Md. Muhit
DNA nanotechnology has shown great promise in molecular diagnostic, bioanalytical and biomedical applications. The great challenge of detecting target analytes, biomarkers and small molecules, in molecular diagnostics is low yield sensitivity. To address this challenge, different nanomaterials have been used for a long time and to date there is no such cost-effective bioanalytical technique which can detect these target biomarkers (DNA, RNA, circulating DNA/miRNA) or environmental heavy metal ions (Hg2+ and Ag+) in a cost-effective and efficient manner. Herein, we initially discuss two possible bioanalytical detection methods- a) colorimetric and b) fluorometric assays which are very popular nowadays due to their distinctive spectroscopic properties. Finally, we report the promising colorimetric assay using a novel DNA based amplification strategy know as hybridization chain reaction (HCR) for potential application in the visual detection of low copies of biomarkers (miRNAs as little as 20 femtomole in an RNA pool and cell extracts in seven different combinations and Ebola virus DNA as low as 400 attomoles in liquid biopsy mimics in sixteen different combinations), environmental and biological heavy metal ions (mercury and silver concentrations as low as 10 pM in water, soil and urine samples) and also successfully applied to a molecular logic gate operation to distinguish OR and AND logic gates. No results showed any false-positive or false-negative information. On the other hand, we also discuss the future possibilities of HCR amplification technology, which is very promising for fluorometric bioanalysis. The HCR based nanoprobe technology has numerous remarkable advantages over other methods. It is re-programmable, simple, inexpensive, easy to assemble and operate and can be performed with visual and spectroscopic read-outs upon recognition of the target analytes. This rapid, specific and sensitive approach for biomarkers and heavy metal ion detection generates
Rosado, A.S.; Seldin, L.; Wolters, A.; Elsas, van J.D.
1996-01-01
A molecular method for the detection of Paenibacillus azotofixans in soil and the wheat rhizosphere was developed. The system consisted of polymerase chain reaction (PCR) amplification of part of the variable V1 to V4 regions of the 16S ribosomal RNA gene, followed by hybridization with a specific
Energy Technology Data Exchange (ETDEWEB)
Jovanovic, Jelena V. [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom); Rennie, Kristian [GSTS Pathology, Guy’s Hospital, London (United Kingdom); Culligan, Dominic [Department of Haematology, Aberdeen Royal Infirmary, Aberdeen (United Kingdom); Peniket, Andrew [Department of Haematology, John Radcliffe Hospital, Oxford (United Kingdom); Lennard, Anne [Department of Haematology, Royal Victoria Infirmary, Newcastle (United Kingdom); Harrison, Justin [Department of Haematology, Hemel Hempstead Hospital, Hemel Hempstead (United Kingdom); Vyas, Paresh [Medical Research Council Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, Oxford (United Kingdom); Grimwade, David, E-mail: david.grimwade@genetics.kcl.ac.uk [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom)
2011-10-25
Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10{sup 4}−10{sup 5}. Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.
International Nuclear Information System (INIS)
Jovanovic, Jelena V.; Rennie, Kristian; Culligan, Dominic; Peniket, Andrew; Lennard, Anne; Harrison, Justin; Vyas, Paresh; Grimwade, David
2011-01-01
Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10 4 −10 5 . Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.
Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M
1993-01-01
A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.
Estimation of parameter sensitivities for stochastic reaction networks
Gupta, Ankit
2016-01-07
Quantification of the effects of parameter uncertainty is an important and challenging problem in Systems Biology. We consider this problem in the context of stochastic models of biochemical reaction networks where the dynamics is described as a continuous-time Markov chain whose states represent the molecular counts of various species. For such models, effects of parameter uncertainty are often quantified by estimating the infinitesimal sensitivities of some observables with respect to model parameters. The aim of this talk is to present a holistic approach towards this problem of estimating parameter sensitivities for stochastic reaction networks. Our approach is based on a generic formula which allows us to construct efficient estimators for parameter sensitivity using simulations of the underlying model. We will discuss how novel simulation techniques, such as tau-leaping approximations, multi-level methods etc. can be easily integrated with our approach and how one can deal with stiff reaction networks where reactions span multiple time-scales. We will demonstrate the efficiency and applicability of our approach using many examples from the biological literature.
International Nuclear Information System (INIS)
Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.
2005-01-01
Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)
Directory of Open Access Journals (Sweden)
Edina Rodrigues Pires
1997-01-01
Full Text Available Although Biomphalaria occidentalis and B. tenagophila are indistinguishable on the basis of shell morphology and the majority of their genital organs, only the latter is susceptible to infection with Schistosoma mansoni. Thus, the identification of these species is fundamental to epidemiological studies of schistosomiasis. Here we describe a simple and rapid method for differentiating B. tenagophila from B. occidentalis based on low stringency polymerase chain reaction and using a pair of primers specific for the amplification of the 18S rRNA gene. Analysis of the low stringency product profiles of populations of these snails from different geographical regions confirmed this approach as being applicable to the identification of B. tenagophila and B. occidentalis in cases where classical morphology is inconclusive
Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma
2015-03-01
Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. © 2012 APJPH.
Aguilera Galaviz, Luis Alejandro; Aceves Medina, Ma del Carmen; Estrada García, Iris C
2002-01-01
Streptococcus mutans is a pathogen related to the occurrence of human dental caries. The determination of total amounts of mutans streptococci, as well as the proportion related to other oral bacteria, is of interest when assessing the risk of developing caries. In this context, it is better to use a sensitive, specific and non-time consuming method such as the polymerase chain reaction (PCR), than to use culture and biochemical identification methods. In this work we identified potentially cariogenic strains of S. mutans and assessed the relationship with the dmft, DMFT or dmft/DMFT index. Using DNA isolated from dental plaque, a 192 bp sequence was identified and amplified from the spaP gene and a 722 bp sequence from the dexA gene. The results suggest that it is important to evaluate the presence of cariogenic S. mutans strains in plaque content rather than the accumulation of plaque itself However, other factors like diet, hygiene, genetic background, the flow rate of saliva and the presence of specific antibodies, also play a key role in the development of caries.
Studying Chemical Reactions, One Bond at a Time, with Single Molecule AFM Techniques
Fernandez, Julio M.
2008-03-01
atomic force microscopy (AFM) techniques, as shown here, can probe dynamic rearrangements within an enzyme's active site which cannot be resolved with any other current structural biological technique. Furthermore, our work at the single bond level directly demonstrates that thiol/disulfide exchange in proteins is a force-dependent chemical reaction. Our findings suggest that mechanical force plays a role in disulfide reduction in vivo, a property which has never been explored by traditional biochemistry. 1.-Wiita, A.P., Ainavarapu, S.R.K., Huang, H.H. and Julio M. Fernandez (2006) Force-dependent chemical kinetics of disulfide bond reduction observed with single molecule techniques. Proc Natl Acad Sci U S A. 103(19):7222-7 2.-Wiita, A.P., Perez-Jimenez, R., Walther, K.A., Gräter, F. Berne, B.J., Holmgren, A., Sanchez-Ruiz, J.M., and Fernandez, J.M. (2007) Probing the chemistry of thioredoxin catalysis with force. Nature, 450:124-7.
Helmig, Sarah; Gothelf, Kurt Vesterager
2017-10-23
Signal transfer is central to the controlled exchange of information in biology and advanced technologies. Therefore, the development of reliable, long-range signal transfer systems for artificial nanoscale assemblies is of great scientific interest. We have designed such a system for the signal transfer between two connected DNA nanostructures, using the hybridization chain reaction (HCR). Two sets of metastable DNA hairpins, one of which is immobilized at specific points along tracks on DNA origami structures, are polymerized to form a continuous DNA duplex, which is visible using atomic force microscopy (AFM). Upon addition of a designed initiator, the initiation signal is efficiently transferred more than 200 nm from a specific location on one origami structure to an end point on another origami structure. The system shows no significant loss of signal when crossing from one nanostructure to another and, therefore, has the potential to be applied to larger multi-component DNA assemblies. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Polymerase chain reaction as a tool for developing stress protein probes
Energy Technology Data Exchange (ETDEWEB)
Cochrane, B.J.; Mattley, Y.D. (Univ. of South Florida, Tampa, FL (United States). Dept. of Biology); Snell, T.W. (Georgia Inst. of Tech., Atlanta, GA (United States). Div. of Biology)
1994-08-01
Because of the high degree of evolutionary conservation of stress proteins, potential exists for the development of nucleic acid probes from particular species that could be used to monitor stress-related changes in mRNA abundance. The polymerase chain reaction (PCR) is a powerful tool that can be applied to the generation of these probes, provided that primer sequences can be identified that specifically amplify sequences of interest from a wide variety of organisms. The authors identified such sequences from multiple alignments of published chaperonin and stress-70 sequences, and tested their ability to amplify appropriately sized fragments from genomic DNA from a variety of vertebrates and invertebrates. Although no primer pair could be used successfully with all species, the authors were able to derive specific products from most species by testing different pairs. One primer pair for chaperonin proved particularly useful. Products were obtained from all tested species, and with a single exception (human), these primers appeared to amplify a single copy sequence. The authors determined the nucleotide sequence of the product obtained from the rotifer Brachionus plicatilis and determined by phylogenetic analysis of the inferred protein product that the product obtained is most likely derived from a rotifer DNA template. Finally, the authors show that this product can be used to detect changes in abundance of homologous mRNA in heat-stressed rotifers.
Manduzio, Hélène; Ezan, Eric; Fenaille, François
2010-12-30
We have investigated the potential and robustness of the off-line coupling of polymerase chain reaction (PCR) with electrospray ionization mass spectrometry (ESI-MS), for further applications in the screening of single-nucleotide polymorphisms (SNPs). This was based on recently reported data demonstrating that anion-exchange solid-phase extraction was the most efficient technique for efficiently desalting PCR products, with a recovery of ∼70%. Results showed that this purification approach efficiently removes almost all the chemicals commonly added to PCR buffers. ESI-MS analysis of a model 114-bp PCR product performed on the LTQ-Orbitrap instrument demonstrated that detection limits in the nM range along with an average mass measurement uncertainty of 9.15 ± 7.11 ppm can be routinely obtained using an external calibration. The PCR/ESI-MS platform was able to detect just a few copies of a targeted oligonucleotide. However, it was shown that if two PCR products are present in a mixture in a ratio higher than 10 to 1, the lower abundance one might not be reproducibly detected. Applications to SNPs demonstrated that an LTQ-Orbitrap with a resolution of 30 000 (at m/z 400) easily identified a single (A ↔ G) switch, i.e. a 16 Da difference, in binary mixtures of ∼ 35 kDa PCR products. Complementary experiments also showed that the combination of endonucleases and ESI-MS could be used to confirm base composition and sequence, and thus to screen for unknown polymorphisms in specific sequences. For example, a single (T ↔ A) switch (9 Da mass difference) was successfully identified in a 114-bp PCR product. Copyright © 2010 John Wiley & Sons, Ltd.
Winther, Birgit; Alper, Cuneyt M; Mandel, Ellen M; Doyle, William J; Hendley, J Owen
2007-06-01
Otitis media is a frequent complication of a viral upper respiratory tract infection, and the reported co-incidence of those diseases increases with assay sensitivity and sampling density. We determined the incidence of otitis-media complications in young children when referenced to cold-like illnesses and to concurrent virus recovery from the nasopharynx. A total of 60 children from 24 families were followed from October 2003 through April 30, 2004, by daily parental recording of illness signs, weekly pneumatic otoscopic examinations, and periodic polymerase chain reaction assay of collected nasal fluids for common viruses. One hundred ninety-nine cold-like illnesses were observed, but a sample for virus assay was not collected concurrent with 71 episodes. Of the remainder, 73% of cold-like illnesses were temporally related to recovery of 1 or a combination of the assayed viruses, with rhinovirus predominating. For non-cold-like illness periods, 54 (18%) of 297 assays were positive for virus, and the virus frequency distribution was similar to that for cold-like illnesses. There were 93 diagnosed otitis-media episodes; 65 (70%) of these occurred during a cold-like illness. For the 79 otitis-media episodes with available nasal samples, 61 (77%) were associated with a positive virus result. In this population, the otitis-media complication rate for a cold-like illness was 33%. A cold-like illness was not a prerequisite for polymerase chain reaction detection of viruses in the nose and nasopharynx of young children. Viral detection by polymerase chain reaction in the absence of a cold-like illness is associated with complications in some subjects. Otitis media is a complication of viral infection both with and without concurrent cold-like illnesses, thus downwardly biasing coincidence estimates that use cold-based illnesses as the denominator.
Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal
2012-01-01
The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.
Directory of Open Access Journals (Sweden)
Hamed Rezaeejam
2015-01-01
Full Text Available Understanding of cellular responses to ionizing radiation (IR is essential for the development of predictive markers useful for assessing human exposure. Biological markers of exposure to IR in human populations are of great interest for assessing normal tissue injury in radiation oncology and for biodosimetry in nuclear incidents and accidental radiation exposures. Traditional radiation exposure biomarkers based on cytogenetic assays (biodosimetry, are time-consuming and do not provide results fast enough and requires highly trained personnel for scoring. Hence, the development of rapid biodosimetry methods is one of the highest priorities. Exposure of cells to IR activates multiple signal transduction pathways, which result in complex alterations in gene-expression. Real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR has become the benchmark for the detection and quantification of RNA targets and is being utilized increasingly in monitoring the specific genes with more accurately and sensitively. This review evaluates the RT-qPCR as a biodosimetry method and we investigated the papers from 2000 up to now, which identified the genes-expression related the DNA repair, cell cycle checkpoint, and apoptosis induced by ionization radiation in peripheral blood and determined as biodosimeters. In conclusion, it could be say that RT-qPCR technique for determining the specific genes as biodosimeters could be a fully quantitative reliable and sensitive method. Furthermore, the results of the current review will help the researchers to recognize the most expressed genes induced by ionization radiation.
International Nuclear Information System (INIS)
Lucatero, M.A.
1976-01-01
The technique of the gamma-rays capture spectrometry was used in the experimental determination of nuclear reaction rates of the type (n,γ). This technique consists in the incidence of a thermal neutrons collimated beam upon a sample, detecting the capture spectrum of gamma rays emitted at a solid fixed angle. In the determination of the efficiency curve intrinsic to the detection electronic system the reactions 199 Hg(n,γ) 200 Hg, 56 Fe(n,γ) 57 Fe and 63 Cu(n,γ) 64 Cu were used with the energy of the gamma rays capture of 5.976, 7.635 and 7.915 Mev respectively, through the irradiation of standard samples of Hg(175.3g), Fe(110.4g) and Cu(108.5g) of cylindrical geometry the two former and parallelepiped the latter. The problem concerning the corrections due to the thermal neutrons flux depression, the gammas auto-attenuation, and the geometric factor due to the cylindrical and parallelepiped geometry are involved in the data process. The experimental determination of the reaction 35 Cl(n,γ) 36 Cl rate was made through the observation of the gamma caputre of 6.111 Mev when a sample of CaCl 2 of cylindrical geometry was irradiated. This rate can be favorably compared with the reaction rate determined theoretically. (author)
Sugiyama, Yu-ki; Kato, Rei; Sakurada, Tetsuya; Okamoto, Sentaro
2011-06-29
A cobalt-catalyzed alkyne [2 + 2 + 2] cycloaddition reaction has been applied to polymerizations yielding linear polymers via selective cross-cyclotrimerization of yne-diyne monomers, which occurs in a chain-growth manner. Additionally, through control of the alkyne reactivity of the two monomers, this method was efficiently applied to the spontaneous block copolymerization of their mixture. Here we present the proposed mechanism of the catalyst transfer process of this cycloaddition polymerization.
Oates, A C; Wollberg, P; Achen, M G; Wilks, A F
1998-08-28
The polymerase chain reaction (PCR), with cDNA as template, has been widely used to identify members of protein families from many species. A major limitation of using cDNA in PCR is that detection of a family member is dependent on temporal and spatial patterns of gene expression. To circumvent this restriction, and in order to develop a technique that is broadly applicable we have tested the use of genomic DNA as PCR template to identify members of protein families in an expression-independent manner. This test involved amplification of DNA encoding protein tyrosine kinase (PTK) genes from the genomes of three animal species that are well known development models; namely, the mouse Mus musculus, the fruit fly Drosophila melanogaster, and the nematode worm Caenorhabditis elegans. Ten PTK genes were identified from the mouse, 13 from the fruit fly, and 13 from the nematode worm. Among these kinases were 13 members of the PTK family that had not been reported previously. Selected PTKs from this screen were shown to be expressed during development, demonstrating that the amplified fragments did not arise from pseudogenes. This approach will be useful for the identification of many novel members of gene families in organisms of agricultural, medical, developmental and evolutionary significance and for analysis of gene families from any species, or biological sample whose habitat precludes the isolation of mRNA. Furthermore, as a tool to hasten the discovery of members of gene families that are of particular interest, this method offers an opportunity to sample the genome for new members irrespective of their expression pattern.
International Nuclear Information System (INIS)
Liu, Hongying; Bei, Xiaoqiong; Xia, Qiuting; Fu, Yan; Zhang, Shi; Liu, Maochuan; Fan, Kai; Zhang, Mingzhen; Yang, Yong
2016-01-01
We describe a sensitive enzyme-free bioassay for the determination of microRNA-21. It is based on a combination of target-triggered hybridization chain reaction, tagging with CdTe quantum dots (QDs), and anodic stripping voltammetry. Firstly, a thiolated capture hairpin probe SH-HP1 was immobilized on the surface of a gold electrode. HP1 unfolds in the presence of microRNA-21. If hairpin probe 2 (HP2) is present, a HP1-HP2 complex will be formed which possesses an exposed stem of HP2, and microRNA is released in parallel. The released microRNA-21 triggers a hybridization chain reaction and this leads to form an exposed DNA segment of HP2 and cycle use microRNA-21. With the aid of assistant DNA A1 and A2, the exposed DNA segment of HP2 progressed to a long double strand. The strand is rich in CdTe QDs with the help of QDs-A1. Then, the attached QDs were dissolved with HNO 3 to give dissolved Cd(II) ions. Finally, the corresponding electrochemical current response of Cd(II) is monitored by anodic stripping voltammetry and used to quantify the concentration of microRNA-21. More microRNA-21 participated in this reaction increases the number of CdTe QDs, which results in increased electrochemical current. Thus, an ultrasensitive detection of microRNA-21 is accomplished by anodic stripping voltammetry. This gene assay displays a detection limit as low as 33 aM. It can discriminate between complementary DNA sequence and single-base mismatched DNA, indicating its high specificity. (author)
DEFF Research Database (Denmark)
Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte
2012-01-01
To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...... (NA) and European (EU) genotype isolates were analyzed by the participants. Great differences regarding qualitative diagnostics as well as analytical sensitivity were observed between the individual RT-qPCR systems, especially when investigating strains from the EU genotype. None of the assays...
Zhang, Junjun; Zhang, Wenjuan; Guo, Jinjin; Wang, Junchun; Zhang, Yuzhong
2017-12-15
In this study, a sandwich-type electrochemical immunosensor for the detection of C-reactive protein (CRP) is described. In design, Copper nanoparticles (Cu NPs) were used for signal tag and hybridization chain reaction (HCR)amplified output signal. The immunosensor fabrication involved three steps: (i) primary antibodies (Ab 1 ) were immobilized on the surface of gold nanoparticles (Au NPs); (ii) the sandwich-type structure formation contained "primary antibodies-antigen-secondary antibodies conjugated with primer (Ab 2 -S 0 )"; and (iii) long DNA concatemers intercalating amounts of Cu NPs was linked to the sandwich-type structure via hybridization reaction. Differential pulse voltammetry (DPV) was used to record the response signal of the immunosensor in phosphate-buffered saline (PBS). Under optimal conditions, the anodic peak currents of Cu NPs at the peak potential of about 0.08V(VS.SCE) were linear with the logarithm of CRP concentration in the range of 1.0 fg mL -1 to 100 ng mL -1 with a detection limit of 0.33 fg mL -1 (at signal/noise [S/N] = 3). In addition, the practical application of immunosensor was evaluated by analyzing CRP in real human serum samples, the recoveries obtained were within 95.3%-103.8%, indicating the immunosensor possessed potential application ability for practical disease diagnosis. Copyright © 2017 Elsevier Inc. All rights reserved.
Spectroscopy of element 115 decay chains.
Rudolph, D; Forsberg, U; Golubev, P; Sarmiento, L G; Yakushev, A; Andersson, L-L; Di Nitto, A; Düllmann, Ch E; Gates, J M; Gregorich, K E; Gross, C J; Heßberger, F P; Herzberg, R-D; Khuyagbaatar, J; Kratz, J V; Rykaczewski, K; Schädel, M; Åberg, S; Ackermann, D; Block, M; Brand, H; Carlsson, B G; Cox, D; Derkx, X; Eberhardt, K; Even, J; Fahlander, C; Gerl, J; Jäger, E; Kindler, B; Krier, J; Kojouharov, I; Kurz, N; Lommel, B; Mistry, A; Mokry, C; Nitsche, H; Omtvedt, J P; Papadakis, P; Ragnarsson, I; Runke, J; Schaffner, H; Schausten, B; Thörle-Pospiech, P; Torres, T; Traut, T; Trautmann, N; Türler, A; Ward, A; Ward, D E; Wiehl, N
2013-09-13
A high-resolution α, x-ray, and γ-ray coincidence spectroscopy experiment was conducted at the GSI Helmholtzzentrum für Schwerionenforschung. Thirty correlated α-decay chains were detected following the fusion-evaporation reaction 48Ca + 243Am. The observations are consistent with previous assignments of similar decay chains to originate from element Z=115. For the first time, precise spectroscopy allows the derivation of excitation schemes of isotopes along the decay chains starting with elements Z>112. Comprehensive Monte Carlo simulations accompany the data analysis. Nuclear structure models provide a first level interpretation.
Directory of Open Access Journals (Sweden)
A. A. Sultanova
2017-02-01
Full Text Available It is the chain growth specific reaction rate that was determined for the process of methyl methacrylate mass radical polymerization within the temperature range of 40–900 С in quasi-steady approximation by means of Monte Carlo method. The theoretical model of radical polymerization was developed taking the gel effect into account. Computer software was developed that enables to imitate radical polymerization process taking gel effect into account within the minimum run time. The programme was tested on asymptotic examples as well as was applied for methyl methacrylate mass radical polymerization. The programme makes it possible to calculate monomer conversion, molecular mass variation, molecular-mass distribution, etc.
Chisi, Songelwayo L; Schmidt, Tracy; Akol, George W; Van Heerden, Henriette
2017-09-27
Serology is primarily used in the diagnosis of bovine brucellosis. Bacterial culture and isolation is the gold standard in diagnosing brucellosis but, like serology, it does not offer complete (100%) diagnostic sensitivity and specificity. Polymerase chain reaction (PCR) has been suggested to offer better specificity and sensitivity. In this study, we evaluated the performance of Brucella abortus species specific (BaSS) PCR directly from different samples in the diagnosis of bovine brucellosis in naturally infected cattle in KwaZulu-Natal province of South Africa with known infectious status from culture. The BaSS PCR had a low diagnostic sensitivity (DSe) of 70%, but was able to identify vaccine strains using abomasal fluid from aborted foetuses and detect Brucella DNA from decomposing samples. The best sample for the BaSS PCR was abomasal fluid.
Toxin genotyping of Clostridium perfringens strains using a polymerase chain reaction protocol
Directory of Open Access Journals (Sweden)
Elisabetta Di Giannatale
2010-03-01
Full Text Available A polymerase chain reaction protocol consisting of a multiplex to identify the cpa, cpb1, cpetx, cpi genes and a duplex to identify the cpe and cpb2 genes encoding for a, b1, e, i, enterotoxin and b2 toxins, respectively, was applied to DNA extracted from two collections of Clostridium perfringens strains. The first collection involved 19 isolates from rabbits. The second collection of 41 isolates came from routine necropsies. The cpa gene alone, or in association with the cpb2 gene, was detected in all DNA samples examined. The cpa gene, together with cpb2 gene, were detected in seven of the rabbit C. perfringens strains (36.8% and in nine isolates from necropsies (21.9%. The cpa gene was found in 63.2% of rabbit strains and 76.9% of strains from other animal species. In rabbits, the pathological lesions associated with C. perfringens detection were predominantly forms of non-inflammatory enteropathies. In other species, C. perfringens was mainly associated with congestive-haemorrhagic enteropathy, but also with fatal traumatic lesions, degenerative diseases and organs with post-mortem autolysis. No clear correlation was observed between detection of b2 toxin gene and species-specific pathological features.
Spatiotemporal Patterns in a Ratio-Dependent Food Chain Model with Reaction-Diffusion
Directory of Open Access Journals (Sweden)
Lei Zhang
2014-01-01
Full Text Available Predator-prey models describe biological phenomena of pursuit-evasion interaction. And this interaction exists widely in the world for the necessary energy supplement of species. In this paper, we have investigated a ratio-dependent spatially extended food chain model. Based on the bifurcation analysis (Hopf and Turing, we give the spatial pattern formation via numerical simulation, that is, the evolution process of the system near the coexistence equilibrium point (u2*,v2*,w2*, and find that the model dynamics exhibits complex pattern replication. For fixed parameters, on increasing the control parameter c1, the sequence “holes → holes-stripe mixtures → stripes → spots-stripe mixtures → spots” pattern is observed. And in the case of pure Hopf instability, the model exhibits chaotic wave pattern replication. Furthermore, we consider the pattern formation in the case of which the top predator is extinct, that is, the evolution process of the system near the equilibrium point (u1*,v1*,0, and find that the model dynamics exhibits stripes-spots pattern replication. Our results show that reaction-diffusion model is an appropriate tool for investigating fundamental mechanism of complex spatiotemporal dynamics. It will be useful for studying the dynamic complexity of ecosystems.
Supply chain simulation tools and techniques: a survey
Kleijnen, J.P.C.
2005-01-01
The main contribution of this paper is twofold: it surveys different types of simulation for supply chain management; it discusses several methodological issues. These different types of simulation are spreadsheet simulation, system dynamics, discrete-event simulation and business games. Which
Directory of Open Access Journals (Sweden)
Shyamala G
2008-01-01
Full Text Available Background: Perinatal viral infections of fetus are among the leading causes of congenital cataract and identifying the viral etiology is important. Objectives: To detect the presence of Rubella virus (RV, herpes simplex virus (HSV and cytomegalovirus (CMV in lens aspirate specimens obtained from patients with congenital cataract and relate the results with serology. Setting and Design: Prospective study carried out in tertiary care hospital. Materials and Methods: Fifty lens aspirates from 50 infants with congenital cataract were subjected to HSV, RV isolation and polymerase chain reaction (PCR for detection of HSV and CMV. Reverse transcription polymerase chain reaction (RT-PCR was applied for RV detection. Peripheral blood specimens were screened for anti-HSV, RV and CMV antibodies by enzyme-linked immunosorbant assay (ELISA. Results: Rubella virus was detected in nine (18% lens aspirates, by nRT-PCR which includes six positive by culture. HSV-2 DNA was detected in nine other lens aspirates, while CMV was not detected by PCR. Serological results did not correlate with the presence of viruses in the lens aspirates. This is the first report of detection of HSV-2 DNA in cases of congenital cataract. Conclusions: Cytomegalovirus may not be playing a significant role in causation of congenital cataract. The role of serology in identifying causative viral infection for congenital cataract needs to be re-evaluated.
Taylor, P.W.; Winton, J.R.
2002-01-01
Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.
Wu, Wenming; Trinh, Kieu The Loan; Lee, Nae Yoon
2015-03-07
We introduce a new strategy for fabricating a seamless three-dimensional (3D) helical microreactor utilizing a silicone tube and a paraffin mold. With this method, various shapes and sizes of 3D helical microreactors were fabricated, and a complicated and laborious photolithographic process, or 3D printing, was eliminated. With dramatically enhanced portability at a significantly reduced fabrication cost, such a device can be considered to be the simplest microreactor, developed to date, for performing the flow-through polymerase chain reaction (PCR).
Rokhina, E.V.; Makarova, K.; Golovina, E.A.; As, van H.; Virkutyte, J.
2010-01-01
The homolysis of peracetic acid (PAA) as a relevant source of free radicals (e.g., •OH) was studied in detail. Radicals formed as a result of chain radical reactions were detected with electron spin resonance and nuclear magnetic resonance spin trapping techniques and subsequently identified by
Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna
2016-05-01
Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment. © 2016 Wiley Periodicals, Inc.
Hilton, Margaret J; Xu, Li-Ping; Norrby, Per-Ola; Wu, Yun-Dong; Wiest, Olaf; Sigman, Matthew S
2014-12-19
The mechanism of the redox-relay Heck reaction was investigated using deuterium-labeled substrates. Results support a pathway through a low energy palladium-alkyl intermediate that immediately precedes product formation, ruling out a tautomerization mechanism. DFT calculations of the relevant transition structures at the M06/LAN2DZ+f/6-31+G* level of theory show that the former pathway is favored by 5.8 kcal/mol. Palladium chain-walking toward the alcohol, following successive β-hydride eliminations and migratory insertions, is also supported in this study. The stereochemistry of deuterium labels is determined, lending support that the catalyst remains bound to the substrate during the relay process and that both cis- and trans-alkenes form from β-hydride elimination.
A polymerase chain reaction-based methodology to detect gene doping.
Carter, Adam; Flueck, Martin
2012-04-01
The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.
Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T
2016-06-01
We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. © 2015 Society for Laboratory Automation and Screening.
Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid
2017-01-01
Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.
Directory of Open Access Journals (Sweden)
Samira Mohammadi
2017-01-01
Full Text Available Background: Nontuberculous mycobacteria (NTM are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.
Directory of Open Access Journals (Sweden)
Kush Shrivastava
2015-10-01
Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.
Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2014-09-09
Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.
International Nuclear Information System (INIS)
Howell, C.R.; Tornow, W.; Pfuetzner, H.G.; Li Anli; Roberts, M.L.; Murphy, K.; Felsher, P.D.; Weisel, G.J.; Naqvi, A.; Walter, R.L.; Lambert, J.M.; Treado, P.A.
1990-01-01
Experimental methods to measure the vector analyzing powers over a broad range of kinematic configurations in the n-d breakup reaction have been developed at TUNL. These techniques employ the polarized beam facilities at TUNL and use the 2 H(d vector, n vector) 3 He reaction as a source of low-energy polarized neutrons. Our methods permit measurements to a high statistical accuracy over a large fraction of three-nucleon phase space. The techniques are described and experimental spectra along with kinematic calculations are presented. (orig.)
Bluhm, B H; Flaherty, J E; Cousin, M A; Woloshuk, C P
2002-12-01
The genus Fusarium comprises a diverse group of fungi including several species that produce mycotoxins in food commodities. In this study, a multiplex polymerase chain reaction (PCR) assay was developed for the group-specific detection of fumonisin-producing and trichothecene-producing species of Fusarium. Primers for genus-level recognition of Fusarium spp. were designed from the internal transcribed spacer regions (ITS1 and ITS2) of rDNA. Primers for group-specific detection were designed from the TRI6 gene involved in trichothecene biosynthesis and the FUM5 gene involved in fumonisin biosynthesis. Primer specificity was determined by testing for cross-reactivity against purified genomic DNA from 43 fungal species representing 14 genera, including 9 Aspergillus spp., 9 Fusarium spp., and 10 Penicillium spp. With purified genomic DNA as a template, genus-specific recognition was observed at 10 pg per reaction; group-specific recognition occurred at 100 pg of template per reaction for the trichothecene producer Fusarium graminearum and at 1 ng of template per reaction for the fumonisin producer Fusarium verticillioides. For the application of the PCR assay, a protocol was developed to isolate fungal DNA from cornmeal. The detection of F. graminearum and its differentiation from F. verticillioides were accomplished prior to visible fungal growth at cornmeal. This level of detection is comparable to those of other methods such as enzyme-linked immunosorbent assay, and the assay described here can be used in the food industry's effort to monitor quality and safety.
A Bullet-Block Experiment that Explains the Chain Fountain
Pantaleone, J.; Smith, R.
2018-05-01
It is common in science for two phenomena to appear to be very different, but in fact follow from the same basic principles. Here we consider such a case, the connection between the chain fountain and a bullet-block collision experiment. When an upward moving bullet strikes a wooden block resting on a horizontal table, the block will rise to a higher height when the bullet strikes near the end of the block. This is because the quickly rotating block experiences an additional upward "reaction" force from its contact with the table. Such a reaction force also explains the chain fountain. When a chain falls from a pile in a container to the floor below, the chain rises up above the container. This rise occurs because the quickly rotating links in the container push off of the surface beneath them. We derive a model that accurately describes our measurements in the bullet-block experiment, and then use this same model to calculate an approximate expression for the distance the chain rises above the container. More extensive discussions of the chain fountain are available elsewhere.
Directory of Open Access Journals (Sweden)
I. Karthika Lakshmi
2018-04-01
Full Text Available Aim: The present study was designed to standardize real-time polymerase chain reaction (PCR for detecting the bluetongue virus from blood samples of sheep collected during outbreaks of bluetongue disease in the year 2014 in Andhra Pradesh and Telangana states of India. Materials and Methods: A 10-fold serial dilution of Plasmid PUC59 with bluetongue virus (BTV NS3 insert was used to plot the standard curve. BHK-21 and KC cells were used for in vitro propagation of virus BTV-9 at a TCID50/ml of 105 ml and RNA was isolated by the Trizol method. Both reverse transcription -PCR and real-time PCR using TaqMan probe were carried out with RNA extracted from virus-spiked culture medium and blood to compare the sensitivity by means of finding out the limit of detection (LoD. The results were verified by inoculating the detected and undetected dilutions onto cell cultures with further cytological (cytopathic effect and molecular confirmation (by BTV-NS1 group-specific PCR. The standardized technique was then applied to field samples (blood for detecting BTV. Results: The slope of the standard curve obtained was -3.23, and the efficiency was 103%. The LoD with RT-PCR was 8.269Ex103 number of copies of plasmid, whereas it was 13 with real-time PCR for plasmid dilutions. Similarly, LoD was determined for virus-spiked culture medium, and blood with both the types of PCR and the values were 103 TCID 50/ml and 104 TCID 50/ml with RT-PCR and 10° TCID 50/ml and 102 TCID 50/ml with real-time PCR, respectively. The standardized technique was applied to blood samples collected from BTV suspected animals; 10 among 20 samples were found positive with Cq values ranging from 27 to 39. The Cq value exhibiting samples were further processed in cell cultures and were confirmed to be BT positive. Likewise, Cq undetected samples on processing in cell cultures turned out to be BTV negative. Conclusion: Real-time PCR was found to be a very sensitive as well as reliable method
International Nuclear Information System (INIS)
Li, Lin; Borry, Richard W.; Iglesia, Enrique
2000-01-01
Detailed kinetic-transport models were used to explore thermodynamic and kinetic barriers in the non-oxidative conversion of CH4 via homogeneous and homogeneous-heterogeneous pathways and the effects of continuous hydrogen removal and of catalytic sites on attainable yields of useful C2-C10 products. The homogeneous kinetic model combines separately developed models for low-conversion pyrolysis and for chain growth to form large aromatics and carbon. The H2 formed in the reaction decreases CH4 pyrolysis rates and equilibrium conversions and it favors the formation of lighter products. The removal of H2 along tubular reactors with permeable walls increases reaction rates and equilibrium CH4 conversions. C2-C10 yields reach values greater than 90 percent at intermediate values of dimensionless transport rates (delta=1-10), defined as the ratio hydrogen transport and methane conversion rates. Homogeneous reactions require impractical residence times, even with H2 removal, because of slow initiation and chain transfer rates. The introduction of heterogeneous chain initiation pathways using surface sites that form methyl radicals eliminates the induction period without influencing the homogeneous product distribution. Methane conversion, however, occurs predominately in the chain transfer regime, within which individual transfer steps and the formation of C2 intermediates become limited by thermodynamic constraints. Catalytic sites alone cannot overcome these constraints. Catalytic membrane reactors with continuous H2 removal remove these thermodynamic obstacles and decrease the required residence time. Reaction rates become limited by homogeneous reactions of C2 products to form C6+ aromatics. Higher delta values lead to subsequent conversion of the desired C2-C10 products to larger polynuclear aromatics. We conclude that catalytic methane pyrolysis at the low temperatures required for restricted chain growth and the elimination of thermodynamics constraints via
Focke, Felix; Haase, Ilka; Fischer, Markus
2011-01-26
Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.
Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario
2010-06-01
Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.
Solan, Eilon; Vieille, Nicolas
2015-01-01
We study irreducible time-homogenous Markov chains with finite state space in discrete time. We obtain results on the sensitivity of the stationary distribution and other statistical quantities with respect to perturbations of the transition matrix. We define a new closeness relation between transition matrices, and use graph-theoretic techniques, in contrast with the matrix analysis techniques previously used.
Directory of Open Access Journals (Sweden)
Ji Yeon Kwon
2013-09-01
Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.
Özenci, Volkan; Patel, Robin; Ullberg, Måns; Strålin, Kristoffer
2018-01-18
Although there are several US Food and Drug Administration (FDA)-approved/cleared molecular microbiology diagnostics for direct analysis of patient samples, all are single target or panel-based tests. There is no FDA-approved/cleared diagnostic for broad microbial detection. Polymerase chain reaction (PCR)/electrospray ionization-mass spectrometry (PCR/ESI-MS), commercialized as the IRIDICA system (Abbott) and formerly PLEX-ID, had been under development for over a decade and had become CE-marked and commercially available in Europe in 2014. Capable of detecting a large number of microorganisms, it was under review at the FDA when, in April 2017, Abbott discontinued it. This turn of events represents not only the loss of a potential diagnostic tool for infectious diseases but may be a harbinger of similar situations with other emerging and expensive microbial diagnostics, especially genomic tests. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Nikhil Moorchung
2011-01-01
Full Text Available Background: Lymphoid malignancies are a heterogeneous group of disorders which may be difficult to differentiate from reactive proliferations even after immunohistochemistry. Polymerase chain reaction (PCR is believed to be a good adjunct tool for diagnosis. Materials and Methods: We examined 24 cases of neoplastic and non-neoplastic lymphoproliferative lesions in this study and evaluated the PCR as an additional tool in the confirmation of the diagnosis. Two different PCR methodologies were evaluated. Results: In the evaluation of the T-cell PCR, it was seen that the correlation using both the commercial kits and the custom-synthesized primers was highly significant at a P value of 0.05. Conclusions: Both the methods showed an excellent concordance for T-cell γ gene rearrangements, However, the same was not seen in the B-cell receptor rearrangements. This may be because of the small sample size or the inability of consensus V primers to recognize complementary DNA sequences in all of the V segments.
Sakuraoka, Yuhki; Sawada, Tokihiko; Shiraki, Takayuki; Park, Kyunghwa; Sakurai, Yuhichiro; Tomosugi, Naohisa; Kubota, Keiichi
2012-07-28
To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC). Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC. Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years. Quantitative PCR was performed. Immunohistochemistry and in situ hybridization for hepcidin were also performed. Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully. The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues. A method of in situ hybridization for hepcidin was established successfully, and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue. We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.
Rensen, Gabriel; Smith, Wayne; Ruzante, Juliana; Sawyer, Mary; Osburn, Bennie; Cullor, James
2005-01-01
A real-time fluorescent polymerase chain reaction assay for detecting prohibited ruminant materials such as bovine meat and bone meal (BMBM) in cattle feed using primers and FRET probes targeting the ruminant specific mitochondrial cytochrome b gene was developed and evaluated on two different types of cattle feed. Common problems involved with PCR based testing of cattle feed include the presence of high levels of PCR inhibitors and the need for certain pre-sample processing techniques in order to perform DNA extractions. We have developed a pre-sample processing technique for extracting DNA from cattle feed which does not require the feed sample to be ground to a fine powder and utilizes materials that are disposed of between samples, thus, reducing the potential of cross contamination. The DNA extraction method utilizes Whatman FTA card technology, is adaptable to high sample throughput analysis and allows for room temperature storage with established archiving of samples of up to 14 years. The Whatman FTA cards are subsequently treated with RNAse and undergo a Chelex-100 extraction (BioRad, Hercules, CA), thus removing potential PCR inhibitors and eluting the DNA from the FTA card for downstream PCR analysis. The detection limit was evaluated over a period of 30 trials on calf starter mix and heifer starter ration feed samples spiked with known concentrations of BMBM. The PCR detection assay detected 0.05% wt/wt BMBM contamination with 100% sensitivity, 100% specificity, and 100% confidence. Concentrations of 0.005% and 0.001% wt/wt BMBM contamination were also detected in both feed types but with varying levels of confidence.
Aysan, Ayse Beyza; Knejzlík, Zdeněk; Ulbrich, Pavel; Šoltys, Marek; Zadražil, Aleš; Štěpánek, František
2017-05-01
The combination of nanoparticles with the polymerase chain reaction (PCR) can have benefits such as easier sample handling or higher sensitivity, but also drawbacks such as loss of colloidal stability or inhibition of the PCR. The present work systematically investigates the interaction of magnetic iron oxide nanoparticles (MIONs) with the PCR in terms of colloidal stability and potential PCR inhibition due to interaction between the PCR components and the nanoparticle surface. Several types of MIONs with and without surface functionalisation by sodium citrate, dextran and 3-aminopropyl-triethoxysilane (APTES) were prepared and characterised by Transmission Electron Microscopy (TEM), dynamic light scattering (DLS) and Fourier Transform Infrared (FT-IR) spectroscopy. Colloidal stability in the presence of the PCR components was investigated both at room temperature and under PCR thermo-cycling. Dextran-stabilized MIONs show the best colloidal stability in the PCR mix at both room and elevated temperatures. Citrate- and APTES-stabilised as well as uncoated MIONs show a comparable PCR inhibition near the concentration 0.1mgml -1 while the inhibition of dextran stabilized MIONs became apparent near 0.5mgml -1 . It was demonstrated that the PCR could be effectively carried out even in the presence of elevated concentration of MIONs up to 2mgml -1 by choosing the right coating approach and supplementing the reaction mix by critical components, Taq DNA polymerase and Mg 2+ ions. Copyright © 2017 Elsevier B.V. All rights reserved.
Rigor in Qualitative Supply Chain Management Research
DEFF Research Database (Denmark)
Goffin, Keith; Raja, Jawwad; Claes, Björn
2012-01-01
, reliability, and theoretical saturation. Originality/value – It is the authors' contention that the addition of the repertory grid technique to the toolset of methods used by logistics and supply chain management researchers can only enhance insights and the building of robust theories. Qualitative studies......Purpose – The purpose of this paper is to share the authors' experiences of using the repertory grid technique in two supply chain management studies. The paper aims to demonstrate how the two studies provided insights into how qualitative techniques such as the repertory grid can be made more...... rigorous than in the past, and how results can be generated that are inaccessible using quantitative methods. Design/methodology/approach – This paper presents two studies undertaken using the repertory grid technique to illustrate its application in supply chain management research. Findings – The paper...
Multi-template polymerase chain reaction.
Kalle, Elena; Kubista, Mikael; Rensing, Christopher
2014-12-01
PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.
International Nuclear Information System (INIS)
Flores, Erico M.M.; Barin, Juliano S.; Mesko, Marcia F.; Knapp, Guenter
2007-01-01
In this review, a general discussion of sample preparation techniques based on combustion reactions in closed vessels is presented. Applications for several kinds of samples are described, taking into account the literature data reported in the last 25 years. The operational conditions as well as the main characteristics and drawbacks are discussed for bomb combustion, oxygen flask and microwave-induced combustion (MIC) techniques. Recent applications of MIC techniques are discussed with special concern for samples not well digested by conventional microwave-assisted wet digestion as, for example, coal and also for subsequent determination of halogens
The Buccaneer software for automated model building. 1. Tracing protein chains.
Cowtan, Kevin
2006-09-01
A new technique for the automated tracing of protein chains in experimental electron-density maps is described. The technique relies on the repeated application of an oriented electron-density likelihood target function to identify likely C(alpha) positions. This function is applied both in the location of a few promising ;seed' positions in the map and to grow those initial C(alpha) positions into extended chain fragments. Techniques for assembling the chain fragments into an initial chain trace are discussed.
Cancino-Faure, Beatriz; Fisa, Roser; Alcover, M. Magdalena; Jimenez-Marco, Teresa; Riera, Cristina
2016-01-01
Molecular techniques based on real-time polymerase chain reaction (qPCR) allow the detection and quantification of DNA but are unable to distinguish between signals from dead or live cells. Because of the lack of simple techniques to differentiate between viable and nonviable cells, the aim of this study was to optimize and evaluate a straightforward test based on propidium monoazide (PMA) dye action combined with a qPCR assay (PMA-qPCR) for the selective quantification of viable/nonviable epimastigotes of Trypanosoma cruzi. PMA has the ability to penetrate the plasma membrane of dead cells and covalently cross-link to the DNA during exposure to bright visible light, thereby inhibiting PCR amplification. Different concentrations of PMA (50–200 μM) and epimastigotes of the Maracay strain of T. cruzi (1 × 105–10 parasites/mL) were assayed; viable and nonviable parasites were tested and quantified by qPCR with a TaqMan probe specific for T. cruzi. In the PMA-qPCR assay optimized at 100 μM PMA, a significant qPCR signal reduction was observed in the nonviable versus viable epimastigotes treated with PMA, with a mean signal reduction of 2.5 logarithm units and a percentage of signal reduction > 98%, in all concentrations of parasites assayed. This signal reduction was also observed when PMA-qPCR was applied to a mixture of live/dead parasites, which allowed the detection of live cells, except when the concentration of live parasites was low (10 parasites/mL). The PMA-qPCR developed allows differentiation between viable and nonviable epimastigotes of T. cruzi and could thus be a potential method of parasite viability assessment and quantification. PMID:27139452
International Nuclear Information System (INIS)
Wang Feng; Peng Xiao-Shi; Liu Shen-Ye; Xu Tao; Kang Dong-Guo
2013-01-01
A study is conducted using a two-dimensional simulation program (Lared-s) with the goal of developing a technique to evaluate the effect of Rayleigh-Taylor growth in a neutron fusion reaction region. Two peaks of fusion reaction rate are simulated by using a two-dimensional simulation program (Lared-s) and confirmed by the experimental results. A neutron temporal diagnostic (NTD) system is developed with a high temporal resolution of ∼ 30 ps at the Shen Guang-III (SG-III) prototype laser facility in China, to measure the fusion reaction rate history. With the shape of neutron reaction rate curve and the spherical harmonic function in this paper, the degree of Rayleigh-Taylor growth and the main source of the neutron yield in our experiment can be estimated qualitatively. This technique, including the diagnostic system and the simulation program, may provide important information for obtaining a higher neutron yield in implosion experiments of inertial confinement fusion
Energy Technology Data Exchange (ETDEWEB)
Marteau, Chantal; Gaillard-Cusin, Francoise; James, Henri [Centre National de la Recherche Scientifique, 45 - Orleans-la-Source (France). Centre de Recherches sur la Chimie de Combustion et des Hautes Temperatures
1978-05-01
Investigation of experimental data related to evolution period exhibited by H/sub 2/-D/sub 2/ exchange process requires to take into account the variation against time of every atomic species -adsorbed or not- implied in the reaction mechanism. The formation of first chain carriers involves: - chemisorption of either gaseous reactant on the surface active centres (..sigma..), e.g.: ..sigma.. + 1/2 H/sub 2/ reversible ..sigma..H; - consecutive generation of atomic species through hetero-homogeneous transfer between chemisorbed species (..sigma..H) and gaseous molecules: ..sigma..H+H/sub 2/..--> sigma..+H/sub 2/+H/sup 0/, ..sigma..H+D/sub 2/..--> sigma..+HD+D/sup 0/. Therefore, it can be shown that the heterogeneous initiation process of a gas phase reaction identifies to a chain linear mechanism. Such an heterogeneous sequence conditions the further proceeding of the homogeneous chain reaction; both evolutions being kinematically connected. Rate constant of hydrogen adsorption on silica glass: ksub(a1) approximately 10/sup 14/ exp(-47/RT)Isup(0,5).molesup(-0,5).S/sup -1/ has been evaluated.
Prestes, Suzane Ribeiro; Guerra, Jorge Augusto de Oliveira; Romero, Gustavo Adolfo Sierra; Magalhaes, Laylah Kelre Costa; Santana, Rosa Amelia Gonçalves; Maciel, Marcel Gonçalves; Custódio, Ana; Barbosa, Maria das Graças Vale; Silveira, Henrique
2015-01-01
In the Americas, mucosal leishmaniasis is primarily associated with infection by Leishmania (Viannia) braziliensis. However, Leishmania (Viannia) guyanensis is another important cause of this disease in the Brazilian Amazon. In this study, we aimed at detecting Leishmaniadeoxyribonucleic acid (DNA) within paraffin-embedded fragments of mucosal tissues, and characterizing the infecting parasite species. We evaluated samples collected from 114 patients treated at a reference center in the Brazilian Amazon by polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analyses. Direct examination of biopsy imprints detected parasites in 10 of the 114 samples, while evaluation of hematoxylin and eosin-stained slides detected amastigotes in an additional 17 samples. Meanwhile, 31/114 samples (27.2%) were positive for Leishmania spp. kinetoplast deoxyribonucleic acid (kDNA) by PCR analysis. Of these, 17 (54.8%) yielded amplification of the mini-exon PCR target, thereby allowing for PCR-RFLP-based identification. Six of the samples were identified as L. (V.) braziliensis, while the remaining 11 were identified as L. (V.) guyanensis. The results of this study demonstrate the feasibility of applying molecular techniques for the diagnosis of human parasites within paraffin-embedded tissues. Moreover, our findings confirm that L. (V.) guyanensisis a relevant causative agent of mucosal leishmaniasis in the Brazilian Amazon.
DEFF Research Database (Denmark)
Xu, Shenzhi; Ai, Xiaomeng; Fang, Jiakun
2017-01-01
Photovoltaic (PV) power generation has made considerable developments in recent years. But its intermittent and volatility of its output has seriously affected the security operation of the power system. In order to better understand the PV generation and provide sufficient data support...... for analysis the impacts, a novel generation method for PV power time series combining decomposition technique and Markov chain theory is presented in this paper. It digs important factors from historical data from existing PV plants and then reproduce new data with similar patterns. In detail, the proposed...... method first decomposes the PV power time series into ideal output curve, amplitude parameter series and random fluctuating component three parts. Then generating daily ideal output curve by the extraction of typical daily data, amplitude parameter series based on the Markov chain Monte Carlo (MCMC...
Direct Reaction Experimental Studies with Beams of Radioactive Tin Ions
Energy Technology Data Exchange (ETDEWEB)
Jones, K. L. [University of Tennessee, Knoxville (UTK); Ahn, S.H. [University of Tennessee, Knoxville (UTK); Allmond, James M [ORNL; Ayres, A. [University of Tennessee, Knoxville (UTK); Bardayan, Daniel W [ORNL; Baugher, T. [Michigan State University, East Lansing; Bazin, D. [Michigan State University, National Superconducting Cyclotron Laboratory (NSCL); Beene, James R [ORNL; Berryman, J. S. [Michigan State University, East Lansing; Bey, A. [University of Tennessee, Knoxville (UTK); Bingham, C. R. [University of Tennessee, Knoxville (UTK); Cartegni, L. [University of Tennessee, Knoxville (UTK); Chae, K. Y. [University of Tennessee, Knoxville (UTK)/Sungkyunkwan University, Korea; Cizewski, J. A. [Rutgers University; Gade, A. [Michigan State University, National Superconducting Cyclotron Laboratory (NSCL); Galindo-Uribarri, Alfredo {nmn} [ORNL; Garcia-Ruiz, R.F. [Instituut voor Kernen Stralingsfysica, KU Leuven, B-3001, Leuven, Belgium; Grzywacz, Robert Kazimierz [ORNL; Howard, Meredith E [ORNL; Kozub, R. L. [Tennessee Technological University (TTU); Liang, J Felix [ORNL; Manning, Brett M [ORNL; Matos, M. [Louisiana State University; McDaniel, S. [Michigan State University, East Lansing; Miller, D. [University of Tennessee, Knoxville (UTK); Nesaraja, Caroline D [ORNL; O' Malley, Patrick [Rutgers University; Padgett, S [University of Tennessee, Knoxville (UTK); Padilla-Rodal, Elizabeth [Universidad Nacional Autonoma de Mexico (UNAM); Pain, Steven D [ORNL; Pittman, S. T. [University of Tennessee (UTK) and Oak Ridge National Laboratory (ORNL); Radford, David C [ORNL; Ratkiewicz, Andrew J [ORNL; Schmitt, Kyle [ORNL; Smith, Michael Scott [ORNL; Stracener, Daniel W [ORNL; Stroberg, S. [Michigan State University, East Lansing; Tostevin, Jeffrey A [ORNL; Varner Jr, Robert L [ORNL; Weisshaar, D. [Michigan State University, East Lansing; Wimmer, K. [Michigan State University, National Superconducting Cyclotron Laboratory (NSCL)/Central Michigan University; Winkler, R. [Michigan State University, East Lansing
2015-01-01
The tin chain of isotopes provides a unique region in which to investigate the evolution of single-particle structure, spreading from N = 50 at Sn-100, through 10 stable isotopes and the N = 82 shell closure at Sn-132 out into the r-process path. Direct reactions performed on radioactive ion beams are sensitive spectroscopic tools for studying exotic nuclei. Here we present one experiment knocking out neutrons from tin isotopes that are already neutron deficient and two reactions that add a neutron to neutron-rich Sn-130. Both techniques rely on selective particle identification and the measurement of gamma rays in coincidence with charged ions. We present the goals of the two experiments and the particle identification for the channels of interest. The final results will be presented in future publications.
Banerjee, Surajita; Biswas, Nibir; Kanti Das, Nilay; Sil, Amrita; Ghosh, Pramit; Hasanoor Raja, Abu Hena; Dasgupta, Sarbani; Kanti Datta, Pijush; Bhattacharya, Basudev
2011-12-01
Diagnosing leprosy is challenging, especially in early-stage cases, and the need for a sensitive diagnostic tool is urgent. Polymerase chain reaction (PCR) holds promise as a simple and sensitive diagnostic tool, but its usefulness in the Indian context requires further evaluation. Slit-skin smear (SSS) remains the conventional method of leprosy detection. Hence, this study was undertaken to evaluate and compare the diagnostic efficacy of PCR versus that of SSS. Punch biopsy of skin and SSS were obtained from the active margins of lesions. Cases were clinically grouped according to whether they were multibacillary (MB) or paucibacillary (PB) and classified into tuberculoid (TT), borderline tuberculoid (BT), borderline lepromatous (BL), lepromatous (LL), histoid, and indeterminate groups after clinicopathological correlation. DNA was extracted from biopsy specimens, and multiplex PCR was carried out incorporating primers intended for the amplification of a specific 372-bp fragment of a repetitive sequence of Mycobacterium leprae DNA. Among 164 patients, PCR was positive in 82.3%. The sensitivity of PCR was significantly greater (P chain reaction had higher sensitivity compared with SSS, especially in diagnostically challenging and PB cases. Thus, the use of this costly but sensitive tool should be restricted to this subgroup, because SSS is sufficiently sensitive in the diagnosis of LL and histoid leprosy. © 2011 The International Society of Dermatology.
Meurs, K M; Fox, P R; Magnon, A L; Liu, S; Towbin, J A
2000-01-01
Viral myocarditis has been suggested as an etiology for cardiomyopathy in several mammalian species. Myocarditis and idiopathic cardiomyopathy have been reported in the domestic cat, although a viral etiology has not been demonstrated. Because of the continuing interest in the potential relationship between viral myocarditis and cardiomyopathy, we evaluated hearts from cats with spontaneous, idiopathic cardiomyopathy for viral genomic material within myocytes by polymerase chain reaction, and for the presence of myocarditis by light microscopy. Thirty-one (31) formalin-fixed hearts from domestic cats who died of idiopathic cardiomyopathy were randomly selected from pathology archives. Seventeen (17) formalin-fixed hearts from healthy cats were similarly selected as normal controls. The polymerase chain reaction (PCR) was used to evaluate myocardial tissue for the presence of viral genome from feline panleukopenia virus, herpes virus, calici virus, and corona virus. Hearts were examined using light microscopy for histologic evidence of myocarditis according to the Dallas criteria. Panleukopenia virus was identified by PCR in 10 of 31 cats with cardiomyopathy but in none of the controls. Neither cardiomyopathic or control cats tested positive by PCR for herpes virus, calici virus, and corona virus. Myocarditis was detected by histologic examination in 18 of 31 cardiomyopathic cats and in none of 17 control cats. Myocarditis and or feline panleukopenia virus genome was detected in felines with idiopathic hypertrophic, dilated, and restrictive cardiomyopathy, suggesting a possible role of viral infection and inflammation in the pathogenesis of cardiomyopathy in this species.
Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum
Directory of Open Access Journals (Sweden)
Ching Giap Tan
2014-09-01
Full Text Available The present study was based on the reverse transcription polymerase chain reaction (RT-PCR of the 16S ribosomal nucleic acid (rRNA of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20–25 h at 37 °C, 22–25 h at 16 °C, and 23–27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h. The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.
Directory of Open Access Journals (Sweden)
Daniela Camargos Costa
2014-02-01
Full Text Available The polymerase chain reaction (PCR-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34 of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.
Chain radiation-chemical oxidation of aromatic amines in polyvinylchloride films
International Nuclear Information System (INIS)
Kolninov, O.V.; Lisovskaya, I.A.; Milinchuk, V.K.
1983-01-01
Radiation-chemical oxidation of tetramethyldiaminediphenylmethane in polyvinylchloride (PVC) and polystyrene (PS) films was investigated in the presence of CBr 4 at 300 K. Radiation yields (G) of 70 and 1 were obtained for an oxidized amine form (Am + ) in PVC and PS, resp. High yields of Am + in PVC matrix indicate the chain character of an oxidation reaction. Triplet states, which form exciplexes with CBr 4 were established to participate in oxidation reactions. The kinetic scheme suggested for the chain radiation oxidation of Am takes into account energy transfer, formation and degradation of the excited states of molecules resulting in the initiation and propagation of the chain on the account of active particles. (author)
Pournajaf, Abazar; Rajabnia, Ramazan; Sedighi, Mansour; Kassani, Aziz; Moqarabzadeh, Vahid; Lotfollahi, Lida; Ardebilli, Abdollah; Emadi, Behzad; Irajian, Gholamreza
2016-01-01
This study aimed to determine the prevalence, and virulence factors of Listeria monocytogenes isolated from various samples by multiplex polymerase chain reaction (MPCR). A total of 617 isolates were obtained and MPCR was employed for detection of the inlA, inlC, and inlJ genes. L. monocytogenes was detected in 46 (7.45%) of the 617 specimens. inlA, inlC, and inlJ were detected in 100%, 76.26%, and 71% isolates, respectively. This study validated MPCR in the analysis and rapid detection of L. monocytogenes. The role of the genes in pathogenesis of the strains can also be affirmed.
Ionothermal synthesis and crystal structures of metal phosphate chains
International Nuclear Information System (INIS)
Wragg, David S.; Le Ouay, Benjamin; Beale, Andrew M.; O'Brien, Matthew G.; Slawin, Alexandra M.Z.; Warren, John E.; Prior, Timothy J.; Morris, Russell E.
2010-01-01
We have prepared isostructural aluminium and gallium phosphate chains by ionothermal reactions in 1-ethyl-3-methylimidazolium bromide and 1-ethylpyridinium bromide under a variety of conditions. The chains can be prepared as pure phases or along with three dimensional framework phases. The chains are favoured at shorter heating times and the crystallinity can be improved by addition of transition metal acetates and amines which are not included in the final structure. The chain can be prepared with or without the presence of hydrofluoric acid. - Graphical abstract: Chain structures prepared from ionic liquid solvents under a wide variety of synthesis conditions.
DEFF Research Database (Denmark)
Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte
2013-01-01
steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence......We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...
Chain Dynamics in Magnetorheological Suspensions
Gast, A. P.; Furst, E. M.
1999-01-01
fluctuating chains of dipolar particles. Resolving this issue would contribute greatly to the understanding of these interesting and important materials. We have begun to test the predictions of the HT model by both examining the dynamics of individual chains and by measuring the forces between dipolar chains directly to accurately and quantitatively assess the interactions that they experience. To do so, we employ optical trapping techniques and video-microscopy to manipulate and observe our samples on the microscopic level. With these techniques, it is possible to observe chains that are fluctuating freely in three-dimensions, independent of interfacial effects. More importantly, we are able to controllably observe the interactions of two chains at various separations to measure the force-distance profile. The techniques also allow us to study the mechanical properties of individual chains and chain clusters. Our work to this point has focused on reversibly-formed dipolar chains due to field induced dipoles where the combination of this chaining, the dipolar forces, and the hydrodynamic interactions that dictate the rheology of the suspensions. One can envision, however, many situations where optical, electronic, or rheological behavior may be optimized with magneto-responsive anisotropic particles. Chains of polarizable particles may have the best properties as they can coil and flex in the absence of a field and stiffen and orient when a field is applied. We have recently demonstrated a synthesis of stable, permanent paramagnetic chains by both covalently and physically linking paramagnetic colloidal particles. The method employed allows us to create monodisperse chains of controlled length. We observed the stability, field-alignment, and rigidity of this new class of materials. The chains may exhibit unique rheological properties in an applied magnetic field over isotropic suspensions of paramagnetic particles. They are also useful rheological models as bead
Spectroscopy of element 115 decay chains
Energy Technology Data Exchange (ETDEWEB)
Rudolph, Dirk [Lund University, Sweden; Forsberg, U. [Lund University, Sweden; Golubev, P. [Lund University, Sweden; Sarmiento, L. G. [Lund University, Sweden; Yakushev, A. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Andersson, L.-L. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Di Nitto, A. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Duehllmann, Ch. E. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Gates, J. M. [Lawrence Berkeley National Laboratory (LBNL); Gregorich, K. E. [Lawrence Berkeley National Laboratory (LBNL); Gross, Carl J [ORNL; Hessberger, F. P. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Herzberg, R.-D [University of Liverpool; Khuyagbaatar, J. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Kratz, J. V. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Rykaczewski, Krzysztof Piotr [ORNL; Schaedel, M. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Aberg, S. [Lund University, Sweden; Ackermann, D. [GSI-Hemholtzzentrum fur Schwerionenforschung, Darmstadt, Germany; Block, M. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Brand, H. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Carlsson, B. G. [Lund University, Sweden; Cox, D. [University of Liverpool; Derkx, X. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Eberhardt, K. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Even, J. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Fahlander, C. [Lund University, Sweden; Gerl, J. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Jaeger, E. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Kindler, B. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Krier, J. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Kojouharov, I. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Kurz, N. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Lommel, B. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Mistry, A. [University of Liverpool; Mokry, C. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Nitsche, H. [Lawrence Berkeley National Laboratory (LBNL); Omtvedt, J. P. [Paul Scherrer Institut, Villigen, Switzerland; Papadakis, P. [University of Liverpool; Ragnarsson, I. [Lund University, Sweden; Runke, J. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Schaffner, H. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Schausten, B. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Thoerle-Pospiech, P. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Torres, T. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Traut, T. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Trautmann, N. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Tuerler, A. [Paul Scherrer Institut, Villigen, Switzerland; Ward, A. [University of Liverpool; Ward, D. E. [Lund University, Sweden; Wiehl, N. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany
2013-01-01
A high-resolution a, X-ray and -ray coincidence spectroscopy experiment was conducted at the GSI Helmholtzzentrum fu r Schwerionenforschung. Thirty correlated a-decay chains were detected following the fusion-evaporation reaction 48Ca + 243Am. The observations are consistent with previous assignments of similar decay chains to originate from element Z = 115. The data includes first candidates of fingerprinting the decay step Mt --> Bh with characteristic X rays. For the first time, precise spectroscopy allows the derivation of excitation schemes of isotopes along the decay chains starting with elements Z > 112. Comprehensive Monte-Carlo simulations accompany the data analysis. Nuclear structure models provide a first level interpretation.
Energy Technology Data Exchange (ETDEWEB)
Chandler, D.W. [Sandia National Laboratories, Livermore, CA (United States)
1993-12-01
Over the past few years the author has investigated the photochemistry of small molecules using the photofragment imaging technique. Bond energies, spectroscopy of radicals, dissociation dynamics and branching ratios are examples of information obtained by this technique. Along with extending the technique to the study of bimolecular reactions, efforts to make the technique as quantitative as possible have been the focus of the research effort. To this end, the author has measured the bond energy of the C-H bond in acetylene, branching ratios in the dissociation of HI, the energetics of CH{sub 3}Br, CD{sub 3}Br, C{sub 2}H{sub 5}Br and C{sub 2}H{sub 5}OBr dissociation, and the alignment of the CD{sub 3} fragment from CD{sub 3}I photolysis. In an effort to extend the technique to bimolecular reactions the author has studied the reaction of H with HI and the isotopic exchange reaction between H and D{sub 2}.
Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Cesare Bonacina
2010-01-01
Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.
Approximate quantum Markov chains
Sutter, David
2018-01-01
This book is an introduction to quantum Markov chains and explains how this concept is connected to the question of how well a lost quantum mechanical system can be recovered from a correlated subsystem. To achieve this goal, we strengthen the data-processing inequality such that it reveals a statement about the reconstruction of lost information. The main difficulty in order to understand the behavior of quantum Markov chains arises from the fact that quantum mechanical operators do not commute in general. As a result we start by explaining two techniques of how to deal with non-commuting matrices: the spectral pinching method and complex interpolation theory. Once the reader is familiar with these techniques a novel inequality is presented that extends the celebrated Golden-Thompson inequality to arbitrarily many matrices. This inequality is the key ingredient in understanding approximate quantum Markov chains and it answers a question from matrix analysis that was open since 1973, i.e., if Lieb's triple ma...
Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria
2003-12-15
Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.
Directory of Open Access Journals (Sweden)
Pooja H. Gupta
2015-05-01
Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.
Multi-template polymerase chain reaction
Directory of Open Access Journals (Sweden)
Elena Kalle
2014-12-01
Full Text Available PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.
Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T
2002-03-01
Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.
Directory of Open Access Journals (Sweden)
Carlo Mengoli
2009-06-01
Full Text Available Background Trichomonas vaginalis is the most common nonviral sexually trasmitted diseases (STDs agent. For females, the diagnostic gold standard is the culture of vaginal swab, which is labour-exacting.The direct microscopic examination of vaginal secretions is the most used approach, but its sensitivity depends on the skill of the observer. Objectives We evaluated an original real-time TaqMan-based Polymerase Chain Reaction (PCR technique.The scope of the study was to confirm the effectiveness of the molecular approach in a clinical context and to explore its relevance to an epidemiological investigation. Study Design a ß-tubulin gene was chosen as target sequence.The assay was designed to exploit the quantitative potential of the TaqMan procedure.The population sample was 583 adult females presenting at the Service from January 2005 to December 2005.Three vaginal swabs were collected from each patient, one for wet mount microscopy, one for broth culture, and one for the molecular assay. Results The prevalence was 3.3% (culture, 3.1% (microscopy, 3.8% (PCR.An excess risk was detected in the immigrant population (risk ratio by PCR = 28. Conclusions The molecular approach was the most accurate way to detect the protozoon.The real-time PCR is convenient in a busy laboratory, provided the necessary equipment is available, and it is suitable for epidemiological investigation.
Directory of Open Access Journals (Sweden)
Camila Appolinário
2015-09-01
Full Text Available Rabies virus (RABV isolated from different mammals seems to have unique characteristics that influence the outcome of infection. RABV circulates in nature and is maintained by reservoirs that are responsible for the persistence of the disease for almost 4000 years. Considering the different pattern of pathogenicity of RABV strains in naturally and experimentally infected animals, the aim of this study was to analyze the characteristics of RABV variants isolated from the main Brazilian reservoirs, being related to a dog (variant 2, Desmodus rotundus (variant 3, crab eating fox, marmoset, and Myotis spp. Viral replication in brain tissue of experimentally infected mouse was evaluated by two laboratory techniques and the results were compared to clinical evolution from five RABV variants. The presence of the RABV was investigated in brain samples by fluorescent antibody test (FAT and real time polymerase chain reaction (qRT-PCR for quantification of rabies virus nucleoprotein gene (N gene. Virus replication is not correlated with clinical signs and evolution. The pattern of FAT is associated with RABV replication levels. Virus isolates from crab eating fox and marmoset had a longer evolution period and higher survival rate suggesting that the evolution period may contribute to the outcome. RABV virus variants had independent characteristics that determine the clinical evolution and survival of the infected mice.
Lee, Hyun-A; Hong, Sunhwa; Chung, Yungho; Kim, Okjin
2011-09-01
Eimeria tenella and Eimeria maxima are important pathogens causing intracellular protozoa infections in laboratory avian animals and are known to affect experimental results obtained from contaminated animals. This study aimed to find a fast, sensitive, and efficient protocol for the molecular identification of E. tenella and E. maxima in experimental samples using chickens as laboratory avian animals. DNA was extracted from fecal samples collected from chickens and polymerase chain reaction (PCR) analysis was employed to detect E. tenella and E. maxima from the extracted DNA. The target nucleic acid fragments were specifically amplified by PCR. Feces secreting E. tenella and E. maxima were detected by a positive PCR reaction. In this study, we were able to successfully detect E. tenella and E. maxima using the molecular diagnostic method of PCR. As such, we recommended PCR for monitoring E. tenella and E. maxima in laboratory avian facilities.
Directory of Open Access Journals (Sweden)
M. Usta
2005-08-01
Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.
DEFF Research Database (Denmark)
Bu, Minqiang; R. Perch-Nielsen, Ivan; Sørensen, Karen Skotte
steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature dependent fluorescence......We present a new temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with external heater and temperature sensor. The method employs optimized temperature overshooting and undershooting...
Optimal scope of supply chain network & operations design
Ma, N.
2014-01-01
The increasingly complex supply chain networks and operations call for the development of decision support systems and optimization techniques that take a holistic view of supply chain issues and provide support for integrated decision-making. The economic impacts of optimized supply chain are
Energy Technology Data Exchange (ETDEWEB)
Niu, Zhijun; Zhao, Yang; Sun, Wei; Shi, Suqing, E-mail: shisq@nwu.edu.cn; Gong, Yongkuan
2016-11-15
Highlights: • Biomimetic surface modification of PP was successfully conducted by integrating mussel-inspired technology, thiol chemistry and cell outer membranes-like structures. • The resultant biomimetic surface exhibits good interface and surface stability. • The obvious suppression of protein adsorption and platelet adhesion is also achieved. • The residue thoil groups on the surface could be further functionalized. - Abstract: Biomimetic surface modification of polypropylene (PP) is conducted by surface chain transfer reaction based on the mussel-inspired versatile adhesion technology and thiol chemistry, using 2-methacryloyloxyethylphosphorylcholine (MPC) as a hydrophilic monomer mimicking the cell outer membrane structure and 2,2-azobisisobutyronitrile (AIBN) as initiator in ethanol. A layer of polydopamine (PDA) is firstly deposited onto PP surface, which not only offers good interfacial adhesion with PP, but also supplies secondary reaction sites (-NH{sub 2}) to covalently anchor thiol groups onto PP surface. Then the radical chain transfer to surface-bonded thiol groups and surface re-initiated polymerization of MPC lead to the formation of a thin layer of polymer brush (PMPC) with cell outer membrane mimetic structure on PP surface. X-ray photoelectron spectrophotometer (XPS), atomic force microscopy (AFM) and water contact angle measurements are used to characterize the PP surfaces before and after modification. The protein adsorption and platelet adhesion experiments are also employed to evaluate the interactions of PP surface with biomolecules. The results show that PMPC is successfully grafted onto PP surface. In comparison with bare PP, the resultant PP-PMPC surface exhibits greatly improved protein and platelet resistance performance, which is the contribution of both increased surface hydrophilicity and zwitterionic structure. More importantly, the residue thiol groups on PP-PMPC surface create a new pathway to further functionalize such
International Nuclear Information System (INIS)
Niu, Zhijun; Zhao, Yang; Sun, Wei; Shi, Suqing; Gong, Yongkuan
2016-01-01
Highlights: • Biomimetic surface modification of PP was successfully conducted by integrating mussel-inspired technology, thiol chemistry and cell outer membranes-like structures. • The resultant biomimetic surface exhibits good interface and surface stability. • The obvious suppression of protein adsorption and platelet adhesion is also achieved. • The residue thoil groups on the surface could be further functionalized. - Abstract: Biomimetic surface modification of polypropylene (PP) is conducted by surface chain transfer reaction based on the mussel-inspired versatile adhesion technology and thiol chemistry, using 2-methacryloyloxyethylphosphorylcholine (MPC) as a hydrophilic monomer mimicking the cell outer membrane structure and 2,2-azobisisobutyronitrile (AIBN) as initiator in ethanol. A layer of polydopamine (PDA) is firstly deposited onto PP surface, which not only offers good interfacial adhesion with PP, but also supplies secondary reaction sites (-NH 2 ) to covalently anchor thiol groups onto PP surface. Then the radical chain transfer to surface-bonded thiol groups and surface re-initiated polymerization of MPC lead to the formation of a thin layer of polymer brush (PMPC) with cell outer membrane mimetic structure on PP surface. X-ray photoelectron spectrophotometer (XPS), atomic force microscopy (AFM) and water contact angle measurements are used to characterize the PP surfaces before and after modification. The protein adsorption and platelet adhesion experiments are also employed to evaluate the interactions of PP surface with biomolecules. The results show that PMPC is successfully grafted onto PP surface. In comparison with bare PP, the resultant PP-PMPC surface exhibits greatly improved protein and platelet resistance performance, which is the contribution of both increased surface hydrophilicity and zwitterionic structure. More importantly, the residue thiol groups on PP-PMPC surface create a new pathway to further functionalize such
Directory of Open Access Journals (Sweden)
Yong-Zhong Wang
Full Text Available OBJECTIVES: Detection of mutations associated to nucleos(tide analogs and hepatitis B virus (HBV genotyping are essential for monitoring treatment of HBV infection. We developed a multiplex polymerase chain reaction-ligase detection reaction (PCR-LDR assay for the rapid detection of HBV genotypes and mutations associated with lamivudine, adefovir, and telbivudine resistance in HBV-infected patients. METHODS: HBV templates were amplified by PCR, followed by LDR and electrophoresis on a sequencer. The assay was evaluated using plasmids that contained wild-type or mutant HBV sequences and 216 clinical samples. RESULTS: The PCR-LDR assay and sequencing gave comparable results for 158 of the 216 samples (73.1% with respect to mutation detection and genotyping. Complete agreement between the two methods was observed for all the samples (100% at codon 180 and codon 204. Concordant results were observed for 99.4% of the 158 samples at codon 181 and 98.7% at codon 236. The genotyping results were completely concordant between the PCR-LDR assay and sequencing. The PCR-LDR assay could detect a proportion of 1% mutant plasmid in a background of wild-type plasmid. CONCLUSION: The PCR-LDR assay is sensitive and specific for detection of HBV genotypes and drug resistance mutations, and could be helpful for decision making in the treatment of HBV infection.
Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M
2008-09-01
Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.
Ground reaction forces produced by two different hockey skating arm swing techniques.
Hayward-Ellis, Julie; Alexander, Marion J L; Glazebrook, Cheryl M; Leiter, Jeff
2017-10-01
The arm swing in hockey skating can have a positive effect on the forces produced by each skate, and the resulting velocity from each push off. The main purpose of this study was to measure the differences in ground reaction forces (GRFs) produced from an anteroposterior versus a mediolateral style hockey skating arm swing. Twenty-four elite-level female hockey players performed each technique while standing on a ground-mounted force platform, and all trials were filmed using two video cameras. Force data was assessed for peak scaled GRFs in the frontal and sagittal planes, and resultant GRF magnitude and direction. Upper limb kinematics were assessed from the video using Dartfish video analysis software, confirming that the subjects successfully performed two distinct arm swing techniques. The mediolateral arm swing used a mean of 18.38° of glenohumeral flexion/extension and 183.68° of glenohumeral abduction/adduction while the anteroposterior technique used 214.17° and 28.97° respectively. The results of this study confirmed that the mediolateral arm swing produced 37% greater frontal plane and 33% less sagittal plane GRFs than the anteroposterior arm swing. The magnitudes of the resultant GRFs were not significantly different between the two techniques; however, the mediolateral technique produced a resultant GRF with a significantly larger angle from the direction of travel (44.44°) as compared to the anteroposterior technique (31.60°). The results of this study suggest that the direction of GRFs produced by the mediolateral arm swing more closely mimic the direction of lower limb propulsion during the skating stride.
Design of Closed Loop Supply Chains
H.R. Krikke (Harold); J.M. Bloemhof-Ruwaard (Jacqueline); L.N. van Wassenhove (Luk)
2001-01-01
textabstractIncreased concern for the environment has lead to new techniques to design products and supply chains that are both economically and ecologically feasible. This paper deals with the product - and corresponding supply chain design for a refrigerator. Literature study shows that there are
Energy Technology Data Exchange (ETDEWEB)
Howell, C.R.; Tornow, W.; Pfuetzner, H.G.; Li Anli; Roberts, M.L.; Murphy, K.; Felsher, P.D.; Weisel, G.J.; Naqvi, A.; Walter, R.L. (Duke Univ., Durham, NC (USA) Triangle Universities Nuclear Lab., Durham, NC (USA)); Lambert, J.M.; Treado, P.A. (Georgetown Univ., Washington, DC (USA). Dept. of Physics); Slaus, I. (Institut Rudjer Boskovic, Zagreb (Yugoslavia))
1990-05-10
Experimental methods to measure the vector analyzing powers over a broad range of kinematic configurations in the n-d breakup reaction have been developed at TUNL. These techniques employ the polarized beam facilities at TUNL and use the {sup 2}H(d vector, n vector){sup 3}He reaction as a source of low-energy polarized neutrons. Our methods permit measurements to a high statistical accuracy over a large fraction of three-nucleon phase space. The techniques are described and experimental spectra along with kinematic calculations are presented. (orig.).
Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong
2015-01-01
The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.
Directory of Open Access Journals (Sweden)
Lai-yu Kwok
Full Text Available The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota.
International Nuclear Information System (INIS)
Tang Yabing; Xing Da; Zhu Debin; Liu Jinfeng
2007-01-01
Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity
Five years' experience of classical swine fever polymerase chain reaction ring trials in France.
Po, F; Le Dimna, M; Le Potier, M F
2011-12-01
Since 2004, the French National Reference Laboratory for classical swine fever (CSF) has conducted an annual proficiency test (PT) to evaluate the ability of local veterinary laboratories to perform real-time polymerase chain reaction (PCR) for CSF virus. The results of five years of testing (2004-2008) are described here. The PT was conducted under blind conditions on 20 samples. The same batch of samples was used for all five years. The number of laboratories that analysed the samples increased from four in 2004 to 13 in 2008. The results of the PT showed the following: cross-contamination between samples and deficiencies in RNA preparation can occur even in experienced laboratories; sample homogeneity should be checked carefully before selection; samples stored at-80 degrees C for several years remain stable; and poor shipment conditions do not damage the samples with regard to detection of CSF virus genome. These results will enable redesign of the panel to improve the overall quality of the PT, which will encourage laboratories to check and improve their PCR procedures and expertise. This is an excellent way to determine laboratory performance.
Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton
2003-02-01
A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.
Directory of Open Access Journals (Sweden)
Milić Nenad
2010-01-01
Full Text Available Examinations were performed on 65 samples of nasal smeas taken from calves and young cows with clinical symptoms of respiratory infection to determine the presence of the bovine herpes virus 1 using parallel implementation of molecular and standard methods of virological diagnostics. The appearance of a cytopathogenic effect (CPE was not established in inoculated cell lines 24h, 48h and 72h following inoculation, or after two successive passages of the examined material sample through these cell lines. The application of polymerize chain reaction (PCR using a primer for glucoprotein B and thymidine - kinasis, established the presence of bovine herpes virus 1 nucleic acid in one sample of a bovine nasal smear, while the presence of this virus was established in three samples in an examination of the nasal smear samples using the Real-Time PCR method.
Efunshile, Michael A; Ngwu, Bethrand A F; Kurtzhals, Jørgen A L; Sahar, Sumrin; König, Brigitte; Stensvold, Christen R
2015-08-01
Diarrhea remains the second largest killer of children worldwide, and Nigeria ranks number two on the list of global deaths attributable to diarrhea. Meanwhile, prevalence studies on potentially diarrheagenic protozoa in asymptomatic carriers using molecular detection methods remain scarce in sub-Saharan countries. To overcome sensitivity issues related to microscopic detection and identification of cysts in stool concentrates, real-time polymerase chain reaction (PCR) was used to analyze genomic DNAs extracted from stool samples from 199 healthy school children for Entamoeba histolytica, E. dispar, Giardia intestinalis, and Cryptosporidium. Questionnaires were administered for epidemiological data collection. E. histolytica was not detected in any of the samples, whereas Giardia (37.2%), E. dispar (18.6%), and Cryptosporidium (1%) were found. Most of the children sourced their drinking water from community wells (91%), while the majority disposed of feces in the bush (81.9%). Our study is the first to use real-time PCR to evaluate the epidemiology of E. histolytica, Giardia, and Cryptosporidium in Nigeria where previous studies using traditional diagnostic techniques have suggested higher and lower carriage rates of E. histolytica and Giardia, respectively. It is also the first study to accurately identify the prevalence of common potentially diarrheagenic protozoa in asymptomatic carriers in sub-Saharan Africa. © The American Society of Tropical Medicine and Hygiene.
Energy Technology Data Exchange (ETDEWEB)
Stranks, D. R.; Yandell, J. R. [University of Adelaide, Adelaide (Australia)
1965-10-15
, which may be observed in rigorously pure reactant solutions. However, in solutions containing micromolar concentrations of impurities, this exponent can rise to 0.70 owing to the importance of the scavenging reaction Tl{sup 2}+ + S ->Tl{sup +} (or Tl{sup 3+}) + S'. The short lifetime of Tl{sup 2+} (probably milliseconds) has so far prevented the measurement of the rate of the Tl{sup 2+} disproportionation reaction by rotating sector techniques. The relative rates of these electron-transfer reactions are discussed in terms of electron-tunnelling theories. The observed primary quantum yield for the reaction Tl{sup 3+}. OH{sup -} + hv -> Tl{sup 2+} + OH is shown to be consistent with the Noyes theory of diffusion of geminate radicals. (author) [French] L'absorption d'une lumiere de longueur d'onde appropriee peut considerablement accelerer la vitesse d'un echange deux electrons. L'absorption avec transfert de charges produit un etat d'oxydation intermediaire auquel est due la propagation d'une reaction en chaine entre les deux etats d'oxydation stables. Les auteurs etablissent les equations cinetiques generales pour les systemes d'echange impliquant une propagation en chaine et une terminaison soit lineaire soit quadratique. Ils demontrent que la relation de dependance entre le rendement quantique observe, d'une part, et les concentrations en corps reagissants et l'intensite de la lumiere absorbee, d'autre part, est plus complexe que dans l'hypothese admise jusqu'ici. En principe, une etude cinetique portant sur un tel systeme d'echange devrait tendrea evaluer le rendement quantique primaire pour le processus d'absorption initial avec transfert de charge, les vitesses du transfert d'electrons entre chacun des deux etats d'oxydation stables et l'etat intermediaire, ainsi que la vitesse de dismutation de l'etat d'oxydation intermediaire. Ces considerations generales sont illustrees par les resultats d'une etude experimentale sur le systeme Tl{sup I}-Tl{sup III}. Pour
Directional Track Selection Technique in CR39 SSNTD for lowyield reaction experiments
Ingenito, Francesco; Andreoli, Pierluigi; Batani, Dimitri; Bonasera, Aldo; Boutoux, Guillaume; Burgy, Frederic; Cipriani, Mattia; Consoli, Fabrizio; Cristofari, Giuseppe; De Angelis, Riccardo; Di Giorgio, Giorgio; Ducret, Jean Eric; Giulietti, Danilo; Jakubowska, Katarzyna
2018-01-01
There is a great interest in the study of p-11B aneutronic nuclear fusion reactions, both for energy production and for determination of fusion cross-sections at low energies. In this context we performed experiments at CELIA in which energetic protons, accelerated by the laser ECLIPSE, were directed toward a solid Boron target. Because of the small cross-sections at these energies the number of expected reactions is low. CR39 Solid-State Nuclear Track Detectors (SSNTD) were used to detect the alpha particles produced. Because of the low expected yield, it is difficult to discriminate the tracks due to true fusion products from those due to natural background in the CR39. To this purpose we developed a methodology of particle recognition according to their direction with respect to the detector normal, able to determine the position of their source. We applied this to the specific experiment geometry, so to select from all the tracks those due to particles coming from the region of interaction between accelerated protons and solid boron target. This technique can be of great help on the analysis of SSNTD in experiments with low yield reactions, but can be also generally applied to any experiment where particles reach the track detector with known directions, and for example to improve the detection limit of particle spectrometers using CR39.
Popescu, Gabriel Adrian; Serban, Roxana; Pistol, Adriana; Niculcea, Andreea; Preda, Andreea; Lemeni, Daniela; Macovei, Ioana Sabina; Tălăpan, Daniela; Rafila, Alexandru; Florea, Dragoş
2018-03-15
To investigate the epidemiology of Clostridium difficile infection in Romanian hospitals. A survey was conducted at nine hospitals throughout Romania between November 2013 and February 2014. The survey identified 393 patients with Clostridium difficile infection. The median age was 67 years (range: 2-94 years); 56% of patients were aged >65 years. The mean prevalence of Clostridium difficile infection was 5.2 cases per 10.000 patient-days. The highest prevalences were 24.9 and 20 per 10.000 patient-days in hospitals specializing in gastroenterology and infectious diseases, respectively. Clostridium difficile infections were health care-associated in 70.5% patients and community-acquired in 10.2%. The origin was not determined in 19.3%. Clostridium difficile infection was severe in 12.3% of patients, and the in-hospital all-cause mortality was 8.8%. Polymerase chain reaction ribotype 027 had the highest prevalence in all participating hospitals and represented 82.6% of the total ribotyped isolates. The minimum inhibitory concentration of moxifloxacin was >4 μg/mL for 59 of 80 tested isolates (73.8%). Of 59 isolates, 54 were highly resistant to moxifloxacin (minimum inhibitory concentration ≥32 μg/mL), and the majority were polymerase chain reaction ribotype 027 (pClostridium difficile infections in Romania. In some specialized hospitals, the prevalence of Clostridium difficile infection was higher than the European mean prevalence, and this demonstrates the need for strict adherence to infection control programs.
Regeneration and general Markov chains
Directory of Open Access Journals (Sweden)
Vladimir V. Kalashnikov
1994-01-01
Full Text Available Ergodicity, continuity, finite approximations and rare visits of general Markov chains are investigated. The obtained results permit further quantitative analysis of characteristics, such as, rates of convergence, continuity (measured as a distance between perturbed and non-perturbed characteristics, deviations between Markov chains, accuracy of approximations and bounds on the distribution function of the first visit time to a chosen subset, etc. The underlying techniques use the embedding of the general Markov chain into a wide sense regenerative process with the help of splitting construction.
Directory of Open Access Journals (Sweden)
Abazar Pournajaf
Full Text Available Abstract INTRODUCTION: This study aimed to determine the prevalence, and virulence factors of Listeria monocytogenes isolated from various samples by multiplex polymerase chain reaction (MPCR. METHODS: A total of 617 isolates were obtained and MPCR was employed for detection of the inlA, inlC, and inlJ genes. RESULTS: L. monocytogenes was detected in 46 (7.45% of the 617 specimens. inlA, inlC, and inlJ were detected in 100%, 76.26%, and 71% isolates, respectively. CONCLUSIONS: This study validated MPCR in the analysis and rapid detection of L. monocytogenes. The role of the genes in pathogenesis of the strains can also be affirmed.
Directory of Open Access Journals (Sweden)
Mini P Singh
2017-01-01
Full Text Available Detecting high-risk-human papillomavirus (HPV types has become an integral part of the cervical cancer screening programmes. This study aimed to develop a multiplex polymerase chain reaction (PCR for identification of HPV types 16 and 18 along with the beta globin gene in formalin-fixed and paraffin-embedded cervical biopsy specimens. A total of 59 samples from patients with cervical abnormalities were tested. HPV 16 positivity was 50% in cervical cancers and 52.9% in cervical intraepithelial neoplasia. Our multiplex PCR protocol can be used as a simple and cost-effective tool for high-risk-HPV detection in cervical cancer screening programmes.
Directory of Open Access Journals (Sweden)
Jobin Thomas
2014-11-01
Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.
Directory of Open Access Journals (Sweden)
Richard Atherton
2013-06-01
Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.
Shahabpoor, Erfan; Pavic, Aleksandar
2017-09-12
Monitoring natural human gait in real-life environments is essential in many applications, including quantification of disease progression, monitoring the effects of treatment, and monitoring alteration of performance biomarkers in professional sports. Nevertheless, developing reliable and practical techniques and technologies necessary for continuous real-life monitoring of gait is still an open challenge. A systematic review of English-language articles from scientific databases including Scopus, ScienceDirect, Pubmed, IEEE Xplore, EBSCO and MEDLINE were carried out to analyse the 'accuracy' and 'practicality' of the current techniques and technologies for quantitative measurement of the tri-axial walking ground reactions outside the laboratory environment, and to highlight their strengths and shortcomings. In total, 679 relevant abstracts were identified, 54 full-text papers were included in the paper and the quantitative results of 17 papers were used for meta-analysis and comparison. Three classes of methods were reviewed: (1) methods based on measured kinematic data; (2) methods based on measured plantar pressure; and (3) methods based on direct measurement of ground reactions. It was found that all three classes of methods have competitive accuracy levels with methods based on direct measurement of the ground reactions showing highest accuracy while being least practical for long-term real-life measurement. On the other hand, methods that estimate ground reactions using measured body kinematics show highest practicality of the three classes of methods reviewed. Among the most prominent technical and technological challenges are: (1) reducing the size and price of tri-axial load-cells; (2) improving the accuracy of orientation measurement using IMUs; (3) minimizing the number and optimizing the location of required IMUs for kinematic measurement; (4) increasing the durability of pressure insole sensors, and (5) enhancing the robustness and versatility of the
Directory of Open Access Journals (Sweden)
Erfan Shahabpoor
2017-09-01
Full Text Available Monitoring natural human gait in real-life environments is essential in many applications, including quantification of disease progression, monitoring the effects of treatment, and monitoring alteration of performance biomarkers in professional sports. Nevertheless, developing reliable and practical techniques and technologies necessary for continuous real-life monitoring of gait is still an open challenge. A systematic review of English-language articles from scientific databases including Scopus, ScienceDirect, Pubmed, IEEE Xplore, EBSCO and MEDLINE were carried out to analyse the ‘accuracy’ and ‘practicality’ of the current techniques and technologies for quantitative measurement of the tri-axial walking ground reactions outside the laboratory environment, and to highlight their strengths and shortcomings. In total, 679 relevant abstracts were identified, 54 full-text papers were included in the paper and the quantitative results of 17 papers were used for meta-analysis and comparison. Three classes of methods were reviewed: (1 methods based on measured kinematic data; (2 methods based on measured plantar pressure; and (3 methods based on direct measurement of ground reactions. It was found that all three classes of methods have competitive accuracy levels with methods based on direct measurement of the ground reactions showing highest accuracy while being least practical for long-term real-life measurement. On the other hand, methods that estimate ground reactions using measured body kinematics show highest practicality of the three classes of methods reviewed. Among the most prominent technical and technological challenges are: (1 reducing the size and price of tri-axial load-cells; (2 improving the accuracy of orientation measurement using IMUs; (3 minimizing the number and optimizing the location of required IMUs for kinematic measurement; (4 increasing the durability of pressure insole sensors, and (5 enhancing the robustness and