Polymerase chain reaction methods (PCR in agrobiotechnology
Directory of Open Access Journals (Sweden)
Taški-Ajduković Ksenija
2006-01-01
Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.
Comparison of polymerase chain reaction (PCR) and loop-mediated ...
African Journals Online (AJOL)
Comparison of polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) for diagnosis of Fusarium solani in human immunodeficiency virus (HIV) positive patients. ... The test was carried out in 1 h reaction at 65°C in a heater block. The specificity of the test was 100% and its sensitivity was a ...
Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data
Ramakers, Christian; Ruijter, Jan M.; Deprez, Ronald H. Lekanne; Moorman, Antoon F. M.
2003-01-01
Quantification of mRNAs using real-time polymerase chain reaction (PCR) by monitoring the product formation with the fluorescent dye SYBR Green I is being extensively used in neurosciences, developmental biology, and medical diagnostics. Most PCR data analysis procedures assume that the PCR
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
Role of Polymerase Chain Reaction (PCR) in the detection of ...
African Journals Online (AJOL)
Background: Staphylococcus aureus is mainly acquired from hospital infections and demonstrated the ability of developing resistance to many antibiotics. Polymerase Chain Reaction (PCR) was used to identify antibiotic-resistant isolates. This study was conducted in Al-Mujtahed, Al-Mouwasat and the Children Hospitals in ...
Polymerase Chain Reaction (PCR) provides a superior tool for the ...
African Journals Online (AJOL)
Polymerase Chain Reaction (PCR) provides a superior tool for the diagnosis of Pneumococcal Infection in Burkina Faso. Y Chaibou, M Congo/Ouedraogo, I Sanou, H Somlare, K Ouattara, CM Kienou, H Belem, E Sampo, SA Traore, R Traore/Ouedraogo, C Hatcher, L Mayer, X Wang, L Sangare ...
Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique
İLHAK, O. İrfan; ARSLAN, Ali
2014-01-01
The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...
Directory of Open Access Journals (Sweden)
Sefrita Tri Utami
2014-01-01
Full Text Available ABSTRACTLeptospirosis is a zoonotic disease, which is caused by leptospira. Leptospirosis cases often show no specificclinical symptoms and is difficult to diagnose without testing samples in the laboratory. Testing using PCR(Polymerase Chain Reaction is considered more accurate than the other methods. Components required in theexamination Leptospira bacteria in human blood samples using PCR method is DNA template, DNA polymeraseenzyme, forward primer (PU1 and SU1 and reverse primer (Lep R1, nuclease free water, Mg 2 +, and dNTPs.Examination of Leptospira bacteria in human blood samples include sampling, DNA isolation, examination byPCR, and electrophoresis running.Key words: leptospirosis, Leptospira, PCR methodsABSTRAKLeptospirosis adalah penyakit zoonosis yang disebabkan oleh bakteri Leptospira. Kasus leptospirosis seringtidak menunjukkan gejala klinis yang spesifik dan sulit didiagnosis tanpa pengujian sampel di laboratorium.Pengujian dengan menggunakan metode PCR (Polymerase Chain Reaction dinilai lebih akurat dibandingkandengan metode yang lain. Komponen-komponen yang dibutuhkan dalam pemeriksaan bakteri Leptospira padasampel darah manusia menggunakan metode PCR adalah DNA template, enzim polymerase, Primer PU 1 danPrimer SU 1, Primer Lep R1, air, Mg2+ , dan dNTP. Pemeriksaan bakteri Leptospira pada sampel darah manusiameliputi pengambilan sampel, isolasi DNA, pemeriksaan dengan metode PCR, dan running elektroforesis.Kata kunci: leptospirosis, Leptospira, metode PCR
International Nuclear Information System (INIS)
Sudrajat, Dadang; R, Maria Lina; Suhadi, F.
2000-01-01
A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...
Identifying of meat species using polymerase chain reaction (PCR)
International Nuclear Information System (INIS)
Foong, Chow Ming; Sani, Norrakiah Abdullah
2013-01-01
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing
Identifying of meat species using polymerase chain reaction (PCR)
Energy Technology Data Exchange (ETDEWEB)
Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)
2013-11-27
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.
Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol
2010-01-01
Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic ...
Rubio, J.M.; Post, R.J.; Docters van Leeuwen, W.M.; Henry, M.C.; Lindergard, G.; Hommel, M.
2002-01-01
A simplified protocol for the identification of Plasmodium species by semi-nested multiplex polymerase chain reaction (SnM-PCR) in human blood samples is compared with microscopical examination of thin and thick blood films in 2 field trials in Côte d'Ivoire and Cameroon. Also, dried blood spots or
Directory of Open Access Journals (Sweden)
Milić Nenad
2010-01-01
Full Text Available Examinations were performed on 65 samples of nasal smeas taken from calves and young cows with clinical symptoms of respiratory infection to determine the presence of the bovine herpes virus 1 using parallel implementation of molecular and standard methods of virological diagnostics. The appearance of a cytopathogenic effect (CPE was not established in inoculated cell lines 24h, 48h and 72h following inoculation, or after two successive passages of the examined material sample through these cell lines. The application of polymerize chain reaction (PCR using a primer for glucoprotein B and thymidine - kinasis, established the presence of bovine herpes virus 1 nucleic acid in one sample of a bovine nasal smear, while the presence of this virus was established in three samples in an examination of the nasal smear samples using the Real-Time PCR method.
DEFF Research Database (Denmark)
Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen
2011-01-01
Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...
Outcome of polymerase chain reaction (PCR) analysis in 100 suspected cases of infectious uveitis.
Kharel Sitaula, Ranju; Janani, M K; Madhavan, H N; Biswas, Jyotirmay
2018-01-10
Polymerase chain reaction (PCR) analysis is an important tool in the diagnosis of infectious uveitis. A retrospective, interventional study of PCR analysis of ocular fluid in suspected infectious uveitis cases between January 2014 to July 2016 was done. Nested, real-time and broad range PCR was performed for detection of the genome of Mycobacterium tuberculosis, herpes virus family, Chikungunya virus, Toxoplasma gondii, fungus, eubacterium and propionibacterium acne. Total of 100 cases included, mean age was 39.2 ± 15.4 years. Uveitis was unilateral in 82% and granulomatous in 40%. Mean visual acuity at the initial visit and final visit was 0.73 logMar and 0.63 logMar respectively. PCR analysis confirmed the clinical diagnosis in 70.1% patients. The sensitivity, specificity, positive predictive value and negative predictive value of PCR analysis was 90.2%, 93.9%, 93.9% and 90.2% respectively. The quantitative value of real-time M. tb. Positive PCR ranged from 32c/ml to 2722 c/ml. PCR assay is an accurate technique with high sensitivity and specificity to diagnose the DNA genome in infectious uveitis.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedure recommended for... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... tracheal swabs in PBS or 1 mL of broth culture by a non-phenolic procedure. Centrifuge samples at 14,000 x...
Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays
Energy Technology Data Exchange (ETDEWEB)
Frank F. Roberto
2008-08-01
Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.
International Nuclear Information System (INIS)
Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.
2005-01-01
Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)
Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D
1995-06-01
A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.
ÖZKUL, Aykut
2002-01-01
In this study, the detection of canine parvovirus (CPV) in a fecal sample from a dog with enteritis was performed for the first time using the polymerase chain reaction (PCR) in Turkey. The final PCR product was analyzed using the restriction fragment length polymorphysm (RFLP) technique. RFLP analysis using Apa LI and Eco RV restriction endonucleases revealed homology in the nucleotide sequence in at least the VP2 coding region of the virus DNAs detected in the fecal specimen and prepared fr...
Estimation of the reaction efficiency in polymerase chain reaction
Lalam, N.
2006-01-01
Polymerase chain reaction (PCR) is largely used in molecular biology for increasing the copy number of a specific DNA fragment. The succession of 20 replication cycles makes it possible to multiply the quantity of the fragment of interest by a factor of 1 million. The PCR technique has
Thermally multiplexed polymerase chain reaction.
Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R
2015-07-01
Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.
Directory of Open Access Journals (Sweden)
U. Pagnini
2010-02-01
Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.
International Nuclear Information System (INIS)
Shen Cenchao; Yang Wenjuan; Ji Qiaoli; Zhang Zhizhou; Maki, Hisaji; Dong Anjie
2009-01-01
Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
zino
2014-02-05
Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).
Directory of Open Access Journals (Sweden)
Achmad Himawan, Yohanes Berchmans umardiyono, Susamto Somowiyarjo, Yohanes Andi Trisyono & Andrew Beattie.
2011-11-01
Full Text Available Detection using PCR (Polymerase Chain Reaction Candidatus Liberibacter asiaticus, Huanglongbing causal Organism on Siem Mandarin with different types of symptoms. Huanglongbing (HLB or Citrus Vein Phloem Degeration (CVPD is one of major diseases on Siem mandarin in Indonesia. HLB is caused by bacteria Candidatus liberibacter asiatus (LAS. The bacteria only live in the phloem cells of host tree and only recently it was reported to be successfully cultured on agar medium. Early detection method of LAS is needed to support healthy Siem mandarin cultivation program. This research was conducted to detect LAS in different types of HLB leaf symptoms based on Polymerase Chain Reaction (PCR method with specific primer forward MHO 353 and reverse MHO 354. The results suggested that 8 types of HLB leaf symptoms were found on the samples used in this experiment. LAS was detected at 60% on the leaves without any symptom followed by the leaves with completely chlorosis symptom at 66%. The leaves with unevenly yellow showing higher percentage of LAS detection ranged from 80-86%. PCR technique successfully amplified DNA of LAS with the size target of 600 bp.
Directory of Open Access Journals (Sweden)
Reza Faraji
2018-02-01
Full Text Available Broad-range bacterial rDNA polymerase chain reaction (PCR followed by sequencing may be identified as the etiology of infective endocarditis (IE from surgically removed valve tissue; therefore, we reviewed the value of molecular testing in identifying organisms' DNA in the studies conducted until 2016. We searched Google Scholar, Scopus, ScienceDirect, Cochrane, PubMed, and Medline electronic databases without any time limitations up to December 2016 for English studies reporting microorganisms involved in infective endocarditis microbiology using PCR and real-time PCR. Most studies were prospective. Eleven out of 12 studies used valve tissue samples and blood cultures while only 1 study used whole blood. Also, 10 studies used the molecular method of PCR while 2 studies used real-time PCR. Most studies used 16S rDNA gene as the target gene. The bacteria were identified as the most common microorganisms involved in infective endocarditis. Streptococcus spp. and Staphylococcus spp. were, by far, the most predominant bacteria detected. In all studies, PCR and real-time PCR identified more pathogens than blood and tissue cultures; moreover, the sensitivity and specificity of PCR and real-time PCR were more than cultures in most of the studies. The highest sensitivity and specificity were 96% and 100%, respectively. The gram positive bacteria were the most frequent cause of infective endocarditis. The molecular methods enjoy a greater sensitivity compared to the conventional blood culture methods; yet, they are applicable only to the valve tissue of the patients undergoing cardiac valve surgery.
Faraji, Reza; Behjati-Ardakani, Mostafa; Moshtaghioun, Seyed Mohammad; Kalantar, Seyed Mehdi; Namayandeh, Seyedeh Mahdieh; Soltani, Mohammadhossien; Emami, Mahmood; Zandi, Hengameh; Firoozabadi, Ali Dehghani; Kazeminasab, Mahmood; Ahmadi, Nastaran; Sarebanhassanabadi, Mohammadtaghi
2018-02-01
Broad-range bacterial rDNA polymerase chain reaction (PCR) followed by sequencing may be identified as the etiology of infective endocarditis (IE) from surgically removed valve tissue; therefore, we reviewed the value of molecular testing in identifying organisms' DNA in the studies conducted until 2016. We searched Google Scholar, Scopus, ScienceDirect, Cochrane, PubMed, and Medline electronic databases without any time limitations up to December 2016 for English studies reporting microorganisms involved in infective endocarditis microbiology using PCR and real-time PCR. Most studies were prospective. Eleven out of 12 studies used valve tissue samples and blood cultures while only 1 study used whole blood. Also, 10 studies used the molecular method of PCR while 2 studies used real-time PCR. Most studies used 16S rDNA gene as the target gene. The bacteria were identified as the most common microorganisms involved in infective endocarditis. Streptococcus spp. and Staphylococcus spp. were, by far, the most predominant bacteria detected. In all studies, PCR and real-time PCR identified more pathogens than blood and tissue cultures; moreover, the sensitivity and specificity of PCR and real-time PCR were more than cultures in most of the studies. The highest sensitivity and specificity were 96% and 100%, respectively. The gram positive bacteria were the most frequent cause of infective endocarditis. The molecular methods enjoy a greater sensitivity compared to the conventional blood culture methods; yet, they are applicable only to the valve tissue of the patients undergoing cardiac valve surgery. Copyright © 2017. Published by Elsevier Taiwan.
Determining Annealing Temperatures for Polymerase Chain Reaction
Porta, Angela R.; Enners, Edward
2012-01-01
The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…
Bordetella pertussis diagnosed by polymerase chain reaction
DEFF Research Database (Denmark)
Birkebaek, N H; Heron, I; Skjødt, K
1994-01-01
The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...... in 25 patients in whose nasopharyngeal secretions BP had been demonstrated after 4-7 days of culture. The detection limit of PCR in aqueous solution was 1-2 BP bacteria per reaction tube. PCR was 100% specific for BP, showing no response with other Bordetella species or other bacteria known to colonize...
Felice, A. E.; Alshinawi, C.
1996-01-01
The product of the Polymerase Chain Reaction (PCR) may be generically suitable for four types of investigations: Discovery PCR, Analytical PCR, Modification by PCR, and Synthetic PCR. Despite the potential problem of contamination with extraneous DNA, PCR is relatively simple and inexpensive, and
Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.
Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal
2014-05-01
Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.
Polymerase chain reaction to search for Herpes viruses in uveitic ...
African Journals Online (AJOL)
Objective: To analyse aqueous polymerase chain reaction (PCR) results in patients diagnosed with undifferentiated uveitis ... Cite as: Laaks D, Smit DP, Harvey J. Polymerase chain reaction to search for Herpes viruses in uveitic and healthy eyes: a South African ... may be mild and patients do not seek medical attention.
de Haas, V.; Breunis, W. B.; dee, R.; Verhagen, O. J. H. M.; Kroes, W.; van Wering, E. R.; van Dongen, J. J. M.; van den Berg, H.; van der Schoot, C. E.
2002-01-01
Prospective studies in children with B-precursor acute lymphoblastic leukaemia (ALL) have shown that polymerase chain reaction (PCR)-based detection of minimal residual disease (MRD) using immunoglobin (Ig) and T-cell receptor (TCR) gene rearrangements as targets can be used to identify patients
Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction
Energy Technology Data Exchange (ETDEWEB)
Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Sharma, Shyam Sundar [Govt. women Engineering College, Ajmer (India); Agrawal, Kailash [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Department of Botany, University of Rajasthan, Jaipur 302004 (India)
2016-05-06
An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.
Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G
The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,
The application of polymerase chain reaction-denaturing gradient ...
African Journals Online (AJOL)
Jane
2011-05-23
May 23, 2011 ... dominance in microbial ecology if the corresponding environment samples had been provided. This ... yeast peptone dextrose; PCR, polymerase chain reaction. method, DGGE method ..... Two nuclear mutations that block.
DEFF Research Database (Denmark)
Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte
2013-01-01
steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence......We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...
The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...
DEFF Research Database (Denmark)
Bu, Minqiang; R. Perch-Nielsen, Ivan; Sørensen, Karen Skotte
steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature dependent fluorescence......We present a new temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with external heater and temperature sensor. The method employs optimized temperature overshooting and undershooting...
Directory of Open Access Journals (Sweden)
Carroll Bernie
2010-03-01
Full Text Available Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII. The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Results Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90% were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8% and the lowest in fibroblastic DNA (92.3%, P ≤ 0.05. Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P ≤ 0.05. Conclusions The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic
Faham Khamesipour; Esmat Noshadi; Mitra Moradi; Mehdi Raissy
2014-01-01
Shrimp is one of the most important fishery products of the coastal provinces in the Persian Gulf in Iran. Vibriosis has been an important cause of production loss due to bacterial disease in shrimp farms in south Iran in recent years. The objective of this study was to detect the prevalence of Vibrio spp. in shrimp samples from farms in the southern provinces of Iran by polymerase chain reaction (PCR). A total number of 36 shrimp were caught from south coast of Iran and were stud...
Directory of Open Access Journals (Sweden)
M. Usta
2005-08-01
Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.
One-stop polymerase chain reaction (PCR): An improved PCR ...
African Journals Online (AJOL)
Yomi
2011-12-21
Dec 21, 2011 ... membrane filtration was carried out with a commercial PCR product purification kit (Generay, Shanghai), according to the manufacture's instruction. In brief, 50 µl PCR product was mixed thoroughly with binding buffer, and the resultant mixture was loaded directly onto a silica membrane Gelclean column.
Directory of Open Access Journals (Sweden)
Hermansyah
2011-05-01
Full Text Available Yeast Saccharomyces cerevisiae is an excellent model to studi genes function of eukarotic cells such as study of gene encoding protein phosphatase PTC2. Novel phenotypic caused by mutated gene is an important step to study function of gene. In this study constructed mutant of PTC2 gene encoding protein phosphatase. Method that used in this construction was replacement of target gene (PTC2 with auxotroph marker Candida albicans HIS3 by Polymer Chain Reaction (PCR or called by PCR-mediated disruption. Mutant colonies which grew in selective medium SC without histidine were confirmed by PCR amplification. By using 1% Agarose gel electrophoresis the result showed that size of ptc2D::CgHIS3 transformant was 3.52 kb while wild type strain was 2.9 kb, indicated that ptc2D::CgHIS3 has integrated on chromosome V replacing PTC2 wild type.
Solcà, Manuela da Silva; Guedes, Carlos Eduardo Sampaio; Nascimento, Eliane Gomes; Oliveira, Geraldo Gileno de Sá; dos Santos, Washington Luis Conrado; Fraga, Deborah Bittencourt Mothé; Veras, Patrícia Sampaio Tavares
2012-03-23
Because infected dogs are widely considered to be the main domestic reservoir for Leishmania infantum (syn Leishmania chagasi) parasites in Brazil, the diagnosis of canine visceral leishmaniasis (CVL) must be made both accurately and promptly. The present study attempted to standardize a conventional polymerase chain reaction (cPCR) protocol for the detection of L. infantum DNA in canine spleen samples. Quantitative PCR (qPCR) technique was used to confirm the presence of Leishmania DNA in the canine spleen fragments. A comparison was made between the efficacies of these molecular diagnostic techniques and conventional parasitological and serological methods. cPCR protocols for spleen samples were standardized using primers that amplify a 145 bp fragment, located at the parasite kinetoplast minicircle. The genus specificity of the cPCR protocol was assessed by its inability to amplify the DNA of other common canine pathogens, such as Ehrlichia canis, Babesia canis, Toxoplasma gondii and Trypanosoma cruzi. cPCR protocol sensitivity was tested by assessing the reaction detection limit, determined to be 10 fg of L. infantum reference strain DNA, which corresponds to a range of 0.03-0.1 parasites per fragment. Standardized cPCR protocol was used to detect the presence of Leishmania in 45 dog spleen samples. Our results showed that 40% of the spleen fragment cultures were positive for Leishmania parasites, 58% of the dog serum samples tested positive using ELISA, and parasite DNA was detected in 44% using qPCR, while 47% of the spleen samples using cPCR. Diagnostic methods performance was assessed and revealed a better degree of ascertainment for cPCR when compared to other diagnostic methods. The sensitivity of ELISA was 83.3%, qPCR was 83.3%, and cPCR was 88.9%; PPV for ELISA was 57.7%, qPCR was 75% and cPCR was 76.2%; the Kappa coefficients were found to be 0.40 (fair) for ELISA, 0.64 (substantial) for qPCR and 0.68 (substantial) for cPCR. In both oligosymptomatic
Rapid establishment of polymerase chain reaction-restriction ...
African Journals Online (AJOL)
2012-03-30
Mar 30, 2012 ... genome using polymerase chain reaction (PCR) has made it possible to explore organelle DNA diversity for taxonomic and phylogenetic purposes. Because of its uniparental mode of inheritance and its low mutation rate related to the nuclear genome, chloroplast DNA (cpDNA) is considered to be an ideal ...
Directory of Open Access Journals (Sweden)
P K Balne
2015-01-01
Full Text Available This study is a comparative evaluation (Chi-square test of a closed tube loop mediated isothermal amplification assay using hydroxy naphthol blue dye (HNB-LAMP, real-time polymerase chain reaction (PCR and conventional PCR in the diagnosis of intraocular tuberculosis. Considering clinical presentation as the gold standard in 33 patients, the sensitivity of HNB-LAMP assay (75.8% was higher (not significant, P value 0.2 than conventional PCR (57.6% and lower than real-time PCR (90.9%. Specificity was 100% by all three methods. No amplification was observed in negative controls (n = 20 by all three methods. The cost of the HNB-LAMP assay was Rs. 500.00 and it does not require thermocycler, therefore, it can be used as an alternative to conventional PCR in resource-poor settings.
DEFF Research Database (Denmark)
Høgdall, Estrid; Vuust, Jens; Lind, Peter
2000-01-01
of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...
Directory of Open Access Journals (Sweden)
Tuti Susanti Legiastuti
2013-04-01
Full Text Available Yellow leaf curl disease, caused by a member of Begomovirus (Geminiviridae, is one of important diseases of chilli pepper in Indonesia. Exploration of endophytic fungi was initiated in order to find biological control agents for an alternative control strategies of this disease. Isolates of endophytic fungi were collected from chilli pepper growing area in Sleman, Yogyakarta and further identification using molecular technique involving polymerase chain reaction (PCR and DNA sequencing was performed. DNA fragments of ±500 bp were successfully amplified from 10 fungal isolates by PCR using primer pair ITS1/ITS4, but only 8 DNA sequences was obtained for further genetic analysis. Based on BLASTN analysis the endophytic fungi were identified as having the highest similarity with Pleosporaceae sp. (98% for H1 isolate, Cercospora nicotianae (100% for H5 isolate, ercospora piaropi (98% for H11 isolate, Guignardia mangiferae (99% for H16 isolate, Geomyces pannorum 95% for H17 isolate, Diaporthe phaseoloru (99% for H18 isolate, Dothideomycete sp. (100% for K3 isolate, and Alternaria longissima (99% for K10 isolate. Key words: Begomovirus, chillipepper, DNA sequencing, polymerase chain reaction
International Nuclear Information System (INIS)
Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.
1995-01-01
Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs
Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.
Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T
1997-09-01
In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.
Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.
Ragheb, Suzan Mohammed; Jimenez, Luis
Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.
Vongsakulyanon, A; Kitpoka, P; Kunakorn, M; Srikhirin, T
2015-12-01
To develop reliable and convenient methods for Miltenberger (Mi(a) ) blood group typing. To apply real-time polymerase chain reaction (qPCR) melting curve analysis to Mi(a) blood group typing. The Mi(a) blood group is the collective set of glycophorin hybrids in the MNS blood group system. Mi(a+) blood is common among East Asians and is also found in the Thai population. Incompatible Mi(a) blood transfusions pose the risk of life-threatening haemolysis; therefore, Mi(a) blood group typing is necessary in ethnicities where the Mi(a) blood group is prevalent. One hundred and forty-three blood samples from Thai blood donors were used in the study. The samples included 50 Mi(a+) samples and 93 Mi(a-) samples, which were defined by serology. The samples were typed by Mi(a) typing qPCR, and 50 Mi(a+) samples were sequenced to identify the Mi(a) subtypes. Mi(a) subtyping qPCR was performed to define GP.Mur. Both Mi(a) typing and Mi(a) subtyping were tested on a conventional PCR platform. The results of Mi(a) typing qPCR were all concordant with serology. Sequencing of the 50 Mi(a+) samples revealed 47 GP.Mur samples and 3 GP.Hop or Bun samples. Mi(a) subtyping qPCR was the supplementary test used to further define GP.Mur from other Mi(a) subtypes. Both Mi(a) typing and Mi(a) subtyping performed well using a conventional PCR platform. Mi(a) typing qPCR correctly identified Mi(a) blood groups in a Thai population with the feasibility of Mi(a) subtype discrimination, and Mi(a) subtyping qPCR was able to further define GP.Mur from other Mi(a) subtypes. © 2015 British Blood Transfusion Society.
Directory of Open Access Journals (Sweden)
Wen-Pin Chou
2017-02-01
Full Text Available Polymerase chain reaction (PCR has been one of the principal techniques of molecular biology and diagnosis for decades. Conventional PCR platforms, which work by rapidly heating and cooling the whole vessel, need complicated hardware designs, and cause energy waste and high cost. On the other hand, partial heating on the various locations of vessels to induce convective solution flows by buoyancy have been used for DNA amplification in recent years. In this research, we develop a new convective PCR platform, capillary loop convective polymerase chain reaction (clcPCR, which can generate one direction flow and make the PCR reaction more stable. The U-shaped loop capillaries with 1.6 mm inner diameter are designed as PCR reagent containers. The clcPCR platform utilizes one isothermal heater for heating the bottom of the loop capillary and a CCD device for detecting real-time amplifying fluorescence signals. The stable flow was generated in the U-shaped container and the amplification process could be finished in 25 min. Our experiments with different initial concentrations of DNA templates demonstrate that clcPCR can be applied for precise quantification. Multiple sample testing and real-time quantification will be achieved in future studies.
Pathogen detection by the polymerase chain reaction
Energy Technology Data Exchange (ETDEWEB)
Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)
1994-05-01
In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.
Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan
2011-06-01
The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.
Amplification of nonspecific products in quantitative polymerase chain reactions (qPCR
Directory of Open Access Journals (Sweden)
Adrián Ruiz-Villalba
2017-12-01
Full Text Available Quantitative PCR allows the precise measurement of DNA concentrations and is generally considered to be straightforward and trouble free. However, a survey with 93 validated assays for genes in the Wnt-pathway showed that the amplification of nonspecific products occurs frequently and is unrelated to Cq or PCR efficiency values. Titration experiments showed that the occurrence of low and high melting temperature artifacts was shown to be determined by annealing temperature, primer concentration and cDNA input. To explore the range of input variations that occur in the normal use of the Cre assay these conditions were mimicked in a complete two-way design of template âplasmid DNA- and non-template âmouse cDNA- concentrations. These experiments showed that the frequency of the amplification of the correct product and the artifact, as well as the valid quantification of the correct product, depended on the concentration of the non-template cDNA. This finding questions the interpretation of dilution series in which template as well as non-template concentrations are simultaneously decreasing. Repetition of this cDNA concentration experiment with other templates revealed that exact reproduction qPCR experiments was affected by the time it takes to complete the pipetting of a qPCR plate. Long bench times were observed to lead to significantly more artifacts. However, the measurement of artifact-associated fluorescence can be avoided by inclusion of a small heating step after the elongation phase in the amplification protocol. Taken together, this trouble-shooting journey showed that reliability and reproducibility of qPCR experiments not only depends on standardization and reporting of the biochemistry and technical aspects but also on hitherto neglected factors as sample dilution and waiting times in the laboratory work flow. Keywords: RT-qPCR, Melting curve analysis, Reaction parameters, Artifacts
Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction
Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka
2005-01-01
AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152
Directory of Open Access Journals (Sweden)
Abtin, A.R.
2013-05-01
Full Text Available Contagious agalactia (C.A is an infectious syndrome of sheep that is characterized by mastitis andsubsequent failure of milk production, arthritis, abortion and keratoconjunctivitis. Mycoplasma agalactiae(M. agalactiae is the main cause of the disease in sheep. The aim of this study was isolation andidentification of M. agalactiae with culture and polymerase chain reaction (PCR assay from sheep of Qomprovince in Iran. A total of 102 samples were collected from milk secretion, eye, ear and joint exudates ofsheep. All samples were cultured in PPLO broth supplemented for M. agalaciae isolation. The bacteriaDNAs were extracted by phenol/chloroform method and the PCR assay was applied for detecting ofMycoplasma genus in 163bp fragment of 16S rRNA gene and M. agalactiae in 375bp fragment oflipoprotein gene from culture as same as in clinical samples. Out of the 102 samples, 19(18.63% cultureswere shown positive and typical Mycoplasma colonies in PPLO agar culture diagnostic method and59(57.8% were scored positive by Mycoplasma genus PCR, 19(18.62% of the samples were scoredpositive by using M. agalactiae PCR as diagnostic method. Out of the 102 samples, 19 samples wereshown both positive in the culture and PCR, 42 samples were shown both negative in the culture and PCR.40 samples were negative in the culture and positive in PCR whereas only one sample was positive inculture and negative in PCR. The results showed that the more isolations of M. agalactiae were taken from milk and less in joint samples. M. agalactiae was one of the main factors of contagious agalactia that was detected for the first time from sheep in Qom province.
Fan, Hongxin; Robetorye, Ryan S
2013-01-01
Although well-established diagnostic criteria exist for mature B-cell neoplasms, a definitive diagnosis of a B-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because B-cell malignancies contain identically rearranged immunoglobulin heavy chain genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal B-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal immunoglobulin heavy chain (IGH) variable and joining region (VH-JH) gene rearrangements (IGH VH-JH PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol involves the use of three separate master mix tubes that target the conserved framework (FR1, FR2, and FR3) and joining (J) regions of the IGH gene. Analysis of these three framework regions can detect approximately 88% of clonal IGH gene rearrangements.
Use of polymerase chain reaction for detection of Chlamydia trachomatis
DEFF Research Database (Denmark)
Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna
1990-01-01
A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...
Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology
Directory of Open Access Journals (Sweden)
Kordo B. A. Saeed
2013-11-01
Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.
Polymerase chain reaction for the detection of Mycobacterium leprae
Hartskeerl, R. A.; de Wit, M. Y.; Klatser, P. R.
1989-01-01
A polymerase chain reaction (PCR) using heat-stable Taq polymerase is described for the specific detection of Mycobacterium leprae, the causative agent of leprosy. A set of primers was selected on the basis of the nucleotide sequence of a gene encoding the 36 kDa antigen of M. leprae. With this set
Polymerase chain reaction for detection of invasive Shigella flexneri in food.
Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E
1990-01-01
The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the in...
Theory and applications of the polymerase chain reaction.
Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A
1990-04-01
The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.
Directory of Open Access Journals (Sweden)
AH Rasit
2011-03-01
Full Text Available OBJECTIVE: The aim of this study was to evaluate the role of polymerase chain reaction (PCR in the diagnosis of spinal tuberculosis after 2 weeks of preoperative anti-tuberculosis treatment and to compare PCR to the Löwenstein - Jensen Culture (LJC and histopathological examination (HPE methods. METHODS: Twenty-five patients were included in this study. Sixteen patients were diagnosed and treated for spinal tuberculosis based on clinical and radiological evidence. Nine patients were controls. The LJC method and HPE of the specimen were performed according to hospital protocol. PCR was performed using primer encoding insertion of sequences IS6110 for mycobacterium tuberculosis complex. Clinical findings and radiological features were the gold standard for comparison. RESULTS: PCR results were 15 positive and one negative. The sensitivity and specificity of PCR was 94% and 100% respectively (with 95% confidence interval [CI] 67% to 99% and 63% to 100%, respectively. HPE results showed 13 were positive and 3 negative in the spinal tuberculosis group; for the control group, all were negative. Sensitivity and specificity value of HPE was 82 % and 100% respectively (with 95% confidence interval [CI] 54% to 95% and 63% to 100%, respectively. Use of LJC showed only one was positive and 15 were negative in the spinal tuberculosis group whole all nine in the control group were negative. Sensitivity and specificity value of LJC was 6% and 100% respectively (with 95% confidence interval [CI] 0.3% to 32% and 63% to 100%, respectively. CONCLUSION: Our findings showed that the PCR for Mycobacterium tuberculosis is reliable as a method for diagnosis of spinal tuberculosis, even after of 2 weeks of anti-TB treatment, with an overall sensitivity of 94% and specificity of 100%.
Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.
Lorenz, Todd C
2012-05-22
In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling
Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.
Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti
2015-08-01
This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Nuchprayoon, Surang; Saksirisampant, Wilai; Jaijakul, Siraya; Nuchprayoon, Issarang
2007-01-01
We evaluated the diagnostic value of Flinders Technology Associates (FTA) filter paper together with polymerase chain reaction (PCR) for detection of Pneumocystis jirovecii (carinii) from induced sputum (IS) and bronchoalveolar lavage fluid (BALF) samples. The study involved 162 patients with clinical diagnosis of pneumocystis pneumonia (PcP) of human immunodeficiency virus/acquired immune deficiency syndrome (HIV/AIDS) patients and other immunocompromised patients. P. jirovecii cysts or trophozoites were detected in IS and BALF by cytological method. The mitochondrial 5S ribosomal ribonucleic acid (rRNA) gene of P. jirovecii was amplified from these samples by using FTA filters together with a one-step PCR method (FTA-PCR). With the FTA-PCR method, the sensitivity and specificity of the test compared to microscopic examination were 67% and 90% for IS, while they were 67% and 91% for BALF, respectively. The sensitivity and specificity of the FTA-PCR test was also comparable to PCR with the conventional deoxyribonucleic acid (DNA) extraction method. We concluded that FTA-PCR is useful to detect P. jirovecii in noninvasive IS.
Reverse transcription and polymerase chain reaction: principles and applications in dentistry.
Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth
2004-03-01
Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.
Polymerase chain reaction: A molecular diagnostic tool in periodontology
Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam
2016-01-01
This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822
Directory of Open Access Journals (Sweden)
Lisha, V.
2017-01-01
Full Text Available modified crops which brought up a controversy on the safety usage of genetically modified organisms (GMOs. It has been implemented globally that all GMO products and its derived ingredients should have regulations on the usage and labelling. Thus, it is necessary to develop methods that allow rapid screening of GMO products to comply with the regulations. This study employed a reliable and flexible multiplex polymerase chain reaction (PCR method for the rapid detection of transgenic elements in genetically modified soy and maize along with the soybean LECTIN gene and maize ZEIN gene respectively. The selected four common transgenic elements were 35S promoter (35S; Agrobacterium tumefaciens nopaline synthase terminator (NOS; 5-enolypyruvylshikimate-3-phosphate synthase (epsps gene; and Cry1Ab delta-endotoxin (cry1Ab gene. Optimization of the multiplex PCR methods were carried out by using 1% Roundup ReadyTM Soybean (RRS as the certified reference material for soybean that produced fourplex PCR method detecting 35S promoter, NOS terminator, epsps gene and soybean LECTIN gene and by using 1% MON810 as the certified reference material for maize that produced triplex PCR method detecting 35S promoter, cry1Ab gene and maize ZEIN gene prior to screening of the GMO traits in various food products and animal feeds. 1/9 (11.1% of the animal feed contained maize and 1/15 (6.7% of the soybean food products showed positive results for the detection of GMO transgenic gene. None of the maize food products showed positive results for GMO transgenic gene. In total, approximately 4% of the food products and animal feed were positive as GMO. This indicated GMOs have not widely entered the food chain. However, it is necessary to have an appropriate screening method due to GMOs’ unknown potential risk to humans and to animals. This rapid screening method will provide leverage in terms of being economically wise, time saving and reliable.
Evaluation of a new HTLV-I/II polymerase chain reaction
Vrielink, H.; Zaaijer, H. L.; Cuypers, H. T.; van der Poel, C. L.; Woerdeman, M.; Lelie, P. N.; Winkel, C.; Reesink, H. W.
1997-01-01
AIM: Evaluation of a qualitative HTLV-I/II DNA polymerase chain reaction (PCR) test for the detection of HTLV-I/II DNA (Roche Diagnostic Systems, Branchburg, N.J., USA) in various panels. METHODS: The panels consisted of fresh EDTA blood samples from blood donors who were anti-HTLV-I/II ELISA
DEFF Research Database (Denmark)
Pedersen, Ken Steen; Stege, Helle; Jensen, Tim Kåre
2013-01-01
Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L. intrace......Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L...
LENUS (Irish Health Repository)
Drew, Richard J
2012-03-01
Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.
Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Toshiaki Higashi
2012-04-01
Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.
Directory of Open Access Journals (Sweden)
Yuny Erwanto
2014-10-01
Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.
Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul
2014-10-01
This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.
Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard
2013-05-30
Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.
Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor
International Nuclear Information System (INIS)
Liu Dayu; Liang Guangtie; Lei Xiuxia; Chen Bin; Wang Wei; Zhou Xiaomian
2012-01-01
Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil–water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: ► Droplet formation in a capillary. ► Transport the droplet using oscillation-flow. ► Oscillation droplet PCR. ► Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil–water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 μL) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to 89.5% and a detection limit of 10 DNA copies. The miniature PCR protocol developed in the current
Fusion chain reaction - a chain reaction with charged particles
International Nuclear Information System (INIS)
Peres, A.; Shvarts, D.
1975-01-01
When a DT-plasma is compressed to very high density, the particles resulting from nuclear reactions give their energy mostly to D and T ions, by nuclear collisions, rather than to electrons as usual. Fusion can thus proceed as a chain reaction, without the need of thermonuclear temperatures. In this paper, we derive relations for the suprathermal ion population created by a fusion reaction. Numerical integration of these equations shows that a chain reaction can proceed in a cold infinite DT-plasma at densities above 8.4x10 27 ions.cm -3 . Seeding the plasma with a small amount of 6 Li reduces the critical density to 7.2x10 27 ions.cm -3 (140000times the normal solid density). (author)
International Nuclear Information System (INIS)
Pavelic, J.
1996-07-01
Testing for the presence of hepatitis C virus (HCV) in blood derivatives used in clinical medicine is important to ensure the safety of such preparations. A reliable and reproducible method is described for the isolation of HCV RNA, subsequent reverse transcription and nested polymerase chain reaction (PCR) from blood derivatives. Of 17 batches of blood derivatives (14 negative for anti-HCV and 3 of unknown anti-HCV status) five were found to be positive in the nested PCR. (author). 4 refs, 3 figs, 1 tab
DEFF Research Database (Denmark)
Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang
2018-01-01
Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...
Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E
1993-01-01
Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...
Case Report:False-negative HIV-1 polymerase chain reaction in a ...
African Journals Online (AJOL)
Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. However, when clinical manifestations are not consistent with laboratory results, additional investigation is required. We report a 15-month-old HIV-exposed boy referred to our hospital after he had ...
DEFF Research Database (Denmark)
Hougs, L; Barington, T; Madsen, HO
1993-01-01
reaction (PCR) using in addition a degenerate kappa light chain signal peptide region primer. The PCR product was cloned into the M13mp18 phage. The cloning efficiency was 100-600 clones/ml of blood. Of the 86 clones sequenced, 90% represented rearranged kappa light chain genes from different antibody...... of the B lymphocytes activated in vivo. Here, we present a method for rapid analysis of the rearranged kappa light chain genes used by human circulating antigen-specific B lymphocytes. After vaccination with Haemophilus influenzae type b capsular polysaccharide (HibCP) conjugated with protein, the Hib...
Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes.
Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry
2012-11-16
The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.
Real-Time PCR (qPCR) Primer Design Using Free Online Software
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…
Directory of Open Access Journals (Sweden)
Silvia Cristina Osaki
2013-06-01
Full Text Available Introduction Cryptosporidium is an important protozoan cause of waterborne disease worldwide of concern to public health authorities. To prevent outbreaks of cryptosporidiosis, the monitoring of this parasite in drinking water is necessary. In the present work, the polymerase chain reaction (PCR and nested-PCR techniques were used to detect Cryptosporidium in raw water from catchment points of four water treatment plants (WTP in Curitiba, Paraná, Brazil. Methods First, DNA extraction techniques were tested in samples containing decreasing amount of oocysts in reagent water, and PCR and nested-PCR with specific primers for 18SSU rDNA of Cryptosporidium were conducted to determine their sensitivity. In reagent water, a commercial extraction kit provided the best analytical sensitivity, and PCR and nested-PCR allowed the detection of five and two oocysts, respectively, with the primers XIAOR/XIAOF and XIAO1F/XIAO2R. Results In the spiking experiments, only the PCR with the primers AWA995F/AWA1206R was successful at detecting concentrations of 0.1 oocysts/mL. Two catchments samples of raw water and/or water sludge from four WTPs were contaminated with Cryptosporidium. Conclusions The application of the techniques to monitor Cryptosporidium in water and detect contamination in water catchments of WTPs in Curitiba are discussed in the present work.
[REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].
Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A
2015-01-01
Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.
Early detection of typhoid by polymerase chain reaction
International Nuclear Information System (INIS)
Haque, A.; Qureshi, Javed A.; Ahmed, J.
1999-01-01
Typhoid is a common problem in developing countries. Cultivation ofbacteria and serology (especially Widal test) gives unacceptable levels offalse-negative and false-positive results respectively. In this study, arecently introduced polymerase chain reaction based technique (which has 100%specificity for Salmonella typhi) was compared with blood culture and Widaltest during the first week of illness of 82 suspected cases of typhoid. Therespective figures of positivity for PCR, blood culture and Widal test were71.95%, 34.1% and 36.5%. A control group of 20 healthy persons gave figuresof 0%, 0% and 33.3%, respectively. We conclude that this PCR-based techniqueis not only absolutely specific, but also very sensitive and therefore muchsuperior to blood culture and, Widal test for the early diagnosis of typhoid.(author)
Susan Maphilindawati Noor; Pratiwi Pujilestari Sudarmono; Asmarani Kusumawati; Anis Karuniawati
2014-01-01
Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR) is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4), B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle...
Directory of Open Access Journals (Sweden)
Trioso Purnawarman
2014-04-01
Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.
Mathematical analysis of the real time array PCR (RTA PCR) process
Dijksman, Johan Frederik; Pierik, A.
2012-01-01
Real time array PCR (RTA PCR) is a recently developed biochemical technique that measures amplification curves (like with quantitative real time Polymerase Chain Reaction (qRT PCR)) of a multitude of different templates in a sample. It combines two different methods in order to profit from the
Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom
2015-01-01
This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449
False-negative HIV-1 polymerase chain reaction in a 15-month-old ...
African Journals Online (AJOL)
Corresponding author: S Korsman (stephen.korsman@nhls.ac.za). Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. ... mismatches relative to the consensus are shown as coloured blocks. Nucleic acid numbering relative to consensus C gag p24 is ...
Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G
The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial
Gallas-Lindemann, Carmen; Sotiriadou, Isaia; Plutzer, Judit; Noack, Michael J; Mahmoudi, Mohammad Reza; Karanis, Panagiotis
2016-06-01
Environmental water samples from the Lower Rhine area in Germany were investigated via immunofluorescence assays (IFAs), nested polymerase chain reaction (nested PCR) and loop-mediated isothermal amplification (LAMP) to detect the presence of Giardia spp. (n=185) and Cryptosporidium spp. (n=227). The samples were concentrated through filtration or flocculation, and oocysts were purified via centrifugation through a sucrose density gradient. For all samples, IFA was performed first, followed by DNA extraction for the nested PCR and LAMP assays. Giardia cysts were detected in 105 samples (56.8%) by IFA, 62 samples (33.5%) by nested PCR and 79 samples (42.7%) by LAMP. Cryptosporidium spp. were detected in 69 samples (30.4%) by IFA, 95 samples (41.9%) by nested PCR and 99 samples (43.6%) by LAMP. According to these results, the three detection methods are complementary for monitoring Giardia and Cryptosporidium in environmental waters. Copyright © 2016 Elsevier B.V. All rights reserved.
Tang, Min; Zhao, Xiao-Gang; Gu, Y. John; Chen, Chang-Zhi
The accurate temperature control of a polymerase chain reaction (PCR) thermocycler was exploited in developing an in vitro model to study neutrophil activation during cardiopulmonary bypass. Neutrophils from 12 volunteers underwent temperature changes in a PCR thermocycler (37 degrees C for 30
Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions
Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory
1989-04-01
The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.
Evidence of simian retrovirus type D by polymerase chain reaction.
Hwa, Christian Z R; Tsai, Sheung Pun; Yee, JoAnn L; Van Rompay, Koen K; Roberts, Jeffrey A
2017-06-01
Over the past few years, there have been reports of finding Simian retrovirus type D (SRV) in macaque colonies where some animals were characterized as antibody positive but virus negative raising questions about how SRV was transmitted or whether there is a variant strain detected by antibody but not polymerase chain reaction (PCR) in current use. We developed a three-round nested PCR assay using degenerate primers targeting the pol gene to detect for SRV serotypes 1-5 and applied this newly validated PCR assay to test macaque DNA samples collected in China from 2010 to 2015. Using the nested PCR assay validated in this study, we found 0.15% of the samples archived on FTA ® cards were positive. The source of SRV infection identified within domestic colonies might have originated from imported macaques. The multiplex nested PCR assay developed here may supplement the current assays for SRV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms
International Nuclear Information System (INIS)
Liu Jinfeng; Xing Da; Shen Xingyan; Zhu Debin
2005-01-01
With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency
polymerase chain reaction (pcr) provides a superior tool
African Journals Online (AJOL)
boaz
Keywords: Streptococcus pneumoniae, meningitis, rt-PCR, standard bacteriological methods ... qualification de techniciens et les matériels pour son application constituent des ... Streptococcus pneumonia (pneumococcus) is a common.
DEFF Research Database (Denmark)
Zhou, X.G.; Sandvej, K.; Gregersen, Niels
1999-01-01
Aims-To evaluate the specificity of standard and fluorescence based (GENESCAN) polymerase chain reaction (PCR) immunoglobulin heavy chain (IgH) gene rearrangement analysis in complete and microdissected paraffin wax embedded sections from lymphoid proliferations. Methods-PCR IgH gene rearrangement...... because of preferential priming or detection of local B cell clones. Data from clonal analysis of small, microdissected or lymphocyte poor samples must be evaluated critically. It is recommended that analyses should be run in parallel on at least two tissue specimens. Only reproducible bands present...
Directory of Open Access Journals (Sweden)
Sungbae Joo
Full Text Available To efficiently investigate the forage preference of Svalbard reindeer (Rangifer tarandus platyrhynchus, we applied length-heterogeneity polymerase chain reaction (LH-PCR based on length differences of internal transcribed spacer (ITS regions of ribosomal RNA (rRNA to fecal samples from R. tarandus platyrhynchus. A length-heterogeneity (LH database was constructed using both collected potential food sources of Svalbard reindeer and fecal samples, followed by PCR, cloning and sequencing. In total, eighteen fecal samples were collected between 2011 and 2012 from 2 geographic regions and 15 samples were successfully amplified by PCR. The LH-PCR analysis detected abundant peaks, 18.6 peaks on an average per sample, ranging from 100 to 500 bp in size and showing distinct patterns associated with both regions and years of sample collection. Principal component analysis (PCA resulted in clustering of 15 fecal samples into 3 groups by the year of collection and region with a statistically significant difference at 99.9% level. The first 2 principal components (PCs explained 71.1% of the total variation among the samples. Through comparison with LH database and identification by cloning and sequencing, lichens (Stereocaulon sp. and Ochrolechia sp. and plant species (Salix polaris and Saxifraga oppositifolia were detected as the food sources that contributed most to the Svalbard reindeer diet. Our results suggest that the use of LH-PCR analysis would be a non-invasive and efficient monitoring tool for characterizing the foraging strategy of Svalbard reindeer. Additionally, combining sequence information would increase its resolving power in identification of foraged diet components.
Identification of aflatoxigenic fungi using polymerase chain reaction-based assay
Directory of Open Access Journals (Sweden)
Šošo Vladislava M.
2014-01-01
Full Text Available As the aflatoxins represent a health-risk for humans because of their proven carcinogenicity, food-borne fungi that produce them as secondary metabolites, mainly Aspergillus flavus and Aspergillus parasiticus, have to be isolated and identified. The best argument for identifying problem fungi is that it indicates control points within the food system as part of a hazard analysis critical control point (HACCP approach. This assumes there is a close link between fungus and toxin. Conventional methods for isolation and identification of fungi are time consuming and require admirably dedicated taxonomists. Hence, it is imperative to develop methodologies that are relatively rapid, highly specific and as an alternative to the existing methods. The polymerase chain reaction (PCR facilitates the in vitro amplification of the target sequence. The main advantages of PCR is that organisms need not be cultured, at least not for a long time, prior to their detection, target DNA can be detected even in a complex mixture, no radioactive probes are required, it is rapid, sensitive and highly versatile. The gene afl-2 has been isolated and shown to regulate aflatoxin biosynthesis in A. flavus. Also, the PCR reaction was targeted against aflatoxin synthesis regulatory gene (aflR1 since these genes are nearly identical in A. flavus and A. parasiticus in order to indicate the possibility of detection of both the species with the same PCR system (primers/reaction. [Projekat Ministarstva nauke Republike Srbije, br. III46009
The generation of radiolabeled DNA and RNA probes with polymerase chain reaction
International Nuclear Information System (INIS)
Schowalter, D.B.; Sommer, S.S.
1989-01-01
By including a radioactive triphosphate during polymerase chain reaction (PCR), probes of very high specific activity can be generated. The advantages of PCR labeling include (1) uniform labeling with a specific activity of 5 X 10(9) cpm/micrograms or higher (sensitivity of detection: 0.028 pg of target DNA per 24 h); (2) ease of regulation of both the specific activity and the amount of labeled probe produced; (3) efficient labeling of fragments less than 500 bp; (4) efficient incorporation over a wide range of input DNA template; (5) labeling with subnanogram amounts of input DNA; and (6) direct labeling of genomic DNA. The minimal amount of input DNA allows a virtually unlimited number of PCR labeling reactions to be performed on DNA generated by one amplification under the previously described nonlabeling conditions. This obviates the need for CsCl gradients or other large scale methods of DNA preparation. The above advantages except for the very high specific activity can also be achieved by transcript labeling after an amplification where one or both of PCR primers contain a phage promoter sequence
Principles and applications of polymerase chain reaction in medical diagnostic fields: a review.
Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio
2009-01-01
Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances.
Blood grouping based on PCR methods and agarose gel electrophoresis.
Sell, Ana Maria; Visentainer, Jeane Eliete Laguila
2015-01-01
The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.
Multiplex polymerase chain reaction (PCR) and fluorescence-based ...
African Journals Online (AJOL)
reading 7
2011-12-28
Dec 28, 2011 ... mitochondrial DNA and cytochrome b as an internal PCR control. The amplified species- ... more labour-saving than using each pair of species- specific primers separately for .... obtained from the NCBI nucleotide data bank.
Development of the polymerase chain reaction for diagnosis of chancroid.
Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R
1993-01-01
The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959
Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)
Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.
1999-01-01
Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal
DEFF Research Database (Denmark)
Skøt, J; Lerche, A G; Kolmos, H J
1995-01-01
To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....
Chain chemical reactions during matrix devitrification
International Nuclear Information System (INIS)
Barkalov, I.M.
1980-01-01
Investigation results of chain reaction mechanisms, proceeding at devitrification of glass-like matrices under the effect of γ-irradiation are summarized. Peculiarities of kinetics and mechanism of chain reactions proceeding at devitrification are considered: hydrocarbon chlorination, polymerization of vinyl monomers, copolymerization and graft polymerization. Possible application aspects of the chain reaction conducting during matrix devitrification are also considered
Polymerase chain reaction: Theory, practice and application: A review
Directory of Open Access Journals (Sweden)
S E Atawodi
2010-01-01
Full Text Available Polymerase Chain Reaction (PCR is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension of the annealed primers by DNA polymerase, result in the exponential accumulation of a specific fragment whose termini are defined by 5′ end of the primers. The primer extension products synthesized in one cycle can serve as a template in the next. Hence the number of target DNA copies approximately doubles at every cycle. Since its inception, PCR has had an enormous impact in both basic and diagnostic aspects of molecular biology. Like the PCR itself, the number of applications has been accumulating exponentially. It is therefore recommended that relevant scientists and laboratories in developing countries like Nigeria should acquire this simple and relatively inexpensive, but rather robust technology.
Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats.
Lorch, Jeffrey M; Gargas, Andrea; Meteyer, Carol Uphoff; Berlowski-Zier, Brenda M; Green, D Earl; Shearn-Bochsler, Valerie; Thomas, Nancy J; Blehert, David S
2010-03-01
A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.
Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats
Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.
2010-01-01
A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.
Cocolin, L; Manzano, M; Aggio, D; Cantoni, C; Comi, G
2001-05-01
A new molecular method consisting of polymerase chain reaction (PCR) amplification and denaturing gradient gel electrophoresis (DGGE) of a small fragment from the 16S rRNA gene identified the Micrococcaceae strains isolated from natural fermented Italian sausages. Lactic acid bacteria, total aerobic mesophilic flora, Enterobacteriaceae and faecal enterococci were also monitored. Micrococcaceaea control strains from international collections were used to optimise the method and 90 strains, isolated from fermented sausages, were identified by biochemical tests and PCR-DGGE. No differences were observed between the methods used. The results reported in this paper prove that Staphylococcus xylosus is the main bacterium involved in fermented sausage production, representing, from the tenth day of ripening, the only Micrococcaceaea species isolated.
[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].
Harano, K; Harano, T; Kushida, Y; Ueda, S
1991-08-01
Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.
Chase, D.M.; Elliott, D.G.; Pascho, R.J.
2006-01-01
Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.
Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat
Directory of Open Access Journals (Sweden)
Carla Bertechini Faria
2012-03-01
Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.
Detection of Salmonella typhi by nested polymerase chain reaction in blood, urine, and stool samples
Hatta, Mochammad; Smits, Henk L.
2007-01-01
A nested polymerase chain reaction (PCR) specific for Salmonella enterica serovar Typhi was used for the detection of the pathogen in blood, urine, and stool samples from 131 patients with clinical suspicion of typhoid fever. The sensitivity of blood culture, the PCRs with blood, urine, and feces,
Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F
2011-09-01
The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human Fab (fragment antigen binding) antibody libraries. In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final Fab products that are used for cloning.
Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.
Mo, Yiqun; Wan, Rong; Zhang, Qunwei
2012-01-01
Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.
A primer on on-demand polymerase chain reaction technology.
Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise
2015-10-01
Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein
2017-09-01
The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species
Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis
Directory of Open Access Journals (Sweden)
Anupam Berwal
2017-01-01
Full Text Available Tuberculous meningitis (TBM is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1% patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM.
Two-temperature PCR for Microfluidics
Kodzius, Rimantas
2010-05-01
Since its invention in 1983, polymerase chain reaction (PCR) has been the method of choice for DNA amplification. Successful PCR depends on the optimization of several parameters, which is a cumbersome task due to the many variables (conditions and compon
Two-temperature PCR for Microfluidics
Kodzius, Rimantas; Chang, Donald Choy; Sheng, Ping; Wen, Weijia; Wu, Jinbo; Xiao, Kang; Yu, Vivian
2010-01-01
Since its invention in 1983, polymerase chain reaction (PCR) has been the method of choice for DNA amplification. Successful PCR depends on the optimization of several parameters, which is a cumbersome task due to the many variables (conditions and compon
Modeling qRT-PCR dynamics with application to cancer biomarker quantification.
Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A
2017-01-01
Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.
Stelzer, Erin A.; Strickler, Kriston M.; Schill, William B.
2012-01-01
During summer and early fall 2010, 15 river samples and 6 fecal-source samples were collected in West Virginia. These samples were analyzed by three laboratories for three microbial source tracking (MST) markers: AllBac, a general fecal indicator; BacHum, a human-associated fecal indicator; and BoBac, a ruminant-associated fecal indicator. MST markers were analyzed by means of the quantitative polymerase chain reaction (qPCR) method. The aim was to assess interlaboratory precision when the three laboratories used the same MST marker and shared deoxyribonucleic acid (DNA) extracts of the samples, but different equipment, reagents, and analyst experience levels. The term assay refers to both the markers and the procedure differences listed above. Interlaboratory precision was best for all three MST assays when using the geometric mean absolute relative percent difference (ARPD) and Friedman's statistical test as a measure of interlaboratory precision. Adjustment factors (one for each MST assay) were calculated using results from fecal-source samples analyzed by all three laboratories and applied retrospectively to sample concentrations to account for differences in qPCR results among labs using different standards and procedures. Following the application of adjustment factors to qPCR results, ARPDs were lower; however, statistically significant differences between labs were still observed for the BacHum and BoBac assays. This was a small study and two of the MST assays had 52 percent of samples with concentrations at or below the limit of accurate quantification; hence, more testing could be done to determine if the adjustment factors would work better if the majority of sample concentrations were above the quantification limit.
Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage
International Nuclear Information System (INIS)
Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M.; Savva, D.; Walker, C.
1998-01-01
The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)
Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage
Energy Technology Data Exchange (ETDEWEB)
Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M. [University of Plymouth (United Kingdom). Environmental Research Centre; Child, P. [ADAS Boxworth (United Kingdom); Savva, D.; Walker, C. [University of Reading (United Kingdom). School of Animal and Microbial Sciences
1998-07-01
The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)
A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification
Directory of Open Access Journals (Sweden)
Luiz Tadeu M Figueiredo
1997-05-01
Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique
Accuracy of real-time polymerase chain reaction for Toxoplasma gondii in amniotic fluid.
Wallon, Martine; Franck, Jacqueline; Thulliez, Philippe; Huissoud, Cyril; Peyron, François; Garcia-Meric, Patricia; Kieffer, François
2010-04-01
To provide clinicians with information about the accuracy of real-time polymerase chain reaction (PCR) analysis of amniotic fluid for the prenatal diagnosis of congenital Toxoplasma infection. This was a prospective cohort study of women with Toxoplasma infection identified by prenatal screening in three centers routinely carrying out real-time PCR for the detection of Toxoplasma gondii in amniotic fluid. The data available were gestational age at maternal infection, types and dates of maternal treatment, results of amniocentesis and neonatal work-up and definitive infectious status of the child. We estimated sensitivity, specificity and positive and negative predictive values both overall and per trimester of pregnancy at the time of maternal infection. Polymerase chain reaction analysis was carried out on amniotic fluid for 261 of the 377 patients included (69%). It was accurate with the exception of four negative results in children who were infected. Overall sensitivity and negative predictive value were 92.2% (95% confidence interval [CI] 81-98%) and 98.1% (95% CI 95-99.5%), respectively. There was no significant association with the trimester of pregnancy during which maternal infection occurred. Specificity and positive predictive values of 100% were obtained for all trimesters. Real-time PCR analysis significantly improves the detection of T. gondii on amniotic fluid. It provides an accurate tool to predict fetal infection and to decide on appropriate treatment and surveillance. However, postnatal follow-up remains necessary in the first year of life to fully exclude infection in children for whom PCR results were negative. III.
A novel polymerase chain reaction (PCR) for rapid isolation of a new ...
African Journals Online (AJOL)
mediated self-formed panhandle PCR, for gene or chromosome walking. It combined the advantages of ligation-mediated PCR in its specificity and of panhandle PCR in its efficiency. Self-formed panhandle PCR was used for a new rbcS gene ...
Critical analysis: use of polymerase chain reaction to diagnose leprosy
Directory of Open Access Journals (Sweden)
Flaviane Granero Maltempe
Full Text Available ABSTRACT Leprosy is a neglected tropical disease and an important public health problem, especially in developing countries. It is a chronic infectious disease that is caused by Mycobacterium leprae, which has a predilection for the skin and peripheral nerves. Although it has low sensitivity, slit-skin smear (SSS remains the conventional auxiliary laboratory technique for the clinical diagnosis of leprosy. Polymerase chain reaction (PCR is a molecular biology technique that holds promise as a simple and sensitive diagnostic tool. In the present study, the performance of two PCR methods, using different targets, PCR-LP and PCR-P, were compared with SSS with regard to leprosy diagnosis in a reference laboratory. M. leprae DNA was extracted from 106 lymph samples of 40 patients who had clinical suspicion of leprosy. The samples were subjected to both PCR techniques and SSS. Amplification of the human b-globin gene was used as PCR inhibitor control. The specificity of both PCR techniques was 100%, and sensitivity was 0.007 and 0.015 µg/ml for PCR-LP and PCR-P, respectively. No significant difference was found between either the PCR-LP or PCR-P results and SSS results (p > 0.05. Although PCR is not yet a replacement for SSS in the diagnosis of leprosy, this technique may be used as an efficient auxiliary tool for early detection of the disease, especially in endemic regions. This strategy may also be useful in cases in which SSS results are negative (e.g., in paucibacillary patients and cases in which skin biopsy cannot be performed.
Directory of Open Access Journals (Sweden)
Laurent Dacheux
2016-07-01
Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for
Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve
2016-07-01
The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus
Normalised quantitative polymerase chain reaction for diagnosis of tuberculosis-associated uveitis.
Barik, Manas Ranjan; Rath, Soveeta; Modi, Rohit; Rana, Rajkishori; Reddy, Mamatha M; Basu, Soumyava
2018-05-01
Polymerase chain reaction (PCR)-based diagnosis of tuberculosis-associated uveitis (TBU) in TB-endemic countries is challenging due to likelihood of latent mycobacterial infection in both immune and non-immune cells. In this study, we investigated normalised quantitative PCR (nqPCR) in ocular fluids (aqueous/vitreous) for diagnosis of TBU in a TB-endemic population. Mycobacterial copy numbers (mpb64 gene) were normalised to host genome copy numbers (RNAse P RNA component H1 [RPPH1] gene) in TBU (n = 16) and control (n = 13) samples (discovery cohort). The mpb64:RPPH1 ratios (normalised value) from each TBU and control sample were tested against the current reference standard i.e. clinically-diagnosed TBU, to generate Receiver Operating Characteristic (ROC) curves. The optimum cut-off value of mpb64:RPPH1 ratio (0.011) for diagnosing TBU was identified from the highest Youden index. This cut-off value was then tested in a different cohort of TBU and controls (validation cohort, 20 cases and 18 controls), where it yielded specificity, sensitivity and diagnostic accuracy of 94.4%, 85.0%, and 89.4% respectively. The above values for conventional quantitative PCR (≥1 copy of mpb64 per reaction) were 61.1%, 90.0%, and 74.3% respectively. Normalisation markedly improved the specificity and diagnostic accuracy of quantitative PCR for diagnosis of TBU. Copyright © 2018 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Zhouli Wang
Full Text Available A combination of immunomagnetic separation (IMS and polymerase chain reaction (PCR was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agarose gel electrophoresis results of 20 different strains showed that the IMS-PCR procedure presented high specificity to the A. acidoterrestris. The sensitivity of the IMS-PCR was 2×10(1 CFU/mL and the total detection time was 3 to 4 h. Of the 78 naturally contaminated apple juice samples examined, the sensitivity, specificity and accuracy of IMS-PCR compared with the standardized pour plate method were 90.9%, 97.0% and 96.2%, respectively. The results exhibited that the developed IMS-PCR method will be a valuable tool for detecting A. acidoterrestris and improving food quality in juice samples.
Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F
2011-09-01
The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human scFv (single chain antibody fragment) libraries using a short linker (GGSSRSS) or a long linker (GGSSRSSSSGGGGSGGGG). In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final scFv products that are used for cloning.
Energy Technology Data Exchange (ETDEWEB)
Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest; Singh, Anup K.
2017-10-31
Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required for PCR.
Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Radji, M.
2010-01-01
Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.
Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada
2009-01-01
A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.
Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2014-09-09
Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.
DEFF Research Database (Denmark)
Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper
2007-01-01
OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR......-BM). METHODS: We applied a PCR that targeted conserved regions of the 16S ribosomal ribonucleic acid gene to cerebrospinal fluid (CSF) samples from patients with external ventricular drainage or a ventriculoperitoneal shunt during the course of VR-BM. We compared the PCR results with CSF cultures. A total...... of 350 routine CSF samples were consecutively collected from 86 patients. The CSF deoxyribonucleic acid was automatically purified and subjected to PCR. Amplicons from the PCR samples that were positive for VR-BM were subsequently deoxyribonucleic acid sequenced for final identification. Clinical data...
Nuclear chain reaction: forty years later
International Nuclear Information System (INIS)
Sachs, R.G.
1984-01-01
The proceedings from a 1982 symposium 40 years after the first controlled nuclear chain reaction took place in Chicago covers four sessions and public discussion. The session covered the history of the chain reaction; peaceful uses in technology, medicine, and biological science; peaceful uses in power generation; and nuclear weapons control. Among the speakers were Eugene Wigner, Glenn Seaborg, Alvin Weinberg, and others who participated in the first chain reaction experiments. The proceedings reflect differences of opinion among the scientists as well as the general public. References, slides, and tables used to illustrate the individual talks are included with the papers
Directory of Open Access Journals (Sweden)
Mohammad Rubayet Hasan
2014-01-01
Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.
Method of identification of unbranched chain reaction with cross termination of chain
International Nuclear Information System (INIS)
Poluehktov, V.A.; Begishev, I.R.
1977-01-01
Gas-phase chlorination of unsymmetrical difluoroethane initiated by gamma quanta of Co 60 has been studied. At decreased temperatures the only hydrogen is replaced by a chlorine atom. Over a wide range of ratios of the initial reagents, the reaction occurs with a chain rupture. An analysis of the kinetics of such a reaction provides a method for identification of an unbranched chain reaction with a cross-rupture of the chain
Directory of Open Access Journals (Sweden)
Daniela Camargos Costa
2014-02-01
Full Text Available The polymerase chain reaction (PCR-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34 of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.
Diez, Cristina; Lorenz, Virginia; Ortiz, Silvia; Gonzalez, Verónica; Racca, Andrea; Bontempi, Iván; Manattini, Silvia; Solari, Aldo; Marcipar, Iván
2010-01-01
We have evaluated blood samples of chronic and congenital Trypanosoma cruzi-infected patients from the city of Reconquista located in the northeast of Argentina where no information was previously obtained about the genotype of infecting parasites. Fourteen samples of congenital and 19 chronical patients were analyzed by hybridization with DNA probes of minicircle hypervariable regions (mHVR). In congenital patients, 50% had single infections with TcIId, 7% single infections with TcIIe, 29% mixed infections with TcIId/e, and 7% had mixed infections with TcIId/b and 7% TcIId/b, respectively. In Chronical patients, 52% had single infections with TcIId, 11% single infections with TcIIe, 26% had mixed infections with TcIId/e, and 11% had non-identified genotypes. With these samples, we evaluated the minicircle lineage-specific polymerase chain reaction assay (MLS-PCR), which involves a nested PCR to HVR minicircle sequences and we found a correlation with hybridization probes of 96.4% for TcIId and 54.8% for TcIIe. PMID:20064998
Tran, Hong Hanh; Trinh, Kieu The Loan; Lee, Nae Yoon
2013-10-01
In this study, we fabricate a monolithic poly(methylmethacrylate) (PMMA) microdevice on which solid phase-based DNA preparation and flow-through polymerase chain reaction (PCR) units were functionally integrated for one-step sample preparation and amplification operated by pressure. Chelex resin, which is used as a solid support for DNA preparation, can capture denatured proteins but releases DNA, and the purified DNA can then be used as a template in a subsequent amplification process. Using the PMMA microdevices, DNA was successfully purified from both Escherichia coli and human hair sample, and the plasmid vector inserted in E. coli and the D1S80 locus in human genomic DNA were successfully amplified from on-chip purified E. coli and human hair samples. Furthermore, the integration potential of the proposed sample preparation and flow-through PCR units was successfully demonstrate on a monolithic PMMA microdevice with a seamless flow, which could pave the way for a pressure-driven, simple one-step sample preparation and amplification with greatly decreased manufacture cost and enhanced device disposability. Copyright © 2013 Elsevier B.V. All rights reserved.
Diagnostic value of polymerase chain reaction analysis of skin biopsies in purpura fulminans.
Beau, Caroline; Vlassova, Natalia; Sarlangue, Jean; Brissaud, Olivier; Léauté-Labrèze, Christine; Boralevi, Franck
2013-01-01
Even though prompt diagnosis and treatment of purpura fulminans (PF) is essential to reduce mortality, early administration of antibiotics may preclude identification of the causative agent by standard bacterial cultures and thus render definitive diagnosis impossible. Here we present a case of an infant with PF and negative bacterial cultures for whom polymerase chain reaction (PCR) analysis of a cutaneous biopsy specimen obtained 4 days after initiation of antibiotics identified the genomic sequence of Neisseria meningitidis genogroup C. When bacterial cultures fail to provide useful information, PCR of skin biopsy specimens can be a valuable diagnostic tool in PF. © 2013 Wiley Periodicals, Inc.
Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M
1993-01-01
A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.
Culture-Negative Endocarditis Diagnosed Using 16S DNA Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Stephen Duffett
2012-01-01
Full Text Available 16S DNA polymerase chain reaction (PCR is a molecular amplification technique that can be used to identify bacterial pathogens in culture-negative endocarditis. Bacterial DNA can be isolated from surgically excised valve tissue or from blood collected in EDTA vials. Use of this technique is particularly helpful in identifying the bacterial pathogen in cases of culture-negative endocarditis. A case involving a 48-year-old man who presented with severe aortic regurgitation and a four-month prodrome of low-grade fever is reported. Blood and valve tissue cultures following valve replacement were negative. A valve tissue sample was sent for investigation with 16S DNA PCR, which successfully identified Streptococcus salivarius and was interpreted as the true diagnosis. A review of the literature suggests that 16S DNA PCR from valve tissue is a more sensitive diagnostic test than culture. It is also extremely specific, based on a sequence match of at least 500 base pairs.
Directory of Open Access Journals (Sweden)
JANNOTTI-PASSOS Liana Konovaloff
2000-01-01
Full Text Available In order to determine Schistosoma mansoni infection rates in Biomphalaria tenagophila and B. straminea, low stringency polymerase chain reaction (LS-PCR technique was used as a complementary method to light exposure technique. LS-PCR has already been standardized in our laboratory to detect the trematode DNA in B. glabrata. Higher S. mansoni infection rates were detected using conventional method and LS-PCR. The parasite DNA profile was detected in both species after 7-day exposure to miracidia, using LS-PCR. This technique enables early detection of schistosomiasis transmission focuses, in endemic areas, before the beginning of cercariae shedding.
Polymerase Chain Reaction (Pcr) Assay to Detect Hepatitis C Virus
International Nuclear Information System (INIS)
Lina MR; Dadang S; Budiman Bela
2004-01-01
Research on the detection of hepatitis C virus in blood serum using PCR technique has been carried out. Amount of 50 blood serum from laboratory of Indonesia Red Cross (Palang Merah Indonesia = PMI) and RSCM hospital as samples, were used in this research. Lysis of virus cell and extraction of RNA virus as a preliminary treatment of the sample, was done with BOOM method using guanidine thiocyanate and diatomaceous earth, respectively. Synthesis of cDNA from RNA as an extraction product mentioned above, was carried out by means of reverse-transcriptase and RNA-se inhibitor. Amplification of cDNA was done with nested PCR technique that was performed with two times PCR processes using two pairs of oligonucleotide primers for each process. The amplified DNA was detected by agarose gel electrophoresis and ethidium bromide staining. Subsequently, the DNA was visualized with UV transilluminator. Result shows that of 50 blood serum samples, 13 serum were positive for RNA HCV that were performed with the present of specific DNA band on agarose gel. (author)
Polymerase chain reaction for detection of invasive Shigella flexneri in food.
Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E
1990-06-01
The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.
DEFF Research Database (Denmark)
Blair, D.; Waycott, M.; Byrne, L.
2006-01-01
This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...
Directory of Open Access Journals (Sweden)
FIGUEIREDO Luiz Tadeu Moraes
1997-01-01
Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination
Gretch, D R; Wilson, J J; Carithers, R L; dela Rosa, C; Han, J H; Corey, L
1993-01-01
We evaluated a new hepatitis C virus RNA assay based on one-stage PCR followed by liquid hybridization with an oligonucleotide probe and compared it with nested-set PCR. The one-stage and nested-set PCR assays had identical sensitivities in analytical experiments and showed 100% concordance when clinical specimens were used. One-stage PCR may be less prone to contamination than nested-set PCR.
Aysan, Ayse Beyza; Knejzlík, Zdeněk; Ulbrich, Pavel; Šoltys, Marek; Zadražil, Aleš; Štěpánek, František
2017-05-01
The combination of nanoparticles with the polymerase chain reaction (PCR) can have benefits such as easier sample handling or higher sensitivity, but also drawbacks such as loss of colloidal stability or inhibition of the PCR. The present work systematically investigates the interaction of magnetic iron oxide nanoparticles (MIONs) with the PCR in terms of colloidal stability and potential PCR inhibition due to interaction between the PCR components and the nanoparticle surface. Several types of MIONs with and without surface functionalisation by sodium citrate, dextran and 3-aminopropyl-triethoxysilane (APTES) were prepared and characterised by Transmission Electron Microscopy (TEM), dynamic light scattering (DLS) and Fourier Transform Infrared (FT-IR) spectroscopy. Colloidal stability in the presence of the PCR components was investigated both at room temperature and under PCR thermo-cycling. Dextran-stabilized MIONs show the best colloidal stability in the PCR mix at both room and elevated temperatures. Citrate- and APTES-stabilised as well as uncoated MIONs show a comparable PCR inhibition near the concentration 0.1mgml -1 while the inhibition of dextran stabilized MIONs became apparent near 0.5mgml -1 . It was demonstrated that the PCR could be effectively carried out even in the presence of elevated concentration of MIONs up to 2mgml -1 by choosing the right coating approach and supplementing the reaction mix by critical components, Taq DNA polymerase and Mg 2+ ions. Copyright © 2017 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline
2015-01-01
BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma hae...
Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui
2016-05-01
In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.
Bartzavali-Louki, Christina; Dimitracopoulos, George; Spiliopoulou, Iris
2003-06-01
Characterization of clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA) and representatives of three MRSA clones from other hospitals was performed by arbitrarily primed polymerase chain reaction (AP-PCR) and antibiotic susceptibility patterns. All isolates were mecA-positive and two main antibiotypes have been characterized. Two major clones were identified with AP-PCR related to the aforementioned antibiotypes. The combination of antibiotypes with AP-PCR patterns successfully identified the two major clones in our hospital, which are identical with the MRSA clones previously characterized in Athens and in Central and North Greece.
DEFF Research Database (Denmark)
Skøt, J; Lerche, A G; Kolmos, H J
1995-01-01
was performed. The sensitivity and specificity were 85 and 100% 934/40 and 77/77) respectively. A non-radioactive labelling system BluGENE was evaluated on all specimens, and found to be as effective as P32-labelling. To increase the speed and convenience of detection, a dot blot system was tested......To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....
Harmey, Judith H.; Harmey, Matthew A.
1993-01-01
We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...
Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo
2014-03-01
The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.
DEFF Research Database (Denmark)
Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels
1992-01-01
We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes....... Four heterozygotes could not be unequivocally typed with the PCR-RFLP method. The HLA-DPB1 typing results obtained with the PCR-RFLP method were compared with the typing results obtained with PCR allele-specific oligonucleotides (PCR-ASO) in 50 individuals. The results obtained with the two methods...
International Nuclear Information System (INIS)
Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.
2003-01-01
Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)
Directory of Open Access Journals (Sweden)
Samantha J Ogden
2015-01-01
Full Text Available This study evaluated the performance of the Wuxi AGCU ScienTech Incorporation (HuiShan, Wuxi, China AGCU Expressmarker 16 (EX 16 and 22 (EX22 short tandem repeat (STR amplification kits in reduced reaction volumes using direct polymerase chain reaction (PCR amplification workflows. The commercially available PowerPlex® 21 (PP21 System (Promega, Wisconsin, USA, which follows similar direct workflows, was used as a reference. Anticoagulate blood applied to chemically impregnated FTA TM Micro Cards (GE Healthcare UK Limited, Amersham Place, Little Chalfont, Buckinghamshire, HP7 9NA, UK was used to represent a complex biological sample. Allelic concordance, first-pass success rate, average peak heights, heterozygous peak height ratios (HPHRs, and intracolor and intercolor peak height balance were determined. In reduced volume PCR reactions, the performances of both the EX16 and EX22 STR amplification kits were comparable to that of the PP21 System. The level of performance was maintained at PCR reaction volumes, which are 40% of that recommended. The EX22 and PP21 System kits possess comparable overlapping genome coverage. This study evaluated the performance of the AGCU EX16 and EX22 STR amplification kits in reduced PCR reaction volumes using direct workflows in combination with whole blood applied to FTA TM Micro Cards. Allelic concordance, first-pass success rate, average peak heights, HPHRs, and intracolor and intercolor peak height balance were determined. A concordance analysis was completed that compared the performance of the EX16 and EX22 kits using human blood applied to FTA Micro Cards in combination with full, half, and reduced PCR reaction volumes. The PP21 System (Promega was used as a reference kit. Where appropriate, the distributions of data were assessed using the Shapiro-Wilk test. For normally-distributed data, statistics were calculated using analysis of variance (ANOVA and for nonparametric data the Wilcoxon
A polymerase chain reaction strategy for the diagnosis of camelpox.
Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar
2009-03-01
Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.
DEFF Research Database (Denmark)
Andresen, K; Gaafar, A; El-Hassan, A M
1996-01-01
We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed by microscopi......We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed......%, respectively. The PCR should be considered as a valuable and sensitive diagnostic tool in the diagnosis of cutaneous leishmaniasis; it has the added advantage of identification of the species of Leishmania causing the lesion....
Brüggemann, M.; White, H.; Gaulard, P.; Garcia-Sanz, R.; Gameiro, P.; Oeschger, S.; Jasani, B.; Ott, M.; Delsol, G.; Orfao, A.; Tiemann, M.; Herbst, H.; Langerak, A. W.; Spaargaren, M.; Moreau, E.; Groenen, P. J. T. A.; Sambade, C.; Foroni, L.; Carter, G. I.; Hummel, M.; Bastard, C.; Davi, F.; Delfau-Larue, M.-H.; Kneba, M.; van Dongen, J. J. M.; Beldjord, K.; Molina, T. J.
2007-01-01
Polymerase chain reaction (PCR) assessment of clonal T-cell receptor (TCR) and immunoglobulin (Ig) gene rearrangements is an important diagnostic tool in mature T-cell neoplasms. However, lack of standardized primers and PCR protocols has hampered comparability of data in previous clonality studies.
Directory of Open Access Journals (Sweden)
Kröncke, Klaus-Dietrich
2008-08-01
Full Text Available [english] Background: The polymerase chain reaction (PCR is an example of a technology that for many medical students is not easy to understand. We investigated whether a tutor-supported e-learning teaching unit is suitable to teach undergraduate medical students the PCR. Methods: We developed a computer-based practical course (attendance is compulsory that uses an open source-based system as a learning platform. The students learned to search in scientific medical databases to find PCR-relevant data. In addition, they learned the essential features of the PCR with the aid of embedded textual information and audiovisual animations. To check that the learning objectives were fulfilled, the students had to solve medical-related PCR tasks on the computer. Results: In total, 311 students went through the course. They were satisfied with the e-learning teaching unit and evaluated it very positively, independently of their prior knowledge concerning the PCR. Students with low levels of computer skills did not feel over-challenged. Conclusion: Our results show that a computer-based practical training course is an excellent option for teaching undergraduate medical students complex technologies that could otherwise only be taught in a laboratory at great expense of time and effort. [german] Zielsetzung: Es sollte untersucht werden, ob ein E-Learning Praktikumsversuch geeignet ist, Medizin-Studierenden der Vorklinik die Polymerase-Kettenreaktion (PCR begreiflich zu machen. Methodik: Ein Computer-basierter Praktikumsversuch wurde entwickelt, der sowohl das Recherchieren in wissenschaftlich-medizinischen Datenbanken zum Auffinden von PCR-relevanten Informationen beinhaltet als auch Selbstlerneinheiten über die PCR. Als Lernzielkontrollen dienten Aufgaben aus der medizinischen PCR-Diagnostik. Die Akzeptanz der Lehrveranstaltung bei den Studierenden wurde mit einem Fragebogen ermittelt, der 19 Items enthielt. Ergebnisse: 311 Studierende absolvierten den
Directory of Open Access Journals (Sweden)
Andriani .
2013-08-01
Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Detection of foodborne pathogens by qPCR: A practical approach for food industry applications
Directory of Open Access Journals (Sweden)
María-José Chapela
2015-12-01
Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.
Trends and advances in food analysis by real-time polymerase chain reaction.
Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin
2016-05-01
Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.
Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.
Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P
1999-08-02
Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.
Directory of Open Access Journals (Sweden)
Susan Maphilindawati Noor
2014-10-01
Full Text Available Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4, B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle in Java (Jakarta andBandung, South Sulawesi (Maros, East Nusa Tenggara (Kupang and Belu were used in this study. TheDNA bands were observed by agarose gel in the presence of ethidium bromide. Identification was performedbased on the size and number of DNA products amplified by PCR from each isolates. The results showedthat the 50 isolates were of B. abortus field strains. This finding showed that the cause of bovine brucellosisin Indonesia is B. abortus field strains.
DEFF Research Database (Denmark)
Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie
2005-01-01
Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...
Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics
Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David
2014-02-01
Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.
Chisi, Songelwayo L; Schmidt, Tracy; Akol, George W; Van Heerden, Henriette
2017-09-27
Serology is primarily used in the diagnosis of bovine brucellosis. Bacterial culture and isolation is the gold standard in diagnosing brucellosis but, like serology, it does not offer complete (100%) diagnostic sensitivity and specificity. Polymerase chain reaction (PCR) has been suggested to offer better specificity and sensitivity. In this study, we evaluated the performance of Brucella abortus species specific (BaSS) PCR directly from different samples in the diagnosis of bovine brucellosis in naturally infected cattle in KwaZulu-Natal province of South Africa with known infectious status from culture. The BaSS PCR had a low diagnostic sensitivity (DSe) of 70%, but was able to identify vaccine strains using abomasal fluid from aborted foetuses and detect Brucella DNA from decomposing samples. The best sample for the BaSS PCR was abomasal fluid.
RT-PCR Protocols - Methods in Molecular Biology
Directory of Open Access Journals (Sweden)
Manuela Monti
2011-03-01
Full Text Available “The first record I have of it, is when I made a computer file which I usually did whenever I had an idea, that would have been on the Monday when I got back, and I called it Chain Reaction.POL, meaning polymerase. That was the identifier for it and later I called the thing the Polymerase Chain Reaction, which a lot of people thought was a dumb name for it, but it stuck, and it became PCR”. With these words the Nobel prize winner, Kary Mullis, explains how he named the PCR: one of the most important techniques ever invented and currently used in molecular biology. This book “RT-PCR Protocols” covers a wide range of aspects important for the setting of a PCR experiment for both beginners and advanced users. In my opinion the book is very well structured in three different sections. The first one describes the different technologies now available, like competitive RT-PCR, nested RT-PCR or RT-PCR for cloning. An important part regards the usage of PCR in single cell mouse embryos, stressing how important...........
Directory of Open Access Journals (Sweden)
Yuny Erwanto
2013-03-01
Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction ABSTRAK Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang
DEFF Research Database (Denmark)
Juul, L; Hougs, L; Andersen, V
1997-01-01
The expressed human kappa light chain gene repertoire utilized by healthy individuals was studied by two different single-sided specific PCR techniques to avoid bias for certain V genes. A total of 103 rearranged kappa sequences from peripheral blood mononuclear cells from healthy individuals were...
Kiss, S; Zsikla, V; Frank, A; Willi, N; Cathomas, G
2016-04-01
Helicobacter-negative gastritis has been increasingly reported. Molecular techniques as the polymerase chain reaction (PCR) may detect bacterial DNA in histologically negative gastritis. To evaluate of Helicobacter PCR in gastric biopsies for the daily diagnostics of Helicobacter-negative gastritis. Over a 5-year period, routine biopsies with chronic gastritis reminiscent of Helicobacter infection, but negative by histology, were tested by using a H. pylori specific PCR. Subsequently, PCR-negative samples were re-evaluated using PCR for other Helicobacter species. Of the 9184 gastric biopsies, 339 (3.7%) with histological-negative gastritis and adequate material were forwarded to PCR analysis for H. pylori and 146 (43.1%) revealed a positive result. In 193 H. pylori DNA-negative biopsies, re-analysis using PCR primers for other Helicobacter species, revealed further 23 (11.9%) positive biopsies, including 4 (2.1%) biopsies with H. heilmannii sensu lato. PCR-positive biopsies showed a higher overall inflammatory score, more lymphoid follicles/aggregates and neutrophils (P gastritis. © 2016 John Wiley & Sons Ltd.
Amara, Khaled; Trimeche, Mounir; Ziadi, Sonia; Sriha, Badreddine; Mokni, Moncef; Korbi, Sadok
2006-01-01
Polymerase chain reaction (PCR)-based analysis, employed for detecting immunoglobulin heavy chain (IgH) gene rearrangements, has become a diagnostic tool widely used in the investigation of B-cell lymphomas, but the overall sensitivity of these methods does not exceed 80%, notably in germinal center (GC) and post-GC B-cell origin lymphomas. Many PCR strategies devised for detecting immunoglobulin light chain (IgL) gene rearrangements have been developed to enhance the clonality detection rates. However, the feasibility of these methods in routine clinical diagnosis using paraffin-embedded tissues has not yet been investigated sufficiently. We studied a large series of 108 cases of B-cell lymphomas, as well as 20 reactive lymphoid tissues using degenerate primers to amplify immunoglobulin kappa (Igkappa) and lambda (Iglambda) light chain genes. B-cell clonality was further investigated using semi-nested PCR for IgH gene rearrangements. B-cell clonality was detected in 74%, 56.5%, and 43.5% of cases using IgH, Igkappa, and Iglambda PCR, respectively. By combining these methods, the clonality detection rate increased to 93.5%. Only polyclonal patterns were noted in reactive lymphoid samples. We concluded that in addition to the established methods for IgH analysis, a PCR-based approach for IgL gene rearrangements analysis improves the clonality detection rate in over 90% of B-cell lymphoma cases using routine histological specimens with poor preservation of the genomic DNA.
Directory of Open Access Journals (Sweden)
Suresh Dirasantchu
2015-01-01
Full Text Available Aims and Objectives: Certain strains of human papillomavirus (HPV have been shown to be etiologically related to the development of uterine, cervical, and other genital cancers, but their role in the development of malignancies at other sites is less well established. Previous studies have shown HPV in tumors of the head and neck, but its prevalence has varied depending on the detection methods and the types of tumor and/or tissue examined. This study was undertaken for the detection of high-risk HPV types 16 and 18 and human immunodeficiency virus (HIV in oral squamous cell carcinoma. Materials and Methods: Twenty-five patients histologically diagnosed with oral squamous cell carcinoma and 10 apparently normal persons as controls were selected for the present study. Two biopsy specimens were removed surgically by incision biopsy for histopathological examination and polymerized chain reaction (PCR study. Results: Out of 25 oral squamous cell carcinoma subjects, 8 were found to be HPV positive in PCR. Out of these eight subjects, four had HPV 16 and the other four had other genotypes, and one subject was HIV positive. Conclusion: The conclusion drawn from the present study was that well-defined risk factors like HPV may play a prominent role in the development of oral squamous cell carcinomas, in addition to other risk factors. Further studies with a larger sample size are necessary to arrive at conclusions and to explore the relationship of HPV and HIV in oral squamous cell carcinoma.
Directory of Open Access Journals (Sweden)
Dastur P
2004-01-01
Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.
Lee, Hyun-A; Hong, Sunhwa; Chung, Yungho; Kim, Okjin
2011-09-01
Eimeria tenella and Eimeria maxima are important pathogens causing intracellular protozoa infections in laboratory avian animals and are known to affect experimental results obtained from contaminated animals. This study aimed to find a fast, sensitive, and efficient protocol for the molecular identification of E. tenella and E. maxima in experimental samples using chickens as laboratory avian animals. DNA was extracted from fecal samples collected from chickens and polymerase chain reaction (PCR) analysis was employed to detect E. tenella and E. maxima from the extracted DNA. The target nucleic acid fragments were specifically amplified by PCR. Feces secreting E. tenella and E. maxima were detected by a positive PCR reaction. In this study, we were able to successfully detect E. tenella and E. maxima using the molecular diagnostic method of PCR. As such, we recommended PCR for monitoring E. tenella and E. maxima in laboratory avian facilities.
Directory of Open Access Journals (Sweden)
W. Ali
2017-06-01
Full Text Available The aim of this study was to evaluate the economic impact of the disease by using milk production records and to determine the serotypes circulating in the region during 2015. Sampling was done from different outbreaks initially on the basis of clinical signs and later reverse transcriptase-polymerase chain reaction (RT-PCR was employed for the conformation of FMDV genome. Out of total 88 samples, 73 were found positive which were then serotyped into type O (n=44, Asia1 (n=18 and A (n=06. The economic impact was analyzed by recording milk loss at four affected farms. Their average milk yield was observed 9.2 liters before the onset of disease that decreased dramatically after the disease. Milk loss of 225 and 195 liters was recorded for buffalo and cattle respectively, during 70 days of the study period.
Role of Polymerase Chain Reaction (PCR) in the detection of ...
African Journals Online (AJOL)
Rajeh Ali
2014-06-20
Jun 20, 2014 ... in 2013. Objectives: This study aimed to investigate S. aureus in some clinical samples by PCR and study .... culture, the isolates of S. aureus were incubated at 37 °C for. 18–24 h .... characteristics, and ability to form biofilm.
Directory of Open Access Journals (Sweden)
Bramastha Rosadi
2015-01-01
Full Text Available Background: Benign Prostatic Hyperplasia (BPH has been correlated with chronic prostatitis according recent study. Chronic pelvic pain is the chief complain of BPH followed by prostatitis. The gold standard of the etiological diagnosis is urine culture, but the negativity rate is still high. Multiplex polymerase chain reaction (PCR as a diagnostic tool in search of etiological causes could identify microorganism on DNA level. This research aims to find out the role of multiplex polymerase chain reaction as diagnostic tools on prostatitis patients. Material and Method: A total of 12 samples collected during the TURP procedure in Sanglah General Hospital Denpasar – Bali from February until May 2015. All of the samples has been diagnosed prostatitis clinically and perform urine culture test. The prostate specimen taken was sent to the Pathological anatomy for histopathology diagnostic and underwent multiplex PCR for etiologic diagnostic. Result: 12 samples have been declared as prostatitis based on histopathology examination, and then were analyzed using multiplex PCR. 10 samples were positive (6 were E. coli, 2 were C. trachomatis, the rest were N. gonorrhea and P. aeruginosa. The urine culture revealed 9 positive, within the result 6 were E. coli, and the others were P. aeruginosa, M. morganii and A. haemolyticus. Conclusion: In prostatitis patient, the etiological diagnostic was important. Multiplex PCR as diagnostic tools could detect the microorganism on a negative urine culture. The combination of the urine culture test and multiplex PCR revealed a better result on etiologic diagnosis which leads to a better management of the disease.
Pathogen Causing Disease of Diagnosis PCR Tecnology
SEVİNDİK, Emre; KIR, A. Çağrı; BAŞKEMER, Kadir; UZUN, Veysel
2013-01-01
Polimerase chain reaction (PCR) with which, the development of recombinant DNA tecnology, a technique commonly used in field of moleculer biology and genetic. Duplication of the target DNA is provided with this technique without the need for cloning. Some fungus species, bacteria, viruses constitutent an important group of pathogenicity in human, animals and plants. There are routinely applied types of PCR in the detection of pathogens infections diseases. These Nested- PCR, Real- Time PCR, M...
Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum
Directory of Open Access Journals (Sweden)
Ching Giap Tan
2014-09-01
Full Text Available The present study was based on the reverse transcription polymerase chain reaction (RT-PCR of the 16S ribosomal nucleic acid (rRNA of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20–25 h at 37 °C, 22–25 h at 16 °C, and 23–27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h. The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.
Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal
2012-01-01
The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.
Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun
2014-09-01
The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.
Mackay, Ian M.; Arden, Katherine E.; Nitsche, Andreas
2002-01-01
The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of P...
Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur
2017-05-17
Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.
Real time polymerase chain reaction in diagnosis of chronic myeloid leukemia
International Nuclear Information System (INIS)
Tashfeen, S.; Ahmed, S.; Bhatti, F.A.; Ali, N.
2014-01-01
Objective: To compare the sensitivity and specificity of Real Time Polymerase Chain Reaction (RT-PCR) with conventional cytogenetics in diagnosis of chronic myeloid leukemia. Study Design: A cross-sectional, analytical study. Place and Duration of Study: The Armed Forces Institute of Pathology (AFIP), Rawalpindi, from December 2010 to January 2012. Methodology: A total number of 40 patients were studied, in which all were diagnosed as CML on peripheral blood and bone marrow aspiration. The subjects were tested for the presence of Philadelphia (Ph) chromosome by cytogenetics and BCR-ABL fusion gene by RT-PCR. 2-3 ml of venous blood was collected, half in sodium heparin (anti-coagulant) for cytogenetics and half in EDTA for PCR. For cytogenetics, cells were cultured for 72 hours in RPMI 1640 medium and examined by arresting in metaphase using Colchicine to identify Philadelphia chromosome. For PCR, RNA extraction was done by Tri Reagent LS (MRC, USA) and cDNA was synthesized using reverse transcriptase and gene specific primer. RT- PCR was done on ABI-7500. The positive samples were identified when fluorescence exceeded threshold limit. Results of cytogenetics and RT PCR were compared. Results: Out of the 40 patients, PCR showed 37 (92.5%) were positive and 3 (7.5%) were negative for BCR-ABL fusion gene, whereas in cytogenetics 28 (70%) were positive for Ph chromosome and 12 (30%) were negative for Ph chromosome. Sensitivity and specificity of cytogenetics was 75.6% and 100% respectively. Conclusion: Real time PCR as compared to cytogenetics is less tedious, gives quick results, does not require multiple sampling due to culture failure and can be done on peripheral blood. (author)
International Nuclear Information System (INIS)
Fox, J.C.; Ait-Khaled, Mounir; Webster, Alison; Emery, V.C.
1991-01-01
The sensitivity of polymerase chain reaction (PCR) can mean that even very low levels of contamination with the target DNA will result in a positive signal. At present this aspect is a major limitation in the use of PCR as a routine diagnostic method. By exposing PCR reagents to UV light, contaminating DNA can be inactivated, thus providing an opportunity to eradicate false positive reactions. UV irradiation was applied to PCR systems used for detection of human cytomegalovirus CMV and human immunodeficiency virus (HIV) and shown to be effective in eradicating both laboratory encountered contamination and plasmid DNA (below 100 pg) added to PCR systems prior to UV exposure. Sensitivity of a PCR system to amplify the long terminal repeat (LTR) sequence of HIV-1 was not affected by the irradiation procedure; however, ultimate sensitivity of a PCR system for the amplification of an early gene pro-motor sequence of the CMV genome was reduced 1000-fold. UV irradiation did not affect the size of the PCR product as determined by strand separating polyacrylamide gel electrophoresis of a 32 P-labelled amplimer. Thus, a simple pre-exposure to UV light would seem a worth-wile step to incorporate into PCR protocols provided that the effects on sensitivity have been determined empirically for each PCR system. (author). 11 refs.; 3 figs
Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo
2013-01-01
Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334
DEFF Research Database (Denmark)
Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard
2015-01-01
Background. Isolation of patients suspected for pulmonary tuberculosis is guided by serial sputum smears. This can result in isolation for days for patients with noncontagious tuberculosis. To determine whether a single sample negative for Mycobacterium tuberculosis complex at polymerase chain...... reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days...... before or after the initial culture-positive sample. We repeated the process for those with ≥2 samples within 28 days. The primary outcome was PCR-negative, smear-positive patients. Results. We included 53 533 sputum samples from 20 928 individuals; 1636 had culture-confirmed tuberculosis. Of these, 856...
Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo
2004-01-01
We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...
Directory of Open Access Journals (Sweden)
PD Andrade
2013-01-01
Full Text Available BACKGROUND: Human cytomegalovirus is an important cause of morbidity and mortality in immunocompromised patients. Qualitative polymerase chain reaction (PCR has proven to be a sensitive and effective technique in defining active cytomegalovirus infection, in addition to having low cost and being a useful test for situations in which there is no need for quantification. Real-time PCR has the advantage of quantification; however, the high cost of this methodology makes it impractical for routine use.
The polymerase chain reaction and its application to clinical plastic surgery.
LENUS (Irish Health Repository)
Rea, S
2012-02-03
Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.
DEFF Research Database (Denmark)
Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld
2007-01-01
Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage,......, and this feature is relevant in investigating RHD mosaicism and chimerism....
Directory of Open Access Journals (Sweden)
Yong-Zhong Wang
Full Text Available OBJECTIVES: Detection of mutations associated to nucleos(tide analogs and hepatitis B virus (HBV genotyping are essential for monitoring treatment of HBV infection. We developed a multiplex polymerase chain reaction-ligase detection reaction (PCR-LDR assay for the rapid detection of HBV genotypes and mutations associated with lamivudine, adefovir, and telbivudine resistance in HBV-infected patients. METHODS: HBV templates were amplified by PCR, followed by LDR and electrophoresis on a sequencer. The assay was evaluated using plasmids that contained wild-type or mutant HBV sequences and 216 clinical samples. RESULTS: The PCR-LDR assay and sequencing gave comparable results for 158 of the 216 samples (73.1% with respect to mutation detection and genotyping. Complete agreement between the two methods was observed for all the samples (100% at codon 180 and codon 204. Concordant results were observed for 99.4% of the 158 samples at codon 181 and 98.7% at codon 236. The genotyping results were completely concordant between the PCR-LDR assay and sequencing. The PCR-LDR assay could detect a proportion of 1% mutant plasmid in a background of wild-type plasmid. CONCLUSION: The PCR-LDR assay is sensitive and specific for detection of HBV genotypes and drug resistance mutations, and could be helpful for decision making in the treatment of HBV infection.
Pérez Urquiza, M.; Acatzi Silva, A. I.
2014-02-01
Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.
DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.
Guthrie, J N; Moriarty, D J; Blackall, L L
2000-12-15
A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.
Directory of Open Access Journals (Sweden)
Nikhil Moorchung
2011-01-01
Full Text Available Background: Lymphoid malignancies are a heterogeneous group of disorders which may be difficult to differentiate from reactive proliferations even after immunohistochemistry. Polymerase chain reaction (PCR is believed to be a good adjunct tool for diagnosis. Materials and Methods: We examined 24 cases of neoplastic and non-neoplastic lymphoproliferative lesions in this study and evaluated the PCR as an additional tool in the confirmation of the diagnosis. Two different PCR methodologies were evaluated. Results: In the evaluation of the T-cell PCR, it was seen that the correlation using both the commercial kits and the custom-synthesized primers was highly significant at a P value of 0.05. Conclusions: Both the methods showed an excellent concordance for T-cell γ gene rearrangements, However, the same was not seen in the B-cell receptor rearrangements. This may be because of the small sample size or the inability of consensus V primers to recognize complementary DNA sequences in all of the V segments.
Sakuraoka, Yuhki; Sawada, Tokihiko; Shiraki, Takayuki; Park, Kyunghwa; Sakurai, Yuhichiro; Tomosugi, Naohisa; Kubota, Keiichi
2012-07-28
To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC). Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC. Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years. Quantitative PCR was performed. Immunohistochemistry and in situ hybridization for hepcidin were also performed. Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully. The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues. A method of in situ hybridization for hepcidin was established successfully, and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue. We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.
Multi-template polymerase chain reaction.
Kalle, Elena; Kubista, Mikael; Rensing, Christopher
2014-12-01
PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.
an overview on the application of polymerase chain reaction (pcr)
African Journals Online (AJOL)
DR. AMINU
Hill New York Pp818. Chul, W.P., Jang-Hee, H., Jin-Hyeok, J. et al (2004). Detection rates of Bacteria in chronic Otitis. Media with Effusion in Children, Journal of. Korean Medical Sciences 19: 735-738. Cockerill, F.R. and Smith, T.F. (2002). Rapid-Cycle real time PCR: A revolution of clinical. Microbiology. ASM News 68:2.
Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.
The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of
Pierce, Kenneth E; Wangh, Lawrence J
2007-01-01
Accurate detection of gene sequences in single cells is the ultimate challenge to polymerase chain reaction (PCR) sensitivity. Unfortunately, commonly used conventional and real-time PCR techniques are often too unreliable at that level to provide the accuracy needed for clinical diagnosis. Here we provide details of linear-after-the-exponential-PCR (LATE-PCR), a method similar to asymmetric PCR in the use of primers at different concentrations, but with novel design criteria to ensure high efficiency and specificity. Compared with conventional PCR, LATE-PCR increases the signal strength and allele discrimination capability of oligonucleotide probes such as molecular beacons and reduces variability among replicate samples. The analysis of real-time kinetics of LATE-PCR signals provides a means for improving the accuracy of single cell genetic diagnosis.
International Nuclear Information System (INIS)
John C. Fisher
2000-01-01
Although helium atoms do not form molecules, a sufficiently large number will bind into a stable liquid droplet. A comparable situation is expected for neutrons, with a sufficiently large number binding into a stable droplet of neutron matter. Such polyneutron droplets can be viewed as isotopes of an element with nuclear charge Z=0, tentatively denoted neutrium, symbol Nt. Because of the relatively weak binding of neutrons compared with that of a mix of neutrons and protons, the minimum number of neutrons required for stability of a droplet is fairly large. Early estimates of ∼60 may be reduced to a dozen or so by the BCS pairing interaction. The Nt entries with N≥12 are new to the table of isotopes. Because all of them are beta-unstable, none is expected to persist as a free particle. Yet, some may occasionally be produced by means to be described below, and it is of interest to examine their decay chains and their interactions with charged nuclei to ascertain how their presence might be revealed. Although these reactions are interesting, they cannot be taken seriously without identifying a source for the initial Nt isotope that begins the chain. Here, we consider possible interactions between 16 O and A Nt. Although there is no strong interaction between them, we can expect a very weak residual attraction that can form a loosely bound 16 O A Nt nuclear molecule. This is not a compound nucleus in the usual sense because, considered as fluids, the 16 O and A Nt droplets are immiscible. For a droplet with fewer than about 60 neutrons, beta decay of A Nt is prevented by the buildup of Coulomb energy associated with transforming A Nt into A H in close proximity to 16 O. Thus, it is possible that 16 O A Nt molecules can persist indefinitely and that a few of them may be present in ordinary water as supermassive oxygen nuclei. Because the binding of these molecules is weak, the A Nt component can tunnel to an adjacent nucleus, and if the adjacent nucleus is 18 O, a
Clinical value of polymerase chain reaction in detecting group B streptococcus during labor.
Koppes, Dorothea Maria; Vriends, Antonius Arnoldus Cornelis Maria; van Rijn, Michiel; van Heesewijk, Antonine Dimphne
2017-06-01
To reduce the intrapartum use of antibiotics in women with prolonged rupture of the membranes (PROM) by restriction of antibiotics to women who are colonized with group B streptococci (GBS), as identified with the Cepheid Gene Xpert polymerase chain reaction (PCR) for detecting GBS. We conducted a randomized controlled trial among full-term delivering women with PROM. Fifty-four women were enrolled, based on a power calculation with a significance level of 5% and a power of 95%. Twenty-seven women received the standard treatment (rectovaginal swab [RVS] for bacterial culture and antibiotics). For another 27 women PCR was performed on the RVS and antibiotics were used only when the PCR was positive. The primary outcome was reduction in antibiotic use, defined as the percentage of women who received antibiotics during labor. 54 Women were enrolled in the study between 1 May and 18 November 2014. There were no significant differences in baseline characteristics. In total, 10 of the 54 women were GBS positive (18.5%). Of those 10 women, three were identified on bacterial culture and seven on PCR. In the bacterial culture group all the women received antibiotics. In the PCR group 10 women (37%) received antibiotics (P = 0.002). Two false-positive PCR tests were identified. There were no false-negative PCR tests. Real-time identification of GBS on PCR reduces the intrapartum use of antibiotics in women with PROM. © 2017 Japan Society of Obstetrics and Gynecology.
Does Polymerase Chain Reaction of Tissue Specimens Aid in the Diagnosis of Tuberculosis?
Directory of Open Access Journals (Sweden)
Yoo Jin Lee
2016-11-01
Full Text Available Background Mycobacterial culture is the gold standard test for diagnosing tuberculosis (TB, but it is time-consuming. Polymerase chain reaction (PCR is a highly sensitive and specific method that can reduce the time required for diagnosis. The diagnostic efficacy of PCR differs, so this study determined the actual sensitivity of TB-PCR in tissue specimens. Methods We retrospectively reviewed 574 cases. The results of the nested PCR of the IS6110 gene, mycobacterial culture, TB-specific antigen-induced interferon-γ release assay (IGRA, acid-fast bacilli (AFB staining, and histological findings were evaluated. Results The positivity rates were 17.6% for PCR, 3.3% for the AFB stain, 22.2% for mycobacterial culture, and 55.4% for IGRA. PCR had a low sensitivity (51.1% and a high specificity (86.3% based on the culture results of other studies. The sensitivity was higher (65.5% in cases with necrotizing granuloma but showed the highest sensitivity (66.7% in those with necrosis only. The concordance rate between the methods indicated that PCR was the best method compared to mycobacterial culture, and the concordance rate increased for the methods using positive result for PCR or histologic features. Conclusions PCR of tissue specimens is a good alternative to detect tuberculosis, but it may not be as sensitive as previously suggested. Its reliability may also be influenced by some histological features. Our data showed a higher sensitivity when specimens contained necrosis, which indicated that only specimens with necrosis should be used for PCR to detect tuberculosis.
Tabachnick, W J; MacLachlan, N J; Thompson, L H; Hunt, G J; Patton, J F
1996-05-01
Cattle bloods containing only polymerase chain reaction (PCR)--detectable bluetongue-10 viral nucleic acid, but as determined by virus isolation techniques, not bluetongue-10 virus, were incapable of infecting intrathoracically inoculated Culicoides variipennis sonorensis. These insects also failed to transmit bluetongue-10 virus when fed on sheep. Cattle whose blood contain only PCR-detectable bluetongue viral nucleic acid, but no infectious virus, are unlikely to play a role in the epidemiology of bluetongue. The biological significance of PCR-based detection assays and their effect on animal health regulations on the international trade of livestock and livestock germplasm is discussed. Bluetongue virus infection provides a very useful model with which to study arthropod-transmitted RNA virus infections of humans and other animals.
International Nuclear Information System (INIS)
Tang Yabing; Xing Da; Zhu Debin; Liu Jinfeng
2007-01-01
Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity
Banerjee, Surajita; Biswas, Nibir; Kanti Das, Nilay; Sil, Amrita; Ghosh, Pramit; Hasanoor Raja, Abu Hena; Dasgupta, Sarbani; Kanti Datta, Pijush; Bhattacharya, Basudev
2011-12-01
Diagnosing leprosy is challenging, especially in early-stage cases, and the need for a sensitive diagnostic tool is urgent. Polymerase chain reaction (PCR) holds promise as a simple and sensitive diagnostic tool, but its usefulness in the Indian context requires further evaluation. Slit-skin smear (SSS) remains the conventional method of leprosy detection. Hence, this study was undertaken to evaluate and compare the diagnostic efficacy of PCR versus that of SSS. Punch biopsy of skin and SSS were obtained from the active margins of lesions. Cases were clinically grouped according to whether they were multibacillary (MB) or paucibacillary (PB) and classified into tuberculoid (TT), borderline tuberculoid (BT), borderline lepromatous (BL), lepromatous (LL), histoid, and indeterminate groups after clinicopathological correlation. DNA was extracted from biopsy specimens, and multiplex PCR was carried out incorporating primers intended for the amplification of a specific 372-bp fragment of a repetitive sequence of Mycobacterium leprae DNA. Among 164 patients, PCR was positive in 82.3%. The sensitivity of PCR was significantly greater (P chain reaction had higher sensitivity compared with SSS, especially in diagnostically challenging and PB cases. Thus, the use of this costly but sensitive tool should be restricted to this subgroup, because SSS is sufficiently sensitive in the diagnosis of LL and histoid leprosy. © 2011 The International Society of Dermatology.
Testing for Genetically Modified Foods Using PCR
Taylor, Ann; Sajan, Samin
2005-01-01
The polymerase chain reaction (PCR) is a Nobel Prize-winning technique that amplifies a specific segment of DNA and is commonly used to test for the presence of genetic modifications. Students use PCR to test corn meal and corn-muffin mixes for the presence of a promoter commonly used in genetically modified foods, the cauliflower mosaic virus 35S…
Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn
2009-08-01
A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.
Directory of Open Access Journals (Sweden)
Natália Malaguti
2015-01-01
Full Text Available Bacterial vaginosis (BV is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%, and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future.
Mogeni, Polycarp; Williams, Thomas N; Omedo, Irene; Kimani, Domtila; Ngoi, Joyce M; Mwacharo, Jedida; Morter, Richard; Nyundo, Christopher; Wambua, Juliana; Nyangweso, George; Kapulu, Melissa; Fegan, Gregory; Bejon, Philip
2017-11-27
Malaria control strategies need to respond to geographical hotspots of transmission. Detection of hotspots depends on the sensitivity of the diagnostic tool used. We conducted cross-sectional surveys in 3 sites within Kilifi County, Kenya, that had variable transmission intensities. Rapid diagnostic test (RDT), microscopy, and polymerase chain reaction (PCR) were used to detect asymptomatic parasitemia, and hotspots were detected using the spatial scan statistic. Eight thousand five hundred eighty-one study participants were surveyed in 3 sites. There were statistically significant malaria hotspots by RDT, microscopy, and PCR for all sites except by microscopy in 1 low transmission site. Pooled data analysis of hotspots by PCR overlapped with hotspots by microscopy at a moderate setting but not at 2 lower transmission settings. However, variations in degree of overlap were noted when data were analyzed by year. Hotspots by RDT were predictive of PCR/microscopy at the moderate setting, but not at the 2 low transmission settings. We observed long-term stability of hotspots by PCR and microscopy but not RDT. Malaria control programs may consider PCR testing to guide asymptomatic malaria hotspot detection once the prevalence of infection falls. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.
Directory of Open Access Journals (Sweden)
Tiana Milanda
2014-09-01
Full Text Available Escherichia coli is a rod negative Gram which could be pathogenic, if its value increases or located in outer gastrointestinal tract. Pathogenic E. coli will produce enterotoxin which will cause diarrhoea or infection in urine tract. Ampicilin was one of particular antibiotics to overcome infection. Ampicilin nowadays is no longer used as primary medicine, because of its resistance case. The aim of this research is to detect the presence of gene which is responsible to ampicilin resistant E. coli. We used isolated midstream urine from cystitis object in Hasan Sadikin Hospital (RSHS as samples. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were done to invenstigate the antibiotic resistency. Based on the result of antibiotic susceptibility testing to ampicillin, E. coli samples were resistant to ampicilin. Elektroforegram products of colony-PCR and DNA-PCR showed that the resistance case of ampicilin caused by bla gene (199 bp. Selective and rational antibiotic treatment is required to prevent ampicillin resistance in patients with symptoms
Rapid establishment of polymerase chain reaction-restriction ...
African Journals Online (AJOL)
RFLP) optimization reaction system for cpDNA in tea [Camellia sinensis (L.) O. Kuntze] was rapidly established. Results show that the optimal PCR reaction system was 100 ng template DNA, 200 μmolL-1 dNTPs, 1.5 mmolL-1 MgCl2, 50 ng primer, ...
Jawad, Nisreen; Ahemd, Asmat; Abdullah, Aminah
2018-04-01
The aim of this study was to investigate the presence of Bacillus cereus and detection of enterotoxigenic genes in food samples by utilizing a Polymerase Chain Reaction technique (PCR). In this study the providence of B. cereus was carried out to food samples. The B. cereus isolates were investigated for enterotoxigenic gene. The cooked seafood, and raw milk samples were purchased from several restaurants and market in the area of (Bangi, Kajang, Serdang and UKM) Selangor, Malaysia. A total of 60 samples have been analyzed. B. cereus contamination has been formed between 1.4×105 - 3×105 cfu/mL of cooked seafood and raw milk samples. Five colonies have been detected as B. cereus using biochemical test. All B. cereus isolates named BC1 to BC27, were characterized for haemolytic enterotoxin (HBL) complex encoding genes (hblA), non-haemolytic enterotoxin encoding gene (NheA). 10 isolates have been reported to be positive towards hblA and 12 isolates were positive towards NheA. The presence of B. cereus and their enterotoxigenic genes in cooked seafood and raw milk from to food samples obtained may pose a potential risk for public health.
Directory of Open Access Journals (Sweden)
Xu Q
2015-06-01
Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect
DEFF Research Database (Denmark)
Andresen, K; Gasim, S; Elhassan, A M
1997-01-01
We have evaluated the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool for Leishmania donovani using blood, bone marrow and lymph node samples from Sudanese patients with a confirmed infection. Forty patients were diagnosed by microscopic examination of bone marrow or lymph...
Ieven, M; Ursi, D; Van Bever, H; Quint, W; Niesters, H G; Goossens, H
Mycoplasma pneumoniae and viruses in acute respiratory tract infections in children were studied during the winter of 1992-1993 in Antwerp, Belgium. M. pneumoniae was diagnosed in nasopharyngeal aspirates by culture and polymerase chain reaction (PCR). For this, amplification of a fragment of the PI
Multi-template polymerase chain reaction
Directory of Open Access Journals (Sweden)
Elena Kalle
2014-12-01
Full Text Available PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.
Directory of Open Access Journals (Sweden)
Dastur R
2003-01-01
Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.
Fan, Hongxin; Robetorye, Ryan S
2013-01-01
Although established diagnostic criteria exist for mature T-cell neoplasms, a definitive diagnosis of a T-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because T-cell malignancies contain identically rearranged T-cell receptor gamma (TCRG) and/or beta (TCRB) genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal T-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal TCRB and TCRG gene rearrangements (TCRB and TCRG PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol for the TCRB assay involves the use of three separate multiplex master mix tubes. Tubes A and B target the framework regions within the variable and joining regions of the TCRB gene, and Tube C targets the diversity and joining regions of the TCRB gene. The core protocol for the TCRG assay utilizes two multiplex master mix tubes (Tubes A and B) that target the variable and joining regions of the TCRG gene. Use of the five BIOMED-2 TCRB and TCRG PCR multiplex tubes in parallel can detect approximately 94% of clonal TCR gene rearrangements.
Evaluation of a PCR assay for identification and differentiation of Campylobacter fetus subspecies
DEFF Research Database (Denmark)
Hum, S.; Quinn, K.; Brunner, J.
1997-01-01
methods were attributed to methodological differences used in various laboratories. Conclusion Our results indicate that misidentification of C fetus in routine diagnostic laboratories may be relatively common. The PCR assay evaluated gave rapid and reproducible results and is thus a valuable adjunctive......Objective To evaluate a polymerase chain reaction assay for identification of Campylobacter fetus and differentiation of the defined subspecies. Design Characterisation of bacterial strains by traditional phenotyping, polymerase chain reaction, a probabilistic identification scheme...... by traditional phenotypic methods and the PCR assay was found to be 80.8%. The polymerase chain reaction proved to be a reliable technique for the species and subspecies identification of C fetus; equivocal results were obtained in only two instances. Initial misidentifications by conventional phenotyping...
Directory of Open Access Journals (Sweden)
Shyamala G
2008-01-01
Full Text Available Background: Perinatal viral infections of fetus are among the leading causes of congenital cataract and identifying the viral etiology is important. Objectives: To detect the presence of Rubella virus (RV, herpes simplex virus (HSV and cytomegalovirus (CMV in lens aspirate specimens obtained from patients with congenital cataract and relate the results with serology. Setting and Design: Prospective study carried out in tertiary care hospital. Materials and Methods: Fifty lens aspirates from 50 infants with congenital cataract were subjected to HSV, RV isolation and polymerase chain reaction (PCR for detection of HSV and CMV. Reverse transcription polymerase chain reaction (RT-PCR was applied for RV detection. Peripheral blood specimens were screened for anti-HSV, RV and CMV antibodies by enzyme-linked immunosorbant assay (ELISA. Results: Rubella virus was detected in nine (18% lens aspirates, by nRT-PCR which includes six positive by culture. HSV-2 DNA was detected in nine other lens aspirates, while CMV was not detected by PCR. Serological results did not correlate with the presence of viruses in the lens aspirates. This is the first report of detection of HSV-2 DNA in cases of congenital cataract. Conclusions: Cytomegalovirus may not be playing a significant role in causation of congenital cataract. The role of serology in identifying causative viral infection for congenital cataract needs to be re-evaluated.
Directory of Open Access Journals (Sweden)
Herintha Coeto Neitzke-Abreu
Full Text Available Cutaneous leishmaniasis (CL can occur in skin and mucosa, causing disfiguring lesions. The laboratory diagnosis of CL involves immunological methods and optical detection of the parasite, al of which have limitations. There is a need for more effective diagnostic methods for CL which wil allow treatment to be initiated more promptly in order to help prevent the development of severe forms of mucosal disease, and to estimate the prognosis of the infection. The polymerase chain reaction (PCR has been widely used to diagnose CL, because of its higher sensitivity. This study estimated the accuracy and compared PCRs of samples from lesion scarification (PCR-L and blood sample-enriched leukocytes (PCR-B with three conventional diagnostic techniques: parasite direct search (DS, Montenegro skin test (MST, and indirect immunofluorescence reaction (IIF. The study included 276 patients under suspicion of CL. We conducted a cross-sectional study, in which patients were selected by convenience sampling. We used MP3H/MP1L primers to generate a Leishmania (Viannia (minicircle kDNA fragment of 70-bp. Of 106 patients with CL, 83.87%, 51.67%, 64.52%, 85.71%, or 96.10% tested positive by PCR-L, PCR-B, DS, IIF, or MST, respectively. Five patients tested positive only by PCR-L, and two other patients only by PCR-B. PCR-L is indicated for use in patients with chronic lesions or Leishmania reinfection, which may progress to mucosal lesion. PCR-B is indicated for use in patients with negative results in conventional tests or for patients with no apparent lesion. PCR is not only useful in diagnosing CL but also helps to identify the infecting species.
DEFF Research Database (Denmark)
Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte
2012-01-01
To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...... (NA) and European (EU) genotype isolates were analyzed by the participants. Great differences regarding qualitative diagnostics as well as analytical sensitivity were observed between the individual RT-qPCR systems, especially when investigating strains from the EU genotype. None of the assays...
International Nuclear Information System (INIS)
Nie Leng; Gao Lizeng; Yan Xiyun; Wang Taihong
2007-01-01
Functionalized tetrapodal ZnO nanostructures are tested in plasmid DNA experiments (1) as a solid-phase adsorbent for plasmid DNA purification (2) as improving reagents in a polymerase chain reaction (PCR) and (3) as novel carriers for gene delivery. The amino-modification, the tetrapod-like shape of the nanostructure and its high biocompatibility all contribute to measurements showing promise for applications. A sol-gel method is used for silica coating and amino-modification. Plasmid DNA is purified through reversible conjugations of amino-modified ZnO tetrapods with DNA. Also, as additional reagents, functionalized tetrapods are shown to improve the amount of PCR product. For transfection, ZnO tetrapods provide some protection against deoxyribonuclease cleavage of plasmid DNA and deliver plasmid DNA into cells with little cytotoxicity
DEFF Research Database (Denmark)
Larsen, Lars Erik; Tjørnehøj, Kirsten; Viuff, B.
1999-01-01
A reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for detection of bovine respiratory syncytial virus (BRSV) in lung tissue of naturally and experimentally infected cattle. Primers were selected from the gene coding the F fusion protein, which is relatively conserved......, in addition, 10 animals that were negative with the ELISA were positive with the RT-PCR assay. These results indicates that the RT-PCR assay can be a sensitive, reliable alternative to conventional diagnostic procedures....... among BRSV isolates. The RT-PCR assay was highly specific, it yielded positive reactions only when performed on BRSV-infected cell cultures or tissues. The detection limit of the RT-PCR assay was assessed as 5 TCID50. BRSV was detected in tissues of the respiratory tract and in the tracheobroncheal...
Directory of Open Access Journals (Sweden)
Tiana Milanda
2014-12-01
Full Text Available Pseudomonas aeruginosa is an opportunistic Gram negative bacteria, which may cause infection in eyes, ears, skin, bones, central nervous system, gastrointestinal tract, circulatory system, heart, respiratory system, and urinary tract. Recently, chloramphenicol is no longer used as the main option of the therapy due of its resistance case. The aim of this research was to detect the presence of gene which is responsible to chloramphenicol resistance in clinical isolates of P.aeruginosa. These bacteria isolated from pus of external otitis patients in Hasan Sadikin Hospital in Bandung City. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were performed to detect this resistance gene. Electropherogram from PCR products showed that the chloramphenicol resistance in clinical isolates of P. aeruginosa was caused by cat gene (317 bp. Based on this research, cat gene may be used to detect the chloramphenicol resistance in patients with external ostitis.
Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).
Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli
2018-02-26
Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.
Directory of Open Access Journals (Sweden)
Cielo M. León
2017-10-01
Full Text Available Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR, limit of detection (LoD and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia. Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America.
León, Cielo M.; Muñoz, Marina; Hernández, Carolina; Ayala, Martha S.; Flórez, Carolina; Teherán, Aníbal; Cubides, Juan R.; Ramírez, Juan D.
2017-01-01
Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR) including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets) and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR), limit of detection (LoD) and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively) and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia). Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America. PMID:29046670
Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn
2013-06-01
A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. Copyright © 2013 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Jobin Thomas
2014-11-01
Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.
Amplification of nonspecific products in quantitative polymerase chain reactions (qPCR)
Ruiz-Villalba, Adrián; van Pelt-Verkuil, Elizabeth; Gunst, Quinn D.; Ruijter, Jan M.; van den Hoff, Maurice J. B.
2017-01-01
Quantitative PCR allows the precise measurement of DNA concentrations and is generally considered to be straightforward and trouble free. However, a survey with 93 validated assays for genes in the Wnt-pathway showed that the amplification of nonspecific products occurs frequently and is unrelated
Typing of Y chromosome SNPs with multiplex PCR methods
DEFF Research Database (Denmark)
Sanchez Sanchez, Juan Jose; Børsting, Claus; Morling, Niels
2005-01-01
We describe a method for the simultaneous typing of Y-chromosome single nucleotide polymorphism (SNP) markers by means of multiplex polymerase chain reaction (PCR) strategies that allow the detection of 35 Y chromosome SNPs on 25 amplicons from 100 to 200 pg of chromosomal deoxyribonucleic acid...... factors for the creation of larger SNP typing PCR multiplexes include careful selection of primers for the primary amplification and the SBE reaction, use of DNA primers with homogenous composition, and balancing the primer concentrations for both the amplification and the SBE reactions....
Directory of Open Access Journals (Sweden)
Eduardus Bimo Aksono
2017-06-01
Full Text Available Legionella pneumophila is a Gram-negative bacillus that causes nosocomial and community-acquired pneumonia. The aim of this research was to detect the presence of bacteria of L. pneumophila species in the swimming pools water of Surabaya city by using nested Polymerase Chain Reaction (PCR assay of a specific gene for L. pneumophila (mip gene. This study used purposive sampling method. A total of 10 water samples were collected from five swimming pools consisting of 200 mL water for each swimming pool. The results showed that of 10 samples tested by nested PCR, one sample was positive for L. pneumophila, and nine samples were negative. L. pneumophila were found in pool water samples with a higher temperature (>30ºC.Serogrouping analysis of positive sample that L. pneumophila bacteria detected in the water sample of swimming pool in Surabaya was L. pneumophila serogroup 9 (98% and serogroup 10 (98%. L. pneumophila detection of bacteria is expected to raise the awareness of physician and microbiologists about the transmission of L. pneumophila and will also be useful for controlling the agents. ABSTRAK Legionella pneumophila adalah bakteri Gram-negatif berbentuk batang yang dapat menyebabkan penyakit nosokomial dan pneumonia. Tujuan penelitian ini adalah untuk mendeteksi keberadaan bakteri L. pneumophila pada air kolam renang di Kota Surabaya dengan menggunakan nested Polymerase Chain Reaction (PCR berbasis gen spesifik L. pneumophila (mip gene. Penelitian ini menggunakan metode purposive sampling. Sebanyak sepuluh sampel diambil dari lima kolam renang. Sampel diambil sebanyak 200 mL dari air kolam renang di setiap lokasi. Hasil dari 10 sampel yang diuji menggunakan nested PCR, satu sampel menunjukkan hasil positif untuk L.pneumophila, dan sembilan sampel menunjukkan hasil negatif. Bakteri L. pneumophila ditemukan pada sampel air kolam dengan suhu yang lebih tinggi (>30ºC. Satu sampel positip tersebut ketika dilanjutkan terhadap analisis serogrup
Taylor, P.W.; Winton, J.R.
2002-01-01
Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.
David E. Schreiber; Karen J. Garner; James M. Slavicek
1997-01-01
Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...
Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y; Whelen, A Christian; Calimlim, Precilia S; Sciulli, Rebecca H; Honda, Stacey A A; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M; da Silva, Alexandre J
2016-01-01
Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis. © The American Society of Tropical Medicine and Hygiene.
Directory of Open Access Journals (Sweden)
Raden Wasito
2015-05-01
Full Text Available Avian influenza virus subtype H5N1 (AIV H5N1 is highly pathogenic and fatal in poultry. The virusis still endemic with low virulence rate, although it may play a critical role in causing high morbidity andmortality rates in poultry in Indonesia. In general, diagnostic approach for AIV H5N1 is based onconventional serological and viral isolation methods that have the potential to produce consumings oftime and relatively expensive cost within the laboratory without compromising test utility. Thus, amolecular approach of multiplex reverse transcription-polymerase chain reaction (mRT-PCR was developedand applied for the detection of matrix gene type A influenza viruses, AIV subtype subtype H5hemagglutinin gene with simultaneous detection of N1 nucleoprotein gene. Thirty sera specimens fromthe diseased commercial chickens that were specifically amplified positive-RT-PCR for AIV H5N1 wereselected for mRT-PCR. The mRT-PCR products were visualized by agarose gel electrophoresis and consistedof DNA fragments of AIV of 245 bp, 545 bp and 343 bp for M, H5 and N1 genes, respectively. Thus, themRT-PCR that can rapidly differentiate simultaneously between these genes is very important for thecontrol and even eradication of AIV transmission in poultry in Indonesia.
Detection of chromosome abnormalities by quantitative fluorescent PCR in ectopic pregnancies
Goddijn, Mariette; van Stralen, Marja; Schuring-Blom, Heleen; Redeker, Bert; van Leeuwen, Liesbeth; Repping, Sjoerd; Leschot, Nico; van der Veen, Fulco
2005-01-01
Objective: To evaluate the potential value of quantitative fluorescent polymerase chain reaction (QF-PCR) in the detection of chromosome abnormalities in ectopic pregnancies. Methods: Seventy chorionic villi samples of ectopic pregnancies were studied by QF-PCR. Primers for chromosomes 16, 21, X and
International Nuclear Information System (INIS)
Fanaro, G.B.; Aquino, S.; Guedes, R.L.; Crede, R.G.; Sabundjian, I.T.; Ruiz, M.O.; Villavicencio, A.L.C.H.
2005-01-01
Today Brazil, as the largest soy exporter in the world, has undergone the consequences of the contamination of these crops by the Asian dust fungus, being harmed since the plantation up to the harvest, with losses in its productivity ranging 10-80%. As it is a new disease in the Americas, there are not any resistant species to this fungus attack. The grains contamination harms the exportation for countries which do not want to have their crops contaminated, affecting therefore the international commerce and agro-business relationship with those countries Brazil has trade with. The Asian dust is caused by the fungus Phakopsora pachyrhizi and its dissemination is of difficult control, since occurs through the wind dispersion. The P. pachyrhizi is an Asian fungus and was recently found in South Africa, Paraguay, Argentina and Brazil. As an alternative process to minimize these losses is the process to preserve the grains by radiation, the use of the electron accelerator was indicated, since its advantage for the grains exportation industry is fundamental. Besides the possibility of being disconnected when not in use, this source does not need to be recharged, is easily available and has high dose rate, streamlining the process and reducing logistics costs. The present work aims to identify, by the Polymerase Chain Reaction technique (PCR), the P. pachyrhizi fungus presence in the irradiated soy grains, at doses 1 and 2 kGy, at the IPEN-CNEN electron Accelerator, a Dynamitron Machine (Radiation Dynamics Co. model JOB, New York, USA), with 1.5 MeV power and 2.5 mA electrical current. (author)
Boussier, Rémi; Rogez, Sylvie; François, Bruno; Denes, Eric; Ploy, Marie-Cécile; Garnier, Fabien
2013-03-01
Positive heart valve (HV) culture is a major Duke's criterion for the diagnosis of infective endocarditis but is poorly sensitive. Two broad-range 16S rDNA polymerase chain reaction (PCR) methods were applied to 31 HV samples: first, a real-time method, then conventional end-point PCR was applied to HV samples on which the first PCR was negative. Five specific real-time PCR procedures were also used in order to identify Bartonella spp., Tropheryma whipplei, Chlamydophila pneumoniae, Mycoplasma pneumonia, and Coxiella burnetii. A strategy combining the 2-step broad-range PCR methods improved the sensitivity of the molecular method from 38.7% to 58%. Specific PCR identified 1 T. whipplei, which was also identified by conventional end-point PCR. These results confirm that blood culture is the gold standard for the diagnosis of infective endocarditis, shows that molecular methods applied to HV can be useful when blood culture is negative, and that 2-step broad-range PCR approach seems to be more sensitive. Copyright © 2013 Elsevier Inc. All rights reserved.
Multiplex polymerase chain reaction test for the diagnosis of acute viral hepatitis A.
Heo, Nae-Yun; Lim, Young-Suk; An, Jihyun; Ko, Sun-Young; Oh, Heung-Bum
2012-12-01
The early diagnosis of acute hepatitis A (AHA) is hindered because serum IgM against hepatitis A virus (HAV) can yield false-negative results during the window period. This study evaluated the diagnostic accuracy of a polymerase chain reaction (PCR) kit for HAV RNA for the diagnosis of AHA. Samples were collected from 136 patients with acute severe hepatitis at their admission to Asan Medical Center between June 2010 and July 2010. Samples were analyzed for serum IgM anti-HAV using an immunoassay test and for qualitative HAV RNA using the Magicplex HepaTrio PCR test kit. The diagnostic accuracies of these methods were tested on the basis of clinical and laboratory diagnoses of AHA. The concordance rate and kappa value between IgM anti-HAV and HAV RNA PCR were 88.2% and 0.707, respectively. For the diagnosis of AHA, the sensitivity and specificity of IgM anti-HAV were 90.7% and 100%, respectively, when an "equivocal" result was regarded as positive; and 79.1% and 100%, respectively, when an "equivocal" result was regarded as negative. The sensitivity and specificity of HAV RNA PCR were 81.4% and 100%, respectively. All four patients with negative IgM anti-HAV and positive HAV RNA PCR results and all four patients with equivocal IgM anti-HAV RNA and positive HAV RNA PCR results were eventually diagnosed with AHA. The qualitative HAV RNA PCR test has an equivalent diagnostic accuracy for AHA compared to IgM anti-HAV and may be more sensitive during the window period.
Bi, Sai; Yue, Shuzhen; Zhang, Shusheng
2017-07-17
Developing powerful, simple and low-cost DNA amplification techniques is of great significance to bioanalysis and biomedical research. Thus far, many signal amplification strategies have been developed, such as polymerase chain reaction (PCR), rolling circle amplification (RCA), and DNA strand displacement amplification (SDA). In particular, hybridization chain reaction (HCR), a type of toehold-mediated strand displacement (TMSD) reaction, has attracted great interest because of its enzyme-free nature, isothermal conditions, simple protocols, and excellent amplification efficiency. In a typical HCR, an analyte initiates the cross-opening of two DNA hairpins, yielding nicked double helices that are analogous to alternating copolymers. As an efficient amplification platform, HCR has been utilized for the sensitive detection of a wide variety of analytes, including nucleic acids, proteins, small molecules, and cells. In recent years, more complicated sets of monomers have been designed to develop nonlinear HCR, such as branched HCR and even dendritic systems, achieving quadratic and exponential growth mechanisms. In addition, HCR has attracted enormous attention in the fields of bioimaging and biomedicine, including applications in fluorescence in situ hybridization (FISH) imaging, live cell imaging, and targeted drug delivery. In this review, we introduce the fundamentals of HCR and examine the visualization and analysis techniques for HCR products in detail. The most recent HCR developments in biosensing, bioimaging, and biomedicine are subsequently discussed with selected examples. Finally, the review provides insight into the challenges and future perspectives of HCR.
Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi
2008-07-23
A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.
Patwardhan, Vrushali; Bhalla, Preena; Rawat, Deepti; Garg, Vijay Kumar; Sardana, Kabir; Sethi, Sumit
2017-01-01
To compare laboratory tests that can simultaneously detect and type herpes simplex virus (HSV) directly from the genital ulcer specimens in clinically suspected cases of genital herpes. A study was conducted over 10 months and 44 adult male and female patients clinically suspected with genital herpes were recruited. Genital ulcer swab specimens were subjected to glycoprotein-G gene-based conventional polymerase chain reaction (PCR) and commercially available direct fluorescent antibody (DFA) test and the results were compared. PCR for HSV was positive in 82% (36/44) cases. DFA was positive in 68.2% (30/44) cases. There was 100% agreement between HSV types detected by DFA and PCR. The strength of agreement between the results was better in primary genital herpes than recurrent cases. PCR was found to be better in the detection of HSV in recurrent genital herpes patients. It is a better modality, especially when genital herpes clinically presents with ulcerative or crusted lesions, and is also a cheaper alternative as compared to DFA.
Ma, Yanlin; Deng, Yang; Xu, Zhenbo; Liu, Junyan; Dong, Jianjun; Yin, Hua; Yu, Junhong; Chang, Zongming; Wang, Dongfeng
The spoilage of beer by bacteria is of great concern to the brewer as this can lead to turbidity and abnormal flavors. The polymerase chain reaction (PCR) method for detection of beer-spoilage bacteria is highly specific and provides results much faster than traditional microbiology techniques. However, one of the drawbacks is the inability to differentiate between live and dead cells. In this paper, the combination of propidium monoazide (PMA) pretreatment and conventional PCR had been described. The established PMA-PCR identified beer spoilage Lactobacillus brevis based not on their identity, but on the presence of horA gene which we show to be highly correlated with the ability of beer spoilage LAB to grow in beer. The results suggested that the use of 30μg/mL or less of PMA did not inhibit the PCR amplification of DNA derived from viable L. brevis cells. The minimum amount of PMA to completely inhibit the PCR amplification of DNA derived from dead L. brevis cells was 2.0μg/mL. The detection limit of PMA-PCR assay described here was found to be 10 colony forming units (CFU)/reaction for the horA gene. Moreover, the horA-specific PMA-PCR assays were subjected to 18 reference isolates, representing 100% specificity with no false positive amplification observed. Overall the use of horA-specific PMA-PCR allows for a substantial reduction in the time required for detection of potential beer spoilage L. brevis and efficiently differentiates between viable and nonviable cells. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Alexander, C L; Shankland, G S; Carman, W; Williams, C
2011-05-01
Dermatophytes are the major cause of superficial mycoses in samples submitted to Clinical Mycology, Glasgow. The most prevalent species is Trichophyton rubrum as identified classically by microscopy and culture. Recent advances in polymerase chain reaction (PCR) technology were examined for the feasibility of introducing a T. rubrum real-time PCR assay into a routine diagnostic service. To improve the diagnostic mycology service by the introduction of a real-time PCR test for T. rubrum. The DNA from 4972 nail and skin samples was obtained using the Qiagen QIAsymphony automated extractor. This DNA was subjected to real-time PCR using T. rubrum-specific primers and a probe. During phase 1 of the study, 862 samples were analysed; 446 of 470 specimens that grew T. rubrum were detected by PCR. Out of 4110 samples analysed during phase 2, 753 T. rubrum infections were diagnosed and reported within 72 h. A total of 3357 samples were negative for a fungal infection by PCR and microscopy; these were also reported within 72 h. A vast reduction in the turnaround times can be achieved using this technique as opposed to classical methods. Samples which are PCR negative but microscopy positive are still subjected to culture. Screening samples for their suitability for PCR prior to processing eliminates the application of PCR for T. rubrum on inappropriate samples such those from the scalp or pityriasis versicolor. © 2011 The Authors. BJD © 2011 British Association of Dermatologists.
Comparison between ICT and PCR for diagnosis of Chlamydia trachomatis.
Khan, E R; Hossain, M A; Paul, S K; Mahmud, C; Hasan, M M; Rahman, M M; Nahar, K; Kubayashi, N
2012-04-01
Chlamydia trachomatis is an obligate intracellular gram-negative bacterium which is the most prevalent cause of bacterial sexually transmitted infections (STI). The present study was carried to diagnose genital Chlamydia trachomatis infection among women of reproductive age, attending Mymensingh Medical College Hospital, during July 2009 to June 2010 by Immunochromatographic test (ICT) and Polymerase chain reaction (PCR). A total of 70 females were included in this study. Out of 70 cases 56 were symptomatic and 14 asymptomatic. Endocervical swabs were collected from each of the cases and examined by Immunochromatographic test (ICT) for antigen detection and Polymerase chain reaction (PCR) for detection of endogenous plasmid-based nucleic acid. A total 29(41.4%) of the cases were found positive for C. trachomatis either by ICT or PCR. Of the 56 symptomatic cases, 19(33.9%) were found ICT positive and 17(30.4%) were PCR positive. Among 14 asymptomatic females, 2(14.3%) were ICT positive and none were PCR positive. Though PCR is highly sensitive but a total of twelve cases were found ICT positive but PCR negative. It may be due to presence of plasmid deficient strain of C trachomatis which could be amplified by ompA based (Chromosomal gene) multiplex PCR.
Directory of Open Access Journals (Sweden)
Fábio Takenori Higa
2013-04-01
Full Text Available We evaluated the use of a newly described sodC-based real-time-polymerase chain reaction (RT-PCR assay for detecting Neisseria meningitidis in normally sterile sites, such as cerebrospinal fluid and serum. The sodC-based RT-PCR assay has an advantage over ctrA for detecting nongroupable N. meningitidis isolates, which are commonly present in asymptomatic pharyngeal carriage. However, in our study, sodC-based RT-PCR was 7.5% less sensitive than ctrA. Given the public health impact of possible false-negative results due to the use of the sodC target gene alone, sodC-based RT-PCR for the diagnosis of meningococcal meningitis should be used with caution.
Focke, Felix; Haase, Ilka; Fischer, Markus
2011-01-26
Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.
International Nuclear Information System (INIS)
Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.
1991-01-01
A Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene using microtomed sections from paraffin-embedded radiation-induced and spontaneous tumors as the DNA source. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons) were analyzed. Tumors in six neutron-irradiated mice also had no mRb deletions. However, one of six tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene
Johnson, Jennifer A; Wright, Michael E; Sheperd, Lyndsay A; Musher, Daniel M; Dang, Bich N
2015-01-01
The role at admission of nasal polymerase chain reaction (PCR) for patients with methicillin-resistant Staphylococcus aureus (MRSA) in guiding antibiotic therapy for lower respiratory tract infection is unknown. To determine whether nasal MRSA PCR at admission can predict the absence of MRSA in lower respiratory tract secretions. We performed a retrospective study of adult patients admitted to a large urban hospital. Patients had a nasal MRSA PCR test and a lower respiratory tract culture obtained within 48 hours of admission and the culture yielded S aureus. Sensitivity, specificity, and positive and negative predictive values. Our results showed high sensitivity (93.3%) and negative predictive value (95.2%) of nasal PCR for MRSA in the lower respiratory tract. With its high sensitivity and negative predictive value, a nasal MRSA PCR test performed within 48 hours of hospital admission could help guide the discontinuation of MRSA-directed empiric antibiotic therapy in patients who are unlikely to be infected with this organism. A prospective study is needed to confirm these findings.
International Nuclear Information System (INIS)
Gokahmetoglu, S.; Deniz, E.
2007-01-01
To compare the real-time (RT) and qualitative (Q) polymerase chain reaction (PCR) assays for detection of Cytomegalovirus (CMV) DNA. The study took place in the Department of Microbiology, Erciyes University, Kayseri and in Iontek Laboratory, Istanbul, Turkey, from August to December 2006. One hundred and seven clinical specimens from 67 patients were included in the study. Cytomegalovirus DNA was investigated using RT-PCR kit (Fluorion Iontek, Turkey) and Q-PCR kit (Fluorion Iontek, Turkey). Deoxyribonucleic acid sequencing was applied to the samples that yielded discrepant results in both assays. Mac Nema's Chi Square test was used for statistical analysis. Of the specimens, 27 were found positive with both assays: 9 with only RT-PCR, and 11 with only Q-PCR assay. Both assays were found negative in 60 of the specimens. There was a good agreement between the 2 assays in 87(81.3%) of the specimens. There was no statistical significant difference between the assays (p>0.05). Two of the 11 samples that RT-PCR negative Q-PCR positive, and 3 of 9 samples that RT-PCR positive Q-PCR negative were found to be CMV DNA positive by DNA sequencing. A good level of concordance between RT-PCR and Q-PCR assays for CMV DNA detection has been found. (author)
Laserson, K F; Petralanda, I; Hamlin, D M; Almera, R; Fuentes, M; Carrasquel, A; Barker, R H
1994-02-01
We have examined the reproducibility, sensitivity, and specificity of detecting Plasmodium falciparum using the polymerase chain reaction (PCR) and the species-specific probe pPF14 under field conditions in the Venezuelan Amazon. Up to eight samples were field collected from each of 48 consenting Amerindians presenting with symptoms of malaria. Sample processing and analysis was performed at the Centro Amazonico para la Investigacion y Control de Enfermedades Tropicales Simon Bolivar. A total of 229 samples from 48 patients were analyzed by PCR methods using four different P. falciparum-specific probes. One P. vivax-specific probe and by conventional microscopy. Samples in which results from PCR and microscopy differed were reanalyzed at a higher sensitivity by microscopy. Results suggest that microscopy-negative, PCR-positive samples are true positives, and that microscopy-positive and PCR-negative samples are true negatives. The sensitivity of the DNA probe/PCR method was 78% and its specificity was 97%. The positive predictive value of the PCR method was 88%, and the negative predictive value was 95%. Through the analysis of multiple blood samples from each individual, the DNA probe/PCR methodology was found to have an inherent reproducibility that was highly statistically significant.
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection.
Pitz, Amanda de Faveri; Koishi, Andrea Cristine; Tavares, Eliandro Reis; Andrade, Fábio Goulart de; Loth, Eduardo Alexandre; Gandra, Rinaldo Ferreira; Venancio, Emerson José
2013-01-01
Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR) assay for the detection of Paracoccidioides brasiliensis. We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.
A Micro Polymerase Chain Reaction Module for Integrated and Portable DNA Analysis Systems
Directory of Open Access Journals (Sweden)
Elisa Morganti
2011-01-01
Full Text Available This work deals with the design, fabrication, and thermal characterization of a disposable miniaturized Polymerase Chain Reaction (PCR module that will be integrated in a portable and fast DNA analysis system. It is composed of two independent parts: a silicon substrate with embedded heater and thermometers and a PDMS (PolyDiMethylSiloxane chamber reactor as disposable element; the contact between the two parts is assured by a mechanical clamping obtained using a Plastic Leaded Chip Carrier (PLCC. This PLCC is also useful, avoid the PCR mix evaporation during the thermal cycles. Finite Element Analysis was used to evaluate the thermal requirements of the device. The thermal behaviour of the device was characterized revealing that the temperature can be controlled with a precision of ±0.5°C. Different concentrations of carbon nanopowder were mixed to the PDMS curing agent in order to increase the PDMS thermal conductivity and so the temperature control accuracy.
Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T
2016-06-01
We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. © 2015 Society for Laboratory Automation and Screening.
Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid
2017-01-01
Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.
Directory of Open Access Journals (Sweden)
Samira Mohammadi
2017-01-01
Full Text Available Background: Nontuberculous mycobacteria (NTM are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.
DEFF Research Database (Denmark)
Zornhagen, K. W.; Kristensen, A. T.; Hansen, Anders Elias
2015-01-01
Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours....... The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm...
Tangled nonlinear driven chain reactions of all optical singularities
Vasil'ev, V. I.; Soskin, M. S.
2012-03-01
Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.
Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria
2003-12-15
Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.
Sabrina, Rabehi; Mossadak, Hamdi Taha; Bakir, Mamache; Asma, Meghezzi; Khaoula, Boushaba
2018-01-01
Aim: The aim of this study was to detect Brucella spp. DNA in milk samples collected from seronegative cows using the real-time polymerase chain reaction (PCR) assay for diagnosis of brucellosis in seronegative dairy cows to prevent transmission of disease to humans and to reduce economic losses in animal production. Materials and Methods: In this study, 65 milk samples were investigated for the detection of Brucella spp. The detection of the IS711 gene in all samples was done by real-time PCR assay by comparative cycle threshold method. Results: The results show that of the 65 DNA samples tested, 2 (3.08%) were positive for Brucella infection. The mean cyclic threshold values of IS711 real-time PCR test were 37.97 and 40.48, indicating a positive reaction. Conclusion: The results of the present study indicated that the real-time PCR appears to offer several advantages over serological tests. For this reason, the real-time PCR should be validated on representative numbers of Brucella-infected and free samples before being implemented in routine diagnosis in human and animal brucellosis for controlling this disease. PMID:29657430
van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.
1994-01-01
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
Lee, Hong Sun; Lee, Ji Hyun; Choo, Ji Yoon; Byun, Hee Jin; Jun, Jin Hyun
2016-01-01
Background Immunohistochemistry and polymerase chain reaction (PCR) are the most widely used methods for the detection of viruses. PCR is known to be a more sensitive and specific method than the immunohistochemical method at this time, but PCR has the disadvantages of high cost and skilled work to use widely. With the progress of technology, the immunohistochemical methods used in these days has come to be highly sensitive and actively used in the diagnostic fields. Objective To evaluate and compare the usefulness of immunohistochemistry and PCR for detection human papilloma virus (HPV) in wart lesions. Methods Nine biopsy samples of verruca vulgaris and 10 of condyloma accuminatum were examined. Immunohistochemical staining using monoclonal antibody to HPV L1 capsid protein and PCR were done for the samples. DNA sequencing of the PCR products and HPV genotyping were also done. Results HPV detection rate was 78.9% (88.9% in verruca vulgaris, 70.0% in condyloma accuminatum) on immunohistochemistry and 100.0% for PCR. HPV-6 genotype showed a lower positivity rate on immunohistochemistry (50.0%) as compared to that of the other HPV genotypes. Conclusion Immunohistochemistry for HPV L1 capsid protein showed comparable sensitivity for detection HPV. Considering the high cost and great effort needed for the PCR methods, we can use immunohistochemistry for HPV L1 capsid protein with the advantage of lower cost and simple methods for HPV detection. PMID:27489431
Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov
2014-01-01
A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.
Directory of Open Access Journals (Sweden)
Maria Frølund
Full Text Available A novel multiplex quantitative real-time polymerase chain reaction (qPCR for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.
Impact of PCR for respiratory viruses on antibiotic use : Theory and practice
van de Pol, Alma C.; Wolfs, Tom F. W.; Tacke, Carline E. A.; Uiterwaal, Cuno S. P.; Forster, Johannes; van Loon, Anton M.; Kimpen, Jan L. L.; Rossen, John W. A.; Jansen, Nicolaas J. G.
RATIONALE FOR THE STUDY: Real-time polymerase chain reaction (PCR) for respiratory viruses is more sensitive, yet more expensive, than conventionally used direct immunofluorescence (DIF). We determined the impact of real-time PCR, additional to DIF, on antibiotic prescription in ventilated children
International Nuclear Information System (INIS)
Rehman, H.; Hafizullah, M.; Shah, S.T.; Khan, S.B.; Hadi, A.; Ahmad, F.; Shah, I.; Gul, A.M.
2012-01-01
Objective: To know the sensitivity of polymerase chain reaction (PCR) in pericardial fluid and response to antituberculous treatment (ATT) in PCR positive patients who were presumptively diagnosed and treated as tuberculous pericardial effusion. Methodology: This was a descriptive cross sectional study carried out from June 1, 2009 to 31 May 2010 at Cardiology Department, Lady Reading Hospital, Peshawar. Patients with presumptive diagnosis and receiving treatment for tuberculous pericardial effusion were included. Pericardial fluid sample was aspirated under fluoroscopy for the routine work up. The specimens were subjected to PCR detection of mycobacterium tuberculous DNA. Results: During 12 month study period, a total of 54 patients with large pericardial effusion presented to Cardiology department, Lady Reading Hospital, Peshawar. Of them, 46 patients fulfilled the criteria for presumptive diagnosis of tuberculous pericardial effusion. PCR for mycobacterium tuberculous DNA in pericardial fluid was positive in 45.7%(21). Patients were followed for three months. In PCR positive group, 01 patient while in PCR negative group 3 patients were lost to follow up. Among PCR positive patients 17(85%) while in PCR negative group 11(47.82%) patient responded to ATT both clinically and echo-cardio graphically. We found that patients who were PCR positive responded better to therapy than those who were PCR negative and this finding was statistically significant (p=0.035). Conclusion: PCR, with all its limitations, is potentially a useful diagnostic test in patients with presumptively diagnosed tuberculous pericardial effusion. A PCR positive patient responds better to therapy as compared to PCR negative patient. (author)
Directory of Open Access Journals (Sweden)
Kosuke Nakamura
2016-06-01
Real-time polymerase chain reaction (PCR detection method for unauthorized genetically modified (GM papaya (Carica papaya L. line PRSV-YK (PRSV-YK detection method was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976. Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.
DEFF Research Database (Denmark)
Efunshile, Michael A; Ngwu, Bethrand A F; Kurtzhals, Jørgen A L
2015-01-01
Diarrhea remains the second largest killer of children worldwide, and Nigeria ranks number two on the list of global deaths attributable to diarrhea. Meanwhile, prevalence studies on potentially diarrheagenic protozoa in asymptomatic carriers using molecular detection methods remain scarce in sub......-Saharan countries. To overcome sensitivity issues related to microscopic detection and identification of cysts in stool concentrates, real-time polymerase chain reaction (PCR) was used to analyze genomic DNAs extracted from stool samples from 199 healthy school children for Entamoeba histolytica, E. dispar, Giardia...
Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V
2000-12-01
ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.
Almy, Frederic S.; Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.
2006-01-01
Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic.
White, P. Lewis; Wingard, John R.; Bretagne, Stéphane; Löffler, Jürgen; Patterson, Thomas F.; Slavin, Monica A.; Barnes, Rosemary A.; Pappas, Peter G.; Donnelly, J. Peter
2015-01-01
Background. Aspergillus polymerase chain reaction (PCR) was excluded from the European Organisation for the Research and Treatment of Cancer/Mycoses Study Group (EORTC/MSG) definitions of invasive fungal disease because of limited standardization and validation. The definitions are being revised. Methods. A systematic literature review was performed to identify analytical and clinical information available on inclusion of galactomannan enzyme immunoassay (GM-EIA) (2002) and β-d-glucan (2008), providing a minimal threshold when considering PCR. Categorical parameters and statistical performance were compared. Results. When incorporated, GM-EIA and β-d-glucan sensitivities and specificities for diagnosing invasive aspergillosis were 81.6% and 91.6%, and 76.9% and 89.4%, respectively. Aspergillus PCR has similar sensitivity and specificity (76.8%–88.0% and 75.0%–94.5%, respectively) and comparable utility. Methodological recommendations and commercial PCR assays assist standardization. Although all tests have limitations, currently, PCR is the only test with independent quality control. Conclusions. We propose that there is sufficient evidence that is at least equivalent to that used to include GM-EIA and β-d-glucan testing, and that PCR is now mature enough for inclusion in the EORTC/MSG definitions. PMID:26113653
Bubble-free on-chip continuous-flow polymerase chain reaction: concept and application.
Wu, Wenming; Kang, Kyung-Tae; Lee, Nae Yoon
2011-06-07
Bubble formation inside a microscale channel is a significant problem in general microfluidic experiments. The problem becomes especially crucial when performing a polymerase chain reaction (PCR) on a chip which is subject to repetitive temperature changes. In this paper, we propose a bubble-free sample injection scheme applicable for continuous-flow PCR inside a glass/PDMS hybrid microfluidic chip, and attempt to provide a theoretical basis concerning bubble formation and elimination. Highly viscous paraffin oil plugs are employed in both the anterior and posterior ends of a sample plug, completely encapsulating the sample and eliminating possible nucleation sites for bubbles. In this way, internal channel pressure is increased, and vaporization of the sample is prevented, suppressing bubble formation. Use of an oil plug in the posterior end of the sample plug aids in maintaining a stable flow of a sample at a constant rate inside a heated microchannel throughout the entire reaction, as compared to using an air plug. By adopting the proposed sample injection scheme, we demonstrate various practical applications. On-chip continuous-flow PCR is performed employing genomic DNA extracted from a clinical single hair root sample, and its D1S80 locus is successfully amplified. Also, chip reusability is assessed using a plasmid vector. A single chip is used up to 10 times repeatedly without being destroyed, maintaining almost equal intensities of the resulting amplicons after each run, ensuring the reliability and reproducibility of the proposed sample injection scheme. In addition, the use of a commercially-available and highly cost-effective hot plate as a potential candidate for the heating source is investigated.
Impact of Fungicide Residues on Polymerase Chain Reaction and on Yeast Metabolism
Directory of Open Access Journals (Sweden)
Gildo Almeida da Silva
Full Text Available ABSTRACT The indiscriminate use of pesticides on grape crops is harmful for consumers´ healthin “in natura” consumption and in the ingestion of wine and grape juice. During winemaking, a rapid and efficient fermentation stage is critical to avoid proliferation of contaminating microorganisms and to guarantee the product´s quality. Polymerase chain reaction (PCR has the advantage of detecting these contaminants in the early stages of fermentation. However,this enzymatic reaction may also be susceptible to specific problems, reducing its efficiency. Agricultural practices, such as fungicide treatments, may be a source of PCR inhibiting factors and may also interfere in the normal course of fermentation.The action of the pesticides captan and folpet on PCR and on yeast metabolism was evaluated, once these phthalimide compounds are widely employed in Brazilian vineyards. DNA amplification was only observed at 75 and 37.5 µg/mL of captan concentrations, whereas with folpet, amplification was observed only in the two lowest concentrations tested (42.2 and 21.1µg/mL.Besides the strong inhibition on Taq polymerase activity, phthalimides also inhibited yeast metabolism at all concentrations analyzed.Grape must containing captan and folpet residues could not be transformed into wine due to stuck fermentation caused by the inhibition of yeast metabolism. Non-compliance with the waiting period for phthalimide fungicides may result in financial liabilities to the viticulture sector.The use of yeasts with high fungicide sensitivity should be selected for must fermentation as a strategy for sustainable wine production and to assure that products comply with health and food safety standards.
Red blood cells in cerebrospinal fluid as possible inhibitory factor for enterovirus RT-PCR
Directory of Open Access Journals (Sweden)
Sérgio Monteiro de Almeida
Full Text Available ABSTRACT The presence of hemoglobin in samples are considered an important inhibitory factor for polymerase chain reaction (PCR. The aim of this study was to examine the influence of red blood cells (RBCs in cerebrospinal fluid (CSF as an inhibitory factor to reverse transcription polymerase chain reaction (RT-PCR for enteroviruses (EV. Forty-four CSF samples from patients showing characteristics of viral meningitis were assessed for EV by RT-PCR. Viral RNA extracted with guanidine isothyocianate buffer and virus detection was performed by in-house nested PCR. Positivity for EV RT-PCR was higher in CSF samples without RBCs than in samples with RBCs: 13(26% and 36(9.2%, p = 0.001. In the group with positive EV RT-PCR, the mean + SD CSF RBC was 37 ± 183 cell/mm3; the group with negative results had 580 + 2,890 cell/mm3 (p = 0.007. The acceptable upper limit for CSF RBCs that could not influence RT-PCR was 108 cells/mm3. CSF samples with negative results for EV RT-PCR have more erythrocytes.
Das, P; Pandey, P; Harishankar, A; Chandy, M; Bhattacharya, S; Chakrabarti, A
2017-01-01
Standardization of Aspergillus polymerase chain reaction (PCR) poses two technical challenges (a) standardization of DNA extraction, (b) optimization of PCR against various medically important Aspergillus species. Many cases of aspergillosis go undiagnosed because of relative insensitivity of conventional diagnostic methods such as microscopy, culture or antigen detection. The present study is an attempt to standardize real-time PCR assay for rapid sensitive and specific detection of Aspergillus DNA in EDTA whole blood. Three nucleic acid extraction protocols were compared and a two-step real-time PCR assay was developed and validated following the recommendations of the European Aspergillus PCR Initiative in our setup. In the first PCR step (pan-Aspergillus PCR), the target was 28S rDNA gene, whereas in the second step, species specific PCR the targets were beta-tubulin (for Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus), gene and calmodulin gene (for Aspergillus niger). Species specific identification of four medically important Aspergillus species, namely, A. fumigatus, A. flavus, A. niger and A. terreus were achieved by this PCR. Specificity of the PCR was tested against 34 different DNA source including bacteria, virus, yeast, other Aspergillus sp., other fungal species and for human DNA and had no false-positive reactions. The analytical sensitivity of the PCR was found to be 102 CFU/ml. The present protocol of two-step real-time PCR assays for genus- and species-specific identification for commonly isolated species in whole blood for diagnosis of invasive Aspergillus infections offers a rapid, sensitive and specific assay option and requires clinical validation at multiple centers.
Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I
1999-07-01
Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.
The first nuclear chain reaction
International Nuclear Information System (INIS)
Zinn, W.H.
1989-01-01
The author offers his recollections of the experimental efforts beginning in 1939 which culminated in the Chain Reaction in the squash court on December 2, 1942. Recalled are Columbia University experiments which did much to establish the feasibility of the chain in natural uranium and which stimulated the creation of the Manhattan District. The Columbia group moved to the University of Chicago, where, in early summer of 1942, construction and analysis of a number of subcritical reactors (piles) gave assurance with a high probability that only a reasonable amount of uranium and moderator would be required
Zarrinfar, Hossein; Mirhendi, Hossein; Fata, Abdolmajid; Khodadadi, Hossein; Kordbacheh, Parivash
2015-01-01
Background: Pulmonary aspergillosis (PA) is one of the most serious complications in immunocompromised patients, in particular among hematopoietic stem cell transplants (HSCT) and patients with hematological malignancies. Objectives: The current study aimed to evaluate the incidence of PA and utility of molecular methods in HSCT and patients with hematological malignancies, four methods including direct examination, culture, nested polymerase chain reaction (PCR) and real-time PCR were performed on bronchoalveolar lavage (BAL) specimens in Tehran, Iran. Patients and Methods: During 16 months, 46 BAL specimens were obtained from individuals with allogeneic HSCT (n = 18) and patients with hematological malignancies (n = 28). Direct wet mounts with 20% potassium hydroxide (KOH) and culture on mycological media were performed. The molecular detection of Aspergillus fumigatus and A. flavus was done by amplifying the conserved sequences of internal transcribed spacer 1 (ITS1) ribosomal DNA by nested-PCR and the β-tubulin gene by TaqMan real-time PCR. Results: Seven (15.2%) out of 46 specimens were positive in direct examination and showed branched septate hyphae; 11 (23.9%) had positive culture including eight (72.7%) A. flavus and three (27.3%) A. fumigatus; 22 (47.8%) had positive nested-PCR and eight (17.4%) had positive real-time PCR. The incidence of invasive pulmonary aspergillosis (IPA) in these patients included proven IPA in 1 (2.2%), probable IPA in 10 (21.7%), possible IPA in 19 (41.3%) and not IPA in 16 cases (34.8%). Conclusions: The incidence of IPA in allogeneic HSCT and patients with hematological malignancies was relatively high and A. flavus was the most common cause of PA. As molecular methods had higher sensitivity, it may be useful as screening methods in HSCT and patients with hematological malignancies, or to determine when empirical antifungal therapy can be withheld. PMID:25763133
Low-Cost Temperature Logger for a Polymerase Chain Reaction Thermal Cycler
Directory of Open Access Journals (Sweden)
Chan-Young Park
2016-10-01
Full Text Available Polymerase chain reaction (PCR is a method of amplifying DNA which is normally carried out with a thermal cycler. To obtain more accurate and reliable PCR results, the temperature change within the chamber of the thermal cycler needs to be verified and calibrated regularly. Commercially available temperature loggers commonly used for temperature verification tests usually require a graphical user interface (GUI attached to the logger for convenience and straightforward understanding of the device. In this study, a host-local architecture for the temperature logger that significantly reduces the development time and cost is proposed. Employing standard computing devices as the host gives better development environment and user-friendly GUI. This paper presents the hardware and software design of the host-local temperature logger, and demonstrates the use of the local temperature logger connected to a personal computer with a Windows operating system. The probe design, thermistor resistance measurement, temperature filtering, and temperature calibration is described in detail. The thermistor self-heating problem was investigated in particular to determine the reference resistor that was serially connected to the thermistor. The temperature accuracy and temporal precision of the proposed system was 0.1 K.
Directory of Open Access Journals (Sweden)
K. Rathore
2018-04-01
Full Text Available Aim: This study was designed to evaluate the potential of the use of multiplex polymerase chain reaction (PCR as an alternative to conventional antibiotic sensitivity test. Materials and Methods: Isolates of Staphylococcus aureus (total = 36 from clinical cases presented to Teaching Veterinary Clinical Complex of College of Veterinary and Animal Sciences (CVAS, Navania, Udaipur, were characterized by morphological, cultural, and biochemical methods. Then, the isolates were further subjected to molecular characterization by PCR targeting S. aureus-specific sequence (107 bp. Phenotypic antibiotic sensitivity pattern was analyzed by Kirby Bauer disc diffusion method against 11 commonly used antibiotics in veterinary medicine in and around Udaipur region. The genotypic antibiotic sensitivity pattern was studied against methicillin, aminoglycosides, and tetracycline targeting the gene mecA, aacA-aphD, and tetK by multiplex PCR. Results: There was 100% correlation between the phenotype and genotype of aminoglycoside resistance, more than 90% correlation for methicillin resistance, and 58.3% in the case tetracycline resistance. Conclusion: As there is a good correlation between phenotype and genotype of antibiotic resistance, multiplex PCR can be used as an alternative to the conventional antibiotic susceptibility testing, as it can give a rapid and true prediction of antibiotic sensitivity pattern.
Cabada, Miguel M.; Malaga, Jose L.; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A.; Naeger, Patrick A.; Rogers, Hayley K.; Maharsi, Safa; Mbaka, Maryann; White, A. Clinton
2017-01-01
Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)–based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization. PMID:27821691
Directory of Open Access Journals (Sweden)
Wang Xiaowei
2008-12-01
Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.
An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection
Directory of Open Access Journals (Sweden)
Amanda de Faveri Pitz
2013-12-01
Full Text Available Introduction Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR assay for the detection of Paracoccidioides brasiliensis. Methods We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. Results The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. Conclusions The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.
Meletiadis, J.; Melchers, W.J.G.; Meis, J.F.G.M.; Hurk, P.J.J.C. van den; Jannes, G.; Verweij, P.E.
2003-01-01
An assay system in which polymerase chain reaction (PCR) amplification of the ITS-1 region of ribosomal DNA (rDNA) is combined with a reverse-hybridization line probe assay (LiPA) was used for the identification of six Candida species and four Aspergillus species in pure cultures of clinical
Detection of Mycobacterium Tuberculosis by using PCR
International Nuclear Information System (INIS)
Suhadi, F; Dadang-Sudrajat; Maria-Lina, R.
1996-01-01
Polymerase Chain Reaction (PCR) procedure using three primary set derived from repetitive DNA sequence specific to mycobacteria was used to diagnose pathogenic Mycobacterium tuberculosis. The assay was specific for M. tuberculosis and could be used to detect the amount DNA less than 10 -9 g
Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.
2006-01-01
Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978
Directory of Open Access Journals (Sweden)
N. M. Alyab'eva
2013-01-01
Full Text Available Aim: to compare two methods of S. pneumoniae molecular typing: classic serological method and the multiplex polymerase chain reaction (M-PCR assay modified in accordance to the date on the serotypes circulating in Russian Federation. Patients and methods: 420 pneumococcal isolates mainly from non-sterile loci were analyzed. After microbiological identification pneumococci were serologically typed with the means of specific antiserum produced by Staten Serum Institute (Denmark in latex agglutination test and/or capsular swelling method. At the same time we performed series of the M-PCR, which consisted of 7 consecutive reactions at the most. Results: serotype was identified by the means of serological method in all 420 strains of S. pneumoniae; in total we determined 24 different serotypes. By the means of the M-PCR we succeeded in identification of 95% (399/420 examined strains, and 90% of them were typed during the first 3 reactions. All isolates failed to be typed by M-PCR (n =21 have serotypes not included into the composition of the M-PCR. The results of serological and molecular typing were identical in 99,2% (396/399 of the isolates; 3 strains showed contradictory results: serotype 19A was found on serological assay and serotype 19F — on PCR assay. Conclusions: the introduced modification of M-PCR allows correct identification of pneumococcal serotype more than in 90% of strains circulating in the Russian Federation, including all serotypes of pneumococcal polysaccharide conjugate vaccine.
Directory of Open Access Journals (Sweden)
Marcos Lázaro Moreli
2004-10-01
Full Text Available We report a nested reverse transcription-polymerase chain reaction (RT-PCR assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity and in all 9 blood samples (100% positivity by nested-PCR. The eight amplicons obtained by RT-PCR (P1, P3-P9, including one obtained by nested-PCR (P-2 and not obtained by RT-PCR, were sequenced and showed high homology (94.8% to 99.1% with the N gene of Araraquara hantavirus. Although the serologic method ELISA is the most appropriate test for HCPS diagnosis, the use of nested RT-PCR for hantavirus in Brazil would contribute to the diagnosis of acute hantavirus disease detecting viral genomes in patient specimens as well as initial genomic characterization of circulating hantaviruses.
Droplet digital Polymerase chain reaction (ddPCR) is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. It is a promising DNA quantification technology for medical diagnostics but there are only a few reports of its use for plant pat...
Diagnosis of lymphoma in paraffin wax sections by nested PCR and immunohistochemistry.
Kitamura, Y; Nanba, E; Inui, S; Tanigawa, T; Ichihara, K
1996-01-01
AIMS: To investigate whether nested polymerase chain reaction (PCR) and immunohistochemistry can be used to diagnose malignant lymphoma. METHODS: Paraffin wax embedded tissue sections from 31 patients with malignant lymphoma were analysed by nested PCR and immunohistochemistry using standard protocols. RESULTS: Nested PCR amplification of 1 pg DNA confirmed monoclonality in B cell lymphoma; PCR amplification of 10 pg DNA confirmed monoclonality in T cell lymphoma. Twenty seven (87%) samples w...
DEFF Research Database (Denmark)
Dodt, K K; Jacobsen, P H; Hofmann, B
1997-01-01
; OR: CMV PCR 10.0, antigenemia test 4.4 and CMV cultures 4.3. No clinical parameters had any significant predictive value in the stepwise multivariate model. CONCLUSIONS: The CMV PCR and the CMV antigenemia tests are both sensitive methods that may predict development of CMV disease up to several...... evaluated PCR and the antigenemia tests as methods for early detection of CMV disease. METHODS: Two-hundred HIV-seropositive subjects with CD4 T-cell counts below 100 x 10(6)/l were monitored with CMV polymerase chain reaction (PCR), the antigenemia test, blood cultures and CMV immunoglobulin (Ig) G and Ig...... showed that the CMV PCR, the antigenemia test and blood cultures all had significant predictive values for subsequent development of CMV disease with odds ratios (OR) of 30, 22 and 20. CMV serology had no predictive value. Multivariate analysis showed that the PCR method was superior to the other tests...
Energy Technology Data Exchange (ETDEWEB)
Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe
2008-12-01
We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection of target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.
Rosado, A.S.; Seldin, L.; Wolters, A.; Elsas, van J.D.
1996-01-01
A molecular method for the detection of Paenibacillus azotofixans in soil and the wheat rhizosphere was developed. The system consisted of polymerase chain reaction (PCR) amplification of part of the variable V1 to V4 regions of the 16S ribosomal RNA gene, followed by hybridization with a specific
Li, Kai; Chen, Bei; Zhou, Yuxun; Huang, Rui; Liang, Yinming; Wang, Qinxi; Xiao, Zhenxian; Xiao, Junhua
2009-03-01
A new method, based on ligase detection reaction (LDR), was developed for quantitative detection of multiplex PCR amplicons of 16S rRNA genes present in complex mixtures (specifically feces). LDR has been widely used in single nucleotide polymorphism (SNP) assay but never applied for quantification of multiplex PCR products. This method employs one pair of DNA probes, one of which is labeled with fluorescence for signal capture, complementary to the target sequence. For multiple target sequence analysis, probes were modified with different lengths of polyT at the 5' end and 3' end. Using a DNA sequencer, these ligated probes were separated and identified by size and dye color. Then, relative abundance of target DNA were normalized and quantified based on the fluorescence intensities and exterior size standards. 16S rRNA gene of three preponderant bacteria groups in human feces: Clostridium coccoides, Bacteroides and related genera, and Clostridium leptum group, were amplified and cloned into plasmid DNA so as to make standard curves. After PCR-LDR analysis, a strong linear relationship was found between the florescence intensity and the diluted plasmid DNA concentrations. Furthermore, based on this method, 100 human fecal samples were quantified for the relative abundance of the three bacterial groups. Relative abundance of C. coccoides was significantly higher in elderly people in comparison with young adults, without gender differences. Relative abundance of Bacteroides and related genera and C. leptum group were significantly higher in young and middle aged than in the elderly. Regarding the whole set of sample, C. coccoides showed the highest relative abundance, followed by decreasing groups Bacteroides and related genera, and C. leptum. These results imply that PCR-LDR can be feasible and flexible applied to large scale epidemiological studies.
DEFF Research Database (Denmark)
Guil-Luna, S.; Stenvang, Jan; Brünner, Nils
2014-01-01
and its isoforms in formalin-fixed, paraffin-embedded tissue samples from canine mammary lesions (4 dysplasias, 10 benign tumors, and 46 carcinomas) using 1-step SYBR Green quantitative real-time polymerase chain reaction (RT-qPCR). Progesterone receptor was expressed in 75% of dysplasias, all benign...... in the expression of isoform A versus B. Analysis of progesterone receptor mRNA isoforms by RT-qPCR was successful in routinely formalin-fixed, paraffin-embedded tissue samples and enabled the distribution of isoforms A and B to be identified for the first time in dysplasias, benign tumors, and malignant tumors...
Matsushita, T; Matsui, Y; Shirasaki, N
2006-01-01
Virus removal experiments using river water spiked with bacteriophages were conducted by an in-line coagulation-ceramic microfiltration hybrid system to investigate the effects of filtration flux (62.5 and 125 L/(m2 x h)) and type of virus (Qbeta and MS2) on virus removal. In addition, the mass balance of viruses through the hybrid system was analysed by quantifying the infectious and inactive viruses by a combination of the polymerase chain reaction (PCR) method and the plaque forming units (PFU) method. Even when the system was operated at high filtration flux (125 L/(m2 x h)), high virus removal (> 6 log) with short coagulation time (2.4 s) was successfully achieved by dosing polyaluminium chloride (PACI) at more than 1.08 mg-Al/L. Removal performances were different between Qbeta and MS2, although their diameters are almost the same: greater virus removal was achieved for MS2 at PACI dosing of 0.54 mg-Al/L, and for Qbeta at PACI dosing of more than 1.08 mg-Al/L. The combination of the PCR and PFU methods revealed that two phenomena, adsorption to/entrapment in aluminium floc and virucidal activity of PACI, partially account for the high virus removal in the coagulation-MF hybrid system.
Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong
2015-01-01
The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.
Saliva Polymerase-Chain-Reaction Assay for Cytomegalovirus Screening in Newborns
Boppana, Suresh B.; Ross, Shannon A.; Shimamura, Masako; Palmer, April L.; Ahmed, Amina; Michaels, Marian G.; Sánchez, Pablo J.; Bernstein, David I.; Tolan, Robert W.; Novak, Zdenek; Chowdhury, Nazma; Britt, William J.; Fowler, Karen B.
2011-01-01
BACKGROUND Congenital cytomegalovirus (CMV) infection is an important cause of hearing loss, and most infants at risk for CMV-associated hearing loss are not identified early in life because of failure to test for the infection. The standard assay for newborn CMV screening is rapid culture performed on saliva specimens obtained at birth, but this assay cannot be automated. Two alternatives — real-time polymerase-chain-reaction (PCR)–based testing of a liquid-saliva or dried-saliva specimen obtained at birth — have been developed. METHODS In our prospective, multicenter screening study of newborns, we compared real-time PCR assays of liquid-saliva and dried-saliva specimens with rapid culture of saliva specimens obtained at birth. RESULTS A total of 177 of 34,989 infants (0.5%; 95% confidence interval [CI], 0.4 to 0.6) were positive for CMV, according to at least one of the three methods. Of 17,662 newborns screened with the use of the liquid-saliva PCR assay, 17,569 were negative for CMV, and the remaining 85 infants (0.5%; 95% CI, 0.4 to 0.6) had positive results on both culture and PCR assay. The sensitivity and specificity of the liquid-saliva PCR assay were 100% (95% CI, 95.8 to 100) and 99.9% (95% CI, 99.9 to 100), respectively, and the positive and negative predictive values were 91.4% (95% CI, 83.8 to 96.2) and 100% (95% CI, 99.9 to 100), respectively. Of 17,327 newborns screened by means of the dried-saliva PCR assay, 74 were positive for CMV, whereas 76 (0.4%; 95% CI, 0.3 to 0.5) were found to be CMV-positive on rapid culture. Sensitivity and specificity of the dried-saliva PCR assay were 97.4% (95% CI, 90.8 to 99.7) and 99.9% (95% CI, 99.9 to 100), respectively. The positive and negative predictive values were 90.2% (95% CI, 81.7 to 95.7) and 99.9% (95% CI, 99.9 to 100), respectively. CONCLUSIONS Real-time PCR assays of both liquid- and dried-saliva specimens showed high sensitivity and specificity for detecting CMV infection and should be
Reduction of heteroduplex formation in PCR amplification
Czech Academy of Sciences Publication Activity Database
Michu, Elleni; Mráčková, Martina; Vyskot, Boris; Žlůvová, Jitka
2010-01-01
Roč. 54, č. 1 (2010), s. 173-176 ISSN 0006-3134 R&D Projects: GA AV ČR(CZ) KJB600040801; GA ČR(CZ) GD204/09/H002; GA AV ČR(CZ) IAA600040801; GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : polymerase chain reaction * reconditioning PCR * mixed-template PCR Subject RIV: BO - Biophysics Impact factor: 1.582, year: 2010
Scheepers, Marius A; Lecuona, Karin A; Rogers, Graeme; Bunce, Catey; Corcoran, Craig; Michaelides, Michel
2013-01-01
To assess the value of routine polymerase chain reaction (PCR) analysis on intraocular fluid from patients presenting with a first episode of suspected active infectious posterior uveitis in a population with a high prevalence of human immunodeficiency virus infection. Retrospective, interventional case series. Participants. 159 consecutive patients presenting at a tertiary care hospital over a five-year period. PCR analysis was performed for cytomegalovirus, varicella zoster virus, herpes simplex virus types 1 and 2, Toxoplasma gondii, and Mycobacterium tuberculosis. PCR analysis confirmed the initial clinical diagnosis in 55 patients (35%) and altered the initial clinical diagnosis in 36 patients (23%). The clinical diagnosis prior to PCR testing was nonspecific (uncertain) in 51 patients (32%), with PCR providing a definitive final diagnosis in 20 of these patients (39%); necrotizing herpetic retinopathy and ocular toxoplasmosis were particularly difficult to diagnose correctly without the use of PCR analysis. The clinical phenotype alone was unreliable in diagnosing the underlying infectious cause in a quarter of patients in this study. Since the outcome of incorrectly treated infective uveitis can be blinding, PCR analysis of ocular fluids is recommended early in the disease even in resource poor settings.
Directory of Open Access Journals (Sweden)
Mini P Singh
2017-01-01
Full Text Available Detecting high-risk-human papillomavirus (HPV types has become an integral part of the cervical cancer screening programmes. This study aimed to develop a multiplex polymerase chain reaction (PCR for identification of HPV types 16 and 18 along with the beta globin gene in formalin-fixed and paraffin-embedded cervical biopsy specimens. A total of 59 samples from patients with cervical abnormalities were tested. HPV 16 positivity was 50% in cervical cancers and 52.9% in cervical intraepithelial neoplasia. Our multiplex PCR protocol can be used as a simple and cost-effective tool for high-risk-HPV detection in cervical cancer screening programmes.
Directory of Open Access Journals (Sweden)
Thiago Leite Fraga
2010-05-01
Full Text Available The diagnosis of visceral leishmaniasis (VL generally requires the use of invasive tests for the collection of infected tissue (aspirates of bone marrow, spleen, liver or lymph nodes. This difficulty has led to the search for safer and less painful techniques to confirm the occurrence of the disease in children. Polymerase chain reaction (PCR is a method that is advantageous in that it allows the use of peripheral blood samples for diagnosis. This paper reports the utilisation of PCR on peripheral blood samples to diagnose VL in 45 children in Mato Grosso do Sul, Brazil. This technique is compared with methods carried out using tissue collected by invasive procedures, including direct microscopy, culture and detection of Leishmania DNA by PCR in bone marrow aspirates. The results show that PCR of peripheral blood provides great sensitivity (95.6% that is similar to that from the PCR of bone marrow aspirates (91.1% and higher than that achieved with microscopy (80% or culture (26.7% methods. PCR of peripheral blood proved to be a suitable tool for the diagnosis of VL in children because it is highly sensitive and safe, with tissue collection being less invasive than in traditional tests.
Nasarabadi, Shanavaz [Livermore, CA
2011-01-11
A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.
PCR IN TRAUMATOLOGY AND ORTHOPAEDICS: METHOD DESCRIPTION AND APPLICABILITY
Directory of Open Access Journals (Sweden)
E. M. Polyakova
2014-01-01
Full Text Available Review brief presents description of polymerase chain reaction method (PCR and its most common variants. Three PCR-based lines of research, carried out in the traumatology and orthopaedics, include identifying a causative agents of the implant-associated infection after orthopaedic surgery; detection of antibiotic resistance genes and biofilm forming genes. It was shown that PCR can be used as additional method for detection of genetic disorders, significant for traumatology and orthopaedics, and for investigation of cartilage and bone regeneration.
DEFF Research Database (Denmark)
Møller, Kristian; Ahrens, Peter
1996-01-01
A polymerase chain reaction (PCR) was developed for the specific amplification of a part of each of the five Clostridium perfringens toxin genes: alpha (alpha), beta (beta), epsilon (epsilon), iota (iota), and enterotoxin (CPE). While the toxicity neutralization test (TNT) only showed limited...
Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA
Directory of Open Access Journals (Sweden)
Ana Lisa do Vale Gomes
2006-10-01
Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.
International Nuclear Information System (INIS)
Baransel, Asyun; Dugler, Hikmat E.; Tokdemir, Mehmet
2004-01-01
The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)
International Nuclear Information System (INIS)
Aquino, Simone
2003-01-01
The aim of this present study was to verify the effects of gamma radiation on the growth of Aspergillus flavus Link aflatoxins producer; to demonstrate the application of Polymerase Chain Reaction (PCR) technique in the diagnostic of A. Flavus, as well to verify the effect of radiation in the profile of DNA bands. Twenty samples of grains maize with 200 g each were individually irradiated with 20 kGy, to eliminate the microbial contamination. In following, the samples were inoculated with an toxigenic A. flavus (1x10 6 spores/ml), incubated for 15 days at 25 deg C with a relative humidity of around 97,5% and irradiated with 0, 2; 5 and 10 kGy. The samples, 5 to each dose of irradiation, were individually analyzed for the number of fungal cells, water activity, viability test (fluorescein diacetate and ethidium bromide), PCR and aflatoxins (AFB) detection. The results showed that the doses used were effective in reducing the number of Colony Forming Units (CFU/g) mainly the doses of 5 and 10 kGy. In addition, the viability test showed a decrease of viable cells with increase of irradiation doses. The reduction of AFB 1 and AFB-2, was more efficient with the use of 2 kGy in comparison with the dose of 5 kGy, while the dose of 10 kGy, degraded the aflatoxins. Thereby, it was observed that AFB2 showed to be more radiosensitive. The use of PCR technique showed the presence of DNA bands, in all samples. (author)
Optimisation of the PCR-invA primers for the detection of Salmonella ...
African Journals Online (AJOL)
A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.
Wen, Weijia; Wu, Jinbo; Kodzius, Rimantas
2011-01-01
A polymerase chain reaction (PCR) device for fast amplification and detection of DNA includes an interchangeable PCR chamber, a temperature control component, and an optical detection system. The DNA amplification is performed on an interchangeable
Li, Y; Saxena, D; Barnes, V M; Trivedi, H M; Ge, Y; Xu, T
2006-10-01
Clinical evaluation of oral microbial reduction after a standard prophylactic treatment has traditionally been based on bacterial cultivation methods. However, not all microbes in saliva or dental plaque can be cultivated. Polymerase chain reaction-based denaturing gradient gel electrophoresis (PCR-DGGE) is a cultivation-independent molecular fingerprinting technique that allows the assessment of the predominant bacterial species present in the oral cavity. This study sought to evaluate the oral microbial changes that occurred after a standard prophylactic treatment with a conventional oral care product using PCR-DGGE. Twelve healthy adults participated in the study. Pooled plaque samples were collected at baseline, 24 h after prophylaxis (T1), and 4 days after toothbrushing with fluoride toothpaste (T4). The total microbial genomic DNA of the plaque was isolated. PCR was performed with a set of universal bacterial 16S rDNA primers. The PCR-amplified 16S rDNA fragments were separated by DGGE. The effects of the treatment and of dental brushing were assessed by comparing the PCR-DGGE fingerprinting profiles. The mean numbers of detected PCR amplicons were 22.3 +/- 6.1 for the baseline group, 13.0 +/- 3.1 for the T1 group, and 13.5 +/- 4.3 for the T4 group; the differences among the three groups were statistically significant (P < 0.01). The study also found a significant difference in the mean similarities of microbial profiles between the baseline and the treatment groups (P < 0.001). PCR-based DGGE has been shown to be an excellent means of rapidly and accurately assessing oral microbial changes in this clinical study.
International Nuclear Information System (INIS)
Lee, H.; Bang, H.E.; Johnson, R.; Jordaan, A.M.; Victor, T.C. . E-mail : tv@sun.ac.za; Dar, L.; Khan, B.K.; Cho, S.N. . E-mail : raycho@yonsei.ac.kr
2006-01-01
Rapid and sensitive detection of mutations at the rpoB gene of Mycobacterium tuberculosis would be of great importance for proper management of tuberculosis (TB) patients and control of multi-drug resistant TB. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) using both radioisotopic and non-radioisotopic methods have been widely used for detecting such mutations. However, the silver staining method, which is the most frequently employed in PCR-SSCP, has been reported to be producing results of varying sensitivity. Radioisotope-based methods have shown greater sensitivity in detecting the rpoB mutations than the silver staining method. The primary objective of this study was therefore to compare the radioisotopic method with the silver staining method detection of mutations of rpoB gene by PCR-SSCP in the same laboratory. Purified DNAs from M. tuberculosis H37Rv were serially diluted and used for PCR amplification with and without radionuclides. The PCR products were then detected by silver staining and autoradiography methods. In addition, clinical isolates were analyzed by PCR-SSCP. The radioisotopic method showed about four-fold increase in the detection of PCR products over ethidium bromide staining in agarose gel. When compared with silver staining, the radioisotopic method gave a sensitivity of more than 10-fold in detecting PCR products and about 8-fold in PCR-SSCP. Radioisotope-based detection methods provided a clearer resolution in PCR-SSCP than the silver staining method when applied to clinical isolates of M. tuberculosis. Radioisotope-based detection method was shown to be more sensitive than non-isotope-based method in detecting PCR products and mutations at the rpoB gene of M. tuberculosis by PCR-SSCP. It may be noted that mutations in the rpoB gene as a marker have significant clinical importance because of the increasing number of MDR-TB cases in the world. It is especially relevant to MDR and Extreme Drug Resistance TB
Directory of Open Access Journals (Sweden)
Camila Ximenes
2014-12-01
Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.
Directory of Open Access Journals (Sweden)
M.V. Resende
2011-06-01
Full Text Available The objective of the present study was to determine the sperm enrichment with X-bearing spermatozoa, after one centrifugation in a Percoll or OptiPrep continuous density gradient, using quantitative real-time polymerase chain reaction (qPCR of sperm DNA and resultant in vitro-produced bovine embryos by PCR. Frozen/thawed sperm was layered on density gradients and the tubes were centrifuged. Supernatants were gently aspirated and the sperm recovered from the bottom of the tubes. Cleavage and blastocyst rates were determined through in vitro production of embryos and PCR was performed to identify the embryos' genetic sex. A difference in blastocyst rate was found in the Percoll treatment compared to OptiPrep (P<0.05. The percentage of female embryos in the Percoll and OptiPrep groups was 62.0% and 47.1%, respectively. These results were confirmed by qPCR of spermatozoa DNA and underestimation was seen only in the Percoll group. It was possible to sexing sperm using simple approach.
Maedi in slaughtered sheep: a pathology and polymerase chain reaction study in southwestern Iran.
Azizi, Shahrzad; Tajbakhsh, Elahe; Fathi, Farzad; Oryan, Ahmad; Momtaz, Hassan; Goodarzi, Mehdi
2012-01-01
Maedi-visna (MV) is an important slow viral disease of sheep leading to a progressive lymphoproliferative disease. It affects multiple organs primarily the lungs, where it causes interstitial pneumonia (maedi). In this study, the lungs of 1,000 sheep carcasses were grossly inspected and those suspected to have maedi were studied at histopathological and molecular levels. A polymerase chain reaction (PCR) technique that amplified a 291-base pair DNA in the long terminal repeat (LTR) sequence of MV provirus was conducted on all the 50 suspected lungs together with 10 normal appearing lungs as controls. Amplicons of the expected size were detected in 11 (n=11/50) suspected sheep, and one of the 10 control sheep. Histopathologic study of the pulmonary lesions of all 11 (n=11/11) positive sheep showed MV lesions, including hyperplasia of the perivascular and peribronchiolar lymphoid cells, interstitial lymphoplasmacytic infiltration and smooth muscle hyperplasia and the histopathologic findings were correlated with PCR results. In contrast, the tissue sections of control animals were almost normal at histopathological level; however, PCR technique demonstrated that one of them was affected by maedi. This study showed that the LTR-PCR had high specificity and sensitivity in diagnosis of this viral infection. This study is the first to evaluate the prevalence of MV virus infection in sheep in Iran.
Zhong, Yong; Huang, Lihong; Zhang, Zhisen; Xiong, Yunjing; Sun, Liping; Weng, Jian
2016-01-01
Graphene oxides (GOs) with different surface characteristics, such as size, reduction degree and charge, are prepared, and their effects on the specificity of polymerase chain reaction (PCR) are investigated. In this study, we demonstrate that GO with a large size and high reduction degree is superior to small and nonreduced GO in enhancing the specificity of PCR. Negatively charged polyacrylic acid (PAA), positively charged polyacrylamide (PAM), neutral polyethylene glycol (PEG) and zwitterionic polymer poly(sulfobetaine) (pSB) are used to modify GO. The PCR specificity-enhancing ability increases in the following order: GO-PAA Pfu DNA polymerase. Our data demonstrate that the size, reduction degree and surface charge of GO affect the specificity of PCR. Based on our results, zwitterionic polymer-modified GO may be used as an efficient additive for enhancing the specificity of PCR. PMID:27956830
Ayatollahi, Hossein; Fani, Azar; Ghayoor Karimiani, Ehsan; Homaee, Fateme; Shajiei, Arezoo; Sheikh, Maryam; Shakeri, Sepideh; Shams, Seyyede Fatemeh
2017-01-01
The assessment of human epidermal growth factor receptor 2 (HER2) status has become of great importance in the diagnosis of breast cancer. The aim of this study was to investigate the diagnostic value of quantitative Polymerase Chain Reaction (qPCR) and Chromogenic In Situ Hybridization (CISH) to assess HER2 status of biopsy specimens. To elucidate the status of HER2 gene amplification, biopsies of breast carcinoma from 120 patients with 2+ IHC status were analyzed by qPCR and CISH. The results of the two experiments were compared, and it was depicted that the concordance rate between CISH and qPCR assays was 88.1%.The quantification of HER2 gene with CISH and qPCR showed that there was a significant correlation (p value= 0.0001 and r= 0.808). The results of this research support the idea that qPCR is a precise and reproducible technique, which can be employed as a supplementary method to evaluate HER2 status.
Blanco, Roberta Morozetti; Romero, Eliete Caló
2014-04-01
The aim of this study was to analyse the nested polymerase chain reaction (nested PCR) in human serum samples of patients with clinical manifestations of leptospirosis. The cases of leptospirosis were defined by the microagglutination test (MAT). The samples were collected in 2010. Of 1042 serum samples collected from 521 patients, 28 (5.4%) were considered positive cases of leptospirosis, and 493 (94.6%) were negative. Twenty-three confirmed cases had no MAT-detectable antibodies in the acute sample (mean of 5.6 days after onset). Nested PCR was positive in 22/23 (95.7%) patients during the acute phase of the disease, with negative results by MAT. Nested PCR was negative in all convalescent serum samples with positive results by MAT. All negative cases of leptospirosis were negative by nested PCR. The nested PCR is an alternative diagnostic tool for early detection of leptospires in sera during the first 7 days of the disease. Copyright © 2014 Elsevier Inc. All rights reserved.
Meurs, K M; Fox, P R; Magnon, A L; Liu, S; Towbin, J A
2000-01-01
Viral myocarditis has been suggested as an etiology for cardiomyopathy in several mammalian species. Myocarditis and idiopathic cardiomyopathy have been reported in the domestic cat, although a viral etiology has not been demonstrated. Because of the continuing interest in the potential relationship between viral myocarditis and cardiomyopathy, we evaluated hearts from cats with spontaneous, idiopathic cardiomyopathy for viral genomic material within myocytes by polymerase chain reaction, and for the presence of myocarditis by light microscopy. Thirty-one (31) formalin-fixed hearts from domestic cats who died of idiopathic cardiomyopathy were randomly selected from pathology archives. Seventeen (17) formalin-fixed hearts from healthy cats were similarly selected as normal controls. The polymerase chain reaction (PCR) was used to evaluate myocardial tissue for the presence of viral genome from feline panleukopenia virus, herpes virus, calici virus, and corona virus. Hearts were examined using light microscopy for histologic evidence of myocarditis according to the Dallas criteria. Panleukopenia virus was identified by PCR in 10 of 31 cats with cardiomyopathy but in none of the controls. Neither cardiomyopathic or control cats tested positive by PCR for herpes virus, calici virus, and corona virus. Myocarditis was detected by histologic examination in 18 of 31 cardiomyopathic cats and in none of 17 control cats. Myocarditis and or feline panleukopenia virus genome was detected in felines with idiopathic hypertrophic, dilated, and restrictive cardiomyopathy, suggesting a possible role of viral infection and inflammation in the pathogenesis of cardiomyopathy in this species.
Directory of Open Access Journals (Sweden)
Praphathip Eamsobhana
2013-02-01
Full Text Available Cerebrospinal fluid (CSF samples from clinically diagnosed patients with detectable Angiostrongylus canto-nensis-specific antibodies (n = 10, patients with clinically suspected cases that tested negative for A. cantonensis-an-tibodies (n = 5 and patients with cerebral gnathostomiasis (n = 2 and neurocysticercosis (n = 2 were examined by a single-step polymerase chain reaction (PCR method using the AC primers for the 66-kDa native protein gene. The PCR method detected A. cantonensis DNA in CSF samples from four of 10 serologically confirmed angiostrongyliasis cases. The PCR results were negative for the remaining CSF samples. The nucleotide sequences of three positive CSF-PCR samples shared 98.8-99.2% similarity with the reference sequence of A. cantonensis. These results indicate the potential application of this PCR assay with clinical CSF samples for additional support in the confirmation of eosinophilic meningitis due to A. cantonensis.
Nanomaterials have been widely reported to affect the polymerase chain reaction (PCR). However, many studies in which these effects were observed were not comprehensive, and many of the proposed mechanisms have been primarily speculative. In this work, we used amino-modified silica-coated magnetic n...
DEFF Research Database (Denmark)
Horn, P; Schouenborg, P Øland; Brandslund, I
2007-01-01
OBJECTIVE: The objective of this study was to test a polymerase chain reaction (PCR) assay intended as a tool for monitoring hand hygiene in hospital wards. METHODS: The hands of 20 health-care workers were sampled for 10 days using real-time PCR for quantification of Staphylococcus aureus and S....... epidermidis. Reference intervals (CI) and biological variation were evaluated using index of individuality (II) and critical difference (CD). RESULTS: 45% of the participants were positive for S. aureus on all 10 days. Intra-individual biological variation (CVI) was 129% for S. aureus and 62% for S...
Rampersad, Joanne; Wang, Xiaohui; Gayadeen, Helen; Ramsewak, Samuel; Ammons, David
2007-11-01
To provide a preliminary assessment of in-house polymerase chain reaction (PCR) as an alternative to the more costly commercial test for detection of asymptomatic infection by Chlamydia trachomatis and to provide much needed demographic data on infection indicators within the Trinidad and Tobago public health care system. An inexpensive in-house nested-PCR with an Internal Amplification Control was used to detect C. trachomatis and Neisseria gonorrhoeae in urine samples collected from 273 apparently healthy, pregnant women from March-September 2004 in Trinidad, West Indies. Demographic information on participants was collected and subjected to statistical analyses. C. trachomatis was detected in 57/273 (21%) samples, of which 5 (2%) were also positive for N. gonorrhoeae. Infection correlated well with certain demographic parameters, with the highest incidence of C. trachomatis infection found among pregnant women that were single or of African descent. Given the lack of commercial tests in Trinidad, in-house PCR is an inexpensive alternative that can be used to detect asymptomatic infections of C. trachomatis and to provide demographic information needed for interventions by the public health care system.
A naked-eye colorimetric "PCR developer"
Valentini, Paola; Pompa, Pier Paolo
2016-04-01
Despite several advances in molecular biology and diagnostics, Polymerase Chain Reaction (PCR) is currently the gold standard for nucleic acids amplification and detection, due to its versatility, low-cost and universality, with estimated genetically modified organisms, and pathogens). The PCR developer proved to be highly specific and ultra-sensitive, discriminating down to few copies of HIV viral DNA, diluted in an excess of interfering human genomic DNA, which is a clinically relevant viral load. Hence, it could be a valuable tool for both academic research and clinical applications.
Gamper, H.A.; Leuchtmann, A.
2007-01-01
Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking
Nuclear fission, chain reaction and criticality
International Nuclear Information System (INIS)
Reuss, Paul
2016-01-01
Criticality is, notably for nuclear reactors, the status which separates the case of a fission chain reaction which inexorably decays, from that of a reaction which grows faster and faster until a counter-reaction occurs. If this status is an objective in nuclear reactors, it must not be reached or exceeded in any case in other types of installations in which fissile materials are handled (fabrication, transports, nuclear fuel processing). The author proposes an insight into this notion of criticality, discusses elements of neutron science which allow the multiplication factor to be assessed, analyses accidental scenarios which may happen, and presents associated experiments and computation codes
Directory of Open Access Journals (Sweden)
Shyamal G
2005-01-01
Full Text Available Purpose: To standardize and apply a polymerase chain reaction (PCR on the glycoprotein D gene to differentiate Herpes simplex virus (HSV 1 & 2 serotypes in culture negative intraocular specimens. Methods: Twenty-one intraocular fluids collected from 19 patients were subjected to cultures for HSV and uniplex PCR (uPCR for DNA polymerase gene. To differentiate HSV serotypes, as 1 & 2, a seminested PCR (snPCR targeting the glycoprotein D gene was standardised and applied onto 21 intraocular fluids. The specificity of the snPCR was verified by application onto ATCC strains of HSV 1 and 2, clinical isolates and DNA sequencing of the amplified products. All specimens were also tested for the presence of cytomegalovirus (CMV and varicella zoster virus (VZV by nucleic acid amplification methods. Results: Four of the 21 intraocular fluids were positive for HSV by uPCR. snPCR detected HSV in three additional specimens (total of seven specimens, and identified three as HSV 1 and four as HSV 2. DNA sequencing of PCR products showed 100% homology with the standard strains of HSV 1 and 2 respectively. None of the samples were positive in culture. Among the other patients, CMV DNA was detected in two and VZV DNA in five others. Conclusions: The standardized snPCR can be applied directly onto the culture negative specimens for rapid differentiation of HSV serotypes.
Directory of Open Access Journals (Sweden)
C. Latha
2017-08-01
Full Text Available Aim: The objective of the study was to investigate the occurrence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using the multiplex polymerase chain reaction (PCR method. Materials and Methods: The assay combined an enrichment step in tryptic soy broth with yeast extract formulated for the simultaneous growth of target pathogens, DNA isolation and multiplex PCR. A total of 1134 samples including beef (n=349, chicken (n=325, pork (n=310, chevon (n=50, and meat products (n=100 were collected from different parts of Kerala, India. All the samples were subjected to multiplex PCR analysis and culture-based detection for the four pathogens in parallel. Results: Overall occurrence of L. monocytogenes was 0.08 % by cultural method. However, no L. monocytogenes was obtained by multiplex PCR method. Yersinia enterocolitica was obtained from beef and pork samples. A high prevalence of S. aureus (46.7% was found in all types of meat samples tested. None of the samples was positive for S. Typhimurium. Conclusion: Multiplex PCR assay used in this study can detect more than one pathogen simultaneously by amplifying more than one target gene in a single reaction, which can save time and labor cost.
Jalal Kiani, Seyed; Shatizadeh Malekshahi, Somayeh; Yousefi Ghalejoogh, Zohreh; Ghavvami, Nastaran; Shafiei Jandaghi, Nazanin Zahra; Shahsiah, Reza; Jahanzad, Isa; Yavarian, Jila
2015-01-01
Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have developed a multiplex PCR for simultaneous detection and typing of different HPVs. Objectives: The aim of the present study was to investigate the prevalence of HPV infection and its types in cervical Squamous Cell Carcinoma (SCC) using the Nested Multiplex PCR (NMPCR) assay. Patients and Methods: Sixty-six samples with histologically confirmed SCC were evaluated. Total DNA was isolated by phenol–chloroform extraction and ethanol precipitation. Nested multiplex PCR was performed with first-round PCR by GP-E6/E7 consensus primers for amplification of the genomic DNA of all known mucosal HPV genotypes and second-round PCR by type-specific multiplex PCR primer cocktails. Results: Human papilloma virus infection was detected in 78.8% of samples, with the highest prevalence of HPV 16 (60.6%) while concurrent infections with two types was detected in 10.6%. Conclusions: The NMPCR assay is more convenient and easy for analysis of results, which is important for fast diagnosis and patient management, in a type-specific manner. PMID:26865940
Directory of Open Access Journals (Sweden)
Aaron J. Stevens
2017-03-01
Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.
Directory of Open Access Journals (Sweden)
Dyah Ayu Hewajuli
2014-03-01
Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.
[Value of polymerase chain reaction in serum for the diagnosis of enteroviral meningitis].
Marque Juillet, S; Lion, M; Pilmis, B; Tomini, E; Dommergues, M-A; Laporte, S; Foucaud, P
2013-06-01
Enteroviruses (EV) are a common cause of aseptic meningitis in children. Virological diagnosis of EV meningitis is currently based on the detection of the viral genome in the cerebrospinal fluid (CSF). This study attempted to determine the correlation and the temporality of the polymerase chain reaction (PCR) assay in serum and CSF and to evaluate the possibility of diagnosing EV infection only on the serum PCR. The EV genome was sought by RT real-time PCR (Smart Cycler EV Primer and Probe Set(®), Cepheid) in CSF and serum, collected at the same time, for all children who underwent a lumbar puncture for suspected meningitis, between 1 June and 31 July 2010 at the Versailles Hospital. Forty-four patients were included in the study. EV infection was documented for 22 of them. In 10 patients, the EV genome was detected in CSF only; in 3 patients in serum only, and in 9 patients in both. Among patients with acute EV neurological infection, viremic children were significantly younger (1.6 months versus 5.8 years; Pvalue of EV PCR in serum. It suggests that in some children and under certain conditions (age >3 months, clinical and biological compatibility with a viral infection, no previous antibiotic therapy, time from symptom onset to blood sampling <30 h, PCR in serum analyzed within 3h), PCR in serum, when positive, is a possible alternative. Therefore, it may be possible to diagnose EV infection without performing a lumbar puncture in a limited number of young children (11.4% of our suspected cases). This study needs to be reinforced by a multicenter study with a broader panel of patients. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Institute of Scientific and Technical Information of China (English)
YAO Zhiyuan(姚志远); ZHENG Heyi(郑和义); CAO Jingjiang(曹经江)
2002-01-01
Objective: To study the prevalence of Trichomonas vaginalis(TV) infection in Chinese male patients with nongonococcalurethritis (NGU), to evaluate the sensitivity and specificity ofurine-based and urethral swab polymerase chain reaction(PCR) detection, to set up a method for non-invasive detectionof male TV infection. Method: One hundred and five male NGU patients wereselected from a Beijing STD clinic. Two urethral swabs wereobtained from each patient, one for the InPouch TV culturesystem and the other for PCR. In addition, one first void urinespecimen was collected for PCR detection. Culture wasconsidered the "gold standard". The sensitivity, specificity,positive predictive value (PPV) and negative predictive value(NPV) of the two PCR detections were compared to cultureresults. Results: The prevalence of urine-based PCR and urethralswab PCR detection was 3.81% (4/105) and 4.76% (5/105)respectively. Compared to culture, the sensitivity, specificity,PPV and NPV were 80%, 100%, 100% and 99% for urine-based PCR and 80%, 99%, 80% and 99% for urethral swabPCR.Conclusion: TV is one of the etiological agents in male NGU,with a 4.76% prevalence of infection in our study. The urine-based PCR detection has higher sensitivity and specificity andprovides a noninvasive method more feasible in practice.
Directory of Open Access Journals (Sweden)
Ji Yeon Kwon
2013-09-01
Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.
Özenci, Volkan; Patel, Robin; Ullberg, Måns; Strålin, Kristoffer
2018-01-18
Although there are several US Food and Drug Administration (FDA)-approved/cleared molecular microbiology diagnostics for direct analysis of patient samples, all are single target or panel-based tests. There is no FDA-approved/cleared diagnostic for broad microbial detection. Polymerase chain reaction (PCR)/electrospray ionization-mass spectrometry (PCR/ESI-MS), commercialized as the IRIDICA system (Abbott) and formerly PLEX-ID, had been under development for over a decade and had become CE-marked and commercially available in Europe in 2014. Capable of detecting a large number of microorganisms, it was under review at the FDA when, in April 2017, Abbott discontinued it. This turn of events represents not only the loss of a potential diagnostic tool for infectious diseases but may be a harbinger of similar situations with other emerging and expensive microbial diagnostics, especially genomic tests. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise
Robertson, Amber L.; Phillips, Allison R.
2008-01-01
Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessm...
Furutani, Shunsuke; Hagihara, Yoshihisa; Nagai, Hidenori
2017-09-01
Correct labeling of foods is critical for consumers who wish to avoid a specific meat species for religious or cultural reasons. Therefore, gene-based point-of-care food analysis by real-time Polymerase Chain Reaction (PCR) is expected to contribute to the quality control in the food industry. In this study, we perform rapid identification of meat species by our portable rapid real-time PCR system, following a very simple DNA extraction method. Applying these techniques, we correctly identified beef, pork, chicken, rabbit, horse, and mutton in processed foods in 20min. Our system was sensitive enough to detect the interfusion of about 0.1% chicken egg-derived DNA in a processed food sample. Our rapid real-time PCR system is expected to contribute to the quality control in food industries because it can be applied for the identification of meat species, and future applications can expand its functionality to the detection of genetically modified organisms or mutations. Copyright © 2017 Elsevier Ltd. All rights reserved.
How useful is PCR in the diagnosis of malaria?
Hänscheid, Thomas; Grobusch, Martin P.
2002-01-01
Polymerase chain reaction (PCR) assays are the most sensitive and specific method to detect malaria parasites, and have acknowledged value in research settings. However, the time lag between sample collection, transportation and processing, and dissemination of results back to the physician limits
International Nuclear Information System (INIS)
Yilmaz, R.; Cabi, E.; Dogan, M.
2014-01-01
RAPD-PCR (Random Amplified Polymorphic DNA Polymerase Chain Reaction) and Post PCR (Polymerase Chain Reaction) Melting Curve Analysis (MCA) have been used to investigate the pattern of genetic variation among some species in the genera Eremopyrum (Ledeb.) Jaub. and Spach and Agropyron Gaertner (Poaceae). Thirteen primers have been used in the study based on the RAPD-PCR and MCA analyses. Each species produced a distinct pattern of DNA fragments which have been used as a measure of the degree of relationship between species by means of using the RAPD-PCR results with three primers selected for identifying the genetic similarities. Polymorphic melting profiles have been obtained with Post PCR MCA method using three primers. Genetic similarities are calculated for all the species studied with RAPD-PCR and MCA methods, the dendrograms are obtained with the MVSP (Multi Variate Statistical Package) software using UPGMA (Unweighted Pair Group Method with Arithmetic Averages) and Jaccard's Coefficient. Polymorphism between 18 populations of Eremopyrum and 6 Agropyron populations and within the species are determined by using RAPD-PCR and Post PCR melting curve analysis (MCA) respectively. (author)
Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H
2013-04-01
Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.
International Nuclear Information System (INIS)
Aleksandrov, I.D.; Lapidus, I.L.; Aleksandrova, M.V.; Karpovskij, A.L.; Korablinova, S.V.; Levkovich, N.V.
1998-01-01
A total of 27 independent isolated spontaneous and gamma-ray-induced heritable mutations at the vestigial gene of Drosophila melanogaster were analysed by a rapid deletion screening method with polymerase chain reaction (PCR) amplification. According to the results obtained 36.4% (4 of 11) of spontaneous mutants and 62.5% (10 of 16) of gamma-ray-induced ones have revealed deficiency of one or more fragments studied. The rest of spontaneous and radiation mutants showed no alterations in the PCR patterns, indicating possible small scale changes (point mutations) inside the gene region studied or, probably, the gross lesions situated elsewhere. The distribution of the mutation damages in the gene region studied are discussed
Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Cesare Bonacina
2010-01-01
Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.
Khan, S; Miah, M R; Khatun, S
2015-12-01
A nested polymerase chain reaction (PCR) specific for Salmonella enterica subspecies enteric serovar Typhi was used for the detection of the pathogen, in blood. This study was done during the period of March 2013 to February 2014. A total of 80 clinically suspected cases of typhoid fever were included in the study. Blood was collected from all participating individuals. Nested PCR targeting the flagellin gene (fliC) of Salmonella Typhi & blood culture were done for each of the cases. The positivity rate of PCR & blood culture was 70%& 20% respectively. The positivity rate of PCR was significantly higher than blood culture (Ptyphoid fever cases on the basis of clinical features but with negative cultures. We conclude that the PCR technique could be used as a novel diagnostic method of typhoid fever, particularly in culture-negative cases in an endemic country like Bangladesh.
Singh, Rahul; Kumar, Pawan; Singh, Rajendra; Dhama, Kuldeep; Kumari, Swati; Yadav, Jay Prakash; Kashyap, Gayatri; Singh, Karam Pal; Singh, Vidya; Sahoo, Monalisa
2017-11-01
The small ruminant lentiviruses are known to cause maedi-visna (MV) and caprine arthritis - encephalitis in sheep and goats, typically affecting joints, udder, lungs, and the central nervous system. The diagnosis usually involves serology, clinical signs, immunohistochemistry, and polymerase chain reaction (PCR). In the present study, the histopathologically positive pneumonia cases of MV were confirmed by PCR in lung tissue probably for the first time in India. A total of 888 lungs of adult sheep, aged between 2 and 5 years, were screened during slaughter, of which 121 were found to have pneumonic lesions. The tissues from each pneumonic lung including associated lymph nodes were collected in 10% neutral buffered formalin for histopathology. The frozen tissues of the same were also collected and stored at -20°C for PCR confirmation. Three of 121 cases of pneumonic lungs of sheep revealed gross and histopathological lesions suggestive of maedi or ovine progressive pneumonia infection. These 3 cases were further confirmed by PCR technique that amplified 291-base pair DNA in the long terminal repeat sequence of MV provirus. This study suggests the low occurrence of MV virus (MVV) infection in India in naturally affected sheep based on pathomorphological lesions and using the molecular tool of PCR detection of the virus in tissues. Further, a combination of pathomorphology or/and PCR testing might be optimal for detecting the animals infected with MVV.
Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton
2003-02-01
A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.
Fabrication of Polymerase Chain Reaction Plastic Lab-on-a-Chip Device for Rapid Molecular Diagnoses
Directory of Open Access Journals (Sweden)
Kieu The Loan Trinh
2016-05-01
Full Text Available Purpose: We aim to fabricate a thermoplastic poly(methylmethacrylate (PMMA Lab-on-a-Chip device to perform continuous- flow polymerase chain reactions (PCRs for rapid molecular detection of foodborne pathogen bacteria. Methods: A miniaturized plastic device was fabricated by utilizing PMMA substrates mediated by poly(dimethylsiloxane interfacial coating, enabling bonding under mild conditions, and thus avoiding the deformation or collapse of microchannels. Surface characterizations were carried out and bond strength was measured. The feasibility of the Lab-on-a-Chip device for performing on-chip PCR utilizing a lab-made, portable dual heater was evaluated. The results were compared with those obtained using a commercially available thermal cycler. Results: A PMMA Lab-on-a-Chip device was designed and fabricated for conducting PCR using foodborne pathogens as sample targets. A robust bond was established between the PMMA substrates, which is essential for performing miniaturized PCR on plastic. The feasibility of on-chip PCR was evaluated using Escherichia coli O157:H7 and Cronobacter condimenti, two worldwide foodborne pathogens, and the target amplicons were successfully amplified within 25 minutes. Conclusions: In this study, we present a novel design of a low-cost and high-throughput thermoplastic PMMA Lab-on-a-Chip device for conducting microscale PCR, and we enable rapid molecular diagnoses of two important foodborne pathogens in minute resolution using this device. In this regard, the introduced highly portable system design has the potential to enable PCR investigations of many diseases quickly and accurately.
Directory of Open Access Journals (Sweden)
Rodrigo Staggemeier
2014-04-01
Full Text Available A novel SYBR® green-real time polymerase chain reaction (qPCR was developed to detect two Bartonella species, B. henselae and B. clarridgeiae, directly from blood samples. The test was used in blood samples obtained from cats living in animal shelters in Southern Brazil. Results were compared with those obtained by conventional PCR targeting Bartonella spp. Among the 47 samples analyzed, eight were positive using the conventional PCR and 12 were positive using qPCR. Importantly, the new qPCR detected the presence of both B. henselae and B. clarridgeiae in two samples. The results show that the qPCR described here may be a reliable tool for the screening and differentiation of two important Bartonella species.
Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum
Directory of Open Access Journals (Sweden)
Ma Xiaoying
2017-02-01
Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.
Directory of Open Access Journals (Sweden)
Manju Soman
2014-10-01
Full Text Available Aim: The aim was to isolate and characterize Riemerella anatipestifer organisms from disease outbreaks in ducks in Kerala. Materials and Methods: Ducklings, suspected of Riemerella infection, were sacrificed and subjected to post-mortem examination. Heart blood smears and impression smears from liver and spleen were examined for the presence of pathogenic organisms. Heart blood, lung, liver, and spleen collected aseptically from the birds were subjected to isolation trials in brain heart infusion agar and 10% bovine blood agar. The isolates were characterized based on morphology, cultural characteristics and biochemical tests, and their identity were confirmed by polymerase chain reaction (PCR and the PCR amplified DNA was sequenced. The antibiotic sensitivity testing of the isolates were carried out using six antibiotics viz ciprofloxacin, chloramphenicol, enrofloxacin, amoxycillin, cotrimoxazole, and gentamicin. Results: Colonies suggestive of Riemerella organisms could be isolated on blood agar. Biochemical characterization and PCR confirmed the identity of isolates as R. anatipestifer. The nucleotide sequence of the PCR product showed 99% homology to the R. anatipestifer sequences in the NCBI. The antibiogram revealed that the organisms were sensitive to ciprofloxacin, enrofloxacin, and gentamicin. Conclusion: The present study suggests that the PCR assay can facilitate fast and proper identification of R. anatipestifer infection in ducks. The assay can also differentiate between R. anatipestifer and Pasteurella multocida and can replace the traditional methods of differentiation which are cumbersome and time-consuming.
Pure chromosome-specific PCR libraries from single sorted chromosomes
VanDevanter, D. R.; Choongkittaworn, N. M.; Dyer, K. A.; Aten, J. A.; Otto, P.; Behler, C.; Bryant, E. M.; Rabinovitch, P. S.
1994-01-01
Chromosome-specific DNA libraries can be very useful in molecular and cytogenetic genome mapping studies. We have developed a rapid and simple method for the generation of chromosome-specific DNA sequences that relies on polymerase chain reaction (PCR) amplification of a single flow-sorted
Angers, M; Cloutier, J F; Castonguay, A; Drouin, R
2001-08-15
Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.
Pittet, Laure F; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M
2014-01-01
Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001-, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.
Evaluation of a Solid Phase DNA Binding Matrix for Downstream PCR Analysis
National Research Council Canada - National Science Library
Bader, Douglas E; Fisher, Glen R; Stratilo, Chad W
2005-01-01
A commercially available solid-phase DNA binding matrix (FTA cards) was evaluated for its ability to capture and release DNA for downstream gene amplification and detection assays using polymerase chain reaction (PCR...
Directory of Open Access Journals (Sweden)
Aline Lavado Tolardo
2016-06-01
Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.
Directory of Open Access Journals (Sweden)
João Bortoletti Filho
2013-01-01
Full Text Available A brief report on the nature and epidemiology of T. gondii infection is firstly presented. The importance of the specific IgG avidity test and polymerase chain reaction (PCR for toxoplasmosis is discussed, along with their significance and importance as auxiliary methods for determining the most likely time for the initial infection by this coccidian and for defining the therapeutic strategy. Lastly, practical comments are made in relation to the classical therapeutic regimens, with special attention to the indications for fetal treatment, when this is necessary.
Wellenberg, G.J.; Verstraten, E.; Belak, S.; Verschuren, S.B.E.; Rijsewijk, F.A.M.; Peshev, R.; Oirschot, van J.T.
2001-01-01
A polymerase chain reaction (PCR) assay was developed to detect bovine herpesvirus 4 (BHV4) glycoprotein B (gB) DNA, and a nested-PCR assay was modified for the detection of BHV4 thymidine kinase (TK) DNA in bovine milk samples. To identify false-negative PCR results, internal control templates were
Directory of Open Access Journals (Sweden)
Marize Quinhones Pires
2014-04-01
Full Text Available Introduction During a diagnostic evaluation of canine visceral leishmaniasis (VL, two of seventeen dogs were found to be co-infected by Leishmania (Viannia braziliensis and Leishmania (Leishmania chagasi. Methods Specific polymerase chain reaction (PCR and restriction fragment length polymorphism-PCR (RFLP-PCR assays were performed. Results PCR assays for Leishmania subgenus identification followed by RFLP-PCR analysis in biopsies from cutaneous lesions and the spleen confirmed the presence of Leishmania (Viannia braziliensis and Leishmania (Leishmania chagasi in those fragments. Conclusions This report reinforces the importance of using serological and molecular techniques in the epidemiological surveillance of canine populations in endemic areas in which both diseases are known to co-exist. In such cases, a reassessment of the control measures is required.
Determination of Sperm Sex Ratio in Bovine Semen Using Multiplex Real-time Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Trisadee Khamlor
2014-10-01
Full Text Available Gender selection is important in livestock industries; for example, female calves are required in the dairy industry. Sex-sorted semen is commonly used for the production of calves of the desired gender. However, assessment of the sex ratio of the sorted semen is tedious and expensive. In this study, a rapid, cost effective and reliable method for determining the sex ratio was developed using a multiplex real-time polymerase chain reaction (PCR assay. In this assay, the X and Y chromosome-specific markers, i.e., bovine proteolipid protein (PLP gene and sex-determining region Y (SRY were simultaneously quantified in a single tube. The multiplex real-time PCR assay was shown to have high amplification efficiencies (97% to 99% comparable to the separated-tube simplex real-time PCR assay. The results obtained from both assays were not significantly different (p>0.05. The multiplex assay was validated using reference DNA of known X ratio (10%, 50%, and 90% as templates. The measured %X in semen samples were the same within 95% confidence intervals as the expected values, i.e., >90% in X-sorted semen, <10% in Y-sorted semen and close to 50% in the unsorted semen. The multiplex real-time PCR assay as shown in this study can thus be used to assess purity of sex-sorted semen.
A Trio of Human Molecular Genetics PCR Assays
Reinking, Jeffrey L.; Waldo, Jennifer T.; Dinsmore, Jannett
2013-01-01
This laboratory exercise demonstrates three different analytical forms of the polymerase chain reaction (PCR) that allow students to genotype themselves at four different loci. Here, we present protocols to allow students to a) genotype a non-coding polymorphic Variable Number of Tandem Repeat (VNTR) locus on human chromosome 5 using conventional…
Carrera, E; García, T; Céspedes, A; González, I; Sanz, B; Hernández, P E; Martín, R
1998-04-01
Restriction site analysis of polymerase chain reaction (PCR) products from a conserved region of the cytochrome b gene has been used for the identification of fresh and smoked samples of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Digestion of the 359-bp PCR product with the endonucleases EcoRV and TaqI yielded specific banding patterns for salmon and trout. This genetic marker can be very useful for detecting fraudulent substitution of the cheaper smoked trout for the more expensive smoked salmon.
Manduzio, Hélène; Ezan, Eric; Fenaille, François
2010-12-30
We have investigated the potential and robustness of the off-line coupling of polymerase chain reaction (PCR) with electrospray ionization mass spectrometry (ESI-MS), for further applications in the screening of single-nucleotide polymorphisms (SNPs). This was based on recently reported data demonstrating that anion-exchange solid-phase extraction was the most efficient technique for efficiently desalting PCR products, with a recovery of ∼70%. Results showed that this purification approach efficiently removes almost all the chemicals commonly added to PCR buffers. ESI-MS analysis of a model 114-bp PCR product performed on the LTQ-Orbitrap instrument demonstrated that detection limits in the nM range along with an average mass measurement uncertainty of 9.15 ± 7.11 ppm can be routinely obtained using an external calibration. The PCR/ESI-MS platform was able to detect just a few copies of a targeted oligonucleotide. However, it was shown that if two PCR products are present in a mixture in a ratio higher than 10 to 1, the lower abundance one might not be reproducibly detected. Applications to SNPs demonstrated that an LTQ-Orbitrap with a resolution of 30 000 (at m/z 400) easily identified a single (A ↔ G) switch, i.e. a 16 Da difference, in binary mixtures of ∼ 35 kDa PCR products. Complementary experiments also showed that the combination of endonucleases and ESI-MS could be used to confirm base composition and sequence, and thus to screen for unknown polymorphisms in specific sequences. For example, a single (T ↔ A) switch (9 Da mass difference) was successfully identified in a 114-bp PCR product. Copyright © 2010 John Wiley & Sons, Ltd.
Sharma, Deepa K; Nalavade, Uma P; Deshpande, Jagadish M
2015-10-01
The poliovirus serotype identification and intratypic differentiation by real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay is suitable for serotype mixtures but not for intratypic mixtures of wild and vaccine poliovirus strains. This study was undertaken to develop wild poliovirus 1 and 3 (WPV1 and WPV3) specific rRT-PCR assays for use. Specific primers and probes for rRT-PCR were designed based on VP1 sequences of WPV1 and WPV3 isolated in India since 2000. The specificity of the rRT-PCR assays was evaluated using WPV1 and WPV3 of different genetic lineages, non-polio enteroviruses (NPEVs) and mixtures of wild/wild and wild/Sabin vaccine strains. The sensitivity of the assays was determined by testing serial 10-fold dilutions of wild poliovirus 1 and 3 stock suspensions of known titre. No cross-reactivity with Sabin strains, intertypic wild poliovirus isolates or 27 types of NPEVs across all the four Enterovirus species was found for both the wild poliovirus 1 and 3 rRT-PCR assays. All WPV1 and WPV3 strains isolated since 2000 were successfully amplified. The rRT-PCR assays detected 10 4.40 CCID 50 /ml of WPV1 and 10 4.00 CCID 50 /ml of WPV3, respectively either as single isolate or mixture with Sabin vaccine strains or intertypic wild poliovirus. rRT-PCR assays for WPV1 and WPV3 have been validated to detect all the genetic variations of the WPV1 and WPV3 isolated in India for the last decade. When used in combination with the current rRT-PCR assay testing was complete for confirmation of the presence of wild poliovirus in intratypic mixtures.
Altınel, Ahmet
2017-01-01
Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256
Directory of Open Access Journals (Sweden)
Gusti Ayu Yuniati Kencana
2013-07-01
Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.
The role of chain carriers in fusion reaction kinetics
International Nuclear Information System (INIS)
Harms, A.A.; Krenciglowa, E.M.
1980-01-01
The role of chain carriers as contributors to multiplicative closed cycles in advanced fusion fuels is examined. Emphasis is placed on rate processes which can be used to characterize critical/supercritical/subcritical tendencies of arbitrary closed fusion cycles. Temporal trajectories for the chain carriers which describe both increasing and decreasing multiplicative processes have been found to exist and identified according to their fusion fuel cycle characteristics. Practical criteria to ensure the attainment of steady-state fusion reaction processes have been formulated in terms of fusion reaction rate relationships. (author)
Validation of kinetics similarity in qPCR
Czech Academy of Sciences Publication Activity Database
Bar, T.; Kubista, Mikael; Tichopád, Aleš
2012-01-01
Roč. 40, č. 4 (2012), s. 1395-1406 ISSN 0305-1048 R&D Projects: GA ČR GAP303/10/1338; GA ČR GA301/09/1752 Institutional research plan: CEZ:AV0Z50520701 Keywords : REAL-TIME PCR * POLYMERASE-CHAIN-REACTION * SYBR-GREEN-I Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 8.278, year: 2012
Campos, Ivón M.; Uribe, Mary L.; Cuesta, Carolina; Franco-Gallego, Alexander; Carmona-Fonseca, Jaime; Maestre, Amanda
2011-01-01
The technical capability of different methods to diagnose Plasmodium in maternal peripheral blood, placenta, and umbilical cord blood has not been assessed in Colombia and seldom explored in other malaria-endemic regions. We designed a study to compare the technical and the operational-economical performances of light microscopy (LM), nested polymerase chain reaction (nPCR), and histopathology (HP). In maternal blood, LM had 41% sensitivity and 100% specificity and in placental blood, 35% and 100%, respectively, compared with nPCR. In placental tissue, LM had 33% sensitivity and 95% specificity; and nPCR 47% and 77%, respectively; compared with HP. Light microscopy had the best operational-economical qualification. We concluded that nPCR and HP performed better compared with LM, but field implementation of these two techniques remains a problem. Therefore, LM is recommended as the gold standard for diagnosis of gestational malaria and placental blood infection in the field. PMID:21633030
Czech Academy of Sciences Publication Activity Database
Huggett, J.F.; Foy, C.A.; Benes, V.; Emslie, K.; Garson, J.A.; Haynes, R.; Hellemans, J.; Kubista, Mikael; Mueller, R.D.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; Vandesompele, J.; Wittwer, C.T.; Bustin, S.A.
2013-01-01
Roč. 59, č. 6 (2013), s. 892-902 ISSN 0009-9147 R&D Projects: GA ČR GAP303/10/1338 Institutional research plan: CEZ:AV0Z50520701 Keywords : REAL - TIME PCR * POLYMERASE-CHAIN-REACTION * COPY NUMBER VARIATION * RT-PCR Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 7.768, year: 2013
Polymerase chain reaction versus enzyme-linked immunosorbent ...
African Journals Online (AJOL)
Polymerase chain reaction versus enzyme-linked immunosorbent assay in detection of Chlamydia trachomatis infection among gynaecological patients in southwestern Nigeria. ... Socio-demographic bio-data and gynaecological history were obtained with questionnaire; data was analyzed using SPSS version 20.0.
Silvar, C; Díaz, J; Merino, F
2005-12-01
ABSTRACT Reliable and sensitive quantification of Phytophthora capsici in pepper plants is of crucial importance in managing the multiple syndromes caused by this pathogen. A real-time polymerase chain reaction (PCR) assay was developed for the determination of P. capsici in pepper tissues. DNA levels of a highly virulent and a less virulent isolate were measured in different pepper genotypes with varying degrees of resistance. Using SYBR Green and specific primers for P. capsici, the minimal amount of pathogen DNA quantified was 10 pg. Pathogen DNA was recorded as early as 8 h postinoculation. Thereafter, the increase was rapid in susceptible cultivars and slower in resistant ones. The amount of pathogen DNA quantified in each pepper genotype correlated with susceptibility to Phytophthora root rot. Likewise, there was a relationship between the virulence of the pathogen and the degree of colonization. Differences also were found in oomycete amount among pepper tissues, with maximal pathogen biomass occurring in stems. The real-time PCR technique developed in this study was sensitive and robust enough to assess both pathogen development and resistance to Phytophthora root rot in different pepper genotypes.
Dong, X Y; Li, W H; Zhu, J L; Liu, W J; Zhao, M Q; Luo, Y W; Chen, J D
2015-01-01
Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance.
Directory of Open Access Journals (Sweden)
CUNHA Regina Ayr Florio da
1998-01-01
Full Text Available The objective of the present study was to determine the prevalence of certain mycoplasma species, i.e., Mycoplasma hominis, Ureaplasma urealyticum and Mycoplasma penetrans, in urethral swabs from HIV-1 infected patients compared to swabs from a control group. Mycoplasmas were detected by routine culture techniques and by the Polymerase Chain Reaction (PCR technique, using 16SrRNA generic primers of conserved region and Mycoplasma penetrans specific primers. The positivity rates obtained with the two methods were comparable. Nevertheless, PCR was more sensitive, while the culture techniques allowed the quantification of the isolates. The results showed no significant difference (p < 0.05 in positivity rates between the methods used for mycoplasma detection.
DEFF Research Database (Denmark)
Munch, M.; Nielsen, L.P.; Handberg, Kurt
2001-01-01
A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...
Opisthorchis viverrini: Detection by polymerase chain reaction (PCR) in human stool samples
Digital Repository Service at National Institute of Oceanography (India)
Umesha, K.R.; SanathKumar; Parvathi, A.; Duenngai, K.; Sithithaworn, P.; Karunasagar, Indrani; Karunasagar, Iddya
Journal of Tropical Medicine and Public Health 22 (Suppl.), 174–178. Duenngai, K., Sithithaworn, P., Rudrappa, U.K., Karunasagar, I., Laha, T., Stensvold, C.R., Strandgaard, H., Johansen, M.V., 2008. Improvement of PCR for detection of Opisthrochis... and lecithodendriid trematodes. Southeast Asian Journal of Tropical Medicine and Public Health 22, 623–630. Kobayashi, J., Vannachone, B., Sato, Y., Manivong, K., Nambanya, S., Inthakone, S., 2000. An epidemiological study on Opisthorchis viverrini infection in Lao...
Xie, Liji; Xie, Zhixun; Huang, Li; Wang, Sheng; Huang, Jiaoling; Zhang, Yanfang; Zeng, Tingting; Luo, Sisi
2017-11-01
Sequence analysis of duck plague virus (DPV) revealed that there was a 528bp (B fragment) deletion within the UL2 gene of DPV attenuated vaccine strain in comparison with field virulent strains. The finding of gene deletion provides a potential differentiation test between DPV virulent strain and attenuated strain based on their UL2 gene sizes. Thus we developed a polymerase chain reaction (PCR) assay targeting to the DPV UL2 gene for simultaneous detection of DPV virulent strain and attenuated strain, 827bp for virulent strain and 299bp for attenuated strain. This newly developed PCR for DPV was highly sensitive and specific. It detected as low as 100fg of DNA on both DPV virulent and attenuated strains, no same size bands were amplified from other duck viruses including duck paramyxovirus, duck tembusu virus, duck circovirus, Muscovy duck parvovirus, duck hepatitis virus type I, avian influenza virus and gosling plague virus. Therefore, this PCR assay can be used for the rapid, sensitive and specific detection of DPV virulent and attenuated strains affecting ducks. Copyright © 2017. Published by Elsevier B.V.
Lily; Siregar, Y.; Ilyas, S.
2018-03-01
This study purposed to describe the product Polymerase Chain Reaction (PCR) and sequencing of DNA Mycobacterium (M.) tuberculosis from sputum of tuberculosis (TB) patients in Medan. Sputum was collected from patients that diagnosed with pulmonary TB by a physician. Specimen processed by PCR method of Li et al. and sequencing at Macrogen Laboratory. All of 12 product PCR were showed brightness bands at 126 base pair (bp). These results indicated similarity to the study of Li et al. Sequencing analysis showed the presence of a mutation and non-mutation groups of M. tuberculosis. The reference and outcome berange of the mutation and non-mutation of M. tuberculosis were 56-107, 59-85, 60-120 and 63-94, respectively. The percentage bp difference between the outcome and references for mutation and non-mutation were 3.448-6.569and 3.278-7.428%, respectively. In conclusion, the successful amplification of PCR products in a 1.5% agarose gel electrophoresis where all 12 sputa contained rpoB-positive M. tuberculosis and 0.644% difference was found between the outcome with reference bp of the mutation and non-mutation M. tuberculosis groups.
Sanyal, Sudip; Siriwardena, Ajith K; Byers, Richard
2018-06-01
The aim of this study is to compare gene expression profiles in RNA isolated from pancreatic ductal juice with the RNA expression profiles of the same genes from matched intra-operative tissue samples from pancreatic tumours. Intra-operative sampling of pancreatic juice and collection of matched tissue samples was undertaken in patients undergoing pancreatoduodenectomy for clinically suspected pancreatic cancer and a precursor lesion, main-duct intraductal papillary mucinous neoplasm. RNA was isolated and Poly A PCR was used to globally amplify the RNA. Real-time polymerase chain reaction (RT-PCR) was used to measure expression levels of 17 genes selected from microarray studies. Spearman's rank correlation test was used to examine the relationship of gene expression between pancreatic juice and tissue. The study was approved by Regional Ethics Committee. Mesothelin (MSLN) showed significant correlation (p cDNA using poly A PCR is technically feasible. Application of the technique to non-invasively obtained pancreatic juice during endoscopic assessment of tumours and the use of gene arrays of cancer indicator genes are the next steps in development of this technique. Copyright © 2018 IAP and EPC. Published by Elsevier B.V. All rights reserved.
Xu, Yao; Zheng, Zhi
2016-05-15
We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Jovanovic, Jelena V. [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom); Rennie, Kristian [GSTS Pathology, Guy’s Hospital, London (United Kingdom); Culligan, Dominic [Department of Haematology, Aberdeen Royal Infirmary, Aberdeen (United Kingdom); Peniket, Andrew [Department of Haematology, John Radcliffe Hospital, Oxford (United Kingdom); Lennard, Anne [Department of Haematology, Royal Victoria Infirmary, Newcastle (United Kingdom); Harrison, Justin [Department of Haematology, Hemel Hempstead Hospital, Hemel Hempstead (United Kingdom); Vyas, Paresh [Medical Research Council Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, Oxford (United Kingdom); Grimwade, David, E-mail: david.grimwade@genetics.kcl.ac.uk [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom)
2011-10-25
Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10{sup 4}−10{sup 5}. Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.
International Nuclear Information System (INIS)
Jovanovic, Jelena V.; Rennie, Kristian; Culligan, Dominic; Peniket, Andrew; Lennard, Anne; Harrison, Justin; Vyas, Paresh; Grimwade, David
2011-01-01
Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10 4 −10 5 . Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.
Directory of Open Access Journals (Sweden)
Sundaran S. Tinky
2015-04-01
Full Text Available Aim: The present study was undertaken to detect the presence of canine parvovirus (CPV in fecal samples of diarrheic dogs by conventional polymerase chain reaction (PCR and immunochromatographic (IC strip test and to compare the diagnostic potential of these tests. Materials and Methods: A total of 50 fecal samples collected from diarrheic dogs suspected for CPV infection were subjected to PCR using CPV-555 primer amplifying the gene coding for the VP1 protein. These samples were also tested by IC strip test using a commercial rapid Ag test kit. The results were statistically analyzed using McNemar test. Results: A total of 22 samples (44% were detected as positive by PCR, which yielded a specific amplicon of 583 bp. In IC strip test, 18 (36% samples were found to be positive. The sensitivity of the test as compared to PCR was found to be 72.22% and specificity was 92.86%. Positive predictive value and negative predictive value of IC strip test was found to be 88.89% and 81.25%, respectively. Statistical analysis of the results of PCR and IC assay using McNemar test revealed no significant difference (p>0.05. Conclusion: The IC strip test could be employed as a rapid field level diagnostic tool for the diagnosis of canine parvoviral diarrhea.
Mirsadraee, Majid; Shafahie, Ahmad; Reza Khakzad, Mohammad; Sankian, Mojtaba
2014-04-01
Anthracofibrosis is the black discoloration of the bronchial mucosa with deformity and obstruction. Association of this disease with tuberculosis (TB) was approved. The objective of this study was to find the additional benefit of assessment of TB by the polymerase chain reaction (PCR) method. Bronchoscopy was performed on 103 subjects (54 anthracofibrosis and 49 control subjects) who required bronchoscopy for their pulmonary problems. According to bronchoscopic findings, participants were classified to anthracofibrosis and nonanthracotic groups. They were examined for TB with traditional methods such as direct smear (Ziehl-Neelsen staining), Löwenstein-Jensen culture, and histopathology and the new method "PCR" for Mycobacterium tuberculosis genome (IS6110). Age, sex, smoking, and clinical findings were not significantly different in the TB and the non-TB groups. Acid-fast bacilli could be detected by a direct smear in 12 (25%) of the anthracofibrosis subjects, and adding the results of culture and histopathology traditional tests indicated TB in 27 (31%) of the cases. Mycobacterium tuberculosis was diagnosed by PCR in 18 (33%) patients, but the difference was not significant. Detection of acid-fast bacilli in control nonanthracosis subjects was significantly lower (3, 6%), but PCR (20, 40%) and accumulation of results from all traditional methods (22, 44%) showed a nonsignificant difference. The PCR method showed a result equal to traditional methods including accumulation of smear, culture, and histopathology.
Soejima, Mikiko; Tsuchiya, Yuji; Egashira, Kouichi; Kawano, Hiroyuki; Sagawa, Kimitaka; Koda, Yoshiro
2010-06-01
Anhaptoglobinemic patients run the risk of severe anaphylactic transfusion reaction because they produce serum haptoglobin (Hp) antibodies. Being homozygous for the Hp gene deletion (HP(del)) is the only known cause of congenital anhaptoglobinemia, and clinical diagnosis of HP(del) before transfusion is important to prevent anaphylactic shock. We recently developed a 5'-nuclease (TaqMan) real-time polymerase chain reaction (PCR) method. A SYBR Green I-based duplex real-time PCR assay using two forward primers and a common reverse primer followed by melting curve analysis was developed to determine HP(del) zygosity in a single tube. In addition, to obviate initial DNA extraction, we examined serially diluted blood samples as PCR templates. Allelic discrimination of HP(del) yielded optimal results at blood sample dilutions of 1:64 to 1:1024. The results from 2231 blood samples were fully concordant with those obtained by the TaqMan-based real-time PCR method. The detection rate of the HP(del) allele by the SYBR Green I-based method is comparable with that using the TaqMan-based method. This method is readily applicable due to its low initial cost and analyzability using economical real-time PCR machines and is suitable for high-throughput analysis as an alternative method for allelic discrimination of HP(del).
Stepwise kinetic equilibrium models of quantitative polymerase chain reaction
Directory of Open Access Journals (Sweden)
Cobbs Gary
2012-08-01
Full Text Available Abstract Background Numerous models for use in interpreting quantitative PCR (qPCR data are present in recent literature. The most commonly used models assume the amplification in qPCR is exponential and fit an exponential model with a constant rate of increase to a select part of the curve. Kinetic theory may be used to model the annealing phase and does not assume constant efficiency of amplification. Mechanistic models describing the annealing phase with kinetic theory offer the most potential for accurate interpretation of qPCR data. Even so, they have not been thoroughly investigated and are rarely used for interpretation of qPCR data. New results for kinetic modeling of qPCR are presented. Results Two models are presented in which the efficiency of amplification is based on equilibrium solutions for the annealing phase of the qPCR process. Model 1 assumes annealing of complementary targets strands and annealing of target and primers are both reversible reactions and reach a dynamic equilibrium. Model 2 assumes all annealing reactions are nonreversible and equilibrium is static. Both models include the effect of primer concentration during the annealing phase. Analytic formulae are given for the equilibrium values of all single and double stranded molecules at the end of the annealing step. The equilibrium values are then used in a stepwise method to describe the whole qPCR process. Rate constants of kinetic models are the same for solutions that are identical except for possibly having different initial target concentrations. Analysis of qPCR curves from such solutions are thus analyzed by simultaneous non-linear curve fitting with the same rate constant values applying to all curves and each curve having a unique value for initial target concentration. The models were fit to two data sets for which the true initial target concentrations are known. Both models give better fit to observed qPCR data than other kinetic models present in the
Stepwise kinetic equilibrium models of quantitative polymerase chain reaction.
Cobbs, Gary
2012-08-16
Numerous models for use in interpreting quantitative PCR (qPCR) data are present in recent literature. The most commonly used models assume the amplification in qPCR is exponential and fit an exponential model with a constant rate of increase to a select part of the curve. Kinetic theory may be used to model the annealing phase and does not assume constant efficiency of amplification. Mechanistic models describing the annealing phase with kinetic theory offer the most potential for accurate interpretation of qPCR data. Even so, they have not been thoroughly investigated and are rarely used for interpretation of qPCR data. New results for kinetic modeling of qPCR are presented. Two models are presented in which the efficiency of amplification is based on equilibrium solutions for the annealing phase of the qPCR process. Model 1 assumes annealing of complementary targets strands and annealing of target and primers are both reversible reactions and reach a dynamic equilibrium. Model 2 assumes all annealing reactions are nonreversible and equilibrium is static. Both models include the effect of primer concentration during the annealing phase. Analytic formulae are given for the equilibrium values of all single and double stranded molecules at the end of the annealing step. The equilibrium values are then used in a stepwise method to describe the whole qPCR process. Rate constants of kinetic models are the same for solutions that are identical except for possibly having different initial target concentrations. Analysis of qPCR curves from such solutions are thus analyzed by simultaneous non-linear curve fitting with the same rate constant values applying to all curves and each curve having a unique value for initial target concentration. The models were fit to two data sets for which the true initial target concentrations are known. Both models give better fit to observed qPCR data than other kinetic models present in the literature. They also give better estimates of
Brucella contamination in raw milk by polymerase chain reaction
Directory of Open Access Journals (Sweden)
Mohammad Khalili
2016-10-01
Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. Brucella organisms, which are small aerobic, facultative intracellular coccobacilli, localize in the reproductive organs of host animals, causing abortions and sterility. They are shed in large numbers in the animal’s urine, milk, placental fluid, and other fluids. Dairy product from raw milk are a potential threat to public health in endemic developing countries. The gold standard for the diagnosis of brucellosis is isolation of Brucella species. However, isolation Brucella species is time consuming and needed to level 3 biocontainment facilities and highly skilled technical personnel to handle samples and live bacteria for eventual identification. Handling Brucella species increase risk of laboratory infection. Polymerase chain reaction (PCR with high sensitivity and specifity overcomed to these disadvantages. The aim of this study was to detect Brucella species in milk from dairy cattle farms in Kerman province, Iran by PCR technique. Methods: Forty and eight bulk tank milk (BTM were collected from October 2015 to March 2016 from 48 dairy cattle farm including 4200 cows. DNA of milk samples extracted by lysis buffer and proteinase K method. All milk samples were examined by PCR to detect Brucella-specific DNA targeting IS 711. Positive samples must be showed 317 bp amplified, corresponding to the expected size of the IS 711 genome region in all Brucella species. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp. from 48 BTM samples in this area. Conclusion: The results indicate that brucellosis by Brucella species is endemic in the Kerman province dairy farms. Consumption of raw milk dairy products by individual farmers operating under poor hygienic conditions represents an high risk to public health. The need for implementing control measures and raising public awareness on zoonotic transmission of
Directory of Open Access Journals (Sweden)
Rahul Singh
2017-11-01
Full Text Available Aim: The small ruminant lentiviruses are known to cause maedi-visna (MV and caprine arthritis - encephalitis in sheep and goats, typically affecting joints, udder, lungs, and the central nervous system. The diagnosis usually involves serology, clinical signs, immunohistochemistry, and polymerase chain reaction (PCR. In the present study, the histopathologically positive pneumonia cases of MV were confirmed by PCR in lung tissue probably for the first time in India. Materials and Methods: A total of 888 lungs of adult sheep, aged between 2 and 5 years, were screened during slaughter, of which 121 were found to have pneumonic lesions. The tissues from each pneumonic lung including associated lymph nodes were collected in 10% neutral buffered formalin for histopathology. The frozen tissues of the same were also collected and stored at -20°C for PCR confirmation. Results: Three of 121 cases of pneumonic lungs of sheep revealed gross and histopathological lesions suggestive of maedi or ovine progressive pneumonia infection. These 3 cases were further confirmed by PCR technique that amplified 291-base pair DNA in the long terminal repeat sequence of MV provirus. Conclusion: This study suggests the low occurrence of MV virus (MVV infection in India in naturally affected sheep based on pathomorphological lesions and using the molecular tool of PCR detection of the virus in tissues. Further, a combination of pathomorphology or/and PCR testing might be optimal for detecting the animals infected with MVV.
Singh, Rahul; Kumar, Pawan; Singh, Rajendra; Dhama, Kuldeep; Kumari, Swati; Yadav, Jay Prakash; Kashyap, Gayatri; Singh, Karam Pal; Singh, Vidya; Sahoo, Monalisa
2017-01-01
Aim: The small ruminant lentiviruses are known to cause maedi-visna (MV) and caprine arthritis - encephalitis in sheep and goats, typically affecting joints, udder, lungs, and the central nervous system. The diagnosis usually involves serology, clinical signs, immunohistochemistry, and polymerase chain reaction (PCR). In the present study, the histopathologically positive pneumonia cases of MV were confirmed by PCR in lung tissue probably for the first time in India. Materials and Methods: A total of 888 lungs of adult sheep, aged between 2 and 5 years, were screened during slaughter, of which 121 were found to have pneumonic lesions. The tissues from each pneumonic lung including associated lymph nodes were collected in 10% neutral buffered formalin for histopathology. The frozen tissues of the same were also collected and stored at −20°C for PCR confirmation. Results: Three of 121 cases of pneumonic lungs of sheep revealed gross and histopathological lesions suggestive of maedi or ovine progressive pneumonia infection. These 3 cases were further confirmed by PCR technique that amplified 291-base pair DNA in the long terminal repeat sequence of MV provirus. Conclusion: This study suggests the low occurrence of MV virus (MVV) infection in India in naturally affected sheep based on pathomorphological lesions and using the molecular tool of PCR detection of the virus in tissues. Further, a combination of pathomorphology or/and PCR testing might be optimal for detecting the animals infected with MVV. PMID:29263606
Wei, Jiaojun; Li, Feiwu; Guo, Jinchao; Li, Xiang; Xu, Junfeng; Wu, Gang; Zhang, Dabing; Yang, Litao
2013-11-27
The papaya (Carica papaya L.) Chymopapain (CHY) gene has been reported as a suitable endogenous reference gene for genetically modified (GM) papaya detection in previous studies. Herein, we further validated the use of the CHY gene and its qualitative and quantitative polymerase chain reaction (PCR) assays through an interlaboratory collaborative ring trial. A total of 12 laboratories working on detection of genetically modified organisms participated in the ring trial and returned test results. Statistical analysis of the returned results confirmed the species specificity, low heterogeneity, and single-copy number of the CHY gene among different papaya varieties. The limit of detection of the CHY qualitative PCR assay was 0.1%, while the limit of quantification of the quantitative PCR assay was ∼25 copies of haploid papaya genome with acceptable PCR efficiency and linearity. The differences between the tested and true values of papaya content in 10 blind samples ranged from 0.84 to 6.58%. These results indicated that the CHY gene was suitable as an endogenous reference gene for the identification and quantification of GM papaya.
Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A
2017-03-10
Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.
Johnston, Stephen; Gallaher, Zachary; Czaja, Krzysztof
2012-05-15
Quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is widely used to investigate transcriptional changes following experimental manipulations to the nervous system. Despite the widespread utilization of qPCR, the interpretation of results is marred by the lack of a suitable reference gene due to the dynamic nature of endogenous transcription. To address this inherent deficiency, we investigated the use of an exogenous spike-in mRNA, luciferase, as an internal reference gene for the 2(-∆∆Ct) normalization method. To induce dynamic transcription, we systemically administered capsaicin, a neurotoxin selective for C-type sensory neurons expressing the TRPV-1 receptor, to adult male Sprague-Dawley rats. We later isolated nodose ganglia for qPCR analysis with the reference being either exogenous luciferase mRNA or the commonly used endogenous reference β-III tubulin. The exogenous luciferase mRNA reference clearly demonstrated the dynamic expression of the endogenous reference. Furthermore, variability of the endogenous reference would lead to misinterpretation of other genes of interest. In conclusion, traditional reference genes are often unstable under physiologically normal situations, and certainly unstable following the damage to the nervous system. The use of exogenous spike-in reference provides a consistent and easily implemented alternative for the analysis of qPCR data.
Lee, Adria D; Cassiday, Pamela K; Pawloski, Lucia C; Tatti, Kathleen M; Martin, Monte D; Briere, Elizabeth C; Tondella, M Lucia; Martin, Stacey W
2018-01-01
The appropriate use of clinically accurate diagnostic tests is essential for the detection of pertussis, a poorly controlled vaccine-preventable disease. The purpose of this study was to estimate the sensitivity and specificity of different diagnostic criteria including culture, multi-target polymerase chain reaction (PCR), anti-pertussis toxin IgG (IgG-PT) serology, and the use of a clinical case definition. An additional objective was to describe the optimal timing of specimen collection for the various tests. Clinical specimens were collected from patients with cough illness at seven locations across the United States between 2007 and 2011. Nasopharyngeal and blood specimens were collected from each patient during the enrollment visit. Patients who had been coughing for ≤ 2 weeks were asked to return in 2-4 weeks for collection of a second, convalescent blood specimen. Sensitivity and specificity of each diagnostic test were estimated using three methods-pertussis culture as the "gold standard," composite reference standard analysis (CRS), and latent class analysis (LCA). Overall, 868 patients were enrolled and 13.6% were B. pertussis positive by at least one diagnostic test. In a sample of 545 participants with non-missing data on all four diagnostic criteria, culture was 64.0% sensitive, PCR was 90.6% sensitive, and both were 100% specific by LCA. CRS and LCA methods increased the sensitivity estimates for convalescent serology and the clinical case definition over the culture-based estimates. Culture and PCR were most sensitive when performed during the first two weeks of cough; serology was optimally sensitive after the second week of cough. Timing of specimen collection in relation to onset of illness should be considered when ordering diagnostic tests for pertussis. Consideration should be given to including IgG-PT serology as a confirmatory test in the Council of State and Territorial Epidemiologists (CSTE) case definition for pertussis.
International Nuclear Information System (INIS)
Lina, M.; Dadang, S.; Suhadi, F.
2002-01-01
Research for detecting the presence of HBV DNA in serum with PCR technique by using two pairs of oligonucleotide primers, has been carried out. Ten serum consisted of 5 HBsAg positive serum, I HBsAg weak positive serum, 3 HBsAg negative serum, and I sampel with negative HBV DNA as a previous PCR product trom another laboratory, were used to purify and to extract the DNA of virus, the sample pretreatment was done with Boom method. The two pairs of primers used for the- PCR process, were PC1 and PC2 and P1 and P2. The amplification process by means of PC1 and PC2 primer was carried out with two treatments, l.a. and l.b treatments of 5 HBsAg positive serum samples, 3 were positive for HBV DNA by PCR test with l.a. treatment. The PCR test by means of either the same primer but different treaunent (l.b treatment) or different pair of primer (pI and P2 pimer), revealed the presence of HBV DNA in all of HBsAg serum mentioned above of HBsAg negative Seruln, I serum was positive for HBV DNA and it was an amplification product of PCR test by using PI and P2 primer. The amplification products of PCR processwith either l.b treatment or PI and P2 primer, showed the positive results for I HBV positive serum as a previous PCR product trom another laboratory. All of the PCR test in this research provided the negative HBV DNA result in the HBsAg weak positive serum. The DNA amplification process by means of PI and P2 primer was more sensitive compared with PC I and PC2 primer
International Nuclear Information System (INIS)
Khan, S. A.; Ahmed, S.; Khan, F. A.; Shamshad, G. U.; Joyia, Z.; Mushahid, N.; Saeed, S.
2013-01-01
Objective: To determine the sensitivity of a real time polymerase chain reaction (PCR) for malaria diagnosis and to compare its accuracy with microscopy and an antigen based rapid diagnostic test (OptiMal). Study Design: Cross-sectional analytical study. Place and Duration of Study: Military Hospital, Armed Forces Institute of Transfusion and Armed Forces Institute of Pathology, Rawalpindi, from July to December 2011. Methodology: Venous blood samples of 300 clinically suspected patients of malaria were tested for malaria parasite by microscopy and OptiMal; and malaria parasite index was calculated for the positive samples. Plasmodium genus specific real time PCR was performed on all specimens, targeting small subunit rRNA gene. Diagnostic accuracy of three tests was compared and cost analysis was done. Results: Out of 300 patients, malaria parasite was detected in 110, 106 and 123 patients by microscopy, OptiMAL and PCR respectively. Real time PCR was 100% sensitive while microscopy and OptiMal had sensitivity of 89.4% and 86.2% respectively. All methods were 100% specific. The cost per test was calculated to be 0.2, 2.75 and 3.30 US dollar by microscopy, OptiMal and PCR respectively, excluding the once capital cost on PCR equipment. Conclusion: Genus specific real time PCR for the diagnosis of malaria was successfully established as a highly sensitive and affordable technology that should be incorporated in the diagnostic algorithm in this country. (author)
DEFF Research Database (Denmark)
Høie, S.; Dalsgaard, Inger; Aase, I.L.
1999-01-01
. salmonicida subsp. salmonicida isolates tested, belonged to group 1. The PCR primer-sets separated A. salmonicida from other reference strains of Aeromonas species and related bacteria with the exception of Aeromonas hydrophila. The results indicated that PCR typing is a useful framework for characterization...
Kolm, Claudia; Martzy, Roland; Brunner, Kurt; Mach, Robert L; Krska, Rudolf; Heinze, Georg; Sommer, Regina; Reischer, Georg H; Farnleitner, Andreas H
2017-06-20
We report a novel molecular assay, based on helicase-dependent amplification (HDA), for the detection of enterococci as markers for fecal pollution in water. This isothermal assay targets the same Enterococcus 23S rRNA gene region as the existing quantitative polymerase chain reaction (qPCR) assays of U.S. Environmental Protection Agency Methods 1611 and 1609 but can be entirely performed on a simple heating block. The developed Enterococcus HDA assay successfully discriminated 15 enterococcal from 15 non-enterococcal reference strains and reliably detected 48 environmental isolates of enterococci. The limit of detection was 25 target copies per reaction, only 3 times higher than that of qPCR. The applicability of the assay was tested on 30 environmental water sample DNA extracts, simulating a gradient of fecal pollution. Despite the isothermal nature of the reaction, the HDA results were consistent with those of the qPCR reference. Given this performance, we conclude that the developed Enterococcus HDA assay has great potential as a qualitative molecular screening method for resource-limited settings when combined with compatible up- and downstream processes. This amplification strategy can pave the way for developing a new generation of rapid, low-cost, and field-deployable molecular diagnostic tools for water quality monitoring.
International Nuclear Information System (INIS)
Balogh, Brian.
1991-01-01
Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)
Alarcón, Gonzalo; Barraza, Gabriela; Vera, Andrea; Wozniak, Aniela; García, Patricia
2016-02-01
Trichomonas vaginalis, Mycoplasma hominis and Ureaplasma spp. are microorganisms responsible for genitourinary and pregnancy pathologies. Nucleic acid amplification methods have shown several advantages, but have not been widely studied for the detection of these microorganisms. To implement a conventional polymerase chain reaction (PCR) for the detection of the microorganisms and to compare its results versus the methods currently used at our laboratory. 91 available samples were processed by PCR, culture (M. hominis y Ureaplasma spp.) and wet mount (T vaginalis). Results were compared and statistically analyzed by kappa agreement test. 85, 80 and 87 samples resulted in agreement for the detection of M. hominis, Ureaplasma spp. y T. vaginalis, respectively. For M. hominis and Ureaplasma spp., agreement was substantial, whereas for T. vaginalis it was moderate, however, for the latter, PCR detected more cases than wet mount. We recommend the implementation of PCR for detection of T. vaginalis whereas culture kit is still a useful method for the other microorganisms.
Ross, Shannon A; Ahmed, Amina; Palmer, April L; Michaels, Marian G; Sánchez, Pablo J; Stewart, Audra; Bernstein, David I; Feja, Kristina; Fowler, Karen B; Boppana, Suresh B
2017-05-01
To determine the utility of dried blood spot (DBS) polymerase chain reaction (PCR) in identifying infants with cytomegalovirus (CMV) infection-associated sensorineural hearing loss (SNHL). Newborns at 7 US hospitals between March 2007 and March 2012 were screened for CMV by saliva rapid culture and/or PCR. Infected infants were monitored for SNHL during the first 4 years of life to determine sensitivity, specificity, and positive and negative likelihood ratios of DBS PCR for identifying CMV-associated SNHL. DBS at birth was positive in 11 of 26 children (42%) with SNHL at age 4 years and in 72 of 270 children (27%) with normal hearing (P = .11). The sensitivity (42.3%; 95% CI, 23.4%-63.1%) and specificity (73.3%; 95% CI, 67.6%-78.5%) was low for DBS PCR in identifying children with SNHL at age 4 years. The positive and negative likelihood ratios of DBS PCR positivity to detect CMV-associated SNHL at age 4 years were 1.6 (95% CI, 0.97-2.6) and 0.8 (95% CI, 0.6-1.1), respectively. There was no difference in DBS viral loads between children with SNHL and those without SNHL. DBS PCR for CMV has low sensitivity and specificity for identifying infants with CMV-associated hearing loss. These findings, together with previous reports, demonstrate that DBS PCR does not identify either the majority of CMV-infected newborns or those with CMV-associated SNHL early in life. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Tak, Yu Kyung; Kim, Won Young; Kim, Min Jung; Han, Eunyoung; Han, Myun Soo; Kim, Jong Jin; Kim, Wook; Lee, Jong Eun; Song, Joon Myong
2012-01-01
Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.
Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H
2007-03-01
A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.
Directory of Open Access Journals (Sweden)
Saroj K. Dangi
2014-10-01
Full Text Available Aim: The present study was aimed at polymerase chain reaction (PCR amplification and cloning of NAD-dependent betahydroxybutyryl coenzyme A dehydrogenase (BHBD gene of Clostridium chauvoei. Materials and Methods: C. chauvoei was cultured and confirmed by 16-23S rDNA spacer region primers. The primers for nad-bhbd gene of C. chauvoei were designed to aid in cloning into pRham-N-His SUMO-Kan vector, and nad-bhbd gene was amplified by PCR. The amplified nad-bhbd gene was purified and cloned into pRham-N-His SUMO-Kan expression vector. The recombinant plasmid was transformed into E. cloni 10 G cells and the clone was confirmed by colony PCR using the pRham-SUMO-NAD-For and pRham-SUMO-NAD-Rev primers and also by sequencing. Results: PCR amplification of nad-bhbd gene yielded a product length of 844 base pairs which was cloned into pRham-NHis SUMO-Kan vector followed by transformation into E. cloni 10G chemically competent cells. The recombinant clones were characterized by colony PCR, sequencing, followed by basic local alignment search tool (BLAST analysis to confirm the insert. Conclusions: Immunogenic protein NAD- dependent BHBD of C. chauvoei was cloned and the recombinant clones were confirmed by colony PCR and sequencing analysis.
Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis
Directory of Open Access Journals (Sweden)
Shoughy SS
2015-12-01
Full Text Available Samir S Shoughy,1 Hind M Alkatan,2,4 Abdulelah A Al-Abdullah,2 Albarah El-Khani,2 Jolanda DF de Groot-Mijnes,3 Khalid F Tabbara1,4,5 1Department of Ophthalmology, The Eye Center and The Eye Foundation for Research in Ophthalmology, 2Department of Pathology & Laboratory Medicine and Uveitis Division, King Khaled Eye Specialist Hospital, Riyadh, Saudi Arabia; 3Department of Virology and Ophthalmology, University Medical Center Utrecht, Utrecht, the Netherlands; 4Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 5The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USA Background and objectives: Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis.Patients and methods: A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein–Barr virus, and rubella virus.Results: There were six male and six female patients. The mean age was 43 years, with an age range of 11–82 years. All 12 cases presented with unilateral anterior uveitis. In four (33% patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein–Barr virus.Conclusion: Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis. Keywords: viral anterior uveitis, PCR, herpes simplex virus, cytomegalovirus, diffuse keratic precipitates, anterior chamber
Wu, Wenming; Trinh, Kieu The Loan; Lee, Nae Yoon
2015-03-07
We introduce a new strategy for fabricating a seamless three-dimensional (3D) helical microreactor utilizing a silicone tube and a paraffin mold. With this method, various shapes and sizes of 3D helical microreactors were fabricated, and a complicated and laborious photolithographic process, or 3D printing, was eliminated. With dramatically enhanced portability at a significantly reduced fabrication cost, such a device can be considered to be the simplest microreactor, developed to date, for performing the flow-through polymerase chain reaction (PCR).
MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS
Wigner, E.P.; Weinberg, A.M.
1961-01-24
A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)
Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario
2010-06-01
Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.
Chase, D.M.; Pascho, R.J.
1998-01-01
Nucleic acid-based assays have shown promise for diagnosing Renibacterium salmoninarum in tissues and body fluids of salmonids. DeVelopment of a nested polymerase chain reaction (PCR) method to detect a 320 bp DNA segment of the gene encoding the p57 protein of R. salmoninarum is described. Whereas a conventional PCR for a 383 bp segment of the p57 gene reliably detected 1000 R. salmoninarum cells per reaction in kidney tissue, the nested PCR detected as few as 10 R. salmoninarum per reaction in kidney tissue. Two DNA extraction methods for the nested PCR were compared and the correlation between replicate samples was generally higher in samples extracted by the QIAamp system compared with those extracted by the phenol/chloroform method. The specificity of the nested PCR was confirmed by testing DNA extracts of common bacterial fish pathogens and a panel of bacterial species reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA) and the fluorescent antibody test (FAT) for R. salmoninarum. Kidney samples from 74 naturally infected chinook Salmon were examined by the nested PCR, the ELISA, and the FAT, and the detected prevalences of R. salmoninarum were 61, 47, and 43%, respectively.
Results of Multiplex Polymerase Chain Reaction Assay to Identify Urethritis Pathogens
Directory of Open Access Journals (Sweden)
Mehmet Sarıer
2017-03-01
Full Text Available Objective: The purpose of this study was to evaluate the results of multiplex polymerase chain reaction (PCR test applied to identify the pathogens in male patients who attended our urology clinic with a pre-diagnosis of urethritis related with sexual intercourse. Materials and Methods: In this study, we included a total of 91 male patients, who sought medical advice in our clinic between August 2015 and October 2016 due to complaints of urethral discharge, dysuria and urethral itching, having a visible urethral discharge during the physical examination or a positive leukocyte esterase test (Combur-Test®-Roche in the first urine sample. In the urethral swab samples of these patients, urethritis pathogens were searched with a multiplex PCR test. The multiplex PCR kit, which is able to identify nine pathogens and produced by PathoFinder® (Holland, was used in the process. The pathogens that could be detected by the kit were Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis, Mycoplasma genitalium, Ureaplasma urealyticum, Gardnerella vaginalis, Trichomonas vaginalis, Treponema pallidum, and Candida albicans. Results: The average age of the subjects was 35.1 (19-57 years. Sixty one out of 91 patients (67% were found to have a pathogen in the urethral swab sample. In 45 patients (49.4%, only one pathogen, in 12 (13.1% - two different pathogens and in 4 (4.3% patients, 3 different pathogens were detected. The pathogens found were as follows: Ureaplasma urealyticum in 22 patients (27.1%, Gardnerella vaginalis in 15 (18.6%, Neisseria gonorrhoeae in 13 (16.1%, Mycoplasma genitalium (10 patients; 12.3%, Mycoplasma hominis (8 patients; 9.9%, Chlamydia trachomatis (8 patients; 9.9%, Trichomonas vaginalis (3 patients; 3.8%, and Candida albicans (2 patients; 2.4%. None of the patients were identified with Treponema pallidum. None of the pathogens were identified in 30 patients (32.9% whose samples were examined by PCR method. Conclusion
Directory of Open Access Journals (Sweden)
Perkins James R
2012-07-01
Full Text Available Abstract Background Measuring gene transcription using real-time reverse transcription polymerase chain reaction (RT-qPCR technology is a mainstay of molecular biology. Technologies now exist to measure the abundance of many transcripts in parallel. The selection of the optimal reference gene for the normalisation of this data is a recurring problem, and several algorithms have been developed in order to solve it. So far nothing in R exists to unite these methods, together with other functions to read in and normalise the data using the chosen reference gene(s. Results We have developed two R/Bioconductor packages, ReadqPCR and NormqPCR, intended for a user with some experience with high-throughput data analysis using R, who wishes to use R to analyse RT-qPCR data. We illustrate their potential use in a workflow analysing a generic RT-qPCR experiment, and apply this to a real dataset. Packages are available from http://www.bioconductor.org/packages/release/bioc/html/ReadqPCR.htmland http://www.bioconductor.org/packages/release/bioc/html/NormqPCR.html Conclusions These packages increase the repetoire of RT-qPCR analysis tools available to the R user and allow them to (amongst other things read their data into R, hold it in an ExpressionSet compatible R object, choose appropriate reference genes, normalise the data and look for differential expression between samples.
Five years' experience of classical swine fever polymerase chain reaction ring trials in France.
Po, F; Le Dimna, M; Le Potier, M F
2011-12-01
Since 2004, the French National Reference Laboratory for classical swine fever (CSF) has conducted an annual proficiency test (PT) to evaluate the ability of local veterinary laboratories to perform real-time polymerase chain reaction (PCR) for CSF virus. The results of five years of testing (2004-2008) are described here. The PT was conducted under blind conditions on 20 samples. The same batch of samples was used for all five years. The number of laboratories that analysed the samples increased from four in 2004 to 13 in 2008. The results of the PT showed the following: cross-contamination between samples and deficiencies in RNA preparation can occur even in experienced laboratories; sample homogeneity should be checked carefully before selection; samples stored at-80 degrees C for several years remain stable; and poor shipment conditions do not damage the samples with regard to detection of CSF virus genome. These results will enable redesign of the panel to improve the overall quality of the PT, which will encourage laboratories to check and improve their PCR procedures and expertise. This is an excellent way to determine laboratory performance.
Directory of Open Access Journals (Sweden)
Zeinab Abiri
2016-02-01
Full Text Available Background: Coxiella burnetii is an important intracellular pathogen that ruminants can act as primary reservoirs. Reservoirs may excrete the bacterium into the placenta, vaginal mucus and feces. Objectives: The aim of this study was to detect C. burnetii in aborted samples from ruminant flocks in Mashhad city, northeast of Iran, using the polymerase chain reaction (PCR assay. Materials and Methods: A total number of 154 fetal tissue samples of cattle, sheep and goat were subjected to nested PCR assay. Results: Sixteen (17.3% out of 92 samples from sheep and 15 (25% from 60 cattle fetuses were positive. Conclusions: The results of this study indicate the presence of C. burnetii in aborted ruminants and these can be the potential reservoirs of C. burnetii in the mentioned area.
Optimizing polymerase chain reaction testing for the diagnosis of pertussis: current perspectives
Directory of Open Access Journals (Sweden)
Arbefeville S
2015-09-01
Full Text Available Sophie Arbefeville, Patricia Ferrieri Department of Laboratory Medicine and Pathology, University of Minnesota Medical School, Minneapolis, MN, USA Abstract: Nucleic acid testing has revolutionized the diagnosis of pertussis in the clinical microbiology laboratory and has become the main avenue of testing for pertussis infection. Real-time polymerase chain reaction (RT-PCR is an important tool for timely diagnosis of pertussis and is more sensitive than culture. The most commonly amplified targets are the insertion-sequence (IS genes, which are found in multiple copies in the genome of Bordetella species. Some strains of Bordetella pertussis have more than 200 copies of IS481 in their genome. This high number of repeats allows RT-PCR assays to be very sensitive and makes nucleic acid testing two to three times more sensitive than culture. Despite these advantages, RT-PCR can give inaccurate results due to contamination or lack of specificity. Contamination can easily happen during specimen collection, DNA extraction, or nucleic acid amplification steps. To avoid contamination, laboratories need to have quality controls and good workflows in place. The poor specificity of the nucleic acid assays amplifying the IS genes is because they are found in various Bordetella species and, thus, not unique to a specific species. Bordetella holmesii, a more recently described Bordetella species found to be responsible for respiratory symptoms similar to pertussis in adolescents and adults, can be misidentified as B. pertussis in RT-PCR assays that amplify only the IS481 target. Use of multiple targets may improve specificity of RT-PCR assays for pertussis. In the past few years, the US Food and Drug Administration has cleared three commercial assays for the detection of B. pertussis in respiratory specimens. Several commercial assays and analyte-specific reagents, which are not US Food and Drug Administration cleared, are available for the detection of one
International Nuclear Information System (INIS)
Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.
1994-01-01
A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma gene using histological sections from radiation-induced and spontaneous tumors as the DNA source. Six mouse Rb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mouse Rb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (5.69 Gy 60 Co γ rays or 0.6 Gy JANUS neutrons, which have been found to have approximately equal radiobiological effectiveness) were analyzed for mouse Rb deletions. Tumors in 6 neutron-irradiated mice had no mouse Rb deletions. However, 1 of 6 tumors from γ-irradiated mice (17%) and 6 of 18 spontaneous tumors from unirradiated mice (33%) showed a deletion in one or both mouse Rb alleles. All deletions detected were in the 5' region of the mouse Rb gene. 36 refs., 2 figs., 2 tabs
Directory of Open Access Journals (Sweden)
Maria Cesarina Abete
2013-04-01
Full Text Available Lifting of the ban on the use of processed animal proteins (PAPs from non-ruminants in non-ruminant feed is in the wind, avoiding intraspecies recycling. Discrimination of species will be performed through polymerase chain reaction (PCR, which is at a moment a merely qualitative method. Nevertheless, quantification of PAPs in feed is needed. The aim of this study was to approach the quantitative determination of PAPs in feed through Real Time (RT-PCR technique; three different protocols picked up from the literature were tested. Three different kind of matrices were examined: pure animal meals (bovine, chicken and pork; one feed sample certified by the European reference laboratory on animal proteins (EURL AP in feed spiked with 0.1% bovine meal; and genomic DNAs from bovine, chicken and pork muscles. The limit of detection (LOD of the three protocols was set up. All the results obtained from the three protocols considered failed in the quantification process, most likely due to the uncertain copy numbers of the analytical targets chosen. This preliminary study will allow us to address further investigations, with the purpose of developing a RT-PCR quantitative method.
Energy Technology Data Exchange (ETDEWEB)
Zhang, N.
1999-02-12
Genotyping is to detect specific loci in the human genome. These loci provide important information for forensic testing, construction of genetic linkage maps, gene related disease diagnosis and pharmacogenetic research. Genotyping is becoming more and more popular after these loci can be easily amplified by polymerase chain reaction (PCR). Capillary electrophoresis has its unique advantages for DNA analysis due to its fast heat dissipation and ease of automation. Four projects are described in which genotyping is performed by capillary electrophoresis emphasizing different aspects. First, the author demonstrates a principle to determine the genotype based on capillary electrophoresis system. VNTR polymorphism in the human D1S80 locus was studied. Second, the separation of four short tandem repeat (STR) loci vWF, THO1, TPOX and CSF1PO (CTTv) by using poly(ethylene oxide) (PEO) was studied in achieving high resolution and preventing rehybridization of the DNA fragments. Separation under denaturing, non-denaturing conditions and at elevated temperature was discussed. Third, a 250 {micro}m i.d., 365 {micro}m o.d. fused silica capillary was used as the microreactor for PCR. Fourth, direct PCR from blood was studied to simplify the sample preparation for genotyping to minimum.
International Nuclear Information System (INIS)
R, Maria Lina; S, Dadang; Suhadi, F.
2000-01-01
To detect to DNA of 9 drug-resistant isolates of m. tuberculosis such as isoniazid, streptomycin, isoniazid + streptomycin and isoniazid + rifampisin- resistant isolates, the DNA amplification by using PCR assay was carried out after lysing the bacterial cells. Two primer pairs for amplification used were Pt8 and Pt9 and Pt3 and Pt6. The amplified DNA taeget of 8 drug-resistant isolates and 1 drug-resistant isolate by means Pt8 8 Pt9 primer, gave the positive and negative result, respectively. Presence of amplified DNA target fragmens/bands on agarose gel, showed the positive result and vice verse. PCR process by using Pt3 and Pt6 primer revealed the positive results on 2 drug-resistant islates, whereas there was no amplified DNA bands from the other 7 isolates. DNA amplification by using either Pt8 and Pt9 or Pt3 and Pt6 primers occurred on H sub.37Rv strain DNA. Size of the amplified DNA products with Pt8 and Pt9 and Pt3 and Pt6 primers were 541 bp and 188 bp, respectively
Faggioli, F; Pasquini, G; Barba, M
1998-09-01
The diagnosis of plum pox virus (PPV) is still considered one of the most important aspects of the "sharka" problem. In fact, different studies demonstrated an uneven distribution of the virus in infected trees due to a high variability in virus concentration. These aspects complicate the PPV diagnosis. To date, biological, serological and molecular assays have been successively developed in order to obtain sensitive and efficient PPV detection techniques. In particular, the polymerase chain reaction (PCR) technique seems to be promising and can be considered the most sensitive and reliable one. Preparation of viral RNA is still a fundamental step in reverse transcription-PCR (RT-PCR) technique, especially when applied to large scale testing, i.e., for certification purposes. In order to find the most rapid and efficient procedure, we have compared three different procedures of extraction of viral RNA to be processed RT-PCR. Their common characteristics is their capacity to extract the RNA from a small amount of plant tissue without organic solvents in the extraction fluid. The procedures were as follows: an immuno-capture (IC) method using a specific antiserum, a silica-capture (SC) method using a non-specific matrix, and a simple and rapid RNA extraction (RE) method. They all were followed by one-tube RT-PCR. The obtained results show that all the three techniques allowed a successful amplification and detection of PPV in tested samples except the SC-PCR method which proved less effective. In fact, the IC-PCR and RE-PCR methods amplified and detected PPV in all isolates tested, while the SC-PCR method was able to reveal the presence of the virus in apricot and infected control samples only.
Chaya, Dr; Parija, Subhash Chandra
2014-01-01
Cystic echinococcosis (CE) is a chronic zoonosis which presents with variable clinical manifestations. Currently the diagnosis of this disease is based on radiological findings and serological tests which lack specificity. Although antigen detection from the cyst fluid is the most specific, it is seldom done due to the complications involved. Detecting the presence of Echinococcus granulosus specific deoxyribonucleic acid (DNA) by the polymerase chain reaction (PCR) could provide a definitive diagnosis of CE. An in-house PCR assay was devised to detect E. granulosus specific DNA in serum, urine and hydatid cyst fluid. The ability of the PCR to detect E. granulosus in the above mentioned samples were observed in comparison with other antigen and antibody detection tests. Serum samples from surgically confirmed patients of CE with ruptured cysts contained the corresponding DNA while the in the majority of cases who had an intact cyst had no DNA of E. granulosus in their serum. DNA of E. granulosus was not found to be excreted in urine. PCR performed equal to antigen detection ELISA while testing hydatid cyst fluid samples. Serum and urine might not serve as useful samples for the molecular diagnosis of cystic echinococcosis. However, PCR can be useful on serum samples to detect ruptured hydatid cysts and on hydatid cyst fluid to confirm the parasitic diagnosis.
Directory of Open Access Journals (Sweden)
Juthika Mandal
2014-09-01
Full Text Available Objective: To develop a multiplex polymerase chain reaction (PCR protocol for the simultaneous detection of Salmonella enterica serovar Typhi (S. Typhi and Class 1 integron, so as to aid rapid diagnosis of S. Typhi cases and help in the selection of treatment options based on the presence of the Class 1 integron that can carry resistance cassettes to a range of antibiotics. Methods: PCR for amplification of specific regions was done using fliC-d and intl primers and agarose gel electrophoresis was used for resolution of PCR products. Results: The fliC-d primer (S. Typhi specific amplified a 587 bp region and the intl primer (Class 1 integron specific amplified two bands approximately 500 and 550 bps. The developed method was specific for S. Typhi and did not amplify any products with Salmonella enterica serovar Typhimurium ATCC 14028, Salmonella enterica serovar Paratyphi and Escherichia coli O157:H7. Conclusions: The developed multiplex PCR protocol can be used for rapid diagnosis and aid in proper treatment strategies for patients infected with S. Typhi.
PCR detection of Bartonella spp. in the dog
Directory of Open Access Journals (Sweden)
Jarmila Konvalinová
2014-01-01
Full Text Available Our study aimed at using PCR to identify the incidence of Bartonella spp. in blood of dogs. Altogether 286 dogs of 92 breeds aged 3 month to 17 years were tested from October 2008 to December 2009. Healthy dogs as well as dogs with various clinical symptoms of disease were included in the group. Samples were tested by polymerase chain reaction (PCR specific for the presence of Bartonella spp. Following the DNA examination in 286 dogs by PCR and subsequent sequencing, two samples were identified as Bartonella henselae (0.7%. Other species of Bartonella were not found. It was the first time in the Czech Republic when incidence of Bartonella spp. was determined in dogs.
Peano, C; Lesignoli, F; Gulli, M; Corradini, R; Samson, M C; Marchelli, R; Marmiroli, N
2005-09-15
In the present study a peptide nucleic acid (PNA)-mediated polymerase chain reaction (PCR) clamping method was developed and applied to the detection of genetically modified organisms (GMO), to test PCR products for band identity and to obtain a semiquantitative evaluation of GMO content. The minimal concentration of PNA necessary to block the PCR was determined by comparing PCRs containing a constant amount of DNA in the presence of increasing concentration of target-specific PNA. The lowest PNA concentration at which specific inhibition took place, by the inhibition of primer extension and/or steric hindrance, was the most efficient condition. Optimization of PCR clamping by PNA was observed by testing five different PNAs with a minimum of 13 bp to a maximum of 15 bp, designed on the target sequence of Roundup Ready soybean. The results obtained on the DNA extracted from Roundup Ready soybean standard flour were verified also on DNA extracted from standard flours of maize GA21, Bt176, Bt11, and MON810. A correlation between the PNA concentration necessary for inducing PCR clamping and the percentage of the GMO target sequence in the sample was found.
Venema, K.; Maathuis, A.J.H.
2003-01-01
A polymerase chain reaction (PCR)-based method was developed for the identification of isolates of Bifidobacterium at the species level. Using two Bifidobacterium-specific primers directed against the 16S ribosomal gene (Bif164 and Bif662), a PCR product was obtained from the type strains of 12
Boujnan, Mohamed; Duits, Ashley J; Koppelman, Marco H G M
2018-03-01
Several countries have implemented safety strategies to reduce the risk of Zika virus (ZIKV) transmission through blood transfusion. These strategies have included nucleic acid amplification testing (NAT) of blood donations. In this study, a new real-time polymerase chain reaction (PCR) assay including internal control for the detection of ZIKV on the cobas omni Utility Channel (UC) on the cobas 6800 system is presented. PCR conditions and primer/probe concentrations were optimized on the LightCycler 480 instrument. Optimized conditions were transferred to the cobas omni UC on the cobas 6800 system. Subsequently, the limit of detection (LOD) in plasma and urine, genotype inclusivity, specificity, cross-reactivity, and clinical sensitivity were determined. The 95% LOD of the ZIKV PCR assay on the cobas 6800 system was 23.0 IU/mL (95% confidence interval [CI], 16.5-37.5) in plasma and 24.5 IU/mL (95% CI, 13.4-92.9) in urine. The assay detected African and Asian lineages of ZIKV. The specificity was 100%. The clinical concordance between the newly developed ZIKV PCR assay and the investigational Roche cobas Zika NAT test was 83% (24/29). We developed a sensitive ZIKV PCR assay on the cobas omni UC on the cobas 6800 system. The assay can be used for large-scale screening of blood donations for ZIKV or for testing of blood donors returning from areas with ZIKV to avoid temporal deferral. This study also demonstrates that the cobas omni UC on the cobas 6800 system can be used for in-house-developed PCR assays. © 2018 AABB.
Standardization of diagnostic PCR for the detection of foodborne pathogens
DEFF Research Database (Denmark)
Malorny, B.; Tassios, P.T.; Radstrom, P.
2003-01-01
In vitro amplification of nucleic acids using the polymerase chain reaction (PCR) has become, since its discovery in the 1980s, a powerful diagnostic tool for the analysis of microbial infections as well as for the analysis of microorganisms in food samples. However, despite its potential, PCR has...... neither gained wide acceptance in routine diagnostics nor been widely incorporated in standardized methods. Lack of validation and standard protocols, as well as variable quality of reagents and equipment, influence the efficient dissemination of PCR methodology from expert research laboratories to end......-user laboratories. Moreover, the food industry understandably requires and expects officially approved standards. Recognizing this, in 1999, the European Commission approved the research project, FOOD-PCR (http://www.PCR.dk), which aims to validate and standardize the use of diagnostic PCR for the detection...
Directory of Open Access Journals (Sweden)
Ni Luh Putu Indi Dharmayanti
2016-07-01
Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.
Wilkes, Rebecca Penrose; Kania, Stephen A; Tsai, Yun-Long; Lee, Pei-Yu Alison; Chang, Hsiu-Hui; Ma, Li-Juan; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2015-07-01
Feline immunodeficiency virus (FIV) is an important infectious agent of cats. Clinical syndromes resulting from FIV infection include immunodeficiency, opportunistic infections, and neoplasia. In our study, a 5' long terminal repeat/gag region-based reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) was developed to amplify all known FIV strains to facilitate point-of-need FIV diagnosis. The RT-iiPCR method was applied in a point-of-need PCR detection platform--a field-deployable device capable of generating automatically interpreted RT-iiPCR results from nucleic acids within 1 hr. Limit of detection 95% of FIV RT-iiPCR was calculated to be 95 copies standard in vitro transcription RNA per reaction. Endpoint dilution studies with serial dilutions of an ATCC FIV type strain showed that the sensitivity of lyophilized FIV RT-iiPCR reagent was comparable to that of a reference nested PCR. The established reaction did not amplify any nontargeted feline pathogens, including Felid herpesvirus 1, feline coronavirus, Feline calicivirus, Feline leukemia virus, Mycoplasma haemofelis, and Chlamydophila felis. Based on analysis of 76 clinical samples (including blood and bone marrow) with the FIV RT-iiPCR, test sensitivity was 97.78% (44/45), specificity was 100.00% (31/31), and agreement was 98.65% (75/76), determined against a reference nested-PCR assay. A kappa value of 0.97 indicated excellent correlation between these 2 methods. The lyophilized FIV RT-iiPCR reagent, deployed on a user-friendly portable device, has potential utility for rapid and easy point-of-need detection of FIV in cats. © 2015 The Author(s).
Hashimoto, Y; Takahashi, H; Kishiyama, K; Sato, Y; Nakao, M; Miyamoto, K; Iizuka, H
1998-02-01
A 64-year-old woman with Lyme disease and manifesting facial nerve palsy had been bitten by a tick on the left frontal scalp 4 weeks previously. Erythema migrans appeared on the left forehead, accompanied by left facial paralysis. Nested polymerase chain reaction-restriction fragment length polymorphism analysis (nested PCR-RFLP) was performed on DNA extracted from a skin biopsy of the erythema on the left forehead. Borrelia flagellin gene DNA was detected and its RFLP pattern indicated that the organism was B. garinii, Five weeks later, B. garinii was isolated by conventional culture from the erythematous skin lesion, but not from the cerebrospinal fluid. After treatment with ceftriaxone intravenously for 10 days and oral administration of minocycline for 7 days, both the erythema and facial nerve palsy improved significantly. Nested PCR and culture taken after the lesion subsided, using skin samples obtained from a site adjacent to the original biopsy, were both negative. We suggest that nested PCR-RFLP analysis might be useful for the rapid diagnosis of Lyme disease and for evaluating therapy.
Bluhm, B H; Flaherty, J E; Cousin, M A; Woloshuk, C P
2002-12-01
The genus Fusarium comprises a diverse group of fungi including several species that produce mycotoxins in food commodities. In this study, a multiplex polymerase chain reaction (PCR) assay was developed for the group-specific detection of fumonisin-producing and trichothecene-producing species of Fusarium. Primers for genus-level recognition of Fusarium spp. were designed from the internal transcribed spacer regions (ITS1 and ITS2) of rDNA. Primers for group-specific detection were designed from the TRI6 gene involved in trichothecene biosynthesis and the FUM5 gene involved in fumonisin biosynthesis. Primer specificity was determined by testing for cross-reactivity against purified genomic DNA from 43 fungal species representing 14 genera, including 9 Aspergillus spp., 9 Fusarium spp., and 10 Penicillium spp. With purified genomic DNA as a template, genus-specific recognition was observed at 10 pg per reaction; group-specific recognition occurred at 100 pg of template per reaction for the trichothecene producer Fusarium graminearum and at 1 ng of template per reaction for the fumonisin producer Fusarium verticillioides. For the application of the PCR assay, a protocol was developed to isolate fungal DNA from cornmeal. The detection of F. graminearum and its differentiation from F. verticillioides were accomplished prior to visible fungal growth at cornmeal. This level of detection is comparable to those of other methods such as enzyme-linked immunosorbent assay, and the assay described here can be used in the food industry's effort to monitor quality and safety.
Improved thermal cycling durability and PCR compatibility of polymer coated quantum dot
International Nuclear Information System (INIS)
Xun Zhe; Guan Yifu; Zhao Xiaoyun
2013-01-01
Quantum dots have experienced rapid development in imaging, labeling and sensing in medicine and life science. To be suitable for polymerase chain reaction (PCR) assay, we have tested QD thermal cycling durability and compatibility, which have not been addressed in previous reports. In this study, we synthesized CdSe/ZnS QDs with a surface modification with high-MW amphiphilic copolymers and observed that Mg 2+ ions in the PCR reaction could induce the QDs to precipitate and reduce their fluorescence signal significantly after thermal cycling. To overcome this problem, we used mPEG2000 to conjugate the QD surface for further protection, and found that this modification enables QDs to endure 40 thermal cycles in the presence of other components essential for PCR reactions. We have also identified that QDs have different effects on rTaq and Ex Taq polymerization systems. A high QD concentration could apparently reduce the PCR efficiency, but this inhibition was relieved significantly in the Ex PCR system as the concentration of Ex Taq polymerase was increased. Real-time PCR amplification results showed that QDs could provide a sufficiently measurable fluorescence signal without excessively inhibiting the DNA amplification. Based on this improved thermal cycling durability and compatibility with the PCR system, QDs have the potential to be developed as stable fluorescent sensors in PCR and real-time PCR amplification. (paper)
Johnson, Stephanie T; Van Tassell, Eric R; Tonnetti, Laura; Cable, Ritchard G; Berardi, Victor P; Leiby, David A
2013-11-01
Babesia microti, an intraerythrocytic parasite, has been implicated in transfusion transmission. B. microti seroprevalence in Connecticut (CT) blood donors is approximately 1%; however, it is not known what percentage of donors is parasitemic and poses a risk for transmitting infection. Therefore, we determined the prevalence of demonstrable B. microti DNA in donors from a highly endemic area of CT and compared observed rates with concurrent immunofluorescence assay (IFA) testing results. Blood samples from consenting donors in southeastern CT were collected from mid-August through early October 2009 and tested by IFA for immunoglobulin G antibodies and real-time polymerase chain reaction (PCR) for B. microti DNA. IFA specificity was determined using blood donor samples collected in northwestern Vermont (VT), an area nonendemic for Babesia. Of 1002 CT donors, 25 (2.5%) were IFA positive and three (0.3%) were real-time PCR positive. Among the three real-time PCR-positive donors, two were also IFA positive, while one was IFA negative and may represent a window period infection. The two IFA- and real-time PCR-positive donors appeared to subsequently clear infection. The other real-time PCR-positive donor did not provide follow-up samples. Of 1015 VT donors tested by IFA, only one (0.1%) was positive, but may have acquired infection during travel to an endemic area. We prospectively identified several real-time PCR-positive blood donors, including an IFA-negative real-time PCR-positive donor, in an area highly endemic for B. microti. These results suggest the need to include nucleic acid testing in planned mitigation strategies for B. microti. © 2013 American Association of Blood Banks.
DEFF Research Database (Denmark)
Dybkær, Karen; Munch, Mette; Handberg, Kurt J.
2004-01-01
Three 1-tube Reverse Transcriptase Polymerase Chain Reactions (RT-PCR) directed against the genes encoding the nucleoprotein (NP) and the H5 and H7 hemagglutinin (HA) gene, respectively, were used for detection of avian influenza virus (AIV) in various specimens. A total of 1,040 samples...... originating from chickens experimentally infected with 2 different low pathogenic avian influenza viruses, from domestic ducks and from wild aquatic birds were examined. The outcome of 1) the universal AIV RT-PCR including a PCR-enzyme-linked immunosorbent assay (ELISA) procedure directed against NP (NP RT...
Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai
2014-10-29
Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.
Quantification of algal endosymbionts (Symbiodinium) in coral tissue using real-time PCR
Mieog, J. C.; Van Oppen, M. J. H.; Berkelmans, R.; Stam, W. T.; Olsen, J. L.
Understanding the flexibility of the endosymbioses between scleractinian corals and single-cell algae of the genus Symbiodinium will provide valuable insights into the future of coral reefs. Here, a real-time polymerase chain reaction (PCR) assay is presented to accurately determine the cell
Quantification of organellar DNA and RNA using real-time PCR.
Weihe, Andreas
2014-01-01
Quantitative (real-time) polymerase chain reaction (PCR) allows the measurement of relative organellar gene copy numbers as well as transcript abundance of individual mitochondrial or plastidial genes. Requiring only minute amounts of total DNA or RNA, the described method can replace traditional analyses like Southern or Northern hybridization which require large amounts of organellar nucleic acids and usually provide only semiquantitative data. Here we describe prerequisites, reaction conditions, and data analysis principles, which should be applicable for a wide range of plant species and experimental situations where comparative and precise determination of gene copy numbers or transcript abundance is requested. Sequences of amplification primers for qPCR of organellar genes from Arabidopsis are provided.
Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A
2012-08-15
Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
M. Soma Sekhar
2017-11-01
Full Text Available Aim: The aim of this study was to characterize virulent Escherichia coli isolated from different poultry species and poultry farm workers using enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR genotyping. Materials and Methods: Fecal swabs from different poultry species (n=150 and poultry farm workers (n=15 were analyzed for E. coli and screened for virulence genes (stx1, stx2, eaeA, and hlyA by multiplex PCR. Virulent E. coli was serotyped based on their "O" antigen and then genotyped using ERIC-PCR. Results: A total of 134 E. coli isolates (122/150 from poultry and 12/15 from farm workers were recovered. Virulence genes were detected in a total of 12 isolates. Serological typing of the 12 virulent E. coli revealed nine different serotypes (O2, O49, O60, O63, O83, O101, O120, UT, and Rough. ERIC-PCR genotyping allowed discrimination of 12 virulent E. coli isolates into 11 ERIC-PCR genotypes. The numerical index of discrimination was 0.999. Conclusion: Our findings provide information about the wide genetic diversity and discrimination of virulent E. coli in apparently healthy poultry and poultry farm workers of Andhra Pradesh (India based on their genotype.
Investigating radical cation chain processes in the electrocatalytic Diels-Alder reaction.
Imada, Yasushi; Okada, Yohei; Chiba, Kazuhiro
2018-01-01
Single electron transfer (SET)-triggered radical ion-based reactions have proven to be powerful options in synthetic organic chemistry. Although unique chain processes have been proposed in various photo- and electrochemical radical ion-based transformations, the turnover number, also referred to as catalytic efficiency, remains unclear in most cases. Herein, we disclose our investigations of radical cation chain processes in the electrocatalytic Diels-Alder reaction, leading to a scalable synthesis. A gram-scale synthesis was achieved with high current efficiency of up to 8000%. The reaction monitoring profiles showed sigmoidal curves with induction periods, suggesting the involvement of intermediate(s) in the rate determining step.
Asing; Ali, Md. Eaqub; Abd Hamid, Sharifah Bee; Hossain, M. A. Motalib; Mustafa, Shuhaimi; Kader, Md. Abdul; Zaidul, I. S. M.
2016-01-01
The Malayan box turtle (Cuora amboinensis) (MBT) is a vulnerable and protected turtle species, but it is a lucrative item in the illegal wildlife trade because of its great appeal as an exotic food item and in traditional medicine. Although several polymerase chain reaction (PCR) assays to identify MBT by various routes have been documented, their applicability for forensic authentication remains inconclusive due to the long length of the amplicon targets, which are easily broken down by natural decomposition, environmental stresses or physiochemical treatments during food processing. To address this research gap, we developed, for the first time, a species-specific PCR-restriction fragment length polymorphism (RFLP) assay with a very short target length (120 bp) to detect MBT in the food chain; this authentication ensured better security and reliability through molecular fingerprints. The PCR-amplified product was digested with Bfa1 endonuclease, and distinctive restriction fingerprints (72, 43 and 5 bp) for MBT were found upon separation in a microfluidic chip-based automated electrophoresis system, which enhances the resolution of short oligos. The chances of any false negative identifications were eliminated through the use of a universal endogenous control for eukaryotes, and the limit of detection was 0.0001 ng DNA or 0.01% of the meat under admixed states. Finally, the optimized PCR-RFLP assay was validated for the screening of raw and processed commercial meatballs, burgers and frankfurters, which are very popular in most countries. The optimized PCR-RFLP assay was further used to screen MBT materials in 153 traditional Chinese medicines of 17 different brands and 62 of them were found MBT positive; wherein the ingredients were not declared in product labels. Overall, the novel assay demonstrated sufficient merit for use in any forensic and/or archaeological authentication of MBT, even under a state of decomposition. PMID:27716792
Asing; Ali, Md Eaqub; Abd Hamid, Sharifah Bee; Hossain, M A Motalib; Mustafa, Shuhaimi; Kader, Md Abdul; Zaidul, I S M
2016-01-01
The Malayan box turtle (Cuora amboinensis) (MBT) is a vulnerable and protected turtle species, but it is a lucrative item in the illegal wildlife trade because of its great appeal as an exotic food item and in traditional medicine. Although several polymerase chain reaction (PCR) assays to identify MBT by various routes have been documented, their applicability for forensic authentication remains inconclusive due to the long length of the amplicon targets, which are easily broken down by natural decomposition, environmental stresses or physiochemical treatments during food processing. To address this research gap, we developed, for the first time, a species-specific PCR-restriction fragment length polymorphism (RFLP) assay with a very short target length (120 bp) to detect MBT in the food chain; this authentication ensured better security and reliability through molecular fingerprints. The PCR-amplified product was digested with Bfa1 endonuclease, and distinctive restriction fingerprints (72, 43 and 5 bp) for MBT were found upon separation in a microfluidic chip-based automated electrophoresis system, which enhances the resolution of short oligos. The chances of any false negative identifications were eliminated through the use of a universal endogenous control for eukaryotes, and the limit of detection was 0.0001 ng DNA or 0.01% of the meat under admixed states. Finally, the optimized PCR-RFLP assay was validated for the screening of raw and processed commercial meatballs, burgers and frankfurters, which are very popular in most countries. The optimized PCR-RFLP assay was further used to screen MBT materials in 153 traditional Chinese medicines of 17 different brands and 62 of them were found MBT positive; wherein the ingredients were not declared in product labels. Overall, the novel assay demonstrated sufficient merit for use in any forensic and/or archaeological authentication of MBT, even under a state of decomposition.
Xu, Chen; Zhang, Nan; Huo, Qianyu; Chen, Minghui; Wang, Rengfeng; Liu, Zhili; Li, Xue; Liu, Yunde; Bao, Huijing
2016-04-15
In this article, we discuss the polymerase chain reaction (PCR)-hybridization assay that we developed for high-throughput simultaneous detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum using one set of primers and two specific DNA probes based on urease gene nucleotide sequence differences. First, U. urealyticum and U. parvum DNA samples were specifically amplified using one set of biotin-labeled primers. Furthermore, amine-modified DNA probes, which can specifically react with U. urealyticum or U. parvum DNA, were covalently immobilized to a DNA-BIND plate surface. The plate was then incubated with the PCR products to facilitate sequence-specific DNA binding. Horseradish peroxidase-streptavidin conjugation and a colorimetric assay were used. Based on the results, the PCR-hybridization assay we developed can specifically differentiate U. urealyticum and U. parvum with high sensitivity (95%) compared with cultivation (72.5%). Hence, this study demonstrates a new method for high-throughput simultaneous differentiation and detection of U. urealyticum and U. parvum with high sensitivity. Based on these observations, the PCR-hybridization assay developed in this study is ideal for detecting and discriminating U. urealyticum and U. parvum in clinical applications. Copyright © 2016 Elsevier Inc. All rights reserved.
PCR performance of a thermostable heterodimeric archaeal DNA polymerase
Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine
2014-01-01
DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications. PMID:24847315
PCR performance of a thermostable heterodimeric archaeal DNA polymerase
Directory of Open Access Journals (Sweden)
Tom eKillelea
2014-05-01
Full Text Available DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR, cDNA cloning, genome sequencing and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3’ primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications.
Sleeve reaction chamber system
Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA
2009-08-25
A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.
Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino
2007-10-01
Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.
RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza
DEFF Research Database (Denmark)
Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen
2003-01-01
A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected wit...... of the twenty-three VI-positive specimens were negative when tested by RT-PCR-ELISA. The diagnostic sensitivity and specificity of the RT-PCR-ELISA was 91% and 97%, respectively, using VI in SPF eggs as the gold reference standard....
International Nuclear Information System (INIS)
Ali, J.; Khan, S.A.; Rauf, S.E.; Ayyub, M.; Ali, N.
2017-01-01
To compare the sensitivity and specificity of fluorescence in situ hybridization (FISH) with real time polymerase chain reaction (RT-PCR) in the diagnosis of Chronic Myeloid Leukemia (CML). Study Design: A cross-sectional, analytical study. Place and Duration of Study: Haematology Department, Armed Forces Institute of Pathology, Rawalpindi, from January 2012 to February 2014. Methodology:A total number of 87 patients of CML were studied. The diagnosis was made on the basis of clinical history, peripheral blood and bone marrow aspiration. These patients were tested for the presence of BCR-ABL1 fusion gene by RT-PCR and FISH. About 5 ml of venous blood was collected, half was taken in heparin for FISH and half in ethylenediamine tetra-acetic acid (EDTA) for CBC and PCR. For FISH, cells were cultured for 24 hours in RPMI 1640 medium and evaluated using BX51 fluorescence microscope for dual fusion signal of yellow colour. Samples having 20 or more interphases positive for dual fusion signals were taken as positive. For PCR, RNA extraction was done by Tri-Reagent LS (MRC, USA) and cDNA was synthesized using reverse transcriptase and gene specific primer. RT-PCR was done on ABI-7500. The positive samples were identified when fluorescence exceeded threshold limit. Results of RT-PCR and FISH were compared. Results: Out of the 87 patients, 85 (97.7%) were PCR positive and 2 (2.3%) were PCR negative, whereas in FISH 83 (95.4%) were positive and 4 (4.5%) were negative. Sensitivity and specificity of FISH was 97.6% and 100%, respectively. Conclusion: FISH is a reliable supplementary method to PCR for detection of BCR-ABL1 fusion gene in the diagnosis of CML. (author)
Single base pair mutation analysis by PNA directed PCR clamping
DEFF Research Database (Denmark)
Ørum, H.; Nielsen, P.E.; Egholm, M.
1993-01-01
A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....
Directory of Open Access Journals (Sweden)
Yuexia Wang
2015-09-01
Full Text Available Real-time polymerase chain reaction (PCR allows rapid detection of Salmonella in frozen dairy products, but it might cause a false positive detection result because it might amplify DNA from dead target cells as well. In this study, Salmonella-free frozen ice cream was initially inoculated with heat-killed Salmonella Typhimurium cells and stored at −18°C. Bacterial DNA extracted from the sample was amplified using TaqMan probe-based real-time PCR targeting the invA gene. Our results indicated that DNA from the dead cells remained stable in frozen ice cream for at least 20 days, and could produce fluorescence signal for real-time PCR as well. To overcome this limitation, propidium monoazide (PMA was combined with real-time PCR. PMA treatment can effectively prevent PCR amplification from heat-killed Salmonella cells in frozen ice cream. The PMA real-time PCR assay can selectively detect viable Salmonella at as low as 103 CFU/mL. Combining 18 hours of pre-enrichment with the assay allows for the detection of viable Salmonella at 100 CFU/mL and avoiding the false-positive result of dead cells. The PMA real-time PCR assay provides an alternative specifically for detection of viable Salmonella in ice cream. However, when the PMA real-time PCR assay was evaluated in ice cream subjected to frozen storage, it obviously underestimated the contamination situation of viable Salmonella, which might lead to a false negative result. According to this result, the use of enrichment prior to PMA real-time PCR analysis remains as the more appropriate approach.
Wang, Yuexia; Yang, Ming; Liu, Shuchun; Chen, Wanyi; Suo, Biao
2015-09-01
Real-time polymerase chain reaction (PCR) allows rapid detection of Salmonella in frozen dairy products, but it might cause a false positive detection result because it might amplify DNA from dead target cells as well. In this study, Salmonella-free frozen ice cream was initially inoculated with heat-killed Salmonella Typhimurium cells and stored at -18°C. Bacterial DNA extracted from the sample was amplified using TaqMan probe-based real-time PCR targeting the invA gene. Our results indicated that DNA from the dead cells remained stable in frozen ice cream for at least 20 days, and could produce fluorescence signal for real-time PCR as well. To overcome this limitation, propidium monoazide (PMA) was combined with real-time PCR. PMA treatment can effectively prevent PCR amplification from heat-killed Salmonella cells in frozen ice cream. The PMA real-time PCR assay can selectively detect viable Salmonella at as low as 10 3 CFU/mL. Combining 18 hours of pre-enrichment with the assay allows for the detection of viable Salmonella at 10 0 CFU/mL and avoiding the false-positive result of dead cells. The PMA real-time PCR assay provides an alternative specifically for detection of viable Salmonella in ice cream. However, when the PMA real-time PCR assay was evaluated in ice cream subjected to frozen storage, it obviously underestimated the contamination situation of viable Salmonella, which might lead to a false negative result. According to this result, the use of enrichment prior to PMA real-time PCR analysis remains as the more appropriate approach. Copyright © 2015. Published by Elsevier B.V.
Wagner, Franz F; Flegel, Willy A; Bittner, Rita; Döscher, Andrea
2017-03-01
Determining blood group antigens by serological methods may be unreliable in certain situations, such as in patients after chronic or massive transfusion. Red cell genotyping offers a complementary approach, but current methods may take much longer than conventional serological typing, limiting their utility in urgent situations. To narrow this gap, we devised a rapid method using direct polymerase chain reaction (PCR) amplification while avoiding the DNA extraction step. DNA was amplified by PCR directly from plasma or serum of blood donors followed by a melting curve analysis in a capillary rapid-cycle PCR assay. We evaluated the single nucleotide polymorphisms underlying the clinically relevant Fy a , Fy b , Jk a and Jk b antigens, with our analysis being completed within 40 min of receiving a plasma or serum sample. The positive predictive value was 100% and the negative predictive value at least 84%. Direct PCR with melting point analysis allowed faster red cell genotyping to predict blood group antigens than any previous molecular method. Our assay may be used as a screening tool with subsequent confirmatory testing, within the limitations of the false-negative rate. With fast turnaround times, the rapid-cycle PCR assay may eventually be developed and applied to red cell genotyping in the hospital setting. © 2016 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Teofânia HDA Vidigal
1996-12-01
Full Text Available The low stringency-polymerase chain reaction (LS-PCR with a pair of specific primers for the amplification of the 18S rRNA gene was evaluated as a means of differentiating between the two Schistosoma mansoni intermediate host species in Brazil: Biomphalaria glabrata and B. tenagophila. Individual snails obtained from different states of Brazil were used and the amplification patterns obtained showed a high degree of genetic variability in these species. Nevertheless, 4 and 3 clearly defined specific diagnostic bands was observed in individuals from B. glabrata and B. tenagophila respectively. The detection of snail specific diagnostic bands suggests the possibility of reliable species differentiation at the DNA level using LS-PCR.
Xia, Minghui; Qi, Qingguo
2013-01-01
We used denaturing gradient gel electrophoresis (DGGE) to compare bacterial profiles in periodontium and root canals of teeth with combined periodontal-endodontic lesions. Samples of dental plaque and necrotic pulp were collected from thirteen extracted teeth with advanced periodontitis. Genomic DNA was extracted for polymerase chain reaction (PCR) analysis using universal bacterial primers. The PCR products were then loaded onto DGGE gels to obtain fractionated bands. Characteristic DGGE bands were excised and DNA was cloned and sequenced. The number of bands, which indicates the number of bacterial species, was compared between dental plaques and necrotic pulp tissues from the same tooth. Although the difference was statistically significant (P bacteria species were present in both the periodontal pockets and root canals of the same tooth; however, periodontal bacteria did not always invade the root canals, and some bacteria in root canals were not present in periodontal pockets of the same tooth. In some teeth, unique bacteria in root canals had not passed from periodontal pockets. A basic local alignment search tool (BLAST) sequence search in Genbank indicated that new bacteria species were present in periodontal pockets and root canals. Their characteristics must thus be further analyzed.
A Rapid and Low-Cost PCR Thermal Cycler for Low Resource Settings.
Directory of Open Access Journals (Sweden)
Grace Wong
Full Text Available Many modern molecular diagnostic assays targeting nucleic acids are typically confined to developed countries or to the national reference laboratories of developing-world countries. The ability to make technologies for the rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a revolutionary step forward in global health. Many molecular assays are also developed based on polymerase chain reactions (PCR, which require thermal cyclers that are relatively heavy (>20 pounds and need continuous electrical power. The temperature ramping speed of most economical thermal cyclers are relatively slow (2 to 3 °C/s so a polymerase chain reaction can take 1 to 2 hours. Most of all, these thermal cyclers are still too expensive ($2k to $4k for low-resource setting uses.In this article, we demonstrate the development of a low-cost and rapid water bath based thermal cycler that does not require active temperature control or continuous power supply during PCR. This unit costs $130 to build using commercial off-the-shelf items. The use of two or three vacuum-insulated stainless-steel Thermos food jars containing heated water (for denaturation and annealing/extension steps and a layer of oil on top of the water allow for significantly stabilized temperatures for PCR to take place. Using an Arduino-based microcontroller, we automate the "archaic" method of hand-transferring PCR tubes between water baths.We demonstrate that this innovative unit can deliver high speed PCR (17 s per PCR cycle with the potential to go beyond the 1,522 bp long amplicons tested in this study and can amplify from templates down to at least 20 copies per reaction. The unit also accepts regular PCR tubes and glass capillary tubes. The PCR efficiency of our thermal cycler is not different from other commercial thermal cyclers. When combined with a rapid nucleic acid detection approach, the thermos thermal cycler (TTC can enable on-site molecular
Lee, Jaehee; Lee, Shin Yup; Yoo, Seung Soo; Cha, Seung Ick; Won, Dong Il; Park, Jae Yong; Lee, Won-Kil; Kim, Chang Ho
2012-07-01
Combining a polymerase chain reaction (PCR) test with bronchoscopy is frequently performed to allow a rapid diagnosis of smear-negative pulmonary tuberculosis (PTB). However, limited data are available concerning clinical judgment in patients with suspected PTB and AFB smear- and PCR-negative bronchial aspirates (BA). The present study evaluated the usefulness of whole-blood QuantiFERON-TB Gold In-Tube (QFT) testing in these patients. Of 166 patients with suspected PTB who had undergone bronchoscopy because of smear-negative sputum or inadequate sputum production, 93 (56%) were diagnosed with culture-positive PTB. Seventy-four patients were either AFB smear- or PCR-positive. In the 75 patients whose BA AFB smear and PCR results were both negative, 19 were finally diagnosed with PTB by culture. The QFT test had a negative predictive value of 91% for PTB. The QFT test may be useful for excluding PTB in patients with suspected PTB whose BA AFB smear and PCR results are both negative. Copyright © 2012 Elsevier Inc. All rights reserved.
Competing irreversible cooperative reactions on polymer chains
International Nuclear Information System (INIS)
Evans, J.W.; Hoffman, D.K.; Burgess, D.R.
1984-01-01
We analyze model processes involving competition between several irreversible reactions at the sites of a 1D, infinite, uniform polymer chain. These reactions can be cooperative, i.e., the corresponding rates depend on the state of the surrounding sites. An infinite hierarchy of rate equations is readily derived for the probabilities of various subconfigurations. By exploiting a shielding property of suitable blocks of unreacted sites, we show how exact hierarchy truncation and solution is sometimes possible. The behavior of solutions is illustrated in several cases by plotting families of ''reaction trajectories'' for varying ratios of reactant concentrations. As a specific application, we consider competition between coordination of ZnCl 2 to pairs of oxygen atoms and to single oxygen atoms in poly(propylene oxide). The observed glass transition temperature behavior is eludicated
Whipps, Christopher M; Burton, Tamara; Watral, Virginia G; St-Hilaire, Sophie; Kent, Michael L
2006-01-30
Ichthyophonus hoferi Plehn & Mulsow, 1911, is a cosmopolitan, protistan pathogen of marine fishes. It is prevalent in mature returning Chinook salmon Oncorhynchus tshawytscha in the Yukon River watershed, and may be associated with prespawning mortality. We developed and evaluated a polymerase chain reaction (PCR) test for I. hoferi using primers specific to the parasite's small subunit rDNA. The test has a minimum detection limit of approximately 10(-5) parasite spores per reaction and does not cross-react with the closely related salmon parasites Dermocystidium salmonis or Sphaerothecum destruens. Sensitivity and specificity of the PCR test used on somatic muscle and heart tissue for detecting infected fish were determined using 334 Chinook salmon collected from the Yukon River at 2 locations (Tanana and Emmonak) in 2003 and 2004. The true infection status of the fish was determined by testing somatic muscle, heart and kidney tissue using histological evaluation, culture, and PCR. The severity of infection was grouped into 2 categories, light and heavy infection. The probability of detecting a heavily infected fish (sensitivity of the test) was generally much higher than the probability of detecting light infection, suggesting that more than one tissue and/or method should be used to accurately detect light or early infection by I. hoferi. The probability of correctly identifying a negative fish (specificity of the test) was always greater than 94% regardless of the tissue used, infection severity, sampling site or year of collection.
Schmalz, Gerhard; Tsigaras, Sandra; Rinke, Sven; Kottmann, Tanja; Haak, Rainer; Ziebolz, Dirk
2016-07-01
The aim of this study was to compare the microbial analysis methods of polymerase chain reaction (PCR) and real-time PCR (RT-PCR) in terms of detection of five selected potentially periodontal pathogenic bacteria in peri-implant disease. Therefore 45 samples of healthy, mucositis and peri-implantitis (n = 15 each) were assessed according to presence of the following bacteria using PCR (DNA-strip technology) and RT-PCR (fluorescent dye SYBR green-system): Aggregatibacter actinomycetemcomitans (Aa), Porphyromonas gingivalis (Pg), Treponema denticola (Td), Tanerella forsythia (Tf), and Fusobacterium nucleatum (Fn). There were no significant correlations between the bacterial and disease patterns, so the benefit of using microbiological tests for the diagnosis of peri-implant diseases is questionable. Correlations between the methods were highest for Tf (Kendall's Tau: 0.65, Spearman: 0.78), Fn (0.49, 0.61) and Td (0.49, 0.59). For Aa (0.38, 0.42) and Pg (0.04, 0.04), lower correlation values were detected. Accordingly, conventional semi-quantitative PCR seems to be sufficient for analyzing potentially periodontal pathogenic bacterial species. Copyright © 2016 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Meldgaard, Michael; Morling, N
1997-01-01
Detection on automated DNA sequencers of polymerase chain reaction (PCR) products of tetra- and penta-nucleotide short tandem repeat (STR) loci frequently reveals one or more extra peaks along with the true, major allele peak. The most frequent extra peak pattern is a single smaller peak which...... is one repeat unit shorter than the true allele peak. The existence of such artificial peaks is of special importance when the methods are used for forensic investigations because the artificial extra peaks may simulate true alleles when samples containing mixtures of DNA from different individuals...... are analyzed. We have investigated the relative levels of formation of extra peaks in 14 STR marker systems. We found that not only the parameters of the PCR but also factors determining the stringency during the post-PCR and pre-electrophoresis handling of samples were of importance for the formation of extra...
LENUS (Irish Health Repository)
O'Connor, T M
2012-02-03
BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.
Arvanitis, Marios; Anagnostou, Theodora; Mylonakis, Eleftherios
2015-10-15
Screening of high-risk patients for invasive aspergillosis (IA) has the potential to decrease the use of empiric antifungal agents. However, the performance of different screening methods has not been studied. We performed a meta-analysis of published studies to assess the diagnostic performance of galactomannan (GM) and polymerase chain reaction (PCR) as weekly screening tests in high-risk populations. The sensitivity and specificity of 6 approaches combining GM and PCR were estimated using the bivariate model. Thirteen studies with 1670 patients met our inclusion criteria. Single positive test results had modest sensitivity and specificity for screening (respectively, 92% and 90% for GM; 84% and 76% for PCR). The screening approach with the highest sensitivity was the one that used at least 1 GM- or PCR-positive result to define a positive episode, achieving a sensitivity of 99%, significantly higher than any single test (P = .0018 compared with GM and P value of 100%, whereas the presence of at least 2 positive results is highly suggestive of an active infection with a positive predictive value of 88%. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven
2014-01-01
A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.
Millon, Laurence; Larosa, Fabrice; Lepiller, Quentin; Legrand, Faezeh; Rocchi, Steffi; Daguindau, Etienne; Scherer, Emeline; Bellanger, Anne-Pauline; Leroy, Joel; Grenouillet, Frederic
2013-05-01
The aim of our study was to assess the detection of circulating DNA from the most common species of Mucorales for early diagnosis of mucormycosis in at-risk patients. We retrospectively evaluated a combination of 3 quantitative polymerase chain reaction (qPCR) assays using hydrolysis probes targeting Mucor/Rhizopus, Lichtheimia (formerly Absidia), and Rhizomucor for circulating Mucorales detection. Serial serum samples from 10 patients diagnosed with proven mucormycosis (2-9 samples per patient) were analyzed. No cross-reactivity was detected in the 3 qPCR assays using 19 reference strains of opportunistic fungi, and the limit of detection ranged from 3.7 to 15 femtograms/10 µL, depending on the species. DNA from Mucorales was detected in the serum of 9 of 10 patients between 68 and 3 days before mucormycosis diagnosis was confirmed by histopathological examination and/or positive culture. All the qPCR results were concordant with culture and/or PCR-based identification of the causing agents in tissue (Lichtheimia species, Rhizomucor species, and Mucor/Rhizopus species in 4, 3, and 2 patients, respectively). Quantitative PCR was negative in only 1 patient with proven disseminated mucormycosis caused by Lichtheimia species. Our study suggests that using specific qPCR targeting several species of Mucorales according to local ecology to screen at-risk patients could be useful in a clinical setting. The cost and efficacy of this strategy should be evaluated. However, given the human and economic cost of mucormycosis and the need for rapid diagnosis to initiate prompt directed antifungal therapy, this strategy could be highly attractive.
A RAPID DNA EXTRACTION METHOD FOR PCR IDENTIFICATION OF FUNGAL INDOOR AIR CONTAMINANTS
Following air sampling, fungal DNA needs to be extracted and purified to a state suitable for laboratory use. Our laboratory has developed a simple method of extraction and purification of fungal DNA appropriate for enzymatic manipulation and polymerase chain reaction (PCR) appli...
Wiland, Homer O; Procop, Gary W; Goldblum, John R; Tuohy, Marion; Rybicki, Lisa; Patil, Deepa T
2013-06-01
Polymerase chain reaction (PCR)-based assays using stool samples are currently the most effective method of detecting Clostridium difficile. This study examines the feasibility of this assay using mucosal biopsy samples and evaluates the interobserver reproducibility in diagnosing and distinguishing ischemic colitis from C difficile colitis. Thirty-eight biopsy specimens were reviewed and classified by 3 observers into C difficile and ischemic colitis. The findings were correlated with clinical data. PCR was performed on 34 cases using BD GeneOhm C difficile assay. The histologic interobserver agreement was excellent (κ= 0.86) and the agreement between histologic and clinical diagnosis was good (κ = 0.84). All 19 ischemic colitis cases tested negative (100% specificity) and 3 of 15 cases of C difficile colitis tested positive (20% sensitivity). C difficile colitis can be reliably distinguished from ischemic colitis using histologic criteria. The C difficile PCR test on endoscopic biopsy specimens has excellent specificity but limited sensitivity.
Comparative quantification of human intestinal bacteria based on cPCR and LDR/LCR.
Tang, Zhou-Rui; Li, Kai; Zhou, Yu-Xun; Xiao, Zhen-Xian; Xiao, Jun-Hua; Huang, Rui; Gu, Guo-Hao
2012-01-21
To establish a multiple detection method based on comparative polymerase chain reaction (cPCR) and ligase detection reaction (LDR)/ligase chain reaction (LCR) to quantify the intestinal bacterial components. Comparative quantification of 16S rDNAs from different intestinal bacterial components was used to quantify multiple intestinal bacteria. The 16S rDNAs of different bacteria were amplified simultaneously by cPCR. The LDR/LCR was examined to actualize the genotyping and quantification. Two beneficial (Bifidobacterium, Lactobacillus) and three conditionally pathogenic bacteria (Enterococcus, Enterobacterium and Eubacterium) were used in this detection. With cloned standard bacterial 16S rDNAs, standard curves were prepared to validate the quantitative relations between the ratio of original concentrations of two templates and the ratio of the fluorescence signals of their final ligation products. The internal controls were added to monitor the whole detection flow. The quantity ratio between two bacteria was tested. cPCR and LDR revealed obvious linear correlations with standard DNAs, but cPCR and LCR did not. In the sample test, the distributions of the quantity ratio between each two bacterial species were obtained. There were significant differences among these distributions in the total samples. But these distributions of quantity ratio of each two bacteria remained stable among groups divided by age or sex. The detection method in this study can be used to conduct multiple intestinal bacteria genotyping and quantification, and to monitor the human intestinal health status as well.
HLA-DQA1 typing in Danes by two polymerase chain reaction (PCR) based methods
DEFF Research Database (Denmark)
Cowland, J B; Madsen, H O; Morling, N
1995-01-01
(ASA) method, which together recognise eight alleles. In 146 unrelated Danish individuals, the HLA-DQA1 alleles were in Hardy-Weinberg equilibrium. For identity testing, the power of discrimination (PD) of HLA-DQA1 was 0.932 with the RDB method and 0.942 with the PCR-RFLP/ASA method. For paternity...
Directory of Open Access Journals (Sweden)
Stewart Don
2008-05-01
Full Text Available Abstract Background Based upon defining a common reference point, current real-time quantitative PCR technologies compare relative differences in amplification profile position. As such, absolute quantification requires construction of target-specific standard curves that are highly resource intensive and prone to introducing quantitative errors. Sigmoidal modeling using nonlinear regression has previously demonstrated that absolute quantification can be accomplished without standard curves; however, quantitative errors caused by distortions within the plateau phase have impeded effective implementation of this alternative approach. Results Recognition that amplification rate is linearly correlated to amplicon quantity led to the derivation of two sigmoid functions that allow target quantification via linear regression analysis. In addition to circumventing quantitative errors produced by plateau distortions, this approach allows the amplification efficiency within individual amplification reactions to be determined. Absolute quantification is accomplished by first converting individual fluorescence readings into target quantity expressed in fluorescence units, followed by conversion into the number of target molecules via optical calibration. Founded upon expressing reaction fluorescence in relation to amplicon DNA mass, a seminal element of this study was to implement optical calibration using lambda gDNA as a universal quantitative standard. Not only does this eliminate the need to prepare target-specific quantitative standards, it relegates establishment of quantitative scale to a single, highly defined entity. The quantitative competency of this approach was assessed by exploiting "limiting dilution assay" for absolute quantification, which provided an independent gold standard from which to verify quantitative accuracy. This yielded substantive corroborating evidence that absolute accuracies of ± 25% can be routinely achieved. Comparison
Directory of Open Access Journals (Sweden)
Mateusz G Adamski
Full Text Available Over the past decade rapid advances have occurred in the understanding of RNA expression and its regulation. Quantitative polymerase chain reactions (qPCR have become the gold standard for quantifying gene expression. Microfluidic next generation, high throughput qPCR now permits the detection of transcript copy number in thousands of reactions simultaneously, dramatically increasing the sensitivity over standard qPCR. Here we present a gene expression analysis method applicable to both standard polymerase chain reactions (qPCR and high throughput qPCR. This technique is adjusted to the input sample quantity (e.g., the number of cells and is independent of control gene expression. It is efficiency-corrected and with the use of a universal reference sample (commercial complementary DNA (cDNA permits the normalization of results between different batches and between different instruments--regardless of potential differences in transcript amplification efficiency. Modifications of the input quantity method include (1 the achievement of absolute quantification and (2 a non-efficiency corrected analysis. When compared to other commonly used algorithms the input quantity method proved to be valid. This method is of particular value for clinical studies of whole blood and circulating leukocytes where cell counts are readily available.
Morelli, Michael S; Rouster, Susan D; Giannella, Ralph A; Sherman, Kenneth E
2004-08-01
Clostridium difficile is a common cause of diarrhea in hospitalized patients and is associated with significant morbidity and cost. The current diagnostic standard, enzyme immunoassay (EIA), has low sensitivity, leading to duplicate testing and empiric treatment. We sought to show the usefulness and potential cost effectiveness of polymerase chain reaction (PCR) amplification of toxin B gene for diagnosis of C. difficile-induced diarrhea. A total of 148 stool samples from academic and community-based hospitals were sent for EIA testing and were evaluated prospectively for the presence of toxin B gene by PCR. Results were compared with EIA regarding sensitivity, specificity, and predictive values. Medical charts were reviewed to determine the following: (1) number of EIAs sent per admission, (2) number sent within a 24-hour time period, and (3) how caregivers practiced based on EIA results. The mean age of 130 patients was 55 years. EIA and PCR were positive in 6.8% and 13.6% of patients, respectively. EIA sensitivity was 40%, specificity was 98%, and positive and negative predictive values were 80% and 91%, respectively. The cost of the PCR was $22/sample. Empiric treatment for C. difficile was given unnecessarily in 42% of EIA-negative results. Thirty percent of patients had 3 or more EIAs sent during their hospital admission. Of patients with multiple samples sent, 57% had more than 1 sample sent in a 24-hour period. Many physicians do not conform to practice guidelines regarding recommended diagnosis and empiric treatment of C. difficile. Toxin B gene PCR represents a more sensitive and potentially cost-effective method to diagnose C. difficile-induced diarrhea than EIA and should be considered for use as an alternative diagnostic standard.
Directory of Open Access Journals (Sweden)
Mojtaba Tahmoorespur
2016-04-01
Full Text Available Introduction Butyrivibrio fibrisolvens strains are presently recognized as the major butyrate-producing bacteria found in the rumen and digestive track of many animals and also in the human gut. In this study we reported the development of two DNA based techniques, quantitative competitive (QC PCR and absolute based Real-Time PCR, for enumerating Butyrivibrio fibrisolvens strains. Despite the recent introduction of real-time PCR method for the rapid quantification of the target DNA sequences, use of quantitative competitive PCR (QC-PCR technique continues to play an important role in nucleic acid quantification since it is more cost effective. The procedure relies on the co-amplification of the sequence of interest with a serially diluted synthetic DNA fragment of the known concentration (competitor, using the single set primers. A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the polymerase chain reaction (PCR. It monitors the amplification of a targeted DNA molecule during the PCR. Materials and Methods At first reported species-specific primers targeting the 16S rDNA region of the bacterium Butyrivibrio fibrisolvens were used for amplifying a 213 bp fragment. A DNA competitor differing by 50 bp in length from the 213 bp fragment was constructed and cloned into pTZ57R/T vector. The competitor was quantified by NanoDrop spectrophotometer and serially diluted and co-amplified by PCR with total extracted DNA from rumen fluid samples. PCR products were quantified by photographing agarose gels and analyzed with Image J software and the amount of amplified target DNA was log plotted against the amount of amplified competitor. Coefficient of determination (R2 was used as a criterion of methodology precision. For developing the Real-time PCR technique, the 213 bp fragment was amplified and cloned into pTZ57R/T was used to draw a standard curve. Results and Discussion The specific primers of Butyrivibrio
Quantification of Xylella fastidiosa from Citrus Trees by Real-Time Polymerase Chain Reaction Assay.
Oliveira, Antonio C; Vallim, Marcelo A; Semighini, Camile P; Araújo, Welington L; Goldman, Gustavo H; Machado, Marcos A
2002-10-01
ABSTRACT Xylella fastidiosa is the causal agent of citrus variegated chlorosis (CVC), a destructive disease of sweet orange cultivars in Brazil. Polymerase chain reaction (PCR)-based assays constitute the principal diagnostic method for detection of these bacteria. In this work, we established a real-time quantitative PCR (QPCR) assay to quantify X. fastidiosa in naturally and artificially infected citrus. The X. fastidiosa cell number detected in the leaves increased according to the age of the leaf, and bacteria were not detected in the upper midrib section in young leaves, indicating temporal and spatial distribution patterns of bacteria, respectively. In addition, the X. fastidiosa cell number quantified in leaves of 'Pera' orange and 'Murcott' tangor reflected the susceptible and resistant status of these citrus cultivars. None of the 12 endophytic citrus bacteria or the four strains of X. fastidiosa nonpathogenic to citrus that were tested showed an increase in the fluorescence signal during QPCR. In contrast, all 10 CVC-causing strains exhibited an increase in fluorescence signal, thus indicating the specificity of this QPCR assay. Our QPCR provides a powerful tool for studies of different aspects of the Xylella-citrus interactions, and can be incorporated into breeding programs in order to select CVC-resistant plants more quickly.
IDENTIFIKASI TIPE HLA KELAS II DENGAN TEKNIK PCR
Directory of Open Access Journals (Sweden)
Ervi Salwati
2012-09-01
Full Text Available HLA (Human Leukocyte Antigen contains a set of genes located together on the short arm of chromosome 6. These genes control immune responses, graft acceptance or rejection and tumor surveillance. These abilities have close relationship with genetic variation (occur in "many forms" or alleles that bind and present antigens to T lymphocytes. Using advanced technology and molecular biology approaches (PCR technique detection of genetic variation in the HLA region (or HLA typing has been performed based on DNA.. PCR is an in vitro technique to amplify the DNA sequence enzymatically. "Sequence Specific Primers" (SSP are designed for this PCR to obtain amplification of specific alleles or groups of alleles. The PCR products are visualized through agarose gel electrophoresis stained with ethidium bromide. The PCR technique requires small amount of whole blood (0.5 - 1 ml, gives rapid, accurate and complete result. This paper discuss identification of HLA class II typing using PCR-SSP technique and show the examples of the results. Key words: HLA (Human Leukocyte Antigen class II, PCR (Polymerase Chain Reaction
U.S. Environmental Protection Agency — Quantitative polymerase chain reaction (qPCR) has become a frequently used technique for quantifying enterococci in recreational surface waters, but there are...