WorldWideScience

Sample records for chain reaction products

  1. Chain reaction

    Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)

  2. Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

    Dewit, D.; Wootton, M.; Allan, B; Steyn, L

    1993-01-01

    A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not c...

  3. Chain Reaction Polymerization.

    McGrath, James E.

    1981-01-01

    The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

  4. Detection of Staphylococcus aureus in Dairy Products by Polymerase Chain Reaction Assay

    YANG Yang; SU Xu-dong; YUAN Yao-wu; KANG Chun-yu; LI Ying-jun; ZHANG wei; ZHONG Xiao-ying

    2007-01-01

    A polymerase chain reaction (PCR) assay was employed for direct detection of Staphylococcus aureus without enrichment in dairy products. A solvent extraction procedure was successfully modified for the extraction of Staphylococcus aureus DNA from artificially contaminated whole milk, skim milk, and cheese. A primer targeting the thermostable nuclease gene (nuc) was used in the PCR. A DNA fragment of 279 bp was amplified. The PCR product was confirmed by DNA sequencing. In this study, the PCR, GB- 4789.10-94, Perifilm RSA.Count Plate, and Baird-Parker + RPF Agar were compared.The sensitivity of the PCR was 10 CFU mL-1 of whole milk, skim milk, and 55 CFU g-1 of cheese. The developed methodology allowed for detection of Staphylococcus aureus in dairy products in less than 6 h. The time taken for the development of this PCR assay was 12-24 h, less than the time taken by the general PCR assay using the enrichment method, and the coincidence rate of this developed PCR was 94.3%, the sensitivity was 100%. It was a rapid, sensitive, and effective method for PCR to detect Staphylococcus aureus in milk and milk products.

  5. Polymerase chain reaction

    Gaurav Solanki

    2015-01-01

    The polymerase chain reaction (PCR) is a technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. There are three major steps involved in the PCR technique: denaturation, annealing and extension. PCR is useful in the investigation...

  6. Polymerase Chain Reaction

    Gaurav Solanki

    2012-10-01

    Full Text Available The polymerase chain reaction (PCR is a technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. There are three major steps involved in the PCR technique: denaturation, annealing and extension. PCR is useful in the investigation and diagnosis of a growing number of diseases. PCR is also used in forensics laboratories. PCR can identify genes that have been implicated in the development of cancer. The present paper is an attempt to review basics of PCR in relation to its methods, application and use.

  7. Multiplex-polymerase chain reaction assay for the authentication of the mackerel Scomber colias in commercial canned products.

    Infante, Carlos; Manchado, Manuel

    2006-01-01

    A multiplex-polymerase chain reaction (PCR) system was developed for the authentication of the mackerel Scomber colias in commercial canned products. This novel method consists of an S. colias-specific fragment [159 base pairs (bp)] located in the nontranscribed spacer (NTS) sequence, and a Scomber genus-specific PCR product in the 5S rRNA gene (196-201 bp) as a positive amplification control. The system was assayed using 18 different canned products labeled as S. colias. A positive identification was made in all but one sample, revealing this methodology as a potential molecular tool for direct application in the authentication of S. colias canned products. PMID:16792069

  8. Acyl chains of phospholipase D transphosphatidylation products in Arabidopsis cells: a study using multiple reaction monitoring mass spectrometry.

    Dominique Rainteau

    Full Text Available BACKGROUND: Phospholipases D (PLD are major components of signalling pathways in plant responses to some stresses and hormones. The product of PLD activity is phosphatidic acid (PA. PAs with different acyl chains do not have the same protein targets, so to understand the signalling role of PLD it is essential to analyze the composition of its PA products in the presence and absence of an elicitor. METHODOLOGY/PRINCIPAL FINDINGS: Potential PLD substrates and products were studied in Arabidopsis thaliana suspension cells treated with or without the hormone salicylic acid (SA. As PA can be produced by enzymes other than PLD, we analyzed phosphatidylbutanol (PBut, which is specifically produced by PLD in the presence of n-butanol. The acyl chain compositions of PBut and the major glycerophospholipids were determined by multiple reaction monitoring (MRM mass spectrometry. PBut profiles of untreated cells or cells treated with SA show an over-representation of 160/18:2- and 16:0/18:3-species compared to those of phosphatidylcholine and phosphatidylethanolamine either from bulk lipid extracts or from purified membrane fractions. When microsomal PLDs were used in in vitro assays, the resulting PBut profile matched exactly that of the substrate provided. Therefore there is a mismatch between the acyl chain compositions of putative substrates and the in vivo products of PLDs that is unlikely to reflect any selectivity of PLDs for the acyl chains of substrates. CONCLUSIONS: MRM mass spectrometry is a reliable technique to analyze PLD products. Our results suggest that PLD action in response to SA is not due to the production of a stress-specific molecular species, but that the level of PLD products per se is important. The over-representation of 160/18:2- and 16:0/18:3-species in PLD products when compared to putative substrates might be related to a regulatory role of the heterogeneous distribution of glycerophospholipids in membrane sub-domains.

  9. Supply chain reaction

    'Logic' (Leading Oil and Gas Industry Competitiveness) is a government-industry supply chain management initiative which aims to improve the competitiveness of the UK's North Sea business by 1 billion UK pounds by 2002 and its export performance by 50% inside 5 years. Much of the article is devoted to the background and views of Logic's chief executive Chris. Freeman. Freeman makes clear that 'unlike Crine, we are not a cost-reduction initiative: that may be one of the outcomes, but we are really focusing on the co-operation side of things'. Logic aims to change the culture of the UK offshore industry through example. Freeman believes that the creation of collaborative success will flag up industry and give credence to Logics objectives

  10. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase

    Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588 (Japan); Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki [System Instruments Co., Ltd., 776-2 Komiya-cho, Hachioji, Tokyo 192-0031 (Japan); Noda, Mamoru; Igimi, Shizunobu [Division of Biomedical Food Research, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Ikebukuro, Kazunori, E-mail: ikebu@cc.tuat.ac.jp [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588 (Japan)

    2013-11-01

    Graphical abstract: -- Highlights: •Zif268 fused to luciferase was used for E. coli O157, Salmonella and coliform detection. •Artificial zinc finger protein fused to luciferase was constructed for Norovirus detection. •An analyzer that automatically detects PCR products by zinc finger protein fused to luciferase was developed. •Target pathogens were specifically detected by the automatic analyzer with zinc finger protein fused to luciferase. -- Abstract: An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268–luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF–luciferase fusion protein. By means of the automatic analyzer with ZF–luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0 × 10 to 1.0 × 10{sup 6} copies.

  11. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase

    Graphical abstract: -- Highlights: •Zif268 fused to luciferase was used for E. coli O157, Salmonella and coliform detection. •Artificial zinc finger protein fused to luciferase was constructed for Norovirus detection. •An analyzer that automatically detects PCR products by zinc finger protein fused to luciferase was developed. •Target pathogens were specifically detected by the automatic analyzer with zinc finger protein fused to luciferase. -- Abstract: An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268–luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF–luciferase fusion protein. By means of the automatic analyzer with ZF–luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0 × 10 to 1.0 × 106 copies

  12. Partial strands synthesizing leads to inevitable aborting and complicated products in consecutive polymerase chain reactions (PCRs)

    2007-01-01

    Various abnormal phenomena have been observed during PCR so far. The present study performed a series of consecutive PCRs (including many rounds of re-amplification continuously) and found that the abortion of re-amplification was inevitable as long as a variety of complicated product appeared. The aborting stages varied, according to the lengths of targets. Longer targets reached the abortion earlier than the shorter ones, marked by appearance of the complex that was immobile in electropho-resis. Denatured gel-electrophoresis revealed that the complex was mainly made up of shorter or partially synthesized strands, together with small amounts of full-length ones. Able to be digested by S1 nuclease but unable by restriction endonucleases (REs), the complex was proved to consist of both single regions and double-helix regions that kept the complex stable thermodynamically. Simulations gave evidence that partial strands, even at lower concentration, could disturb re-amplification effec- tively and lead to the abortion of re-amplifications finally. It was pointed out that the partial strands formed chiefly via polymerase’s infidelity, and hence the solution to lighten the abnormality was also proposed.

  13. Partial strands synthesizing leads to inevitable aborting and complicated products in consecutive polymerase chain reactions (PCRs)

    LUO Rui; ZHANG DaMing

    2007-01-01

    Various abnormal phenomena have been observed during PCR so far. The present study performed a series of consecutive PCRs (including many rounds of re-amplification continuously) and found that the abortion of re-amplification was inevitable as long as a variety of complicated product appeared.The aborting stages varied, according to the lengths of targets. Longer targets reached the abortion earlier than the shorter ones, marked by appearance of the complex that was immobile in electrophoresis. Denatured gel-electrophoresis revealed that the complex was mainly made up of shorter or partially synthesized strands, together with small amounts of full-length ones. Able to be digested by S1 nuclease but unable by restriction endonucleases (REs), the complex was proved to consist of both single regions and double-helix regions that kept the complex stable thermodynamically. Simulations gave evidence that partial strands, even at lower concentration, could disturb re-amplification effectively and lead to the abortion of re-amplifications finally. It was pointed out that the partial strands formed chiefly via polymerase's infidelity, and hence the solution to lighten the abnormality was also proposed.

  14. Species-specific identification of adulteration in cooked mutton Rista (a Kashmiri Wazwan cuisine product) with beef and buffalo meat through multiplex polymerase chain reaction

    M. Mansoor Bhat; Mir Salahuddin; Imtiyaz A. Mantoo; Sheikh Adil; Henna Jalal; M. Ashraf Pal

    2016-01-01

    Aim: Meat adulteration is a serious problem in the meat industry and needs to be tackled to ensure the authenticity of meat products and protect the consumers from being the victims. In view of such likely problem in indigenous meat products of Kashmiri cuisine (Wazwan), the present work was performed to study the detection of beef and buffalo meat in cooked mutton Rista by mitochondrial DNA (mtDNA) based multiplex polymerase chain reaction (PCR) method under laboratory conditions. Materia...

  15. Polymerization as a Model Chain Reaction

    Morton, Maurice

    1973-01-01

    Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

  16. Double Gene Targeting Multiplex Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay Discriminates Beef, Buffalo, and Pork Substitution in Frankfurter Products.

    Hossain, M A Motalib; Ali, Md Eaqub; Abd Hamid, Sharifah Bee; Asing; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Zaidul, I S M

    2016-08-17

    Beef, buffalo, and pork adulteration in the food chain is an emerging and sensitive issue. Current molecular techniques to authenticate these species depend on polymerase chain reaction (PCR) assays involving long and single targets which break down under natural decomposition and/or processing treatments. This novel multiplex polymerase chain reaction-restriction fragment length polymorphism assay targeted two different gene sites for each of the bovine, buffalo, and porcine materials. This authentication ensured better security, first through a complementation approach because it is highly unlikely that both sites will be missing under compromised states, and second through molecular fingerprints. Mitochondrial cytochrome b and ND5 genes were targeted, and all targets (73, 90, 106, 120, 138, and 146 bp) were stable under extreme boiling and autoclaving treatments. Target specificity and authenticity were ensured through cross-amplification reaction and restriction digestion of PCR products with AluI, EciI, FatI, and CviKI-1 enzymes. A survey of Malaysian frankfurter products revealed rampant substitution of beef with buffalo but purity in porcine materials. PMID:27501408

  17. The chain re-action

    2009-01-01

    On 18 March, beam commissioning started in the first ‘link’ of the accelerator chain – LINAC 2. This marks the start of what will be the longest period of beam operations in CERN’s history, with the accelerator complex remaining operational throughout the winter to supply the LHC. The Bulletin finds out what is being done to make sure the whole chain is ready for this historic run.

  18. Concurrent Product & Supply Chain Creation

    Gubi, Ebbe

    that product and supply chains should be created concurrently and integrated. The concept of Concurrent Product & Supply Chain Creation is introduced, and the two main components Focused Supply Chains and Design For Logistics are explained and exemplified by use of Bang & Olufsen....

  19. Diagnosis of. alpha. sub 1 -antitrypsin deficiency by enzymatic amplification of human genomic DNA and direct sequencing of polymerase chain reaction products

    Newton, C.R.; Graham, A.; Powell, S.; Gammack, A.; Riley, J.; Markham, A.F. (ICI Diagnostics, Cheshire (England)); Kalsheker, N. (Univ. of Wales, Cardiff (Wales))

    1988-09-12

    The authors have compared sequencing of cloned polymerase chain reaction (PCR) products and the direct sequencing of PCR products in the examination of individuals from six families affected with {alpha}{sub 1}-antitrypsin (AAT) deficiency. In families where paternity was in question they confirmed consanguinity by DNA fingerprinting using a panel of locus-specific minisatellite probes. They demonstrate that direct sequencing of PCR amplification products is the method of choice for the absolutely specific diagnosis of AAT deficiency and can distinguish normals, heterozygotes and homozygotes in a single, rapid and facile assay. Furthermore, they demonstrate the reproducibility of the PCR and a rapid DNA isolation procedure. They have also shown that two loci can be simultaneously amplified and that the PCR product from each locus can be independently examined by direct DNA sequencing.

  20. Environmental Management in Product Chains

    Jørgensen, Michael Søgaard; Forman, Marianne

    2009-01-01

    The chapter aims at giving background to companies, consultants, governmental regulators, NGOs etc. for the analysis and planning of environmental management in specific product chains through: A framework for understanding environmental management in product chains as shaped by the interaction...... between existing resources, norms and values and external pressures for environmental management (second section). A model for the types of corporate network relations that need to be mapped and understood in order to analyze and/or develop environmental management in a product chain (third section). An...... developed or needed to be developed as part of environmental management in a product chain (fifth and sixth sections). A framework for understanding, in particular, environmental management in product chains involving companies from different countries with different regulatory frameworks and some...

  1. Environmental Management in Product Chains

    Jørgensen, Michael Søgaard; Forman, Marianne

    2009-01-01

    The chapter aims at giving background to companies, consultants, governmental regulators, NGOs etc. for the analysis and planning of environmental management in specific product chains through: A framework for understanding environmental management in product chains as shaped by the interaction...... between existing resources, norms and values and external pressures for environmental management (second section). A model for the types of corporate network relations that need to be mapped and understood in order to analyze and/or develop environmental management in a product chain (third section......). An overview of examples from our own research and from literature of the type and the role of environmental issues and initiatives in product chains (fourth section). A typology for characterizing corporate strategies as part of environmental management in product chains and characterizing those competencies...

  2. Product Classification in Supply Chain

    Xing, Lihong; Xu, Yaoxuan

    2010-01-01

    Oriflame is a famous international direct sale cosmetics company with complicated supply chain operation but it lacks of a product classification system. It is vital to design a product classification method in order to support Oriflame global supply planning and improve the supply chain performance. This article is aim to investigate and design the multi-criteria of product classification, propose the classification model, suggest application areas of product classification results and intro...

  3. Bordetella pertussis diagnosed by polymerase chain reaction

    Birkebaek, N H; Heron, I; Skjødt, K

    1994-01-01

    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity of...

  4. Determining Annealing Temperatures for Polymerase Chain Reaction

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  5. Target-selective joint polymerase chain reaction: A robust and rapid method for high-throughput production of recombinant monoclonal antibodies from single cells

    Isobe Masaharu

    2011-07-01

    Full Text Available Abstract Background During the development of a therapeutic antibody, large numbers of monoclonal antibodies are required to screen for those that are best suited for the desired activity. Although the single cell-based immunoglobulin variable gene cloning technique is a powerful tool, the current methods remain an obstacle to the rapid production of large numbers of recombinant antibodies. Results We have developed a novel overlap extension polymerase chain reaction, the target-selective joint polymerase chain reaction (TS-jPCR, and applied it to the generation of linear immunoglobulin gene expression constructs. TS-jPCR is conducted using a PCR-amplified immunoglobulin variable gene and an immunoglobulin gene-selective cassette (Ig-cassette that contains all essential elements for antibody expression and overlapping areas of immunoglobulin gene-specific homology. The TS-jPCR technique is simple and specific; the 3'-random nucleotide-tailed immunoglobulin variable gene fragment and the Ig-cassette are assembled into a linear immunoglobulin expression construct, even in the presence of nonspecifically amplified DNA. We also developed a robotic magnetic beads handling instrument for single cell-based cDNA synthesis to amplify immunoglobulin variable genes by rapid amplification of 5' cDNA ends PCR. Using these methods, we were able to produce recombinant monoclonal antibodies from large numbers of single plasma cells within four days. Conclusion Our system reduces the burden of antibody discovery and engineering by rapidly producing large numbers of recombinant monoclonal antibodies in a short period of time.

  6. A new label technology for the detection of specific polymerase chain reaction products in a closed tube

    Nurmi, Jussi; Ylikoski, Alice; Soukka, Tero; Karp, Matti; Lövgren, Timo

    2000-01-01

    A novel signal generation principle suitable for real time and end-point detection of specific PCR products in a closed tube is described. Linear DNA probes were labeled at their 5′-ends with a stable, fluorescent terbium chelate. The fluorescence intensity of this chelate is lower when it is coupled to single-stranded DNA than when the chelate is free in solution. The synthesized probes were used in the real time monitoring of PCR using a prototype instrument that consisted of a fluorometer ...

  7. Environmental management in product chains

    Jørgensen, Michael Søgaard; Forman, Marianne; Hansen, Anne Grethe

    of environmental initiatives, a number of recommendations for governmental regulation, which can support the further diffusion of environmental management in product chains, are developed. Furthermore, the report describes a number of theoretical perspectives from sociology of technology, organisation theory......This report presents the analyses of the shaping, implementation and embedding of eight types of environmental initiatives in product chains. The analyses focus on • the role of the type of product and branch, of the size of the companies and of governmental regulation • the focus...... of the environmental concerns and the reductions in environmental impact • organisational changes which have been part of the embedding of the initiatives The analyses are based on 25 cases from national and international product chains involving one or more Danish companies. Based on the analyses of the eight types...

  8. Species-specific identification of adulteration in cooked mutton Rista (a Kashmiri Wazwan cuisine product) with beef and buffalo meat through multiplex polymerase chain reaction

    Bhat, M. Mansoor; Salahuddin, Mir; Mantoo, Imtiyaz A.; Adil, Sheikh; Jalal, Henna; Pal, M. Ashraf

    2016-01-01

    Aim: Meat adulteration is a serious problem in the meat industry and needs to be tackled to ensure the authenticity of meat products and protect the consumers from being the victims. In view of such likely problem in indigenous meat products of Kashmiri cuisine (Wazwan), the present work was performed to study the detection of beef and buffalo meat in cooked mutton Rista by mitochondrial DNA (mtDNA) based multiplex polymerase chain reaction (PCR) method under laboratory conditions. Materials and Methods: Three experimental trials were conducted wherein the products were prepared from pure mutton, beef and buffalo meat, and their admixtures in the ratios of 60:20:20, 80:10:10, 90:05:05 and 98:01:01, respectively. Results: The primers used in the study amplified the cyt b gene fragments of sizes 124 bp, 472 bp and 585 bp for buffalo, cattle and sheep, respectively. It was possible to detect cattle and buffalo meat at the level of 1% in the mixed meat cooked Rista. The multiplex PCR successfully amplified cyt b gene fragments of mtDNA of the target species and thus produced characteristic band pattern for each species. The band intensities of cattle and buffalo in the mixed meat Rista progressively decreased corresponding to their decreasing level from 20% to 1%. Processing, cooking (moist heating) and non-meat formulation ingredients had no effect on detection of meat species adulteration. Conclusion: The multiplex PCR procedure standardized and developed in this study is simple, efficient, sensitive, reliable and highly specific for detecting falsification of cooked mutton product with beef and buffalo meat up to 1% level. PMID:27057103

  9. Species-specific identification of adulteration in cooked mutton Rista (a Kashmiri Wazwan cuisine product with beef and buffalo meat through multiplex polymerase chain reaction

    M. Mansoor Bhat

    2016-03-01

    Full Text Available Aim: Meat adulteration is a serious problem in the meat industry and needs to be tackled to ensure the authenticity of meat products and protect the consumers from being the victims. In view of such likely problem in indigenous meat products of Kashmiri cuisine (Wazwan, the present work was performed to study the detection of beef and buffalo meat in cooked mutton Rista by mitochondrial DNA (mtDNA based multiplex polymerase chain reaction (PCR method under laboratory conditions. Materials and Methods: Three experimental trials were conducted wherein the products were prepared from pure mutton, beef and buffalo meat, and their admixtures in the ratios of 60:20:20, 80:10:10, 90:05:05 and 98:01:01, respectively. Results: The primers used in the study amplified the cyt b gene fragments of sizes 124 bp, 472 bp and 585 bp for buffalo, cattle and sheep, respectively. It was possible to detect cattle and buffalo meat at the level of 1% in the mixed meat cooked Rista. The multiplex PCR successfully amplified cyt b gene fragments of mtDNA of the target species and thus produced characteristic band pattern for each species. The band intensities of cattle and buffalo in the mixed meat Rista progressively decreased corresponding to their decreasing level from 20% to 1%. Processing, cooking (moist heating and non-meat formulation ingredients had no effect on detection of meat species adulteration. Conclusion: The multiplex PCR procedure standardized and developed in this study is simple, efficient, sensitive, reliable and highly specific for detecting falsification of cooked mutton product with beef and buffalo meat up to 1% level.

  10. Transformational leadership: a cascading chain reaction.

    Murphy, Lorraine

    2005-03-01

    Historical influences still permeate contemporary nursing practise. These are mirrored in organizational philosophies, transactional and autocratic leadership styles and disempowered staff. Whilst there is disparity amongst the theorists' definitions of leadership, there is consensus pertaining to the attributes necessary to realize effective leadership. Transformational leadership is heralded as new criterion for nurse managers, and can be achieved through training, education and professional development in key leadership competencies. To achieve a chain reaction, charismatic transformational leaders espouse intellectual stimulation and individual consideration to empower staff and enhance patient care. Nurse managers that develop and foster transformational leadership can surmount oppressive traditions and confidently navigate a complex and rapidly changing health care environment. PMID:15720482

  11. Reaction chain modeling of denitrification reactions during a push-pull test

    Boisson, A.; de Anna, P.; Bour, O.; Le Borgne, T.; Labasque, T.; Aquilina, L.

    2013-05-01

    Field quantitative estimation of reaction kinetics is required to enhance our understanding of biogeochemical reactions in aquifers. We extended the analytical solution developed by Haggerty et al. (1998) to model an entire 1st order reaction chain and estimate the kinetic parameters for each reaction step of the denitrification process. We then assessed the ability of this reaction chain to model biogeochemical reactions by comparing it with experimental results from a push-pull test in a fractured crystalline aquifer (Ploemeur, French Brittany). Nitrates were used as the reactive tracer, since denitrification involves the sequential reduction of nitrates to nitrogen gas through a chain reaction (NO3- → NO2- → NO → N2O → N2) under anaerobic conditions. The kinetics of nitrate consumption and by-product formation (NO2-, N2O) during autotrophic denitrification were quantified by using a reactive tracer (NO3-) and a non-reactive tracer (Br-). The formation of reaction by-products (NO2-, N2O, N2) has not been previously considered using a reaction chain approach. Comparison of Br- and NO3- breakthrough curves showed that 10% of the injected NO3- molar mass was transformed during the 12 h experiment (2% into NO2-, 1% into N2O and the rest into N2 and NO). Similar results, but with slower kinetics, were obtained from laboratory experiments in reactors. The good agreement between the model and the field data shows that the complete denitrification process can be efficiently modeled as a sequence of first order reactions. The 1st order kinetics coefficients obtained through modeling were as follows: k1 = 0.023 h- 1, k2 = 0.59 h- 1, k3 = 16 h- 1, and k4 = 5.5 h- 1. A next step will be to assess the variability of field reactivity using the methodology developed for modeling push-pull tracer tests.

  12. Chain reaction. History of the atomic bomb

    Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)

  13. Application of polymerase chain reaction to detect rearrangement of immunoglobulin heavy chain genes in lymphoproliferative disease.

    Khalil, S H; Siegrist, K; Akhtar, M

    1997-07-01

    As part of our routine work-up in the diagnosis of lymphoproliferative disease, we used a rapid polymerase chain reaction (PCR) assay to amplify the DNA fragments of the framework 3 (FR3) region of the immunoglobulin heavy (IgH) chain genes. The assay does not involve hybridization, nested priming, or sequencing of the amplified PCR product. It was performed on 66 specimens of B-cell lymphoproliferative disease, including acute lymphoblastic leukemia, chronic lymphocytic leukemia, multiple myeloma, hairy cell leukemia and follicular lymphoma. Twenty-six specimens of negative controls, including acute myeloid leukemia, chronic myeloid leukemia in myeloid transformation and idiopathic thrombocytopenic purpura, were also analyzed. The assay was performed with 77% sensitivity and 100% specificity. The standard IgH chain gene rearrangement by Southern blot analysis is reserved for the remaining negative cases if clinically indicated. PMID:17353588

  14. Actinobaculum suis Detection Using Polymerase Chain Reaction

    Cristina Román Amigo

    2012-01-01

    Full Text Available Actinobaculum suis is an important agent related to urinary infection in swine females. Due to its fastidious growth characteristics, the isolation of this anaerobic bacterium is difficult, thus impairing the estimation of its prevalence. The purpose of this study was to develop and test a polymerase chain reaction (PCR for the detection and identification of A. suis and then compare these results with traditional isolation methods. Bacterial isolation and PCR were performed on one hundred and ninety-two urine samples from sows and forty-five preputial swabs from boars. The results indicate that this PCR was specific for A. suis, presenting a detection limit between 1.0×101 CFU/mL and 1.0×102 CFU/mL. A. suis frequencies, as measured by PCR, were 8.9% (17/192 in sow urine samples and 82.2% (37/45 in preputial swabs. Assessed using conventional culturing techniques, none of the urine samples were positive for A. suis; however, A. suis was detected in 31.1% (14/45 of the swabs. This PCR technique was shown to be an efficient method for the detection of A. suis in urine and preputial swabs.

  15. Radioinitiation of Chain Branched Reactions and its Sensitization

    This paper describes the results of experiments by the writers with radioinitiation of chain branched reactions of the oxidation of organic compounds. The function of radiation as an initiating agent is described with reference to the oxidation of several unsaturated hydrocarbons and butanol. The reaction is self-accelerating and proceeds spontaneously after radiation has ceased. A detailed investigation was made of a process from oxidizing benzene, which has a high radiation resistance. The writers devised a method of sensitizing the radioinitiation of the oxidation of radiation-resistant substances by chemically inert but non-radiation-resistant substances. The main quantitative features of the process for the radiooxidation of benzene are stated to be the accumulation of various reaction products, and the effect of temperature, pressure, power and radiation dosage on the process of such accumulation. Information was obtained about the mechanism of the process. The design of circulating equipment is described. (author)

  16. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency

  17. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    Liu Jinfeng [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Xing Da [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)]. E-mail: xingda@scnu.edu.cn; Shen Xingyan [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Zhu Debin [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)

    2005-04-29

    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency.

  18. Detection of Francisella tularensis in blood by polymerase chain reaction.

    Long, G W; Oprandy, J J; Narayanan, R. B.; Fortier, A H; Porter, K R; Nacy, C.A.

    1993-01-01

    We developed a polymerase chain reaction-based assay for Francisella tularensis which we evaluated by using spiked blood samples and experimentally infected mice. The assay detected both type A and type B F. tularensis at levels equivalent to one CFU/microliter of spiked blood. Results from polymerase chain reaction-based assay of limiting dilutions of blood from mice infected with the live vaccine strain agreed closely with results from blood culture.

  19. CONVERGENCE OF MARKOV CHAIN APPROXIMATIONS TO STOCHASTIC REACTION DIFFUSION EQUATIONS

    Kouritzin, Michael A.; Hongwei Long

    2001-01-01

    In the context of simulating the transport of a chemical or bacterial contaminant through a moving sheet of water, we extend a well-established method of approximating reaction-diffusion equations with Markov chains by allowing convection, certain Poisson measure driving sources and a larger class of reaction functions. Our alterations also feature dramatically slower Markov chain state change rates often yielding a ten to one-hundred-fold simulation speed increase over the previous version o...

  20. Detecting mycoplasma contamination in cell cultures by polymerase chain reaction.

    Uphoff, Cord C; Drexler, Hans G

    2011-01-01

    The detection of mycoplasmas in human and animal cell cultures is mandatory for every cell culture laboratory, because these bacteria are common contaminants, persist unrecognized in cell cultures for many years, and affect research results as well as the purity of cell culture products. The reliability of the mycoplasma detection depends on the sensitivity and specificity of the method and should also be convenient to be included in the basic routine of cell culture quality assessment. Polymerase chain reaction (PCR) detection is one of the acknowledged methodologies to detect mycoplasmas in cell cultures and cell culture products. Although the PCR offers a fast and simple technique to detect mycoplasmas, the method is also susceptible to errors and can produce false positive as well as false-negative results. Thus, the establishment and the routine application of the PCR assay require optimization and the inclusion of the appropriate control reactions. The presented protocol describes sample preparation, DNA extraction, PCR run, the analysis of the PCR products, and speciation of the contaminant. It also provides detailed information on how to avoid artifacts produced by the method. Established properly, PCR is a reliable, fast, and sensitive method and should be applied regularly to monitor the contamination status of cell cultures. PMID:21516400

  1. Integrating product design into the supply chain

    Khan, Omera; Stolte, Terje; Creazza, Alessandro;

    2016-01-01

    Purpose: The aim of the research is to illustrate how companies can create competitive capabilities through integration of product design into the supply chain. In doing so the paper reveals the challenges and the opportunities that companies face when integrating product design and supply chain...... opportunities and challenges when integrating product design and the supply chain and subsequently a step-by-step guide is developed to address these. Practical Implications: The research provides key recommendations to companies on how to create competitive capabilities by integrating product design into the...... supply chain. Originality/Value: This paper provides novel insights to both practitioners and researchers. For practitioners detailed recommendations are given on how they can maximise benefits through integrating product design into the supply chain. The RBV has been harnessed to highlight how...

  2. Meson production in + reactions

    H Machner; M Betigeri; J Bojowald; A Budzanowski; A Chatterjee; J Ernst; L Freindl; D Frekers; W Garske; K Grewer; A Hamacher; J Ilieva; L Jarczyk; K Kilian; S Kliczewski; W Klimala; D Kolev; T Kutsarova; J Lieb; H Machner; A Magiera; H Nann; L Pentchev; H S Plendl; D Protić; B Razen; P Von Rossen; B J Roy; R Siudak; J Smyrski; R V Srikantiah; A Strzałkowski; R Tsenov; K Zwoll

    2001-08-01

    Total and differential cross sections for the reactions $p+d → 3He + 0 with = ; and + → 3H + + were measured with the GEM detector at COSY for beam momenta between threshold and the maximum of the corresponding baryon resonance. For both reactions a strong forward–backward asymmetry was found. The data were compared with model calculations. The aspect of isospin symmetry breaking is studied.

  3. Polymerase chain reaction of Au nanoparticle-bound primers

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang

    2005-01-01

    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  4. Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes

    The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement. (paper)

  5. Reaction product imaging

    Chandler, D.W. [Sandia National Laboratories, Livermore, CA (United States)

    1993-12-01

    Over the past few years the author has investigated the photochemistry of small molecules using the photofragment imaging technique. Bond energies, spectroscopy of radicals, dissociation dynamics and branching ratios are examples of information obtained by this technique. Along with extending the technique to the study of bimolecular reactions, efforts to make the technique as quantitative as possible have been the focus of the research effort. To this end, the author has measured the bond energy of the C-H bond in acetylene, branching ratios in the dissociation of HI, the energetics of CH{sub 3}Br, CD{sub 3}Br, C{sub 2}H{sub 5}Br and C{sub 2}H{sub 5}OBr dissociation, and the alignment of the CD{sub 3} fragment from CD{sub 3}I photolysis. In an effort to extend the technique to bimolecular reactions the author has studied the reaction of H with HI and the isotopic exchange reaction between H and D{sub 2}.

  6. Generalized crested products of Markov chains

    D'Angeli, Daniele

    2010-01-01

    We define a finite Markov chain, called generalized crested product, which naturally appears as a generalization of the first crested product of Markov chains. A complete spectral analysis is developed and the $k$-step transition probability is given. It is important to remark that this Markov chain describes a more general version of the classical Ehrenfest diffusion model. As a particular case, one gets a generalization of the classical Insect Markov chain defined on the ultrametric space. Finally, an interpretation in terms of representation group theory is given, by showing the correspondence between the spectral decomposition of the generalized crested product and the Gelfand pairs associated with the generalized wreath product of permutation groups.

  7. product chain collaboration and environmental innovations

    Remmen, Arne; Mosgaard, Mette

    2004-01-01

    The paper  builds upon a case study from a number of electronic companies in Denmark and describes from an organisational perspective how organisations make environmental innovations in the product chain....

  8. Multi-template polymerase chain reaction

    Elena Kalle

    2014-12-01

    Full Text Available PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.

  9. The Ripple Effect: Citation Chain Reactions of a Nobel Prize

    Faber Frandsen, Tove; Nicolaisen, Jeppe

    2013-01-01

    This paper explores the possible citation chain reactions of a Nobel Prize using the mathematician Robert J. Aumann as a case example. The results show that the award of the Nobel Prize in 2005 affected not only the citations to his work, but also affected the citations to the references in his...... scientific oeuvre. The results indicate that the spillover effect is almost as powerful as the effect itself. We are consequently able to document a ripple effect in which the awarding of the Nobel Prize ignites a citation chain reaction to Aumann's scientific ouvre and to the references in its nearest...

  10. Identifying of meat species using polymerase chain reaction (PCR)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  11. Identifying of meat species using polymerase chain reaction (PCR)

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

  12. Identifying of meat species using polymerase chain reaction (PCR)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  13. The generalised self-sustaining chain reaction theory about ADS

    The basic connotation of ADS (accelerator driven system) is investigated from the point of view of generalized self-sustaining chain reaction. The ADS is composed of proton accelerator, neutron producing target and the subcritical reactor. This system can be viewed entirely as a generalized self sustaining chain reaction system. In this view of point, the accelerator with target, as a part of ADS, can be viewed as an energy-neutron transformer (energy be fed to accelerator to produce medium energy protons, neutrons be produced in the heavy target as a result of proton-heavy nucleus spallation reaction). In this generalized self-sustaining chain reaction system, the number of neutrons produced after a fission event is not only the fission neutrons but also the neutrons produced by the energy-neutron transformer. That is, the ADS has more effective secondary neutrons after a fission event. It is just these additional neutrons, the ADS can be in state of self-sustaining chain reaction (criticality), although the reactor part of ADS is in state of sub-criticality. The critical equation of the generalized self-sustaining chain reaction system is presented. The relationship between the effective multiplication factors of ADS and subcritical reactor part of ADS is also presented. The power output of ADS is represented by a function of the proton current, the subcritical reactivity of the reactor in ADS, the number of neutrons produced in spallation process per proton and etc. At last, the probable application of ADS in the future is investigated

  14. Detection of Durum Wheat Pasta Adulteration in the Jordanian Market by Polymerase Chain Reaction Technology

    H. Al-Rousan; N.D. Al-Hmoud; Ibrahim, M. A.; B.O. Hayek

    2011-01-01

    Taking into account the impact of monitoring food adulteration on the quality of food products, the aim of this study was to use polymerase chain reaction technology to detect possible adulteration of durum wheat pasta products in the Jordanian market. Cetyltrimethyl ammonium bromide method was applied for extracting genomic DNA from twenty six randomly collected pasta products, the results suggested the suitability of this method for DNA extraction from pasta products. Specific primers were ...

  15. Detection of Listeria monocytogenes by using the polymerase chain reaction

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with 32P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains

  16. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

    1990-01-01

    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

  17. Characteristics of a chain thermal explosion as a function of the kinetic properties of reaction chains

    Azatyan, V. V.; Piloyan, A. A.; Saikova, G. R.; Smirnov, N. N.

    2016-03-01

    Study of the combustion and explosion of hydrogen‒carbon oxide‒air mixtures shows that the sharpness of a chain thermal explosion depends on the frequency of branching in a given branch of a reaction chain. It is established that varying the CO: H2 concentration allows us to observe and eliminate the degeneration of an explosion while maintaining the regimes of ignition and deflagration.

  18. Decay Chain Deduction of Uranium Fission Products.

    Guo, Huiping; Tian, Chenyang; Wang, Xiaotian; Lv, Ning; Ma, Meng; Wei, Yingguang

    2016-07-01

    Delayed gamma spectrum is the fingerprint of uranium materials in arms control verification technology. The decay chain is simplified into basic state linear chain and excitation state linear chain to calculate and analyze the delayed gamma spectra of fission products. Formulas of the changing rule for nuclide number before and after zero-time are deduced. The C program for calculating the delayed gamma ray spectra data is constructed, and related experiments are conducted to verify this theory. Through analysis of the delayed gamma counts of several nuclides, the calculated results are found to be consistent with experimental values. PMID:27218290

  19. Selection vector for direct cloning of proof reading polymerase chain reaction products based on the lethal ccdB gene in Escherichia Coli

    Weibel, Pascal; Ender, Miriam; Madon, Jerzy; Zinkernagel, Annelies; Schuepbach, Reto

    2013-01-01

    Introducing PCR products into plasmids vectors is key for molecular techniques. Ideally cloning vectors are easy to construct, modify and propagate, neither require advanced techniques nor special equipment or reagents and efficiently incorporate PCR products at close to zero empty vector background. We provide an easy to engineer self-made cloning vector, neither requiring sophisticated tools or techniques nor advanced cloning knowledge. Through recombination we obtained the pUC18ccdB vector...

  20. Environmental Management Initiatives in Product Chains

    Forman, Marianne; Hansen, Anne Grethe; Jørgensen, Michael Søgaard

    The Environmental Council for Cleaner Products in 2000-2001 initiated a collection of experience from the environmental co-operation in 25 product chains. This collection of experience was to elucidate the concrete co-operation between suppliers, enterprises and purchasers, to go through tools...... and to report on opportunities and barriers for environmental efforts in the entire product chain. This paper aims at giving a comprehensive analysis of the experiences, on the basis of the reporting of the 25 companies and their supply chains (reported by Ettrup and Bauer in 2002. The 25 case studies have been...... carried out by 4 different consultancy firms for the Danish Environmental Protection Agency, but using different methods and different weighting. The material thus represents a large pool of knowledge, but great caution with its heterogeneity should be taken....

  1. Specifics in the chosen production chain?

    L. Pánková

    2010-12-01

    Full Text Available It is possible to consider the production chain as a highly complicated system, within the framework of whichdifferent links and mutual relations function. Therefore it is necessary to analyze the complexity of theproduction chain functioning for the purpose of enhanced knowledge on the existence and the regularitiesfunctioning among different production elements. The contribution deals with an analysis of the pricetransmission in the production chain of cereals, within which only certain partial parts have been earmarked. Cointegrationanalysis, VECM and impulse-response analysis have been used for the price transmission analysis.Information mentioned in the paper resulted from the solution of a research intention VZ MSM 6046070906„The Economics of resources of Czech agriculture and their efficient use in framework of multifunctional agrifoodsystems“.

  2. Effects of upconversion nanoparticles on polymerase chain reaction.

    Sang-Hyun Hwang

    Full Text Available Nanoparticles (NPs are attractive materials owing to their physical and electrochemical properties, which make them extremely useful in diagnostic applications. Photon upconversion is the phenomenon where high-energy photons are emitted upon excitation of low-energy photons. Nucleic acids detection based on upconversion nanoparticles (UCNPs, which display a high signal-to-noise ratio and no photobleaching, has been widely applied. We evaluated whether UCNPs can improve polymerase chain reaction (PCR specificity and affect PCR amplification. The effects of UCNPs with a diameter size of 40, 70, and 250 nm were evaluated using 3 PCR kits (AccuPower PCR PreMix, AmpliTaq Gold 360 Master Mix, and HotStarTaq Plus Master Mix and 3 real-time PCR kits (AccuPower GreenStar qPCR PreMix, SYBR Green PCR Master Mix, and QuantiTect SYBR Green PCR Kit. Quantum dots were used for comparison with the UCNPs. In the presence of an appropriate concentration of UCNPs, PCR specificity was optimized. UCNPs of 40-nm size improved PCR specificity more effectively than did UCNPs sized 70 or 250 nm. As the size and concentrations of the UCNPs were increased, PCR amplification was more severely inhibited. At lower annealing temperatures (25°C-45°C, addition of the 40 nm UCNP (1 µg/µL to the PCR reagent produced specific PCR products without nonspecific sequence amplification. Therefore, UCNPs of different sizes, with different DNA polymerases used in the commercial kits, showed different inhibitory effects on PCR amplification. These results demonstrate that optimization of UCNPs, added to reaction mixtures at appropriate concentrations, can improve PCR specificity. However, the mechanism underlining UCNPs effect on PCR remains unclear and will require further investigation.

  3. MONITORING MYCOTOXIN PRODUCTION AT THE GENETIC LEVEL ON VARIOUS GROWTH SUBSTRATES USING QUANTITATIVE REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION?EXPERIMENT DESIGN

    The paper describes a method of analyzing the production of mycotoxins at the genetic level by monitoring the intracellular levels of messenger RNA (mRNA). Initial work will focus on threshing out the mycotoxin gene clusters in Stachybotrys chartarum followed by analysis of toxin...

  4. What Can Healthcare Supply Chains Learn from Consumer-Product Supply Chains?

    Leroy B. Schwarz

    2008-01-01

    A Framework for Thinking About Supply-Chain Management: “The IDIB Portfolio” (Information, Decision-making, Implementation, Buffer system) Describe Supply-Chains for Consumer Products Before “Wal-Mart” Describe Supply-Chains for Consumer Products After “Wal-Mart” Describe Stylized Supply Chain for Healthcare Products

  5. Detection of Neisseria Gonorrhoeae from Urine with Ligase Chain Reaction

    曹经江; 郑和义; 胡维

    2003-01-01

    Objective: To evaluate the value of ligase chain reaction(LCR) in the diagnosis of diplococcus gonorrhoeae in urine.Methods: LCR detection of the urine for Neisseria gonorrhoeae and bacteria culture of discharge was per-formed simultaneously to 276 patients with urethritis or cervicitis seeking treatment in sex transmitted dis-eases (STDs) outpatient clinic. For specimens with discordant results, polymerase chain reaction was conducted. The purpose was to detect the respective sensitivity and specificity of bacteria culture and LCR. Results: 24 of 276(8.7%) patients had positive LCR results and 21 of 276(7.6%) were positive for culture.5 specimens had discordant results from LCR and bacteria culture. The sensitivity and specificity of LCR in the diagnosis of gonorrhoeae were 92.3% and 100% respectively. Conclusion: This study showed that LCR had a higher sensitivity and specificity for the diagnosis of gonorrhoeae from urine.

  6. The chain gas phase reactions. The present problems

    The results of investigations of chain gas phase reactions which are directed for solving practically important problems have been carried out. The problem of increasing methanol formation selectivity in the direct natural gas oxidation process is discussed. The peculiarities of cool flame of cyclic hydrocarbons, particularly cyclohexane which are containing in the different kinds of fuel. The influence of cool flame on intensity and full consumption of fuels burning is examined. Conjugated processes of SO2 conversion to SO3 and sulfur under effect of hydrocarbon and hydrogen oxidation chain gas phase reactions are considered. The results of discussed investigations can be served as a basis for the developing of industrial processes for conversion natural hydrocarbon row materials and also the ecological problems of utilization of SO2 gas ejected from thermoelectric power stations and metallurgical plants

  7. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology w...

  8. Enteroviral pharyngitis diagnosed by reverse transcriptase-polymerase chain reaction.

    Sharland, M.; Hodgson, J.; Davies, E G; Booth, J.; Jeffery, S

    1996-01-01

    The role of enteroviruses in childhood pharyngitis was investigated using enteroviral specific reverse transcriptase-polymerase chain reaction (RT-PCR). Viral/bacterial throat swabs were taken from 50 children with acute pharyngitis and 26 controls. A positive culture was identified in only 26% of children with pharyngitis (adenovirus 10%, group A streptococci 2%), and none of the controls. Enteroviral RT-PCR was positive in 8% of the pharyngitis group and none of the controls. Enteroviruses ...

  9. Productive Information System Oriented Trust Chain Scheme

    Shen Chang-xiang

    2012-09-01

    Full Text Available Productive information system has high-level security requirements, but Trusted Computing Group’s solution of trust chain isn’t competent. After analysis and comparison of two different trust transfer ways, a new trust chain scheme was designed and its architecture was shown. With independent TPCM as a trust root, this scheme combined the advantages of linear and radial transfer. So that stronger cryptographic algorithm could be adopted by TPCM and applications’ trust attenuation decreased a lot. This scheme was described formally by 6 linear temporal logic rules. It was proved that based on these rules, this scheme could transfer trust from trust root to applications. Meanwhile, it could actively report and handle exceptions in trust chain building and system running. Conclusion and future work were given at the end of this manuscript.

  10. Convective polymerase chain reaction around micro immersion heater

    Hennig, Martin; Braun, Dieter

    2005-10-01

    Polymerase chain reaction (PCR) is performed in the thermal convection created by a micro immersion heater. Instead of repetitive heating and cooling, the temperature gradient induces thermal convection which drives the reaction liquid between hot and cold parts of the chamber. The convection triggers DNA amplification as the DNA melts into two single strands in the hot region and replicates with the use of proteins into twice the amount in the cold region. The constant heater is simply dipped into the reaction solution. Compared to previous experiments, we demonstrate that convective PCR is possible in a robotically accessible open vessel. Our approach compares well with fast PCR cyclers and replicates DNA 500 000 fold within 20minutes. We reduce the necessary components for PCR to cheap, single-use components and therefore increasing the prospects of bringing PCR to point of care applications—even in third world countries.

  11. Pion production reaction near threshold

    The differential cross section of the 40Ca(p,π+)41Ca reaction has been measured. The energy dependence of pion production near threshold has been studied at constant transferred momentum. The cross-section decreases by a factor 7, for proton energies varying from 154 to 149MeV (E(π) varies from 17.4 to 12.4MeV). The results are analyzed in the framework of the one nucleon mechanism

  12. Robust quantification of polymerase chain reactions using global fitting.

    Ana C Carr

    Full Text Available BACKGROUND: Quantitative polymerase chain reactions (qPCR are used to monitor relative changes in very small amounts of DNA. One drawback to qPCR is reproducibility: measuring the same sample multiple times can yield data that is so noisy that important differences can be dismissed. Numerous analytical methods have been employed that can extract the relative template abundance between samples. However, each method is sensitive to baseline assignment and to the unique shape profiles of individual reactions, which gives rise to increased variance stemming from the analytical procedure itself. PRINCIPAL FINDINGS: We developed a simple mathematical model that accurately describes the entire PCR reaction profile using only two reaction variables that depict the maximum capacity of the reaction and feedback inhibition. This model allows quantification that is more accurate than existing methods and takes advantage of the brighter fluorescence signals from later cycles. Because the model describes the entire reaction, the influences of baseline adjustment errors, reaction efficiencies, template abundance, and signal loss per cycle could be formalized. We determined that the common cycle-threshold method of data analysis introduces unnecessary variance because of inappropriate baseline adjustments, a dynamic reaction efficiency, and also a reliance on data with a low signal-to-noise ratio. SIGNIFICANCE: Using our model, fits to raw data can be used to determine template abundance with high precision, even when the data contains baseline and signal loss defects. This improvement reduces the time and cost associated with qPCR and should be applicable in a variety of academic, clinical, and biotechnological settings.

  13. Production chain of CMS pixel modules

    2006-01-01

    The pictures show the production chain of pixel modules for the CMS detector. Fig.1: overview of the assembly procedure. Fig.2: bump bonding with ReadOut Chip (ROC) connected to the sensor. Fig.3: glueing a raw module onto the baseplate strips. Fig.4: glueing of the High Density Interconnect (HDI) onto a raw module. Fig.5: pull test after heat reflow. Fig.6: wafer sensor processing, Indium evaporation.

  14. Implosion chain reaction mitigation in underwater assemblies of photomultiplier tubes

    Since the accident with a cascade failure of photomultiplier tubes (PMTs) in the Super-Kamiokande experiment in 2001, the mechanical performance of large format semi-hemispherical PMTs has become a critical issue for large water Cherenkov detectors. The subject of this study is the survival of an assembled array of PMTs under significant hydrostatic pressure and subjected to shock waves caused by the failure of a single PMT. This paper details the results of the second stage of a R and D program focused on the design and testing of different PMT assemblies to mitigate the risk of a “chain-reaction” of PMT failures. The initial results show that our PMT assembly design can effectively reduce the magnitude of the shock wave. With the testing results in this paper and the hydrodynamic simulation calculation, we can further improve the design of PMT deployment to mitigate the risk of chain reactions caused by implosion induced shock waves

  15. SUPPLY CHAINS IN AGRICULTURE AND FOOD PRODUCTION

    Liliana CONDRAȚCHI

    2014-06-01

    Full Text Available The role of production and supply chain is increasing worldwide due of the growing consumer concerns over foodsafety and quality together with retailer demands for large volumes of consistent and reliable product. In developedcountries, product losses (post harvest losses are generally small during processing, storage and handling becauseof the efficiency of the equipment, better storage facilities, and control of critical variables by a skilled and trainedstaff. Recently, the concept of Agricultural and Food production has been under development as more effective andefficient management system is required for the food production planning, physical collection of primary producefrom fields and homesteads, processing and storage at various levels, handling, packaging, and distribution of finalproduct.

  16. Plasmid Copy Number Determination by Quantitative Polymerase Chain Reaction.

    Anindyajati; Artarini, A Anita; Riani, Catur; Retnoningrum, Debbie S

    2016-01-01

    Recombinant therapeutic proteins are biopharmaceutical products that develop rapidly for years. Recombinant protein production in certain hosts requires vector expression harboring the gene encoding the corresponding protein. Escherichia coli is the prokaryote organism mostly used in recombinant protein production, commonly using a plasmid as the expression vector. Recombinant protein production is affected by plasmid copy number harboring the encoded gene, hence the determination of plasmid copy number also plays an important role in establishing a recombinant protein production system. On the industrial scale, a low copy number of plasmids are more suitable due to their better stability. In the previous study we constructed pCAD, a plasmid derived from the low copy number pBR322 plasmid. This study was aimed to confirm pCAD's copy number by quantitative polymerase chain reaction (qPCR). Plasmid copy number was determined by comparing the quantification signal from the plasmid to those from the chromosome. Copy number was then calculated by using a known copy number plasmid as a standard. Two pairs of primers, called tdk and ori, were designed for targeting a single gene tdk in the chromosome and a conserved domain in the plasmid's ori, respectively. Primer quality was analyzed in silico using PrimerSelect DNASTAR and PraTo software prior to in vitro evaluation on primer specificity and efficiency as well as optimization of qPCR conditions. Plasmid copy number determination was conducted on E. coli lysates harboring each plasmid, with the number of cells ranging from 10(2)-10(5) cells/μL. Cells were lysed by incubation at 95ºC for 10 minutes, followed by immediate freezing at -4°C. pBR322 plasmid with the copy number of ~19 copies/cell was used as the standard, while pJExpress414-sod plasmid possessing the high copy number pUC ori was also determined to test the method being used. In silico analysis based on primer-primer and primer-template interactions showed

  17. Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique

    İLHAK, O. İrfan; Arslan, Ali

    2007-01-01

    The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...

  18. Identification of Erwinia stewartii by a ligase chain reaction assay.

    Wilson, W.J.; Wiedmann, M; Dillard, H. R.; Batt, C A

    1994-01-01

    A PCR-coupled ligase chain reaction (LCR) assay was developed to distinguish the plant pathogenic bacterium Erwinia stewartii from other erwiniae. This new technique allows discrimination to the species level on the basis of a single-base-pair difference in the 16S rRNA gene which is unique to E. stewartii. Portions of the 16S rRNA genes of E. stewartii and the closely related Erwinia herbicola were sequenced. From comparison of the two 16S rRNA gene regions, two primer pairs were constructed...

  19. A chain reaction approach to modelling gene pathways.

    Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

    2012-08-01

    BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By

  20. APPLICATION OF POLYMERASE CHAIN REACTION FOR DIAGNOSING AMEBIC LIVER ABSCESS

    郭增柱; 王正仪; 安亦军; 祝宏

    1996-01-01

    Polymerase chain reaction (PCR) has been applied in diagnosing amebic liver infection by detecting pathogenic Entamoeba histolytica DNA in liver aspirates. Oligonucleotide primers found to he specific for the gene encoding the 30 kDa molecule of this pathogenic ameba were used in the test. Liver aspirates obtained from 23 patients with amebic liver abscess substantiated by typical clinical rnanifastation or with very high titres of anti-E histtolytica antibodies by ELISA were found to he positive by PCR. Fourteen controlsamples (3 cases of bacterial liver abscess, I of liver cancer and 10 of other abscess) were all found to be negative to this reaction. The results suggested PCR to he a specific and sensitive tool for diagnosing amebic liver abscess infections.

  1. Exploring the e-Supply Chain of Information Products

    Raafat George Saadé

    2012-01-01

    Digital information product producers have not taken advantage of the e-supply chain paradigm of today. However, in this information-based sector, a different set of supply chain management challenges exist. Very little research has been done in the supply chain of information products. This study focuses on the process analysis of the supply chain paradigm for digital information products. A framework for digital information products production in e-learning is proposed followed by an exampl...

  2. Optimization of asymmetric polymerase chain reaction for rapid fluorescent DNA sequencing.

    Wilson, R K; Chen, C; Hood, L

    1990-02-01

    A high-throughput method for the preparation of single-stranded template DNA, which is suitable for sequence analysis using fluorescent labeling chemistry, is described here. In this procedure, the asymmetric polymerase chain reaction is employed to amplify recombinant plasmid or bacteriophage DNA directly from colonies or plaques. The use of amplification primers located at least 200 base pairs 5' to the site of sequencing primer annealing removes the need for extensive purification of the asymmetric polymerase chain reaction product. Instead, the single-stranded product DNA is purified by a simple isopropanol precipitation step and then directly sequenced using fluorescent dye-labeled oligonucleotides. This method significantly reduces the time and labor required for template preparation and improves fluorescent DNA sequencing strategies by providing a much more uniform yield of single-stranded DNA. PMID:2317375

  3. Production chain and innovative technologies for living

    Eugenio Arbizzani

    2012-10-01

    Full Text Available The continued growth of residential demand, coupled with the significant decline of the housing market, is encouraging the development of many procedural and constructive experiments on the theme of affordable housing for a range of users increasingly unable to access home ownership. The spread of an approach to planning that is socially, economically and technologically sustainable, represents a culture of quality that is once more measurable, which makes it possible today to define innovative building models for the industrial and production chain. The use of innovative and integrated industrialised building systems may be one of the supporting factors in the achievement of the objectives of social housing.

  4. Detection of Mycoplasma pneumoniae by polymerase chain reaction and nonradioactive hybridization in microtiter plates.

    Lüneberg, E; Jensen, J S; M. Frosch

    1993-01-01

    In order to improve the diagnosis of a Mycoplasma pneumoniae infection, we developed a polymerase chain reaction (PCR)-based assay. The gene encoding elongation factor Tu (tuf) was selected as the target sequence. Oligonucleotides derived from variable stretches of the tuf gene were able to prime the amplification of a 950-bp fragment exclusively when M. pneumoniae DNA was used as the template. The sensitivity of the assay was increased 10-fold when the amplification products were hybridized ...

  5. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  6. Early detection of typhoid by polymerase chain reaction

    Typhoid is a common problem in developing countries. Cultivation ofbacteria and serology (especially Widal test) gives unacceptable levels offalse-negative and false-positive results respectively. In this study, arecently introduced polymerase chain reaction based technique (which has 100%specificity for Salmonella typhi) was compared with blood culture and Widaltest during the first week of illness of 82 suspected cases of typhoid. Therespective figures of positivity for PCR, blood culture and Widal test were71.95%, 34.1% and 36.5%. A control group of 20 healthy persons gave figuresof 0%, 0% and 33.3%, respectively. We conclude that this PCR-based techniqueis not only absolutely specific, but also very sensitive and therefore muchsuperior to blood culture and, Widal test for the early diagnosis of typhoid.(author)

  7. Polymerase chain reaction-based gene removal from plasmids

    Vishnu Vardhan Krishnamurthy

    2015-09-01

    Full Text Available This data article contains supplementary figures and methods to the research article entitled, “Multiplex gene removal by two-step polymerase chain reactions” (Krishnamurthy et al., Anal. Biochem., 2015, doi:http://dx.doi.org/10.1016/j.ab.2015.03.033, which presents a restriction-enzyme free method to remove multiple DNA segments from plasmids. Restriction-free cloning methods have dramatically improved the flexibility and speed of genetic manipulation compared to conventional assays based on restriction enzyme digestion (Lale and Valla, 2014. DNA Cloning and Assembly Methods, vol. 1116. Here, we show the basic scheme and characterize the success rate for single and multiplex gene removal from plasmids. In addition, we optimize experimental conditions, including the amount of template, multiple primers mixing, and buffers for DpnI treatment, used in the one-pot reaction for multiplex gene removal.

  8. Nested methylation-specific polymerase chain reaction cancer detection method

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  9. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Kordo B. A. Saeed

    2013-11-01

    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  10. Modelling of Serpentine Continuous Flow Polymerase Chain Reaction Microfluidics

    Abubakar Mohammed

    2012-03-01

    Full Text Available The continuous flow Polymerase Chain Reaction (PCR microfluidics DNA amplification device is a recent discovery aimed at eliminating the cyclic hold experienced while using the alternative stationary device.The Application of Computational Fluid Dynamics is increasingly growing and can help achieve optimal designs before actual fabrication. This paper presents a CFD modelling of a continuous flow serpentine PCR device with narrow and wider channels. There are two temperature regions at 950C and 600C for denaturation and annealing respectively. Extension is achieved along the middle of the channel at 720C owing to temperature gradient. The model require a pressure of 42.6KPa for a 30 cycle amplification.

  11. Polymerase chain reaction: A molecular diagnostic tool in periodontology.

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  12. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    Rajendran Maheaswari

    2016-01-01

    Full Text Available This review discusses the principles of polymerase chain reaction (PCR and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

  13. Semi-arid development: competitiveness factors in biodiesel productive chain

    Breno Barros Telles do Carmo; Dmontier Pinheiro Aragão; Heráclito Lopes Jaguaribe Pontes; Bruno Magalhães Ribeiro; Marcos Ronaldo Albertin

    2009-01-01

    The new global market competitiveness considerer the competition between productive chains (PC) or supply chains, not just between enterprises. In this case, it can be observed collaboration and cooperation enterprises that dispute with others productives chain. The PC competitiveness can be impaired if is subject by inhibitors factors, that can impairer the performance. This paper analyses these competitiveness factors inhibitors in biodiesel productive chain (CPB) in semi-arid area: exporte...

  14. Controlling Hybridization Chain Reactions with pH.

    Idili, Andrea; Porchetta, Alessandro; Amodio, Alessia; Vallée-Bélisle, Alexis; Ricci, Francesco

    2015-08-12

    By taking inspiration from nature, where self-organization of biomolecular species into complex systems is finely controlled through different stimuli, we propose here a rational approach by which the assembly and disassembly of DNA-based concatemers can be controlled through pH changes. To do so we used the hybridization chain reaction (HCR), a process that, upon the addition of an initiator strand, allows to create DNA-based concatemers in a controlled fashion. We re-engineered the functional units of HCR through the addition of pH-dependent clamp-like triplex-forming domains that can either inhibit or activate the polymerization reaction at different pHs. This allows to finely regulate the HCR-induced assembly and disassembly of DNA concatemers at either basic or acidic pHs in a reversible way. The strategies we present here appear particularly promising as novel tools to achieve better spatiotemporal control of self-assembly processes of DNA-based nanostructures. PMID:26177980

  15. Circulating polymerase chain reaction chips utilizing multiple-membrane activation

    Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin

    2007-02-01

    This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

  16. Supply chain management in product development.

    Tzortzopoulos, Patricia; Kagioglou, Mike; Cooper, Rachel; Dyson, E

    2009-01-01

    Mounting emphasis on construction supply chain management (CSCM) is due to both global sourcing of materials and a shortage of labor. These factors force increasing amounts of value-added work to be conducted off-site deep in the supply chain. Construction Supply Chain Management Handbookcompiles in one comprehensive source an overview of the diverse research and examples of construction supply chain practice around the world.Reflecting the emergence of CSCM as an important area of multi-nati...

  17. Trade in Value Chain of Food Products

    Zdenko Segetlija

    2008-01-01

    The paper sets out from the definition of the value chain upon which follows the analysis of the value chain structure ih the food sector. Special attention is paid to market forms in the food sector (competition, agreements, oligopolistic constellation and the like). After that, modern form of cooperation in the value chain are started (supply chain management - SCM, efficient consumer response – ECR, and other). In this context the role of wholesale and that of retail trade in the food prod...

  18. Future of Supply Chain Management in Various food Production.

    Suhail Tyagi,; Mohd. Nadeem

    2015-01-01

    This paper analyse the case of any production system and the structure of supply chain has evolved progressively over the time of sequential supply chain, to global supply chain. This evolution has reflected the change in business environment from static to dynamic. So the purpose of this paper is to propose an agenda for future research in supply chain management. We also measure the effect of FDI in India to the existing production industries in India.

  19. Future of Supply Chain Management in Various food Production.

    Suhail Tyagi,

    2015-10-01

    Full Text Available This paper analyse the case of any production system and the structure of supply chain has evolved progressively over the time of sequential supply chain, to global supply chain. This evolution has reflected the change in business environment from static to dynamic. So the purpose of this paper is to propose an agenda for future research in supply chain management. We also measure the effect of FDI in India to the existing production industries in India.

  20. Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions

    Zhang, Hefeng

    2015-05-01

    We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b-polystyrenyllithium (PI-. b-PSLi), to the main chain and subsequently to the branches in a divergent way. PI segment is short and serves as a precursor for multifunctional branching unit. The grafting reaction involves two successive steps: i) epoxidation of internal double bonds of PI segments, either in main chain or side chains; ii) ring-opening addition to the resulting epoxy group by the living PI-. b-PSLi. Repeating the two steps affords a series of cylindrical polymer brushes with up to 3rd generation and extremely high molecular weight. The branching multiplicity depends on the average number of oxirane groups per PI segment, usually ca. 8 in the present work. The high branching multiplicity leads to tremendous increase in molecular weights of the cylindrical products with generation growth. Several series of cylindrical polymer brushes with tunable aspect ratios are prepared using backbones and branches with controlled lengths. Shape anisotropy is investigated in dilute solution using light scattering technique. Worm-like single molecular morphology with large persistence length is observed on different substrates by atomic force microscopy.

  1. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections

    2012-01-01

    AIM: To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC).

  2. Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

    Toshiaki Higashi

    2012-04-01

    Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

  3. Time-resolved FTIR [Fourier transform infrared] emission studies of laser photofragmentation and chain reactions

    Recent progress is described resulting from the past three years of DOE support for studies of combustion-related photofragmentation dynamics, energy transfer, and reaction processes using a time-resolved Fourier transform infrared (FTIR) emission technique. The FTIR is coupled to a high repetition rate excimer laser which produces radicals by photolysis to obtain novel, high resolution measurements on vibrational and rotational state dynamics. The results are important for the study of numerous radical species relevant to combustion processes. The method has been applied to the detailed study of photofragmentation dynamics in systems such as acetylene, which produces C2H; chlorofluoroethylene to study the HF product channel; vinyl chloride and dichloroethylene, which produce HCl; acetone, which produces CO and CH3; and ammonia, which produces NH2. In addition, we have recently demonstrated use of the FTIR technique for preliminary studies of energy transfer events under near single collision conditions, radical-radical reactions, and laser-initiated chain reaction processes

  4. Performance evaluation on aquatic product cold-chain logistics

    Wenbing Wu

    2015-11-01

    Full Text Available Purpose: The requirements for high quality and diversification aquatic products are increasing with the improvement of Chinese living standard. However, the distribution between place of production and place of consumption are uneven, which results in large cold-chain logistics demand for aquatic products. At present, the low-level development of cold chain logistics has a bad impact on the circulation of aquatic products in China. So it is very urgent to develop cold-chain logistics in China. Design/methodology/approach: In order to do this, we apply performance evaluation, a well-known management tool, to study Chinese aquatic product cold-chain logistics. In this paper we first propose SISP(Subjects, Indexes, Standards, and Phases of performance evaluation model and ACSSN model(Aquatic product, Customer, Supply Chain, Society, and Node enterprises of supply chain for aquatic products cold-chain logistics performance evaluation. Then an ANP-Fuzzy method is proposed to evaluate the operational performance of Shandong Oriental Ocean Sci-Tech Co., Ltd. Furthermore, a system dynamic model is built to simulate the impact of temperature on the profits in aquatic products cold-chain sales section. Findings: We find out within a reasonable temperature range, lower temperature brings higher profit level. Also, performance improvement methods are proposed and the simulation of performance evaluation system is developed. Practical implications: Our findings can help to improve the level of aquatic product cold-chain logistics in China. Originality/value: The paper proposes the SISP (Subjects, Indexes, Standards, and Phases of performance evaluation model and ACSSN model (Aquatic product, Customer, Supply Chain, Society, and Node enterprises of supply chain for aquatic products cold-chain logistics performance evaluation.

  5. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices

    Ness, K D; Wheeler, E K; Benett, W; Stratton, P; Christian, A; Chen, A; Ortega, J; Weisgraber, T H; Goodson, K E

    2004-09-28

    Polymerase chain reaction (PCR) facilitates DNA detection by significantly increasing the concentration of specific DNA segments. A new class of PCR instruments uses a buoyancy-driven re-circulating flow to thermally cycle the DNA sample and benefits from reduced cycle times, low sample volumes, a miniaturized format, and low power consumption. This paper analyzes a specific buoyancy PCR device in a micro-channel ''race-track'' geometry to determine key parameters about PCR cycle times and other figures of merit as functions of device dimensions. The 1-D model balances the buoyancy driving force with frictional losses. A hydrostatic pressure imbalance concept is used between the left and right sides of the fluid loop to calculate the buoyancy driving force. Velocity and temperature distributions within the channels are determined from two-dimensional analysis of the channel section, with developing region effects included empirically through scaled values of the local Nusselt number. Good agreement between four independent verification steps validate the 1-D simulation approach: (1) analytical expressions for the thermal entrance length are compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum PCR runtime required to get a positive PCR signal from the buoyancy-driven PCR device. The 1-D approach closely models an actual buoyancy-driven PCR device and can further be used as a rapid design tool to simulate buoyancy PCR flows and perform detailed design optimizations studies.

  6. The ligase chain reaction as a primary screening tool for the detection of culture positive tuberculosis.

    O'Connor, T M

    2012-02-03

    BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.

  7. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots

    Liang Gaofeng; Ma Chao; Zhu Yanliang; Li Shuchun; Shao Youhua; Wang Yong; Xiao Zhongdang

    2010-01-01

    Abstract Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR). Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase ...

  8. Sensitive detection of Treponema pallidum by using the polymerase chain reaction.

    Burstain, J M; Grimprel, E; Lukehart, S A; Norgard, M V; Radolf, J D

    1991-01-01

    We have developed a sensitive assay for Treponema pallidum subsp. pallidum (T. pallidum), the agent of veneral syphilis, based upon the polymerase chain reaction (PCR). A 658-bp portion of the gene encoding the 47-kDa membrane immunogen was amplified, and the PCR products were probed by DNA-DNA hybridization with a 496-bp fragment internal to the amplitifed DNA. The assay detected approximately 0.01 pg of purified T. pallidum DNA, and positive results were obtained routinely from suspensions ...

  9. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... test for Mycoplasma gallisepticum (MGLP ReTi). (a) DNA extraction. Use Qiagen Qiamp Mini Kit for...

  10. Design for environment: The greening of product and supply chain

    K Soylu; Dumville, J. C.

    2011-01-01

    This research aims to analyze specifically three disciplines, which are design for environment; design for supportability; and design for supply chain, to assess particularly their interactions and collaborations in the new product development, and to explain briefly how their activities can green new products and supply chains. Experience and a comprehensive review of literature associated with concurrent engineering, supply chain, and environmental management can present a theoretical model...

  11. Optimalization of production inside logistics chain for 21st century

    Drago Pupavac

    2006-12-01

    Full Text Available In today’s world numerous logistics chains exist, competing for similar jobs in different markets throughout the world. By connecting the supply and demand, i.e. production and consumption, logistics chains create national, regional and global logistics network which task is to maximise total generated value. Generated valueis defined as the difference between the price of finished product or service and the input necessary to create such products. The chain profitability is shown by the difference between the income obtained through sale of products or services and total expenditure in that chain. Accordingly, this scientific debate researches the possibilityof production optimisation within logistic chain by application of dynamic programming method with emphasis on information technologies.

  12. Novel Haloperoxidase Reaction: Synthesis of Dihalogenated Products

    Geigert, John; Neidleman, Saul L.; Dalietos, Demetrios J.; DeWitt, Susanne K.

    1983-01-01

    The enzymatic synthesis of vicinal, dihalogenated products from alkenes and alkynes is described. The enzymatic reaction required an alkene or alkyne, dilute hydrogen peroxide, a haloperoxidase, and molar amounts of halide ions. Vicinal dichloro, dibromo, and diiodo products could be formed. A hydroxyl group on the carbon adjacent to the carbon-carbon double or triple bond lowered the halide ion concentration needed to produce the dihalo product. This reaction offers one explanation for the o...

  13. An improved electrochemiluminescence polymerase chain reaction method for the detection of Fusarium wilts

    Jie Wei; Xiao Ming Zhou

    2008-01-01

    An improved electrochemiluminescence polymerase chain reaction (ECL-PCR) method was developed and applied to detect Fusarium wilt. Briefly, the internal transcribed spacer (ITS) sequence of Fusarium oxysporum f. sp Cubense (FOC) was amplified by PCR. Two universal fragments, which were complimentary to Ru(bpy)32+ (TBR) labeled probe and Biotin labeled probe, respectively, were connected to the tail of primers so that all the PCR products got universal sequences. Then biotin labeled probes and TBR labeled probes were hybridized with the PCR products at the same time. Through the specific interaction between biotin and streptavidin, the PCR products were captured by streptavidin coated magnetic bead and then detected by ECL assay. The experiment results showed that the healthy banana samples and infected ones can be discriminated by this ECL-PCR method. This improved ECL-PCR approach is useful in Fusarium wilt detection due to its high sensitivity, simplicity and stability.

  14. Applying the means-end chain concept to product development

    Søndergaard, Helle Alsted

    This paper proposes that the means-end chain (MEC) approach can influence the use of market information and inter-functional communication in new product development (NPD). The central question is whether market information represented by means-end chain data can be a vehicle for inter-functional......This paper proposes that the means-end chain (MEC) approach can influence the use of market information and inter-functional communication in new product development (NPD). The central question is whether market information represented by means-end chain data can be a vehicle for inter...

  15. The effect of chain flexibility and chain mobility on radiation crosslinking reactions of polymers

    Flexibility of polymer chains is an important factor to effects of radiation crosslinking of the polymer. Polymers with flexible chains are easier to be crosslinked, with lower dose of gelation, than polymers with more rigid chains. And it is known that most polymers with abnormal rigidity can be radiation-crosslinked only at high temperatures when the molecular chains get enough mobility. The flexibility of polymer chains also influences the relationship between degree of degradation and radiation dose. A chain flexibility factor β has been introduced to modify the Charlesby-Pinner equation of sol-fraction and radiation dose. The new relationship equation applies to a wider range of polymers in radiation crosslinking. Studies also show that for flexible polymers with lower Tg and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in H type, whereas for rigid polymers with higher Tg and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in T type

  16. 食品中化脓链球菌的PCR检测方法的建立%Establishment of Polymerase Chain Reaction Assay for Detection of Streptococcus Pyogenes in Food Products

    杨学明; 巢强国; 葛宇; 熊薇; 曲勤凤

    2008-01-01

    化脓链球菌是一种常见的食源性致病菌,从19世纪80年代起,化脓链球菌引起的感染在全球范围内呈逐步上升之势并发展成为人类重要致病茵之一.通过已公布的13株化脓链球菌的基因组序列找出具有种特异性的基因序列.运用BLAST(Basic Local Alignment Search Tool,基本局部比对工具)在GenBank中进行序列对库的比对结果表明:化脓链球菌的某些基因(SmeZ,emm,spyM51755)具有种特异性.以这些基因为目的基因,共设计七对引物.经PCR(Polymerase Chain Reaction,聚合酶链式反应)检测发现spvM引物对(spyM51755F,spyM51755R)具有很高的特异性.利用该引物对,建立可快速且灵敏地检测食品中化脓链球菌的PCR方法,其灵敏度达到10 cfu/g样品.

  17. Reaction products of chlorine dioxide.

    Stevens, A A

    1982-01-01

    Inspection of the available literature reveals that a detailed investigation of the aqueous organic chemistry of chlorine dioxide and systematic identification of products formed during water disinfection has not been considered. This must be done before an informed assessment can be made of the relative safety of using chlorine dioxide as a disinfectant alternative to chlorine. Although trihalomethanes are generally not formed by the action of chlorine dioxide, the products of chlorine dioxi...

  18. Snake antivenoms: adverse reactions and production technology

    VM Morais

    2009-01-01

    Full Text Available Antivenoms have been widely used for more than a century for treating snakebites and other accidents with poisonous animals. Despite their efficacy, the use of heterologous antivenoms involves the possibility of adverse reactions due to activation of the immune system. In this paper, alternatives for antivenom production already in use were evaluated in light of their ability to minimize the occurrence of adverse reactions. These effects were classified according to their molecular mechanism as: anaphylactic reactions mediated by IgE, anaphylactoid reactions caused by complement system activation, and pyrogenic reactions produced mainly by the presence of endotoxins in the final product. In the future, antivenoms may be replaced by humanized antibodies, specific neutralizing compounds or vaccination. Meanwhile, improvements in antivenom quality will be focused on the obtainment of a more purified and specific product in compliance with good manufacturing practices and at an affordable cost.

  19. Optimization Model of Close Supply Chain of Green Agricultural Products

    Wang, Duo-hong; Li, Yu; Zhao, Hong-Xia; Zhang, Jiang-quan

    2009-01-01

    Close supply chain of green agricultural products is defined, consisting of the supplier, manufacturer, distributor, retailer and consumer (customer). Cost structure of distributor is analyzed, mainly including the order activity-based cost, the inventory cost and the supply transportation cost of agricultural products in upstream and downstream enterprises. Based on this, conceptual model of the close supply chain of green agricultural products is established. According to the idea of dynami...

  20. Bottleneck on Supply Chain of Organic Agricultural Products and Countermeasures

    ZHANG Xin-min

    2012-01-01

    Organic agriculture is one of successful models of low-carbon agriculture, and plays an important role in alleviating and adapting to climate change. However, the development of supply chain of organic agricultural products lags behind, which seriously restricts development of organic agricultural product market. In this paper, major models and bottleneck of supply chain of organic agricultural products are analyzed, and finally countermeasures are put forward.

  1. Economic optimization of surveillance in livestock production chains

    Guo, X.

    2015-01-01

    Abstract Hazard surveillance in livestock production chains is an essential activity that is usually conducted by surveillance organizations. Its importance has been highlighted by the major crises that occurred in the field of livestock production and food safety during the last decades. Although extensive research has been conducted to achieve surveillance improvement in livestock production chains, they have limitations in terms of coverage of economic aspects and in the level of detail i...

  2. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots

    Liang Gaofeng

    2011-01-01

    Full Text Available Abstract Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR. Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase concentration or by adding bovine serum albumin (BSA. The mechanisms underlying these effects were also discussed. The results indicated that CdTe QDs could be used to optimize the amplification products of the PCR, especially in the multi-PCR system with different primers annealing temperatures, which is of great significance for molecular diagnosis.

  3. The new possibility of the fusion p + 11B chain reaction being induced by intense laser pulses

    Belyaev, V. S.; Krainov, V. P.; Matafonov, A. P.; Zagreev, B. V.

    2015-09-01

    We discuss the experimental and theoretical principal schemes of a thermonuclear reactor, based on the fusion reaction p + 11B: beam collisions, fusion in degenerate plasmas, ignition at the plasma, particle acceleration by nonlinear ponderomotive forces and irradiation of the solid 11B target by a proton beam at the Coulomb explosion of hydrogen microdroplets. The fusion reaction p + 11B can be initiated by ultrashort high intensity laser pulses under conditions far from thermodynamic equilibrium. This may result in fusion products containing a small amount of neutrons and other nuclear radiation effects. It was found that the fusion reaction p + 11B produces further nuclear reactions and generates high-energy protons. The latter can support the chain reaction process. Our approach allows us to also investigate nuclear reactions in the early Universe and in stars.

  4. Supply Chain of Organic Products in Bulgaria

    Mishev, Plamen Dimitrov; Stoyanova, Zornitsa D.

    2009-01-01

    The market of organic products in Bulgaria enlarged significantly in the last few years. Although the share of organic food products in general food market in the country is relatively small-less than 5 %, the total area under organic products in Bulgaria/cultivated and wild collected/ is more than 250 thousand ha. The development of organic production is considered for one of the priority for development of the agricultural sector and food market. One of the factors considered to an obstacle...

  5. Suppression of chicken J chain production by in ovo bursectomy.

    Moriya, O; Ichikawa, Y

    1990-05-01

    The influence of in ovo bursectomy on the levels of J and mu chains in the sera of embryonic and hatched chicks was studied by the dot blotting immunoassay. The results indicated a decrease in the level of J chains during the embryonic stage after treatment with testosterone compared with normal chicks. Testosterone treatment caused a decrease in J-chain levels after hatching which was more marked in reduced-alkylated than in non-reduced sera. In contrast, testosterone caused no significant change in serum levels of mu chains, either in ovo or after hatching. Our findings further present the paradox that although removal of the bursa of Fabricius by testosterone treatment did not impair mu-chain synthesis, B-cell differentiation was suppressed. These observations indicate that in ovo bursectomy selectively inactivates B-cell differentiation as indicated by the induction of immunodeficiency, and results in the failure of J-chain production. PMID:2112285

  6. Polymerase chain reaction for the diagnosis of viral hepatitis B and C.

    Bréchot, C

    1993-01-01

    Polymerase chain reaction is a highly sensitive technique for the detection of hepatitis B virus-DNA and hepatitis C virus-RNA in serum, liver tissue, and peripheral mononuclear blood cells. In chronic hepatitis B, it is particularly useful for identification of infectious subjects who are hepatitis B surface antigen positive and anti-hepatitis B e antigen antibody-positive, and for follow up of hepatitis B virus infections in liver transplantation programmes. Polymerase chain reaction detect...

  7. Polymerase chain reaction for detection of the cholera enterotoxin operon of Vibrio cholerae.

    1991-01-01

    We report a set of oligonucleotide primers and amplification conditions for the polymerase chain reaction to detect the ctx operon of Vibrio cholerae. The results of this assay on strains of V. cholerae and related organisms were identical with those obtained by the DNA colony hybridization test with the polynucleotide probe. The detection limit of this system was 1 pg of chromosomal DNA or broth culture containing three viable cells. The polymerase chain reaction method could directly detect...

  8. Challenges for bio-based products in sustainable value chains

    Cardon, L.; Lin, J.W.; De Groote, M.; Ragaert, K.; Kopecka, J.A.; Koster, R.P.

    2011-01-01

    This work concerns studies related to strategic development of products in which bio-based plastics are or will be applied, referred to as bio-based products. The studies cover (1) current and potential benefits of bio-based products in extended value chains including activities after end-of-life of

  9. Stereoselective synthesis of 2,2-bis(C-branched-chain) glucopyranosid-3-ulose via autoxidation reaction

    LIU Hong-Min; ZHANG Fuyi; TAO Jing-Chao

    2004-01-01

    Many different approaches for synthesis of branched chain sugars have beenestablished,1 because they are very useful intermediates for synthesis of other non-sugar chiralmolecules, and usually occur in nature. Branched chain glycosidulose can be used for construction offive- and six-membered carbocyclic rings to which two chiral carbons of sugar are incorporated byintramolecular aldol condensation and Robinson annulation,2 Therefore they are useful in thesynthesis of natural products which consist of annulated carbohydrates or where a highlyfunctionalised enantiomerically pure cyclopentane or cyclohexane is required. Also, this type ofbranched chain sugar can be considered as the synthons of monoterpenoid natural products of theiridoid class which have the cyclopentan-(c)-pyran structure. In view of the importance of branchedchain glycosiduloses, it is desirable to have a general, convenient methodology to their synthesis.However, none of the literature methods was reported on their synthesis by a nuclephilic addition toa partially protected glycosidulose, due to the fact that these glycosiduloses are very difficult tosynthesize selectively and unstable;3 and what is more, one-step synthesis branched chainglycosidulose using this method is almost impossible.In this paper, we report on a general, convenient method for stereoselective syntheses of2,2-bis(C-branched-chain)glucopyranosid-3-uloses by the new reaction of 1 with various activemethylene compounds. The generality of this method was examined in detail. The optimumtemperature was 18-25℃. The solvent DMF was better than the others. In all cases he yields werehigher than 60%.All the 2,2-bis(C-branched-chain)glucopyranosid-3-uloses were characterized by X-raycrystallographic analyses. In addition, the important iintermediate in this reaction was isolated,which is the product of autoxidation of 1 at C-3 position. Thus the reaction mechanism for thesynthesis of 2,2-bis(C-branched-chain) glucopyranosid-3-uloses

  10. Modes of environmental management in transnational product chains

    Jørgensen, Michael Søgaard; Jørgensen, Ulrik; Hendriksen, Kåre;

    2007-01-01

    opportunities by being present in the country where the sourcing takes place. The paper discusses different modes of environmental management in such transnational product chains based on a number of cases, and explores the links to the business strategy of the companies and national and international...... regulation and standards. The roles of the involved nation states are often limited. In some cases international regulatory initiatives may shape the environmental management in product chains. The interpretative elements in ISO 14001 imply that some companies are sceptical about this kind of management...... in supply chains and practice in stead direct control based on more specific demands. More analyses of environmental management in transnational product chains is needed, including the role of general and more specific international guidelines and standards in combination with initiatives like customers...

  11. Reaction mechanisms in the radiolysis of peptides, polypeptides and proteins II reactions at side-chain loci in model systems

    The major emphasis in radiation biology at the molecular level has been on the nucleic acid component of the nucleic acid-protein complex because of its primary genetic importance. But there is increasing evidence that radiation damage to the protein component also has important biological implications. Damage to capsid protein now appears to be a major factor in the radiation inactivation of phage and other viruses. And, there is increasing evidence that radiation-chemical change in the protein component of chromation leads to changes in the stability of the repressor-operator complexes involved in gene expression. Knowledge of the radiation chemistry of protein is also of importance in other fields such as the application of radiation sterilization to foods and drugs. Recent findings that a class of compounds, the α,α'-diaminodicarboxylic acids, not normally present in food proteins, are formed in protein radiolysis is of particular significance since certain of their peptide derivatives have been showing to exhibit immunological activity. The purpose of this review is to bring together and to correlate our present knowledge of products and mechanisms in the radiolysis of peptides, polypeptides and proteins both aqueous and solid-state. In part 1 we presented a discussion of the radiation-induced reactions of the peptide main-chain in model peptide and polypeptide systems. Here in part 2 the emphasis is on the competing radiation chemistry at side-chain loci of peptide derivatives of aliphatic, aromatic-unsaturated and sulfur-containing amino acids in similar systems. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis, and ESR spectroscopy are included

  12. Snake antivenoms: adverse reactions and production technology

    VM Morais; H Massaldi

    2009-01-01

    Antivenoms have been widely used for more than a century for treating snakebites and other accidents with poisonous animals. Despite their efficacy, the use of heterologous antivenoms involves the possibility of adverse reactions due to activation of the immune system. In this paper, alternatives for antivenom production already in use were evaluated in light of their ability to minimize the occurrence of adverse reactions. These effects were classified according to their molecular mechanism ...

  13. Environmental innovations in the product chain

    Remmen, Arne; Holgaard, Jette Egelund

    2004-01-01

    The article gives an overview of different positions within innovation and network theory, and highlights how enterprises within the organic dairy industry and fish processing industry have made environmental innovations related to their processes and products.......The article gives an overview of different positions within innovation and network theory, and highlights how enterprises within the organic dairy industry and fish processing industry have made environmental innovations related to their processes and products....

  14. Reactions analysis of di-pions production

    After a discussion of ambiguities in the methods used to obtain informations on the ππ diffusion from the reaction π-p→π+π-n with unpolarized targets, a model-independent method is proposed to determine experimentally the cross section for the S-wave production in the reaction π+p→π+π-Δ++. Comparing the S-wave di-pion production in the ζ-mass region from the recent experimental results on the reactions π+p→π=π-Δ++ and π-p→π-π+n on a polarized target, it is found that the amount of S-wave production is generally consistent with the lower bound obtained from the di-pion decay moments

  15. 76 FR 41525 - Hewlett Packard Global Parts Supply Chain, Global Product Life Cycles Management Unit Including...

    2011-07-14

    ... Parts Supply Chain, Global Product Life Cycles Management Unit, including teleworkers reporting to... Chain, Global Product Life Cycles Management Unit, including teleworkers reporting to Houston, Texas... Employment and Training Administration Hewlett Packard Global Parts Supply Chain, Global Product Life...

  16. Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

    Radji, M.

    2010-01-01

    Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

  17. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    1994-01-01

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  18. Design of Multiplex Polymerase Chain Reaction (PCR Method for Molecular Detection of Yersinia pestis Bacterium

    Mohammad Soleimani

    2010-01-01

    Full Text Available Objective: Yersinia pestis, the causative agent of the zoonotic plague infection, is a majorpublic health concern both as a threat and potential bioweapon. The objective of thepresent study was to establish a uniplex and multiplex - polymerase chain reaction (PCRtest for the specific detection of Y. pestis.Materials and Methods: PCR reactions performed by three pair primers which targetedthe caf1 and pla genes located on the pFra and pPst plasmids and the irp2 chromosomalgene located on the ‘pathogenicity island’. After TA cloning of the PCR products, the test’slimit of detection (LOD was determined. For evaluating the specificity, PCR reactionswere performed with negative control bacteria.Results: Assays were performed with the genome of Y. pestis which produced three DNAfragments of the expected sizes 300, 400 and 520 bp which corresponded to the irp2,caf1 and pla genes, respectively. The lower LoD was 370 copy numbers for the caf1 geneand 21 for the pla gene. In PCR reactions that used negative control bacteria, detectablefragments were not observed.Conclusion: Our method clearly discriminated Y. pestis DNA. The rapidity, specificityand sensitivity of this procedure suggest that it can serve as a useful alternative methodfor the inoculation of laboratory animals or the use of specific culture media for routineplaque surveillance and outbreak investigations. Another vital result of this study was theestablishment of Y. pestis molecular detection technique in Iran.

  19. High energy photons production in nuclear reactions

    Hard photon production, in nucleus-nucleus collisions, were studied at beam energies between 10 and 125 MeV. The main characteristics of the photon emission are deduced. They suggest that the neutron-proton collisions in the early stage of the reaction are the main source of high energy gamma-rays. An overview of the theoretical approaches is given and compared with experimental results. Theoretical attempts to include the contribution of charged pion exchange currents to photon production, in calculations of proton-nucleus-gamma and nucleus-nucleus-gamma reactions, showed suitable fitting with experimental data

  20. Absolute rate constants for the reaction of hypochlorous acid with protein side chains and peptide bonds

    Pattison, D I; Davies, Michael Jonathan

    2001-01-01

    , absolute second-order rate constants for the reactions of HOCl with protein side chains, model compounds, and backbone amide (peptide) bonds have been determined at physiological pH values. The reactivity of HOCl with potential reactive sites in proteins is summarized by the series: Met (3.8 x 10(7) M(-1....... Proteins are major targets for this oxidant, and such reaction results in side-chain modification, backbone fragmentation, and cross-linking. Despite a wealth of qualitative data for such reactions, little absolute kinetic data is available to rationalize the in vitro and in vivo data. In this study...

  1. Differentiation of Neisseria gonorrhoeae strains by polymerase chain reaction and restriction fragment length polymorphism of outer membrane protein IB genes.

    Lau, Q C; Chow, V T; Poh, C. L.

    1995-01-01

    OBJECTIVES--To employ polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis for the rapid differentiation of Neisseria gonorrhoeae protein IB (PIB) isolates and to compare its usefulness with the widely accepted auxotype/serovar classification scheme. METHODS--The outer membrane protein IB genes of 47 gonococcal isolates belonging to 10 different serovars were amplified by PCR. The approximately 1 kb DNA products were then digested separately with restri...

  2. Transgenes monitoring in an industrial soybean oil processing by conventional and real-time polymerase chain reaction

    Costa, J; Mafra, I; Amaral, J S; Oliveira, M. B. P. P.

    2009-01-01

    In recent years a great effort has been devoted to the development of new methods for the qualitative and quantitative detection of transgenic sequences in food. Most of the developed analytical methods for GMO detection are DNA-based, since protein-based assays are not suitable for processed food. For that purpose, polimerase chain reaction (PCR) and real-time quantitative PCR have been successfully applied. Since the approval of Roundup Ready (RR) soybean in Europe, the production of soybea...

  3. Environmental innovations in the product chain

    Remmen, Arne; Holgaard, Jette Egelund

    2003-01-01

    The paper gives a brief overview of different positions within innovation and network theory, and on that basis a framework is developed and discussed in relation to environmental innovations.The paper also highlights how enterprises within two different trades in the Danish food industry have made...... environmental innovations related to their processes and products....

  4. Tracking Zoonotic Pathogens in Dairy Production Chains

    Dairy farming is a highly productive system producing ample amounts of high-quality milk and meat from fewer cows on less land on fewer, but larger, farms. Despite this consolidation and modernization zoonotic pathogenic bacteria and protozoans remain problems on the modern dairy farm. Although past...

  5. Amplifying genes using the polymerase chain reaction: A promising diagnostic tool

    The power to amplify genetic material several millionfold using the polymerase chain reaction (PCR) has greatly enhanced the ability of molecular biologists to examine and manipulate genes. We have used the PCR reaction to detect bluetongue virus (BTV) in infected animals and are currently able to serogroup, serotype and determine the geographic origin of a BTV isolate. Similarly, using a combination of hybridization analyses and direct sequencing of the PCR products we can rapidly detect avian influenza virus, Newcastle disease virus and Mycoplasma and predict if we have nucleic acid sequences that are characteristic of a virulent or avirulent isolate. The ability to manipulate genetic information has made it possible to generate proteins containing deletions or create chimeric proteins which contain additions to their sequences. Such studies are important for the understanding of immune responses to various protein epitopes. Besides its sensitivity, PCR has the advantage of speed over some other detection systems. A comprehensive detection and diagnosis can be done in a few hours compared with several weeks previously required for virus isolations. However, there are disadvantages to using PCR. Because of its ability to amplify a sequence several millionfold, contaminants other than the target species may be amplified and since the DNA polymerase used in PCR has no editing or proofreading functions, errors may be quickly incorporated into the final PCR product. 13 refs, 8 figs

  6. Applying the means-end chain concept to product development

    Søndergaard, Helle Alsted

    This paper proposes that the means-end chain (MEC) approach can influence the use of market information and inter-functional communication in new product development (NPD). The central question is whether market information represented by means-end chain data can be a vehicle for inter......-functional communication. This paper describes a PhD project - that through case studies and action research in two companies - aims at investigating the effects on communication and attitudes to communication by those involved when introducing means-end chain data as market information in NPD....

  7. Migration of radioactive products through alimentary chains

    Data on the migration of radioactive products in biocoenoses are presented and their main migration routes are discussed. Data on the radioactive contamination of food of vegetable, animal and marine origin are mentioned. It was proved that the processing of raw foodstuffs and cooking considerably reduces their contamination. Data on the amounts of radionuclides taken in by the human organism owing to local and global radioactive fallout are presented. (author)

  8. In Chains? Automotive Suppliers and Their Product Development Activities

    Corswant, F.; Wynstra, Finn; Wetzels, Alex

    2003-01-01

    textabstractA conceptual framework is developed and tested in which supplier downstream position in the supply chain, supplier innovation strategy and customer development commitment are seen as the antecedents of supplier product development activity. Using partial least squares (PLS), we analyze the results of a survey of 161 Swedish automotive suppliers and test a series of nested models to test our hypotheses. We demonstrate that the position of the supplier in the supply chain and its st...

  9. Traceability: a demand of agro industrial chain for special products

    José Verissimo Foggiatto Silveira

    2007-10-01

    Full Text Available The inclusion of agricultural products with different nutritional features has altered the relationship, the upstream and the downstream of enterprises that produce and commercialize them. Coordination in the Agro Industrial System is demanded, including traceability as a way to guarantee the conformity of products, attending external clients and agricultural industries that require quality certification. This quality tool enables the identification of some details in the productive chain, such as seeds, farming, harvesting, storage, transportation and industrialization of products. Thus, this essay describes the concept of traceability and provides information of special products from a cooperative from Paraná, which has controlled process in the productive chain, demanded by contractual partnerships done with enterprises that provide fertilizers and food processors. It was identified that this cooperative commercializes three products that need traceability: two special kinds of corn and the regular kind of soybean.

  10. Fusion reaction product diagnostics in ASDEX

    A diagnostic method was developed to look for the charged fusion products from the D(D,p)T-reactions in the divertor tokamak ASDEX. With a semi-conductor detector it was possible to evaluate the ion temperature in thermal plasmas from the proton energy spectra as well as from the triton spectra. In lower-hybrid wave heated plasmas non-thermal (fast) ions were observed. These ions create fusion products with a characteristically different energy spectrum. (orig.)

  11. Elongase reactions as control points in long-chain polyunsaturated fatty acid synthesis.

    Melissa K Gregory

    Full Text Available BACKGROUND: Δ6-Desaturase (Fads2 is widely regarded as rate-limiting in the conversion of dietary α-linolenic acid (18:3n-3; ALA to the long-chain omega-3 polyunsaturated fatty acid docosahexaenoic acid (22:6n-3; DHA. However, increasing dietary ALA or the direct Fads2 product, stearidonic acid (18:4n-3; SDA, increases tissue levels of eicosapentaenoic acid (20:5n-3; EPA and docosapentaenoic acid (22:5n-3; DPA, but not DHA. These observations suggest that one or more control points must exist beyond ALA metabolism by Fads2. One possible control point is a second reaction involving Fads2 itself, since this enzyme catalyses desaturation of 24:5n-3 to 24:6n-3, as well as ALA to SDA. However, metabolism of EPA and DPA both require elongation reactions. This study examined the activities of two elongase enzymes as well as the second reaction of Fads2 in order to concentrate on the metabolism of EPA to DHA. METHODOLOGY/PRINCIPAL FINDINGS: The substrate selectivities, competitive substrate interactions and dose response curves of the rat elongases, Elovl2 and Elovl5 were determined after expression of the enzymes in yeast. The competitive substrate interactions for rat Fads2 were also examined. Rat Elovl2 was active with C(20 and C(22 polyunsaturated fatty acids and this single enzyme catalysed the sequential elongation reactions of EPA→DPA→24:5n-3. The second reaction DPA→24:5n-3 appeared to be saturated at substrate concentrations not saturating for the first reaction EPA→DPA. ALA dose-dependently inhibited Fads2 conversion of 24:5n-3 to 24:6n-3. CONCLUSIONS: The competition between ALA and 24:5n-3 for Fads2 may explain the decrease in DHA levels observed after certain intakes of dietary ALA have been exceeded. In addition, the apparent saturation of the second Elovl2 reaction, DPA→24:5n-3, provides further explanations for the accumulation of DPA when ALA, SDA or EPA is provided in the diet. This study suggests that Elovl2 will be

  12. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

    Pérez Urquiza, M.; Acatzi Silva, A. I.

    2014-02-01

    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  13. DCHAIN: A user-friendly computer program for radioactive decay and reaction chain calculations

    A computer program for calculating the time-dependent daughter populations in radioactive decay and nuclear reaction chains is described. Chain members can have non-zero initial populations and be produced from the preceding chain member as the result of radioactive decay, a nuclear reaction, or both. As presently implemented, chains can contain up to 15 members. Program input can be supplied interactively or read from ASCII data files. Time units for half-lives, etc. can be specified during data entry. Input values are verified and can be modified if necessary, before used in calculations. Output results can be saved in ASCII files in a format suitable for including in reports or other documents. The calculational method, described in some detail, utilizes a generalized form of the Bateman equations. The program is written in the C language in conformance with current ANSI standards and can be used on multiple hardware platforms

  14. Effective sourcing strategies for perishable product supply chains

    Rijpkema, Willem A.; Rossi, Roberto; Van Der Vorst, Jack G.A.J.

    2014-01-01

    Purpose – The purpose of this paper is to assess whether an existing sourcing strategy can effectively supply products of appropriate quality with acceptable levels of product waste if applied to an international perishable product supply chain. The authors also analyse whether the effectiveness of this sourcing strategy can be improved by including costs for expected shelf life losses while generating order policies. Design/methodology/approach – The performance of sourcing strategies is exa...

  15. Scenarios for the milk production chain in Brazil in 2020

    Renata Giovinazzo Spers; James Terence Coulter Wright; André de Azevedo Amedomar

    2013-01-01

    Brazilian milk production has grown steadily and in 2004 the country became self-sufficient in dairy production. This article develops possible scenarios for the milk production chain in Brazil for the year 2020 in order to contribute to decisions that must be made by stakeholders. A literature review on foresight and the use of scenarios was conducted, and a scenario writing approach based on Wright and Spers (2006) was adopted, which includes the use of the Delphi method, Michael Porter's F...

  16. An overview on the Brazilian orange juice production chain

    Renato Marcio dos Santos; Irenilza de Alencar Nääs; Mario Mollo Neto; Oduvaldo Vendrametto

    2013-01-01

    Brazil is the world's largest producer of oranges and uses more than 70% of the harvested fruits in the production of juices. The amount of processed orange is growing about 10% per year, confirming the trend of the Brazilian citrus for juice production. This research aimed to investigate the Brazilian orange juice production chain from 2005 to 2009. Data from the amount of frozen juice produced and exported, international price of orange juice, and intermediate transactions were assessed in ...

  17. Pattern on Total Productive Maintenance in Supply Chain

    汪蓉; 黄培; 季建华

    2003-01-01

    Defined as total productive maintenance carried out by all cooperators in Supply Chain, Total Operational Maintenance (TOM) focuses on adapting to collaborative business environment in virtue of Internet & Intranet. It focuses on the managerial ideology of embedded with Quick Response (QR),Total Productive Maintenance (TPM) and Supply Chain. And the theoretical architecture and implementation is also described. It offers emphatically that it is necessary to exceed competitive advantage of the enterprises by optimizing reliability, empowerment and Overall Facilities Effectiveness (OFE) applying TOM together into the strategic improvement plan.

  18. Method of carbon chain extension using novel aldol reaction

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hangson, Susan Kloek

    2013-08-13

    Method of producing C.sub.8-C.sub.15 hydrocarbons comprising providing a ketone starting material; providing an aldol starting material comprising hydroxymethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.2, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  19. Limitations of clonality analysis of B cell proliferations using CDR3 polymerase chain reaction

    Hoeve, M A; Krol, A D G; Philippo, K; Derksen, P W B; Veenendaal, R. A.; Schuuring, E; Kluin, Ph M; Krieken, J.H.J.M. van

    2000-01-01

    Background/Aims—Detection of clonal immunoglobulin heavy chain (IgH) rearrangements by the polymerase chain reaction (PCR) is an attractive alternative to Southern blotting in lymphoma diagnostics. However, the advantages and limitations of PCR in clonality analysis are still not fully appreciated. In this study, clonality was analysed by means of PCR, focusing in particular on the sample size requirements when studying extremely small samples of polyclonal and monoclonal lesions.

  20. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    Tang Yabing [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Xing Da [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)]. E-mail: xingda@scnu.edu.cn; Zhu Debin [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Liu Jinfeng [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)

    2007-01-23

    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity.

  1. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity

  2. A power-efficient thermocycler based on induction heating for DNA amplification by polymerase chain reaction

    Pal, Debjani; Venkataraman, V.; Mohan, K. Naga; Chandra, H. Sharat; Natarajan, Vasant

    2004-09-01

    We have built a thermocycler based on the principles of induction heating for polymerase chain reaction (PCR) of target sequences in DNA samples of interest. The cycler has an average heating rate of ˜0.8 °C/s and a cooling rate of ˜0.5 °C/s, and typically takes ˜4 h to complete a 40-cycle PCR protocol. It is power-efficient (˜6 W per reaction tube), micro-processor controlled, and can be adapted for battery operation. Using this instrument, we have successfully amplified a 350 bp segment from a plasmid and SRY, the human sex determining gene, which occurs as a single-copy sequence in genomic DNA of human males. The PCR products from this thermocycler are comparable to those obtained by the use of commercially available machines. Its easy front-end operation, low-power design, portability and low cost makes it suitable for diagnostic field applications of PCR.

  3. A coalescent approach to the polymerase chain reaction.

    Weiss, G.; von Haeseler, A

    1997-01-01

    A versatile algorithm is developed to model PCR on a computer. The method is based on a modification of the coalescent process and provides a general framework to analyse data from PCR. It allows for incorporation of the dynamics of the replication process as described in terms of the number of starting template molecules and cycle-dependent PCR efficiency. The simulation method generates, as a first step, the genealogy of a set of sequences sampled from a final PCR product. In a second step ...

  4. Optimization of competitively differentiated polymerase chain reaction in detection of HBV basal core promoter mutation

    Xiao-Mou Peng; Lin Gu; Xue-Juan Chen; Jian-Guo Li; Yang-Su Huang; Zhi-Liang Gao

    2005-01-01

    AIM: To improve competitively differentiated polymerase chain reaction (CD-PCR) in detection of HBV basal core promoter mutation.METHODS: Recombinant plasmid of double point mutation A1762T/G1764A in basal core promoter of HBV constructed by site-directed mutagenesis was used as mutant control.To reveal the deficiency mechanism of CD-PCR, relationship between the circle number of PCR and the increased speed of products of each competitive primer was comparatively studied. Diversified amount of dNTPs and mutual primer of the competitive primers were tried to optimize CDPCR. Optimized CD-PCR was evaluated by detecting A1762T/G1764A mutation in recombinant plasmids and clinical sera from patients with HBV infection. RESULTS: The deficiency mechanism of CD-PCR was that the products of mismatched competitive primer grew fast when the amplification of matched primer entered into plateau stage, which led to decrease in or disappearance of the difference in the amount of their products. This phenomenon could be eliminated by reducing dNTPs to10 μmol/L and mutual primer to about 100 nmol/L. Optimized CD-PCR could detect both mutant and wild strain indepe ndent of the amount of templates and the number of PCRcycles. Its detection limit was 103 copies/mL, about 50 copies/reaction. About 10% of mutant DNAs among wild type DNAs could be detected. A1762T/G1764A mutant was detected in 41.8% (51/122) of patients with HBV infection, but not detected in controls with negative HBsAg. CONCLUSION: Optimized CD-PCR can detect mutation independent of the amount of initial templates and the number of PCR cycles.

  5. The shaping of environmental concern in product chains: analysing Danish case studies on environmental aspects in product chain relations

    Forman, Marianne; Hansen, Anne Grethe; Jørgensen, Michael Søgaard

    chain, which the case company represents, are identified. Direct customer and regulatory demands, as well as indirect societal and regulatory demands are mapped, and their role for product chain greening analysed. The case studies point to the importance of customer demand, regulation and potentially...... the way for further greening and for further company and product chain shaping of green demand. The case studies thus lead to suggest to continue the three types of governmental regulation to support the needs for greening: demands to the environmental impact, support to competence development and......Companies and governments, particularly in the industrialised countries are increasingly aware of the environmental consequences of production, and ‘greening activities’ have increasingly played a role in company strategy and government policy. This has also been the case in Denmark, and the Danish...

  6. Researches on Risk Evaluation of Green Agro-product Closed Supply Chain

    Wang, Xue-Feng

    2011-01-01

    Closed supply chain is a superior form of management model of chain supply and an effective means of improving the modernization of agro-product circulation. Based on the research results of the current literatures on supply chain risk and agro-product supply chain, related subjects of the agro-product closed supply chain involving production, management and consumption are studied and analyzed and the primary risking factors in the supply chain system are classified as environmental risk, sy...

  7. Time-resolved studies of free radicals and laser-initiated chain reactions: Final report, 1 April 1979-31 March 1988

    Pulsed lasers were used in this work to photofragment molecules or to initiate chain reactions. One of the major advances was the availability of high-powered rare gas halide excimer lasers. In addition, pulsed Nd:YAG lasers and dye lasers were used throughout. Results include: generalized kinetic formulations of the problem of laser-initiated chain reactions. Several studies were carried out to explore the details of chain combustion phenomena, slow chain reactions, chain branching behavior, and vibrational temperatures of combusting mixtures. A method to determine the rotational temperature of nitrogen molecules by laser multiphoton ionization was shown. The chain reaction methodology was applied to complex polyatomic systems, in which complete infrared spectra of the emitting species were obtained. Systems studied included, chlorine + HBr, HI, methane, hydrogen, ethane, propane, butane, cyclopropane, and cyclohexane. Photofragmentation studies involved the production and analysis of radical species, such as methyl, CH2I, and CCH. Molecules studied included methylene iodide, methyl iodide, dimethyl mercury, acetone, acetylene, vinyl chloride, dichloroethylene, and fluorochloroethylene. The first infrared characterization of a highly vibrationally excited radical was shown. Reactions of methyl radicals were studied in detail, in which a new method for obtaining absolute values of the methyl radical reaction rates were obtained

  8. MRSA CC398 in the pig production chain.

    Broens, E M; Graat, E A M; van der Wolf, P J; van de Giessen, A W; van Duijkeren, E; Wagenaar, J A; van Nes, A; Mevius, D J; de Jong, M C M

    2011-02-01

    In 2005, a distinct clone of methicillin resistant Staphylococcus aureus (MRSA CC398) was found in pigs and people in contact with pigs. The structure of the pig production chain in high technology pig husbandry enables pathogens to spread during animal trading, with an increasing prevalence in herds further down the chain. The objective of this study was to quantify the effect of the MRSA status of the supplying herd on the MRSA status of the receiving herd in order to gain more insight into the role of animal trading as a transmission route for MRSA CC398. Nasal samples (60-80 pigs per herd) were collected from 38 herds; in 20 herds, environmental samples were collected as well. Ten MRSA-positive herds (based on the results of nasal swabs of 10 individual pigs per herd) from a prior study were included in the data analysis. Herds were classified as MRSA positive if at least one sample tested positive. The 48 herds were part of 14 complete (40 herds) and 4 incomplete (8 herds) pig production chains. Fifty-six percent of the herds were classified as MRSA positive. MRSA-positive herds were observed at the start (breeding herds), middle (farrowing herds) and the end (finishing herds) of the pig production chain. All of the herds in 8 chains tested MRSA positive;, all of the herds in 5 chains tested MRSA negative and in the remaining 5 chains, MRSA-positive and MRSA-negative herds were detected. Seven spa types were found, which were all previously confirmed to belong to CC398. All of the isolates were susceptible to mupirocin, linezolid, rifampicin, fusidic acid and cotrimoxazole. Resistance against tetracycline, erythromycin and clindamycin was found in 100, 74 and 76% of the isolates, respectively. Seventy-nine percent of herds with a MRSA-positive supplier of pigs were MRSA positive, whereas 23% of herds with a MRSA-negative supplier were MRSA positive (OR=10.8; 95% CI: 1.5-110.1; P=0.011). The presence of entirely MRSA-positive and MRSA-negative chains and the

  9. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase.

    McInerney, Peter; Adams, Paul; Hadi, Masood Z

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu, Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition. PMID:25197572

  10. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    Peter McInerney

    2014-01-01

    Full Text Available As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu, Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.

  11. Polymerase Chain Reaction (Pcr) Assay to Detect Hepatitis C Virus

    Research on the detection of hepatitis C virus in blood serum using PCR technique has been carried out. Amount of 50 blood serum from laboratory of Indonesia Red Cross (Palang Merah Indonesia = PMI) and RSCM hospital as samples, were used in this research. Lysis of virus cell and extraction of RNA virus as a preliminary treatment of the sample, was done with BOOM method using guanidine thiocyanate and diatomaceous earth, respectively. Synthesis of cDNA from RNA as an extraction product mentioned above, was carried out by means of reverse-transcriptase and RNA-se inhibitor. Amplification of cDNA was done with nested PCR technique that was performed with two times PCR processes using two pairs of oligonucleotide primers for each process. The amplified DNA was detected by agarose gel electrophoresis and ethidium bromide staining. Subsequently, the DNA was visualized with UV transilluminator. Result shows that of 50 blood serum samples, 13 serum were positive for RNA HCV that were performed with the present of specific DNA band on agarose gel. (author)

  12. In Chains? Automotive Suppliers and Their Product Development Activities

    F. von Corswant; J.Y.F. Wynstra (Finn); M. Wetzels (Alex)

    2003-01-01

    textabstractA conceptual framework is developed and tested in which supplier downstream position in the supply chain, supplier innovation strategy and customer development commitment are seen as the antecedents of supplier product development activity. Using partial least squares (PLS), we analyze t

  13. Influence of transesterification reaction temperature on biodiesel production

    Pighinelli, Anna Leticia Montenegro Turtelli; Zorzeto, Thais Queiroz; Park, Kil Jin [Universidade Estadual de Campinas (FEAGRI/UNICAMP), SP (Brazil). Fac. de Engenharia Agricola], E-mail: annalets@agr.unicamp.br; Bevilaqua, Gabriela [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Inst. de Quimica

    2008-07-01

    Brazilian government policy has authorized the introduction of biodiesel into the national energy matrix, law no.11.097 of January 13th, 2005. It is necessary, like any new product, to invest in research which is able to cover its entire production chain (planting of oilseeds, vegetable oils extraction and chemical reactions), providing data and relevant information in order to optimize the process and solve critical issues. The objective of this work was to study the effects of temperature on crude sunflower transesterification reaction with ethanol. A central composite experimental design with five variation levels (25 deg, 32 deg, 47.5 deg, 64 deg and 70 deg C) was used and response surface methodology applied for the data analysis. The statistical analysis of the results showed that the production suffered the influence of temperature (linear and quadratic effects) and reaction time (linear and quadratic). The generated models did not show significant regression. The model generated was not well suited to the experimental data and the value of the coefficient of determination (R{sup 2}=0.52) was low. Consequently it was not possible to build the response surface. (author)

  14. Immunomagnetic Separation Combined with Polymerase Chain Reaction for the Detection of Alicyclobacillus acidoterrestris in Apple Juice

    Wang, Zhouli; Wang, Jun; Yue, Tianli; Yuan, Yahong; Cai, Rui; Niu, Chen

    2013-01-01

    A combination of immunomagnetic separation (IMS) and polymerase chain reaction (PCR) was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris) in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agar...

  15. OVERCOMING TECHNICAL DESPOTISM IN THE UPLAND RICE PRODUCTIVE CHAIN

    Ferreira, Carlos Magri

    2010-01-01

    This paper presents an experiment aimed at developing sustainable rice production in the State of Mato Grosso (Brazil). It shows results from the Perception Method of Upland Rice Cropping System' Sustainability (MPSAT), which is a tool for joint analysis of technicians and stakeholders considering sustainability of upland rice productive chain within a region. It highlights the relevance of this method to overcome some undesirable practices and attitudes of many technicians in conducting rese...

  16. Supply Chain Management of a Modular Product with Returns

    Ulku, M. Ali; Hsuan, Juliana; Yu, Dennis

    Modularity and returns relate to sustainability. In a retailer-manufacturer setting and when the demand for a returnable product depends on both price and modularity level, we develop a profit-maximizing stochastic model. The solution includes optimal expressions for the price, and the order...... quantity. We derive managerial insights from our structural and numerical results relating to the management of such a perishable product and its implications on sustainable supply chain management....

  17. Application of polymerase chain reaction for detection of Legionella pneumophila in serum samples.

    Alexiou-Daniel, S.; Stylianakis, A.; Papoutsi, A.; Zorbas, I.; Papa, A.; Lambropoulos, A.F.; Antoniadis, A.

    1998-03-01

    OBJECTIVE: To apply the polymerase chain reaction (PCR) to serum samples for the rapid diagnosis of Legionnaire's disease using the L5SL9 and L5SR93 primers designed to generate a 104-base-pair (bp) fragment from the 5S RNA gene of Legionella spp. The amplified product was detected by electrophoresis and by hybridization with the L5S-1-specific probe. METHODS: Single specimens of serum obtained from 24 patients with confirmed legionellosis, at different stages of their disease, were tested by PCR. Additionally, 10 serum samples from patients with no clinical symptoms of pneumonia and 10 samples from patients suffering from pneumonia caused by Mycoplasma pneumoniae, Coxiella burnetii or Chlamydia psittaci were also tested as controls in order to determine the specificity of the method. RESULTS: Of the 24 examined serum samples, the amplified products from 12 hybridized with the L5S-1 probe (sensitivity 50%). None of the negative controls was positive after PCR. No correlation was found between the day of illness and the positivity in the test. CONCLUSIONS: The PCR technique could be applied as a diagnostic tool for the rapid diagnosis of legionellosis in serum samples after modification, mainly to improve its sensitivity. PMID:11864308

  18. Polymerase chain reaction for detection of herpesvirus simiae (B virus) in clinical specimens.

    Slomka, M J; Brown, D W; Clewley, J P; Bennett, A M; Harrington, L; Kelly, D C

    1993-01-01

    A polymerase chain reaction (PCR) was designed which is specific to Macaca fascicularis (cynomolgus monkey) isolates of B virus. The PCR primers produced the expected 188 basepair product from the Cyno 2 strain and seven other cynomolgus monkey isolates of B virus. Oligomer hybridization with a 31-mer oligonucleotide was used to confirm the origin of this product. The PCR failed to amplify DNA of Epstein-Barr virus, cytomegalovirus, varicella-zoster virus, and other alphaherpesviruses (herpes simplex virus types 1 and 2, four SA 8 isolates and three rhesus isolates of B virus). PCR testing of swabs obtained from four orally-infected cynomolgus monkeys confirmed the presence of B virus DNA in samples previously shown to be positive by culture. In addition, PCR detected B virus in several swabs from infected monkeys that were culture negative. Total DNA extracts from the trigeminal and sacral ganglia of these animals were tested by nested PCR and B virus DNA was detected in the trigeminal ganglia of 3 of the 4 orally-infected cynomolgus monkeys. Nested PCR did not detect B virus DNA in total DNA extracts obtained from the brains of the four monkeys. PMID:8392323

  19. Use of the polymerase chain reaction in epizootiological studies of viral diseases

    The polymerase chain reaction (PCR) has become a powerful diagnostic tool in veterinary virology. The research team at the Department of Virology of the National Veterinary Institute, Uppsala, Sweden, was among the first groups to develop and apply routine diagnostic PCR assays in veterinary virology, to develop PCR diagnostic kits and to introduce assays of molecular epizootiology, based on comparative nucleotide sequence analysis of the PCR products. In the paper the experiences of 10 years of application of these techniques are summarized, with special regard to technical developments, i.e. simplified methods of sample preparation, precautions to avoid false positive or negative results, comparison of standard and nested PCR and simple assays of visualization. The viruses involved in the routine PCR diagnostic work are listed in two tables. Examples are given concerning the problems of routine PCR diagnosis in veterinary virology. The use of the PCR as a basic method of 'molecular epizootiology' is discussed and illustrated with several examples. The approaches of molecular epizootiology are based on direct sequence analysis of the PCR products, comparative analysis of the sequences and construction of phylogenetic trees. By this approach the phylogenetic relations are determined and the viruses are rapidly identified and grouped. The accurate genetic identification of virus variants provides novel means to the epizootiologists to trace the geographic distribution of the viruses and to determine the origin of a given outbreak. (author)

  20. DETECTION OF PHENOL DEGRADING BACTERIA AND PSEUDOMONAS PUTIDA IN ACTIVATED SLUDGE BY POLYMERASE CHAIN REACTION

    H. Movahedyan ، H. Khorsandi ، R. Salehi ، M. Nikaeen

    2009-04-01

    Full Text Available Phenol is one of the organic pollutants in various industrial wastewaters especially petrochemical and oil refining. Biological treatment is one of the considerable choices for removing of phenol present in these wastewaters. Identification of effective microbial species is considered as one of the important priorities for production of the biomass in order to achieve desirable kinetic of biological reactions. Basic purpose of this research is identification of phenol-degrading Pseudomonas Putida in activated sludge by polymerase chain reaction (PCR that has high speed and specificity. In this research, 10 various colonies of phenol-degrading bacteria were isolated from municipal activated sludge and the rate of phenol removal and growth rate of these bacteria were assessed in different concentrations of phenol (200 – 900 mg/L. Confirmation of the largest subunit of multicomponent phenol hydroxylase (LmPH gene and gene coding the N fragment in Pseudomonas Putida-derived methyl phenol operon (DmpN gene through PCR were used for general identification of phenol-degrading bacteria and Pseudomonas Putida, respectively. Presence of a 600 bp (base pairs bond in all of isolated strains indicated that they contain phenol hydroxylase gene. 6 of 10 isolated bacteria were Pseudomonas Putida because they produced a 199 bp PCR product by DmpN primers. According to PCR results in this study, the best phenol-degrading bacteria that can utilize 500 – 600 mg/L phenol completely after 48 hours incubation, belong to Pseudomonas Putida strains. It is clear that use of isolated bacteria can lead to considerable decrease of treatment time as well as promotion of phenol removal rate.

  1. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.

    1999-01-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal sam

  2. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  3. Polyvinylpyrrolidone-Agarose Gel Electrophoresis Purification of Polymerase Chain Reaction-Amplifiable DNA from Soils

    Young, Charles C.; Burghoff, Robert L.; Keim, Lois G.; Minak-Bernero, Vera; Lute, James R.; Hinton, Stephen M.

    1993-01-01

    This communication describes a modification of agarose gel electrophoresis to provide a rapid and simple method for the purification of polymerase chain reaction-amplifiable DNA from soil. This modification is to add polyvinylpyrrolidone to the agarose gel. The polyvinylpyrrolidone addition retards the electrophoretic mobility of denaturing phenolic compounds so that they do not comigrate with nucleic acids.

  4. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  5. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  6. On-Chip integration of sample pretreatment and Multiplex polymerase chain reaction (PCR) for DNA analysis

    Brivio, Monica; Snakenborg, Detlef; Søgaard, E.; Ahlford, A.; Syvänen, A.-C; Kutter, Jörg Peter; Wolff, Anders

    In this paper we present a modular lab-on-a-chip system for integrated sample pre-treatment (PT) by magnetophoresis and DNA amplification by polymerase chain reaction (PCR). It consists of a polymer-based microfluidic chip mounted on a custom-made thermocycler (Figure 1) and includes a simple and...

  7. RAPID DETECTION OF Salmonella IN SHRIMP BY POLYMERASE CHAIN REACTION [Deteksi Cepat Salmonella pada Udang dengan Polymerase Chain Reaction

    Ulfah Amalia

    2014-06-01

    Full Text Available Shrimp is an important non-oil commodity for foreign trade in Indonesia. However, rejection of shrimp exports by the importing countries is still commonly encountered. In 2011, the USFDA recorded two cases of Salmonella spp. contamination in shrimp products from two shrimp processing companies in Indonesia. Analysis of Salmonella spp. in seafood is generally performed using a conventional method which takes at least 5 days. The objective of the study is to get a Salmonellae rapid detection method in shrimp by PCR. In this study, optimization of PCR protocol method to detect Salmonella invA gene was conducted using six different annealing temperatures (59, 59.5, 60.8, 62, 64 and 64.5°C. The results showed that 64°C was the optimum annealing temperature to detect the 284 bp fragment of Salmonella invA gene. The PCR based detection method has a DNA detection limit of 27.81ug/mL and 10°CFU/mL of viable salmonellae with 100% specificity. The PCR protocol is capable of detecting six different Salmonella serovars (S. Enteritidis, S. Hadar, S. Heidelberg, S. Kentucky, S. Paratyphi and S. Typhimurium but none of the non salmonellae isolates. Application of the PCR assay on Salmonella in shrimp after the selective enrichment step suggested that all 16 samples were positive for Salmonella. At the same time, the conventional method could only detected 3 samples for Salmonella positive.

  8. Comparison of a conventional polymerase chain reaction with real-time polymerase chain reaction for the detection of neurotropic viruses in cerebrospinal fluid samples

    M Ramamurthy; Alexander, M; Aaron, S; Kannangai, R.; Ravi, V.; Sridharan, G.; A.M. Abraham

    2011-01-01

    Purpose : To compare a conventional polymerase chain reaction (PCR) and real-time PCR for the detection of neurotropic DNA viruses. Materials and Methods : A total of 147 cerebrospinal fluid (CSF) samples was collected from patients attending a tertiary care hospital in South India for a period from 2005 to 2008. All these samples were tested using a conventional multiplex/uniplex PCR and a real-time multiplex/uniplex PCR. This technique was used to detect a large number of herpes viruses res...

  9. Mucosal polymerase chain reaction for diagnosing Helicobacter pylori infection in patients with bleeding peptic ulcers

    Hwai-Jeng Lin; Wen-Ching Lo; Chin-Lin Perng; Guan-Ying Tseng; Anna Fen-Yau Li; Yueh-Hsing Ou

    2005-01-01

    AIM: Helicobacter pylori(Hpylori) has been linked to chronic gastritis, peptic ulcers, gastric cancer and MALT-lymphoma.Conventional invasive tests are less sensitive than noninvasive tests in diagnosing H pylori infection in patients with bleeding peptic ulcers. Polymerase chain reaction is a sensitive and accurate method for diagnosing H pylori infection. The aim of this study was to evaluate the diagnostic role of mucosal polymerase chain reaction for H pylori infection in patients with bleeding peptic ulcers.METHODS: In patients with bleeding, non-bleeding peptic ulcers and chronic gastritis, we checked rapid urease test,histology, bacterial culture and mucosal polymerase chain reaction for detecting H pylori infection. Positive H pylori infection was defined as positive culture or both a positive histology and a positive rapid urease test. For mucosal polymerase chain reaction of Hpylori, we checked vacA (s1a, s1b, s1c, s2, m1, m1T, m2),iceA1,iceA2 and cag A.RESULTS: Between October 2000 and April 2002, 88 patients with bleeding peptic ulcers (males/females: 60/28, gastric ulcers/duodenal ulcers: 55/33), 81 patients with non-bleeding peptic ulcers (males/females: 54/27, gastric ulcers/duodenal ulcers: 45/36) and 37 patients with chronic gastritis (males/females: 24/13) were enrolled in this study. In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, 45 patients (51%), 71 patients (88%)and 20 patients (54%) respectively were found to have positive H pylori infection (P<0.001). In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, polymerase chain reaction for H pylori infection was positive in 54 patients (61%), 70 patients (86%) and 20 patients (54%) respectively (P<0.001). The sensitivity,positive predictive value and diagnostic accuracy of mucosal polymerase reaction for Hpylori infection were significantly lower in patients with bleeding peptic ulcers (84%, 79%and 81%) than in

  10. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars

  11. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

    Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.

    2015-07-01

    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

  12. Chemicals in the process chain from raw material to product

    As described in this presentation, chemicals are added at various points along the physical flow from oil/gas well to sold products. They have several functions and are added in different amounts. The chemicals may have a negative impact on the environment by emission to sea. But they can also reduce the regularity of the processing equipment and the prices of the products. Therefore, Statoil has begun a research project that aims to develop improved methods and tools for the prediction of the distribution of chemicals in the process chain and the unwanted effects they might have on the environment, on downstream installations and on the products. 4 refs., 11 figs

  13. DNA amplification fingerprinting using 10 x polymerase chain reaction buffer with ammonium sulfate for human identification

    The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)

  14. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    Ana Lisa do Vale Gomes

    2006-10-01

    Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

  15. Detection of bovine leukemia virus in cattle by the polymerase chain reaction.

    Murtaugh, M P; Lin, G F; Haggard, D L; Weber, A F; Meiske, J C

    1991-06-01

    Bovine leukemia virus (BLV) is widely distributed in U.S. cattle herds. It infects B lymphocytes and causes neoplastic disease in 5-10% of infected animals. Direct economic losses are incurred as a result of death, reduced milk production and condemnation at slaughter. Thus the identification of cattle infected with BLV is of significant concern to the U.S. cattle industry. For this reason, polymerase chain reaction (PCR) amplification was used to examine seropositive and seronegative cattle for the presence of BLV DNA in peripheral blood mononuclear cells. Using an amplification protocol able to detect 1 viral genome in 100,000 cells, BLV was not detected in 7 seronegative cattle in an infected herd. BLV sequences were detected in 13 of 18 seropositive animals with various levels of infection as determined by in vitro lymphocyte culture and electron microscopy. An active infection was demonstrated in one animal, based on the presence of viral RNA. These findings indicate that PCR is a sensitive method for the detection of BLV in cattle and provides new information regarding the dynamics of the infection. PMID:1658030

  16. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism

    Chandrashekar Srinivasa; Umesha Sharanaiah; Chandan Shivamallu

    2012-01-01

    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens.Ralstonia solanacearum,Xanthomoans axonopodis pv.vesicatoria,and Xanthomonas oryzae pv.oryzae are phytopathogenic bacteria,which can infect vegetables,cause severe yield loss.PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA.The technique of PCR-SSCP is being exploited so far,only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi.Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials.In this study,we developed PCR-SSCP technique to identify phytopathogenic bacteria.The PCR product was denatured and separated on a non-denaturing polyacrylamide gel.SSCP banding patterns were detected by silver staining of nucleic acids.We tested over 56 isolates of R. solanacearum,44 isolates of X. axonopodis pv.vesicatoria,and 20 isolates of X.oryzae pv.oryzae.With the use of universal primer 16S rRNA,we could discriminate such species at the genus and species levels.Speciesspecific patterns were obtained for bacteria R.solanacearum,X.axonopodis pv.vesicatoria,and X.oryzae pv.oryzae.The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  17. Routine application of the polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples.

    Noordhoek, G T; Kaan, J A; Mulder, S; Wilke, H; Kolk, A H

    1995-01-01

    AIM--To investigate the use of the polymerase chain reaction (PCR) in the routine laboratory for the detection of Mycobacterium tuberculosis in clinical samples. METHODS--Samples were divided and processed separately for the detection of M tuberculosis by microscopy, culture and PCR. After DNA extraction, PCR was performed with primers specific for the insertion element IS6110 and the product was analysed by agarose gel electrophoresis, Southern blotting or dot blotting and hybridisation with a digoxigenin labelled internal probe. Each sample was tested for inhibitors of Taq polymerase with the aid of an internal control. Multiple negative and positive controls were used to monitor each step of the procedure. RESULTS--The data from two laboratories, using the same operating procedures, were combined. Of 1957 specimens, 79 (4%) were culture and PCR positive, while 1839 (93.9%) were negative in both tests. Thirty specimens (1.5%) were PCR positive only and nine (0.5%) were culture positive but PCR negative. CONCLUSION--Using culture and clinical history as the gold standard, sensitivity and specificity for PCR were 92.1% and 99.8%, respectively. With elaborate precautions, PCR is a suitable and reliable method for the detection of M tuberculosis in clinical samples in a routine microbiology laboratory. Images PMID:7490312

  18. Matrix product states for su(2) invariant quantum spin chains

    Zadourian, Rubina; Fledderjohann, Andreas; Klümper, Andreas

    2016-08-01

    A systematic and compact treatment of arbitrary su(2) invariant spin-s quantum chains with nearest-neighbour interactions is presented. The ground-state is derived in terms of matrix product states (MPS). The fundamental MPS calculations consist of taking products of basic tensors of rank 3 and contractions thereof. The algebraic su(2) calculations are carried out completely by making use of Wigner calculus. As an example of application, the spin-1 bilinear-biquadratic quantum chain is investigated. Various physical quantities are calculated with high numerical accuracy of up to 8 digits. We obtain explicit results for the ground-state energy, entanglement entropy, singlet operator correlations and the string order parameter. We find an interesting crossover phenomenon in the correlation lengths.

  19. Dependence of the product chain-length on detergents for long-chain E-polyprenyl diphosphate synthases

    Pan, Jian-Jung; Ramamoorthy, Gurusankar; Poulter, C. Dale

    2013-01-01

    Long-chain E-polyprenyl diphosphate synthases (E-PDS) catalyze repetitive addition of isopentenyl diphosphate (IPP) to the growing prenyl chain of an allylic diphosphate. The polyprenyl diphosphate products are required for the biosynthesis of ubiquinones and menaquinones required for electron transport during oxidative phosphorylation to generate ATP. In vitro, the long-chain PDSs require addition of phospholipids or detergents to the assay buffer to enhance product release and maintain effi...

  20. Sustainable Palm Oil Production For Bioenergy Supply Chain

    Ng, Wai Kiat

    2009-01-01

    A bioenergy supply chain is formed by many parts which from the raw material, biomass feedstock until the distribution and utilisation. The upstream activity is always managed in a sustainable way in order to be capable enough to support the downstream activity. In this dissertation, the sustainable production of palm oil is focused and researched through problem identification and solving by using the operation management perspective and practices. At first, the global biomass industry is st...

  1. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... sample (100 to 2000 ng/5 μl) with one of the following 45 μl PCR cocktails: (i) 5 μl 10x PCR buffer, 1...

  2. An Evaluation of Microbial Profile in Halitosis with Tongue Coating Using PCR (Polymerase Chain Reaction)- A Clinical and Microbiological Study

    Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana

    2014-01-01

    Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients.

  3. Polymerase chain reaction and conventional DNA tests in detection of HPV DNA in cytologically normal and abnormal cervical scrapes

    Kalia, A.; Jalava, T.; Nieminen, P.;

    1992-01-01

    Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...

  4. Stackelberg Game for Product Renewal in Supply Chain

    Yong Luo

    2013-01-01

    Full Text Available The paper studied the process of product renewal in a supply chain, which is composed of one manufacturer and one retailer. There are original product and renewal product in the supply chain. A market share shift model for renewal product was firstly built on a increment function and a shift function. Based on the model, the decision-making plane consisting of two variables was divided into four areas. Since the process of product renewal was divided into two stages, Stackelberg-Nash game model and Stackelberg-merger game model could be built to describe this process. The optimal solutions of product pricing strategy of two games were obtained. The relationships between renewal rate, cost, pricing strategy, and profits were got by numerical simulation. Some insights were obtained from this paper. Higher renewal rate will make participants’ profits and total profit increase at the same margin cost. What is more important, the way of the optimal decision making of the SC was that RP comes onto the market with a great price differential between OP and RP.

  5. Brazilian chicken meat production chain:a 10-year overview

    IA Nääs

    2015-03-01

    Full Text Available Brazil is the world's largest broiler meat exporter. Health control, knowledge and technology, as well as the natural aspects of the country are pointed out as the keys for the success of that product in the market. Brazilian broiler production grew significantly in the last decade; it creates jobs and has a significant social role in Brazilian economy. This study aimed at evaluating the Brazilian broiler meat supply chain from 2000 to 2010 using the social network analysis (SNA. Data from governmental and private sources were organized and analyzed. The focus of this study was the broiler production supply chain segment involving the hatchery, the broiler farm, the feed mill, the processing plant, and the government. The inputs considered were one-day-old chicks, pullet, feedstuff, and the infrastructure; and the outputs were broiler meat and taxes paid. The software UCINET was applied for calculating the structural attributes and indicators of the network. Results showed a relatively disorganized network in 2000 with the strongest tie between the farmer and the processing plant. The structural organization of the network improved until 2010. The density of the ties in the broiler meat production network increased steadily from 2000 to 2010 within a vertical cohesive supply chain structure. The success of Brazilian broiler meat production is attributed to the abundance of land, fertile soil, favorable climate, and the effort and investments in research and development by innovative companies in the last few years. The results of the present study showed that Brazilian broiler production evolved positively in the last ten years, and it was weakly influenced by international challenges.

  6. Markov Chain for Reuse Strategies of Product Families

    LUO Jia; JIANG Lan

    2007-01-01

    A methodology is presented to plan reuse strategies of common modules in a product family by using the concepts of function degradation, reliability, function requirement, cost and life time. Markov chain model is employed to predict function degradation and reliability. A utility model is used to evaluate the preference between used modules and new modules. An example of cascading-requirment product family illustrates the main ideas of our work. The Markov models are used effectively to predict function degradation and reliability. Utility theory is helpful to evaluate the reuse options of common modules.

  7. THE METHOD OF POLYMERASE CHAIN REACTION FOR SEX DETERMINATION IN HUCHEN (HUCHO HUCHO

    Yu. Rud

    2013-12-01

    Full Text Available Purpose. To analyse the nucleotide sequences of salmonids Y chromosome and to determine the fragment for specific primers selection and also to develop the PCR based method for sex determination in huchen H. hucho. Methodology. Using the ClustalW algorithm in MEGA 5.2, the nucleotide sequences of salmonids Y chromosome were analysed. For developing of method for rapid diagnostic of huchen sex the polymerase chain reaction (PCR assay was used. Tne nucleotide sequences of amplified products were investigated by sequencing. Findings. Using PCR assay the method of sex determination in huchen H. hucho was developed. It was shown that specific PCR products in size of 450 nucleotides were visible in huchen males only. In addition we showed that selected primers can be used in sex determination of rainbow trout Oncorhynchus mykiss and this fact is proved the high rate of sdY locus similarity and its wide destribution in salmonids. Originality. The nucleotide sequences of salmonids Y chromosome were analysed and highly conservative region of sdY locus for specific primers selection, which covers sex-linked marker, was identified. Practical Value. Rapid sex determination in huchen by the developed method will allow to identify reversal males in process of gormonal sex reversion. At the stage of reversal males screening, this method will allow to identify the genotypic males (XY in experimental group and discard them because only phenotypic males with XX genotype (reversal males must be used in the crosses with native femelas for getting of 100 % all-females stock.

  8. Chosen aspects of evaluation of productive processes on the example of productive chains of gear

    M. Roszak

    2005-12-01

    Full Text Available Purpose: The purpose of the study was to present an original approach to evaluation of the real productive chains, including its utilization as a benchmarking method.Design/methodology/approach: In the paper an analysis of value in the productive chains with account of activities based costs was used. The evaluation of the effectivity was made by econometric coefficients.Findings: The paper presents obtained particular results of the analysis of value in the productive chains indicating effectivity of their solutions’ realization.Research limitations/implications: Limitations of the study are associated with particularity of defining of costs of particular operations.Practical implications: Presented method of evaluation of the productive chains gives possibility to assess effectivity of the realized activities.Originality/value: This method is based on the methodology by L.D.Miles and M.E.Porter.

  9. Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk

    V.K. Jain

    2010-02-01

    Full Text Available In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in mastitic milk, a polymerase chain reaction assay was developed using target sequence of 16S to 23S rRNA spacer region. This test can be performed within hours and avoids cumbersome and lengthy steps involved in microbiological culture of milk and biochemical tests. Polymerase chain reaction assay can be used as a screening test for a large herd to detect Staphylococcus aureus in milk.

  10. Detection of Helicobacter pylori using nested polymerase chain reaction in gastric biopsy samples.

    Mahajan, Divya; Jain, Anju; Singh, Varsha; Jain, A K; Rao, G R K; Nath, Gopal

    2008-07-01

    Helicobacter pylori remains a controversial organism with regards to humans, its epidemiology still unclear nearly two decades after discovery. The present study was undertaken to estimate the prevalence of the organism in the gastrointestinal tract in symptomatic and asymptomatic subjects to understand its precise natural history in India. A total of 154 specimens were a part of the study. These included gastric biopsies from peptic ulcer disease and Non ulcer dyspepsia subjects, as visualized on endoscopy, saliva and stool samples from apparently normal healthy adults. Nested polymerase chain reaction was performed using the primers Hp1, Hp2, Hp3 targeting 16S rRNA gene. A prevalence of 65.1%, 100%, 66.7%, and 73.3% respectively was observed by polymerase chain reaction. No association was observed between the H.pylori status and the disease condition of the patient. PMID:23105762

  11. Supply chains of forest chip production in Finland

    Kaerhae, K. (Metsaeteho Oy, Helsinki (Finland)), Email: kalle.karha@metsateho.fi

    2009-07-01

    The Metsaeteho study investigated how logging residue chips. stump wood chips, and chips from small-sized thinning wood and large-sized (rotten) roundwood used by heating and power plants were produced in Finland in 2008. Almost all the major forest chip suppliers in Finland were involved in the study. The total volume of forest chips supplied in 2008 by these suppliers was 6,5 TWh. The study was implemented by conducting an e-mail questionnaire survey and telephone interviews. Research data was collected in March-May 2009. The majority of the logging residue chips and chips from small-sized thinning wood were produced using the roadside chipping supply chain in Finland in 2008. The chipping at plant supply chain was also significant in the production of logging residue chips. 70% of all stump wood chips consumed were comminuted at the plant and 29% at terminals. The role of the terminal chipping supply chain was also significant in the production of chips from logging residues and small-sized wood chips. When producing chips from large-sized (rotten) roundwood, nearly a half of chips were comminuted at plants and more than 40 % at terminals. (orig.)

  12. Supply chains of forest chip production in Finland

    Kaerhae, Kalle (Metsaeteho Oy, Helsinki (Finland)), e-mail: kalle.karha@metsateho.fi

    2010-07-15

    The Metsaeteho study investigated how logging residue chips, stump wood chips, and chips from small sized thinning wood and large-sized (rotten) roundwood used by heating and power plants were produced in Finland in 2008. Almost all the major forest chip suppliers in Finland were involved in the study. The total volume of forest chips supplied in 2008 by these suppliers was 6.5 TWh. The study was implemented by conducting an e-mail questionnaire survey and telephone interviews. Research data was collected in March-May 2009. The majority of the logging residue chips and chips from small-sized thinning wood were produced using the roadside chipping supply chain in Finland in 2008. The chipping at plant supply chain was also significant in the production of logging residue chips. 70% of all stump wood chips consumed were comminuted at the plant and 29% at terminals. The role of the terminal chipping supply chain was also significant in the production of chips from logging residues and small-sized wood chips. When producing chips from large-sized (rotten) roundwood, nearly a half of chips were comminuted at plants and more than 40% at terminals

  13. Light chain editing generates polyreactive antibodies in chronic graft-versus-host reaction

    Witsch, Esther J.; Cao, Hong; Fukuyama, Hidehiro; Weigert, Martin

    2006-01-01

    The chronic graft-versus-host (cGvH) reaction is a model of induced lupus caused by alloreactive CD4+ T cells from a Bm-12 mouse in a C57BL/6 recipient. We used this cGvH reaction in C57BL/6 anti-DNA H chain transgenic mice, 56R/B6, to understand the structure, specificity, and origin of the induced autoantibodies (auto-Abs). We found anti-DNA Abs that reacted to several different antigens, such as phosphatidylserine, myelin basic protein, thyroglobulin, histone, insulin, cytochrome C, and β-...

  14. Instability Criterion of One-Dimensional Detonation Wave with Three-Step Chain Branching Reaction Model

    TENG Hong-Hui; JIANG Zong-Lin

    2011-01-01

    @@ One-dimensional detonation waves are simulated with the three-step chain branching reaction model, and the instability criterion is studied.The ratio of the induction zone length and the reaction zone length may be used to decide the instability, and the detonation becomes unstable with the high ratio.However, the ratio is not invariable with different heat release values.The critical ratio, corresponding to the transition from the stable detonation to the unstable detonation, has a negative correlation with the heat release.An empirical relation of the Chapman-Jouguet Mach number and the length ratio is proposed as the instability criterion.

  15. Quantitative interpretation to the chain mechanism of free radical reactions in cyclohexane pyrolysis

    Yingxian Zhao; Bo Shen; Feng Wei

    2011-01-01

    Pyrolysis of cyclohexane was conducted with a plug flow tube reactor in the temperature range of 873-973 K.Based on the experimental data,the mechanism and kinetic model of cyclohexane pyrolysis reaction were proposed.The kinetic analysis shows that overall conversion of cyclohexane is a first order reaction,of which the rate constant increased from 0.0086 to 0.0225 to 0.0623 s- 1 with the increase of temperature from 873 to 923 to 973 K,and the apparent activation energy was determined to be 155.0+1.0 kJ.mo1-1.The mechanism suggests that the cyclohexane is consumed by four processes:the homolysis of C-C bond (Path Ⅰ),the homolysis of C-H bond (Path Ⅱ) in reaction chain initiation,the H-abstraction of various radicals from the feed molecules in reaction chain propagation (Path Ⅲ),and the process associated with coke formation (Path Ⅳ).The reaction path probability (RPP) ratio of Xpath Ⅰ ∶ Xpath Ⅱ∶ XPath Ⅲ ∶ XPath Ⅳ was 0.5420 ∶ 0.0045 ∶ 0.3897 ∶ 0.0638 at 873 K,and 0.4336 ∶ 0.0061 ∶ 0.4885 ∶ 0.0718 at 973 K,respectively.

  16. Charm and its production in neutrino reactions

    The present thesis gives a survey about the status of the studies of charmed particles. First the quark model is explained. Then it is shown how the spectroscopy of hadrons is extended, if one goes on from the three-quark model to the four-quark model. In the third chapter it is explained how from the weak interaction on the existence of the charmed quark can be concluded. Thereafter the evidences of the existence of a fourth quark from the e+e- annihilation are descrbed. Here also the detection of the J/psi is discussed which could be interpreted as bound state of a new quark-antiquark system and therefore proved the existence of a new quark. In the fifth chapter the production of charmed particles in neutrino experiments is described. Lepton pair events are discussed which showed that the fourth quark is identical with the theoretically predicted charmed quark. The sixth chapter deals with the direct observation of charmed particles in neutrino reactions and finishes with a determination of the production rate of charmed particles in the framework of the quark-parton model. In the seventh chapter the production of charmed particles in electromagnetic and hadronic interactions is discussed. Thereafter follows in the eight chapter a discussion of the decays of charmed particles. (orig./HSI)

  17. DNA amplification by polymerase chain reaction from brain tissues embedded in paraffin.

    Gall, K; Pavelić, J.; Jadro-Santel, D.; Poljak, M; Pavelić, K.

    1993-01-01

    A method which enables analysis of DNA from archival paraffin embedded normal and malignant brain tissue is described. The demonstration of a 317-bp long beta-actin DNA sequence by the polymerase chain reaction (PCR) was used to identify which fixation procedure, deparaffinization time and DNA extraction procedure would give the best results. Tissue specimens 1-39 years old were included in the experiments. Specimens fixed in either 10% formalin, Carnoy's or AMeX fixative were found to be bes...

  18. Microdissection and polymerase chain reaction amplification of genomic DNA from histological tissue sections.

    Moskaluk, C A; Kern, S.E.

    1997-01-01

    Polymerase chain reaction (PCR)-based assays are being used increasingly to study the molecular genetic changes that occur in minute cellular lesions that are identified in histological sections. It is often desirable to microdissect the cells of interest in a lesion, isolating them from surrounding normal tissue to obtain the purest representation of genomic DNA possible. We present here an optimized microdissection and DNA extraction protocol that reliably produces PCR-amplifiable DNA from ...

  19. Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction.

    Jackson, D P; Lewis, F A; Taylor, G R; Boylston, A W; Quirke, P

    1990-01-01

    Several DNA extraction techniques were quantitatively and qualitatively compared using both fresh and paraffin wax embedded tissue and their suitability investigated for providing DNA and RNA for the polymerase chain reaction (PCR). A one hour incubation with proteinase K was the most efficient DNA extraction procedure for fresh tissue. For paraffin wax embedded tissue a five day incubation with proteinase K was required to produce good yields of DNA. Incubation with sodium dodecyl sulphate p...

  20. Uji Diagnostik Polymerase Chain Reaction –Restriction Fragment Length Polymorphism Dalam Menegakkan Diagnosis Onikomikosis.

    Lubis, Nova Zairina

    2015-01-01

    Background: Onychomycosis is a fungal infection of one or more units of the nail caused by dermatophytes, or mold and nondermatophytes yeast. Investigations are needed to establish the diagnosis of onychomycosis before starting treatment. Several investigations methods for diagnosing onychomycosis such as microscopic examination with 20% KOH, fungal culture, histopathology examination with PAS staining (Periodic acid Schiff) and PCR (Polymerase Chain Reaction), for culture methods require a l...

  1. Amplification of human minisatellites by the polymerase chain reaction: towards DNA fingerprinting of single cells.

    Jeffreys, A J; Wilson, V.; Neumann, R.; Keyte, J

    1988-01-01

    Hypervariable minisatellites can be amplified from human DNA by the polymerase chain reaction, using primers from DNA flanking the minisatellite to amplify the entire block of tandem repeat units. Minisatellite alleles up to 5-10 kb long can be faithfully amplified. At least six minisatellite loci can be co-amplified from the same DNA sample and simultaneously detected to provide a reproducible and highly variable DNA fingerprint which can be obtained from nanogram quantities of human DNA. Th...

  2. Genomic fingerprints of Staphylococcus aureus of bovine origin by polymerase chain reaction-based DNA fingerprinting.

    Matthews, K R; Kumar, S. J.; O'Conner, S. A.; Harmon, R J; Pankey, J W; Fox, L. K.; Oliver, S P

    1994-01-01

    Staphylococcus aureus (n = 75) isolated from mammary secretions of cows with subclinical and clinical mastitis from several geographic locations in the USA were examined using polymerase chain reaction-based DNA fingerprinting. DNA fingerprints were produced using a synthetic oligonucleotide primer (5'GTAACGCC3') to produce a distinct spectrum of amplified DNA fragments facilitating a high degree of resolution for differentiating S. aureus strains. PCR-based DNA fingerprinting grouped the 75 ...

  3. Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction

    Harmey, Judith H.; Harmey, Matthew A.

    1993-01-01

    We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

  4. The impact of meningococcal polymerase chain reaction testing on laboratory confirmation of invasive meningococcal disease.

    Drew, Richard J

    2012-03-01

    Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.

  5. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

    Li Jiang; Matthew Mancuso; Zhengda Lu; Gunkut Akar; Ethel Cesarman; David Erickson

    2014-01-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics ...

  6. Compact-like kink in a real electrical reaction-diffusion chain

    We demonstrate experimentally the compact-like kinks existence in a real electrical reaction-diffusion chain. Our measures show that such entities are strictly localized and consequently present a finite spatial extent. We show equally that the kink velocity is threshold-dependent. A theoretical quantification of the critical coupling under which propagation fails is also achieved and reveals that nonlinear coupling leads to a propagation failure reduction

  7. Utility of polymerase chain reaction as a diagnostic tool in cutaneous tuberculosis

    Padmavathy L; Rao L; Veliath A

    2003-01-01

    Background: Differentiation of cutaneous tuberculosis from other infective granulomas of the skin is difficult due to paucity of the organisms in tissue biopsies. Polymerase chain reaction (PCR) is a newer technique to identify the DNA of Mycobacterium tuberculosis in the tissues. Aim: We examined the utility of PCR as a tool for rapid diagnosis of cutaneous tuberculosis especially in cases negative by ZN staining and culture. Material and Methods: Twenty five random skin biopsies from patien...

  8. The design and construction of an electronic model of the chain reaction process

    The design and construction of an electronic model simulating the nuclear chain reaction process up to three successive neutron generations is briefly described. This model is equipped with a special sound effect. However, a tape recorder can be attached and replayed in synchronism with the display with minimum hardware modifications. In this manner, it can function as a useful educational aid. The circuit is built around easily available ttl integrated circuits. (author)

  9. A polymerase chain reaction assay to determine infection of Aedes polynesiensis by Wuchereria bancrofti

    Nicolas, L.; Luquiaud, P.; Lardeux, Frédéric; Mercer, D.R.

    1996-01-01

    The sensitivity of a previously described polymerase chain reaction (PCR) assay was improved to detect a single mosquito, infected by as few as 1-2 microfilariae of #Wuchereria bancrofti$, among 20-50 uninfected mosquitoes. Wild-caught #Aedes polynesiensis$ were used to compare assessment of infection by dissection of individuals with the PCR assay of pools of mosquitoes. The PCR assay was at least as sensitive as dissection for detection of mosquitoes infected with #W. bancrofti$. (Résumé d'...

  10. Effect of fungal and plant secondary metabolites on polimerase chain reaction (PCR)

    Thaler, Nejc; Bajc, Marko

    2013-01-01

    Secondary metabolites are organic compounds that can be found in both fungi and plants, where they play an important role as defensive and signal molecules, or provide other kinds of advantage in natural selection, but are not directly involved in normal growth, development and reproduction of an organism. When working with DNA techniques, it is the secondary metabolites that most often affect the efficiency of polymerase chain reaction (PCR), either by hindering cell lysis, causing ...

  11. Preliminary evaluation of the ligase chain reaction for specific detection of Neisseria gonorrhoeae.

    Birkenmeyer, L; Armstrong, A S

    1992-01-01

    Rapid identification of Neisseria gonorrhoeae in clinical specimens is essential for effective control. Traditional culture requires a minimum of 24 h, and for some specimens harboring gonococci, the gonococci fail to grow or are misidentified. The recently described ligase chain reaction (LCR) is a highly specific and sensitive DNA amplification technique which was evaluated as an alternative to routine culture. Three LCR probe sets were used. Two of the probe sets were directed against the ...

  12. Differentiation of Giardia duodenalis from other Giardia spp. by using polymerase chain reaction and gene probes.

    Mahbubani, M H; Bej, A K; Perlin, M H; Schaefer, F W; Jakubowski, W; Atlas, R M

    1992-01-01

    Giardia spp. are waterborne organisms that are the most commonly identified pathogenic intestinal protozoans in the United States. Current detection techniques for Giardia species in water include microscopy and immunofluorescence techniques. Species of the genus Giardia are classified on the basis of taxonomic criteria, such as cell morphology, and on host specificity. We have developed a polymerase chain reaction- and gene probe-based detection system specific for Giardia spp., which can di...

  13. Analysis of infectious laryngotracheitis virus isolates from Ontario and New Brunswick by the polymerase chain reaction.

    Alexander, H S; Key, D.W.; Nagy, E.

    1998-01-01

    The polymerase chain reaction (PCR) was used to amplify DNA of infectious laryngotracheitis virus (ILTV) isolates obtained from field specimens. The examined 47 samples included 37 isolates representing 35 cases of infectious laryngotracheitis from Ontario and 10 isolates originating from 10 field cases in New Brunswick. The viruses were grown in either embryonated chicken eggs or cell culture, the DNA extracted and amplified using primers designed from the sequence information of a 1.1 kb Ba...

  14. Detection of Rickettsia rickettsii DNA in clinical specimens by using polymerase chain reaction technology.

    Tzianabos, T; Anderson, B E; McDade, J E

    1989-01-01

    A polymerase chain reaction (PCR) procedure for detecting rickettsial DNA was developed and shown to be specific for Rickettsia rickettsii and R. conorii, the etiologic agents of Rocky Mountain spotted fever (RMSF) and Boutonneuse fever, respectively. Blood clots were obtained from nine confirmed RMSF patients and six controls and analyzed for the presence of rickettsial DNA by the PCR method. A defined region of the rickettsial genome was successfully amplified from seven of the nine clinica...

  15. Sodium-water reaction product flow system

    Purpose: To provide the subject equipments wherein thermal insulating layers which neither exfoliate nor react by the impact due to high temperature sodium and hydrogen gas and are used for mitigating the thermal impact are provided on the inner surfaces of the emission system equipments, thereby preventing the destruction of the emission system equipments. Constitution: Thermal insulating layers are formed on the inner surfaces of sodium-water reaction product emission system equipments, that is, the inner surface of the emission system pipeline, that of the accommodation vessel and the surface of the cyclone separator, by film treatment, coating or heat resisting coating, and these surfaces are covered with the layers. Each of the layers is made of a material which does not cause a rapid reaction with high temperature sodium or hydrogen gas nor exfoliates and is withstandable for several seconds in which the thermal impact of at least the emission system comes into question, and its thickness is more than one capable of securing the necessary thermal resistance computed by the thermal impact analysis of the emission system. (Yoshihara, H.)

  16. Reactions of uranium hexafluoride photolysis products

    Lyman, John L.; Laguna, Glenn; Greiner, N. R.

    1985-01-01

    This paper confirms that the ultraviolet photolysis reactions of UF6 in the B band spectral region is simple bond cleavage to UF5 and F. The photolysis products may either recombine to UF6 or the UF5 may dimerize, and ultimately polymerize, to solid UF5 particles. We use four methods to set an upper limit for the rate constant for recombination of kr<2.0×10-12cm3 molecule-1 s-1. We measure the rate constant for UF5 dimerization to be kd=(1.0±0.2)×10-11 cm3 molecule-1 s-1. The principal method employed in these studies is the use of diode lasers to monitor, in real time, the changes in density of the species UF6 and UF5 after laser photolysis of the UF6 gas sample.

  17. Molecular relapse in chronic myelogenous leukemia patients after bone marrow transplantation detected by polymerase chain reaction

    Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction

  18. Long-chain alkane production by the yeast Saccharomyces cerevisiae.

    Buijs, Nicolaas A; Zhou, Yongjin J; Siewers, Verena; Nielsen, Jens

    2015-06-01

    In the past decade industrial-scale production of renewable transportation biofuels has been developed as an alternative to fossil fuels, with ethanol as the most prominent biofuel and yeast as the production organism of choice. However, ethanol is a less efficient substitute fuel for heavy-duty and maritime transportation as well as aviation due to its low energy density. Therefore, new types of biofuels, such as alkanes, are being developed that can be used as drop-in fuels and can substitute gasoline, diesel, and kerosene. Here, we describe for the first time the heterologous biosynthesis of long-chain alkanes by the yeast Saccharomyces cerevisiae. We show that elimination of the hexadecenal dehydrogenase Hfd1 and expression of a redox system are essential for alkane biosynthesis in yeast. Deletion of HFD1 together with expression of an alkane biosynthesis pathway resulted in the production of the alkanes tridecane, pentadecane, and heptadecane. Our study provides a proof of principle for producing long-chain alkanes in the industrial workhorse S. cerevisiae, which was so far limited to bacteria. We anticipate that these findings will be a key factor for further yeast engineering to enable industrial production of alkane based drop-in biofuels, which can allow the biofuel industry to diversify beyond bioethanol. PMID:25545362

  19. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Trioso Purnawarman

    2014-04-01

    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  20. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    Hviid, T V; Madsen, H O; Morling, N

    1992-01-01

    We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... PCR-ASO technique. The frequencies of the HLA-DPB1 genotypes deduced from the results of PCR-RFLP typing were estimated in 71 healthy Danes.......We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes...

  1. Environmental Management in Danish transnational textile product chains

    Jørgensen, Michael Søgaard; Jørgensen, Ulrik; Hendriksen, Kåre;

    2010-01-01

    Purpose The purpose is to analyse environmental responsibility of companies from industrialized countries when they source materials and products in countries with less environmental protection. Methodology The article is a study of corporate environmental management in the Danish textile and...... have a practice without environmental initiatives. Dominating types of initiatives are cleaner technology, environmental management systems and cleaner products. Driving forces are governmental regulation, customer demands, market expectations and protection of corporate brands. Some companies focus on...... capacity building at the suppliers in developing countries, while other companies seem to focus the complex activities at domestic suppliers. Two new facilitating actors in environmental management in product chains were identified. Research limitations and implications The focus on one sector in one...

  2. Evaluation of Neutron Induced Reactions for 32 Fission Products

    Kim, Hyeong Il

    2007-02-15

    Neutron cross sections for 32 fission products were evaluated in the neutron-incident energy range from 10{sup -5} eV to 20 MeV. The list of fission products consists of the priority materials for several applications, extended to cover complete isotopic chains for three elements. The full list includes 8 individual isotopes, {sup 95}Mo, {sup 101}Ru, {sup 103}Rh, {sup 105}Pd, {sup 109}Ag, {sup 131}Xe, {sup 133}Cs, {sup 141}Pr, and 24 isotopes in complete isotopic chains for Nd (8), Sm (9) and Dy (7). Our evaluation methodology covers both the low energy region and the fast neutron region.In the low energy region, our evaluations are based on the latest data published in the Atlas of Neutron Resonances. This resource was used to infer both the thermal values and the resolved resonance parameters that were validated against the capture resonance integrals. In the unresolved resonance region we performed the additional evaluation by using the averages of the resolved resonances and adjusting them to the experimental data.In the fast neutron region our evaluations are based on the nuclear reaction model code EMPIRE-2.19 validated against the experimental data. EMPIRE is the modular system of codes consisting of many nuclear reaction models, including the spherical and deformed Optical Model, Hauser-Feshbach theory with the width fluctuation correction and complete gamma-ray emission cascade, DWBA, Multi-step Direct and Multi-step Compound models, and several versions of the phenomenological preequilibrium models. The code is equipped with a power full GUI, allowing an easy access to support libraries such as RIPL and CSISRS, the graphical package, as well the utility codes for formatting and checking. In general, in our calculations we used the Reference Input Parameter Library, RIPL, for the initial set model parameters. These parameters were properly adjusted to reproduce the available experimental data taken from the CSISRS library. Our evaluations cover cross

  3. Evaluation of Neutron Induced Reactions for 32 Fission Products

    Neutron cross sections for 32 fission products were evaluated in the neutron-incident energy range from 10-5 eV to 20 MeV. The list of fission products consists of the priority materials for several applications, extended to cover complete isotopic chains for three elements. The full list includes 8 individual isotopes, 95Mo, 101Ru, 103Rh, 105Pd, 109Ag, 131Xe, 133Cs, 141Pr, and 24 isotopes in complete isotopic chains for Nd (8), Sm (9) and Dy (7). Our evaluation methodology covers both the low energy region and the fast neutron region.In the low energy region, our evaluations are based on the latest data published in the Atlas of Neutron Resonances. This resource was used to infer both the thermal values and the resolved resonance parameters that were validated against the capture resonance integrals. In the unresolved resonance region we performed the additional evaluation by using the averages of the resolved resonances and adjusting them to the experimental data.In the fast neutron region our evaluations are based on the nuclear reaction model code EMPIRE-2.19 validated against the experimental data. EMPIRE is the modular system of codes consisting of many nuclear reaction models, including the spherical and deformed Optical Model, Hauser-Feshbach theory with the width fluctuation correction and complete gamma-ray emission cascade, DWBA, Multi-step Direct and Multi-step Compound models, and several versions of the phenomenological preequilibrium models. The code is equipped with a power full GUI, allowing an easy access to support libraries such as RIPL and CSISRS, the graphical package, as well the utility codes for formatting and checking. In general, in our calculations we used the Reference Input Parameter Library, RIPL, for the initial set model parameters. These parameters were properly adjusted to reproduce the available experimental data taken from the CSISRS library. Our evaluations cover cross sections for almost all reaction channels including photon

  4. An overview on the Brazilian orange juice production chain

    Renato Marcio dos Santos

    2013-03-01

    Full Text Available Brazil is the world's largest producer of oranges and uses more than 70% of the harvested fruits in the production of juices. The amount of processed orange is growing about 10% per year, confirming the trend of the Brazilian citrus for juice production. This research aimed to investigate the Brazilian orange juice production chain from 2005 to 2009. Data from the amount of frozen juice produced and exported, international price of orange juice, and intermediate transactions were assessed in order to make possible selection of all interveners involved in the chain. The study using the Social Network Analysis (SNA showed that the densest relationships in the network are from exporters to importers and from orange growers to the orange processing industry. No difference was found in the values of the network geodesic distance or the clustering coefficients from 2005 to 2009. The degree of centrality increased steadily throughout the years indicating that the processing industry attempts to minimize the risks by centralizing the actions. A decrease in export of orange juice from 2007 (2.07 10(6 t to 2008 (2.05 10(6 t was found, probably due to the world's financial crisis with recovery in 2009. Since 2004, there has been an increase of nearly 10% per year in the market preference of concentrate juice (OFCJ when compared to the "not from concentrated" juice (NFC. Nowadays the NFC market represents nearly 50% of all Brazilian export which impacted in the logistic distribution and transportation issues.

  5. Electroweak meson production reaction in the nucleon resonance region

    We report on our recent study of the the neutrino-nucleon reaction in the nucleon resonance region. The dynamical reaction model of meson production reaction on the nucleon for the pion and photon induced reaction has been developed in order to investigate the spectrum of nucleon excited state. We have extended this model in order to describe the weak meson production reactions with the πN, ηN, KΛ, KΣ and ππN final states. We also studied the role of the final state interaction in the photon and the neutrino induced pion production reaction on the deuteron around the Δ(1232) resonance region

  6. Differential detection of turkey coronavirus, infectious bronchitis virus, and bovine coronavirus by a multiplex polymerase chain reaction.

    Loa, C C; Lin, T L; Wu, C C; Bryan, T A; Hooper, T A; Schrader, D L

    2006-01-01

    The objective of the present study was to develop a multiplex polymerase chain reaction (PCR) method for differential detection of turkey coronavirus (TCoV), infectious bronchitis coronavirus (IBV), and bovine coronavirus (BCoV). Primers were designed from conserved or variable regions of nucleocapsid (N) or spike (S) protein gene among TCoV, IBV, and BCoV and used in the same PCR reaction. Reverse transcription followed by the PCR reaction was used to amplify a portion of N or S gene of the corresponding coronaviruses. The PCR products were detected on agarose gel stained with ethidium bromide. Two PCR products, a 356-bp band corresponding to N gene and a 727-bp band corresponding to S gene, were obtained for TCoV isolates. In contrast, one PCR product of 356 bp corresponding to a fragment of N gene was obtained for IBV strains and one PCR product of 568 bp corresponding to a fragment of S gene was obtained for BCoV. There were no PCR products with the same primers for Newcastle disease virus, Marek's disease virus, turkey pox virus, pigeon pox virus, fowl pox virus, reovirus, infectious bursal disease virus, enterovirus, astrovirus, Salmonella enterica, Escherichia coli, and Mycoplasma gallisepticum. Performance of the assay with serially diluted RNA demonstrated that the multiplex PCR could detect 4.8x10(-3) microg of TCoV RNA, 4.6x10(-4) microg of IBV RNA, and 8.0x10(-2) microg of BCoV RNA. These results indicated that the multiplex PCR as established in the present study is a rapid, sensitive, and specific method for differential detection of TCoV, IBV, and BCoV in a single PCR reaction. PMID:16137773

  7. Supply Chain Configuration with Coordinated Product, Process and Logistics Decisions: An Approach based on Petri Nets

    Zhang, Linda; You, Xiao; Jiao, Jianxin Roger; Helo, Petri

    2009-01-01

    Abstract Supply chain configuration lends itself to be an effective means to deal with product differentiation and customization throughout a supply chain network. It essentially entails the instantiation of a generic supply chain network to specific supply chains in accordance with diverse customer requirements. The linchpin of supply chain configuration lies in the coordination of product, process and logistics decisions in relation to a variety of customer orders. This paper aim...

  8. A string reaction coordinate for the folding of a polymer chain

    Leitold, Christian; Lechner, Wolfgang; Dellago, Christoph

    2015-05-01

    We investigate the crystallization mechanism of a single, flexible homopolymer chain with short range attractions. For a sufficiently narrow attractive well, the system undergoes a first-order like freezing transition from an expanded disordered coil to a compact crystalline state. Based on a maximum likelihood analysis of committor values computed for configurations obtained by Wang-Landau sampling, we construct a non-linear string reaction coordinate for the coil-to-crystal transition. In contrast to a linear reaction coordinate, the string reaction coordinate captures the effect of different degrees of freedom controlling different stages of the transition. Our analysis indicates that a combination of the energy and the global crystallinity parameter Q6 provide the most accurate measure for the progress of the transition. While the crystallinity paramter Q6 is most relevant in the initial stages of the crystallization, the later stages are dominated by a decrease in the potential energy.

  9. Kinetic characteristics of continuous flow polymerase chain reaction chip: A numerical investigation

    2010-01-01

    Continuous flow PCR (polymerase chain reaction) chip holds impressive advantages compared to micro chamber PCR chip. In order to have better understanding of kinetic characteristics of continuous flow PCR chip, a comprehensive mathematical model is presented in this paper, including melting, annealing and extension phases of a typical PCR process which has the essence of a convection-diffusion-reaction system. Using this model, we can simulate the PCR process in series of reaction cycles. Numerical results show that the average sample velocity plays a significant role in affecting the amplification efficiency. Also, appropriate combination of the PCR mixture is important for high-quality DNA amplification. Giving a large initial DNA concentration range, the continuous flow PCR scheme holds excellent real-time detection ability theoretically. The present numerical model bridges the temperature distribution to the real DNA amplification, and thereby is able to successfully predict continuous flow PCR properties which are important for the chip design.

  10. Production and validation of nuclear reaction data

    Various research collaborations with foreign organizations such as IAEA, OECD, ORNL, BNL, etc. have been performed and strengthened. By actively participating in meetings that are sponsored by IAEA and OECD, we could make a decision on the research directions for nuclear data and offer our nuclear data to the international community without difficulty. Nuclear data uncertainty has been co-studied with ORNL, the calculation of evaluation module for the resonance areas and evaluation of nuclear data for reactor structural materials have completed in cooperation with BNL. Nuclear data that we produced were to be listed in ENDF/B-VII.1. With regard to evaluation techniques, a program to tune model parameters were developed. Covariance data production and a comparative analysis between nuclear data libraries for evaluating uncertainty was performed. Nuclear Data Evaluation module for resonance region and Uncertainty assessment techniques of the nuclear reactor analysis codes were developed. Evaluation was performed on the core material for nuclear fusion, advanced fuel cycle, and structural materials. Uncertainty calculations in the criticality are performed by using nuclear cross section uncertainty analysis system such as ERRORJ-ANISN-SUSD3D and NJOY-DANTSYS-SUSD3D. The number of nuclear materials for the fast reactor, radiation shielding, and actinide are processed and produced multigroup libraries were provided to the researchers. We adjusted the experiments using facilities that are distributed in the domestic research institutes. To build nuclear data measurement system using an electron accelerator in the Korea Atomic Energy Research Institute, conceptual design for fast neutron target and facility was completed. Neutron cross-section, photonuclear reaction was measured by using an electron accelerator in the Pohang neutron facility, The detector has been developed for more accurate measurements. Charged particle induced nuclear reaction cross sections were

  11. Effect of parity on productivity and sustainability of Lotka-Volterra food chains: bounded orbits in food chains.

    Massarelli, Nicole; Hoffman, Kathleen; Previte, Joseph P

    2014-12-01

    Hairston, Slobodkin, and Smith conjectured that top down forces act on food chains, which opposed the previously accepted theory that bottom up forces exclusively dictate the dynamics of populations. We model food chains using the Lotka-Volterra predation model and derive sustainability constants which determine which species will persist or go extinct. Further, we show that the productivity of a sustainable food chain with even trophic levels is predator regulated, or top down, while a sustainable food chain with odd trophic levels is resource limited, which is bottom up, which is consistent with current ecological theory. PMID:24362648

  12. Effect of Pozzolanic Reaction Products on Alkali-silica Reaction

    WEI Fengyan; LAN Xianghui; LV Yinong; XU Zhongzi

    2006-01-01

    The effect of fly ash on controlling alkali-silica reaction (ASR) in simulated alkali solution was studied. The expansion of mortar bars and the content of Ca(OH)2 in cement paste cured at 80 ℃ for 91 d were measured. Transmission electron microscopy (TEM) and high-resolution transmission electron microscopy (HRTEM) were employed to study the microstructure of C-S-H. TEM/energy dispersive spectroscopy (EDS) was then used to determine the composition of C-S-H. The pore structure of the paste was analyzed by mercury intrusion porosimetry (MIP). The results show that the contents of fly ash of 30% and 45% can well inhibit ASR. And the content of Ca(OH)2 decreases with the increase of fly ash. That fly ash reacted with Ca(OH)2 to produce C-S-H with a low Ca/Si molar ratio could bind more Na+ and K+ ions, and produce a reduction in the amount of soluble alkali available for ASR. At the same time, the C-S-H produced by pozzolanic reaction converted large pores to smaller ones (gel pores smaller than 10 nm) to densify the pore structure. Perhaps that could inhibit alkali transport to aggregate for ASR.

  13. Updating the Nuclear Reaction Rate Library (REACLIB) I. Experimental Reaction Rates of the Proton-Proton Chain

    REACLIB is one of the most comprehensive and popular astrophysical reaction rate libraries. However, its experimentally obtained rates for light isotopes still rely mainly on the Caughlan and Fowler (1988) compilation and have never been updated despite the progress in many relevant nuclear astrophysics experiments. Moreover, due to fitting errors REACLIB is not reliable at temperatures lower than 107K. In this work we establish the formalism for updating the obsolete Caughlan-Fowler experimental rates of REACLIB. Then we use the NACRE compilation and results from the LUNA experiments to update some important charged-particle induced rates of REACLIB focusing on the proton-proton chain. The updated rates (available also in digital form) can now be used in the low temperature regime (below 107K) which was forbidden to the old version of REACLIB. (authors)

  14. Process Reengineering of Cold Chain Logistics of Agricultural Products Based on Low-carbon Economy

    Guo, Hong-xia; Shao, Ming

    2012-01-01

    Through the process analysis of cold chain logistics of agricultural products, we find that cold chain logistics of agricultural products contradict the development model of low-carbon economy to some extent. We apply the development idea of low-carbon economy, introduce the third-party logistics companies, establish distribution center of cold chain logistics of agricultural products, and strengthen information sharing, to reengineer the process of cold chain logistics of agricultural produc...

  15. Inhibition of zinc-dependent peptidases by Maillard reaction products

    Missagia de Marco, Leticia

    2015-01-01

    The Maillard reaction is a network of different non-enzymatic reactions between carbonyl groups of reducing sugars and amino groups from amino acids, peptides, or proteins, which progresses in three major stages and originates a very heterogeneous mixture of reaction products. It is also known as non-enzymatic browning, due to the brown macromolecular pigments formed in the final stage of the reaction. The chemistry underlying the Maillard reaction is complex. It encloses not only one reactio...

  16. Is the Reaction of C3N(-) with C2H2 a Possible Process for Chain Elongation in Titan's Ionosphere?

    Lindén, Fredrik; Alcaraz, Christian; Ascenzi, Daniela; Guillemin, Jean-Claude; Koch, Leopold; Lopes, Allan; Polášek, Miroslav; Romanzin, Claire; Žabka, Jan; Zymak, Illia; Geppert, Wolf D

    2016-07-14

    The reaction of C3N(-) with acetylene was studied using three different experimental setups, a triple quadrupole mass spectrometer (Trento), a tandem quadrupole mass spectrometer (Prague), and the "CERISES" guided ion beam apparatus at Orsay. The process is of astrophysical interest because it can function as a chain elongation mechanism to produce larger anions that have been detected in Titan's ionosphere by the Cassini Plasma Spectrometer. Three major products of primary processes, C2H(-), CN(-), and C5N(-), have been identified, whereby the production of the cyanide anion is probably partly due to collisional induced dissociation. The formations of all these products show considerable reaction thresholds and also display comparatively small cross sections. Also, no strong signals of anionic products for collision energies lower than 1 eV have been observed. Ab initio calculations have been performed to identify possible pathways leading to the observed products of the title reaction and to elucidate the thermodynamics of these processes. Although the productions of CN(-) and C5N(-) are exoergic, all reaction pathways have considerable barriers. Overall, the results of these computations are in agreement with the observed reaction thresholds. Due to the existence of considerable reaction energy barriers and the small observed cross sections, the title reaction is not very likely to play a major role in the buildup of large anions in cold environments like the interstellar medium or planetary and satellite ionospheres. PMID:27135984

  17. Non-Covalent Fluorescent Labeling of Hairpin DNA Probe Coupled with Hybridization Chain Reaction for Sensitive DNA Detection.

    Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao

    2016-04-01

    An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. PMID:26879193

  18. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

    1993-01-01

    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial repetiti

  19. Sensitive electrochemical monitoring of nucleic acids coupling DNA nanostructures with hybridization chain reaction

    Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping, E-mail: dianping.tang@fzu.edu.cn

    2013-06-14

    Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling.

  20. Genome editing. The mutagenic chain reaction: a method for converting heterozygous to homozygous mutations.

    Gantz, Valentino M; Bier, Ethan

    2015-04-24

    An organism with a single recessive loss-of-function allele will typically have a wild-type phenotype, whereas individuals homozygous for two copies of the allele will display a mutant phenotype. We have developed a method called the mutagenic chain reaction (MCR), which is based on the CRISPR/Cas9 genome-editing system for generating autocatalytic mutations, to produce homozygous loss-of-function mutations. In Drosophila, we found that MCR mutations efficiently spread from their chromosome of origin to the homologous chromosome, thereby converting heterozygous mutations to homozygosity in the vast majority of somatic and germline cells. MCR technology should have broad applications in diverse organisms. PMID:25908821

  1. Sex Identification of Red-crowned Crane by the Polymerase Chain Reaction

    LI Jian-hong; LI Shu-ling; BAO Jun; BAI Xiu-juan

    2004-01-01

    Sex determining gene primers of Oriental White Stork were used to amplify sex-linked gene of the Red-crowned Crane's W chromosome-specific by PCR for sex identification. The sexes of 7 couples of grown Red-crowned Cranes and 15 youngs were identified. Through DNA sequence analysis, the identity is 94.77% between Red-crowned Crane and Oriental White Stork. The results of this study suggest that the application of the polymerase chain reaction technique is practicable for determining sex in the Red-crowned Crane.

  2. Zoster ... "a lmost" ... sine herpete: diagnostic utility of real time-polymerase chain reaction.

    Vena, Gino A; Apruzzi, Doriana; Vestita, Michelangelo; Calvario, Agata; Foti, Caterina; Cassano, Nicoletta

    2010-10-01

    Zoster sine herpete is a particular form of varicella zoster virus (VZV) infection characterized by segmental pain and dysesthesia, without any cutaneous lesions ever becoming perceptible. This report describes the case of a female patient, presenting with intercostal pain associated with a single papulo-vesicular lesion localized within the same area. Thanks to such a lesion, real time-polymerase chain reaction (PCR) analysis on vesicle fluid swab was possible, thus revealing a significant number of VZV genome copies. This innovative tool has proven essential to diagnose this abortive form of herpes zoster, which would otherwise have remained unidentified. PMID:21213602

  3. Direct detection of Mycobacterium tuberculosis in sputum by polymerase chain reaction and DNA hybridization.

    Nolte, F S; Metchock, B; McGowan, J. E.; Edwards, A; Okwumabua, O; Thurmond, C; Mitchell, P S; Plikaytis, B; Shinnick, T

    1993-01-01

    A polymerase chain reaction (PCR) assay for the rapid diagnosis of pulmonary tuberculosis was developed by using oligonucleotide primers to amplify a fragment of IS6110, an insertion sequence repeated multiple times in the chromosome of Mycobacterium tuberculosis. Sediment obtained from sputa processed by the N-acetyl-L-cysteine-NaOH method was suspended in a simple lysis buffer and was heated at 100 degrees C for 30 min prior to amplification. A dUTP-uracil N-glycosylase PCR protocol was use...

  4. Characterization of a nested polymerase chain reaction assay for detection of parvovirus B19.

    Patou, G.; Pillay, D.; Myint, S; Pattison, J.

    1993-01-01

    The characterization and application of a nested polymerase chain reaction (PCR) assay for the detection of human parvovirus B19 DNA is described. The assay was evaluated with 149 diagnostic serum samples (collected up to 150 days after the onset of symptoms) previously tested by dot blot hybridization for B19 DNA and by class-specific capture radioimmunoassays for the detection of B19 immunoglobulin M (IgM) and IgG. B19 DNA was detectable by the PCR in 70% of the sera. There was a statistica...

  5. Use of polymerase chain reaction for detection of Listeria monocytogenes in food.

    Niederhauser, C; Candrian, U; Höfelein, C; M. Jermini; Bühler, H P; Lüthy, J

    1992-01-01

    A previously described polymerase chain reaction (PCR) assay (B. Furrer, U. Candrian, C. Höfelein, and J. Lüthy, J. Appl. Bacteriol. 70:372-379, 1991) was used to analyze food for the presence of Listeria monocytogenes. Food samples were artificially contaminated to develop two procedures to detect the organism following enrichment steps. Procedure A was based on dilution of the enrichment broth followed by lysis of the bacteria and direct analysis of the lysate with PCR. With procedure A and...

  6. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    I Nyoman Suartha; I Gusti Ngurah Kade Mahardika; Ida Ayu Sri Candra Dewi; Ni Ketut Dias Nursanty; Yosaphat L.S Kote; Anita Dwi Handayani; I Gusti Agung Ayu Suartini

    2008-01-01

    A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTAC...

  7. A highly sensitive aptasensor for OTA detection based on hybridization chain reaction and fluorescent perylene probe.

    Wang, Bin; Wu, Yuanya; Chen, Yanfen; Weng, Bo; Xu, Liqun; Li, Changming

    2016-07-15

    An optical aptasensor was developed for ultrasensitive detection of ochratoxin A (OTA) based on hybridization chain reaction (HCR) amplification strategy and fluorescent perylene probe (PAPDI)/DNA composites. Dendritic DNA concatamers were synthesized by HCR strategy and modified on magnetic nanoparticles through aptamer as medium. A large amount of PAPDI probe aggregated under the induction of DNA concatamers and caused fluorescence quenching. In the presence of OTA, the PAPDI/DNA composites were released from magnetic nanoparticles due to the strong affinity between aptamer and OTA. In ethanol, PAPDI monomers disaggregated and produced strong fluorescence. The present method displays excellent sensitivity and selectivity towards OTA. PMID:26938491

  8. Rapid method for separation of bacterial DNA from humic substances in sediments for polymerase chain reaction.

    Tsai, Y L; Olson, B H

    1992-01-01

    The polymerase chain reaction (PCR) was used to amplify an Escherichia coli 16S ribosomal gene fragment from sediments with high contents of humic substances. Total DNA was extracted from 1 g of E. coli seeded or unseeded samples by a rapid freeze-and-thaw method. Several approaches (use of Bio-Gel P-6 and P-30 and Sephadex G-50 and G-200 columns, as well as use of the Stoffel fragment) were used to reduce interference with the PCR. The best results were obtained when crude DNA extracts conta...

  9. Diagnosis of Dengue by Using Reverse Transcriptase-Polymerase Chain Reaction

    Miagostovich Marize Pereira

    1997-01-01

    Full Text Available A rapid identification of dengue viruses from clinical samples by using a nested reverse transcriptase-polymerase chain reaction (RT-PCR procedure was carried out for diagnostic and epidemiological purposes. RT-PCR identified DEN-1 and DEN-2 viruses in 41% (41/100 of previously confirmed cases and provided an accurate confirmation of DHF in four fatal cases. RT-PCR was also useful for detecting and typing dengue viruses in suspected cases, allowing a rapid identification of new serotypes in endemic areas

  10. Development and validation of a Myxoma virus real-time polymerase chain reaction assay

    Albini, S.; Sigrist, B; Guttinger, R; Schelling, C.; Hoop, R K; Vogtlin, A

    2012-01-01

    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus...

  11. Development and validation of a Myxoma virus real-time polymerase chain reaction assay.

    Albini, Sarah; Sigrist, Brigitte; Güttinger, Regula; Schelling, Claude; Hoop, Richard K; Vögtlin, Andrea

    2012-01-01

    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus in fresh and paraffin-embedded rabbit tissues originating from myxomatosis cases from various regions in Switzerland. PMID:22362943

  12. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    Ana Lisa do Vale Gomes; Fábio L Melo; Roberto P Werkhauser; Frederico GC Abath

    2006-01-01

    This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR) protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA). Th...

  13. Real-Time Polymerase Chain Reaction for Detection of Strongyloides stercoralis in Stool

    Sultana, Yasmin; Jeoffreys, Neisha; Watts, Matthew R.; Gilbert, Gwendolyn L.; Lee, Rogan

    2013-01-01

    The use of real-time polymerase chain reaction (PCR) for detection of Strongyloides stercoralis in stool has recently been described. We compared five DNA extraction methods by using normal human stool spiked with Strongyloides ratti and tested by using a real-time PCR. The PowerSoil kit was found to be the best technique in terms of sensitivity and ease of use. The PCR detected DNA extracted from one spiked S. ratti larva diluted 10−2. The PowerSoil kit was then used to extract DNA from 160 ...

  14. Ultra sensitive detection of Listeria monocytogenes in milk by the polymerase chain reaction (PCR).

    Starbuck, M A; Hill, P J; Stewart, G S

    1992-12-01

    The polymerase chain reaction (PCR) has been used to detect Listeria monocytogenes in whole milk at a level of 0.1 cfu per 30 ml. This high degree of sensitivity has been achieved following enzymatic digestion, polysulphonone membrane filtration and amplification of a nucleotide sequence within the promoter region of hlyA. Key elements of the procedure are the absence of enrichment culture and a complete solubilization of the membrane filter, ensuring total nucleic acid recovery. The simplicity of the protocol coupled with high sample volumes and exquisite sensitivity extends the relevance of PCR within food and environmental microbiology. PMID:1368996

  15. Rapid detection of Helicobacter pylori in gastric biopsy material by polymerase chain reaction.

    Hammar, M.; Tyszkiewicz, T; Wadström, T.; O'Toole, P W

    1992-01-01

    By using primers based on the sequence of a species-specific antigen of Helicobacter pylori (P. O'Toole, S.M. Logan, M. Kostrzynska. T. Wadström, and T.J. Trust, J. Bacteriol. 173:505-513, 1991), a protocol was established for detection of this microorganism in gastric biopsy samples by the polymerase chain reaction (PCR). A single primer pair was used to specifically amplify a 298-bp sequence in a rapid two-step PCR. The primers exhibited the same specificity in PCR as that which we reported...

  16. Use of the Polymerase Chain Reaction in the Detection of Bovine Leukosis

    Kelly, Emma Jane

    1992-01-01

    A diagnostic test for bovine leukosis was developed using the polymerase chain reaction (PCR) to amplify a 375 base pair region in the gag gene of the proviral genome. Blood samples were collected from 3 adult Holstein cows shown to be infected with bovine leukosis virus (BLV) by the agar-gel immunodiffusion (AGID) technique. The 3 samples were mixed and the composite blood was used to inoculate 10 cows. Five of the cows were inoculated with 0.1 ml of blood, and the other cows were inocula...

  17. Diagnosis of Fusarium keratitis in an animal model using the polymerase chain reaction

    Alexandrakis, G.; JALALI, S; Gloor, P

    1998-01-01

    AIMS/BACKGROUND—The purpose of this study was apply the polymerase chain reaction (PCR) to develop a sensitive, specific, and rapid test to diagnose Fusarium keratitis. Fusarium is the most common cause of fungal corneal infection in some parts of the world. It is often difficult to establish that a keratitis is due to fungal infection.
METHODS—Fusarium solani keratitis was induced in three eyes of three rabbits by injection of a suspension of the fungus into the anterior corneal stroma. In o...

  18. Comparison of proteases in DNA extraction via quantitative polymerase chain reaction.

    Eychner, Alison M; Lebo, Roberta J; Elkins, Kelly M

    2015-06-01

    We compared four proteases in the QIAamp DNA Investigator Kit (Qiagen) to extract DNA for use in multiplex polymerase chain reaction (PCR) assays. The aim was to evaluate alternate proteases for improved DNA recovery as compared with proteinase K for forensic, biochemical research, genetic paternity and immigration, and molecular diagnostic purposes. The Quantifiler Kit TaqMan quantitative PCR assay was used to measure the recovery of DNA from human blood, semen, buccal cells, breastmilk, and earwax in addition to low-template samples, including diluted samples, computer keyboard swabs, chewing gum, and cigarette butts. All methods yielded amplifiable DNA from all samples. PMID:25197027

  19. A Novel Nested Polymerase Chain Reaction (n-PCR) Assay for Identifying Sorghum nitidum

    Wei, Shasha; Zhirui DENG; Liping YIN; Yi, Jianping; Renqi WU; Qin CHEN

    2011-01-01

    This work developed a novel nested polymerase chain reaction (n-PCR) assay to identify Sorghum nitidum (S. nitidum). It has been designed a set of specific n-PCR inner primers Snit5/Snit2 and outer primers Nout1/Nout2 based on a conserved nucleotide sequence of adh1-like gene of S. nitidum. Fourteen samples of sorghum were used to investigate the specificity of the primers and the n-PCR assay. The result showed that 9 samples of S. nitidum displayed a positive strong, specific amplified band ...

  20. Synthesis and Intramolecular [4+2] Cycloaddition Reactions of 4-Pyridazinecarbonitriles with Alkyne Side Chains

    Norbert Haider; Günther Fülep

    1998-01-01

    The preparation of a series of new 3-(alkynyl-X)-substituted 4-pyridazinecarbonitriles 2-5 (X = O, NH) is described. The compounds are shown to undergo thermally induced intramolecular Diels-Alder reactions with inverse electron demand, affording the fused benzonitriles 6-8. Incorporation of a 1,2-phenylene unit into the side chain, as in the case of compounds 10 and 13, results in a more favorable conformation of the dienophilic substructure and thus to a pronounced acceleration of the [4+2]...

  1. Dietary Maillard reaction products: implications for human health and disease

    Ames, Jenny

    2009-01-01

    When foods are heat processed, the sugars and lipids react with the proteins they contain via the Maillard and related reactions to form a wide range of products. As a result, the sensory, safety, nutritional and health-promoting attributes of the foods are affected. Reaction products include advanced glycation/lipoxidation endproducts (AGE/ALEs), acrylamide and heterocyclic amines (HAA), all of which may impact on human health and disease. Furthermore, some Maillard reaction products affect ...

  2. The Chain Information Model: a systematic approach for food product development

    Benner, M.

    2005-01-01

    The chain information model has been developed to increase the success rate of new food products. The uniqueness of this approach is that it approaches the problem from a chain perspective and starts with the consumer. The model can be used to analyse the production chain in a systematic way. This r

  3. 76 FR 34271 - Hewlett Packard, Global Parts Supply Chain, Global Product Life Cycles Management Unit, Including...

    2011-06-13

    ... workers of Hewlett Packard, Global Parts Supply Chain, Global Product Life Cycles Management Unit... Employment and Training Administration Hewlett Packard, Global Parts Supply Chain, Global Product Life Cycles... Supply Chain Group, including leased workers from QFlex, North America Logistics and UPS...

  4. Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

    Andriani .

    2013-08-01

    Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.

  5. Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

    Gusti Ayu Yuniati Kencana

    2013-07-01

    Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

  6. Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

    A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

  7. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  8. Study on Inventory of Supply Chain of Supermarket-oriented Agricultural Products

    Hong; HUO; Xin; SHEN; Zhipeng; Huang

    2013-01-01

    Using principle and method of the system dynamics,this paper takes a qualitative analysis on the inventory of supply chain of supermarket-oriented agricultural products,and compares with the supply chain of wholesale-oriented agricultural products. Two inventory models are established for these two different modes of supply chain. Through simulation of two models in the case of random demand and quantitative analysis of results,it is found that the inventory of supply chain of supermarket-oriented agricultural products has smaller fluctuation than that of wholesaler-oriented agricultural products. Besides,both the inventory level and bullwhip effect of above chain are lowered.

  9. Production of lactic acid from C6-polyols by alkaline hydrothermal reactions

    Production of lactic acid from C6-polyols (Mannitol) under alkaline hydrothermal conditions was investigated. Experiments were performed to examine the difference in the production of lactic acid between C6-polyols and C3-polyols (glycerine), as well as C6-aldoses (glucose). Results showed that the yield of lactic acid from C6-polyols was lower than that from both glycerine and glucose. It indicated that long chain polyols might follow a different reaction pathway from that of glycerine. Further investigation is needed to clarify the reaction mechanism and improve the relatively low lactic acid acid yield from C6-polyols.

  10. SWOT Analysis of Agricultural Producers in the Supply Chain of Chinese Agro-products

    2011-01-01

    On the basis of defining the producers in the supply chain of agricultural products,the SWOT analysis is adopted to analyze the advantages,disadvantages,opportunities and threats of producers in the supply chain of Chinese agricultural products.The paper analyzes the advantages of producers in the supply chain of agricultural products from three aspects including land resources,technology level of producers and input costs.The disadvantages of producers in the supply chain of agricultural products are analyzed from three aspects including scale level,mechanization and technology level and profit level.The opportunities of producers in the supply chain of agricultural products are analyzed from the aspects of laws,policies,capitals and technologies.The threats confronted by the producers in the supply chain of agricultural products are analyzed from foreign producers,negotiation control of supply chain of agricultural chain,environment protection and quality safety standard.On the basis of the analysis,the relevant suggestions on facilitating the interests of producers in the supply chain of Chinese agricultural products are put forward,including fully displaying the advantages of land resources;improving the knowledge and technology level of supply chain of agricultural production;establishing the alliances of producers of agricultural products to expand production scale;improving the quality of agricultural products to satisfy the relevant safety quality standard and environmental protection standard.

  11. Determination of the number of radicals in the initial chain reactions by mathematical methods

    Pejović Branko B.

    2009-01-01

    Full Text Available Starting from the fact that the real mechanism in a chemical equation takes places through a certain number of radicals which participate in simultaneous reactions and initiate chain reactions according to a particular pattern, the aim of this study is to determine their number in the first couple of steps of the reaction. Based on this, the numbers of radicals were determined in the general case, in the form of linear difference equations, which, by certain mathematical transformations, were reduced to one equation that satisfies a particular numeric series, entirely defined if its first members are known. The equation obtained was solved by a common method developed in the theory of numeric series, in which its solutions represent the number of radicals in an arbitrary step of the reaction observed, in the analytical form. In the final part of the study, the method was tested and verified using two characteristic examples from general chemistry. The study also gives a suggestion of a more efficient procedure by reducing the difference equation to a lower order.

  12. Vibrational nonequilibrium in chain branching reactions of hydrogen combustion using quasi-classical trajectory analysis

    Voelkel, Stephen; Raman, Venkat; Varghese, Philip

    2015-11-01

    In high-speed reactive flows in scramjets, thermal nonequilibrium is introduced in the flow via shock waves. Though rotational and translational energy modes relax back to equilibrium quickly, vibrational relaxation is comparable to the bulk mixing and reaction timescales. The discrepancy between vibration and rotation/translation energy distributions can dramatically alter on the initiation of the fuel oxidation process. For continuum-scale applications, thermal nonequilibrium effects are derived from the rovibrational state-specific reaction and scattering rates associated with the chemical mechanism. In this work, the state-specific reaction rates are calculated for the chain branching reactions in the hydrogen combustion mechanism using a quasi-classical trajectory (QCT) framework. The state-specific rates are incorporated into a multiple temperature continuum-scale model whereby each species is characterized by a Boltzmann distribution parametrized by its own vibrational temperature. The flame ignition rates are implemented in a CFD code to simulate a reactive coflow. Funded by AFOSR FA9550-12-1-0460.

  13. Scenarios for the milk production chain in Brazil in 2020

    Renata Giovinazzo Spers

    2013-06-01

    Full Text Available Brazilian milk production has grown steadily and in 2004 the country became self-sufficient in dairy production. This article develops possible scenarios for the milk production chain in Brazil for the year 2020 in order to contribute to decisions that must be made by stakeholders. A literature review on foresight and the use of scenarios was conducted, and a scenario writing approach based on Wright and Spers (2006 was adopted, which includes the use of the Delphi method, Michael Porter's Five Competitive Forces model, Interpretative Structural Modeling (ISM (WRIGHT, 1991 and quantitative projections. This methodology provided four scenarios, with quantitative and qualitative elements: two exploratory scenarios ("milk, the new agribusiness star" and "a wasted future", a most probable scenario ("continuous but uneven growth" and a desired scenario ("competitive family agriculture". Overall, it is possible to note many market opportunities, as well as niche markets and the strengthening of cooperatives. Future prospects are also favorable to the dairy industry in general, but nearly all scenarios point to a concentration in the industrial sphere.

  14. Improving the quality of pork and pork products for the consumer : development of innovative, integrated, and sustainable food production chains of high quality pork products matching consumer demands

    Heimann, B.; Christensen, M.; Rosendal Rasmussen, S.; Bonneau, M.; Grunert, K.G.; Arnau, J.; Trienekens, J.H.; Oksbjerg, N.; Greef, de K.H.; Petersen, B.

    2012-01-01

    Improving the quality of pork and pork products for the consumer: development of innovative, integrated, and sustainable food production chains of high quality pork products matching consumer demands.

  15. Products of fission, fusion and deep inelastic reactions

    Factors which influence the yields in heavy ion reactions such as fusion, fission fragment production and deep inelastic reactions are considered in the context of the design of spectroscopic experiments. Factors examined include the suitability of a reaction for a particular application, the expected yield of the required nucleus, and parameters responsible for uncertainties in predicted yields. (U.K.)

  16. Multivariate High Order Statistics of Measurements of the Temporal Evolution of Fission Chain-Reactions

    Mattingly, J.K.

    2001-03-08

    The development of high order statistical analyses applied to measurements of the temporal evolution of fission chain-reactions is described. These statistics are derived via application of Bayes' rule to conditional probabilities describing a sequence of events in a fissile system beginning with the initiation of a chain-reaction by source neutrons and ending with counting events in a collection of neutron-sensitive detectors. Two types of initiating neutron sources are considered: (1) a directly observable source introduced by the experimenter (active initiation), and (2) a source that is intrinsic to the system and is not directly observable (passive initiation). The resulting statistics describe the temporal distribution of the population of prompt neutrons in terms of the time-delays between members of a collection (an n-tuplet) of correlated detector counts, that, in turn, may be collectively correlated with a detected active source neutron emission. These developments are a unification and extension of Rossi-a, pulsed neutron, and neutron noise methods, each of which measure the temporal distribution of pairs of correlated events, to produce a method that measures the temporal distribution of n-tuplets of correlated counts of arbitrary dimension n. In general the technique should expand present capabilities in the analysis of neutron counting measurements.

  17. Solving the SAT problem using a DNA computing algorithm based on ligase chain reaction.

    Wang, Xiaolong; Bao, Zhenmin; Hu, Jingjie; Wang, Shi; Zhan, Aibin

    2008-01-01

    A new DNA computing algorithm based on a ligase chain reaction is demonstrated to solve an SAT problem. The proposed DNA algorithm can solve an n-variable m-clause SAT problem in m steps and the computation time required is O (3m+n). Instead of generating the full-solution DNA library, we start with an empty test tube and then generate solutions that partially satisfy the SAT formula. These partial solutions are then extended step by step by the ligation of new variables using Taq DNA ligase. Correct strands are amplified and false strands are pruned by a ligase chain reaction (LCR) as soon as they fail to satisfy the conditions. If we score and sort the clauses, we can use this algorithm to markedly reduce the number of DNA strands required throughout the computing process. In a computer simulation, the maximum number of DNA strands required was 2(0.48n) when n=50, and the exponent ratio varied inversely with the number of variables n and the clause/variable ratio m/n. This algorithm is highly space-efficient and error-tolerant compared to conventional brute-force searching, and thus can be scaled-up to solve large and hard SAT problems. PMID:17904730

  18. Polymerase chain reaction detection of candidatus liberibacter asiatic associated with citrus huanglonbing

    G.P. Jagtap

    2012-08-01

    Full Text Available Polymerase chain reaction diagnosis of Candidatus liberibacter asiatic associated with citrus Huanglonbing disease is molecular technique which is used for detection of disease when pathogen present is very low concentration in disease sample. Among these three DNA isolation methods viz., commercial kit method, sodium sulphite method and membrane bard nucleic acid technique, sodium sulphite method is cost effective for commercial use. In nucleic acid membrane method for DNA extraction isolation there is no use of liquid nitrogen. Polymerase chain reaction detection of disease is based on principal of thermal cycling in which PCR instrument allow to run generally 60-65 thermal cycle, during PCR operation it allow different stages of cycle at different temperatures for different period of time i.e. initiation (940C, denaturation (940C, primer annealing (600C, extension/elongation step (720C, final elongation (720C and holding temperature (40C. PCR based diagnosis system is developed for detection of greening bacteria. The comparative cost of detection by various combinations of reagent and sampling time was determined and cost effective technology was standardized and validated.

  19. Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

    Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B. (Univ. of Illinois, Chicago (USA)); Wunder, J.S.; Andrulis, I.L. (Mount Sinai Hospital, Toronto, Ontario (Canada)); Gazdar, A.F. (National Cancer Inst., Bethesda, MD (USA)); Willman, C.L.; Griffith, B. (Univ. of New Mexico, Albuquerque (USA)); Von Hoff, D.D. (Univ. of Texas, San Antonio (USA))

    1990-09-01

    The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy.

  20. Maillard reaction products in pet foods

    Rooijen, van, J.

    2015-01-01

    Pet dogs and cats around the world are commonly fed processed commercial foods throughout their lives. Often heat treatments are used during the processing of these foods to improve nutrient digestibility, shelf life, and food safety. Processing is known to induce the Maillard reaction, in which a reducing sugar binds to a free reactive amino group of an amino acid. In intact proteins, the ε-amino group of lysine is the most abundant free amino group. The reaction reduces the bioavail...

  1. Modeling and Optimization of Inventory-Distribution Routing Problem for Agriculture Products Supply Chain

    Li Liao; Jianfeng Li; Yaohua Wu

    2013-01-01

    Mathematical models of inventory-distribution routing problem for two-echelon agriculture products distribution network are established, which are based on two management modes, franchise chain and regular chain, one-to-many, interval periodic order, demand depending on inventory, deteriorating treatment cost of agriculture products, start-up costs of vehicles and so forth. Then, a heuristic adaptive genetic algorithm is presented for the model of franchise chain. For the regular chain model,...

  2. Study on Inventory of Supply Chain of Supermarket-oriented Agricultural Products

    Huo, Hong; Shen, Xin; Huang, Zhipeng

    2013-01-01

    Using principle and method of the system dynamics, this paper takes a qualitative analysis on the inventory of supply chain of supermarket-oriented agricultural products, and compares with the supply chain of wholesale-oriented agricultural products. Two inventory models are established for these two different modes of supply chain. Through simulation of two models in the case of random demand and quantitative analysis of results, it is found that the inventory of supply chain of supermarket-...

  3. Construction of Network Management Information System of Agricultural Products Supply Chain Based on 3PLs

    Gao, Shujin; Yang, Qiangxian

    2010-01-01

    The necessity to construct the network management information system of 3PLs agricultural supply chain is analyzed, showing that 3PLs can improve the overall competitive advantage of agricultural supply chain. 3PLs changes the homogeneity management into specialized management of logistics service and achieves the alliance of the subjects at different nodes of agricultural products supply chain. Network management information system structure of agricultural products supply chain based on 3PL...

  4. Quantification of Porcine Follicle-stimulating Hormone Receptor Messenger Ribonucleic Acid by Reverse Transcription-competitive Polymerase Chain Reaction

    2000-01-01

    An easy and reliable method was developed for construction and quantification of competitive templates, which shared the same sequence as the amplified target DNA except for a 20-bp insertion in the middle by recombinant polymerase chain reaction (PCR). Among the advantages of competitive PCR is that any predictable or unpredictable variable that affects amplification has the same effect on both target and competitor species and that the final ratio of amplified products reflects exactly the initial targets. The utilization of a thermostable reverse transcriptase in the RT step was proposed to overcome the problem of the efficiency of target cDNA synthesis. In addition, to obtain reliable measurements, it was recommended to perform four PCR with amounts of competitive template flanking the concentration of the target mRNA.

  5. Detection of Chloramphenicol Resistance Genes (cat in Clinical Isolates of Pseudomonas aeruginosa with Polymerase Chain Reaction Method

    Tiana Milanda

    2014-12-01

    Full Text Available Pseudomonas aeruginosa is an opportunistic Gram negative bacteria, which may cause infection in eyes, ears, skin, bones, central nervous system, gastrointestinal tract, circulatory system, heart, respiratory system, and urinary tract. Recently, chloramphenicol is no longer used as the main option of the therapy due of its resistance case. The aim of this research was to detect the presence of gene which is responsible to chloramphenicol resistance in clinical isolates of P.aeruginosa. These bacteria isolated from pus of external otitis patients in Hasan Sadikin Hospital in Bandung City. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were performed to detect this resistance gene. Electropherogram from PCR products showed that the chloramphenicol resistance in clinical isolates of P. aeruginosa was caused by cat gene (317 bp. Based on this research, cat gene may be used to detect the chloramphenicol resistance in patients with external ostitis.

  6. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    U. Pagnini

    2010-02-01

    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  7. Functionalized tetrapod-like ZnO nanostructures for plasmid DNA purification, polymerase chain reaction and delivery

    Functionalized tetrapodal ZnO nanostructures are tested in plasmid DNA experiments (1) as a solid-phase adsorbent for plasmid DNA purification (2) as improving reagents in a polymerase chain reaction (PCR) and (3) as novel carriers for gene delivery. The amino-modification, the tetrapod-like shape of the nanostructure and its high biocompatibility all contribute to measurements showing promise for applications. A sol-gel method is used for silica coating and amino-modification. Plasmid DNA is purified through reversible conjugations of amino-modified ZnO tetrapods with DNA. Also, as additional reagents, functionalized tetrapods are shown to improve the amount of PCR product. For transfection, ZnO tetrapods provide some protection against deoxyribonuclease cleavage of plasmid DNA and deliver plasmid DNA into cells with little cytotoxicity

  8. Process Reengineering of Cold Chain Logistics of Agricultural Products Based on Low-carbon Economy

    2012-01-01

    Through the process analysis of cold chain logistics of agricultural products,we find that cold chain logistics of agricultural products contradict the development model of low-carbon economy to some extent.We apply the development idea of low-carbon economy,introduce the thirdparty logistics companies,establish distribution center of cold chain logistics of agricultural products,and strengthen information sharing,to reengineer the process of cold chain logistics of agricultural products in China.The results show that applying low-carbon economy to process reengineering of cold chain logistics of agricultural products,has advantages of increasing added value of products,promoting scale merit and abating lag,plays a role in promoting emission reduction,high efficiency and environmental protection in the process of cold chain logistics of agricultural products in China.

  9. A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp

    Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Díez Baños, Pablo; Píriz, Ana; Fickel, Joerns; Sánchez, Antonio

    2011-01-01

    The present study aimed to establish a fluorescence- based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus- specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were an...

  10. A non-radioisotopic quantitative competitive polymerase chain reaction method: application in measurement of human herpesvirus 7 load.

    Kidd, I M; Clark, D A; Emery, V C

    2000-06-01

    Quantitative-competitive polymerase chain reaction (QCPCR) is a well-optimised and objective methodology for the determination of viral load in clinical specimens. A major advantage of QCPCR is the ability to control for the differential modulation of the PCR process in the presence of potentially inhibitory material. QCPCR protocols were developed previously for CMV, HHV-6, HHV-7 and HHV-8 and relied upon radioactively labelled primers, followed by autoradiography of the separated and digested PCR products to quantify viral load. Whilst this approach offers high accuracy and dynamic range, non-radioactive approaches would be attractive. Here, an alternative detection system is reported, based on simple ethidium bromide staining and computer analysis of the separated reaction products, which enables its adoption in the analysis of a large number of samples. In calibration experiments using cloned HHV-7 DNA, the ethidium bromide detection method showed an improved correlation with known copy number over that obtained with the isotopic method. In addition, 67 HHV-7 PCR positive blood samples, derived from immunocompromised patients, were quantified using both detection techniques. The results showed a highly significant correlation with no significant difference between the two methods. The applicability of the computerised densitometry method in the routine laboratory is discussed. PMID:10856765

  11. Detection of Mycobacterium tuberculosis in clinical samples by two-step polymerase chain reaction and nonisotopic hybridization methods.

    Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E

    1993-01-01

    Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...

  12. Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

    Carla Bertechini Faria

    2012-03-01

    Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

  13. Maillard reaction products in pet foods

    Rooijen, van C.

    2015-01-01

    Pet dogs and cats around the world are commonly fed processed commercial foods throughout their lives. Often heat treatments are used during the processing of these foods to improve nutrient digestibility, shelf life, and food safety. Processing is known to induce the Maillard reaction, in which a r

  14. High energy gamma-ray production in nuclear reactions

    Experimental techniques used to study high energy gamma-ray production in nuclear reactions are reviewed. High energy photon production in nucleus-nucleus collisions is discussed. Semi-classical descriptions of the nucleus-nucleus gamma reactions are introduced. Nucleon-nucleon gamma cross sections are considered, including theoretical aspects and experimental data. High energy gamma ray production in proton-nucleus reactions is explained. Theoretical explanations of photon emission in nucleus-nucleus collisions are treated. The contribution of charged pion currents to photon production is mentioned

  15. Effective use of product quality information in food supply chain logistics

    Rijpkema, W.A.

    2014-01-01

    Food supply chains have inherent characteristics, such as variability in product quality and quality decay, which put specific demands on logistics decision making. Furthermore, food supply chain organization and control has changed significantly in the past decades by factors such as scale intensification and globalization. In practice, these characteristics and developments frequently lead to supply chain problems, such as high levels of product waste, product quality problems, and high log...

  16. [Analysis of the vegetable productive chain in Ribeirão Preto, SP].

    Takayanagui, Osvaldo M; Capuano, Divani M; Oliveira, Carlos A D; Bergamini, Alzira M M; Okino, Madalena H T; Castro e Silva, Ana A M C; Oliveira, Maria A; Ribeiro, Eliana G A; Takayanagui, Angela M M

    2006-01-01

    With the aim of assessing the cumulative risk of lettuce contamination, 45 production chains were investigated. The presence of thermotolerant coliforms, Salmonella and/or parasites was detected in 69% of these, in all steps of the production chain. Quality control in all steps of the lettuce production process should be intensified. PMID:16699655

  17. Adoption of GM technology in livestock production chains: an integrating framework

    Novoselova, T.; Meuwissen, M.P.M.; Huirne, R.B.M.

    2007-01-01

    This paper presents an integrating framework for analysing the adoption of new technologies in food chains. We review the literature on the adoption of genetic modification in livestock production chains and conclude that an integrated chain approach is currently lacking. Such an approach is, howeve

  18. PRODUCTION OF MEDIUM-CHAIN ACYLGLYCEROLS BY LIPASE ESTERIFICATION IN PACKED BED REACTOR: PROCESS OPTIMIZATION BY RESPONSE SURFACE METHODOLOGY

    ZANARIAH MOHD DOM

    2014-06-01

    Full Text Available Medium-chain acylglycerols (or glycerides are formed of mono-, di- and triacylglycerol classes. In this study, an alternative method to produce MCA from esterifying palm oil fatty acid distillate (PFAD with the presence of oil palm mesocarp lipase (OPML which is a plant-sourced lipase and PFAD is also cheap by-product is developed in a packed bed reactor. The production of medium-chain acylglycerols (MCA by lipase-catalysed esterification of palm oil fatty acid distillate with glycerol are optimize in order to determine the factors that have significant effects on the reaction condition and high yield of MCA. Response surface methodology (RSM was applied to optimize the reaction conditions. The reaction conditions, namely, the reaction time (30-240 min, enzyme load (0.5-1.5 kg, silica gel load (0.2-1.0 kg, and solvent amount (200-600 vol/wt. Reaction time, enzyme loading and solvent amount strongly effect MCA synthesis (p0.05 influence on MCA yield. Best-fitting models were successfully established for MCA yield (R 2 =0.9133. The optimum MCA yield were 75% from the predicted value and 75.4% from the experimental data for 6 kg enzyme loading, a reaction time of 135min and a solvent amount of 350 vol/wt at 65ºC reaction temperature. Verification of experimental results under optimized reaction conditions were conducted, and the results agreed well with the predicted range. Esterification products (mono-, di- and triacylglycerol from the PBR were identified using Thin Layer Chromatography method. The chromatograms showed the successful fractionation of esterified products in this alternative method of process esterification.

  19. Production and Characterization of Recombinant Light Chain and Carboxyterminal Heavy Chain Fragments of Tetanus Toxin

    Yousefi, Mehdi; Khosravi-Eghbal, Roya; Hemmati, Azam; Shokri, Fazel

    2013-01-01

    Background Light chain (LC) and heavy chain carboxyterminal subdomain (HCC) fragments are the most important parts of tetanus neurotoxin (TeNT) which play key roles in toxicity and binding of TeNT, respectively. In the present study, these two fragments were cloned and expressed in a prokaryotic system and their identity was confirmed using anti-TeNT specific polyclonal and monoclonal antibodies. Methods LC and HCC gene segments were amplified from Clostridium tetani genomic DNA by PCR, clone...

  20. The mutagenic chain reaction: a method for converting heterozygous to homozygous mutations

    Gantz, Valentino M.; Bier, Ethan

    2015-01-01

    An organism with a single recessive loss-of-function allele will typically have a wild-type phenotype while individuals homozygous for two copies of the allele will display a mutant phenotype. Here, we develop a method that we refer to as the mutagenic chain reaction (MCR), which is based on the CRISPR/Cas9 genome editing system for generating autocatalytic mutations to generate homozygous loss-of-function mutations. We demonstrate in Drosophila that MCR mutations efficiently spread from their chromosome of origin to the homologous chromosome thereby converting heterozygous mutations to homozygosity in the vast majority of somatic and germline cells. MCR technology should have broad applications in diverse organisms. PMID:25908821

  1. Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction.

    Jackson, D P; Lewis, F A; Taylor, G R; Boylston, A W; Quirke, P

    1990-01-01

    Several DNA extraction techniques were quantitatively and qualitatively compared using both fresh and paraffin wax embedded tissue and their suitability investigated for providing DNA and RNA for the polymerase chain reaction (PCR). A one hour incubation with proteinase K was the most efficient DNA extraction procedure for fresh tissue. For paraffin wax embedded tissue a five day incubation with proteinase K was required to produce good yields of DNA. Incubation with sodium dodecyl sulphate produced very poor yields, while boiling produced 20% as much DNA as long enzyme digestion. DNA extracted by these methods was suitable for the PCR amplification of a single copy gene. Proteinase K digestion also produced considerable amounts of RNA which has previously been shown to be suitable for PCR analysis. A delay before fixation had no effect on the amount of DNA obtained while fixation in Carnoy's reagent results in a much better preservation of DNA than formalin fixation, allowing greater yields to be extracted. Images PMID:1696290

  2. Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

    Cesare Bonacina

    2010-01-01

    Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

  3. Repetitive sequence based polymerase chain reaction to differentiate close bacteria strains in acidic sites

    XIE Ming; YIN Hua-qun; LIU Yi; LIU Jie; LIU Xue-duan

    2008-01-01

    To study the diversity of bacteria strains newly isolated from several acid mine drainage(AMD) sites in China,repetitive sequence based polymerase chain reaction (rep-PCR),a well established technology for diversity analysis of closely related bacteria strains,was conducted on 30 strains of bacteria Leptospirillum ferriphilium,8 strains of bacteria Acidithiobacillus ferrooxidans,as well as the Acidithiobacillus ferrooxidans type strain ATCC (American Type Culture Collection) 23270.The results showed that,using ERIC and BOX primer sets,rep-PCR produced highly discriminatory banding patterns.Phylogenetic analysis based on ERIC-PCR banding types was made and the results indicated that rep-PCR could be used as a rapid and highly discriminatory screening technique in studying bacterial diversity,especially in differentiating bacteria within one species in AMD.

  4. Magnetic hydrophilic methacrylate-based polymer microspheres designed for polymerase chain reactions applications.

    Spanová, Alena; Horák, Daniel; Soudková, Eva; Rittich, Bohuslav

    2004-02-01

    Magnetic hydrophilic non-porous P(HEMA-co-EDMA), P(HEMA-co-GMA) and PGMA microspheres were prepared by dispersion (co)polymerization of 2-hydroxyethyl methacrylate (HEMA) and ethylene dimethacrylate (EDMA) or glycidyl methacrylate (GMA) in the presence of several kinds of magnetite. It was found that some components used in the preparation of magnetic carriers interfered with polymerase chain reaction (PCR). Influence of non-magnetic and magnetic microspheres, including magnetite nanoparticles and various components used in their synthesis, on the PCR course was thus investigated. DNA isolated from bacterial cells of Bifidobacterium longum was used in PCR evaluation of non-interfering magnetic microspheres. The method enabled verification of the incorporation of magnetite nanoparticles in the particular methacrylate-based polymer microspheres and evaluation of suitability of their application in PCR. Preferably, electrostatically stabilized colloidal magnetite (ferrofluid) should be used in the design of new magnetic methacrylate-based microspheres by dispersion polymerization. PMID:14698232

  5. Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals

    Mayara C. Lombardi

    2014-12-01

    Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.

  6. Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

    Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

  7. Detection of Trypanosoma cruzi DNA within murine cardiac tissue sections by in situ polymerase chain reaction

    Joshua E Lane

    2003-04-01

    Full Text Available The use of in situ techniques to detect DNA and RNA sequences has proven to be an invaluable technique with paraffin-embedded tissue. Advances in non-radioactive detection systems have further made these procedures shorter and safer. We report the detection of Trypanosoma cruzi, the causative agent of Chagas disease, via indirect and direct in situ polymerace chain reaction within paraffin-embedded murine cardiac tissue sections. The presence of three T. cruzi specific DNA sequences were evaluated: a 122 base pair (bp sequence localized within the minicircle network, a 188 bp satellite nuclear repetitive sequence and a 177 bp sequence that codes for a flagellar protein. In situ hybridization alone was sensitive enough to detect all three T. cruzi specific DNA sequences.

  8. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction

    Bell, D.A. (National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States))

    1991-01-01

    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes.

  9. Detection of hepatopancreatic parvovirus (HPV) in wild shrimp from India by nested polymerase chain reaction (PCR).

    Manjanaik, B; Umesha, K R; Karunasagar, Indrani; Karunasagar, Iddya

    2005-02-28

    The prevalence of hepatopancreatic parvovirus (HPV) in wild penaeid shrimp samples from India was studied by nested polymerase chain reaction (PCR) using primers designed in our laboratory. The virus could be detected in 9 out of 119 samples by non-nested PCR. However, by nested PCR 69 out of 119 samples were positive. The PCR results were confirmed by hybridization with digoxigenin-labelled DNA probe. Shrimp species positive by non-nested PCR included Penaeus monodon, Penaeus indicus and Penaeus semisulcatus and by nested PCR Parapenaeopsis stylifera, Penaeus japonicus, Metapenaeus monoceros, M. affinis, M. elegans, M. dobsoni, M. ensis and Solenocera choprai. This is the first report on the prevalence of HPV in captured wild shrimp from India. PMID:15819441

  10. Utility of polymerase chain reaction as a diagnostic tool in cutaneous tuberculosis

    Padmavathy L

    2003-05-01

    Full Text Available Background: Differentiation of cutaneous tuberculosis from other infective granulomas of the skin is difficult due to paucity of the organisms in tissue biopsies. Polymerase chain reaction (PCR is a newer technique to identify the DNA of Mycobacterium tuberculosis in the tissues. Aim: We examined the utility of PCR as a tool for rapid diagnosis of cutaneous tuberculosis especially in cases negative by ZN staining and culture. Material and Methods: Twenty five random skin biopsies from patients with various types of cutaneous tuberculosis were subjected to PCR. Results: An overall positivity of 64% was observed, which is comparable to other series. Seventy five percent of lupus vulgaris cases, 62.2% of tuberculosis verrucosa cutis and 50% of scrofuloderma cases showed PCR positivity. Conclusion: Though useful, the cost and the technique involved limit the use of PCR in developing countries like ours.

  11. Midtrimester fetal herpes simplex-2 diagnosis by serology, culture and quantitative polymerase chain reaction.

    Curtin, William M; Menegus, Marilyn A; Patru, Maria-Magdalena; Peterson, C Jeanne; Metlay, Leon A; Mooney, Robert A; Stanwood, Nancy L; Scheible, Amy L; Dorgan, Angela

    2013-01-01

    The acquisition of herpes simplex virus (HSV) in utero comprises a minority of neonatal herpes infections. Prenatal diagnosis is rare. We describe a midtrimester diagnosis of fetal HSV-2 infection. Ultrasound at 20 weeks for elevated maternal serum α-fetoprotein (MSAFP) showed lagging fetal growth, echogenic bowel, echogenic myocardium, and liver with a mottled pattern of echogenicity. Amniocentesis demonstrated normal karyotype, elevated AFP and positive acetylcholinesterase. Culture isolated HSV-2 with an aberrant growth pattern. Maternal serology was positive for HSV-2. Quantitative DNA polymerase chain reaction (PCR) showed 59 million copies/ml. Fetal autopsy demonstrated widespread tissue necrosis but only sparse HSV-2 inclusions. Fetal HSV-2 infection can be suspected when an elevated MSAFP accompanies ultrasound findings suggesting perinatal infection. Maternal HSV serology, amniotic fluid culture and quantitative PCR are recommended for diagnostic certainty and counseling. PMID:23075531

  12. Thermostable Mismatch-Recognizing Protein MutS Suppresses Nonspecific Amplification during Polymerase Chain Reaction (PCR

    Seiki Kuramitsu

    2013-03-01

    Full Text Available Polymerase chain reaction (PCR-related technologies are hampered mainly by two types of error: nonspecific amplification and DNA polymerase-generated mutations. Here, we report that both errors can be suppressed by the addition of a DNA mismatch-recognizing protein, MutS, from a thermophilic bacterium. Although it had been expected that MutS has a potential to suppress polymerase-generated mutations, we unexpectedly found that it also reduced nonspecific amplification. On the basis of this finding, we propose that MutS binds a mismatched primer-template complex, thereby preventing the approach of DNA polymerase to the 3' end of the primer. Our simple methodology improves the efficiency and accuracy of DNA amplification and should therefore benefit various PCR-based applications, ranging from basic biological research to applied medical science.

  13. Analysis of infectious laryngotracheitis virus isolates from Ontario and New Brunswick by the polymerase chain reaction.

    Alexander, H S; Key, D W; Nagy, E

    1998-01-01

    The polymerase chain reaction (PCR) was used to amplify DNA of infectious laryngotracheitis virus (ILTV) isolates obtained from field specimens. The examined 47 samples included 37 isolates representing 35 cases of infectious laryngotracheitis from Ontario and 10 isolates originating from 10 field cases in New Brunswick. The viruses were grown in either embryonated chicken eggs or cell culture, the DNA extracted and amplified using primers designed from the sequence information of a 1.1 kb BamHI fragment of the Ontario 1598 ILTV strain. Thirty-four of the Ontario isolates and all of the New Brunswick isolates were amplified successfully. This suggests that the selected primers would be useful for the majority of the isolates encountered in outbreaks of ILTV. Images Figure 1. Figure 2. PMID:9442943

  14. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  15. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  16. Genotypic study of verocytotoxic Escherichia coli isolates from deer by multiplex polymerase chain reaction

    Raghavendra Prasad Mishra

    2016-08-01

    Full Text Available Aim: This study was planned to study the genotypes of verocytotoxigenic Escherichia coli (VTEC in fecal samples of deer due to its public health significance. Materials and Methods: A total of 160 fecal samples of deer were taken from Mathura district and Kanpur Zoo and screened for VTEC genes by polymerase chain reaction (PCR. Results: All fecal samples were positive for E. coli. All the E. coli isolates were screened by PCR to detect virulence genes stx1, stx2, eaeA, and hlyA. Of these, 15 isolates were found positive for VTEC having one or more genes in different combinations. Conclusion: Genes such as stx1, stx2, eaeA, and hlyA were prevalent in VTEC isolates from feces of deer. The presence of VTEC isolates having virulent genes may pose a threat to public health.

  17. The polymerase chain reaction and its application to clinical plastic surgery.

    Rea, S

    2012-02-03

    Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.

  18. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  19. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction.

    Bell, D A

    1991-01-01

    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes. PMID:1684153

  20. A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction.

    Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng

    2016-01-01

    In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples. PMID:27534372

  1. Rapid isolation of DNA from fresh and preserved fish scales for polymerase chain reaction.

    Yue, G H; Orban, L

    2001-05-01

    We developed a simple and inexpensive method to extract DNA from fresh and preserved fish scales. The procedure is based on boiling the scales in 5% Chelex 100, followed by digestion with proteinase K and subsequent absorption of genomic DNA using silica. A single fresh scale from larger species (e.g., tilapia) or a few scales from smaller species (e.g., 4 scales from zebrafish) provide over 200 ng of DNA, enough for at least 40 polymerase chain reaction amplifications. The procedure is applicable for DNA isolation not only from fresh and ethanol-preserved scales, but also from dried and formaldehyde-treated samples, and thus might be useful for investigating specimens stored in museums and other collections. Since the removal of a few scales is a gentle means of sample collection, this technique will allow analysis of genetic diversity, mating systems, and parentage in populations of endangered or ornamental fish with minimal experimental influence. PMID:14961356

  2. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  3. The use of polymerase chain reaction for early diagnosis of tuberculosis in Mycobacterium tuberculosis culture

    M. Chagas

    2010-06-01

    Full Text Available Early diagnosis plays a vital role in controlling tuberculosis. The conventional methodology is slow, with results taking several weeks, in addition to having low sensitivity, especially in clinical paucibacillary samples. The objective of this study was to evaluate the use of polymerase chain reaction (PCR on solid medium culture for a rapid diagnosis of tuberculosis, mainly in cases of negative sputum smears. Forty sputum samples were collected from inpatients with tuberculosis treated for less than 2 days. Bacilloscopy, PCR for sputum, culture on Löwestein-Jensen (LJ solid medium, and daily PCR from culture were performed on each sample. DNA extracted from the BCG vaccine, which contains attenuated bacillus Calmette-Guérin, was used as the positive control. Smear microscopy showed 68.6% sensitivity, 80% specificity, 96% positive predictive value, and 26.7% negative predictive value, with culture on LJ medium as the gold standard. Culture at day 28 showed 74.3% sensitivity and 100% specificity. PCR of DNA extracted from sputum amplified a 1027-bp fragment of the 16s RNA gene, showing 22.9% sensitivity and 60% specificity. PCR performed with DNA extracted from daily culture showed that, from the 17th to the 40th day, the sensitivity (85.7% and specificity (60% were constant. We conclude that a 17-day culture is a good choice for rapid diagnosis and to interfere with the transmission chain of tuberculosis.

  4. Detection of PERV by polymerase chain reaction and its safety in bioartificial liver support system

    Hai-Hui Wang; Ying-Jie Wang; Hong-Ling Liu; Jun Liu; Yan-Ping Huang; Hai-Tao Guo; Yu-Ming Wang

    2006-01-01

    AIM: To establish a method detecting porcine endogenous retrovirus (PERV) in China experimental minipigs and to evaluate the safety of PERV in three individuals treated with bioartificial liver support systems based on porcine hepatocytes.METHODS: Porcine hepatocytes were isolated with two-stage perfusion method, then cultured in the bioreactor, which is separated by a semipermeable membrane (0.2μm) from the lumen through which the patients' blood plasma was circulated. After post-hemoperfusion, patients' blood was obtained for screening. Additionally, samples of medium collected from both intraluminal and extraluminal compartments of the laboratory bioreactor and culture supernate in vitro was analyzed. The presence of viral sequences was estimated by polymerase chain reaction (PCR) and reverse transcriptase-polymerase chain reaction (RT-PCR). Finally, the infection of virus in the supernate of common culture was ascertained by exposure to the fetal liver cells.RESULTS: PERV-specific gag sequences were found in the porcine hepatocytes using RT-PCR. and were detected in all samples from the intraluminal,extraluminal samples and culture supernate. However,culture supernatant from primary porcine hepatocytes (cleared of cellular debris) failed to infect human fetal liver cells. Finally, RT-PCR detected no PERV infection was found in the blood samples obtained from three patients at various times post-hemoperfusion.CONCLUSION: The assays used are specific and sensitive, identified by second PCR. PERVs could be released from hepatocytes cultured in bioreactor without the stimulation of mitogen and could not be prevented by the hollow fiber semipermeable membrane, indicating the existence of PERV safety in extracorporeal bioartificial liver support system (EBLSS).

  5. Performance indicators in agri-food production chains

    Aramyan, L.H.; Ondersteijn, C.J.M.; Kooten, van O.; Oude Lansink, A.G.J.M.

    2006-01-01

    The last decade has seen an increasing interest in indicators of supply-chain performance. A large number of various performance indicators have been used to characterize supply chains, ranging from highly qualitative indicators like customer or employee satisfaction to quantitative indicators like

  6. Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

    Liu Dayu, E-mail: ruark@126.com [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Liang Guangtie; Lei Xiuxia; Chen Bin; Wang Wei [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Zhou Xiaomian, E-mail: zhouximi@yahoo.com [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China)

    2012-03-09

    Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil-water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: Black-Right-Pointing-Pointer Droplet formation in a capillary. Black-Right-Pointing-Pointer Transport the droplet using oscillation-flow. Black-Right-Pointing-Pointer Oscillation droplet PCR. Black-Right-Pointing-Pointer Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil-water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 {mu}L) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to

  7. Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

    Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil–water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: ► Droplet formation in a capillary. ► Transport the droplet using oscillation-flow. ► Oscillation droplet PCR. ► Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil–water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 μL) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to 89.5% and a detection limit of 10 DNA copies. The miniature PCR protocol developed in the current

  8. Independent Verification of Element 114 Production in the 48Ca+242Pu Reaction

    Independent verification of the production of element 114 in the reaction of 244-MeV 48Ca with 242Pu is presented. Two chains of time- and position-correlated decays have been assigned to 286114 and 287114. The observed decay modes, half-lives, and decay energies agree with published results. The measured cross sections at a center-of-target energy of 244 MeV for the 242Pu(48Ca,3-4n)287,286114 reactions were 1.4-1.2+3.2 pb each, which are lower than the reported values.

  9. Exclusive hadron production in two photon reactions

    This paper summarises experimental results on exclusive hadron production in two photon collisions at electron positron storage rings and attempts some interpretation. Experimental know how is described and new suggestions are made for future analyses. New model calculations on resonance form factors and pair production amplitudes are presented. The two photon vertex is decomposed such that experiments can be parameterised with the minimal number of free parameters. Selection rules for off shell photon collisions are given in addition to Yang's theorems. (orig.)

  10. Optimization of the performance of the polymerase chain reaction in silicon-based microstructures.

    Taylor, T B; Winn-Deen, E S; Picozza, E; Woudenberg, T M; Albin, M

    1997-01-01

    We have demonstrated the ability to perform real-time homogeneous, sequence specific detection of PCR products in silicon microstructures. Optimal design/ processing result in equivalent performance (yield and specificity) for high surface-to-volume silicon structures as compared to larger volume reactions in polypropylene tubes. Amplifications in volumes as small as 0.5 microl and thermal cycling times reduced as much as 5-fold from that of conventional systems have been demonstrated for the...

  11. Leptospira spp detection by Polymerase Chain Reaction (PCR) in clinical samples of captive black-capped Capuchin monkey (Cebus apella)

    Scarcelli Eliana; Piatti Rosa Maria; Fedullo José Daniel Luzes; Simon Faiçal; Cardoso Maristela Vasconcellos; Castro Vanessa; Miyashiro Simone; Genovez Margareth Élide

    2003-01-01

    Leptospirosis is a widely distributed zoonosis that affects domestic and wild animals, and that has the man as the end point of its epidemiological chain. Leptospirosis diagnosis in primates is more difficult than in other animal species, as clinical signs and lesions are less evident and antibody response is detected only for short periods. The aim of this article was to describe the detection of Leptospira spp using polymerase chain reaction (PCR), in clinical samples from one captive black...

  12. Sustainable Rent-Based Closed-Loop Supply Chain for Fashion Products

    Zhi-Hua Hu; Qing Li; Xian-Juan Chen; Yan-Feng Wang

    2014-01-01

    The textile and clothing industry generates much pollution and consumes a large amount of resources. Improper uses and disposal of clothing products make the problems much more severe. Fast fashion products shorten the valid lifecycle and generate more waste than regular clothing products. Considering the features of fashion products, a system of a rent-based closed-loop supply chain is developed to improve the sustainability of fashion products. The supply chain processes (fashion design and...

  13. A comparison of three DNA extractive procedures with Leptospira for polymerase chain reaction analysis

    Veloso IF

    2000-01-01

    Full Text Available Three DNA extraction methods were evaluated in this study: proteinase K followed by phenol-chloroform; a plant proteinase (E6870 followed by phenol-chloroform; and boiling of leptospires in 0.1 mM Tris, pH 7.0 for 10 min at 100°C, with no phenol treatment. Every strain treated with proteinase K or E6870 afforded positive polymerase chain reaction (PCR reaction. On the other hand, from five strains extracted by the boiling method, three did not feature the 849 bp band characteristic in Leptospira. We also evaluated by RAPD-PCR, DNAs from serovars isolated with proteinase K and proteinase 6870 with primers B11/B12. Each of the DNA samples provided PCR profiles in agreement with previous data. Moreover, the results with E6870 showed less background non-specific amplification, suggesting that removal of nucleases was more efficient with E6870. The limit for detection by PCR using Lep13/Lep14 was determined to be 10(2 leptospira, using the silver stain procedure.

  14. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  15. A disposable, continuous-flow polymerase chain reaction device: design, fabrication and evaluation.

    Ragsdale, Victoria; Li, Huizhong; Sant, Himanshu; Ameel, Tim; Gale, Bruce K

    2016-08-01

    Polymerase Chain Reaction (PCR) is used to amplify a specific segment of DNA through a thermal cycling protocol. The PCR industry is shifting its focus away from macro-scale systems and towards micro-scale devices because: micro-scale sample sizes require less blood from patients, total reaction times are on the order of minutes opposed to hours, and there are cost advantages as many microfluidic devices are manufactured from inexpensive polymers. Some of the fastest PCR devices use continuous flow, but they have all been built of silicon or glass to allow sufficient heat transfer. This article presents a disposable polycarbonate (PC) device that is capable of achieving real-time, continuous flow PCR in a completely disposable polymer device in less than 13 minutes by thermally cycling the sample through an established temperature gradient in a serpentine channel. The desired temperature gradient was determined through simulations and validated by experiments which showed that PCR was achieved. Practical demonstration included amplification of foot-and-mouth disease virus (FMDV) derived cDNA. PMID:27393216

  16. Series DNA Amplification Using the Continuous-Flow Polymerase Chain Reaction Chip

    Joung, Seung-Ryong; Kang, Chi Jung; Kim, Yong-Sang

    2008-02-01

    We proposed a continuous-flow polymerase chain reaction (PCR) chip that can be used for series DNA amplification. The continuous-flow PCR chip has several advantages such as fast thermal cycling, series of amplifications, cost-effective fabrication, portability, and fluorescence detection. The continuous-flow PCR chip is composed of two parts namely poly(dimethylsiloxane) (PDMS) microchannel for sample injection and indium-tin-oxide (ITO) heater/glass chip for thermal cycling. The fabricated microchannel width and depth are 250 and 200 µm, respectively. Also, the total working length of the PDMS microchannel is 1340 mm which is equivalent for 20 cycles of amplification. A 2:2:3 microchannel length ratio for three different temperature zones namely denaturation, annealing, and extension was assigned, respectively. Upon the operation of the fabricated continuous-flow PCR chip, the amplification of plasmid DNA pKS-GFP with 720 base pairs and PG-noswsi with 300 base pairs were found successfully with a total reaction time of 15 min.

  17. Real-time polymerase chain reaction for diagnosis and quantitation of negative strand of chikungunya virus.

    Chiam, Chun Wei; Chan, Yoke Fun; Loong, Shih Keng; Yong, Sara Su Jin; Hooi, Poh Sim; Sam, I-Ching

    2013-10-01

    Quantitative real-time polymerase chain reaction (qRT-PCR) is useful for diagnosis and studying virus replication. We developed positive- and negative-strand qRT-PCR assays to detect nsP3 of chikungunya virus (CHIKV), a positive-strand RNA alphavirus that causes epidemic fever, rash, and arthritis. The positive- and negative-strand qRT-PCR assays had limits of quantification of 1 and 3 log10 RNA copies/reaction, respectively. Compared to a published E1 diagnostic assay using 30 laboratory-confirmed clinical samples, the positive-strand nsP3 qRT-PCR assay had higher R(2) and efficiency and detected more positive samples. Peak viral load of 12.9 log(10) RNA copies/mL was reached on day 2 of illness, and RNA was detectable up to day 9, even in the presence of anti-CHIKV IgM. There was no correlation between viral load and persistent arthralgia. The positive-strand nsP3 assay is suitable for diagnosis, while the negative-strand nsP3 assay, which uses tagged primers to increase specificity, is useful for study of active viral replication kinetics. PMID:23886793

  18. Estimation and Preparation of the Hypervariable Regions I/II Templates for Mitochondrial DNA Typing From Human Bones and Teeth Remains Using Singleplex Quantitative Polymerase Chain Reaction.

    Le, Thien Ngoc; Van Phan, Hieu; Dang, Anh Tuan Mai; Nguyen, Vy Thuy

    2016-09-01

    A method was designed for estimating and sequencing of mitochondrial DNA (mtDNA) that effectively and more quickly provides a complete mtDNA profile. In this context, we have developed this novel strategy for typing mtDNA from 10 bones and teeth remains (3 months to 44 years). The quantification of mtDNA was achieved by singleplex real-time polymerase chain reaction of the hypervariable region I fragment (445 bp) and hypervariable region II fragment (617 bp). Combined with the melting curve analysis, we have determined as little as 10 pg of mtDNA template that is suitable for sequence analysis. Furthermore, quantitative polymerase chain reaction products were directly used for following step of mtDNA typing by Sanger sequencing. This method allows the profile to be completely provided for faster human identification. PMID:27356010

  19. Researches on Risk Evaluation of Green Agro-product Closed Supply Chain

    2011-01-01

    Closed supply chain is a superior form of management model of chain supply and an effective means of improving the modernization of agro-product circulation. Based on the research results of the current literatures on supply chain risk and agro-product supply chain, related subjects of the agro-product closed supply chain involving production, management and consumption are studied and analyzed and the primary risking factors in the supply chain system are classified as environmental risk, system risk, information risk, management risk and quality risk. Risk of agro-product closed supply chain is evaluated by using the method of fuzzy comprehensive evaluation and the values are acquired. The result shows that risk of agro-product closed supply chain is moderate with relatively high risk, which basically accords with the present actual situations. It can be seen from the index weights of various levels that the key first-level indices influencing the risks are system risk, information risk, quality and safety risk and the key second-level are the coordinating and controlling ability of core enterprises, the implementation of information traceability and the construction of quality safety system. Therefore, risk of agro-product closed supply chain should be reduced by taking prevention and controlling measures mainly from these aspects.

  20. HEALTH CONCERNS ON FISHERY PRODUCTS: ANTIBIOTIC RESISTANCE AND PARASITE RISK ASSESSMENT IN FISH PRODUCTION VALUE CHAINS

    Smaldone, Giorgio

    2014-01-01

    Capture fisheries and aquaculture supplied the world with about 148 million tonnes of fish in 2010, of which about 128 million tonnes were utilized as food for people. The fishery market is becoming much more complex and stratified, with greater diversification among species and product forms and for this reason food safety remains a major concern facing the seafood industry. Along fish value chain there are a lot of concern regarding public health and for this reason the aim of this work was...

  1. Engineering Yarrowia lipolytica for production of medium-chain fatty acids.

    Rutter, Charles D; Zhang, Shuyan; Rao, Christopher V

    2015-09-01

    Lipids are naturally derived products that offer an attractive, renewable alternative to petroleum-based hydrocarbons. While naturally produced long-chain fatty acids can replace some petroleum analogs, medium-chain fatty acid would more closely match the desired physical and chemical properties of currently employed petroleum products. In this study, we engineered Yarrowia lipolytica, an oleaginous yeast that naturally produces lipids at high titers, to produce medium-chain fatty acids. Five different acyl-acyl carrier protein (ACP) thioesterases with specificity for medium-chain acyl-ACP molecules were expressed in Y. lipolytica, resulting in formation of either decanoic or octanoic acid. These novel fatty acid products were found to comprise up to 40 % of the total cell lipids. Furthermore, the reduction in chain length resulted in a twofold increase in specific lipid productivity in these engineered strains. The medium-chain fatty acids were found to be incorporated into all lipid classes. PMID:26129951

  2. Resonance production in γγ reactions

    Experimental results on the exclusive production of resonances in γγ collisions are reviewed. These include new measurements of the radiative widths of the pseudoscalar (eta,eta') and the tensor mesons (f, A2, f'). A comparison of these results with SU(3) is made. Upper limits for other states than f in γγ -> ππ are given. The searches for γγ production of the states iota and theta as well as etasub(c) are presented and upper limits are given. Finally a limit is given for the rare decay f -> π+π-2π0. (orig.)

  3. Operating Analysis of the Closed Supply Chain of Green Agricultural Products Based on Logistics Center

    2010-01-01

    This thesis gives the overview of concept and constitution of the closed supply chain of green agricultural products based on logistics center,and the necessity of regarding logistics center as core enterprise.Meanwhile,it analyzes the function of logistics center of agricultural products,namely functions of exchange,collection,distribution,storage and transportation.It also poses the prerequisites of logistics center.The logistics center of agricultural products must have stable profit expectancy,prominent scale,strong appealing power,capacity of bearing market risk and basic thoughts of supply chain management.The functional design of the closed supply chain of green agricultural products has been discussed in 5 aspects,namely logistics center,production base,providers of means of production,retailer and consumer.The operating thoughts of the closed supply chain of green agricultural products based on logistics center are put forward on the basis of the research of operating objective and service target of supply chain as follows:first,based on local principal agricultural products,the logistics center mainly distributes the massed agricultural products;second,it is necessary to choose appropriate strategic cooperative partners to sign contract;third,the operating procedure of supply chain entails bringing in professional managerial talents of supply chain;finally,the relationships of supply chain should be maintained.

  4. A product study of the isoprene+NO3 reaction

    A. Hansel

    2009-02-01

    Full Text Available Oxidation of isoprene through reaction with NO3 is a significant sink for isoprene that persists after dark. The products of the reaction are multifunctional nitrates. These nitrates constitute a significant NOx sink in the nocturnal boundary layer and they likely play an important role in formation of secondary organic aerosol. Products of the isoprene+NO3 reaction will, in many locations, be abundant enough to affect nighttime radical chemistry and to persist into daytime where they may represent a source of NOx. Product formation in the isoprene+NO3 reaction was studied in a smog chamber at Purdue University. Isoprene nitrates and other hydrocarbon products were observed using Proton Transfer Reaction-Mass Spectrometry (PTR-MS and reactive nitrogen products were observed using Thermal Dissociation–Laser Induced Fluorescence (TD-LIF. The organic nitrate yield is found to be 62±6% and the combined yield of MACR+MVK is found to be ~10%. Additional hydrocarbon products, thought to be primarily C4 and C5 carbonyl compounds, were observed by the PTR-MS at various m/z ratios and their yields quantified. These other oxidation products are used as additional constraints on the reaction mechanism.

  5. A product study of the isoprene+NO3 reaction

    R. C. Cohen

    2009-07-01

    Full Text Available Oxidation of isoprene through reaction with NO3 radicals is a significant sink for isoprene that persists after dark. The main products of the reaction are multifunctional nitrates. These nitrates constitute a significant NOx sink in the nocturnal boundary layer and they likely play an important role in formation of secondary organic aerosol. Products of the isoprene+NO3 reaction will, in many locations, be abundant enough to affect nighttime radical chemistry and to persist into daytime where they may represent a source of NOx. Product formation in the isoprene + NO3 reaction was studied in a smog chamber at Purdue University. Isoprene nitrates and other hydrocarbon products were observed using Proton Transfer Reaction-Mass Spectrometry (PTR-MS and reactive nitrogen products were observed using Thermal Dissociation–Laser Induced Fluorescence (TD-LIF. The organic nitrate yield is found to be 65±12% of which the majority was nitrooxy carbonyls and the combined yield of methacrolein and methyl vinyl ketone (MACR+MVK is found to be ∼10%. PTR-MS measurements of nitrooxy carbonyls and TD-LIF measurements of total organic nitrates agreed well. The PTR-MS also observed a series of minor oxidation products which were tentatively identified and their yields quantified These other oxidation products are used as additional constraints on the reaction mechanism.

  6. Products of the Benzene + O(3P) Reaction

    Taatjes, Craig A.; Osborn, David L.; Selby, Talitha M.; Meloni, Giovanni; Trevitt, Adam J.; Epifanovsky, Evgeny; Krylov, Anna I.; Sirjean, Baptiste; Dames, Enoch; Wang, Hai

    2009-12-21

    The gas-phase reaction of benzene with O(3P) is of considerable interest for modeling of aromatic oxidation, and also because there exist fundamental questions concerning the prominence of intersystem crossing in the reaction. While its overall rate constant has been studied extensively, there are still significant uncertainties in the product distribution. The reaction proceeds mainly through the addition of the O atom to benzene, forming an initial triplet diradical adduct, which can either dissociate to form the phenoxy radical and H atom, or undergo intersystem crossing onto a singlet surface, followed by a multiplicity of internal isomerizations, leading to several possible reaction products. In this work, we examined the product branching ratios of the reaction between benzene and O(3P) over the temperature range of 300 to 1000 K and pressure range of 1 to 10 Torr. The reactions were initiated by pulsed-laser photolysis of NO2 in the presence of benzene and helium buffer in a slow-flow reactor, and reaction products were identified by using the multiplexed chemical kinetics photoionization mass spectrometer operating at the Advanced Light Source (ALS) of Lawrence Berkeley National Laboratory. Phenol and phenoxy radical were detected and quantified. Cyclopentadiene and cyclopentadienyl radical were directly identified for the first time. Finally, ab initio calculations and master equation/RRKM modeling were used to reproduce the experimental branching ratios, yielding pressure-dependent rate expressions for the reaction channels, including phenoxy + H, phenol, cyclopentadiene + CO, which are proposed for kinetic modeling of benzene oxidation.

  7. Micromachined polymerase chain reaction system for multiple DNA amplification of upper respiratory tract infectious diseases.

    Liao, Chia-Sheng; Lee, Gwo-Bin; Wu, Jiunn-Jong; Chang, Chih-Ching; Hsieh, Tsung-Min; Huang, Fu-Chun; Luo, Ching-Hsing

    2005-01-15

    This paper presents a micro polymerase chain reaction (PCR) chip for the DNA-based diagnosis of microorganism genes and the detection of their corresponding antibiotic-resistant genes. The micro PCR chip comprises cheap biocompatible soda-lime glass substrates with integrated thin-film platinum resistors as heating/sensing elements, and is fabricated using micro-electro-mechanical-system (MEMS) techniques in a reliable batch-fabrication process. The heating and temperature sensing elements are made of the same material and are located inside the reaction chamber in order to ensure a uniform temperature distribution. This study performs the detection of several genes associated with upper respiratory tract infection microorganisms, i.e. Streptococcus pneumoniae, Haemopilus influenze, Staphylococcu aureus, Streptococcus pyogenes, and Neisseria meningitides, together with their corresponding antibiotic-resistant genes. The lower thermal inertia of the proposed micro PCR chip relative to conventional bench-top PCR systems enables a more rapid detection operation with reduced sample and reagent consumption. The experimental data reveal that the high heating and cooling rates of the system (20 and 10 degrees C/s, respectively) permit successful DNA amplification within 15 min. The micro PCR chip is also capable of performing multiple DNA amplification, i.e. the simultaneous duplication of multiple genes under different conditions in separate reaction wells. Compared with the large-scale PCR system, it is greatly advantageous for fast diagnosis of multiple infectious diseases. Multiplex PCR amplification of two DNA segments in the same well is also feasible using the proposed micro device. The developed micro PCR chip provides a crucial tool for genetic analysis, molecular biology, infectious disease detection, and many other biomedical applications. PMID:15590288

  8. EPR and NMR detection of transient radicals and reaction products

    Magnetic resonance methods in radiation chemistry are illustrated. The most recent developments in pulsed EPR and NMR studies in pulse radiolysis are outlined with emphasis on the study of transient radicals and their reaction products. 12 figures

  9. Game Analysis and Countermeasures on Increasing Prices of Agricultural Products under Triple Supply Chain

    2011-01-01

    From the perspective of supply chain of agricultural products,by establishing Stackelberg game model based on triple supply chain,this paper researches the price formation and profit distribution mechanism of agricultural products under circumstance of non-cooperation and cooperation.The results show the main factors responsible for the hiking of prices of agricultural products as follows:the cost of agricultural products climbs incessantly;the circulation cost hovers at high level;the factor inputs of agricultural products are short;inflation pressure is incessantly mounting;the profit distribution of supply chain is irrational.Finally,corresponding countermeasures are put forward.

  10. Pion Production in High-Energy Neutrino Reactions with Nuclei

    Mosel, Ulrich

    2015-01-01

    [Background] A quantitative understanding of neutrino interactions with nuclei is needed for precision era neutrino long baseline experiments (MINOS, NOvA, LBNE) which all use nuclear targets. Pion production is the dominant reaction channel at the energies of these experiments. [Purpose] Investigate the influence of nuclear effects on neutrino-induced pion production cross sections and compare predictions for pion-production with available data. [Method] The Giessen Boltzmann--Uehling--Uhlenbeck (GiBUU) model is used for the description of all incohrent channels in neutrino-nucleus reactions. [Results] Differential cross sections for charged and neutral pion production for the MINER$\

  11. The Heck reaction in the production of fine chemicals

    Vries, Johannes G. de

    2001-01-01

    An overview is given of the use of the Heck reaction for the production of fine chemicals. Five commercial products have been identified that are produced on a scale in excess of 1 ton/year. The herbicide Prosulfuron™ is produced via a Matsuda reaction of 2-sulfonatobenzenediazonium on 3,3,3-trifluoropropene. The sunscreen agent 2-ethylhexyl p-methoxy-cinnamate has been produced on pilot scale using Pd/C as catalyst. Naproxen™ is produced via the Heck reaction of 2-bromo-6-methoxy-naphthalene...

  12. Immersion-histo polymerase chain reaction: a practical tool for visualization of single-copy genes in tissue sections.

    L. Pan; Diss, T C; Peng, H.; Isaacson, P G

    1997-01-01

    A method, immersion-histo polymerase chain reaction (IH-PCR), was developed for visualization of single-copy DNA sequences in cells in paraffin-embedded tissue sections. Sections were mounted on coverslips, cut into small pieces, and immersed in reaction mixtures in micro-tubes for specific DNA amplification using a conventional thermal cycler. This was followed by in situ hybridization, in micro-tubes, with PCR-generated, digoxigenin-labeled probes. Epstein-Barr virus, chromosomal translocat...

  13. Early diagnosis of primary human herpesvirus 6 infection in childhood: Serology, polymerase chain reaction, and virus load

    Chiu, SS; Peiris, M.; Tse, CYC; Cheung, CY

    1998-01-01

    Qualitative and quantitative polymerase chain reaction (PCR) for human herpesvirus 6 (HHV-6) DNA in whole blood and plasma was correlated with serology and clinical assessment in 143 children hospitalized for undifferentiated febrile illness to evaluate options for diagnosis of primary HHV-6 infection on the acute blood specimen. PCR and serology for HHV-7 were done in parallel to define serologic cross-reactions. Using HHV-6 seroconversion as the reference standard, detection of HHV-6 DNA in...

  14. Greenhouse gas emissions in milk and dairy product chains: Improving the carbon footprint of dairy products

    Flysjoe, A.M.

    2012-11-01

    The present PhD project has focused on some of the most critical methodological aspects influencing GHG emission estimates of milk and dairy products and how the methodology can be improved. In addition, the Carbon Footprint (CF) for different types of dairy products has been analysed. Based on these results, mitigation options have been identified along the entire dairy value chain. The key methodological challenges analysed in the present study are: estimation of CH{sub 4} and N{sub 2}O emissions, assessment of CO{sub 2} emissions from land use change (LUC), co-product handling, and definition of the functional unit. Estimates of the biogenic emissions CH{sub 4} and N{sub 2}O are associated with large uncertainties due to the complexity and natural variation in biological processes. Accounting for these variations resulted in a {+-}30-50% variation in the CF for milk in Sweden and New Zealand (excluding emissions from LUC). The inclusion of emissions from LUC can drastically affect the CF of dairy products, and different models can even provide contradictory results. Thus, it is suggested that emissions associated with LUC are reported separately and that underlying assumptions are clearly explained. Accounting for the by-product beef is decisive for the CF of milk, and when designing future strategies for the dairy sector, milk and meat production needs to be addressed in an integrated approach. It is shown that an increase in milk yield per cow does not necessarily result in a lower CF of milk, when taking into account the alternative production of the by-product beef. This demonstrates that it is important to investigate interactions between different product chains, i.e. to apply system thinking. The CF of dairy products from Arla Foods analysed in the present study range from: 1.2-5.5 kg CO{sub 2}e per kg fresh dairy products, 7.3-10.9 kg CO{sub 2}e per kg butter and butter blends, 4.5-9.9 kg CO{sub 2}e per kg cheese, and 1.0-17.4 kg CO{sub 2}e per kg milk

  15. Game Analysis and Countermeasures on Increasing Prices of Agricultural Products under Triple Supply Chain

    Liu, Tao

    2011-01-01

    From the perspective of supply chain of agricultural products, by establishing Stackelberg game model based on triple supply chain, this paper researches the price formation and profit distribution mechanism of agricultural products under circumstance of non-cooperation and cooperation. The results show the main factors responsible for the hiking of prices of agricultural products as follows: the cost of agricultural products climbs incessantly; the circulation cost hovers at high level; the ...

  16. An amplified electrochemical aptasensor based on hybridization chain reactions and catalysis of silver nanoclusters

    Chen, Ling; Sha, Liang; Qiu, Yuwei; Wang, Guangfeng; Jiang, Hong; Zhang, Xiaojun

    2015-02-01

    In the present study, based on the mimic oxidase catalytic character of nucleic-acid-stabilized silver nanoclusters (DNA/AgNCs) and hybridization chain reactions for signal amplification, the fabrication of a label-free sensitive ``turn-on'' electrochemical aptasensor for the amplified determination of lysozyme was demonstrated. First, the designed DNA duplex was modified on the electrode. With the specific binding of the target, lysozyme and its aptamer, the lysozyme-binding DNA sequence was liberated, exposing the induced DNA sequence, which in turn triggered the formation of the supersandwich DNA structure. Because the cytosine-rich sequence was designed ingeniously on the DNA sequence, DNA/AgNCs were formed on the supersandwich DNA structure. The peroxidase-like character of DNA/AgNCs produced detectable electrochemical signals for the lysozyme aptasensor, which showed a satisfying sensitive detection of lysozyme with a low detection limit of 42 pM and a wide linear range of 10-10 M to 10-5 M.In the present study, based on the mimic oxidase catalytic character of nucleic-acid-stabilized silver nanoclusters (DNA/AgNCs) and hybridization chain reactions for signal amplification, the fabrication of a label-free sensitive ``turn-on'' electrochemical aptasensor for the amplified determination of lysozyme was demonstrated. First, the designed DNA duplex was modified on the electrode. With the specific binding of the target, lysozyme and its aptamer, the lysozyme-binding DNA sequence was liberated, exposing the induced DNA sequence, which in turn triggered the formation of the supersandwich DNA structure. Because the cytosine-rich sequence was designed ingeniously on the DNA sequence, DNA/AgNCs were formed on the supersandwich DNA structure. The peroxidase-like character of DNA/AgNCs produced detectable electrochemical signals for the lysozyme aptasensor, which showed a satisfying sensitive detection of lysozyme with a low detection limit of 42 pM and a wide linear

  17. Electromagnetic separators for recoiling reaction products

    This chapter describes the use of magnetic spectrometers and spectrographs, recoil mass spectrometers, and velocity filters as standard tools in many heavy-ion investigations. Topics considered include ion optics, examples of recoil selectors with static fields (the SHIP, the MIT-BNL energy-mass spectrometer, the MIT-BNL recoil-mass selector, the recoil-mass spectrometer at Michigan State University, the recoil-mass spectrometer at the University of Rochester, the Daresbury recoil separator, the MIT-ORNL recoil-mass selector), examples of recoil selectors with RF fields (the Munich RF separator, an RF separator proposed for GSI), magnetic spectrometers combined with time of flight (the GSI spectrometer, mirror-symmetric magnetic spectrometers), spectrometers for spallation products (the BEVALAC spectrometers, a proposed time-of-flight spectrometer for LAMPF), and technical aspects of electromagnetic separators (electric-field limitations, beam scattering)

  18. Use of Polymerase Chain Reaction Enzyme Linked Oligonucleotide Sorbent Assay (Pcr-Elosa for Detection of Disease Agents

    Simson Tarigan

    2016-03-01

    Full Text Available Diagnostic tool comprises one of the vital components in the control of infectious diseases. One of the most common techniques in the diagnosis of infectious disease currently available is the polymerase chain reaction (PCR because this technique is very sensitive, specific, and rapid. This technique requires an adjunct technique to indicate the formation of the right reaction product. Agarose gel electrophoresis has been the most common technique to visualise the PCR product or amplicon. Enzyme linked oligonucleotide sorbent assay (ELOSA is an alternative technique which is more sensitive and gives more important identity of the amplicon. This technique can be more than 100 times as sensitive as a gel agarose electrophoresis, and very specific since confirmation of the amplicon is carried out by DNA hibridisation. The capacity of the ELOSA can also be extended to the detection of disease-causal agent at subtype level, or detection of mutation at particular location in a gene. Since the equipment used for ELOSA is similar to that for ELISA (enzyme linked immunosorbent assay, a large number of samples can be accomplished rapidly. As in ELISA, a number of variation can be made in ELOSA depend on the requirement. Nucleotide can be immobilised on the microwell plate either by passive adsorbtion, by first conjugation of nucleotide with biotin then immobilisation on streptavidin-coated microwell plate, or immobilisaion by covalent bonding. The PCR and ELOSA can be performed at separate or in a single tube by first immobilising the PCR primers on the surface of microwell plates.

  19. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    Abdulmawjood, A.; Bulte, M.; Roth, S.; Schonenbrucher, H.; Cook, N.; Heuvelink, A.E.; Hoorfar, Jeffrey

    2004-01-01

    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select...

  20. Identification of related DNA sequences in Borrelia burgdorferi and two strains of Leptospira interrogans by using polymerase chain reaction.

    Kron, M A; Gupta, A; Mackenzie, C. D.

    1991-01-01

    The suitability of a polymerase chain reaction assay for Borrelia burgdorferi in epidemiological studies of infected tick populations was evaluated by using 28 strains of Leptospira interrogans and lysates of fixed adult Ixodes tick tissues. Two false positives representing leptospires were differentiated from B. burgdorferi by using an oligonucleotide probe.

  1. A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

    A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

  2. Quantitation of RHD by real-time polymerase chain reaction for determination of RHD zygosity and RHD mosaicism/chimerism

    Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld

    2007-01-01

    Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage...

  3. Detection of human immunodeficiency virus DNA in cultured human glial cells by means of the polymerase chain reaction

    Teglbjærg, Lars Stubbe; Hansen, J-ES; Dalbøge, H;

    1991-01-01

    This report describes the use of the polymerase chain reaction (PCR) for the detection of viral genomic sequences in latently infected cells. Infection with human immunodeficiency virus in cultures of human glial cells was demonstrated, using nucleic acid amplification followed by dot blot hybrid...... where viral replication is absent, or where genomic copies are present at such low numbers that they are otherwise undetectable....

  4. Evaluation of a multiplex real-time polymerase chain reaction assay for the detection of influenza and respiratory syncytial viruses.

    Esposito, Susanna; Scala, Alessia; Tagliabue, Claudia; Zampiero, Alberto; Bianchini, Sonia; Principi, Nicola

    2016-01-01

    Nasopharyngeal swabs from 424 children were used to compare the performances of the new multiplex real-time polymerase chain reaction (RT-PCR) RIDA®GENE Flu & RSV kit and monospecific RT-PCR assays in detecting respiratory syncytial and influenza viruses. The easy-to-use kit was highly sensitive and specific and is recommended for routine practice. PMID:26458277

  5. Evaluation of Amplification Targets for the Specific Detection of Bordetella pertussis Using Real-Time Polymerase Chain Reaction

    Mohammad Rubayet Hasan

    2014-01-01

    Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.

  6. Testing vaccines in human experimental malaria: statistical analysis of parasitemia measured by a quantitative real-time polymerase chain reaction.

    Hermsen, C.C.; Vlas, S.J. de; Gemert, G.J.A. van; Telgt, D.S.C.; Verhage, D.F.; Sauerwein, R.W.

    2004-01-01

    Clinical trials are an essential step in evaluation of safety and efficacy of malaria vaccines, and human experimental malaria infections have been used for evaluation of protective immunity of Plasmodium falciparum malaria. In this study, a quantitative real-time polymerase chain reaction was used

  7. Diagnosis of ventricular drainage-related bacterial meningitis by broad-range real-time polymerase chain reaction

    Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper;

    2007-01-01

    OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR-BM). M...

  8. Pooling of porcine fecal samples for quantification of Lawsonia intracellularis by real-time polymerase chain reaction

    Pedersen, Ken Steen; Johansen, Markku; Jorsal, Sven Erik Lind;

    2014-01-01

    obtained by averaging test results from individual fecal samples in relation to a quantitative polymerase chain reaction (qPCR) test for Lawsonia intracellularis. Ten diarrheic and 10 normal fecal samples were submitted from each of 43 Danish swine herds (n = 860 fecal samples). Pools (n = 43), each...

  9. Duff reaction on phenols: Characterization of non steam volatile products

    Wahidullah, S.; DeSouza, L.; Bhattacharya, J.

    New products having structures 1 and 2 have been characterized in the Duff reaction thymol arid carvacrol. These products have been identified as 2.6'-dithymylmethane 1 and 5.5' -dicarvacryl methane 2 respectively on the basis of spectral data...

  10. The need for integration in the supply chain of vegetable production

    Deleuran, Lise Christina; Jelsøe, Erling; Boelt, Birte

    2008-01-01

    One of the challenges in food production is to ensure sufficient food and feed globally. In order to overcome food shortages there is a current need for a better integration in the supply chain of food production and inclusion of an overlooked issue in many supply chains - the availability of...... quality seed. Quality seed also creates the base for quality products which is of increasing interest for the conscious consumers. In all, varying reasons for looking further into how supply chains function. The supply chain within vegetables is represented by seed producers, seed companies, salad....../vegetable producers, retailers/supermarkets and consumers. The various actors of the chain, as well as external actors like media, regulators and politicians, influence product quality from different points of view. Economic factors play a significant role for quality management. Furthermore, the concept of quality...

  11. Overcoming RNA inhibition in the fluorescent polymerase chain reaction assay to enhance detection of bovine DNA in cattle feeds.

    Sawyer, Mary; Rensen, Gabriel; Smith, Wayne; Yee, Melanie; Wong, Alice; Osburn, Bennie; Cullor, James

    2004-01-01

    The practice of incorporating mammalian protein in ruminant feeds was banned in the United States in 1997 as a measure to avoid transmission of bovine spongiform encephalopathy (BSE). A sensitive means of identifying the banned additives in feeds would be by detection of species-specific DNA using the polymerase chain reaction (PCR). However, problems may arise in the PCR due to the presence of inhibitory substances. Using human DNA as an internal PCR control, inhibitory substances were evident in the DNA extraction products of cattle feeds. The results of heating experiments excluded enzymes as a cause of inhibition, and spectrophotometric calculations suggested the possibility of RNA contamination. Co-electrophoresis of untreated and RNAse digested extracts confirmed the presence of RNA in the undigested product. Seven cattle feeds were spiked with predetermined amounts of bovine meat and bone meal (BMBM). The DNA extracted products were treated with RNAse and the bovine specific mitochondrial DNA (B-mtDNA) was amplified by PCR. The minimum level of detection of B-mtDNA was influenced by RNAse treatment and feed composition. RNAse treatment decreased false-negative results overall by 75%. False-negative results were decreased 100% in the higher BMBM concentrations and 50% in the lower BMBM concentrations. Also, each cattle feed was spiked to attain a 2% wt/wt concentration with each swine, fish, sheep, or poultry product, or cattle dried blood. Amplification of B-mtDNA occurred only with the cattle dried blood and only in three feeds in which B-mtDNA was detected at the only level tested (2%). A commercial immunochromotographic assay (Neogen) detected the spiked BMBM in only one of the seven feeds and only at the upper concentration (1%). PMID:15992269

  12. Modeling the Manipulation of Natural Populations by the Mutagenic Chain Reaction.

    Unckless, Robert L; Messer, Philipp W; Connallon, Tim; Clark, Andrew G

    2015-10-01

    The use of recombinant genetic technologies for population manipulation has mostly remained an abstract idea due to the lack of a suitable means to drive novel gene constructs to high frequency in populations. Recently Gantz and Bier showed that the use of CRISPR/Cas9 technology could provide an artificial drive mechanism, the so-called mutagenic chain reaction (MCR), which could lead to rapid fixation of even a deleterious introduced allele. We establish the near equivalence of this system to other gene drive models and review the results of simple models showing that, when there is a fitness cost to the MCR allele, an internal equilibrium may exist that is usually unstable. In this case, introductions must be at a frequency above this critical point for the successful invasion of the MCR allele. We obtain estimates of fixation and invasion probabilities for the appropriate scenarios. Finally, we discuss how polymorphism in natural populations may introduce sources of natural resistance to MCR invasion. These modeling results have important implications for application of MCR in natural populations. PMID:26232409

  13. Improvement of Temperature Uniformity for Polymerase Chain Reaction Chip with Heat Spreader

    Chen, Rong-Sheng; Mao, Chao-Yang; Chen, Yung-Shieng

    2007-11-01

    For polymerase chain reaction (PCR) applications, a uniform temperature field in the microreactor is crucial. In this paper, we report on the electrothermal and computational fluid dynamics (CFD) simulations performed with the aim of optimizing the temperature distribution by heat spreaders for PCR application. Firstly, the equivalent resistivity of the microresistor heater is evaluated, and a conformable result is then verified by comparing with the experimental result using a prototype PCR chip. Secondly, the temperature distribution at 94 °C in the PCR chip is investigated. Furthermore, a heat spreader is inserted into the PCR chip to reduce the temperature difference in the DNA sample and thus improve the temperature uniformity effectively. The results demonstrated that the effective volume percentage and the energy consumption in the chamber are positively related to the thickness of the heat spreader, while the temperature difference is inversely related to the thickness of the heat spreader. Finally, the (b)-design is better than the (a)-design in terms of both the increase in effective volume percentage of the DNA sample and the decrease in energy consumption. In other words, the (b)-design is recognized as having better temperature uniformity.

  14. Non-detection of Chlamydia trachomatis infection by polymerase chain reaction in pregnant Iranian women

    Parvin Hassanzadeh

    2012-03-01

    Full Text Available Chlamydia trachomatis is the most common cause of sexually transmitted infection. In 75% of women and 50% of men infection is asymptomatic. According to World Health Organization reports, the number of new genital infections with Chlamydia trachomatis reaches 100 million annually. The sensitivity and specificity of nacid amplification tests are 95% and 99%, respectively. Urine samples can provide a non-invasive method of testing for the detection of Chlamydia trachomatis by polymerase chain reaction (PCR. The aim of this study was to evaluate the prevalence of Chlamydia trachomatis infection in pregnant women referred to a teaching hospital affiliated to Shiraz University of Medical Sciences. Urine samples were obtained from 210 pregnant women and investigated microscopically and macroscopically by urinalysis. Precipitants were also used for DNA extraction and PCR test for detecting Chlamydia trachomatis. Among 210 urine specimens from women aged 15-39 years, none were positive for Chlamydia trachomatis by PCR. In spite of the high sensitivity and specificity of PCR, and the elimination of inhibitory effects on PCR test, no pregnant woman was positive for Chlamydia trachomatis. Here, we suggest that a larger sample should be studied and other sensitive methods could also be used in the future.

  15. Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens

    Adriana Antônia da Cruz Furini

    2013-12-01

    Full Text Available OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens.METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results.RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard, we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively.CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis.

  16. Identification of Entamoeba histolytica and E. dispar cysts in stool by polymerase chain reaction.

    Sanuki, J; Asai, T; Okuzawa, E; Kobayashi, S; Takeuchi, T

    1997-01-01

    An attempt to identify cysts of Entamoeba histolytica and E. dispar in human stool was conducted by polymerase chain reaction (PCR) using two sets of primers (p11 plus p12 and p13 plus p14) specific for either species of ameba. The cysts in stool specimens obtained from 12 infected individuals were concentrated, freeze-thawed, and treated with Triton X-100 before their examination by PCR. The results of PCR on the cysts were generally consistent with data obtained by PCR on ameba trophozoites hatched from the cysts, by zymodeme analysis, and by enzyme-linked immunosorbent assay (ELISA) and with clinical findings. This PCR was negative for the stool containing large numbers of cysts of either E. coli, E. hartmanni, or Giardia lamblia as well as for the stool specimens obtained from uninfected individuals. The ameba cyst in stool processed using the present method was effective for the PCR analysis even after 1 month of storage at 4 degrees C. The present PCR was sensitive enough to detect ten cysts of either of the amebae. PMID:9000244

  17. Three sample preparation protocols for polymerase chain reaction based detection of Cryptosporidium parvum in environmental samples.

    Kostrzynska, M; Sankey, M; Haack, E; Power, C; Aldom, J E; Chagla, A H; Unger, S; Palmateer, G; Lee, H; Trevors, J T; De Grandis, S A

    1999-02-01

    Cryptosporidium parvum is a protozoan parasite responsible for an increasing number of outbreaks of gastrointestinal illness worldwide. In this report, we describe development of sample preparation protocols for polymerase chain reaction (PCR)-based detection of C. parvum in fecal material and environmental water samples. Two of these methods were found adequate for isolation of Cryptosporidium DNA from filtered water pellet suspensions. The first involved several filtration steps, immunomagnetic separation and freeze-thaw cycles. The second method involved filtration, addition of EnviroAmp lysis reagent, freeze-thaw cycles and precipitation of the DNA with isopropanol. Using nested PCR, we detected 100 oocysts/ml of filtered water pellet suspension, with either of the above sample preparation procedures. Nested PCR increased sensitivity of the assay by two to three orders of magnitude as compared to the primary PCR. The detection limit for seeded fecal samples was 10-fold higher than for filtered environmental water pellet suspension. Nested PCR results showed 62.4 and 91.1% correlation with immunofluorescence assay (IFA) for fecal samples and filtered environmental water pellet suspensions, respectively. This correlation decreased to 47.2% and 44.4%, respectively, when only IFA positive samples were analyzed. However, in fecal samples contaminated with a high number (> 10(5)/g) of C. parvum oocysts, this correlation was 100%. PMID:10076632

  18. Alkyl chain length-dependent surface reaction of dodecahydro-N-alkylcarbazoles on Pt model catalysts

    Gleichweit, Christoph; Amende, Max; Bauer, Udo; Schernich, Stefan; Höfert, Oliver; Lorenz, Michael P. A.; Zhao, Wei; Bachmann, Philipp; Papp, Christian, E-mail: christian.papp@fau.de [Lehrstuhl für Physikalische Chemie II, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Müller, Michael; Koch, Marcus [Lehrstuhl für Chemische Reaktionstechnik, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Wasserscheid, Peter [Lehrstuhl für Chemische Reaktionstechnik, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Erlangen Catalysis Resource Center, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Libuda, Jörg; Steinrück, Hans-Peter [Lehrstuhl für Physikalische Chemie II, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Erlangen Catalysis Resource Center, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany)

    2014-05-28

    The concept of liquid organic hydrogen carriers (LOHC) holds the potential for large scale chemical storage of hydrogen at ambient conditions. Herein, we compare the dehydrogenation and decomposition of three alkylated carbazole-based LOHCs, dodecahydro-N-ethylcarbazole (H{sub 12}-NEC), dodecahydro-N-propylcarbazole (H{sub 12}-NPC), and dodecahydro-N-butylcarbazole (H{sub 12}-NBC), on Pt(111) and on Al{sub 2}O{sub 3}-supported Pt nanoparticles. We follow the thermal evolution of these systems quantitatively by in situ high-resolution X-ray photoelectron spectroscopy. We show that on Pt(111) the relevant reaction steps are not affected by the different alkyl substituents: for all LOHCs, stepwise dehydrogenation to NEC, NPC, and NBC is followed by cleavage of the C–N bond of the alkyl chain starting at 380–390 K. On Pt/Al{sub 2}O{sub 3}, we discern dealkylation on defect sites already at 350 K, and on ordered, (111)-like facets at 390 K. The dealkylation process at the defects is most pronounced for NEC and least pronounced for NBC.

  19. Genotypic characterization by polymerase chain reaction of Staphylococcus aureus isolates associated with bovine mastitis.

    Ote, Isabelle; Taminiau, Bernard; Duprez, Jean-Noël; Dizier, Isabelle; Mainil, Jacques G

    2011-12-15

    Staphylococcus aureus is recognized worldwide as a pathogen causing many serious diseases in humans and animals, and is the most common aetiological agent of clinical and subclinical bovine mastitis. The importance of evaluating the combination of S. aureus virulence factors has been emphasized both in human and veterinary medicine, and knowledge about the genetic variability within different S. aureus populations would help in the design of efficient treatments. The aim of the present study was to determine the genetic profiles of S. aureus strains isolated from milk of cows suffering from clinical and subclinical mastitis in Belgium. The presence of about forty virulence-associated genes was investigated by specific polymerase chain reaction (PCR) amplification. A high number of genotypic subtypes were observed, demonstrating further the large variation in the presence of virulence genes in S. aureus isolates and the considerable diversity of strains populations that are able to cause mastitis in cows. In accordance with other studies, we showed that some genes are associated with mastitis-causing S. aureus isolates, whereas others are absent or rarely present. We also further highlighted the presence of conserved gene combinations, namely the enterotoxigenic egc-cluster and the bovine pathogenicity island SaPIbov. Importantly, the presence of isolates carrying genes coding for toxins involved in important human infections makes the milk of cows with mastitis a potential reservoir for these toxins, and therefore a potential danger in human health, which strengthens the importance to consider raw milk consumption and its processing very carefully. PMID:21708435

  20. Molecular identification of Amazonian stingless bees using polymerase chain reaction single-strand conformation polymorphism.

    Souza, M T; Carvalho-Zilse, G A

    2014-01-01

    In countries containing a mega diversity of wildlife, such as Brazil, identifying and characterizing biological diversity is a continuous process for the scientific community, even in face of technological and scientific advances. This activity demands initiatives for the taxonomic identification of highly diverse groups, such as stingless bees, including molecular analysis strategies. This type of bee is distributed in all of the Brazilian states, with the highest species diversity being found in the State of Amazônia. However, the estimated number of species diverges among taxonomists. These bees are considered the main pollinators in the Amazon rainforest, in which they obtain food and shelter; however, their persistence is constantly threatened by deforestation pressure. Hence, it is important to classify the number and abundance of bee specie, to measure their decline and implement meaningful, priority conservation strategies. This study aims to maximize the implementation of more direct, economic and successful techniques for the taxonomic identification of stingless bees. Specifically, the genes 16S rRNA and COI from mitochondrial DNA were used as molecular markers to differentiate 9 species of Amazonian stingless bees based on DNA polymorphism, using the polymerase chain reaction-single-strand conformation polymorphism technique. We registered different, exclusive SSCP haplotypes for both genes in all species analyzed. These results demonstrate that SSCP is a simple and cost-effective technique that is applicable to the molecular identification of stingless bee species. PMID:25117306

  1. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Tolardo, Aline Lavado; de Souza, William Marciel; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; de Araujo, Jansen; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; da Fonseca, Benedito Antonio Lopes; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes

    2016-01-01

    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  2. Detection of canine herpesvirus 1 in a wide range of tissues using the polymerase chain reaction.

    Burr, P D; Campbell, M E; Nicolson, L; Onions, D E

    1996-12-01

    Canine herpesvirus 1 (CHV-1), a member of the alphaherpesvirus sub-family, is known to cause fatal infections in litters of puppies and may also be involved in infertility, abortion, and stillbirths in adult dogs. The purpose of this study was to determine the presence of CHV-1 DNA using the polymerase chain reaction (PCR) in twelve key sites that have been associated with latency for the other herpesviruses. A 605 base pair portion of the viral glycoprotein B (gB) gene was amplified using degenerate primers, cloned, and sequenced. Conventional 20 mer primers were designed using this sequence information to amplify a 120 bp fragment of gB situated between the original degenerate primers. The specificity of amplification was confirmed by Southern Blot hybridisation using an internal oligonucleotide probe. DNA was extracted from tissue samples taken from twelve dogs at post mortem and from twenty-four blood samples. Nine out of twelve dogs showed evidence of infection with CHV-1; the tissues most commonly affected were lumbo-sacral ganglia (5/12 dogs), tonsil (5/12), parotid salivary gland (4/9), and liver (4/9). No positive results were detected within the twenty-four blood samples. These results indicate that exposure to CHV-1 may be much more common than previously suggested. PMID:9008334

  3. Hybridization chain reaction amplification for highly sensitive fluorescence detection of DNA with dextran coated microarrays.

    Chao, Jie; Li, Zhenhua; Li, Jing; Peng, Hongzhen; Su, Shao; Li, Qian; Zhu, Changfeng; Zuo, Xiaolei; Song, Shiping; Wang, Lianhui; Wang, Lihua

    2016-07-15

    Microarrays of biomolecules hold great promise in the fields of genomics, proteomics, and clinical assays on account of their remarkably parallel and high-throughput assay capability. However, the fluorescence detection used in most conventional DNA microarrays is still limited by sensitivity. In this study, we have demonstrated a novel universal and highly sensitive platform for fluorescent detection of sequence specific DNA at the femtomolar level by combining dextran-coated microarrays with hybridization chain reaction (HCR) signal amplification. Three-dimensional dextran matrix was covalently coated on glass surface as the scaffold to immobilize DNA recognition probes to increase the surface binding capacity and accessibility. DNA nanowire tentacles were formed on the matrix surface for efficient signal amplification by capturing multiple fluorescent molecules in a highly ordered way. By quantifying microscopic fluorescent signals, the synergetic effects of dextran and HCR greatly improved sensitivity of DNA microarrays, with a detection limit of 10fM (1×10(5) molecules). This detection assay could recognize one-base mismatch with fluorescence signals dropped down to ~20%. This cost-effective microarray platform also worked well with samples in serum and thus shows great potential for clinical diagnosis. PMID:26922047

  4. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-02-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  5. Trends and advances in food analysis by real-time polymerase chain reaction.

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling. PMID:27407185

  6. DIFFERENTIATION OF PSEUDOCONDYLOMA OF VULVA AND CONDYLOMA ACUMINATA BY DOT BLOT HYBRIDIZATION AND POLYMERASE CHAIN REACTION

    刘跃华; 王家璧; 司静懿

    1996-01-01

    This study differentiated pseudocondyloma of vulva from condyloma acunainata using dot blot hybridization and polymerase chain reaction (PCR). A total of 27 cases o{ pseudocondyloma of vulva and 65 cases of condyloma acuminata were selected for the sttldy. The genital lesions were examined clinically and were biopsled. Each biopsy v-as subjected to histological examination and HPV DNA analysis by dot blot hybridization and PCR. Dot blot analysis detected HPV DNA in 19(82.6%) out of 23 cases of condyloma acuminata and 2(25%) out of 8 cases pseudocondyloma of vulvae(P<0. 05). PCR detected HPV DNA in 51(92.7%) our of 55 cases of eondyloma acuminata, compared with none in 23 cases of pseudocondylorna(P<0. 001). HPV DNA was present in the majority of condyloma acuminata specimens, HPV 6 and 11 were the predominant types. Peudocondyloma is probably not associated with HPV. PCR was the most sensitive and useful techntque for HPV DNA detection.

  7. BORRELIA BURGDORFERI DNA IN BIOLOGICAL SAMPLES FROM PATIENTS WITH SARCOIDOSIS USING THE POLYMERASE CHAIN REACTION TECHNIQUE

    连伟; 罗慰慈

    1995-01-01

    Polymerase chain reaction (PCR) was used to detect the presence of Borretia burgdoferi DNA in biological samples from patients with sarcoidcsis. The target DNA sequence was of chromosomal origin. The amplified DNA sequence was analyzed by agarose gel electrophoresis, PAGE with silver staining, and the identity of amplified DNA was confirmed by restriction enzyme cleavage and DNA-DNA hybridlzation with a 32P-labelled probe. The assay was sensitive to fewer than two copies of B. burgdor feri genome, even in the presence of a 104-fold excess of human eukaryotic DNA, and was also specific to different B. burgdorferl strains tested. Sera seroiogieally positive to B. burgdorferi (n=26), broncbemlveolar lavage fluid and supematant of BALF (n=26) and peripheral blood (n=9) from sarcoidosis patients were tested. The positive rate was low (4/26, 2/26, and 0/9, respectively). It was considered that DNA from B. bur gdor feri may be identified in a minority of patients with s,arcoidosis, and it may play a pathogenetic rote in such cases. More studies need to be done before advancing the hypothesis of an etiologic role of B. burgdorferi in sarcoidosis.

  8. Polymerase chain reaction amplification of a GC rich region by adding 1,2 propanediol

    Zeinab Mousavian

    2014-01-01

    Full Text Available Background : Apolipoprotein E (ApoE is one of the most important carriers of lipids in mammalians. The gene for this lipoprotein (ApoE is located on chromosome 19 which is related with the pathogenesis of some nervous system disease. ApoE gene is identified as a high guanine-cytosine (GC content fragment. Detection and amplification of these templates are extensively laborious and baffling. The aim of this study was to find a practical and feasible method for the amplification of the number of GC rich genes such as ApoE. Materials and Methods: We experimented with simple polymerase chain reaction (PCR, nested PCR and PCR with 1-2 propanediol, dimethylsulfoxide (DMSO, and ethyleneglicol as additive substances to enhance the amplification ApoE gene and used the 40 samples of the human whole blood were collected in test tubes with a pre-treatment of ethylene diaminetetraacetic acid. Results: According to our observations, presence of 1-2 propanediol, DMSO, and ethyleneglicol as additive substances resulted to enhanced amplification of ApoE gene. Addition of 1-2 propanediol showed the best results, caused optimization and revealed more specific and sharp bands. Conclusion: According to our findings 1-2 propanediol are the best organic reagent for improving the amplification of ApoE gene. Optimization procedure for each GC rich sequence is recommended to be performed separately in order to identify which of the additive agent is more efficient and applicable for a particular target.

  9. Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum

    Ching Giap Tan

    2014-02-01

    Full Text Available The present study was based on the reverse transcription polymerase chain reaction (RT-PCR of the 16S ribosomal nucleic acid (rRNA of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20–25 h at 37 °C, 22–25 h at 16 °C, and 23–27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h. The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.

  10. Detection of Toxoplasma gondii in venous blood from AIDS patients by polymerase chain reaction.

    Dupouy-Camet, J; de Souza, S L; Maslo, C; Paugam, A; Saimot, A G; Benarous, R; Tourte-Schaefer, C; Derouin, F

    1993-01-01

    Detection of Toxoplasma gondii in blood by means of the polymerase chain reaction (PCR) may facilitate the diagnosis and follow-up of cerebral toxoplasmosis in patients with AIDS. We evaluated this approach with seven patients with tissue culture-proven parasitemia, 14 patients with presumptive cerebral toxoplasmosis, and 17 healthy human immunodeficiency virus-positive controls. Each sample of blood was assayed on three different occasions by a PCR assay based on detection of the gene encoding the P30 surface protein. A positive PCR diagnosis required positivity in at least two of the three PCR tests. None of the controls had a positive PCR diagnosis, but six of the seven patients with parasitemia did. Cerebral toxoplasmosis was confirmed in 13 of the 14 patients with a presumptive diagnosis; diagnosis by PCR was positive before treatment for 9 of these 13 patients, whereas tissue culture was positive for only 1 patient. During treatment, blood samples were taken from 14 patients at regular intervals until day 12. PCR diagnosis became negative on ethidium-stained gels, but persistent signals were observed after hybridization, in some cases, for up to 12 days after initiation of therapy. PCR on venous blood could thus be a sensitive and noninvasive method for the diagnosis of cerebral and disseminated toxoplasmosis in AIDS patients and could be a potential tool for monitoring the effects of treatment. PMID:8349765

  11. Alkyl chain length-dependent surface reaction of dodecahydro-N-alkylcarbazoles on Pt model catalysts

    The concept of liquid organic hydrogen carriers (LOHC) holds the potential for large scale chemical storage of hydrogen at ambient conditions. Herein, we compare the dehydrogenation and decomposition of three alkylated carbazole-based LOHCs, dodecahydro-N-ethylcarbazole (H12-NEC), dodecahydro-N-propylcarbazole (H12-NPC), and dodecahydro-N-butylcarbazole (H12-NBC), on Pt(111) and on Al2O3-supported Pt nanoparticles. We follow the thermal evolution of these systems quantitatively by in situ high-resolution X-ray photoelectron spectroscopy. We show that on Pt(111) the relevant reaction steps are not affected by the different alkyl substituents: for all LOHCs, stepwise dehydrogenation to NEC, NPC, and NBC is followed by cleavage of the C–N bond of the alkyl chain starting at 380–390 K. On Pt/Al2O3, we discern dealkylation on defect sites already at 350 K, and on ordered, (111)-like facets at 390 K. The dealkylation process at the defects is most pronounced for NEC and least pronounced for NBC

  12. The utility of the polymerase chain reaction assay for aetiologic definition of unspecified bacterial meningitis cases

    Mari Tuyama

    2008-03-01

    Full Text Available Most patients with acute suppurative meningitis are otherwise healthy individuals with regard to immune mechanisms against invasive bacterial disease. This medical emergency is among the most dramatic and potentially ravaging diseases that affect humans, particularly young children. The illness often strikes suddenly, and can either result in death or leave the survivors with significant neurological dysfunctions. The demonstration of a bacterial aetiology is necessary for decisions regarding treatment and prophylaxis. Conventional bacteriological methods frequently fail to identify an agent, as a result of administration of antibiotics or delayed lumbar punctures. We investigated the major aetiologic sources of unspecified bacterial meningitis cases (G00.9, ISCD-10 by polymerase chain reaction (PCR-based identification of Neisseria meningitidis (crgA, Streptococcus pneumoniae (ply and Haemophilus influenzae (bexA in cerebrospinal fluid samples. The multiplex PCR detected N. meningitidis in 92%, S. pneumoniae in 4% and H. influenzae in 1% of the 192 clinical samples assayed; 3% were negative for all three DNA targets. Bacterial DNA detection was found to be a valuable adjunct to enhance bacterial meningitis surveillance when the yield of specimens by culture is reduced. The implementation of PCR assays as a diagnostic procedure in Public Health Laboratories is perceived to be a significant advance in the investigation of bacterial meningitis.

  13. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections

    Yuhki Sakuraoka; Tokihiko Sawada; Takayuki Shiraki; Kyunghwa Park; Yuhichiro Sakurai; Naohisa Tomosugi; Keiichi Kubota

    2012-01-01

    AIM:TO establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC).METHODS:Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC.Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years.Quantitative PCR was performed.Immunohistochemistry and in situ hybridization for hepcidin were also performed.RESULTS:Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully.The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues.A method of in situ hybridization for hepcidin was established successfully,and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue.CONCLUSION:We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.

  14. Spatiotemporal Patterns in a Ratio-Dependent Food Chain Model with Reaction-Diffusion

    Lei Zhang

    2014-01-01

    Full Text Available Predator-prey models describe biological phenomena of pursuit-evasion interaction. And this interaction exists widely in the world for the necessary energy supplement of species. In this paper, we have investigated a ratio-dependent spatially extended food chain model. Based on the bifurcation analysis (Hopf and Turing, we give the spatial pattern formation via numerical simulation, that is, the evolution process of the system near the coexistence equilibrium point (u2*,v2*,w2*, and find that the model dynamics exhibits complex pattern replication. For fixed parameters, on increasing the control parameter c1, the sequence “holes → holes-stripe mixtures → stripes → spots-stripe mixtures → spots” pattern is observed. And in the case of pure Hopf instability, the model exhibits chaotic wave pattern replication. Furthermore, we consider the pattern formation in the case of which the top predator is extinct, that is, the evolution process of the system near the equilibrium point (u1*,v1*,0, and find that the model dynamics exhibits stripes-spots pattern replication. Our results show that reaction-diffusion model is an appropriate tool for investigating fundamental mechanism of complex spatiotemporal dynamics. It will be useful for studying the dynamic complexity of ecosystems.

  15. Evaluation of a rapid polymerase chain reaction based identification technique for Vibrio cholerae isolates.

    le Roux, W J; Masoabi, D; de Wet, C M E; Venter, S N

    2004-01-01

    Rapid and accurate identification of waterborne pathogens, such as Vibrio cholerae, in drinking-water sources is important to enable effective resource management and public health protection. Phenotypic systems currently being used for the identification of Vibrio cholerae isolates are time-consuming and the need exists for the development of suitable molecular techniques that can offer both fast and reliable identification. During this study, isolates identified as Vibrio cholerae by means of two different biochemical test systems (API 20E and VITEK 32) were analysed with the polymerase chain reaction (PCR) to compare the reliability of the various identification systems. The selected PCR technique amplified a sequence within the outer membrane protein of Vibrio cholerae, a gene specific for V. cholerae. It was found that out of 243 isolates biochemically identified as V. cholerae with either the API or VITEK system, 21 isolates did not give a positive result with the PCR detection method. Sequencing the 16S rDNA of more than half of these isolates and comparison of the sequences with Internet databases indicated that most of the isolates belonged to the genus Aeromonas. The results indicated that the rapid PCR procedure was more accurate than the API or VITEK systems currently being used for the phenotypic identification of Vibrio cholerae isolates. PMID:15318514

  16. Detecting of Mycoplasma genitalium in male patients with urethritis symptoms in Turkey by polymerase chain reaction

    The aim of this study was to investigate the incidence of Mycoplasma genitalium in the urine samples of 63 male patients who had urethritis symptoms. Along with Neisseria gonorrhoeae (N. gonorrhoeae) and Chlamydia trachomatis (C. trachomatis). We also investigated Mycoplasma hominis (M. hominis) and Ureaplasma urealyticum (U. urealyticum), both of which are known to cause urethritis. Microorganisms were investigated in urine samples of the patients with polymerase chain reaction. The study was conducted between September 2003 - February 2004 at the Department of Microbiology and Clinical Microbiology Ankara University School of Medicine, Ankara, Turkey. A total of 63 urine samples were analyzed and 6 (9.52%) patients had N. gonorrhoeae, 4 (6.34%) had C. trachomatis, while 4 (6.34%) urines were positive in terms of M. genitalium. Nevertheless, 3 (4.76%) patients had U. urealyticum and 2 (3.17%) patients had M. hominis. One urine sample was positive in terms of both N. gonorrhoeae and U. urealyticum, and another urine sample was positive in terms of both M. hominis and U. urealyticum. The results were compared with the control group and found no statistically significant difference. Mycoplasma species are found in normal flora of urogenital system and also as an agent of urogenital infection. In our study, we found low microorganism rates when compared with Europe and America. This difference may be due to the conservative sexual behavior in Turkey. (author)

  17. Improving Nuclear Safety of Fast Reactors by Slowing Down Fission Chain Reaction

    G. G. Kulikov

    2014-01-01

    Full Text Available Light materials with small atomic mass (light or heavy water, graphite, and so on are usually used as a neutron reflector and moderator. The present paper proposes using a new, heavy element as neutron moderator and reflector, namely, “radiogenic lead” with dominant content of isotope 208Pb. Radiogenic lead is a stable natural lead. This isotope is characterized by extremely low micro cross-section of radiative neutron capture (~0.23 mb for thermal neutrons, which is smaller than graphite and deuterium cross-sections. The reflector-converter for a fast reactor core is the structure capable of transforming some part of prompt neutrons leaked from the core into the reflected neutrons with properties similar to those of delayed neutrons, that is, sufficiently large contribution to reactivity at the level of effective fraction of delayed neutrons and relatively long lifetime, comparable with lifetimes of radionuclides-emitters of delayed neutrons. It is evaluated that the use of radiogenic lead makes it possible to slow down the chain fission reaction on prompt neutrons in the fast reactor. This can improve the fast reactor safety and reduce some requirements to the technologies used to fabricate fuel for the fast reactor.

  18. Polymerase chain reaction based epidemiological investigation of canine parvoviral disease in dogs at Bareilly region

    Jobin Thomas

    2014-11-01

    Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.

  19. Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis.

    Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T

    2016-06-01

    We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. PMID:25827436

  20. Rapid enumeration of Listeria monocytogenes in artificially contaminated cabbage using real-time polymerase chain reaction.

    Hough, Angela J; Harbison, Sally-Ann; Savill, Marion G; Melton, Laurence D; Fletcher, Graham

    2002-08-01

    A quantitative real-time polymerase chain reaction (PCR) detection method specific for Listeria monocytogenes was developed, and studies involving pure culture showed that the response of the assay was linear over 7 log10 (log) cycles. The method was then applied to the detection of L. monocytogenes artificially inoculated onto cabbage, a vegetable chosen because it is a major component of coleslaw, which has been associated with an outbreak of listeriosis. After being allowed to attach to the food, cells were washed from the cabbage leaf surface and recovered by centrifugation. The DNA was purified by an organic solvent extraction technique and analyzed by real-time PCR. In this matrix, the method again produced a linear response over 7 log cycles from 1.4 x 10(2) to 1.4 x 10(9) CFU of L. monocytogenes in 25 g of cabbage, and analysis of the reproducibility of the system showed that log differences in L. monocytogenes numbers added to cabbage could be reliably distinguished. The system allowed quantitative results to be obtained within 8 h and was relatively inexpensive, showing good potential for routine analytical use. PMID:12182489

  1. Highly sensitive polymerase chain reaction-free quantum dot-based quantification of forensic genomic DNA

    Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.

  2. GSH2 promoter methylation in pancreatic cancer analyzed by quantitative methylation-specific polymerase chain reaction

    GAO, FEI; HUANG, HAO-JIE; GAO, JUN; LI, ZHAO-SHEN; MA, SHU-REN

    2015-01-01

    Tumor suppressor gene silencing via promoter hypermethylation is an important event in pancreatic cancer pathogenesis. Aberrant DNA hypermethylation events are highly tumor specific, and may provide a diagnostic tool for pancreatic cancer patients. The objective of the current study was to identify novel methylation-related genes that may potentially be used to establish novel therapeutic and diagnostic strategies against pancreatic cancer. The methylation status of the GS homeobox 2 (GSH2) gene was analyzed using the sodium bisulfite sequencing method. The GSH2 methylation ratio was examined in primary carcinomas and corresponding normal tissues derived from 47 patients with pancreatic cancer, using quantitative methylation-specific polymerase chain reaction. Methylation ratios were found to be associated with the patient's clinicopathological features. GSH2 gene methylation was detected in 26 (55.3%) of the 47 pancreatic cancer patients, indicating that it occurs frequently in pancreatic cancer. A significant association with methylation was observed for tumor-node-metastasis stage (P=0.031). GSH2 may be a novel methylation-sensitive tumor suppressor gene in pancreatic cancer and may be a tumor-specific biomarker of the disease. PMID:26171036

  3. Differentiation of Helicobacter pylori isolates by polymerase chain reaction-restriction fragment length polymorphism

    SHI Li; SUN Yong; ZHANG Ya-li; ZHANG Zhen-shu; ZHOU Dian-yuan

    2002-01-01

    Objective: To investigate the association between the diversity of urease gene and urease activity of clinical isolates of Helicobacter pylori (H. pylori). Methods: Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) of urease gene and rapid urease activity test were used to study the urease activity of different clinical isolates of H. pylori. Results: H. pylori clinical isolates were divided into 4types according to their PCR-RFLP results of urease gene and urease activity. Type I , possessing strong urease activity (0. 11) and presented 1 fragment of 1.7 kb by PCR-RFLP, had close relations with gastric ulcer; type Ⅱ , with the weakest urease activity (0. 07) and 2 fragments (1.3 and 0. 4 kb respectively), was associated with duodenal bulb ulcer; type Ⅱ , with the strongest urease activity (0. 12) and 2 fragments (0. 4and 0. 17 kb) with or without 1 fragment (0. 23 or 0. 37 kb) , was responsible for gastritis; type Ⅳ, with weak urease activity (0. 09) and 2 fragments (1.5 and 0. 2 kb), was shown to be related to both gastric and duodenal bulb ulcers. Conclusion: The diversity of urease gene decides different urease activities of different clinical isolates of H. pylori, hence the different possibilities of pathogenesis due to this bacteria.

  4. On Construction of Supply Chain System for China’s Modern Agricultural Products

    Wanjiang; WANG

    2015-01-01

    In view of drawbacks in supply chain of China’s traditional agricultural products,this paper proposed building supply chain system for modern agricultural products: taking informationization as basis,channel system as core,organization system as support,and service system and safety system as guarantee,to promote high efficient operation of the supply chain system. The channel system stresses alliance and integration of channel system,informationization of channel management,and terminalization of channel operation; the organization system stresses organization,large scale,group,and brand of participant entities; service system stresses construction of service means,service platform,and operation mechanism; safety system stresses building quality safety based agricultural product supply chain management mode. In order to ensure high efficient operation of supply chain for modern agricultural products,it is required to straighten out supply chain management system,actively cultivate core enterprises of supply chain,strengthen information construction of supply chain,select suitable supply chain mode,and improve benefit allocation mechanism.

  5. Charge Symmetry Breaking and Nuclear Pion Production Reactions

    Bolton, Daniel R

    2011-01-01

    Large momentum transfer reactions such as pion production represent the frontier of Chiral Perturbation Theory and must be understood before more complex reactions can be considered. Pion production is also interesting in its own right, one application being the hadronic extraction of a charge symmetry breaking parameter: the contribution of the down-up quark mass difference to the neutron-proton mass difference. This dissertation reports on two primary projects: (1) a calculation of the charge symmetry breaking forward-backward asymmetry of the differential cross section of the n p -> d pi^0 reaction, and (2) the development of a new theoretical framework addressing the issue of reducibility in the impulse approximation's contribution to pion production. It is shown that the traditional one-body impulse approximation must be replaced by a two-body operator which makes a larger contribution to s-wave pion production.

  6. Kaon production in heavy ion reactions at intermediate energies

    Fuchs, C

    2006-01-01

    The article reviews the physics related to kaon and antikaon production in heavy ion reactions at intermediate energies. Chiral dynamics predicts substantial modifications of the kaon properties in a dense nuclear environment. The status of the theoretical predictions as well as experimental evidences for medium effects such as repulsive/attractive mass shifts for $K^+/K^-$ are reviewed. In the vicinity of the thresholds, and even more pronounced below threshold, the production of strangeness is a highly collective process. Starting from elementary reaction channels the phenomenology of $K^+$ and $K^-$ production, i.e. freeze-out densities, time scales etc. as derived from experiment and theoretical transport calculations is presented. Below threshold kaon production shows a high sensitivity on the nuclear compression reached in heavy ion reactions. This allows to put constraints on the nuclear equation-of-state which are finally discussed.

  7. Chemical Characterization and Reactivity of Fuel-Oxidizer Reaction Product

    David, Dennis D.; Dee, Louis A.; Beeson, Harold D.

    1997-01-01

    Fuel-oxidizer reaction product (FORP), the product of incomplete reaction of monomethylhydrazine and nitrogen tetroxide propellants prepared under laboratory conditions and from firings of Shuttle Reaction Control System thrusters, has been characterized by chemical and thermal analysis. The composition of FORP is variable but falls within a limited range of compositions that depend on three factors: the fuel-oxidizer ratio at the time of formation; whether the composition of the post-formation atmosphere is reducing or oxidizing; and the reaction or post-reaction temperature. A typical composition contains methylhydrazinium nitrate, ammonium nitrate, methylammonium nitrate, and trace amounts of hydrazinium nitrate and 1,1-dimethylhydrazinium nitrate. Thermal decomposition reactions of the FORP compositions used in this study were unremarkable. Neither the various compositions of FORP, the pure major components of FORP, nor mixtures of FORP with propellant system corrosion products showed any unusual thermal activity when decomposed under laboratory conditions. Off-limit thruster operations were simulated by rapid mixing of liquid monomethylhydrazine and liquid nitrogen tetroxide in a confined space. These tests demonstrated that monomethylhydrazine, methylhydrazinium nitrate, ammonium nitrate, or Inconel corrosion products can induce a mixture of monomethylhydrazine and nitrogen tetroxide to produce component-damaging energies. Damaging events required FORP or metal salts to be present at the initial mixing of monomethylhydrazine and nitrogen tetroxide.

  8. Platypus chain reaction: directional and ordered meiotic pairing of the multiple sex chromosome chain in Ornithorhynchus anatinus.

    Daish, Tasman; Casey, Aaron; Grützner, Frank

    2009-01-01

    Monotremes are phylogenetically and phenotypically unique animals with an unusually complex sex chromosome system that is composed of ten chromosomes in platypus and nine in echidna. These chromosomes are alternately linked (X1Y1, X2Y2, ...) at meiosis via pseudoautosomal regions and segregate to form spermatozoa containing either X or Y chromosomes. The physical and epigenetic mechanisms involved in pairing and assembly of the complex sex chromosome chain in early meiotic prophase I are completely unknown. We have analysed the pairing dynamics of specific sex chromosome pseudoautosomal regions in platypus spermatocytes during prophase of meiosis I. Our data show a highly coordinated pairing process that begins at the terminal Y5 chromosome and completes with the union of sex chromosomes X1Y1. The consistency of this ordered assembly of the chain is remarkable and raises questions about the mechanisms and factors that regulate the differential pairing of sex chromosomes and how this relates to potential meiotic silencing mechanisms and alternate segregation. PMID:19874721

  9. Multiplex Reverse Transcription-Polymerase Chain Reaction untuk Deteksi Cepat Virus Flu Burung H5N1 (MULTIPLEX REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION FOR RAPID DETECTION OF H5N1 AVIAN INFLUENZA VIRUS

    Raden Wasito

    2015-05-01

    Full Text Available Avian influenza virus subtype H5N1 (AIV H5N1 is highly pathogenic and fatal in poultry. The virusis still endemic with low virulence rate, although it may play a critical role in causing high morbidity andmortality rates in poultry in Indonesia. In general, diagnostic approach for AIV H5N1 is based onconventional serological and viral isolation methods that have the potential to produce consumings oftime and relatively expensive cost within the laboratory without compromising test utility. Thus, amolecular approach of multiplex reverse transcription-polymerase chain reaction (mRT-PCR was developedand applied for the detection of matrix gene type A influenza viruses, AIV subtype subtype H5hemagglutinin gene with simultaneous detection of N1 nucleoprotein gene. Thirty sera specimens fromthe diseased commercial chickens that were specifically amplified positive-RT-PCR for AIV H5N1 wereselected for mRT-PCR. The mRT-PCR products were visualized by agarose gel electrophoresis and consistedof DNA fragments of AIV of 245 bp, 545 bp and 343 bp for M, H5 and N1 genes, respectively. Thus, themRT-PCR that can rapidly differentiate simultaneously between these genes is very important for thecontrol and even eradication of AIV transmission in poultry in Indonesia.

  10. Identification of bovine material in porcine spray-dried blood derivatives using the Polymerase Chain Reaction technique

    Sánchez A.

    2004-01-01

    Full Text Available Due to the widely supported theory of bovine spongiform encephalopathy (BSE spread in cattle by contaminated animal feeds, screening of feed products has become essential. For many years, manufacturers have used blood and plasma proteins as high quality ingredients of foods for both pets and farm animals. However, in Europe, the Commission Regulation 1234/2003/EC temporally bans the use of processed animal proteins, including blood-derivative products, in feedstuffs for all farm animals which are fattened or bred for the production of food. This regulation has some exceptions, such as the use of non ruminant blood products into the feed of farm fish. Authorization of the re-introduction of these proteins into animal feed formulations, especially non ruminant proteins into the feed for non ruminant farm animals, is expected when adequate control methods to discriminate ruminant proteins exist. Currently, the number of validated methods to differentiate the species of origin for most of the animal by-products is limited. Here we report the development of a rapid and sensitive polymerase chain reaction (PCR-based assay, which allows detection of bovine or porcine specific mitochondrial DNAfrom spray-dried blood derivate products (plasma, whole blood and red cells, as a marker for bovine contamination in porcine products. Sample extracts, suitable for PCR, were easily and quickly obtained with the commercial PrepManTM Ultra reagent (Applied Biosystems. To confirm the porcine origin of the samples, primers targeting a specific region of 134 bp of the porcine cytochrome b coding sequence were designed (cytbporc1-F and cytbporc2-R. Previously published PCR primers (L8129 and H8357, specific for a 271 bp fragment of the bovine mitochondrial ATPase 8-ATPase 6 genes, were chosen to accomplish amplification of bovine DNA. The limit of detection (LOD of the bovine PCR assay was at least of 0.05% (v/v of bovine inclusion in spray-dried porcine plasma or red

  11. Optimal Financing Decisions of Two Cash-Constrained Supply Chains with Complementary Products

    Yuting Li; Tong Chen; Baogui Xin

    2016-01-01

    In recent years; financing difficulties have been obsessed small and medium enterprises (SMEs); especially emerging SMEs. Inter-members’ joint financing within a supply chain is one of solutions for SMEs. How about members’ joint financing of inter-supply chains? In order to answer the question, we firstly employ the Stackelberg game to propose three kinds of financing decision models of two cash-constrained supply chains with complementary products. Secondly, we analyze qualitatively these m...

  12. Supply chain in brazilian automobile industry: production organization, performance and innovations

    Mario Sacomano Neto; Silvio Roberto Ignacio Pires

    2007-01-01

    This Paper presents the main results of a recent research on Supply Chain Management within the Brazilian Automotive Industry. The research aimed to study how the different forms of configuration of the Automaker’s Supply Chain influence the organization forms of production, the performance measures and the innovations in the Supply Chain Management. The research involves an automaker, two first tier suppliers and two second tier suppliers and it has been conducted through interviews with exe...

  13. Thermochemical Reactions for Solar Energy Storage and Fuel Production

    Roeb, Martin; Sattler, Christian

    2013-01-01

    Thermochemical multistep processes are promising options to face future energy problems. Such reactions can be used to enhance the availability of solar energy in terms of energy transport, of energy demand/supply management and of potential energy related applications. Coupling concentrated sunlight to suitable sequences of thermochemical reaction enables the production of hydrogen, syngas and other fuels derived from those precursors by water- and CO2-splitting as well as the storage of sol...

  14. A Theoretical Investigation on the Reaction Mechanism of the C8H+·10 Side-Chain Decomposition Processes

    CHENG Xue-Li; ZHAO Yan-Yun; LI Feng

    2008-01-01

    The dissociation of ethylbenzene cation C8H+·10 served as a prototype to investigate the decompasition mechanisms of alkylbenzene cations.The reactions of C8H+·10 decomposition reaction system have been studied extensively at the B3L YP/6-311++G** level with Gaussion 98 package.The chain reaction of C8H+·10 dissociation is initiated by C-H bond rupture.All reaction channels were fully investigated with the vibrational mode analysis to confirm the transition states and reveal the reaction mechanism.The energetically most favorable pathway is C8H+·10→TS4→·P2+H· and the channel ieading to C8H+·10 and C2H4 is also competitive.

  15. Study on the Dynamic Pricing Revenue Distribution Model of Fresh Agricultural Products Supply Chain

    Haoran Shi

    2013-12-01

    Full Text Available This study divides the sales cycle of fresh agricultural products into two stages according to the features of fresh agricultural products, establishes two pricing strategies according to its sales and through constructing an centralized-control model of supply chain under the constraints of revenue sharing contract and through analyzing different prices in the two stages, it summarizes the sales strategies of retailers and supplier and the anticipated sales, proposes to coordinate the operation of fresh agricultural products supply chain by adjusting the revenue coefficient in the revenue sharing contract. After comparing the revenue of decentralized-control supply chain model and centralized-control supply chain model, this study concludes that centralized-control supply chain model will have higher revenue.

  16. Detection and traceability of genetically modified organisms in the food production chain.

    Miraglia, M; Berdal, K G; Brera, C; Corbisier, P; Holst-Jensen, A; Kok, E J; Marvin, H J P; Schimmel, H; Rentsch, J; van Rie, J P P F; Zagon, J

    2004-07-01

    Both labelling and traceability of genetically modified organisms are current issues that are considered in trade and regulation. Currently, labelling of genetically modified foods containing detectable transgenic material is required by EU legislation. A proposed package of legislation would extend this labelling to foods without any traces of transgenics. These new legislations would also impose labelling and a traceability system based on documentation throughout the food and feed manufacture system. The regulatory issues of risk analysis and labelling are currently harmonised by Codex Alimentarius. The implementation and maintenance of the regulations necessitates sampling protocols and analytical methodologies that allow for accurate determination of the content of genetically modified organisms within a food and feed sample. Current methodologies for the analysis of genetically modified organisms are focused on either one of two targets, the transgenic DNA inserted- or the novel protein(s) expressed- in a genetically modified product. For most DNA-based detection methods, the polymerase chain reaction is employed. Items that need consideration in the use of DNA-based detection methods include the specificity, sensitivity, matrix effects, internal reference DNA, availability of external reference materials, hemizygosity versus homozygosity, extrachromosomal DNA, and international harmonisation. For most protein-based methods, enzyme-linked immunosorbent assays with antibodies binding the novel protein are employed. Consideration should be given to the selection of the antigen bound by the antibody, accuracy, validation, and matrix effects. Currently, validation of detection methods for analysis of genetically modified organisms is taking place. In addition, new methodologies are developed, including the use of microarrays, mass spectrometry, and surface plasmon resonance. Challenges for GMO detection include the detection of transgenic material in materials

  17. Effects of Demand, Manufacturing Flexibility, Cost and Supply Chain on Product Modularity: A Study in Malaysia

    Noor Raihani Binti Zainol

    2013-11-01

    Full Text Available The objective of this study was to investigate the effect of customer demand, manufacturing flexibility, cost, and supply chain on product modularity. This study employed a cross-sectional design and a proportionate random sampling procedure was used to select 150 manufacturers from a list of 250 manufacturing companies in Malaysia, which are registered in Federation of Malaysian Manufacturers (FMM and Association of Proton vendors. Data was collected from the middle and top management from these selected manufacturing organizations. Findings of this study noted that customer demand, manufacturing flexibility and supply chain has a significant positive effect on product modularity, whereas cost has a negative association with product modularity. Manufacturers, therefore, need to develop customer demand, manufacturing flexibility, cost, and supply chains to ensure the success in developing modularity product manufacturing. This study shows strong association for customer demand, manufacturing flexibility, cost, and supply chain to develop modularity product manufacturing.

  18. IS PRICE TRANSMISSION SYMMETRIC OVER TRANSNATIONALVALUE CHAINS FOR CODFISH PRODUCTS ?

    Menezes, Rui; Dionísio, Andreia

    2008-01-01

    This paper uses a threshold adjustment methodology to find out whether price transmission over the cod value chain between Norway and Portugal is asymmetric. The basic setting relies on price theory and the relationship between prices in the fish market. Empirical tests of price transmission use a cointegration framework similar to many other non-stationary time series analyses. However, it appears that testing for asymmetric price transmission has not been done so often in the...

  19. PARTICULARITIES AND MANAGEMENT OF THE DISTRIBUTION CHAIN FOR FISH AND FISHERY PRODUCTS

    Carmen Georgeta NICOLAE

    2015-10-01

    Full Text Available The total quality principles implementation contributes to the improving in meeting the consumer needs, essential reduction of costs and increasing sales. The total quality is a concept that assures the total satisfaction of clients on the entire distribution chain, including all the actors in this chain. The aquaculture and fisheries are very diverse sectors which use different breeding and fishing technologies and provide a wide variety of specific products. This induces a real complexity of the supply and distribution chain for fish and fishery products, including the links from the production point (fishery or farm to the final consumer. The components of the distribution chain differ with the geographic areas, type of farms, transportation, information on the fishery market and management systems. Implementing the total food quality system for fishery products involves the quality specification in all marketing stages for all products, along the entire distribution chain. The present work was focused on identifying the distribution chain for fish and fishery products with the identification of the specificity of this type of chain form farm to end consumer, which is the first step in the implementation of total quality concept in aquaculture, with all the benefits that come with it.

  20. Detection of gastrin mRNA in fresh human colonic carcinomas by reverse transcription-polymerase chain reaction.

    Monges, G; Biagini, P; Cantaloube, J F; Chicheportiche, C; Frances, V; Brandini, D; Parc, P; Seitz, J F; Giovannini, M; Sauvan, R

    1993-10-01

    To investigate the hypothesis that gastrin might be synthesized by tumour tissues in cancer of the colon, samples from six human colon tumours, one hepatic metastasis, four normal colonic mucosal samples and two antral and one fundic gastric mucosal samples from nine patients were analysed to determine whether gastrin mRNA was present. RNA was extracted from surgical specimens by ultracentrifugation on a CsCl cushion, purified using the guanidinium thiocyanate method, reverse-transcribed and amplified by polymerase chain reaction. Gastrin mRNA was detected in each colonic carcinoma sample (including the hepatic metastasis), while no such signal was observed in normal colon biopsies. Positive and negative controls (gastric antrum and fundus respectively) gave the expected results. In each of the positive samples, the chemiluminescent revelation of amplified products after Southern blotting corresponded to gastrin mRNA without the intron. These findings demonstrate the ability of primary and metastatic human colonic tumours to produce gastrin mRNA. Since malignant cell lines have been reported to produce gastrin peptide, and since gastrin receptors were present in some cases, our results support the idea that gastrin may be involved in an autocrine mechanism. PMID:7507679

  1. Detection of African swine fever virus from formalin fixed and non-fixed tissues by polymerase chain reaction

    P. D. Luka

    2014-10-01

    Full Text Available Aim: Formalin fixing and paraffin embedding of tissue samples is one of the techniques for preserving the structural integrity of cells for a very long time. However, extraction and analysis of genomic material from formalin fixed tissue (FFT remains a challenge despite numerous attempts to develop a more effective method. The success of polymerase chain reaction (PCR depends on the quality of DNA extract. Materials and Methods: Here we assessed the conventional method of DNA extraction from FFT for African swine fever virus (ASFV detection. The modified conventional method gave a higher quality DNA when compared with commercially available DNA extraction kits (QIAamp® DNA Mini Kit, DNeasy® Blood and Tissue Kit, and ZR Genomic DNA™ Tissue MiniPrep. Results: An average A260/A280 DNA purity of 0.86-1.68 and 3.22-5.32 μg DNA/mg for formalin fixed and non-fixed tissues, respectively using a conventional method. In a reproducible and three times repeat PCR, the ASFV DNA expected product size of 278 bp was obtained from the DNA extract of the conventional method but not from the DNA extract of the commercial kits. Conclusion: The present study has demonstrated that the conventional method extracts ASFV genome better than commercial kit. In summary, the commercial kit extraction appeared not suitable to purify ASFV DNA from FFT. We, therefore, recommend that the use of the conventional method be considered for African swine fever DNA extraction from FFT.

  2. Efficacy of a commercial polymerase chain reaction-based assay for detection of Salmonella spp. in animal feeds.

    Maciorowski, K G; Pillai, S D; Ricke, S C

    2000-10-01

    Salmonellosis is a cyclic problem in the food industry, to which animal feed has been contributory. Current conventional methods of Salmonella spp. detection require 96 h for detection and confirmation. With modern and just-in-time production schedules, a 96-h hold represents a significant expense in storage and decontamination. The commercially available assay, 'BAX for Screening/Salmonella' (BAX), is based on the principle of the polymerase chain reaction and may represent a significant decrease in assay time. Seven fresh feed formulations, two fresh feed ingredients, seven stored feeds and two stored feed ingredients were artificially contaminated with a primary poultry isolate of Salmonella typhimurium and analysed by conventional and BAX methodology. The results of BAX agreed with conventional plating results for 16 of 18 samples spiked with 1200 cfu 10 g(-1) of feed and 13 of 18 samples spiked with 40 cfu 10 g(-1) of feed. Indigenous Salmonella spp. were detected in five of eight samples of poultry diets by conventional methods. With BAX, Salmonella spp. could not be detected in any of the samples after only 7 h of enrichment but could be detected in two dietary samples after 13 h of enrichment and four dietary samples after 24 h of enrichment. Specific sequences of salmonella DNA that were extracted from poultry diets could be detected with BAX. PMID:11054177

  3. Effective use of product quality information in food supply chain logistics

    Rijpkema, W.A.

    2014-01-01

    Food supply chains have inherent characteristics, such as variability in product quality and quality decay, which put specific demands on logistics decision making. Furthermore, food supply chain organization and control has changed significantly in the past decades by factors such as scale intensif

  4. Two-stage medium chain fatty acid (MCFA) production from municipal solid waste and ethanol

    Grootscholten, T.I.M.; Strik, D.P.B.T.B.; Steinbusch, K.J.J.; Buisman, C.J.N.; Hamelers, B.

    2014-01-01

    Chain elongation is an anaerobic fermentation that produces medium chain fatty acids (MCFAs) from volatile fatty acids and ethanol. These MCFAs can be used as biochemical building blocks for fuel production and other chemical processes. Producing MCFAs from the organic fraction of municipal solid wa

  5. Detection of epidermal growth factor receptor mutation in lung cancer by droplet digital polymerase chain reaction

    Xu Q

    2015-06-01

    Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect

  6. Antiadenoviral effects of N-chlorotaurine in vitro confirmed by quantitative polymerase chain reaction methods

    Eiichi Uchio

    2010-11-01

    Full Text Available Eiichi Uchio1, Hirotoshi Inoue1, Kazuaki Kadonosono21Department of Ophthalmology, Fukuoka University School of Medicine, Fukuoka, Japan; 2Department of Ophthalmology, Yokohama City University Medical Center, Yokohama, JapanPurpose: Adenoviral keratoconjunctivitis is recognized as one of the major pathogens of ophthalmological nosocomial infection worldwide. N-Chlorotaurine (Cl–HN–CH2–CH2–SO3H, NCT is the N-chloro derivative of the amino acid taurine, which is an oxidant produced by human granulocytes and monocytes during inflammatory reactions. Using conventional viral plaque assay, it was previously shown that NCT causes inactivation of several human adenovirus (HAdV serotypes. In this study, we evaluated the antiadenoviral effect of NCT by quantitative polymerase chain reaction (PCR methods.Methods: A549 cells were used for viral cell culture, and HAdV serotypes 3, 4, 8, 19, and 37 were used. After calculating 50% cytotoxic concentration (CC50 of NCT by MTS (3-(4,5-dimethylthiazol-2-yl-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium method, HAdV was cultured with NCT for 7 days, and extracted adenoviral DNA was quantitatively measured by real-time PCR.Results: A statistically significant (P < 0.05 dose-dependent inhibition was indicated for all serotypes except HAdV type 4 (HAdV4, which was maximally inhibited by only ~50%. Among the serotypes, NCT was particularly effective against HAdV8, HAdV19a, and HAdV37. The 50% effective concentration (EC50 obtained by real-time PCR of NCT ranged between 49 and 256 µM. EC50 of NCT against HAdV3 was slightly higher than that against serotypes of species D. The selective index (CC50/EC50 ranged between 41 and 60 except for HAdV4 (11.5.Conclusions: These results show that NCT has an antiviral effect against most serotypes of human HAdV inducing keratoconjunctivitis, indicating its possible therapeutic use.Keywords: adenovirus, N-chlorotaurine, epidemic keratoconjunctivitis, antiviral

  7. Time-Resolved O3 Chemical Chain Reaction Kinetics Via High-Resolution IR Laser Absorption Methods

    Kulcke, Axel; Blackmon, Brad; Chapman, William B.; Kim, In Koo; Nesbitt, David J.

    1998-01-01

    Excimer laser photolysis in combination with time-resolved IR laser absorption detection of OH radicals has been used to study O3/OH(v = 0)/HO2 chain reaction kinetics at 298 K, (i.e.,(k(sub 1) is OH + 03 yields H02 + 02 and (k(sub 2) is H02 + 03 yields OH + 202). From time-resolved detection of OH radicals with high-resolution near IR laser absorption methods, the chain induction kinetics have been measured at up to an order of magnitude higher ozone concentrations ([03] less than or equal to 10(exp 17) molecules/cu cm) than accessible in previous studies. This greater dynamic range permits the full evolution of the chain induction, propagation, and termination process to be temporally isolated and measured in real time. An exact solution for time-dependent OH evolution under pseudo- first-order chain reaction conditions is presented, which correctly predicts new kinetic signatures not included in previous OH + 03 kinetic analyses. Specifically, the solutions predict an initial exponential loss (chain "induction") of the OH radical to a steady-state level ([OH](sub ss)), with this fast initial decay determined by the sum of both chain rate constants, k(sub ind) = k(sub 1) + k(sub 2). By monitoring the chain induction feature, this sum of the rate constants is determined to be k(sub ind) = 8.4(8) x 10(exp -14) cu cm/molecule/s for room temperature reagents. This is significantly higher than the values currently recommended for use in atmospheric models, but in excellent agreement with previous results from Ravishankara et al.

  8. Real time polymerase chain reaction in diagnosis of chronic myeloid leukemia

    Objective: To compare the sensitivity and specificity of Real Time Polymerase Chain Reaction (RT-PCR) with conventional cytogenetics in diagnosis of chronic myeloid leukemia. Study Design: A cross-sectional, analytical study. Place and Duration of Study: The Armed Forces Institute of Pathology (AFIP), Rawalpindi, from December 2010 to January 2012. Methodology: A total number of 40 patients were studied, in which all were diagnosed as CML on peripheral blood and bone marrow aspiration. The subjects were tested for the presence of Philadelphia (Ph) chromosome by cytogenetics and BCR-ABL fusion gene by RT-PCR. 2-3 ml of venous blood was collected, half in sodium heparin (anti-coagulant) for cytogenetics and half in EDTA for PCR. For cytogenetics, cells were cultured for 72 hours in RPMI 1640 medium and examined by arresting in metaphase using Colchicine to identify Philadelphia chromosome. For PCR, RNA extraction was done by Tri Reagent LS (MRC, USA) and cDNA was synthesized using reverse transcriptase and gene specific primer. RT- PCR was done on ABI-7500. The positive samples were identified when fluorescence exceeded threshold limit. Results of cytogenetics and RT PCR were compared. Results: Out of the 40 patients, PCR showed 37 (92.5%) were positive and 3 (7.5%) were negative for BCR-ABL fusion gene, whereas in cytogenetics 28 (70%) were positive for Ph chromosome and 12 (30%) were negative for Ph chromosome. Sensitivity and specificity of cytogenetics was 75.6% and 100% respectively. Conclusion: Real time PCR as compared to cytogenetics is less tedious, gives quick results, does not require multiple sampling due to culture failure and can be done on peripheral blood. (author)

  9. Relevance of semen polymerase chain reaction positive for tuberculosis in asymptomatic men undergoing infertility evaluation

    Subodh Kumar Regmi

    2015-01-01

    Full Text Available OBJECTIVE: Male partners of infertile women with genital tuberculosis (TB are often screened for genital TB. We aimed to evaluate the clinical significance of a positive screening semen polymerase chain reaction (PCR for Mycobacterium tuberculosis test (TB-PCR in asymptomatic men undergoing infertility evaluation and determine the need for a detailed investigation and treatment for TB. MATERIALS AND METHODS: Between March 2012 and January 2013, male partners of 15 infertile women with a diagnosis of genitourinary TB (GUTB as the cause of infertility, tested positive either on semen PCR for TB (13 cases, or Mycobacterium Growth Indicator Tube-960 test (2 cases. These asymptomatic men underwent infertility evaluation along with evaluation for GUTB. Diagnosis of GUTB was based on standard clinical criteria, which included a high index of suspicion along with clinical, laboratory, and/or radiological evidence of GUTB. Men who had no clinical evidence of GUTB were followed up with clinical evaluation, semen analysis, and repeat semen PCR for TB after 6 months. RESULTS: Fourteen subjects consented for inclusion in the study. One had a history of pulmonary TB 20 years earlier. Another patient was found to have mediastinal lymphadenopathy (tubercular. All except one had a normal semen analysis. None of the patients met the standard clinical criteria for GUTB diagnosis. 8 patients followed up at 6 months with repeat semen analysis, which was similar to the baseline values and no clinical evidence of TB. INTERPRETATION AND CONCLUSIONS: Asymptomatic men with positive screening semen PCR for TB do not have clinical evidence of TB. Male partners of women with infertility and GUTB should not be screened if they have no symptoms.

  10. Use of polymerase chain reaction in the diagnosis of Whipple's disease.

    Kono, Masanori; Yamamoto, Kei; Nagamatsu, Maki; Kutsuna, Satoshi

    2015-12-01

    Whipple's disease, a systemic, chronic infectious disease caused by Tropheryma whipplei, is extremely rare in Asian populations. A correct diagnosis is necessary due to its high mortality rate. Unfortunately, patients are apt to be misdiagnosed with connective tissue diseases since they typically present with arthritis or arthralgia. There are three diagnostic tools for Whipple's disease using intestinal tissues: 1) periodic acid-Schiff (PAS)-positive macrophages; 2) electron microscopic observation; and 3) polymerase chain reaction (PCR). It is challenging to diagnose this disease in the absence of histological findings, especially in Japan, where the clinical protocol currently used to make the diagnosis needs improvement, although symptomology and PCR results may be sufficient. Herein, we investigated a 24-year-old Japanese woman who had suffered from intermittent fever, migratory arthralgia, and watery diarrhea for several months. Her biopsied intestinal tissue was negative for foamy macrophages and PAS-positive cells, and electron microscopy did not provide diagnostic insight. PCR amplification of the specimens, however, successfully revealed T. whipplei. Whipple's disease was diagnosed based on a positive PCR result and strong clinical suspicion. The patient was treated parenterally with ceftriaxone (2 g daily) for two weeks, followed by oral treatment with 160 mg trimethoprim and 800 mg sulfamethoxazole twice per day. After one month of treatment, her symptoms disappeared and inflammatory markers returned to normal levels. This case illustrates the practicality and effectiveness of a PCR-based diagnostic test in combination with clinical suspicion to correctly diagnose Whipple's disease, especially in cases when a histological examination does not provide insight. PMID:26390825

  11. Detection of Listeria monocytogenes in salmon using the Probelia polymerase chain reaction system.

    Wan, Jason; King, Kerryn; Forsyth, Santina; Coventry, M John

    2003-03-01

    A validation was conducted on the performance of a commercially available polymerase chain reaction (PCR) kit (Probelia) in comparison with International Organization for Standardization (ISO) method 11290-1 (adopted as an Australian New Zealand Standard Method, AS/NZS 1766.2.16.1:1998) for the detection of Listeria monocytogenes in salmon samples. The validation was conducted following the guidelines of an Australian New Zealand Standard (Guide to Determining the Equivalence of Food Microbiology Test Methods, Part 1, Qualitative Tests, AS/NZS 4659.1:1999), which adopts an approach similar to that recommended by the Association of Analytical Communities Microbiology Method Validation Program for Performance Tested and Peer Verified Methods. The validation study involved the use of five cultures of L. monocytogenes, each challenged at a single level of inoculation into five different types of salmon samples. A total of 60 salmon samples (30 unchallenged and 30 challenged) were tested using both the PCR method and the ISO method. Results from this study indicated that the Probelia PCR method is equivalent to the ISO method. In addition, the detection sensitivity of the Probelia PCR system was determined as approximately 0.5 CFU per PCR assay (equivalent to 20 CFU/ml broth culture) for a pure culture of L. monocytogenes. The Probelia PCR method offers the advantage of detecting L. monocytogenes to genetic specificity within 48 to 50 h, whereas the ISO method requires 5 days for negative results with additional days for confirmed positive results by the use of other biochemical and cultural tests. PMID:12636297

  12. Application of the polymerase chain reaction and molecular probe technology for the diagnosis of tuberculosis

    Conventional methods for the diagnosis of tubercolosis based on microscopic examination and in vitro culture is both time consuming and tedious. Molecular methods of diagnosis have been suggested as an alternative which may provide the clinical laboratory with a means for rapid diagnosis. The present study was carried out to determined the feasibility of this approach for the detection of mycobacteria. Clinical specimens received from patients with suspected diagnosis of tuberculous infection were used. All specimens were examined microscopically and those that were smear positive were cultured. An aliquot of each specimen were kept for analysis by in vitro amplification using the polymerase chain reaction (PCR). The primers used for PCR were 20-mers specific for the insertion element IS986, which is restricted to the M. tuberculosis complex group. All specimens were analysed in quintriplicate, with 2 samples unspiked and 3 sampled spiked with M. tuberculosis. Appropriate positive and negative controls were included in all essays. Following amplification, the specimens were analysed by agarose gel electrophoresis (AGE). All specimens were further subject to hybridization studies using a specific radiolabelled probe. The sensitivity of the amplification assay coupled with visualization of the amplified targets using eithidium bromide staining was found to be about 1 fg of DNA. A total of 40 smear positive specimens were analyzed, 29 of which were culture positive. Twenty-eight of the 29 culture positive specimens tested positive by PCR/hybridization analysis. Of the 11 culture negative specimens, 9 were positive by PCR. Overall 37/40 (92.5%) specimens were positive by PCR/hybridization analysis. (author). 13 refs, 1 tab

  13. Use of Quantitative Polymerase Chain Reaction for Determining Copy Numbers of Transgenes in Lesquerella fendleri

    Grace Q. Chen

    2010-01-01

    Full Text Available Problem statement: In transgenic plants, the number of transgene copies could greatly influence the level of expression and genetic stability of the target gene, thus it is important to develop an efficient method for accurate estimation of transgene copies. The quantitative Polymerase Chain Reaction (qPCR technique is becoming more efficient nowadays to determine copy numbers of transgenes in transgenic plants, being used here, for the first time in quantifying copy numbers of transgenes in Lesquerella fendleri. Approach: The system utilized a known one copy gene, LfKCS4/5, from L. fendleri as an endogenous calibrator and the threshold Crossing point (Ct measured by Applied Biosystem 7500 system to calculate the copy numbers of transgenes in primary transgenic lines (T0 generation. Results: The qPCR condition was optimized and each primer set had a PCR efficiency of 0.99 or 1.01. Our data demonstrated unambiguous 2-fold discrimination of the copy number of β-glucuronidase gene (gusA and hygromycine phosphotransferase II (hptII genes in 12 T0 lines. Most of the lines contained one or two copies of each gene. Eight out of 12 samples (66.7% showed more copies of gusA gene than that of hptII gene, suggesting rearrangements of the Transferred (T-DNA. Possible modifications of the T-DNA cassette in L. fendleri are discussed based on main models of T-DNA integration in the plant genome. Conclusion: The qPCR described in this study is an efficient method and it is particularly useful in identification and selection of transgenic plants with desirable copy numbers at early stage.

  14. Human von Willebrand factor gene and pseudogene: Structural analysis and differentiation by polymerase chain reaction

    Structural analysis of the von Willebrand factor gene located on chromosome 12 is complicated by the presence of a partial unprocessed pseudogene on chromosome 22q11-13. The structures of the von Willebrand factor pseudogene and corresponding segment of the gene were determined, and methods were developed for the rapid differentiation of von Willebrand factor gene and pseudogene sequences. The pseudogene is 21-29 kilobases in length and corresponds to 12 exons (exons 23-34) of the von Willebrand factor gene. Approximately 21 kilobases of the gene and pseudogene were sequenced, including the 5' boundary of the pseudogene. The 3' boundary of the pseudogene lies within an 8-kb region corresponding to intron 34 of the gene. The presence of splice site and nonsense mutations suggests that the pseudogene cannot yield functional transcripts. The pseudogene has diverged ∼3.1% in nucleotide sequence from the gene. This suggests a recent evolutionary origin ∼19-29 million years ago, near the time of divergence of humans and apes from monkeys. Several repetitive sequences were identified, including 4 Alu, one Line-1, and several short simple sequence repeats. Several of these simple repeats differ in length between the gene and pseudogene and provide useful markers for distinguishing these loci. Sequence differences between the gene and pseudogene were exploited to design oligonucleotide primers for use in the polymerase chain reaction to selectivity amplify sequences corresponding to exons 23-34 from either the von Willebrand factor gene or the pseudogene. This method is useful for the analysis of gene defects in patients with von Willebrand disease, without interference from homologous sequences in the pseudogene

  15. Enhanced detection and serotyping of Streptococcus pneumoniae using multiplex polymerase chain reaction

    Jong Gyun Ahn

    2012-11-01

    Full Text Available &lt;B&gt;Purpose:&lt;/B&gt; Methods for quick and reliable detection of &lt;I&gt;Streptococcus pneumoniae&lt;/I&gt; are needed for the diagnosis of pneumococcal disease and vaccine studies. This study aimed to show that sequential multiplex polymerase chain reaction (PCR is more efficient than conventional culture in achieving &lt;I&gt;S. pneumoniae -positive&lt;/i&gt; results. &lt;B&gt;Methods:&lt;/B&gt; Nasopharyngeal (NP secretions were obtained from 842 pediatric patients admitted with lower respiratory infections at Severance Children’s Hospital in Korea between March 2009 and June 2010. For identification and serotype determination of pneumococci from the NP secretions, the secretions were evaluated via multiplex PCR technique with 35 serotype-specific primers arranged in 8 multiplex PCR sets and conventional bacteriological culture technique. &lt;B&gt;Results:&lt;/B&gt; Among the results for 793 samples that underwent both bacterial culture and PCR analysis for pneumococcal detection, 153 (19.3% results obtained by PCR and 81 (10.2% results obtained by conventional culture technique were positive for S. pneumoniae. The predominant serotypes observed, in order of decreasing frequency, were 19A (23%, 6A/B (16%, 19F (11%, 15B/C (5%, 15A (5%, and 11A (4%; further, 26% of the isolates were non-typeable. &lt;B&gt;Conclusion:&lt;/B&gt; As opposed to conventional bacteriological tests, PCR analysis can accurately and rapidly identify pneumococcal serotypes.

  16. Polymerase chain reaction targeting insertion sequence for the diagnosis of extrapulmonary tuberculosis

    V Makeshkumar

    2014-01-01

    Full Text Available Background & objectives: Diagnosis of extrapulmonary tuberculosis (EPTB is difficult using conventional diagnostic methods. This study was conducted to evaluate the use of polymerase chain reaction (PCR in diagnosis of definitive and probable extrapulmonary tuberculosis patients, and to assess the performance of insertion sequence (IS 6110 based PCR assay as compared to conventional culture by Lowenstein-Jensen (LJ method for the diagnosis of EPTB. Methods: A total of 178 non repeated clinical specimens were collected from clinically suspected extrapulmonary tuberculosis patients. The specimens included 59 ascitic fluid, 54 pleural fluid, 25 cerebrospinal fluid (CSF, 12 fine needle aspiration (FNA, 8 urine, 7 pus, 6 synovial fluid, 2 skin tissue, one pericardial fluid, one liver abscess, one pancreatic cyst fluid, one omental biopsy and one semen sample. All these clinical samples were subjected to Ziehl-Neelsen staining (ZN for acid fast bacilli (AFB and culture on LJ medium. PCR was performed by targeting 123bp fragment of insertion sequence IS6110 of Mycobacterium tuberculosis (MTB. Results: Of the 178 specimens, 10 (5.61% were ZN smear positive for AFB, six (3.37% were L-J culture positive from 10 AFB smear positive cases and 48 (26.96% were PCR IS 6110 positive for M. tuberculosis. Interpretation & conclusions: PCR using IS6110 primer was able to pick up more EPTB patients compared to conventional L-J culture method for detection of M. tuberculosis. False positive PCR IS6110 in three CSF samples may be due to latent TB infection which was limitation in this study.

  17. Use of the polymerase chain reaction to detect Mycobacterium leprae in urine

    K.R. Caleffi

    2012-02-01

    Full Text Available Leprosy is an infectious disease caused by Mycobacterium leprae. The polymerase chain reaction (PCR has been applied to detect M. leprae in different clinical samples and urine seems to be attractive for this purpose. PCR was used to improve the sensitivity for diagnosing leprosy by amplifying a 151-bp PCR fragment of the M. leprae pra gene (PCR-Pra in urine samples. Seventy-three leprosy patients (39 males and 34 females, 14 to 78 years old were selected for leprosy diagnosis at a reference laboratory in Maringá, PR, Brazil. Of these, 36 were under anti-leprosy multidrug therapy with dapsone and rifampicin for tuberculoid (TT and dapsone, rifampicin and clofazimine for borderline (BB and lepromatous (LL forms. The control group contained 50 healthy individuals without any clinical history of leprosy. DNA isolated from leprosy patients’ urine samples was successfully amplified by PCR-Pra in 46.6% (34/73 of the cases. The positivity of PCR-Pra for patients with the TT form was 75% for both patients under treatment and non-treated patients (P = 0.1306. In patients with the LL form, PCR-Pra positivity was 52 and 30% for patients under treatment and non-treated patients, respectively (P = 0.2386. PCR-Pra showed a statistically significant difference in detecting M. leprae between the TT and LL forms of leprosy in patients under treatment (P = 0.0033. Although the current study showed that the proposed PCR-Pra has some limitations in the detection of M. leprae, this method has the potential to be a useful tool for leprosy diagnosis mainly in TT leprosy where the AFB slit-skin smear is always negative.

  18. Identification of five highly priced tuna species by quantitative real-time polymerase chain reaction.

    Liu, Shasha; Xu, Kunhua; Wu, Zhigang; Xie, Xiao; Feng, Junli

    2016-09-01

    Tunas are economically important fishery worldwide, and are often used for commercial processed production. For effective fishery management and protection of consumers' rights, it is important to develop a molecular method to identify species in canned tuna products rapidly and reliably. Here, we have developed a duplex quantitative real-time PCR (qPCR) for identification of five highly priced tuna species (Thunnus maccoyii, Thunnus obesus, Thunnus albacares, Thunnus alalunga and Katsuwonus pelamis) from processed as well as fresh fish. After amplification and sequencing of seven genetic markers commonly used for species identification, 16S rDNA and control region (CR) of mitochondrial DNA were selected as the reference gene markers for genus Thunnus and tuna species identification, respectively. Subsequently, a 73 bp fragment of 16S rDNA and 85-99 bp fragment of CR were simultaneously amplified from each target species by qPCR. The qPCR efficiency of each reaction was calculated according to the standard curves, and the method was validated by amplification DNA extracted from single or mixed tuna specimen. The developed duplex qPCR system was applied to authenticate species of 14 commercial tuna products successfully, which demonstrated it was really a useful and academic technique to identify highly priced tuna species. PMID:25714139

  19. Construction of Network Management Information System of Agricultural Products Supply Chain Based on 3PLs

    2010-01-01

    The necessity to construct the network management information system of 3PLs agricultural supply chain is analyzed,showing that 3PLs can improve the overall competitive advantage of agricultural supply chain.3PLs changes the homogeneity management into specialized management of logistics service and achieves the alliance of the subjects at different nodes of agricultural products supply chain.Network management information system structure of agricultural products supply chain based on 3PLs is constructed,including the four layers (the network communication layer,the hardware and software environment layer,the database layer,and the application layer) and 7 function modules (centralized control,transportation process management,material and vehicle scheduling,customer relationship,storage management,customer inquiry,and financial management).Framework for the network management information system of agricultural products supply chain based on 3PLs is put forward.The management of 3PLs mainly includes purchasing management,supplier relationship management,planning management,customer relationship management,storage management and distribution management.Thus,a management system of internal and external integrated agricultural enterprises is obtained.The network management information system of agricultural products supply chain based on 3PLs has realized the effective sharing of enterprise information of agricultural products supply chain at different nodes,establishing a long-term partnership revolving around the 3PLs core enterprise,as well as a supply chain with stable relationship based on the supply chain network system,so as to improve the circulation efficiency of agricultural products,and to explore the sales market for agricultural products.

  20. Λ-hypernucleus production in proton-induced reaction

    The Λ-hypernucleus (LHN) production in the proton-induced reaction is studied in the distorted wave impulse approximation(DWIA). The cross sections for the LHN production in the reactions where the proton bombards the 6Li, 12C and 16O targets, respectively, are calculated. It is shown that the reaction cross sections are of the order of µb, and the distortion effects tend to reduce the cross sections by a factor of 3~10. For the sΛ–LHN production, the differential cross section is decreased with the increasing mass of the target nucleus. The pΛ–LHN production cross section is normally higher than that for the sΛ–LHN production. The double differential cross sections (DDXS) with respect to the momenta of the outgoing proton and kaon are also demonstrated. The missing mass spectra of the inclusive reaction p+A → p+K++X for the 6Li, 12C and 16O targets, an alternative way to study hypernuclear physics, are proposed. From these spectra, the masses of LHN can accurately be extracted. Moreover, the exotic LHN production in the same type of reaction is also studied . The same physical quantities are calculated. It is shown that the magnitude of the cross section is also in the order of µb. The halo effect of the core nucleus that locates at a place far away from the stable line would make the wave function broader, and consequently reduces the production cross section. (author)

  1. Density functional computational studies on the glucose and glycine Maillard reaction: Formation of the Amadori rearrangement products

    Jalbout, Abraham F.; Roy, Amlan K.; Shipar, Abul Haider; Ahmed, M. Samsuddin

    Theoretical energy changes of various intermediates leading to the formation of the Amadori rearrangement products (ARPs) under different mechanistic assumptions have been calculated, by using open chain glucose (O-Glu)/closed chain glucose (A-Glu and B-Glu) and glycine (Gly) as a model for the Maillard reaction. Density functional theory (DFT) computations have been applied on the proposed mechanisms under different pH conditions. Thus, the possibility of the formation of different compounds and electronic energy changes for different steps in the proposed mechanisms has been evaluated. B-Glu has been found to be more efficient than A-Glu, and A-Glu has been found more efficient than O-Glu in the reaction. The reaction under basic condition is the most favorable for the formation of ARPs. Other reaction pathways have been computed and discussed in this work.0

  2. In vitro degradation and total gas production of byproducts generated in the biodiesel production chain

    Raissa Kiara oliveira de Morais

    2015-05-01

    Full Text Available This study aimed to evaluate the in vitro degradation and total gas production of different oil seed press cakes from a biodiesel production chain gas through the use of a semi-automatic technique of gas production in vitro. The treatments consisted of substituting elephant grass in increasing levels, 0%, 30, 50 and 70%, with the byproducts of Gossyypium hirsutum, Ricinus communis, Moringa oleifeira, Jatropha curcas and Helianthus annus. The oil seed press cakes of Moringa oleifeira had the highest rate of in vitro degradation of dry matter compared with other foods but did not result in a higher final volume of gases production. Gossyypium hirsutum, Pinhão manso curcas and Ricinus communis showed a higher in vitro degradability of similar dry matter. The highest total gas production was obtained by the oil seed press cakes of Helianthus annus. The oil seed press cakes of Moringa oleifeira can replace elephant grass up to 70% and therefore reduce both greenhouse gas emissions and energy loss for the animal.

  3. Analysis of Product Complexity considering Disruption Cost in Fast Fashion Supply Chain

    Shaheen Sardar

    2015-01-01

    Full Text Available Outsourcing in the textile industry has been playing an important role in the global economy for six decades. Recently, reshoring is an emerging trend due to various complexities involved in supply chain management. As compared with basic textile and apparel products, fast fashion products are complex in their own way. A single assortment contains several new styles, colors, and sizes with unpredictable demand and urgent deadlines. Numerous assortments run simultaneously in the supply chain. For each assortment, the garment manufacturer has to source various types of fabrics and materials from different suppliers and then manufacture the garments to ship within the deadlines. This complexity contributes to supply chain disruption. This paper develops a model to estimate supply chain disruption cost as a function of fast fashion product complexity in the global outsourcing environment. Estimation of disruption cost will help us to increase visibility and eliminate the bottlenecks in supply chain. Model conclusions are used to develop a method to manage the level of product complexity from the global supply chain perspective. Several strategies are proposed to manage the impact of product complexity on supply chain design.

  4. Polymerase Chain Reaction-based Suppression of Repetitive Sequences in Whole Chromosome Painting Probes for FISH

    Dugan, L C; Pattee, M; Williams, J; Eklund, M; Bedford, J S; Christian, A T

    2004-04-21

    We have developed a method to suppress the PCR amplification of repetitive sequences in whole chromosome painting probes by adding Cot-1 DNA to the amplification mixture. The repetitive sequences in the Cot-1 DNA bind to their homologous sequences in the probe library, prevent the binding of primers, and interfere with extension of the probe sequences, greatly decreasing PCR efficiency selectively across these blocked regions. A second labeling reaction is then done and this product is resuspended in FISH hybridization mixture without further addition of blocking DNA. The hybridization produces little if any non-specific binding on any other chromosomes. We have been able to successfully use this procedure with both human and rat chromosome probes. This technique should be applicable in producing probes for CGH, M-FISH and SKY, as well as reducing the presence of repetitive DNA in genomic libraries.

  5. A Novel Evaluation Indicator System and Evaluation Method for Supply Chain Performance of Food Production

    Zhai Xiyao

    2015-02-01

    Full Text Available Supply chain performance evaluation is a research hotspot and lies in the core status in supply chain management. The study presents a new evaluation indicator system and evaluation algorithm for supply chain performance. First, the balanced score card is used to construct an evaluation indicator system for supply chain performance evaluation through analyzing the basic principle and connotation characteristics of supply chain management; Second analytic hierarchy process and fuzzy comprehensive evaluation algorithms are combined to satisfy the dynamic, subjective and transitional characteristics of evaluation indicators and improve evaluation accuracy. Thirdly the evaluation indicator system and evaluation algorithm are used in supply chain performance evaluation of fresh food products and the experimental results shows that the presented evaluation indicator system and evaluation algorithm has satisfied validity and feasibility.

  6. Variations in product in reactions of naphthoquinone with primary amines

    Barooah Nilotpal

    2007-03-01

    Full Text Available Abstract Reaction of 1,2-naphthoquinone with primary amines gives a 2-amino-1,4-naphthoquinone derivative which is equivalent to 1,2 to 1,4 carbonyl transposition. For example the reaction of 1,2-naphthoquinone with 4-methoxyaniline gives 2-(4-methoxyanilino-naphthoquinone-1,4-(4-methoxyanil (1 and with n-butylamine gives 2-(butylamino-naphthoquinone-1,4-butylimine (2 respectively. The compounds 1 and 2 are characterized by X-ray crystallography; they have hydrogen-bonded dimeric structures. Similar reaction of 1,4-naphthoquinone with 3-picolylamine and 4-picolylamine gives the corresponding 2-amino 1,4-naphthoquinones; two products are characterized by X-ray crystallography. The reaction of 1,4-naphthoquinone with 4-aminothiophenol and 1,4-naphthoquinone with 4-aminophenol are compared. The former leads to C-S and the latter to C-N bond formation. The reaction of 1,4-naphthoquinone with 4-aminothiophenol in an NMR tube is studied to explain that 2-(4-anilinothiolato 1,4-naphthoquinone derivative to be the sole product in the reaction.

  7. Technical manual for basic version of the Markov chain nest productivity model (MCnest)

    The Markov Chain Nest Productivity Model (or MCnest) integrates existing toxicity information from three standardized avian toxicity tests with information on species life history and the timing of pesticide applications relative to the timing of avian breeding seasons to quantit...

  8. User’s manual for basic version of MCnest Markov chain nest productivity model

    The Markov Chain Nest Productivity Model (or MCnest) integrates existing toxicity information from three standardized avian toxicity tests with information on species life history and the timing of pesticide applications relative to the timing of avian breeding seasons to quantit...

  9. Pea (Pisum sativum) genes involved in symbiosis with nitrogen-fixing bacteria.1.Analysis of the expression of the early nodulin gene ENOD12 using the polymerase chain-reaction

    Zalenskii, A.O.; Kozik, A.V.; Scheres, B.J.G.; Bisseling, A.; Tikhonovich, I.A.

    1991-01-01

    The polymerase chain reaction (PCR) was used to detect the transcription products of the early nodulin gene in the pea. Single-stranded DNA copies were prepared using a primer corresponding to the terminal part of a previously sequenced cDNA clone and a total RNA isolate. The presence of amplificati

  10. Managing product returns to achieve supply chain sustainability

    Shaharudin, Mohd Rizaimy; Govindan, Kannan; Zailani, Suhaiza;

    2015-01-01

    established a product returns management program to handle three types of product returns found in their organizations. This is not surprising because successful product returns management has a number of internal and external benefits to the firms. Our interviews also uncover that the abundant amount of......Abstract The aim of this article is to develop research propositions for product returns management using the Institutional Theory (INT) as the foundation for the study. The paper culminates with a research model based on this theoretical perspective to examine the input and output of product...... product returns is pressing these companies to implement an effective product returns management program. Based on the primary and secondary data collected in this study, three propositions are developed for future research, which should be tested with a large empirical data set to strengthen the...

  11. Mathematical supply-chain modelling: Product analysis of cost and time

    Establishing a mathematical supply-chain model is a proposition that has received attention due to its inherent benefits of evolving global supply-chain efficiencies. This paper discusses the prevailing relationships found within apparel supply-chain environments, and contemplates the complex issues indicated for constituting a mathematical model. Principal results identified within the data suggest, that the multifarious nature of global supply-chain activities require a degree of simplification in order to fully dilate the necessary factors which affect, each sub-section of the chain. Subsequently, the research findings allowed the division of supply-chain components into sub-sections, which amassed a coherent method of product development activity. Concurrently, the supply-chain model was found to allow systematic mathematical formulae analysis, of cost and time, within the multiple contexts of each subsection encountered. The paper indicates the supply-chain model structure, the mathematics, and considers how product analysis of cost and time can improve the comprehension of product lifecycle management

  12. Acid-catalyzed reactions of hexanal on sulfuric acid particles: Identification of reaction products

    Garland, Rebecca M.; Elrod, Matthew J.; Kincaid, Kristi; Beaver, Melinda R.; Jimenez, Jose L.; Tolbert, Margaret A.

    While it is well established that organics compose a large fraction of the atmospheric aerosol mass, the mechanisms through which organics are incorporated into atmospheric aerosols are not well understood. Acid-catalyzed reactions of compounds with carbonyl groups have recently been suggested as important pathways for transfer of volatile organics into acidic aerosols. In the present study, we use the aerodyne aerosol mass spectrometer (AMS) to probe the uptake of gas-phase hexanal into ammonium sulfate and sulfuric acid aerosols. While both deliquesced and dry non-acidic ammonium sulfate aerosols showed no organic uptake, the acidic aerosols took up substantial amounts of organic material when exposed to hexanal vapor. Further, we used 1H-NMR, Fourier transform infrared (FTIR) spectroscopy and GC-MS to identify the products of the acid-catalyzed reaction of hexanal in acidic aerosols. Both aldol condensation and hemiacetal products were identified, with the dominant reaction products dependent upon the initial acid concentration of the aerosol. The aldol condensation product was formed only at initial concentrations of 75-96 wt% sulfuric acid in water. The hemiacetal was produced at all sulfuric acid concentrations studied, 30-96 wt% sulfuric acid in water. Aerosols up to 88.4 wt% organic/11.1 wt% H 2SO 4/0.5 wt% water were produced via these two dimerization reaction pathways. The UV-VIS spectrum of the isolated aldol condensation product, 2-butyl 2-octenal, extends into the visible region, suggesting these reactions may impact aerosol optical properties as well as aerosol composition. In contrast to previous suggestions, no polymerization of hexanal or its products was observed at any sulfuric acid concentration studied, from 30 to 96 wt% in water.

  13. Innovation in a multiple-stage, multiple-product food marketing chain

    Baker, Alister Derek; Christensen, Tove

    A model of a 3-stage food marketing chain is presented for the case of two products. Its extension of existing work is its capacity to examine non-competitive input and output markets in two marketing chains at once, and have them related by demand and cost interactions. The simulated impacts of...... market power in a single chain generally reproduce those delivered by previous authors. The impacts of market power in related chains are found to depend on linkages between chains in terms of interactions in consumer demand. Interactions between products in costs (economies of scope) generate an...... interesting result in that a possible market failure is identified that may be offset by the exercise of market power. The generation of farm-level innovation is seen to be largely unaffected by market power, but where market power is exercised the benefits are extracted from farmers and consumers. The...

  14. Supply Chain Management for Servitized Products: A multi-industry case study

    Johnson, Mark; Mena, Carlos

    2008-01-01

    Manufacturers are combining products and services in order to provide greater value to the customer and to facilitate longer more profitable business relationships. Organisations that pursue this route are following a strategy of servitization which requires the effective management of supply chains. A framework was developed from the extant literature that was used as a lens for the analysis of supply chains for servitized products. This research uses case studies to explor...

  15. An agile supply chain for a project-oriented steel product network

    Iskanius, P. (Päivi)

    2006-01-01

    Abstract Agility – namely, the ability of a supply chain to rapidly respond to changes in market and customer demands – is regarded as the bearer of competitive advantage in today's business world. The need for agility has traditionally been associated with supply chains in high technology industry products. However, traditional industries also face similar challenges in terms of speed, flexibility, increased product diversity and customization. This study contributes to the discussion on ...

  16. Limitations of Certification and Supply Chain Standards for Environmental Protection in Commodity Crop Production

    Kurt B. Waldman; John M. Kerr

    2014-01-01

    Motivated by recent increases in water pollution in major US agricultural watersheds and by the shortcomings of government programs to control non–point source pollution, this paper examines the prospects for using product certification (ecolabeling) and business-to-business supply chain standards for environmental protection in commodity crop production. We introduce the sources of demand for certification and supply chain standards and the political and economic context in which they have e...

  17. Supply Chain Coordination with Demand Disruptions under Convex Production Cost Function

    XU Ming-hui; GAO Cheng-xiu

    2005-01-01

    This paper investigates the problem of how to handling demand disruptions in a one-supplier-one-retailer supply chain, where production cost is a convex function of production quantity andprice-demand relationship is linear. Our results show that, if demand is disrupted, under the new price-demand relationship, all-unit wholesale quantity discount policies combining capacitated linear pricingpolicies can also fully coordinate the supply chain.

  18. An integrated multi-stage supply chain inventory model with imperfect production process

    Soumita Kundu; Tripti Chakrabarti

    2015-01-01

    This paper deals with an integrated multi-stage supply chain inventory model with the objective of cost minimization by synchronizing the replenishment decisions for procurement, production and delivery activities. The supply chain structure examined here consists of a single manufacturer with multi-buyer where manufacturer orders a fixed quantity of raw material from outside suppliers, processes the materials and delivers the finished products in unequal shipments to each customer. In this p...

  19. Supply Chain Design for High Quality Products: Economic Concepts and Examples form the United States

    King, Robert P.

    2002-01-01

    The food system is undergoing significant structural change at local, national, and international levels. As the food system evolves, some segments along the chain between producers and consumers are disappearing. Others are being transformed. Supply chain concepts are useful for identifying and assessing alternative designs for the reconfiguration of food product production systems. Changes in the food system will require farm managers to adopt new ways of thinking and new perspectives on co...

  20. The identification of zones of amplification of disruptions in network supply chains of metallurgic products

    M. Kramarz

    2015-01-01

    Full Text Available An increase in the number of participants in a supply chain and network relations results in an increase in the complexity of the entire logistic and production system. Consequently, there appear additional potential sources of disruptions in material flows. The aim of the research presented in the article is to identify the zones of amplification of disruptions in network supply chains of metallurgic products.

  1. The vinylogous Mukaiyama aldol reaction (VMAR) in natural product synthesis

    Kalesse, Markus; Cordes, Martin; Symkenberg, Gerrit; Lu, Hai-Hua

    2014-01-01

    The vinylogous Mukaiyama aldol reaction (VMAR) allows efficient access to larger segments for complex natural product synthesis, primarily polyketides, through the construction of vicinal hydroxyl and methyl groups as well as di and tri-substituted double bonds in one single operation. In this review, we will highlight stereoselective protocols that have been used in natural product synthesis and cluster them into the four groups that can be obtained from different silyl ketene acetals or eno...

  2. Stochastic aspects of multiparticle production in relativistic nuclear reactions

    Midrapidity multiparticle production process in ordinary hadron and heavy-ion induced reactions at sufficiently high incident energies are analyzed. It is shown that stochastic aspects of multiparticle production process in relativistic range plays a dominating role in understanding the observable phenomena. The basic idea and the main results of the multisource model for hadron-nucleus and nucleus-nucleus collisions are shown. The concept of the NES (number of effective sources) scaling is discussed. 16 refs.; 7 figs

  3. Measurement of exclusive eta' production in γγ reactions

    We observe γγ->eta' production in the reaction e+e- -> e+e-π+π-γ. We measure the product GAMMAsub(γγ)(eta')B(eta' -> rho0γ) to be 1.14+-0.08+-0.11 keV. A first measurement of the γγ->eta' transition form factor is made for Q2 up to 1 GeV2. (orig.)

  4. Identification of HIV-1 Genotypic Resistance in Patients on First-line Antiretroviral Therapy Using Polymerase Chain Reaction and Sequencing

    Jiang Xiao; Gui-ju Gao; Hong-xin Zhao; Yan-mei Li; Ying-xiu Huang; Wen Zhang; Wen-jing Su; Wei Zhang; Ning Han; Di Yang; Xin Li

    2013-01-01

    Objective The aim of the study was to evaluate the characteristics of HIV drug-genotypic resistance among patients taking ifrst-line ARV regimens using polymerase chain reaction and sequencing, and guide to design optimal ARV regimens for these patients. Methods HIV reverse transcriptase-encoded gene was ampliifed with RT-PCR and ampliifed PCR products were aligned and comparatively analyzed with HIV resistance database to ifnd drug-resistance mutations. Results Twenty-eight PCR products were amplified and sequenced successfully in 30 serum samples of recruited HIV-infected patients with virologic failure. The resistance rate was 96%, mutations in NRT region were found in 26 patients (93%), while mutations in NNRT region were found in 27 patients (96%). M184V was the most common mutation (86%), K65R was selected in 14%of recruited individuals and TAMs occurred in 50%of patients, which resulted in resistance to NRTIs. Y181C and V179D were the most common mutations in NNRTIs and prevalence was 43%(12/28) and 36%(10/28), respectively, which resulted in cross-resistance to NNRTIs due to low-genetic barrier. Conclusions Virologic failure may occur in long-term administration of ifrst-line ARV regimens, and drug-resistance mutations can be found in these patients, which resulted in resistance to ifrst-line ARV regimens. We emphasized that HIV viral load assay and resistance assay were important tools to guide healthcare workers to design an optimal second-line ARV regimens for HAART-experienced individuals with virologic failure.

  5. Multiplex quantification of 12 European Union authorized genetically modified maize lines with droplet digital polymerase chain reaction.

    Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Holst-Jensen, Arne; Žel, Jana

    2015-08-18

    Presence of genetically modified organisms (GMO) in food and feed products is regulated in many countries. The European Union (EU) has implemented a threshold for labeling of products containing more than 0.9% of authorized GMOs per ingredient. As the number of GMOs has increased over time, standard-curve based simplex quantitative polymerase chain reaction (qPCR) analyses are no longer sufficiently cost-effective, despite widespread use of initial PCR based screenings. Newly developed GMO detection methods, also multiplex methods, are mostly focused on screening and detection but not quantification. On the basis of droplet digital PCR (ddPCR) technology, multiplex assays for quantification of all 12 EU authorized GM maize lines (per April first 2015) were developed. Because of high sequence similarity of some of the 12 GM targets, two separate multiplex assays were needed. In both assays (4-plex and 10-plex), the transgenes were labeled with one fluorescence reporter and the endogene with another (GMO concentration = transgene/endogene ratio). It was shown that both multiplex assays produce specific results and that performance parameters such as limit of quantification, repeatability, and trueness comply with international recommendations for GMO quantification methods. Moreover, for samples containing GMOs, the throughput and cost-effectiveness is significantly improved compared to qPCR. Thus, it was concluded that the multiplex ddPCR assays could be applied for routine quantification of 12 EU authorized GM maize lines. In case of new authorizations, the events can easily be added to the existing multiplex assays. The presented principle of quantitative multiplexing can be applied to any other domain. PMID:26169291

  6. Differential detection of Entamoeba histolytica from Entamoeba dispar by parasitological and nested multiplex polymerase chain reaction methods

    esmaiel fallah

    2014-02-01

    Full Text Available Introduction: Amebiasis is an intestinal illness caused by a one-celled parasite (amoeba called Entamoeba (E histolytica. E histolytica and E dispar are morphologicallyundistinguishable but have genetic and functional differences. E. histolytica is invasive andcause amoebiasis, but E dispar cause an asymptomatic colonization which does not need to bemedically treated. We have performed a nested multiplex Polymerase Chain Reaction (PCRtargeting small subunit rRNA (Ribosomal ribonucleic acid gene for differential detection of Ehistolytica and E dispar directly from stool samples. Methods: All the fecal samples collected without preservation and were screened for amebiccells by parasitological methods. Fecal samples that containing amebic cells were stored at -20ºC until DNA extraction. DNA extraction was down by using a DNA extraction kit. Thegenus specific primers were designed using nucleotide sequences of 18S-rRNA gene ofEntamoeba. Results: Thirty one (4.28% stool samples out of 724 samples were positive for E histolytica/E dispar. The nested multiplex PCR illustrated that the size of diagnostic fragments of PCR products was obviously different for two Entamoeba species, the specific product size for Ehistolytica and E dispar was 439 and 174 bp. The nested multiplex PCR was positive in 25 outof 31 stool specimens that 17 (54.8% samples were positive for E dispar and 8 (25.8%samples were positive for E histolytica. Conclusion: Nested multiplex PCR was useful for the specific detection of E histolytica and Edispar in stool samples. In current study we detected that E dispar was more prevalent in our study area.

  7. Strangeness production and hypernucleus formation in antiproton induced reactions

    Feng, Zhao-Qing

    2015-01-01

    Formation mechanism of fragments with strangeness in collisions of antiprotons on nuclei has been investigated within the Lanzhou quantum molecular dynamics (LQMD) transport approach combined with a statistical model (GEMINI) for describing the decays of excited fragments. Production of strange particles in the antiproton induced nuclear reactions is modeled within the LQMD model, in which all possible reaction channels such as elastic scattering, annihilation, charge exchange and inelastic scattering in antibaryon-baryon, baryon-baryon and meson-baryon collisions have been included. A coalescence approach is developed for constructing hyperfragments in phase space after de-excitation of nucleonic fragments. The combined approach could describe the production of fragments in low-energy antiproton induced reactions. Hyperfragments are formed within the narrower rapidities and lower kinetic energies. It has advantage to produce heavier hyperfragments and hypernuclides with strangeness s=-2 (double-$\\Lambda$ fra...

  8. Chain extension and branching of poly(L-lactic acid produced by reaction with a DGEBA-based epoxy resin

    2007-11-01

    Full Text Available Dicarboxylated poly(L-lactic acid (PLLA was synthesized by reacting succinic anhydride with L-lactic acid prepolymer prepared by melt polycondensation. PLLA and epoxy resin based on diglycidyl ether of bisphenol A (DGEBA copolymers were prepared by chain extension of dicarboxylated PLLA with DGEBA. Infrared spectra confirmed the formation of dicarboxylated PLLA and PLLA/DGEBA copolymer. Influences of reaction temperature, reaction time, and the amount of DGEBA on the molecular weight and gel content of PLLA/DGEBA copolymer were studied. The viscosity average molecular weight of PLLA/DGEBA copolymer reached 87 900 when reaction temperature, reaction time, and mol ratio of dicarboxylated PLLA to DGEBA is 150°C, 30 min, and 1:1 respectively, while gel content of PLLA/DGEBA copolymer is almost zero.

  9. Chain Map for 'Koopmans Meel' [production of flour]; Ketenmap Koopmans Meel

    Greeve, J. [E kwadraat advies, Leeuwarden (Netherlands)

    2010-06-15

    This chain map provides insight into energy consumption and greenhouse gas emissions of the entire chain of the flour produced by Koopmans Flour (from production to consumption). With this knowledge, a start can be made to make the bread production chain more sustainable [Dutch] Deze ketenkaart verschaft inzicht in het energieverbruik en de emissie van broeikasgassen van de gehele keten van de door Koopmans Meel geproduceerde bloem (van productie tot en met consumptie). Met deze kennis kan een begin gemaakt worden van de verduurzaming van de broodketen.

  10. Information Supply Chain for Offshore Oil and Gas Production

    Lauritsen, Ole Martin

    2009-01-01

    Commercial oil and gas production is one of the world s biggest industries and has activities all over the planet. When operating in a huge and widespread business environment it is challenging for central management and decision makers to keep track of all the company s activities. Real-time information about production operations and activities is fundamental for all decision making, future projections and risk management. In the international world of oil and gas production, standard metho...

  11. An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction

    Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu

    2016-04-01

    A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

  12. Predators of Anopheles gambiae sensu lato (Diptera: Culicidae) larvae in wetlands, western Kenya: confirmation by polymerase chain reaction method.

    Ohba, Shin-Ya; Kawada, Hitoshi; Dida, Gabriel O; Juma, Duncan; Sonye, Gorge; Minakawa, Noboru; Takagi, Masahiro

    2010-09-01

    Polymerase chain reaction analysis was performed to determine whether mosquito predators in wetland habitats feed on Anopheles gambiae sensu lato (s.l.) larvae. Aquatic mosquito predators were collected from six wetlands near Lake Victoria in Mbita, Western Kenya. This study revealed that the whole positive rate of An. gambiae s.l. from 330 predators was 54.2%. The order of positive rate was the highest in Odonata (70.2%), followed by Hemiptera (62.8%), Amphibia (41.7%), and Coleoptera (18%). This study demonstrates that the polymerase chain reaction method can determine whether aquatic mosquito predators feed on An. gambiae s.l. larvae if the predators have undigested An. gambiae s.l. in their midgut or stomach. PMID:20939371

  13. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    Abdulmawjood, A.; Bulte, M.; Roth, S.;

    2004-01-01

    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The...... selectivity of the assay was evaluated against 155 strains, including 32 E. coli O157, 38 E. coli non-O157, and 85 non-E. coli. It was shown to be highly inclusive (100%) and exclusive (100%). The assay has a 100% detection probability of approximately 2 x 10(3) cells per reaction....

  14. Identification of four squid species by quantitative real-time polymerase chain reaction.

    Ye, Jian; Feng, Junli; Liu, Shasha; Zhang, Yanping; Jiang, Xiaona; Dai, Zhiyuan

    2016-02-01

    Squids are distributed worldwide, including many species of commercial importance, and they are often made into varieties of flavor foods. The rapid identification methods for squid species especially their processed products, however, have not been well developed. In this study, quantitative real-time PCR (qPCR) systems based on specific primers and TaqMan probes have been established for rapid and accurate identification of four common squid species (Ommastrephes bartramii, Dosidicus gigas, Illex argentinus, Todarodes pacificus) in Chinese domestic market. After analyzing mitochondrial genes reported in GenBank, the mitochondrial cytochrome b (Cytb) gene was selected for O. bartramii detection, cytochrome c oxidase subunit I (COI) gene for D. gigas and T. Pacificus detection, ATPase subunit 6 (ATPase 6) gene for I. Argentinus detection, and 12S ribosomal RNA (12S rDNA) gene for designing Ommastrephidae-specific primers and probe. As a result, all the TaqMan systems are of good performance, and efficiency of each reaction was calculated by making standard curves. This method could detect target species either in single or mixed squid specimen, and it was applied to identify 12 squid processed products successfully. Thus, it would play an important role in fulfilling labeling regulations and squid fishery control. PMID:26772407

  15. Large-Scale Refolding and Enzyme Reaction of Human Preproinsulin for Production of Human Insulin.

    Kim, Chang-Kyu; Lee, Seung-Bae; Son, Young-Jin

    2015-10-28

    Human insulin is composed of 21 amino acids of an A-chain and 30 amino acids of a B-chain. This is the protein hormone that has the role of blood sugar control. When the recombinant human proinsulin is expressed in Escherichia coli, a serious problem is the formation of an inclusion body. Therefore, the inclusion body must be denatured and refolded under chaotropic agents and suitable reductants. In this study, H27R-proinsulin was refolded from the denatured form with β-mercaptoethanol and urea. The refolding reaction was completed after 15 h at 15°C, whereas the reaction at 25°C was faster than that at 15°C. The refolding yield at 15°C was 17% higher than that at 25°C. The refolding reaction could be carried out at a high protein concentration (2 g/l) using direct refolding without sulfonation. The most economical and optimal refolding condition for human preproinsulin was 1.5 g/l protein, 10 mM glycine buffer containing 0.6 M urea, pH 10.6, and 0.3 mM β-mercaptoethanol at 15°C for 16 h. The maximum refolding yield was 74.8% at 15°C with 1.5 g/l protein. Moreover, the refolded preproinsulin could be converted into normal mature insulin with two enzymes. The average amount of human insulin was 138.2 g from 200 L of fermentation broth after enzyme reaction with H27R-proinsulin. The direct refolding process for H27R-proinsulin was successfully set up without sulfonation. The step yields for refolding and enzyme reaction were comparatively high. Therefore, our refolding process for production of recombinant insulin may be beneficial to the large-scale production of other biologically active proteins. PMID:26139616

  16. Peripheral Blood Leukocytes and Serum Nested Polymerase Chain Reaction Are Complementary Methods for Monitoring Active Cytomegalovirus Infection in Transplant Patients

    PD Andrade

    2013-01-01

    Full Text Available BACKGROUND: Human cytomegalovirus is an important cause of morbidity and mortality in immunocompromised patients. Qualitative polymerase chain reaction (PCR has proven to be a sensitive and effective technique in defining active cytomegalovirus infection, in addition to having low cost and being a useful test for situations in which there is no need for quantification. Real-time PCR has the advantage of quantification; however, the high cost of this methodology makes it impractical for routine use.

  17. Detection of African swine fever virus from formalin fixed and non-fixed tissues by polymerase chain reaction

    P. D. Luka; A. R. Jambol; B. Yakubu

    2014-01-01

    Aim: Formalin fixing and paraffin embedding of tissue samples is one of the techniques for preserving the structural integrity of cells for a very long time. However, extraction and analysis of genomic material from formalin fixed tissue (FFT) remains a challenge despite numerous attempts to develop a more effective method. The success of polymerase chain reaction (PCR) depends on the quality of DNA extract. Materials and Methods: Here we assessed the conventional method of DNA extraction ...

  18. Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK

    Kosuke Nakamura

    2016-06-01

    Real-time polymerase chain reaction (PCR detection method for unauthorized genetically modified (GM papaya (Carica papaya L. line PRSV-YK (PRSV-YK detection method was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976. Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.

  19. Detection of Avibacterium paragallinarum by Polymerase chain reaction from outbreaks of Infectious coryza of poultry in Andhra Pradesh

    T. M. Nabeel Muhammad; Sreedevi, B.

    2015-01-01

    Aim: This study was carried out for the detection of Avibacterium paragallinarum from outbreaks of infectious coryza of poultry Materials and Methods: The polymerase chain reaction (PCR) was standardized for the diagnosis of infectious coryza by using infectious coryza Killed vaccine, ventri biologicals, Pune as source of DNA of A. paragallinarum. Five outbreaks of infectious coryza from Andhra Pradesh were investigated in the present study. A total of 56 infra orbital sinus swabs and 22 nasa...

  20. Alteration in sample preparation to increase the yield of multiplex Polymerase Chain Reaction assay for diagnosis of genital ulcer disease

    Rao, G.; A Das; Prabhakar, P.; V Nema; Risbud, A. R.

    2013-01-01

    Purpose: Genital Ulcer Disease (GUD) is common sexually transmitted infection (STI). Multiple studies have shown that GUDs are strongly associated with the transmission and the acquisition of HIV infection. An accurate diagnosis of common etiology of GUD namely Herpes, syphilis and Chancroid is possible using Multiplex PCR (M-PCR). However, frequent presence of Polymerase Chain Reaction inhibitors in the ulcer swab specimen limits the performance of the assay. In order to overcome this proble...