Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B
2015-01-01
A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.
DEFF Research Database (Denmark)
Bernal Giraldo, Adriana Jimena; Yoo, Cheol-Min; Mutwil, Marek
2008-01-01
A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from that pre......A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from...... for insertions in these genes were partially rescued by reduced temperature growth. However, this was not the case for a double mutant homozygous for insertions in both CSLD2 and CSLD3, suggesting that there may be partial redundancy in the functions of these genes. Mutants in CSLD1 and CSLD4 had a defect...
Energy Technology Data Exchange (ETDEWEB)
Nicholas C Carpita
2009-04-20
Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.
Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants
Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE
2007-07-10
Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
Mokshina, Natalia; Gorshkova, Tatyana; Deyholos, Michael K
2014-01-01
Plant chitinases (EC 3.2.1.14) and chitinase-like (CTL) proteins have diverse functions including cell wall biosynthesis and disease resistance. We analyzed the expression of 34 chitinase and chitinase-like genes of flax (collectively referred to as LusCTLs), belonging to glycoside hydrolase family 19 (GH19). Analysis of the transcript expression patterns of LusCTLs in the stem and other tissues identified three transcripts (LusCTL19, LusCTL20, LusCTL21) that were highly enriched in developing bast fibers, which form cellulose-rich gelatinous-type cell walls. The same three genes had low relative expression in tissues with primary cell walls and in xylem, which forms a xylan type of secondary cell wall. Phylogenetic analysis of the LusCTLs identified a flax-specific sub-group that was not represented in any of other genomes queried. To provide further context for the gene expression analysis, we also conducted phylogenetic and expression analysis of the cellulose synthase (CESA) family genes of flax, and found that expression of secondary wall-type LusCESAs (LusCESA4, LusCESA7 and LusCESA8) was correlated with the expression of two LusCTLs (LusCTL1, LusCTL2) that were the most highly enriched in xylem. The expression of LusCTL19, LusCTL20, and LusCTL21 was not correlated with that of any CESA subgroup. These results defined a distinct type of CTLs that may have novel functions specific to the development of the gelatinous (G-type) cellulosic walls.
Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants
Energy Technology Data Exchange (ETDEWEB)
Somerville, Chris R.; Scieble, Wolf
2000-10-11
Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw
Directory of Open Access Journals (Sweden)
Yanjing Su
2012-06-01
Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.
Kaur, Simerjeet; Dhugga, Kanwarpal S; Beech, Robin; Singh, Jaswinder
2017-11-03
Hemicelluloses are a diverse group of complex, non-cellulosic polysaccharides, which constitute approximately one-third of the plant cell wall and find use as dietary fibres, food additives and raw materials for biofuels. Genes involved in hemicellulose synthesis have not been extensively studied in small grain cereals. In efforts to isolate the sequences for the cellulose synthase-like (Csl) gene family from wheat, we identified 108 genes (hereafter referred to as TaCsl). Each gene was represented by two to three homeoalleles, which are named as TaCslXY_ZA, TaCslXY_ZB, or TaCslXY_ZD, where X denotes the Csl subfamily, Y the gene number and Z the wheat chromosome where it is located. A quarter of these genes were predicted to have 2 to 3 splice variants, resulting in a total of 137 putative translated products. Approximately 45% of TaCsl genes were located on chromosomes 2 and 3. Sequences from the subfamilies C and D were interspersed between the dicots and grasses but those from subfamily A clustered within each group of plants. Proximity of the dicot-specific subfamilies B and G, to the grass-specific subfamilies H and J, respectively, points to their common origin. In silico expression analysis in different tissues revealed that most of the genes were expressed ubiquitously and some were tissue-specific. More than half of the genes had introns in phase 0, one-third in phase 2, and a few in phase 1. Detailed characterization of the wheat Csl genes has enhanced the understanding of their structural, functional, and evolutionary features. This information will be helpful in designing experiments for genetic manipulation of hemicellulose synthesis with the goal of developing improved cultivars for biofuel production and increased tolerance against various stresses.
Endler, Anne; Schneider, Rene; Kesten, Christopher; Lampugnani, Edwin R.; Persson, Staffan
2016-01-01
Cellulose is a cell wall constituent that is essential for plant growth and development, and an important raw material for a range of industrial applications. Cellulose is synthesized at the plasma membrane by massive cellulose synthase (CesA) complexes that track along cortical microtubules in elongating cells of Arabidopsis through the activity of the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1). In a recent study we identified another family of proteins that also are associated with the ...
Formation of wood secondary cell wall may involve two type cellulose synthase complexes in Populus.
Xi, Wang; Song, Dongliang; Sun, Jiayan; Shen, Junhui; Li, Laigeng
2017-03-01
Cellulose biosynthesis is mediated by cellulose synthases (CesAs), which constitute into rosette-like cellulose synthase complexe (CSC) on the plasma membrane. Two types of CSCs in Arabidopsis are believed to be involved in cellulose synthesis in the primary cell wall and secondary cell walls, respectively. In this work, we found that the two type CSCs participated cellulose biosynthesis in differentiating xylem cells undergoing secondary cell wall thickening in Populus. During the cell wall thickening process, expression of one type CSC genes increased while expression of the other type CSC genes decreased. Suppression of different type CSC genes both affected the wall-thickening and disrupted the multilaminar structure of the secondary cell walls. When CesA7A was suppressed, crystalline cellulose content was reduced, which, however, showed an increase when CesA3D was suppressed. The CesA suppression also affected cellulose digestibility of the wood cell walls. The results suggest that two type CSCs are involved in coordinating the cellulose biosynthesis in formation of the multilaminar structure in Populus wood secondary cell walls.
Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.
2015-01-01
Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the
Isolation of developing secondary xylem specific cellulose synthase ...
Indian Academy of Sciences (India)
The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from .... the First strand cDNA synthesis kit (Fermentas, Pittsburgh,. USA). .... ing height of the rooted cutting, girth of the stem, leaf area.
Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey
2015-12-01
Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
[Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].
Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V
2014-01-01
Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.
Energy Technology Data Exchange (ETDEWEB)
Richard L. Blanton
2004-02-19
OAK-B135 The major accomplishments of this project were: (1) the initial characterization of dcsA, the gene for the putative catalytic subunit of cellulose synthase in the cellular slime mold Dictyostelium discoideum; (2) the detection of a developmentally regulated event (unidentified, but perhaps a protein modification or association with a protein partner) that is required for cellulose synthase activity (i.e., the dcsA product is necessary, but not sufficient for cellulose synthesis); (3) the continued exploration of the developmental context of cellulose synthesis and DcsA; (4) the isolation of a GFP-DcsA-expressing strain (work in progress); and (5) the identification of Dictyostelium homologues for plant genes whose products play roles in cellulose biosynthesis. Although our progress was slow and many of our results negative, we did develop a number of promising avenues of investigation that can serve as the foundation for future projects.
Galinousky, Dmitry; Padvitski, Tsimafei; Bayer, Galina; Pirko, Yaroslav; Pydiura, Nikolay; Anisimova, Natallia; Nikitinskaya, Tatyana; Khotyleva, Liubov; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav
2017-08-09
Fiber flax is an important source of natural fiber and a comprehensive model for the plant fiber biogenesis studies. Cellulose-synthase (CesA) and cytoskeletal genes are known to be important for the cell wall biogenesis in general and for the biogenesis of flax fibers in particular. Currently, knowledge about activity of these genes during the plant growth is limited. In this study, we have investigated flax fiber biogenesis by measuring expression of CesA and cytoskeletal genes at two stages of the flax development (seedlings and stems at the rapid growth stage) in several flax subspecies (elongatum, mediterraneum, crepitans). RT-qPCR has been used to quantify the expression of LusСesA1, LusСesA4, LusСesA7, LusСesA6, Actin, and α-Tubulin genes in plant samples. We report that CesA genes responsible for the secondary cell wall synthesis (LusCesA4, LusCesA7) have different expression pattern compared with CesA genes responsible for the primary cell wall synthesis (LusCesA1, LusCesA6): an average expression of LusCesA4 and LusCesA7 genes is relatively high in seedlings and further increases in stems at the rapid growth stage, whereas an average expression of LusCesA1 and LusCesA6 genes decreases. Interestingly, LusCesA1 is the only studied gene with different expression dynamics between the flax subspecies: its expression decreases by 5.2-10.7 folds in elongatum and mediterraneum but does not change in crepitans subspecies when the rapid growth stage and seedlings are compared. The expression of cytoskeleton genes (coding actin and α-tubulin) is relatively stable and significantly higher than the expression of cellulose-synthase genes in all the studied samples. © 2017 International Federation for Cell Biology.
Characterization of Cellulose Synthesis in Plant Cells
Maleki, Samaneh Sadat; Mohammadi, Kourosh; Ji, Kong-shu
2016-01-01
Cellulose is the most significant structural component of plant cell wall. Cellulose, polysaccharide containing repeated unbranched β (1-4) D-glucose units, is synthesized at the plasma membrane by the cellulose synthase complex (CSC) from bacteria to plants. The CSC is involved in biosynthesis of cellulose microfibrils containing 18 cellulose synthase (CesA) proteins. Macrofibrils can be formed with side by side arrangement of microfibrils. In addition, beside CesA, various proteins like the KORRIGAN, sucrose synthase, cytoskeletal components, and COBRA-like proteins have been involved in cellulose biosynthesis. Understanding the mechanisms of cellulose biosynthesis is of great importance not only for improving wood production in economically important forest trees to mankind but also for plant development. This review article covers the current knowledge about the cellulose biosynthesis-related gene family. PMID:27314060
Characterization of Cellulose Synthesis in Plant Cells
Directory of Open Access Journals (Sweden)
Samaneh Sadat Maleki
2016-01-01
Full Text Available Cellulose is the most significant structural component of plant cell wall. Cellulose, polysaccharide containing repeated unbranched β (1-4 D-glucose units, is synthesized at the plasma membrane by the cellulose synthase complex (CSC from bacteria to plants. The CSC is involved in biosynthesis of cellulose microfibrils containing 18 cellulose synthase (CesA proteins. Macrofibrils can be formed with side by side arrangement of microfibrils. In addition, beside CesA, various proteins like the KORRIGAN, sucrose synthase, cytoskeletal components, and COBRA-like proteins have been involved in cellulose biosynthesis. Understanding the mechanisms of cellulose biosynthesis is of great importance not only for improving wood production in economically important forest trees to mankind but also for plant development. This review article covers the current knowledge about the cellulose biosynthesis-related gene family.
Characterising the cellulose synthase complexes of cell walls
Mansoori Zangir, N.
2012-01-01
One of the characteristics of the plant kingdom is the presence of a structural cell wall. Cellulose is a major component in both the primary and secondary cell walls of plants. In higher plants cellulose is synthesized by so called rosette protein complexes with cellulose synthases (CESAs) as
Cellulose synthase complex organization and cellulose microfibril structure.
Turner, Simon; Kumar, Manoj
2018-02-13
Cellulose consists of linear chains of β-1,4-linked glucose units, which are synthesized by the cellulose synthase complex (CSC). In plants, these chains associate in an ordered manner to form the cellulose microfibrils. Both the CSC and the local environment in which the individual chains coalesce to form the cellulose microfibril determine the structure and the unique physical properties of the microfibril. There are several recent reviews that cover many aspects of cellulose biosynthesis, which include trafficking of the complex to the plasma membrane and the relationship between the movement of the CSC and the underlying cortical microtubules (Bringmann et al. 2012 Trends Plant Sci. 17 , 666-674 (doi:10.1016/j.tplants.2012.06.003); Kumar & Turner 2015 Phytochemistry 112 , 91-99 (doi:10.1016/j.phytochem.2014.07.009); Schneider et al. 2016 Curr. Opin. Plant Biol. 34 , 9-16 (doi:10.1016/j.pbi.2016.07.007)). In this review, we will focus on recent advances in cellulose biosynthesis in plants, with an emphasis on our current understanding of the structure of individual catalytic subunits together with the local membrane environment where cellulose synthesis occurs. We will attempt to relate this information to our current knowledge of the structure of the cellulose microfibril and propose a model in which variations in the structure of the CSC have important implications for the structure of the cellulose microfibril produced.This article is part of a discussion meeting issue 'New horizons for cellulose nanotechnology'. © 2017 The Author(s).
Longevity in vivo of primary cell wall cellulose synthases.
Hill, Joseph Lee; Josephs, Cooper; Barnes, William J; Anderson, Charles T; Tien, Ming
2018-02-01
Our work focuses on understanding the lifetime and thus stability of the three main cellulose synthase (CESA) proteins involved in primary cell wall synthesis of Arabidopsis. It had long been thought that a major means of CESA regulation was via their rapid degradation. However, our studies here have uncovered that AtCESA proteins are not rapidly degraded. Rather, they persist for an extended time in the plant cell. Plant cellulose is synthesized by membrane-embedded cellulose synthase complexes (CSCs). The CSC is composed of cellulose synthases (CESAs), of which three distinct isozymes form the primary cell wall CSC and another set of three isozymes form the secondary cell wall CSC. We determined the stability over time of primary cell wall (PCW) CESAs in Arabidopsis thaliana seedlings, using immunoblotting after inhibiting protein synthesis with cycloheximide treatment. Our work reveals very slow turnover for the Arabidopsis PCW CESAs in vivo. Additionally, we show that the stability of all three CESAs within the PCW CSC is altered by mutations in individual CESAs, elevated temperature, and light conditions. Together, these results suggest that CESA proteins are very stable in vivo, but that their lifetimes can be modulated by intrinsic and environmental cues.
Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V
2010-01-01
Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.
DEFF Research Database (Denmark)
Liepman, Aaron H; Nairn, C Joseph; Willats, William G T
2007-01-01
from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...
Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth
2015-09-01
Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. © 2015 American Society of Plant Biologists. All Rights Reserved.
A cellulose synthase-like protein is required for osmotic stress tolerance in Arabidopsis
Zhu, Jianhua
2010-04-16
Osmotic stress imposed by soil salinity and drought stress significantly affects plant growth and development, but osmotic stress sensing and tolerance mechanisms are not well understood. Forward genetic screens using a root-bending assay have previously identified salt overly sensitive (sos) mutants of Arabidopsis that fall into five loci, SOS1 to SOS5. These loci are required for the regulation of ion homeostasis or cell expansion under salt stress, but do not play a major role in plant tolerance to the osmotic stress component of soil salinity or drought. Here we report an additional sos mutant, sos6-1, which defines a locus essential for osmotic stress tolerance. sos6-1 plants are hypersensitive to salt stress and osmotic stress imposed by mannitol or polyethylene glycol in culture media or by water deficit in the soil. SOS6 encodes a cellulose synthase-like protein, AtCSLD5. Only modest differences in cell wall chemical composition could be detected, but we found that sos6-1 mutant plants accumulate high levels of reactive oxygen species (ROS) under osmotic stress and are hypersensitive to the oxidative stress reagent methyl viologen. The results suggest that SOS6/AtCSLD5 is not required for normal plant growth and development but has a critical role in osmotic stress tolerance and this function likely involves its regulation of ROS under stress. © 2010 Blackwell Publishing Ltd.
Mechanics of Cellulose Synthase Complexes in Living Plant Cells
Zehfroosh, Nina; Liu, Derui; Ramos, Kieran P.; Yang, Xiaoli; Goldner, Lori S.; Baskin, Tobias I.
The polymer cellulose is one of the major components of the world's biomass with unique and fascinating characteristics such as its high tensile strength, renewability, biodegradability, and biocompatibility. Because of these distinctive aspects, cellulose has been the subject of enormous scientific and industrial interest, yet there are still fundamental open questions about cellulose biosynthesis. Cellulose is synthesized by a complex of transmembrane proteins called ``Cellulose Synthase A'' (CESA) in the plasma membrane. Studying the dynamics and kinematics of the CESA complex will help reveal the mechanism of cellulose synthesis and permit the development and validation of models of CESA motility. To understand what drives these complexes through the cell membrane, we used total internal reflection fluorescence microscopy (TIRFM) and variable angle epi-fluorescence microscopy to track individual, fluorescently-labeled CESA complexes as they move in the hypocotyl and root of living plants. A mean square displacement analysis will be applied to distinguish ballistic, diffusional, and other forms of motion. We report on the results of these tracking experiments. This work was funded by NSF/PHY-1205989.
Sequence analysis of cereal sucrose synthase genes and isolation ...
African Journals Online (AJOL)
SERVER
2007-10-18
Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.
Yurkevich, Olga Y; Kirov, Ilya V; Bolsheva, Nadezhda L; Rachinskaya, Olga A; Grushetskaya, Zoya E; Zoschuk, Svyatoslav A; Samatadze, Tatiana E; Bogdanova, Marina V; Lemesh, Valentina A; Amosova, Alexandra V; Muravenko, Olga V
2017-01-01
Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase ( CesA ) multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH)-based chromosomal localization of the CesA conserved fragment (KF011584.1), 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum . Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG) 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.
Synthesis and Self-Assembly of Cellulose Microfibrils from Reconstituted Cellulose Synthase.
Cho, Sung Hyun; Purushotham, Pallinti; Fang, Chao; Maranas, Cassandra; Díaz-Moreno, Sara M; Bulone, Vincent; Zimmer, Jochen; Kumar, Manish; Nixon, B Tracy
2017-09-01
Cellulose, the major component of plant cell walls, can be converted to bioethanol and is thus highly studied. In plants, cellulose is produced by cellulose synthase, a processive family-2 glycosyltransferase. In plant cell walls, individual β-1,4-glucan chains polymerized by CesA are assembled into microfibrils that are frequently bundled into macrofibrils. An in vitro system in which cellulose is synthesized and assembled into fibrils would facilitate detailed study of this process. Here, we report the heterologous expression and partial purification of His-tagged CesA5 from Physcomitrella patens Immunoblot analysis and mass spectrometry confirmed enrichment of PpCesA5. The recombinant protein was functional when reconstituted into liposomes made from yeast total lipid extract. The functional studies included incorporation of radiolabeled Glc, linkage analysis, and imaging of cellulose microfibril formation using transmission electron microscopy. Several microfibrils were observed either inside or on the outer surface of proteoliposomes, and strikingly, several thinner fibrils formed ordered bundles that either covered the surfaces of proteoliposomes or were spawned from liposome surfaces. We also report this arrangement of fibrils made by proteoliposomes bearing CesA8 from hybrid aspen. These observations describe minimal systems of membrane-reconstituted CesAs that polymerize β-1,4-glucan chains that coalesce to form microfibrils and higher-ordered macrofibrils. How these micro- and macrofibrils relate to those found in primary and secondary plant cell walls is uncertain, but their presence enables further study of the mechanisms that govern the formation and assembly of fibrillar cellulosic structures and cell wall composites during or after the polymerization process controlled by CesA proteins. © 2017 American Society of Plant Biologists. All Rights Reserved.
Zhang, Baocai; Liu, Xiangling; Yan, Meixian; Zhang, Lanjun; Shi, Yanyun; Zhang, Mu; Qian, Qian; Li, Jiayang; Zhou, Yihua
2013-01-01
Cellulose represents the most abundant biopolymer in nature and has great economic importance. Cellulose chains pack laterally into crystalline forms, stacking into a complicated crystallographic structure. However, the mechanism of cellulose crystallization is poorly understood. Here, via functional characterization, we report that Brittle Culm1 (BC1), a COBRA-like protein in rice, modifies cellulose crystallinity. BC1 was demonstrated to be a glycosylphosphatidylinositol (GPI) anchored protein and can be released into cell walls by removal of the GPI anchor. BC1 possesses a carbohydrate-binding module (CBM) at its N-terminus. In vitro binding assays showed that this CBM interacts specifically with crystalline cellulose, and several aromatic residues in this domain are essential for binding. It was further demonstrated that cell wall-localized BC1 via the CBM and GPI anchor is one functional form of BC1. X-ray diffraction (XRD) assays revealed that mutations in BC1 and knockdown of BC1 expression decrease the crystallite width of cellulose; overexpression of BC1 and the CBM-mutated BC1s caused varied crystallinity with results that were consistent with the in vitro binding assay. Moreover, interaction between the CBM and cellulose microfibrils was largely repressed when the cell wall residues were pre-stained with two cellulose dyes. Treating wild-type and bc1 seedlings with the dyes resulted in insensitive root growth responses in bc1 plants. Combined with the evidence that BC1 and three secondary wall cellulose synthases (CESAs) function in different steps of cellulose production as revealed by genetic analysis, we conclude that BC1 modulates cellulose assembly by interacting with cellulose and affecting microfibril crystallinity. PMID:23990797
Directory of Open Access Journals (Sweden)
Lifeng Liu
Full Text Available Cellulose represents the most abundant biopolymer in nature and has great economic importance. Cellulose chains pack laterally into crystalline forms, stacking into a complicated crystallographic structure. However, the mechanism of cellulose crystallization is poorly understood. Here, via functional characterization, we report that Brittle Culm1 (BC1, a COBRA-like protein in rice, modifies cellulose crystallinity. BC1 was demonstrated to be a glycosylphosphatidylinositol (GPI anchored protein and can be released into cell walls by removal of the GPI anchor. BC1 possesses a carbohydrate-binding module (CBM at its N-terminus. In vitro binding assays showed that this CBM interacts specifically with crystalline cellulose, and several aromatic residues in this domain are essential for binding. It was further demonstrated that cell wall-localized BC1 via the CBM and GPI anchor is one functional form of BC1. X-ray diffraction (XRD assays revealed that mutations in BC1 and knockdown of BC1 expression decrease the crystallite width of cellulose; overexpression of BC1 and the CBM-mutated BC1s caused varied crystallinity with results that were consistent with the in vitro binding assay. Moreover, interaction between the CBM and cellulose microfibrils was largely repressed when the cell wall residues were pre-stained with two cellulose dyes. Treating wild-type and bc1 seedlings with the dyes resulted in insensitive root growth responses in bc1 plants. Combined with the evidence that BC1 and three secondary wall cellulose synthases (CESAs function in different steps of cellulose production as revealed by genetic analysis, we conclude that BC1 modulates cellulose assembly by interacting with cellulose and affecting microfibril crystallinity.
Liu, Lifeng; Shang-Guan, Keke; Zhang, Baocai; Liu, Xiangling; Yan, Meixian; Zhang, Lanjun; Shi, Yanyun; Zhang, Mu; Qian, Qian; Li, Jiayang; Zhou, Yihua
2013-01-01
Cellulose represents the most abundant biopolymer in nature and has great economic importance. Cellulose chains pack laterally into crystalline forms, stacking into a complicated crystallographic structure. However, the mechanism of cellulose crystallization is poorly understood. Here, via functional characterization, we report that Brittle Culm1 (BC1), a COBRA-like protein in rice, modifies cellulose crystallinity. BC1 was demonstrated to be a glycosylphosphatidylinositol (GPI) anchored protein and can be released into cell walls by removal of the GPI anchor. BC1 possesses a carbohydrate-binding module (CBM) at its N-terminus. In vitro binding assays showed that this CBM interacts specifically with crystalline cellulose, and several aromatic residues in this domain are essential for binding. It was further demonstrated that cell wall-localized BC1 via the CBM and GPI anchor is one functional form of BC1. X-ray diffraction (XRD) assays revealed that mutations in BC1 and knockdown of BC1 expression decrease the crystallite width of cellulose; overexpression of BC1 and the CBM-mutated BC1s caused varied crystallinity with results that were consistent with the in vitro binding assay. Moreover, interaction between the CBM and cellulose microfibrils was largely repressed when the cell wall residues were pre-stained with two cellulose dyes. Treating wild-type and bc1 seedlings with the dyes resulted in insensitive root growth responses in bc1 plants. Combined with the evidence that BC1 and three secondary wall cellulose synthases (CESAs) function in different steps of cellulose production as revealed by genetic analysis, we conclude that BC1 modulates cellulose assembly by interacting with cellulose and affecting microfibril crystallinity.
Directory of Open Access Journals (Sweden)
Olga Y. Yurkevich
2017-08-01
Full Text Available Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase (CesA multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH-based chromosomal localization of the CesA conserved fragment (KF011584.1, 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum. Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.
DEFF Research Database (Denmark)
Bernal Giraldo, Adriana Jimena; Jensen, Jacob Krüger; Harholt, Jesper
2007-01-01
Members of a large family of cellulose synthase-like genes (CSLs) are predicted to encode glycosyl transferases (GTs) involved in the biosynthesis of plant cell walls. The CSLA and CSLF families are known to contain mannan and glucan synthases, respectively, but the products of other CSLs...... are unknown. Here we report the effects of disrupting ATCSLD5 expression in Arabidopsis. Both stem and root growth were significantly reduced in ATCSLD5 knock-out plants, and these plants also had increased susceptibility to the cellulose synthase inhibitor isoxaben. Antibody and carbohydrate-binding module...
Sajadi, Elaheh; Babaipour, Valiollah; Deldar, Ali Asghar; Yakhchali, Bagher; Fatemi, Seyed Safa-Ali
2017-09-01
To evaluate the crystallinity index of the cellulose produced by Escherichia coli Nissle 1917 after heterologous expression of the cellulose synthase subunit D (bcsD) gene of Gluconacetobacter xylinus BPR2001. The bcsD gene of G. xylinus BPR2001 was expressed in E. coli and its protein product was visualized using SDS-PAGE. FTIR analysis showed that the crystallinity index of the cellulose produced by the recombinants was 0.84, which is 17% more than that of the wild type strain. The increased crystallinity index was also confirmed by X-ray diffraction analysis. The cellulose content was not changed significantly after over-expressing the bcsD. The bcsD gene can improve the crystalline structure of the bacterial cellulose but there is not any significant difference between the amounts of cellulose produced by the recombinant and wild type E. coli Nissle 1917.
Bacterial cellulose biosynthesis: diversity of operons, subunits, products and functions
Römling, Ute; Galperin, Michael Y.
2015-01-01
Summary Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits – which differ among various taxa – affect the enzymatic activity and product yield in vivo by modulating expression of biosynthesis apparatus, export of the nascent β-D-glucan polymer to the cell surface, and the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of the resulting biofilm, which is particularly important for interactions of bacteria with higher organisms that lead to rhizosphere colonization and modulate virulence of cellulose-producing bacterial pathogens inside and outside of host cells. Here we review the organization of four principal types of cellulose synthase operons found in various bacterial genomes, identify additional bcs genes that encode likely components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms formed by a variety of free-living and pathogenic bacteria and, for the latter, in the choice between acute infection and persistence in the host. PMID:26077867
Cellulose synthases: new insights from crystallography and modeling.
Slabaugh, Erin; Davis, Jonathan K; Haigler, Candace H; Yingling, Yaroslava G; Zimmer, Jochen
2014-02-01
Detailed information about the structure and biochemical mechanisms of cellulose synthase (CelS) proteins remained elusive until a complex containing the catalytic subunit (BcsA) of CelS from Rhodobacter sphaeroides was crystalized. Additionally, a 3D structure of most of the cytosolic domain of a plant CelS (GhCESA1 from cotton, Gossypium hirsutum) was produced by computational modeling. This predicted structure contributes to our understanding of how plant CelS proteins may be similar and different as compared with BcsA. In this review, we highlight how these structures impact our understanding of the synthesis of cellulose and other extracellular polysaccharides. We show how the structures can be used to generate hypotheses for experiments testing mechanisms of glucan synthesis and translocation in plant CelS. Copyright © 2013 Elsevier Ltd. All rights reserved.
Hernández-Blanco, Camilo; Feng, Dong Xin; Hu, Jian; Sánchez-Vallet, Andrea; Deslandes, Laurent; Llorente, Francisco; Berrocal-Lobo, Marta; Keller, Harald; Barlet, Xavier; Sánchez-Rodríguez, Clara; Anderson, Lisa K.; Somerville, Shauna; Marco, Yves; Molina, Antonio
2007-01-01
Cellulose is synthesized by cellulose synthases (CESAs) contained in plasma membrane–localized complexes. In Arabidopsis thaliana, three types of CESA subunits (CESA4/IRREGULAR XYLEM5 [IRX5], CESA7/IRX3, and CESA8/IRX1) are required for secondary cell wall formation. We report that mutations in these proteins conferred enhanced resistance to the soil-borne bacterium Ralstonia solanacearum and the necrotrophic fungus Plectosphaerella cucumerina. By contrast, susceptibility to these pathogens was not altered in cell wall mutants of primary wall CESA subunits (CESA1, CESA3/ISOXABEN RESISTANT1 [IXR1], and CESA6/IXR2) or POWDERY MILDEW–RESISTANT5 (PMR5) and PMR6 genes. Double mutants indicated that irx-mediated resistance was independent of salicylic acid, ethylene, and jasmonate signaling. Comparative transcriptomic analyses identified a set of common irx upregulated genes, including a number of abscisic acid (ABA)–responsive, defense-related genes encoding antibiotic peptides and enzymes involved in the synthesis and activation of antimicrobial secondary metabolites. These data as well as the increased susceptibility of ABA mutants (abi1-1, abi2-1, and aba1-6) to R. solanacearum support a direct role of ABA in resistance to this pathogen. Our results also indicate that alteration of secondary cell wall integrity by inhibiting cellulose synthesis leads to specific activation of novel defense pathways that contribute to the generation of an antimicrobial-enriched environment hostile to pathogens. PMID:17351116
Synthesis and Self-Assembly of Cellulose Microfibrils from Reconstituted Cellulose Synthase1[OPEN
Purushotham, Pallinti; Fang, Chao; Maranas, Cassandra; Bulone, Vincent
2017-01-01
Cellulose, the major component of plant cell walls, can be converted to bioethanol and is thus highly studied. In plants, cellulose is produced by cellulose synthase, a processive family-2 glycosyltransferase. In plant cell walls, individual β-1,4-glucan chains polymerized by CesA are assembled into microfibrils that are frequently bundled into macrofibrils. An in vitro system in which cellulose is synthesized and assembled into fibrils would facilitate detailed study of this process. Here, we report the heterologous expression and partial purification of His-tagged CesA5 from Physcomitrella patens. Immunoblot analysis and mass spectrometry confirmed enrichment of PpCesA5. The recombinant protein was functional when reconstituted into liposomes made from yeast total lipid extract. The functional studies included incorporation of radiolabeled Glc, linkage analysis, and imaging of cellulose microfibril formation using transmission electron microscopy. Several microfibrils were observed either inside or on the outer surface of proteoliposomes, and strikingly, several thinner fibrils formed ordered bundles that either covered the surfaces of proteoliposomes or were spawned from liposome surfaces. We also report this arrangement of fibrils made by proteoliposomes bearing CesA8 from hybrid aspen. These observations describe minimal systems of membrane-reconstituted CesAs that polymerize β-1,4-glucan chains that coalesce to form microfibrils and higher-ordered macrofibrils. How these micro- and macrofibrils relate to those found in primary and secondary plant cell walls is uncertain, but their presence enables further study of the mechanisms that govern the formation and assembly of fibrillar cellulosic structures and cell wall composites during or after the polymerization process controlled by CesA proteins. PMID:28768815
The Tomato Terpene Synthase Gene Family1[W][OA
Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran
2011-01-01
Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655
Li, Ao; Wang, Ruyi; Li, Xianliang; Liu, Mingyong; Fan, Jian; Guo, Kai; Luo, Bing; Chen, Tingting; Feng, Shengqiu; Wang, Yanting; Wang, Bingrui; Peng, Liangcai; Xia, Tao
2016-05-19
Cotton fibers are an excellent model for understanding of cellulose biosynthesis in higher plants. In this study, we determined a high cellulose biosynthesis activity in vitro by optimizing biochemical reaction conditions in cotton fibers. By adding a commercial cellulase enzyme into fibers extraction process, we extracted markedly higher levels of GhCESA1 and GhCESA8 proteins and observed an increase in β-1,4-glucan and β-1,3-glucan products in vitro. LC-MS/MS analysis of anti-GhCESA8-immunoprecipitated proteins showed that 19 proteins could be found in three independent experiments including four CESAs (GhCESA1,2,7,8), five well-known non-CESA proteins, one callose synthase (CALS) and nine novel proteins. Notably, upon the cellulase treatment, four CESAs, one CALS and four novel proteins were measured at relatively higher levels by calculating total peptide counts and distinct peptide numbers, indicating that the cellulase-aid-extracted proteins most likely contribute to the increase in β-glucan products in vitro. These results suggest that the cellulase treatment may aid to release active cellulose synthases complexes from growing glucan chains and make them more amenable to extraction. To our knowledge, it is the first time report about the functional identification of the potential proteins that were associated with plant cellulose and callose synthases complexes by using the cellulase-aided protein extraction.
Cellulose synthesis genes CESA6 and CSI1 are important for salt stress tolerance in Arabidopsis.
Zhang, Shuang-Shuang; Sun, Le; Dong, Xinran; Lu, Sun-Jie; Tian, Weidong; Liu, Jian-Xiang
2016-07-01
Two salt hypersensitive mutants she1 and she2 were identified through genetic screening. SHE1 encodes a cellulose synthase CESA6 while SHE2 encodes a cellulose synthase-interactive protein CSI1. Both of them are involved in cellulose deposition. Our results demonstrated that the sustained cellulose synthesis is important for salt stress tolerance in Arabidopsis. © 2015 Institute of Botany, Chinese Academy of Sciences.
Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori
2016-11-18
Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins. Copyright © 2016 Elsevier Inc. All rights reserved.
Tran, Mai L; McCarthy, Thomas W; Sun, Hao; Wu, Shu-Zon; Norris, Joanna H; Bezanilla, Magdalena; Vidali, Luis; Anderson, Charles T; Roberts, Alison W
2018-01-15
Results from live cell imaging of fluorescently tagged Cellulose Synthase (CESA) proteins in Cellulose Synthesis Complexes (CSCs) have enhanced our understanding of cellulose biosynthesis, including the mechanisms of action of cellulose synthesis inhibitors. However, this method has been applied only in Arabidopsis thaliana and Brachypodium distachyon thus far. Results from freeze fracture electron microscopy of protonemal filaments of the moss Funaria hygrometrica indicate that a cellulose synthesis inhibitor, 2,6-dichlorobenzonitrile (DCB), fragments CSCs and clears them from the plasma membrane. This differs from Arabidopsis, in which DCB causes CSC accumulation in the plasma membrane and a different cellulose synthesis inhibitor, isoxaben, clears CSCs from the plasma membrane. In this study, live cell imaging of the moss Physcomitrella patens indicated that DCB and isoxaben have little effect on protonemal growth rates, and that only DCB causes tip rupture. Live cell imaging of mEGFP-PpCESA5 and mEGFP-PpCESA8 showed that DCB and isoxaben substantially reduced CSC movement, but had no measureable effect on CSC density in the plasma membrane. These results suggest that DCB and isoxaben have similar effects on CSC movement in P. patens and Arabidopsis, but have different effects on CSC intracellular trafficking, cell growth and cell integrity in these divergent plant lineages.
Directory of Open Access Journals (Sweden)
Xuemei Liu
2012-09-01
Full Text Available Cellulose synthase (CESA, which is an essential catalyst for the generation of plant cell wall biomass, is mainly encoded by the CesA gene family that contains ten or more members. In this study; four full-length cDNAs encoding CESA were isolated from Betula platyphylla Suk., which is an important timber species, using RT-PCR combined with the RACE method and were named as BplCesA3, −4, −7 and −8. These deduced CESAs contained the same typical domains and regions as their Arabidopsis homologs. The cDNA lengths differed among these four genes, as did the locations of the various protein domains inferred from the deduced amino acid sequences, which shared amino acid sequence identities ranging from only 63.8% to 70.5%. Real-time RT-PCR showed that all four BplCesAs were expressed at different levels in diverse tissues. Results indicated that BplCESA8 might be involved in secondary cell wall biosynthesis and floral development. BplCESA3 appeared in a unique expression pattern and was possibly involved in primary cell wall biosynthesis and seed development; it might also be related to the homogalacturonan synthesis. BplCESA7 and BplCESA4 may be related to the formation of a cellulose synthase complex and participate mainly in secondary cell wall biosynthesis. The extremely low expression abundance of the four BplCESAs in mature pollen suggested very little involvement of them in mature pollen formation in Betula. The distinct expression pattern of the four BplCesAs suggested they might participate in developments of various tissues and that they are possibly controlled by distinct mechanisms in Betula.
Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).
Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq
2017-08-01
Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.
Cellulose biosynthesis in higher plants
Directory of Open Access Journals (Sweden)
Krystyna Kudlicka
2014-01-01
Full Text Available Knowledge of the control and regulation of cellulose synthesis is fundamental to an understanding of plant development since cellulose is the primary structural component of plant cell walls. In vivo, the polymerization step requires a coordinated transport of substrates across membranes and relies on delicate orientations of the membrane-associated synthase complexes. Little is known about the properties of the enzyme complexes, and many questions about the biosynthesis of cell wall components at the cell surface still remain unanswered. Attempts to purify cellulose synthase from higher plants have not been successful because of the liability of enzymes upon isolation and lack of reliable in vitro assays. Membrane preparations from higher plant cells incorporate UDP-glucose into a glucan polymer, but this invariably turns out to be predominantly β -1,3-linked rather than β -1,4-linked glucans. Various hypotheses have been advanced to explain this phenomenon. One idea is that callose and cellulose-synthase systems are the same, but cell disruption activates callose synthesis preferentially. A second concept suggests that a regulatory protein as a part of the cellulose-synthase complex is rapidly degraded upon cell disruption. With new methods of enzyme isolation and analysis of the in vitro product, recent advances have been made in the isolation of an active synthase from the plasma membrane whereby cellulose synthase was separated from callose synthase.
Cellulose Synthesis in Agrobacterium tumefaciens
Energy Technology Data Exchange (ETDEWEB)
Alan R. White; Ann G. Matthysse
2004-07-31
We have cloned the celC gene and its homologue from E. coli, yhjM, in an expression vector and expressed the both genes in E. coli; we have determined that the YhjM protein is able to complement in vitro cellulose synthesis by extracts of A. tumefaciens celC mutants, we have purified the YhjM protein product and are currently examining its enzymatic activity; we have examined whole cell extracts of CelC and various other cellulose mutants and wild type bacteria for the presence of cellulose oligomers and cellulose; we have examined the ability of extracts of wild type and cellulose mutants including CelC to incorporate UDP-14C-glucose into cellulose and into water-soluble, ethanol-insoluble oligosaccharides; we have made mutants which synthesize greater amounts of cellulose than the wild type; and we have examined the role of cellulose in the formation of biofilms by A. tumefaciens. In addition we have examined the ability of a putative cellulose synthase gene from the tunicate Ciona savignyi to complement an A. tumefaciens celA mutant. The greatest difference between our knowledge of bacterial cellulose synthesis when we started this project and current knowledge is that in 1999 when we wrote the original grant very few bacteria were known to synthesize cellulose and genes involved in this synthesis were sequenced only from Acetobacter species, A. tumefaciens and Rhizobium leguminosarum. Currently many bacteria are known to synthesize cellulose and genes that may be involved have been sequenced from more than 10 species of bacteria. This additional information has raised the possibility of attempting to use genes from one bacterium to complement mutants in another bacterium. This will enable us to examine the question of which genes are responsible for the three dimensional structure of cellulose (since this differs among bacterial species) and also to examine the interactions between the various proteins required for cellulose synthesis. We have carried out one
Ben-Tov, Daniela; Abraham, Yael; Stav, Shira; Thompson, Kevin; Loraine, Ann; Elbaum, Rivka; de Souza, Amancio; Pauly, Markus; Kieber, Joseph J; Harpaz-Saad, Smadar
2015-03-01
Differentiation of the maternally derived seed coat epidermal cells into mucilage secretory cells is a common adaptation in angiosperms. Recent studies identified cellulose as an important component of seed mucilage in various species. Cellulose is deposited as a set of rays that radiate from the seed upon mucilage extrusion, serving to anchor the pectic component of seed mucilage to the seed surface. Using transcriptome data encompassing the course of seed development, we identified COBRA-LIKE2 (COBL2), a member of the glycosylphosphatidylinositol-anchored COBRA-LIKE gene family in Arabidopsis (Arabidopsis thaliana), as coexpressed with other genes involved in cellulose deposition in mucilage secretory cells. Disruption of the COBL2 gene results in substantial reduction in the rays of cellulose present in seed mucilage, along with an increased solubility of the pectic component of the mucilage. Light birefringence demonstrates a substantial decrease in crystalline cellulose deposition into the cellulosic rays of the cobl2 mutants. Moreover, crystalline cellulose deposition into the radial cell walls and the columella appears substantially compromised, as demonstrated by scanning electron microscopy and in situ quantification of light birefringence. Overall, the cobl2 mutants display about 40% reduction in whole-seed crystalline cellulose content compared with the wild type. These data establish that COBL2 plays a role in the deposition of crystalline cellulose into various secondary cell wall structures during seed coat epidermal cell differentiation. © 2015 American Society of Plant Biologists. All Rights Reserved.
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Deng, Ying; Nagachar, Nivedita; Fang, Lin; Luan, Xin; Catchmark, Jeffrey M.; Tien, Ming; Kao, Teh-hui
2015-01-01
Gluconacetobacter hansenii, a Gram-negative bacterium, produces and secrets highly crystalline cellulose into growth medium, and has long been used as a model system for studying cellulose synthesis in higher plants. Cellulose synthesis involves the formation of β-1,4 glucan chains via the polymerization of glucose units by a multi-enzyme cellulose synthase complex (CSC). These glucan chains assemble into ordered structures including crystalline microfibrils. AcsA is the catalytic subunit of the cellulose synthase enzymes in the CSC, and AcsC is required for the secretion of cellulose. However, little is known about other proteins required for the assembly of crystalline cellulose. To address this question, we visually examined cellulose pellicles formed in growth media of 763 individual colonies of G. hansenii generated via Tn5 transposon insertion mutagenesis, and identified 85 that produced cellulose with altered morphologies. X-ray diffraction analysis of these 85 mutants identified two that produced cellulose with significantly lower crystallinity than wild type. The gene disrupted in one of these two mutants encoded a lysine decarboxylase and that in the other encoded an alanine racemase. Solid-state NMR analysis revealed that cellulose produced by these two mutants contained increased amounts of non-crystalline cellulose and monosaccharides associated with non-cellulosic polysaccharides as compared to the wild type. Monosaccharide analysis detected higher percentages of galactose and mannose in cellulose produced by both mutants. Field emission scanning electron microscopy showed that cellulose produced by the mutants was unevenly distributed, with some regions appearing to contain deposition of non-cellulosic polysaccharides; however, the width of the ribbon was comparable to that of normal cellulose. As both lysine decarboxylase and alanine racemase are required for the integrity of peptidoglycan, we propose a model for the role of peptidoglycan in the
Directory of Open Access Journals (Sweden)
Ying Deng
Full Text Available Gluconacetobacter hansenii, a Gram-negative bacterium, produces and secrets highly crystalline cellulose into growth medium, and has long been used as a model system for studying cellulose synthesis in higher plants. Cellulose synthesis involves the formation of β-1,4 glucan chains via the polymerization of glucose units by a multi-enzyme cellulose synthase complex (CSC. These glucan chains assemble into ordered structures including crystalline microfibrils. AcsA is the catalytic subunit of the cellulose synthase enzymes in the CSC, and AcsC is required for the secretion of cellulose. However, little is known about other proteins required for the assembly of crystalline cellulose. To address this question, we visually examined cellulose pellicles formed in growth media of 763 individual colonies of G. hansenii generated via Tn5 transposon insertion mutagenesis, and identified 85 that produced cellulose with altered morphologies. X-ray diffraction analysis of these 85 mutants identified two that produced cellulose with significantly lower crystallinity than wild type. The gene disrupted in one of these two mutants encoded a lysine decarboxylase and that in the other encoded an alanine racemase. Solid-state NMR analysis revealed that cellulose produced by these two mutants contained increased amounts of non-crystalline cellulose and monosaccharides associated with non-cellulosic polysaccharides as compared to the wild type. Monosaccharide analysis detected higher percentages of galactose and mannose in cellulose produced by both mutants. Field emission scanning electron microscopy showed that cellulose produced by the mutants was unevenly distributed, with some regions appearing to contain deposition of non-cellulosic polysaccharides; however, the width of the ribbon was comparable to that of normal cellulose. As both lysine decarboxylase and alanine racemase are required for the integrity of peptidoglycan, we propose a model for the role of
Niu, Erli; Shang, Xiaoguang; Cheng, Chaoze; Bao, Jianghao; Zeng, Yanda; Cai, Caiping; Du, Xiongming; Guo, Wangzhen
2015-01-01
COBRA-Like (COBL) genes, which encode a plant-specific glycosylphosphatidylinositol (GPI) anchored protein, have been proven to be key regulators in the orientation of cell expansion and cellulose crystallinity status. Genome-wide analysis has been performed in A. thaliana, O. sativa, Z. mays and S. lycopersicum, but little in Gossypium. Here we identified 19, 18 and 33 candidate COBL genes from three sequenced cotton species, diploid cotton G. raimondii, G. arboreum and tetraploid cotton G. hirsutum acc. TM-1, respectively. These COBL members were anchored onto 10 chromosomes in G. raimondii and could be divided into two subgroups. Expression patterns of COBL genes showed highly developmental and spatial regulation in G. hirsutum acc. TM-1. Of them, GhCOBL9 and GhCOBL13 were preferentially expressed at the secondary cell wall stage of fiber development and had significantly co-upregulated expression with cellulose synthase genes GhCESA4, GhCESA7 and GhCESA8. Besides, GhCOBL9 Dt and GhCOBL13 Dt were co-localized with previously reported cotton fiber quality quantitative trait loci (QTLs) and the favorable allele types of GhCOBL9 Dt had significantly positive correlations with fiber quality traits, indicating that these two genes might play an important role in fiber development. PMID:26710066
Ben-Tov, Daniela; Abraham, Yael; Stav, Shira; Thompson, Kevin; Loraine, Ann; Elbaum, Rivka; de Souza, Amancio; Pauly, Markus; Kieber, Joseph J.; Harpaz-Saad, Smadar
2015-01-01
Differentiation of the maternally derived seed coat epidermal cells into mucilage secretory cells is a common adaptation in angiosperms. Recent studies identified cellulose as an important component of seed mucilage in various species. Cellulose is deposited as a set of rays that radiate from the seed upon mucilage extrusion, serving to anchor the pectic component of seed mucilage to the seed surface. Using transcriptome data encompassing the course of seed development, we identified COBRA-LIKE2 (COBL2), a member of the glycosylphosphatidylinositol-anchored COBRA-LIKE gene family in Arabidopsis (Arabidopsis thaliana), as coexpressed with other genes involved in cellulose deposition in mucilage secretory cells. Disruption of the COBL2 gene results in substantial reduction in the rays of cellulose present in seed mucilage, along with an increased solubility of the pectic component of the mucilage. Light birefringence demonstrates a substantial decrease in crystalline cellulose deposition into the cellulosic rays of the cobl2 mutants. Moreover, crystalline cellulose deposition into the radial cell walls and the columella appears substantially compromised, as demonstrated by scanning electron microscopy and in situ quantification of light birefringence. Overall, the cobl2 mutants display about 40% reduction in whole-seed crystalline cellulose content compared with the wild type. These data establish that COBL2 plays a role in the deposition of crystalline cellulose into various secondary cell wall structures during seed coat epidermal cell differentiation. PMID:25583925
Beta-Glucan Synthase Gene Expression in Pleurotus sp
International Nuclear Information System (INIS)
Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)
Two alleles of the AtCesA3 gene in Arabidopsis thaliana display intragenic complementation.
Pysh, Leonard D
2015-09-01
Cellulose is the most abundant biomolecule on the planet, yet the mechanism by which it is synthesized by higher plants remains largely unknown. In Arabidopsis thaliana (L.) Heynh, synthesis of cellulose in the primary cell wall requires three different cellulose synthase genes (AtCesA1, AtCesA3, and AtCesA6-related genes [AtCesA2, AtCesA5, and AtCesA6]). The multiple response expansion1 (mre1) mutant contains a hypomorphic AtCesA3 allele that results in significantly shorter, expanded roots. Crosses between mre1 and another allele of AtCesA3 (constitutive expression of VSP1, cev1) yielded an F1 with roots considerably longer and thinner than either parent, suggesting intragenic complementation. The F2 generation resulting from self-crossing these F1 showed three different root phenotypes: roots like mre1, roots like cev1, and roots like the F1. The segregation patterns of the three root phenotypes in multiple F2 and F3 generations were determined. Multiple characteristics of the roots and shoots were analyzed both qualitatively and quantitatively at different developmental stages, both on plates and on soil. The trans-heterozygous plants differed significantly from the parental mre1 and cev1 lines. The two alleles display intragenic complementation. A classic genetic interpretation of these results would suggest that cellulose synthesis requires homo-multimerization of cellulose synthase monomers. © 2015 Botanical Society of America.
Directory of Open Access Journals (Sweden)
Ji Chen
Full Text Available Cotton-rapeseed or cotton-wheat double cropping systems are popular in the Yangtze River Valley and Yellow River Valley of China. Due to the competition of temperature and light resources during the growing season of double cropping system, cotton is generally late-germinating and late-maturing and has to suffer from the coupling of declining temperature and low light especially in the late growth stage. In this study, late planting (LP and shading were used to fit the coupling stress, and the coupling effect on fiber cellulose synthesis was investigated. Two cotton (Gossypium hirsutum L. cultivars were grown in the field in 2010 and 2011 at three planting dates (25 April, 25 May and 10 June each with three shading levels (normal light, declined 20% and 40% PAR. Mean daily minimum temperature was the primary environmental factor affected by LP. The coupling of LP and shading (decreased cellulose content by 7.8%-25.5% produced more severe impacts on cellulose synthesis than either stress alone, and the effect of LP (decreased cellulose content by 6.7%-20.9% was greater than shading (decreased cellulose content by 0.7%-5.6%. The coupling of LP and shading hindered the flux from sucrose to cellulose by affecting the activities of related cellulose synthesis enzymes. Fiber cellulose synthase genes expression were delayed under not only LP but shading, and the coupling of LP and shading markedly postponed and even restrained its expression. The decline of sucrose-phosphate synthase activity and its peak delay may cause cellulose synthesis being more sensitive to the coupling stress during the later stage of fiber secondary wall development (38-45 days post-anthesis. The sensitive difference of cellulose synthesis between two cultivars in response to the coupling of LP and shading may be mainly determined by the sensitiveness of invertase, sucrose-phosphate synthase and cellulose synthase.
Directory of Open Access Journals (Sweden)
Simerjeet Kaur
Full Text Available Cellulose is the primary determinant of mechanical strength in plant tissues. Late-season lodging is inversely related to the amount of cellulose in a unit length of the stem. Wheat is the most widely grown of all the crops globally, yet information on its CesA gene family is limited. We have identified 22 CesA genes from bread wheat, which include homoeologs from each of the three genomes, and named them as TaCesAXA, TaCesAXB or TaCesAXD, where X denotes the gene number and the last suffix stands for the respective genome. Sequence analyses of the CESA proteins from wheat and their orthologs from barley, maize, rice, and several dicot species (Arabidopsis, beet, cotton, poplar, potato, rose gum and soybean revealed motifs unique to monocots (Poales or dicots. Novel structural motifs CQIC and SVICEXWFA were identified, which distinguished the CESAs involved in the formation of primary and secondary cell wall (PCW and SCW in all the species. We also identified several new motifs specific to monocots or dicots. The conserved motifs identified in this study possibly play functional roles specific to PCW or SCW formation. The new insights from this study advance our knowledge about the structure, function and evolution of the CesA family in plants in general and wheat in particular. This information will be useful in improving culm strength to reduce lodging or alter wall composition to improve biofuel production.
Lam, Patricia; Young, Robin; DeBolt, Seth
2015-01-01
CELLULOSE SYNTHASE5 (CESA5) synthesizes cellulose necessary for seed mucilage adherence to seed coat epidermal cells of Arabidopsis (Arabidopsis thaliana). The involvement of additional CESA proteins in this process and details concerning the manner in which cellulose is deposited in the mucilage pocket are unknown. Here, we show that both CESA3 and CESA10 are highly expressed in this cell type at the time of mucilage synthesis and localize to the plasma membrane adjacent to the mucilage pocket. The isoxaben resistant1-1 and isoxaben resistant1-2 mutants affecting CESA3 show defects consistent with altered mucilage cellulose biosynthesis. CESA3 can interact with CESA5 in vitro, and green fluorescent protein-tagged CESA5, CESA3, and CESA10 proteins move in a linear, unidirectional fashion around the cytoplasmic column of the cell, parallel with the surface of the seed, in a pattern similar to that of cortical microtubules. Consistent with this movement, cytological evidence suggests that the mucilage is coiled around the columella and unwinds during mucilage extrusion to form a linear ray. Mutations in CESA5 and CESA3 affect the speed of mucilage extrusion and mucilage adherence. These findings imply that cellulose fibrils are synthesized in an ordered helical array around the columella, providing a distinct structure to the mucilage that is important for both mucilage extrusion and adherence. PMID:25926481
Tani, Shuji; Yuki, Shota; Kunitake, Emi; Sumitani, Jun-Ichi; Kawaguchi, Takashi
2017-06-01
We screened for factors involved in the cellulose-responsive induction of cellulose biomass-degrading enzyme genes from approximately 12,000 Aspergillus aculeatus T-DNA insertion mutants harboring a transcriptional fusion between the FIII-avicelase gene (cbhI) promoter and the orotidine 5'-monophosphate decarboxylase gene. Analysis of 5-fluoroorodic acid (5-FOA) sensitivity, cellulose utilization, and cbhI expression of the mutants revealed that a mutant harboring T-DNA at the dipeptidyl peptidase IV (dppIV) locus had acquired 5-FOA resistance and was deficient in cellulose utilization and cbhI expression. The deletion of dppIV resulted in a significant reduction in the cellulose-responsive expression of both cbhI as well as genes controlled by XlnR-independent and XlnR-dependent signaling pathways at an early phase in A. aculeatus. In contrast, the dppIV deletion did not affect the xylose-responsive expression of genes under the control of XlnR. These results demonstrate that DppIV participates in cellulose-responsive induction in A. aculeatus.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
A Molecular Description of Cellulose Biosynthesis
McNamara, Joshua T.; Morgan, Jacob L.W.; Zimmer, Jochen
2016-01-01
Cellulose is the most abundant biopolymer on Earth, and certain organisms from bacteria to plants and animals synthesize cellulose as an extracellular polymer for various biological functions. Humans have used cellulose for millennia as a material and an energy source, and the advent of a lignocellulosic fuel industry will elevate it to the primary carbon source for the burgeoning renewable energy sector. Despite the biological and societal importance of cellulose, the molecular mechanism by which it is synthesized is now only beginning to emerge. On the basis of recent advances in structural and molecular biology on bacterial cellulose synthases, we review emerging concepts of how the enzymes polymerize glucose molecules, how the nascent polymer is transported across the plasma membrane, and how bacterial cellulose biosynthesis is regulated during biofilm formation. Additionally, we review evolutionary commonalities and differences between cellulose synthases that modulate the nature of the cellulose product formed. PMID:26034894
Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling
2014-01-13
Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.
Augusto, Raphael; Maranho, Rone Charles; Mangolin, Claudete Aparecida; Pires da Silva Machado, Maria de Fátima
2015-01-01
High and low polymorphisms in simple sequence repeats of expressed sequence tag (EST-SSR) for specific proteins and enzymes, such as β-amylase, cellulose synthase, xyloglucan endotransglucosylase, fructose 1,6-bisphosphate aldolase, and fructose 1,6-bisphosphatase, were used to illustrate the genetic divergence within and between varieties of sugarcane (Saccharum spp.) and to guide the technological paths to optimize ethanol production from lignocellulose biomass. The varieties RB72454, RB867515, RB92579, and SP813250 on the second stage of cutting, all grown in the state of Paraná (PR), and the varieties RB92579 and SP813250 cultured in the PR state and in Northeastern Brazil, state of Pernambuco (PE), were analyzed using five EST-SSR primers for EstC66, EstC67, EstC68, EstC69, and EstC91 loci. Genetic divergence was evident in the EstC67 and EstC69 loci for β-amylase and cellulose synthase, respectively, among the four sugarcane varieties. An extremely high level of genetic differentiation was also detected in the EstC67 locus from the RB82579 and SP813250 varieties cultured in the PR and PE states. High polymorphism in SSR of the cellulose synthase locus may explain the high variability of substrates used in pretreatment and enzymatic hydrolysis processes, which has been an obstacle to effective industrial adaptations.
list of genes methylated by DRM
Indian Academy of Sciences (India)
... EXPRESSED DURING: 11 growth stages; Has 149 Blast hits to 146 proteins in 39 .... 333, AT1G24070, cellulose synthase-like A10 [Source:TAIR_LOCUS ...... 714, AT1G56600, galactinol synthase 2 [Source:TAIR_LOCUS;Acc:AT1G56600].
Endothelial nitric oxide synthase gene polymorphisms associated ...
African Journals Online (AJOL)
STORAGESEVER
2010-05-24
May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.
A Gibberellin-Mediated DELLA-NAC Signaling Cascade Regulates Cellulose Synthesis in Rice[OPEN
Huang, Debao; Wang, Shaogan; Zhang, Baocai; Shang-Guan, Keke; Shi, Yanyun; Zhang, Dongmei; Liu, Xiangling; Wu, Kun; Xu, Zuopeng; Fu, Xiangdong; Zhou, Yihua
2015-01-01
Cellulose, which can be converted into numerous industrial products, has important impacts on the global economy. It has long been known that cellulose synthesis in plants is tightly regulated by various phytohormones. However, the underlying mechanism of cellulose synthesis regulation remains elusive. Here, we show that in rice (Oryza sativa), gibberellin (GA) signals promote cellulose synthesis by relieving the interaction between SLENDER RICE1 (SLR1), a DELLA repressor of GA signaling, and NACs, the top-layer transcription factors for secondary wall formation. Mutations in GA-related genes and physiological treatments altered the transcription of CELLULOSE SYNTHASE genes (CESAs) and the cellulose level. Multiple experiments demonstrated that transcription factors NAC29/31 and MYB61 are CESA regulators in rice; NAC29/31 directly regulates MYB61, which in turn activates CESA expression. This hierarchical regulation pathway is blocked by SLR1-NAC29/31 interactions. Based on the results of anatomical analysis and GA content examination in developing rice internodes, this signaling cascade was found to be modulated by varied endogenous GA levels and to be required for internode development. Genetic and gene expression analyses were further performed in Arabidopsis thaliana GA-related mutants. Altogether, our findings reveal a conserved mechanism by which GA regulates secondary wall cellulose synthesis in land plants and provide a strategy for manipulating cellulose production and plant growth. PMID:26002868
Zhou, Qingxin; Xu, Jintao; Kou, Yanbo; Lv, Xinxing; Zhang, Xi; Zhao, Guolei; Zhang, Weixin; Chen, Guanjun
2012-01-01
Appropriate perception of cellulose outside the cell by transforming it into an intracellular signal ensures the rapid production of cellulases by cellulolytic Hypocrea jecorina. The major extracellular β-glucosidase BglI (CEL3a) has been shown to contribute to the efficient induction of cellulase genes. Multiple β-glucosidases belonging to glycosyl hydrolase (GH) family 3 and 1, however, exist in H. jecorina. Here we demonstrated that CEL1b, like CEL1a, was an intracellular β-glucosidase displaying in vitro transglycosylation activity. We then found evidence that these two major intracellular β-glucosidases were involved in the rapid induction of cellulase genes by insoluble cellulose. Deletion of cel1a and cel1b significantly compromised the efficient gene expression of the major cellulase gene, cbh1. Simultaneous absence of BglI, CEL1a, and CEL1b caused the induction of the cellulase gene by cellulose to further deteriorate. The induction defect, however, was not observed with cellobiose. The absence of the three β-glucosidases, rather, facilitated the induced synthesis of cellulase on cellobiose. Furthermore, addition of cellobiose restored the productive induction on cellulose in the deletion strains. The results indicate that the three β-glucosidases may not participate in transforming cellobiose beyond hydrolysis to provoke cellulase formation in H. jecorina. They may otherwise contribute to the accumulation of cellobiose from cellulose as inducing signals. PMID:23002106
Energy Technology Data Exchange (ETDEWEB)
Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)
2014-03-07
Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.
International Nuclear Information System (INIS)
Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko
2014-01-01
Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes
A Gibberellin-Mediated DELLA-NAC Signaling Cascade Regulates Cellulose Synthesis in Rice.
Huang, Debao; Wang, Shaogan; Zhang, Baocai; Shang-Guan, Keke; Shi, Yanyun; Zhang, Dongmei; Liu, Xiangling; Wu, Kun; Xu, Zuopeng; Fu, Xiangdong; Zhou, Yihua
2015-06-01
Cellulose, which can be converted into numerous industrial products, has important impacts on the global economy. It has long been known that cellulose synthesis in plants is tightly regulated by various phytohormones. However, the underlying mechanism of cellulose synthesis regulation remains elusive. Here, we show that in rice (Oryza sativa), gibberellin (GA) signals promote cellulose synthesis by relieving the interaction between SLENDER RICE1 (SLR1), a DELLA repressor of GA signaling, and NACs, the top-layer transcription factors for secondary wall formation. Mutations in GA-related genes and physiological treatments altered the transcription of CELLULOSE SYNTHASE genes (CESAs) and the cellulose level. Multiple experiments demonstrated that transcription factors NAC29/31 and MYB61 are CESA regulators in rice; NAC29/31 directly regulates MYB61, which in turn activates CESA expression. This hierarchical regulation pathway is blocked by SLR1-NAC29/31 interactions. Based on the results of anatomical analysis and GA content examination in developing rice internodes, this signaling cascade was found to be modulated by varied endogenous GA levels and to be required for internode development. Genetic and gene expression analyses were further performed in Arabidopsis thaliana GA-related mutants. Altogether, our findings reveal a conserved mechanism by which GA regulates secondary wall cellulose synthesis in land plants and provide a strategy for manipulating cellulose production and plant growth. © 2015 American Society of Plant Biologists. All rights reserved.
Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W
2012-06-01
Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.
Regulation of cellulose synthesis in response to stress.
Kesten, Christopher; Menna, Alexandra; Sánchez-Rodríguez, Clara
2017-12-01
The cell wall is a complex polysaccharide network that provides stability and protection to the plant and is one of the first layers of biotic and abiotic stimuli perception. A controlled remodeling of the primary cell wall is essential for the plant to adapt its growth to environmental stresses. Cellulose, the main component of plant cell walls is synthesized by plasma membrane-localized cellulose synthases moving along cortical microtubule tracks. Recent advancements demonstrate a tight regulation of cellulose synthesis at the primary cell wall by phytohormone networks. Stress-induced perturbations at the cell wall that modify cellulose synthesis and microtubule arrangement activate similar phytohormone-based stress response pathways. The integration of stress perception at the primary cell wall and downstream responses are likely to be tightly regulated by phytohormone signaling pathways in the context of cellulose synthesis and microtubule arrangement. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila
International Nuclear Information System (INIS)
Enan, M. R.; Bashandy, S.A.
2006-01-01
Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)
Energy Technology Data Exchange (ETDEWEB)
Harris, Darby; Corbin, Kendall; Wang, Tuo; Gutierrez, Ryan; Bertolo, Ana; Petti, Caroalberto; Smilgies, Detlef-M; Estevez, Jose Manuel; Bonetta, Dario; Urbanowicz, Breeanna; Ehrhardt, David; Somerville, Chris; Rose, Jocelyn; Hong, Mei; DeBolt, Seth
2012-01-08
The mechanisms underlying the biosynthesis of cellulose in plants are complex and still poorly understood. A central question concerns the mechanism of microfibril structure and how this is linked to the catalytic polymerization action of cellulose synthase (CESA). Furthermore, it remains unclear whether modification of cellulose microfibril structure can be achieved genetically, which could be transformative in a bio-based economy. To explore these processes in planta, we developed a chemical genetic toolbox of pharmacological inhibitors and corresponding resistance-conferring point mutations in the C-terminal transmembrane domain region of CESA1{sup A903V} and CESA3{sup T942I} in Arabidopsis thaliana. Using {sup 13}C solid-state nuclear magnetic resonance spectroscopy and X-ray diffraction, we show that the cellulose microfibrils displayed reduced width and an additional cellulose C4 peak indicative of a degree of crystallinity that is intermediate between the surface and interior glucans of wild type, suggesting a difference in glucan chain association during microfibril formation. Consistent with measurements of lower microfibril crystallinity, cellulose extracts from mutated CESA1{sup A903V} and CESA3{sup T942I} displayed greater saccharification efficiency than wild type. Using live-cell imaging to track fluorescently labeled CESA, we found that these mutants show increased CESA velocities in the plasma membrane, an indication of increased polymerization rate. Collectively, these data suggest that CESA1{sup A903V} and CESA3{sup T942I} have modified microfibril structure in terms of crystallinity and suggest that in plants, as in bacteria, crystallization biophysically limits polymerization.
Cellulose microfibril structure: inspirations from plant diversity
Roberts, A. W.
2018-03-01
Cellulose microfibrils are synthesized at the plasma membrane by cellulose synthase catalytic subunits that associate to form cellulose synthesis complexes. Variation in the organization of these complexes underlies the variation in cellulose microfibril structure among diverse organisms. However, little is known about how the catalytic subunits interact to form complexes with different morphologies. We are using an evolutionary approach to investigate the roles of different catalytic subunit isoforms in organisms that have rosette-type cellulose synthesis complexes.
Endothelial nitric oxide synthase gene polymorphisms associated ...
African Journals Online (AJOL)
Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...
Directory of Open Access Journals (Sweden)
Mirian Perez Maluf
2009-01-01
Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.
Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance
DEFF Research Database (Denmark)
Huang, Laurence; Crothers, Kristina; Atzori, Chiara
2004-01-01
in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...
DEFF Research Database (Denmark)
Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo
2016-01-01
identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...
[Biomimetic mineralization of rod-like cellulose nano-whiskers and spectrum analysis].
Qu, Ping; Wang, Xuan; Cui, Xiao-xia; Zhang, Li-ping
2012-05-01
Cellulose nano-whiskers/nano-hydroxyapatite composite was prepared with biomimetic mineralization using rod-like cellulose nano-whiskers as template. The cellulose nano-whiskers and cellulose nano-whiskers/nano-hydroxyapatite composite were characterized by X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS) and scanning electron microscope-energy dispersive analysis of X-rays (SEM-EDXA). Variation and distribution of carbon, oxygen, calcium, and phosphorus in the composites were studied. The morphologies and growth mechanism of nano-hydroxyapatite were analyzed. The results showed that nano-hydroxyapatite was formed on the surface of cellulose nano-whiskers; the carbon-oxygen ratio of cellulose nano-whiskers and cellulose nano-whiskers/nano-hydroxyapatite composite was 1.81 and 1.54, respectively; the calcium-phosphorus ratio of the composite was 1.70. The nucleation of nano-hydroxyapatite was around the hydroxyl groups of cellulose nano-whiskers. It is suggested that there is coordination between the hydroxyl groups of cellulose nano-whiskers and calcium ions of nano-hydroxyapatite. The nano-hydroxyapatite can distribute in the matrix of cellulose nano-whiskers. From the atomic force microscope (AFM) images, we can see that the diameter of the spherical nano-hydroxyapatite particles was about 20 nm.
Cyanobacterial cellulose synthesis in the light of the photanol concept
Schuurmans, R.M.; Matthijs, H.C.P.; Stal, L.J.; Hellingwerf, K.J.; Sharma, N.K.; Rai, A.K.; Stal, L.J.
2014-01-01
The detailed knowledge already available about cellulose synthases and their regulation, plus emerging insights into the process of cellulose secretion in cyanobacteria make cellulose an attractive polymer for the application of the photanol concept in an economically viable production process. By
Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan
2016-01-01
The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124
Energy Technology Data Exchange (ETDEWEB)
Xiao, Chaowen; Zhang, Tian; Zheng, Yunzhen; Cosgrove, Daniel J.; Anderson, Charles T.
2015-11-02
Xyloglucan constitutes most of the hemicellulose in eudicot primary cell walls and functions in cell wall structure and mechanics. Although Arabidopsis (Arabidopsis thaliana) xxt1 xxt2 mutants lacking detectable xyloglucan are viable, they display growth defects that are suggestive of alterations in wall integrity. To probe the mechanisms underlying these defects, we analyzed cellulose arrangement, microtubule patterning and dynamics, microtubule- and wall-integrity-related gene expression, and cellulose biosynthesis in xxt1 xxt2 plants. We found that cellulose is highly aligned in xxt1 xxt2 cell walls, that its three-dimensional distribution is altered, and that microtubule patterning and stability are aberrant in etiolated xxt1 xxt2 hypocotyls. We also found that the expression levels of microtubule-associated genes, such as MAP70-5 and CLASP, and receptor genes, such as HERK1 and WAK1, were changed in xxt1 xxt2 plants and that cellulose synthase motility is reduced in xxt1 xxt2 cells, corresponding with a reduction in cellulose content. Our results indicate that loss of xyloglucan affects both the stability of the microtubule cytoskeleton and the production and patterning of cellulose in primary cell walls. These findings establish, to our knowledge, new links between wall integrity, cytoskeletal dynamics, and wall synthesis in the regulation of plant morphogenesis.
NCBI nr-aa BLAST: CBRC-ATHA-03-0002 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-ATHA-03-0002 ref|NP_186955.1| CSLD3 (CELLULOSE SYNTHASE-LIKE 3); cellulose syn...thase/ transferase, transferring glycosyl groups [Arabidopsis thaliana] gb|AAF26119.1|AC012328_22 putative cellulose... synthase catalytic subunit [Arabidopsis thaliana] gb|AAG60543.1|AF232907_1 cellulose synthase-like ...CSLD3 [Arabidopsis thaliana] gb|AAK25890.1|AF360180_1 putative cellulose synthase... catalytic subunit [Arabidopsis thaliana] gb|AAK64073.1| putative cellulose synthase catalytic subunit [Arab
NCBI nr-aa BLAST: CBRC-OSAT-10-0021 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-OSAT-10-0021 ref|NP_186955.1| CSLD3 (CELLULOSE SYNTHASE-LIKE 3); cellulose syn...thase/ transferase, transferring glycosyl groups [Arabidopsis thaliana] gb|AAF26119.1|AC012328_22 putative cellulose... synthase catalytic subunit [Arabidopsis thaliana] gb|AAG60543.1|AF232907_1 cellulose synthase-like ...CSLD3 [Arabidopsis thaliana] gb|AAK25890.1|AF360180_1 putative cellulose synthase... catalytic subunit [Arabidopsis thaliana] gb|AAK64073.1| putative cellulose synthase catalytic subunit [Arab
NCBI nr-aa BLAST: CBRC-OSAT-12-0025 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-OSAT-12-0025 ref|NP_186955.1| CSLD3 (CELLULOSE SYNTHASE-LIKE 3); cellulose syn...thase/ transferase, transferring glycosyl groups [Arabidopsis thaliana] gb|AAF26119.1|AC012328_22 putative cellulose... synthase catalytic subunit [Arabidopsis thaliana] gb|AAG60543.1|AF232907_1 cellulose synthase-like ...CSLD3 [Arabidopsis thaliana] gb|AAK25890.1|AF360180_1 putative cellulose synthase... catalytic subunit [Arabidopsis thaliana] gb|AAK64073.1| putative cellulose synthase catalytic subunit [Arab
Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.
Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako
2009-02-01
Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.
Directory of Open Access Journals (Sweden)
Bechard Matthew E.
2003-01-01
Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.
Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.
2003-01-01
Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.
Samac, Deborah A; Bucciarelli, Bruna; Miller, Susan S; Yang, S Samuel; O'Rourke, Jamie A; Shin, Sanghyun; Vance, Carroll P
2015-12-01
Alfalfa (Medicago sativa L.) is a widely adapted perennial forage crop that has high biomass production potential. Enhanced cellulose content in alfalfa stems would increase the value of the crop as a bioenergy feedstock. We examined if increased expression of sucrose synthase (SUS; EC 2.4.1.13) would increase cellulose in stem cell walls. Alfalfa plants were transformed with a truncated alfalfa phosphoenolpyruvate carboxylase gene promoter (PEPC7-P4) fused to an alfalfa nodule-enhanced SUS cDNA (MsSUS1) or the β-glucuronidase (GUS) gene. Strong GUS expression was detected in xylem and phloem indicating that the PEPC7-P4 promoter was active in stem vascular tissue. In contrast to expectations, MsSUS1 transcript accumulation was reduced 75-90 % in alfalfa plants containing the PEPC7-P4::MsSUS1 transgene compared to controls. Enzyme assays indicated that SUS activity in stems of selected down-regulated transformants was reduced by greater than 95 % compared to the controls. Although SUS activity was detected in xylem and phloem of control plants by in situ enzyme assays, plants with the PEPC7-P4::MsSUS1 transgene lacked detectable SUS activity in post-elongation stem (PES) internodes and had very low SUS activity in elongating stem (ES) internodes. Loss of SUS protein in PES internodes of down-regulated lines was confirmed by immunoblots. Down-regulation of SUS expression and activity in stem tissue resulted in no obvious phenotype or significant change in cell wall sugar composition. However, alkaline/neutral (A/N) invertase activity increased in SUS down-regulated lines and high levels of acid invertase activity were observed. In situ enzyme assays of stem tissue showed localization of neutral invertase in vascular tissues of ES and PES internodes. These results suggest that invertases play a primary role in providing glucose for cellulose biosynthesis or compensate for the loss of SUS1 activity in stem vascular tissue.
Directory of Open Access Journals (Sweden)
Rabia İşkil
2018-04-01
Full Text Available ABSTRACT Plant cell walls are affected by many biotic and abiotic stress conditions. The aim of this study is to determine the effects of 24-Epibrassinolide (EBL on some cell wall-related genes in root tissue of five- and ten-week-old Arabidopsis thaliana plants exposed to boron (B deficiency (0 µM or toxicity (3000 µM at the transcriptional level. Expressions of the genes that encode cellulose synthase (CESA1, CESA4, CESA6 and CESA8, cellulose synthase-like (CSLB5, expansin (EXPA5, EXPA8 and EXPA14 and cell wall protein (SEB1 decreased under conditions of B deficiency and toxicity. EBL treatments, in general, led the expressions of these genes to reduce significantly. Expressions of xyloglucan endotransglucosylase/hydrolase genes (XTH21 and XTH23 changed only under conditions of B toxicity. Boron stress and/or EBL treatments caused different responses in expression of pectin methylesterase (PME2 and PME41 genes. As a result of B stress, the expression levels of investigated genes changed more in roots of five-week-old plants than in roots of ten-week-old plants. Results of the present study include new findings that support the ability of BRs to increase molecular aspects of tolerance to stress in plants.
Molecular cloning of a novel GSK3/shaggy-like gene from Triticum ...
African Journals Online (AJOL)
The deduced amino acid sequence showed a high homology with shaggy-like kinases from Triticum aestivum, Zea mays, Trifolium repens, Nicotine tabacum, Medicago sativa and Arabidopsis thaliana; therefore, the gene was named TmGSK1 (Triticum monococcum Glycogen Synthase Kinase 1,GenBank Accession No.
Jiménez-Ortigosa, Cristina; Aimanianda, Vishukumar; Muszkieta, Laetitia; Mouyna, Isabelle; Alsteens, David; Pire, Stéphane; Beau, Remi; Krappmann, Sven; Beauvais, Anne; Dufrêne, Yves F.
2012-01-01
Aspergillus fumigatus has two chitin synthases (CSMA and CSMB) with a myosin motor-like domain (MMD) arranged in a head-to-head configuration. To understand the function of these chitin synthases, single and double csm mutant strains were constructed and analyzed. Although there was a slight reduction in mycelial growth of the mutants, the total chitin synthase activity and the cell wall chitin content were similar in the mycelium of all of the mutants and the parental strain. In the conidia, chitin content in the ΔcsmA strain cell wall was less than half the amount found in the parental strain. In contrast, the ΔcsmB mutant strain and, unexpectedly, the ΔcsmA/ΔcsmB mutant strain did not show any modification of chitin content in their conidial cell walls. In contrast to the hydrophobic conidia of the parental strain, conidia of all of the csm mutants were hydrophilic due to the presence of an amorphous material covering the hydrophobic surface-rodlet layer. The deletion of CSM genes also resulted in an increased susceptibility of resting and germinating conidia to echinocandins. These results show that the deletion of the CSMA and CSMB genes induced a significant disorganization of the cell wall structure, even though they contribute only weakly to the overall cell wall chitin synthesis. PMID:22964252
Directory of Open Access Journals (Sweden)
KRISHAN MOHAN RAI
2016-08-01
Full Text Available Biomass based alternative fuels offer a solution to the world’s ever-increasing energy demand. With the ability to produce high biomass in marginal lands with low inputs, sorghum has a great potential to meet second-generation biofuel needs. Despite the sorghum crop importance in biofuel and fodder industry, there is no comprehensive information available on the cell wall related genes and gene families (biosynthetic and modification. It is important to identify the cell wall related genes to understand the cell wall biosynthetic process as well as to facilitate biomass manipulation. Genome-wide analysis using gene family specific Hidden Markov Model of conserved domains identified 520 genes distributed among 20 gene families related to biosynthesis/modification of various cell wall polymers such as cellulose, hemicellulose, pectin and lignin. Chromosomal localization analysis of these genes revealed that about 65% of cell wall related genes were confined to four chromosomes (Chr. 1-4. Further, 53 tandem duplication events involving 146 genes were identified in these gene families which could be associated with expansion of genes within families in sorghum. Additionally, we also identified 137 Simple Sequence Repeats related to 112 genes and target sites for 10 miRNAs in some important families such as cellulose synthase, cellulose synthase-like and laccases, etc. To gain further insight into potential functional roles, expression analysis of these gene families was performed using publicly available data sets in various tissues and under abiotic stress conditions. Expression analysis showed tissue specificity as well as differential expression under abiotic stress conditions. Overall, our study provides a comprehensive information on cell wall related genes families in sorghum which offers a valuable resource to develop strategies for altering biomass composition by plant breeding and genetic engineering approaches.
Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.
Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica
2017-10-01
Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T
2017-01-01
Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.
Directory of Open Access Journals (Sweden)
Yan Yang
2017-04-01
Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.
Deng, Ying; Nagachar, Nivedita; Xiao, Chaowen; Tien, Ming
2013-01-01
The acs operon of Gluconacetobacter is thought to encode AcsA, AcsB, AcsC, and AcsD proteins that constitute the cellulose synthase complex, required for the synthesis and secretion of crystalline cellulose microfibrils. A few other genes have been shown to be involved in this process, but their precise role is unclear. We report here the use of Tn5 transposon insertion mutagenesis to identify and characterize six non-cellulose-producing (Cel−) mutants of Gluconacetobacter hansenii ATCC 23769. The genes disrupted were acsA, acsC, ccpAx (encoding cellulose-complementing protein [the subscript “Ax” indicates genes from organisms formerly classified as Acetobacter xylinum]), dgc1 (encoding guanylate dicyclase), and crp-fnr (encoding a cyclic AMP receptor protein/fumarate nitrate reductase transcriptional regulator). Protein blot analysis revealed that (i) AcsB and AcsC were absent in the acsA mutant, (ii) the levels of AcsB and AcsC were significantly reduced in the ccpAx mutant, and (iii) the level of AcsD was not affected in any of the Cel− mutants. Promoter analysis showed that the acs operon does not include acsD, unlike the organization of the acs operon of several strains of closely related Gluconacetobacter xylinus. Complementation experiments confirmed that the gene disrupted in each Cel− mutant was responsible for the phenotype. Quantitative real-time PCR and protein blotting results suggest that the transcription of bglAx (encoding β-glucosidase and located immediately downstream from acsD) was strongly dependent on Crp/Fnr. A bglAx knockout mutant, generated via homologous recombination, produced only ∼16% of the wild-type cellulose level. Since the crp-fnr mutant did not produce any cellulose, Crp/Fnr may regulate the expression of other gene(s) involved in cellulose biosynthesis. PMID:24013627
Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.
Directory of Open Access Journals (Sweden)
Kattina Zavala
Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.
Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model
Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.
DEFF Research Database (Denmark)
von Wettstein, Penny
2017-01-01
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...
Directory of Open Access Journals (Sweden)
Mariela V Catone
Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.
Nitric oxide synthase gene G298 allele
International Nuclear Information System (INIS)
Nagib El-Kilany, Galal E.; Nayel, Ehab; Hazzaa, Sahar
2004-01-01
Background: Nitric oxide (NO) has an important effect on blood pressure, arterial wall, and the basal release of endothelial NO in hypertension (HPN) may be reduced. Until now, there is no solid data revealing the potential role of the polymorphism of the nitric oxide synthase gene (NOS) in patients with HPN and microvascular angina. Aim: The aim of the present study is to investigate the gene of endothelial nitric oxide synthase (eNOS), as the polymorphism of this gene may be a putative candidate for HPN and initiate the process of atherosclerosis. Methods: Sixty participants were recruited for this study; 50 were hypertensive patients complaining of chest pain [30 of them have electrocardiogram (EKG) changes of ischemia], 20 had isolated HPN, and 10 healthy volunteers served as control. All patients underwent stress myocardial perfusion imaging (MPI) and coronary angiography. Genotyping of eNOS for all patients and controls was performed. The linkages between HPN, microvascular angina and eNOS gene polymorphism were investigated. Results: MPI and coronary angiography revealed that 15 patients had chest pain with true ischemia and reversible myocardial perfusion defects (multiple and mild) but normal epicardial coronary arteries (microvascular angina), while 15 patients had significant coronary artery disease (CAD), and 20 hypertensive patients showed normal perfusion scan and coronary angiography. The prevalence of the NOS G 298 allele was higher in the hypertensive group with microvascular angina (documented by MPI) than it was among the control participants (P<.005). The eNOS allele was significantly higher in the hypertensive group than in the control participants, but there was no significant difference in homozygote mutants among hypertensive participants, x-syndrome and patients with CAD. Conclusion: eNOS gene polymorphism is proved to be an important etiology in microvascular angina (x-syndrome) among hypertensive patients. In addition, the eNOS mutant
Final Report for Award DE-FG02-09ER16008
Energy Technology Data Exchange (ETDEWEB)
Somerville, Chris
2014-04-26
The research objectives of this project was to characterize the factors that regulate the pattern, amount and quality of cellulose deposition in higher plants. We pursued this goal in four ways: (1) by searching for proteins that interact with the cellulose synthase complex using novel bioinformatics tools to identify genes which exhibit gene expression patterns that are highly correlated with cellulose synthase components, (2) by using cellulose synthase domains as bait in 2-hybrid screens, and then characterizing any proteins that are identified by both gene expression network analysis and 2-hybrid screens (3) by testing the function of all known post-translational modifications, (4) by identifying and characterizing kinases that carry out most of the known post-translational modification of cellulose synthase components.
Cellulose Degradation by Cellulose-Clearing and Non-Cellulose-Clearing Brown-Rot Fungi
Highley, Terry L.
1980-01-01
Cellulose degradation by four cellulose-clearing brown-rot fungi in the Coniophoraceae—Coniophora prasinoides, C. puteana, Leucogyrophana arizonica, and L. olivascens—is compared with that of a non-cellulose-clearing brown-rot fungus, Poria placenta. The cellulose- and the non-cellulose-clearing brown-rot fungi apparently employ similar mechanisms to depolymerize cellulose; most likely a nonenzymatic mechanism is involved.
Gutierrez, R.; Lindeboom, J.J.; Paredez, A.R.; Emons, A.M.C.; Ehrhardt, D.W.
2009-01-01
Plant cell morphogenesis relies on the organization and function of two polymer arrays separated by the plasma membrane: the cortical microtubule cytoskeleton and cellulose microfibrils in the cell wall. Studies using in vivo markers confirmed that one function of the cortical microtubule array is
Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi
2014-10-01
Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.
GenBank blastx search result: AK287855 [KOME
Lifescience Database Archive (English)
Full Text Available AK287855 J065196O16 AB091060.1 AB091060 Gluconacetobacter xylinus acsAB, acsC, acsD genes for cellulose... synthase subunit AB, cellulose synthase subunit C, cellulose synthase subunit D, complete cds. BCT 4e-15 0 ...
GenBank blastx search result: AK242831 [KOME
Lifescience Database Archive (English)
Full Text Available AK242831 J090067L08 AB091060.1 AB091060 Gluconacetobacter xylinus acsAB, acsC, acsD genes for cellulose... synthase subunit AB, cellulose synthase subunit C, cellulose synthase subunit D, complete cds. BCT 1e-14 1 ...
Chromosomal localization of the human and mouse hyaluronan synthase genes
Energy Technology Data Exchange (ETDEWEB)
Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others
1997-05-01
We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.
The Eucalyptus terpene synthase gene family.
Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J
2015-06-11
Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.
von Wettstein-Knowles, Penny
2017-07-10
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.
Resveratrol suppresses growth of cancer stem-like cells by inhibiting fatty acid synthase.
Pandey, Puspa R; Okuda, Hiroshi; Watabe, Misako; Pai, Sudha K; Liu, Wen; Kobayashi, Aya; Xing, Fei; Fukuda, Koji; Hirota, Shigeru; Sugai, Tamotsu; Wakabayashi, Go; Koeda, Keisuke; Kashiwaba, Masahiro; Suzuki, Kazuyuki; Chiba, Toshimi; Endo, Masaki; Fujioka, Tomoaki; Tanji, Susumu; Mo, Yin-Yuan; Cao, Deliang; Wilber, Andrew C; Watabe, Kounosuke
2011-11-01
Resveratrol is a natural polyphenolic compound and has been shown to exhibit cardio-protective as well as anti-neoplastic effects on various types of cancers. However, the exact mechanism of its anti-tumor effect is not clearly defined. Resveratrol has been shown to have strong hypolipidemic effect on normal adipocytes and as hyper-lipogenesis is a hallmark of cancer cell physiology, the effect of resveratrol on lipid synthesis in cancer stem-like cells (CD24(-)/CD44(+)/ESA(+)) that were isolated from both ER+ and ER- breast cancer cell lines was examined. The authors found that resveratrol significantly reduced the cell viability and mammosphere formation followed by inducing apoptosis in cancer stem-like cells. This inhibitory effect of resveratrol is accompanied by a significant reduction in lipid synthesis which is caused by the down-regulation of the fatty acid synthase (FAS) gene followed by up-regulation of pro-apoptotic genes, DAPK2 and BNIP3. The activation of apoptotic pathway in the cancer stem-like cells was suppressed by TOFA and by Fumonisin B1, suggesting that resveratrol-induced apoptosis is indeed through the modulation of FAS-mediated cell survival signaling. Importantly, resveratrol was able to significantly suppress the growth of cancer stem-like cells in an animal model of xenograft without showing apparental toxicity. Taken together, the results of this study indicate that resveratrol is capable of inducing apoptosis in the cancer stem-like cells through suppression of lipogenesis by modulating FAS expression, which highlights a novel mechanism of anti-tumor effect of resveratrol.
Isolation and expression of the Pneumocystis carinii thymidylate synthase gene
DEFF Research Database (Denmark)
Edman, U; Edman, J C; Lundgren, B
1989-01-01
The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...
Directory of Open Access Journals (Sweden)
Meng eWang
2013-05-01
Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.
Novel spider-web-like nanoporous networks based on jute cellulose nanowhiskers.
Cao, Xinwang; Wang, Xianfeng; Ding, Bin; Yu, Jianyong; Sun, Gang
2013-02-15
Cellulose nanowhiskers as a kind of renewable and biocompatible nanomaterials evoke much interest because of its versatility in various applications. Herein, for the first time, a novel controllable fabrication of spider-web-like nanoporous networks based on jute cellulose nanowhiskers (JCNs) deposited on the electrospun (ES) nanofibrous membrane by simple directly immersion-drying method is reported. Jute cellulose nanowhiskers were extracted from jute fibers with a high yield (over 80%) via a 2,2,6,6-tetramethylpiperidine-1-oxyl radical (TEMPO)/NaBr/NaClO system selective oxidization combined with mechanical homogenization. The morphology of JCNs nanoporous networks/ES nanofibrous membrane architecture, including coverage rate, pore-width and layer-by-layer packing structure of the nanoporous networks, can be finely controlled by regulating the JCNs dispersions properties and drying conditions. The versatile nanoporous network composites based on jute cellulose nanowhiskers with ultrathin diameters (3-10 nm) and nanofibrous membrane supports with diameters of 100-300 nm, would be particularly useful for filter applications. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.
The evolution of function in strictosidine synthase-like proteins.
Hicks, Michael A; Barber, Alan E; Giddings, Lesley-Ann; Caldwell, Jenna; O'Connor, Sarah E; Babbitt, Patricia C
2011-11-01
The exponential growth of sequence data provides abundant information for the discovery of new enzyme reactions. Correctly annotating the functions of highly diverse proteins can be difficult, however, hindering use of this information. Global analysis of large superfamilies of related proteins is a powerful strategy for understanding the evolution of reactions by identifying catalytic commonalities and differences in reaction and substrate specificity, even when only a few members have been biochemically or structurally characterized. A comparison of >2500 sequences sharing the six-bladed β-propeller fold establishes sequence, structural, and functional links among the three subgroups of the functionally diverse N6P superfamily: the arylesterase-like and senescence marker protein-30/gluconolactonase/luciferin-regenerating enzyme-like (SGL) subgroups, representing enzymes that catalyze lactonase and related hydrolytic reactions, and the so-called strictosidine synthase-like (SSL) subgroup. Metal-coordinating residues were identified as broadly conserved in the active sites of all three subgroups except for a few proteins from the SSL subgroup, which have been experimentally determined to catalyze the quite different strictosidine synthase (SS) reaction, a metal-independent condensation reaction. Despite these differences, comparison of conserved catalytic features of the arylesterase-like and SGL enzymes with the SSs identified similar structural and mechanistic attributes between the hydrolytic reactions catalyzed by the former and the condensation reaction catalyzed by SS. The results also suggest that despite their annotations, the great majority of these >500 SSL sequences do not catalyze the SS reaction; rather, they likely catalyze hydrolytic reactions typical of the other two subgroups instead. This prediction was confirmed experimentally for one of these proteins. Copyright © 2011 Wiley-Liss, Inc.
Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H
2004-01-01
The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed
Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un
2016-12-01
Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.
The CSLA and CSLC Families: Recent Advances and Future Perspectives
Directory of Open Access Journals (Sweden)
Aaron Howard Liepman
2012-05-01
Full Text Available The CELLULOSE SYNTHASE (CESA superfamily of proteins contains several sub-families of closely related CELLULOSE SYNTHASE-LIKE (CSL sequences, Among these, the CSLA and CSLC families are closely related to each other and are the most evolutionarily divergent from the CESA family. Significant progress has been made with the functional characterization of CSLA and CSLC genes, which have been shown to encode enzymes with 1,4-B-glycan synthase activities involved in the biosynthesis of mannan and possibly xyloglucan backbones, respectively. This review examines recent work on the CSLA and CSLC families from evolutionary, molecular, and biochemical perspectives. We pose a series of questions, whose answers likely will provide further insight about the specific functions of members of the CSLA and CSLC families and about plant polysaccharide biosynthesis is general.
Energy Technology Data Exchange (ETDEWEB)
Bae, Hyun Jong; Wi, Seung Gon; Kim, Su Bae; Shin, You Jung; Yi, Ju Hui [Chonnam National University, Bio-Energy Research Institute, Gwangju (Korea, Republic of)
2010-10-15
The purpose of this project is optimization of upstream and development of cellulose hydrolysis process for cellulosic bio-ethanol production. Research scope includes 1) screening of various microorganisms from decayed biomass in order to search for more efficient lignocellulose degrading microorganism, 2) identification and verification of new cell wall degrading cellulase for application cellulose bioconversion process, and 3) identification and characterization of novel genes involved in cellulose degradation. To find good microorganism candidates for lignocellulose degrading, 75 decayed samples from different areas were assayed in triplicate and analyzed. For cloning new cell wall degrading enzymes, we selected microorganisms because it have very good lignocellulose degradation ability. From that microorganisms, we have apparently cloned a new cellulase genes (10 genes). We are applying the new cloned cellulase genes to characterize in lignocellulsoe degradation that are most important to cellulosic biofuels production
International Nuclear Information System (INIS)
Bae, Hyun Jong; Wi, Seung Gon; Kim, Su Bae; Shin, You Jung; Yi, Ju Hui
2010-10-01
The purpose of this project is optimization of upstream and development of cellulose hydrolysis process for cellulosic bio-ethanol production. Research scope includes 1) screening of various microorganisms from decayed biomass in order to search for more efficient lignocellulose degrading microorganism, 2) identification and verification of new cell wall degrading cellulase for application cellulose bioconversion process, and 3) identification and characterization of novel genes involved in cellulose degradation. To find good microorganism candidates for lignocellulose degrading, 75 decayed samples from different areas were assayed in triplicate and analyzed. For cloning new cell wall degrading enzymes, we selected microorganisms because it have very good lignocellulose degradation ability. From that microorganisms, we have apparently cloned a new cellulase genes (10 genes). We are applying the new cloned cellulase genes to characterize in lignocellulsoe degradation that are most important to cellulosic biofuels production
Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.
Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M
2008-07-01
Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.
2013-01-01
Background Numerous studies have examined the direct fermentation of cellulosic materials by cellulase-expressing yeast; however, ethanol productivity in these systems has not yet reached an industrial level. Certain microorganisms, such as the cellulolytic fungus Trichoderma reesei, produce expansin-like proteins, which have a cellulose-loosening effect that may increase the breakdown of cellulose. Here, to improve the direct conversion of cellulose to ethanol, yeast Saccharomyces cerevisiae co-displaying cellulase and expansin-like protein on the cell surface were constructed and examined for direct ethanol fermentation performance. Results The cellulase and expansin-like protein co-expressing strain showed 246 mU/g-wet cell of phosphoric acid swollen cellulose (PASC) degradation activity, which corresponded to 2.9-fold higher activity than that of a cellulase-expressing strain. This result clearly demonstrated that yeast cell-surface expressed cellulase and expansin-like protein act synergistically to breakdown cellulose. In fermentation experiments examining direct ethanol production from PASC, the cellulase and expansin-like protein co-expressing strain produced 3.4 g/L ethanol after 96 h of fermentation, a concentration that was 1.4-fold higher than that achieved by the cellulase-expressing strain (2.5 g/L). Conclusions The PASC degradation and fermentation ability of an engineered yeast strain was markedly improved by co-expressing cellulase and expansin-like protein on the cell surface. To our knowledge, this is the first report to demonstrate the synergetic effect of co-expressing cellulase and expansin-like protein on a yeast cell surface, which may be a promising strategy for constructing direct ethanol fermenting yeast from cellulose. PMID:23835302
Sugano, Yasushi; Shoda, Makoto; Sakakibara, Hitoshi; Oiwa, Kazuhiro; Tuzi, Satoru; Imai, Tomoya; Sugiyama, Junji; Takeuchi, Miyuki; Yamauchi, Daisuke
2013-01-01
Cellulases are enzymes that normally digest cellulose; however, some are known to play essential roles in cellulose biosynthesis. Although some endogenous cellulases of plants and cellulose-producing bacteria are reportedly involved in cellulose production, their functions in cellulose production are unknown. In this study, we demonstrated that disruption of the cellulase (carboxymethylcellulase) gene causes irregular packing of de novo-synthesized fibrils in Gluconacetobacter xylinus, a cellulose-producing bacterium. Cellulose production was remarkably reduced and small amounts of particulate material were accumulated in the culture of a cmcax-disrupted G. xylinus strain (F2-2). The particulate material was shown to contain cellulose by both solid-state 13C nuclear magnetic resonance analysis and Fourier transform infrared spectroscopy analysis. Electron microscopy revealed that the cellulose fibrils produced by the F2-2 cells were highly twisted compared with those produced by control cells. This hypertwisting of the fibrils may reduce cellulose synthesis in the F2-2 strains. PMID:23243308
Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng
2018-03-06
Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Crystallographic snapshot of cellulose synthesis and membrane translocation.
Morgan, Jacob L W; Strumillo, Joanna; Zimmer, Jochen
2013-01-10
Cellulose, the most abundant biological macromolecule, is an extracellular, linear polymer of glucose molecules. It represents an essential component of plant cell walls but is also found in algae and bacteria. In bacteria, cellulose production frequently correlates with the formation of biofilms, a sessile, multicellular growth form. Cellulose synthesis and transport across the inner bacterial membrane is mediated by a complex of the membrane-integrated catalytic BcsA subunit and the membrane-anchored, periplasmic BcsB protein. Here we present the crystal structure of a complex of BcsA and BcsB from Rhodobacter sphaeroides containing a translocating polysaccharide. The structure of the BcsA-BcsB translocation intermediate reveals the architecture of the cellulose synthase, demonstrates how BcsA forms a cellulose-conducting channel, and suggests a model for the coupling of cellulose synthesis and translocation in which the nascent polysaccharide is extended by one glucose molecule at a time.
Directory of Open Access Journals (Sweden)
Wen-Qin Bai
Full Text Available Bioactive gibberellins (GAs comprise an important class of natural plant growth regulators and play essential roles in cotton fiber development. To date, the molecular base of GAs' functions in fiber development is largely unclear. To address this question, the endogenous bioactive GA levels in cotton developing fibers were elevated by specifically up-regulating GA 20-oxidase and suppressing GA 2-oxidase via transgenic methods. Higher GA levels in transgenic cotton fibers significantly increased micronaire values, 1000-fiber weight, cell wall thickness and cellulose contents of mature fibers. Quantitative RT-PCR and biochemical analysis revealed that the transcription of sucrose synthase gene GhSusA1 and sucrose synthase activities were significantly enhanced in GA overproducing transgenic fibers, compared to the wild-type cotton. In addition, exogenous application of bioactive GA could promote GhSusA1 expression in cultured fibers, as well as in cotton hypocotyls. Our results suggested that bioactive GAs promoted secondary cell wall deposition in cotton fibers by enhancing sucrose synthase expression.
Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A
2015-12-01
Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Cloning and characterization of ATP synthase CF1 α gene from ...
African Journals Online (AJOL)
ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...
Directory of Open Access Journals (Sweden)
Gea Guerriero
Full Text Available Oomycetes represent some of the most devastating plant and animal pathogens. Typical examples are Phytophthora infestans, which causes potato and tomato late blight, and Saprolegnia parasitica, responsible for fish diseases. Despite the economical and environmental importance of oomycete diseases, their control is difficult, particularly in the aquaculture industry. Carbohydrate synthases are vital for hyphal growth and represent interesting targets for tackling the pathogens. The existence of 2 different chitin synthase genes (SmChs1 and SmChs2 in Saprolegnia monoica was demonstrated using bioinformatics and molecular biology approaches. The function of SmCHS2 was unequivocally demonstrated by showing its catalytic activity in vitro after expression in Pichia pastoris. The recombinant SmCHS1 protein did not exhibit any activity in vitro, suggesting that it requires other partners or effectors to be active, or that it is involved in a different process than chitin biosynthesis. Both proteins contained N-terminal Microtubule Interacting and Trafficking domains, which have never been reported in any other known carbohydrate synthases. These domains are involved in protein recycling by endocytosis. Enzyme kinetics revealed that Saprolegnia chitin synthases are competitively inhibited by nikkomycin Z and quantitative PCR showed that their expression is higher in presence of the inhibitor. The use of nikkomycin Z combined with microscopy showed that chitin synthases are active essentially at the hyphal tips, which burst in the presence of the inhibitor, leading to cell death. S. parasitica was more sensitive to nikkomycin Z than S. monoica. In conclusion, chitin synthases with species-specific characteristics are involved in tip growth in Saprolegnia species and chitin is vital for the micro-organisms despite its very low abundance in the cell walls. Chitin is most likely synthesized transiently at the apex of the cells before cellulose, the major
Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.
2003-01-01
Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...
McLaughlin, Kimberley; Folorunso, Ayorinde O; Deeni, Yusuf Y; Foster, Dona; Gorbatiuk, Oksana; Hapca, Simona M; Immoor, Corinna; Koza, Anna; Mohammed, Ibrahim U; Moshynets, Olena; Rogalsky, Sergii; Zawadzki, Kamil; Spiers, Andrew J
2017-06-01
Although bacterial cellulose synthase (bcs) operons are widespread within the Proteobacteria phylum, subunits required for the partial-acetylation of the polymer appear to be restricted to a few γ-group soil, plant-associated and phytopathogenic pseudomonads, including Pseudomonas fluorescens SBW25 and several Pseudomonas syringae pathovars. However, a bcs operon with acetylation subunits has also been annotated in the unrelated β-group respiratory pathogen, Bordetella avium 197N. Our comparison of subunit protein sequences and GC content analyses confirms the close similarity between the B. avium 197N and pseudomonad operons and suggests that, in both cases, the cellulose synthase and acetylation subunits were acquired as a single unit. Using static liquid microcosms, we can confirm that B. avium 197N expresses low levels of cellulose in air-liquid interface biofilms and that biofilm strength and attachment levels could be increased by elevating c-di-GMP levels like the pseudomonads, but cellulose was not required for biofilm formation itself. The finding that B. avium 197N is capable of producing cellulose from a highly-conserved, but relatively uncommon bcs operon raises the question of what functional role this modified polymer plays during the infection of the upper respiratory tract or survival between hosts, and what environmental signals control its production. Copyright © 2017 Institut Pasteur. All rights reserved.
International Nuclear Information System (INIS)
Rothenberg, M.; Hanson, M.R.
1988-01-01
A novel ATP synthase subunit 9 gene (atp9) was identified in the mitochondrial genome of a Petunia somatic hybrid line (13-133) which was produced from a fusion between Petunia lines 3688 and 3704. The novel gene was generated by intergenomic recombination between atp9 genes from the two parental plant lines. The entire atp9 coding region is represented on the recombinant gene. Comparison of gene sequences using electrophoresis and autoradiography, indicate that the 5' transcribed region is contributed by an atp9 gene from 3704 and the 3' transcribed region is contributed by an atp9 gene from 3688. The recombinant atp9 gene is transcriptionally active. The location of the 5' and 3' transcript termini are conserved with respect to the parental genes, resulting in the production of hybrid transcripts
Cascini, Fidelia; Passerotti, Stella; Martello, Simona
2012-04-10
In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Schindler, Daniel; Nowrousian, Minou
2014-07-01
Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.
Vogt, Leonie M.; Boekschoten, Mark V.; de Groot, Philip J.; Faas, Marijke M.; de Vos, Paul
2015-01-01
The immunomodulatory and epithelial barrier effects of cellulose as a dietary fibre were studied to analyse the potential for use in health promoting functional foods. Reporter assays demonstrated cellulose-mediated activation through TLR/MyD88 dependent-, and independent pathways. Microchip
Schneider, Lizette M; Adamski, Nikolai M; Christensen, Caspar Elo; Stuart, David B; Vautrin, Sonia; Hansson, Mats; Uauy, Cristobal; von Wettstein-Knowles, Penny
2016-03-09
Aliphatic compounds on plant surfaces, called epicuticular waxes, are the first line of defense against pathogens and pests, contribute to reducing water loss and determine other important phenotypes. Aliphatics can form crystals affecting light refraction, resulting in a color change and allowing identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase and Cer-u is a P450 enzyme. All were highly expressed in pertinent leaf sheath tissue of wild type. A physical map revealed the order Cer-c, Cer-u, Cer-q with the flanking genes 101kb apart, confirming they are a gene cluster, Cer-cqu. Homology-based modeling suggests that many of the mutant alleles affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Directory of Open Access Journals (Sweden)
Andreia Michelle Smith-Moritz
2015-08-01
Full Text Available The CELLULOSE SYNTHASE-LIKE F6 (CslF6 gene was previously shown to mediate the biosynthesis of mixed-linkage glucan (MLG, a cell wall polysaccharide that is hypothesized to be a tightly associated with cellulose and also have a role in cell expansion in the primary cell wall of young seedlings in grass species. We have recently shown that loss-of-function cslf6 rice mutants do not accumulate MLG in most vegetative tissues. Despite the absence of a structurally important polymer, MLG, these mutants are unexpectedly viable and only show a moderate growth compromise compared to wild type. Therefore these mutants are ideal biological systems to test the current grass cell wall model. In order to gain a better understanding of the role of MLG in the primary wall, we performed in-depth compositional and structural analyses of the cell walls of three day-old rice seedlings using various biochemical and novel microspectroscopic approaches. We found that cellulose content as well as matrix polysaccharide composition was not significantly altered in the MLG deficient mutant. However, we observed a significant change in cellulose microfibril bundle organization in mesophyll cell walls of the cslf6 mutant. Using synchrotron source Fourier Transform Mid-Infrared Spectromicroscopy for high-resolution imaging, we determined that the bonds associated with cellulose and arabinoxylan, another major component of the primary cell was of grasses, were in a lower energy configuration compared to wild type, suggesting a slightly weaker primary wall in MLG deficient mesophyll cells. Taken together, these results suggest that MLG may influence cellulose deposition in mesophyll cell walls without significantly affecting anisotropic growth thus challenging MLG importance in cell wall expansion.
Molecular size estimation of plasma membrane β-glucan synthase from red beet root
International Nuclear Information System (INIS)
Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.
1986-01-01
Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-01-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...
Flynn, Christopher M; Schmidt-Dannert, Claudia
2018-06-01
The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide
DEFF Research Database (Denmark)
Vestergaard, H; Lund, S; Bjørbaek, C
1995-01-01
We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....
Directory of Open Access Journals (Sweden)
Catalina Sanz
Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.
Directory of Open Access Journals (Sweden)
Tomotaka eShinya
2016-04-01
Full Text Available Eucalyptus species constitutes the most widely planted hardwood trees in temperate and subtropical regions. In this study, we compared the transcript levels of genes involved in lignocellulose formation such as cellulose, hemicellulose and lignin biosynthesis in two selected three-year old hybrid Eucalyptus (Eucalyptus urophylla x E. grandis genotypes (AM063 and AM380 that have different lignin content. AM063 and AM380 had 20.2 and 35.5% of Klason lignin content and 59.0% and 48.2%, -cellulose contents, respectively. We investigated the correlation between wood properties and transcript levels of wood formation-related genes using RNA-seq with total RNAs extracted from developing xylem tissues at a breast height. Transcript levels of cell wall construction genes such as cellulose synthase (CesA and sucrose synthase (SUSY were almost the same in both genotypes. However, AM063 exhibited higher transcript levels of UDP-glucose pyrophosphorylase (UGP and xyloglucan endotransglucoxylase (XTH than those in AM380. Most monolignol biosynthesis- related isozyme genes showed higher transcript levels in AM380. These results indicate monolignol biosynthesis-related genes may regulate wood composition in Eucalyptus. Flavonoids contents were also observed at much higher levels in AM380 as a result of the elevated transcript levels of common phenylpropanoid pathway genes, phenylalanine ammonium lyase (PAL, cinnamate-4-hydroxylase (C4H and 4-coumarate-CoA ligase (4CL. Secondary plant cell wall formation is regulated by many transcription factors. We analyzed genes encoding NAC, WRKY, AP2/ERF and KNOX transcription factors and found higher transcript levels of these genes in AM380. We also observed increased transcription of some MYB and LIM domain transcription factors in AM380 compared to AM063. All these results show that genes related to monolignol biosynthesis may regulate the wood composition and help maintain the ratio of cellulose and lignin contents
Cyclic diguanylic acid and cellulose synthesis in Agrobacterium tumefaciens
International Nuclear Information System (INIS)
Amikam, D.; Benziman, M.
1989-01-01
The occurrence of the novel regulatory nucleotide bis(3',5')-cyclic diguanylic acid (c-di-GMP) and its relation to cellulose biogenesis in the plant pathogen Agrobacterium tumefaciens was studied. c-di-GMP was detected in acid extracts of 32 P-labeled cells grown in various media, and an enzyme responsible for its formation from GTP was found to be present in cell-free preparations. Cellulose synthesis in vivo was quantitatively assessed with [ 14 C]glucose as a tracer. The organism produced cellulose during growth in the absence of plant cells, and this capacity was retained in resting cells. Synthesis of a cellulosic product from UDP-glucose in vitro with membrane preparations was markedly stimulated by c-di-GMP and its precursor GTP and was further enhanced by Ca2+. The calcium effect was attributed to inhibition of a c-di-GMP-degrading enzyme shown to be present in the cellulose synthase-containing membranes
Directory of Open Access Journals (Sweden)
R. Vasudevan
2014-06-01
Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.
Nieuwenhuizen, Niels J; Chen, Xiuyin; Wang, Mindy Y; Matich, Adam J; Perez, Ramon Lopez; Allan, Andrew C; Green, Sol A; Atkinson, Ross G
2015-04-01
Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-D-erythritol 4-phosphate pathway enzyme 1-deoxy-D-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-D-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. © 2015 American
Directory of Open Access Journals (Sweden)
Xiudao Yu
2013-10-01
Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.
Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine
2013-03-01
Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.
Boris, K V; Kochieva, E Z; Kudryavtsev, A M
2014-12-01
The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.
Xu, Zong-Chang; Kong, Yingzhen
2017-06-20
Cellulose-synthase proteins (CESAs) are membrane localized proteins and they form protein complexes to produce cellulose in the plasma membrane. CESA proteins play very important roles in cell wall construction during plant growth and development. In this study, a total of 21 NtCESA gene sequences were identified by using PF03552 conserved protein sequence and 10 AtCESA protein sequences of Arabidopsis thaliana to blast against the common tobacco (Nicotiana tabacum L.) genome database with TBLASTN protocol. We analyzed the physical and chemical properties of protein sequences based on some software or on-line analysis tools. The results showed that there were no significant variances in terms of the physical and chemical properties of the 21 NtCESA proteins. First, phylogenetic tree analysis showed that 21 NtCESA genes and 10 AtCESA genes were clustered into five groups, and the gene structures were similar among the genes that are clustered into the same group. Second, in all of the 21 NtCESA proteins the conserved zinc finger domain was identified in the N-terminus, transmembrane domains were identified in the C-terminus and the DDD-QXXRW conserved domains were also identified. Third, gene expression analysis results indicated that most NtCESA genes were expressed in roots and leaves of seedling or mature tissues of tobacco, seeds and callus tissues. The genes that clustered into the same group share similar expression patterns. Importantly, NtCESA proteins that are involved in secondary cell wall cellulose synthesis have two extra transmembrane domains compared with that involved in primary cell wall cellulose biosynthesis. In addition, subcellular localization results showed that NtCESA9 and NtCESA14 were two plasma membrane anchored proteins. This study will lay a foundation for further functional characterization of these NtCESA genes.
IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT
Directory of Open Access Journals (Sweden)
Mariateresa eVolpicella
2016-03-01
Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.
Yahyaa, Mosaab; Matsuba, Yuki; Brandt, Wolfgang; Doron-Faigenboim, Adi; Bar, Einat; McClain, Alan; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim; Pichersky, Eran; Ibdah, Mwafaq
2015-01-01
Bay laurel (Laurus nobilis) is an agriculturally and economically important dioecious tree in the basal dicot family Lauraceae used in food and drugs and in the cosmetics industry. Bay leaves, with their abundant monoterpenes and sesquiterpenes, are used to impart flavor and aroma to food, and have also drawn attention in recent years because of their potential pharmaceutical applications. To identify terpene synthases (TPSs) involved in the production of these volatile terpenes, we performed RNA sequencing to profile the transcriptome of L. nobilis leaves. Bioinformatic analysis led to the identification of eight TPS complementary DNAs. We characterized the enzymes encoded by three of these complementary DNAs: a monoterpene synthase that belongs to the TPS-b clade catalyzes the formation of mostly 1,8-cineole; a sesquiterpene synthase belonging to the TPS-a clade catalyzes the formation of mainly cadinenes; and a diterpene synthase of the TPS-e/f clade catalyzes the formation of geranyllinalool. Comparison of the sequences of these three TPSs indicated that the TPS-a and TPS-b clades of the TPS gene family evolved early in the evolution of the angiosperm lineage, and that geranyllinalool synthase activity is the likely ancestral function in angiosperms of genes belonging to an ancient TPS-e/f subclade that diverged from the kaurene synthase gene lineages before the split of angiosperms and gymnosperms. PMID:26157114
Characterization of a 1,4-. beta. -D-glucan synthase from Dictyostelium discoideum
Energy Technology Data Exchange (ETDEWEB)
Blanton, R.L.
1992-01-15
Various aspects of research concerning Dictyostelium discoideum are presented. The initial focus of this project was upon: the characterization of potential probes for the cellulose synthase (antibody and nucleic acid), the determination of the cultural induction conditions of cellulose synthesis, the solubilization of the enzyme activity, the development of a non-inhibitory disruption buffer, the generation and isolation of mutant strains deficient in cellulose synthesis, and the development of the capability to determine the degree of polymerization of the in vitro product. I have briefly summarized our most significant findings with only selected data sets being shown in this report in the interest of brevity.
Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne
2004-01-01
The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...
Directory of Open Access Journals (Sweden)
Peter K Busk
Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.
Directory of Open Access Journals (Sweden)
Piotr Szymczyk
2016-09-01
Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.
Nieuwenhuizen, Niels J.; Chen, Xiuyin; Wang, Mindy Y.; Matich, Adam J.; Perez, Ramon Lopez; Allan, Andrew C.; Green, Sol A.; Atkinson, Ross G.
2015-01-01
Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-d-erythritol 4-phosphate pathway enzyme 1-deoxy-d-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-d-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. PMID:25649633
Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong
2016-02-10
In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. Copyright © 2015 Elsevier B.V. All rights reserved.
Olson, Daniel G.; Giannone, Richard J.; Hettich, Robert L.
2013-01-01
The CipA scaffoldin protein plays a key role in the Clostridium thermocellum cellulosome. Previous studies have revealed that mutants deficient in binding or solubilizing cellulose also exhibit reduced expression of CipA. To confirm that CipA is, in fact, necessary for rapid solubilization of crystalline cellulose, the gene was deleted from the chromosome using targeted gene deletion technologies. The CipA deletion mutant exhibited a 100-fold reduction in cellulose solubilization rate, although it was eventually able to solubilize 80% of the 5 g/liter cellulose initially present. The deletion mutant was complemented by a copy of cipA expressed from a replicating plasmid. In this strain, Avicelase activity was restored, although the rate was 2-fold lower than that in the wild type and the duration of the lag phase was increased. The cipA coding sequence is located at the beginning of a gene cluster containing several other genes thought to be responsible for the structural organization of the cellulosome, including olpB, orf2p, and olpA. Tandem mass spectrometry revealed a 10-fold reduction in the expression of olpB, which may explain the lower growth rate. This deletion experiment adds further evidence that CipA plays a key role in cellulose solubilization by C. thermocellum, and it raises interesting questions about the differential roles of the anchor scaffoldin proteins OlpB, Orf2p, and SdbA. PMID:23204466
Energy Technology Data Exchange (ETDEWEB)
Slabaugh, Erin; Scavuzzo-Duggan, Tess; Chaves, Arielle; Wilson, Liza; Wilson, Carmen; Davis, Jonathan K.; Cosgrove, Daniel J.; Anderson, Charles T.; Roberts, Alison W.; Haigler, Candace H.
2015-12-08
Cellulose synthases (CESAs) synthesize the β-1,4-glucan chains that coalesce to form cellulose microfibrils in plant cell walls. In addition to a large cytosolic (catalytic) domain, CESAs have eight predicted transmembrane helices (TMHs). However, analogous to the structure of BcsA, a bacterial CESA, predicted TMH5 in CESA may instead be an interfacial helix. This would place the conserved FxVTxK motif in the plant cell cytosol where it could function as a substrate-gating loop as occurs in BcsA. To define the functional importance of the CESA region containing FxVTxK, we tested five parallel mutations in Arabidopsis thaliana CESA1 and Physcomitrella patens CESA5 in complementation assays of the relevant cesa mutants. In both organisms, the substitution of the valine or lysine residues in FxVTxK severely affected CESA function. In Arabidopsis roots, both changes were correlated with lower cellulose anisotropy, as revealed by Pontamine Fast Scarlet. Analysis of hypocotyl inner cell wall layers by atomic force microscopy showed that two altered versions of Atcesa1 could rescue cell wall phenotypes observed in the mutant background line. Overall, the data show that the FxVTxK motif is functionally important in two phylogenetically distant plant CESAs. The results show that Physcomitrella provides an efficient model for assessing the effects of engineered CESA mutations affecting primary cell wall synthesis and that diverse testing systems can lead to nuanced insights into CESA structure–function relationships. Although CESA membrane topology needs to be experimentally determined, the results support the possibility that the FxVTxK region functions similarly in CESA and BcsA.
Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing
2016-03-01
Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Simerjeet Kaur
2017-11-01
Full Text Available Plant cell wall formation is a complex, coordinated and developmentally regulated process. Cellulose is the most dominant constituent of plant cell walls. Because of its paracrystalline structure, cellulose is the main determinant of mechanical strength of plant tissues. As the most abundant polysaccharide on earth, it is also the focus of cellulosic biofuel industry. To reduce culm lodging in wheat and for improved ethanol production, delineation of the variation for stem cellulose content could prove useful. We present results on the analysis of the stem cellulose content of 288 diverse wheat accessions and its genome-wide association study (GWAS. Cellulose concentration ranged from 35 to 52% (w/w. Cellulose content was normally distributed in the accessions around a mean and median of 45% (w/w. Genome-wide marker-trait association study using 21,073 SNPs helped identify nine SNPs that were associated (p < 1E-05 with cellulose content. Four strongly associated (p < 8.17E-05 SNP markers were linked to wheat unigenes, which included β-tubulin, Auxin-induced protein 5NG4, and a putative transmembrane protein of unknown function. These genes may be directly or indirectly involved in the formation of cellulose in wheat culms. GWAS results from this study have the potential for genetic manipulation of cellulose content in bread wheat and other small grain cereals to enhance culm strength and improve biofuel production.
Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui
2017-07-01
Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.
Directory of Open Access Journals (Sweden)
Bua-In Saowaluck
2014-01-01
Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.
Directory of Open Access Journals (Sweden)
Leila ePazouki
2015-03-01
Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.
Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao
2011-10-01
Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.
Directory of Open Access Journals (Sweden)
Gnanasambandan Ramanathan
2017-01-01
Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.
Cellulose nanocrystal properties and their applications
Directory of Open Access Journals (Sweden)
mahdi jonoobi
2015-05-01
Full Text Available The main purpose of this work is to provide an overview of recent research in the area of cellulose nonmaterials production from different sources. Due to their abundance, their renewability, high strength and stiffness, being eco-friendly, and low weight; numerous studies have been reported on the isolation of cellulose nanomaterials from different cellulosic sources and their use in high performance applications. This work covers an introduction into the nano cellulose definition as well as used methods for isolation of nanomaterials (nanocrystals from various sources. The rod-like cellulose nanocrystals (CNC can be isolated from sources like wood, plant fibers, agriculture and industrial bio residues, tunicates, and bacterial cellulose using acid hydrolysis process. Following this, the paper focused on characterization methods, materials properties and structure. The current review is a comprehensive literature regarding the nano cellulose isolation and demonstrates the potential of cellulose nanomaterials to be used in a wide range of high-tech applications.
Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh
2016-06-01
Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.
Pyramiding genes and alleles for improving energy cane biomass yield
Energy Technology Data Exchange (ETDEWEB)
Ming, Ray [University of Illinois at Urbana-Champaign; Nagai, Chifumi [Hawaii Agriculture Research Center; Yu, Qingyi [Texas A & M AgriLife Research
2018-03-23
The overall goal of this project is to identify genes and gene interaction networks contributed to the extreme segregants with 30 folds biomass yield difference in sugarcane F2 populations. Towards achieving this goal, yield trials of 108 F2 extreme segregants from S. officinarum LA Purple and S. robustum MOL5829 (LM population) were carried out in two locations in three years. A yield trial of the second F2 population from S. officinarum LA Purple and S. spontaneum US56-14-4 (LU population) was installed in the summer of 2014 and the first set of yield component data was collected. For genotyping, transcriptomes from leaves and stalks of 70 extreme segregants of the LM F2 population and 119 individuals of the LU F2 populations were sequenced. The genomes of 91 F1 individuals from the LM populations are being sequenced to construct ultra-high density genetic maps for each of the two parents for both assisting the LA Purple genome assembling and for testing a hypothesis of female restitution. The genomes of 110 F2 individuals from single F1 in the LU population, a different set from the 119 F2 individuals used for transcriptome sequencing, are being sequenced for mapping genes and QTLs affecting biomass yield and for testing a hypothesis of female restitution. Gene expression analysis between extreme segregants of high and low biomass yield showed up-regulation of cellulose synthase, cellulose, and xylan synthase in high biomass yield segregants among 3,274 genes differentially expressed between the two extremes. Our transcriptome results revealed not only the increment of cell wall biosynthesis pathway is essential, but the rapid turnover of certain cell wall polymers as well as carbohydrate partitioning are also important for recycling and energy conservation during rapid cell growth in high biomass sugarcane. Seventeen differentially expressed genes in auxin, one in ethylene and one in gibberellin related signaling and biosynthesis pathways were identified, which
van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.
1991-01-01
Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.
Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui
2015-09-01
In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.
Jeknić, Zoran; Morré, Jeffrey T.; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H.H.
2012-01-01
The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-de...
Long, Qin; Yue, Fang; Liu, Ruochen; Song, Shuiqing; Li, Xianbi; Ding, Bo; Yan, Xingying; Pei, Yan
2018-05-11
Cotton fibers are the most important natural raw material used in textile industries world-wide. Fiber length, strength, and fineness are the three major traits which determine the quality and economic value of cotton. It is known that exogenous application of phosphatidylinositols (PtdIns), important structural phospholipids, can promote cotton fiber elongation. Here, we sought to increase the in planta production of PtdIns to improve fiber traits. Transgenic cotton plants were generated in which the expression of a cotton phosphatidylinositol synthase gene (i.e., GhPIS) was controlled by the fiber-specific SCFP promoter element, resulting in the specific up-regulation of GhPIS during cotton fiber development. We demonstrate that PtdIns content was significantly enhanced in transgenic cotton fibers and the elevated level of PtdIns stimulated the expression of genes involved in PtdIns phosphorylation as well as promoting lignin/lignin-like phenolic biosynthesis. Fiber length, strength and fineness were also improved in the transgenic plants as compared to the wild-type cotton, with no loss in overall fiber yield. Our data indicate that fiber-specific up-regulation of PtdIns synthesis is a promising strategy for cotton fiber quality improvement.
DEFF Research Database (Denmark)
Costa, M C; Helweg-Larsen, J; Lundgren, Bettina
2003-01-01
The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...
Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes
Directory of Open Access Journals (Sweden)
Bin Wang
2010-07-01
Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.
Weterings, Koen; Pezzotti, Mario; Cornelissen, Marc; Mariani, Celestina
2002-11-01
In flowering plants, pollination of the stigma sets off a cascade of responses in the distal flower organs. Ethylene and its biosynthetic precursor 1-aminocyclopropane-1-carboxylate (ACC) play an important role in regulating these responses. Because exogenous application of ethylene or ACC does not invoke the full postpollination syndrome, the pollination signal probably consists of a more complex set of stimuli. We set out to study how and when the pollination signal moves through the style of tobacco (Nicotiana tabacum) by analyzing the expression patterns of pistil-expressed ACC-synthase and -oxidase genes. Results from this analysis showed that pollination induces high ACC-oxidase transcript levels in all cells of the transmitting tissue. ACC-synthase mRNA accumulated only in a subset of transmitting tract cells and to lower levels as compared with ACC-oxidase. More significantly, we found that although ACC-oxidase transcripts accumulate to uniform high levels, the ACC-synthase transcripts accumulate in a wave-like pattern in which the peak coincides with the front of the ingrowing pollen tube tips. This wave of ACC-synthase expression can also be induced by incongruous pollination and (partially) by wounding. This indicates that wounding-like features of pollen tube invasion might be part of the stimuli evoking the postpollination response and that these stimuli are interpreted differently by the regulatory mechanisms of the ACC-synthase and -oxidase genes.
Xuezhu Xu; Haoran Wang; Long Jiang; Xinnan Wang; Scott A. Payne; J.Y. Zhu; Ruipeng Li
2014-01-01
Poly(ethylene oxide) (PEO) nanofiber mats were produced by electrospinning. Biobased cellulose nanocrystals (CNCs) and cellulose nanofibrils (CNFs) as reinforcement nanofillers were also added to the polymer to produce composite nanofiber mats. The effects of the two cellulose nanofillers on the rheological properties of the PEO solutions and the microstructure,...
Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S
2013-03-01
Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.
Bioinformatics analysis of the phytoene synthase gene in cabbage (Brassica oleracea var. capitata)
Sun, Bo; Jiang, Min; Xue, Shengling; Zheng, Aihong; Zhang, Fen; Tang, Haoru
2018-04-01
Phytoene Synthase (PSY) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata PSY (BocPSY) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocPSY1, BocPSY2 and BocPSY3 genes mapped to chromosomes 2,3 and 9, and contains an open reading frame of 1,248 bp, 1,266 bp and 1,275 bp that encodes a 415, 421, 424 amino acid protein, respectively. Subcellular localization predicted all BocPSY genes were in the chloroplast. The conserved domain of the BocPSY protein is PLN02632. Homology analysis indicates that the levels of identity among BocPSYs were all more than 85%, and the PSY protein is apparently conserved during plant evolution. The findings of the present study provide a molecular basis for the elucidation of PSY gene function in cabbage.
Directory of Open Access Journals (Sweden)
Li Yongchao
2012-01-01
Full Text Available Abstract Background The model bacterium Clostridium cellulolyticum efficiently degrades crystalline cellulose and hemicellulose, using cellulosomes to degrade lignocellulosic biomass. Although it imports and ferments both pentose and hexose sugars to produce a mixture of ethanol, acetate, lactate, H2 and CO2, the proportion of ethanol is low, which impedes its use in consolidated bioprocessing for biofuels production. Therefore genetic engineering will likely be required to improve the ethanol yield. Plasmid transformation, random mutagenesis and heterologous expression systems have previously been developed for C. cellulolyticum, but targeted mutagenesis has not been reported for this organism, hindering genetic engineering. Results The first targeted gene inactivation system was developed for C. cellulolyticum, based on a mobile group II intron originating from the Lactococcus lactis L1.LtrB intron. This markerless mutagenesis system was used to disrupt both the paralogous L-lactate dehydrogenase (Ccel_2485; ldh and L-malate dehydrogenase (Ccel_0137; mdh genes, distinguishing the overlapping substrate specificities of these enzymes. Both mutations were then combined in a single strain, resulting in a substantial shift in fermentation toward ethanol production. This double mutant produced 8.5-times more ethanol than wild-type cells growing on crystalline cellulose. Ethanol constituted 93% of the major fermentation products, corresponding to a molar ratio of ethanol to organic acids of 15, versus 0.18 in wild-type cells. During growth on acid-pretreated switchgrass, the double mutant also produced four times as much ethanol as wild-type cells. Detailed metabolomic analyses identified increased flux through the oxidative branch of the mutant's tricarboxylic acid pathway. Conclusions The efficient intron-based gene inactivation system produced the first non-random, targeted mutations in C. cellulolyticum. As a key component of the genetic toolbox
Rice Cellulose SynthaseA8 Plant-Conserved Region Is a Coiled-Coil at the Catalytic Core Entrance
Energy Technology Data Exchange (ETDEWEB)
Rushton, Phillip S.; Olek, Anna T.; Makowski, Lee; Badger, John; Steussy, C. Nicklaus; Carpita, Nicholas C.; Stauffacher, Cynthia V. (NEU); (Purdue)
2016-11-22
The crystallographic structure of a rice (Oryza sativa) cellulose synthase, OsCesA8, plant-conserved region (P-CR), one of two unique domains in the catalytic domain of plant CesAs, was solved to 2.4 Å resolution. Two antiparallel α-helices form a coiled-coil domain linked by a large extended connector loop containing a conserved trio of aromatic residues. The P-CR structure was fit into a molecular envelope for the P-CR domain derived from small-angle X-ray scattering data. The P-CR structure and molecular envelope, combined with a homology-based chain trace of the CesA8 catalytic core, were modeled into a previously determined CesA8 small-angle X-ray scattering molecular envelope to produce a detailed topological model of the CesA8 catalytic domain. The predicted position for the P-CR domain from the molecular docking models places the P-CR connector loop into a hydrophobic pocket of the catalytic core, with the coiled-coil aligned near the entrance of the substrate UDP-glucose into the active site. In this configuration, the P-CR coiled-coil alone is unlikely to regulate substrate access to the active site, but it could interact with other domains of CesA, accessory proteins, or other CesA catalytic domains to control substrate delivery.
Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.
Noar, Roslyn D; Daub, Margaret E
2016-01-01
Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode
Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.
Directory of Open Access Journals (Sweden)
Roslyn D Noar
Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that
Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.
2015-01-01
Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891
Directory of Open Access Journals (Sweden)
Resnanti Utami Handayani
2014-07-01
Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.
Directory of Open Access Journals (Sweden)
Noda Shuhei
2012-04-01
Full Text Available Abstract Background Benzoic acid is one of the most useful aromatic compounds. Despite its versatility and simple structure, benzoic acid production using microbes has not been reported previously. Streptomyces are aerobic, Gram-positive, mycelia-forming soil bacteria, and are known to produce various kinds of antibiotics composed of many aromatic residues. S. maritimus possess a complex amino acid modification pathway and can serve as a new platform microbe to produce aromatic building-block compounds. In this study, we carried out benzoate fermentation using S. maritimus. In order to enhance benzoate productivity using cellulose as the carbon source, we constructed endo-glucanase secreting S. maritimus. Results After 4 days of cultivation using glucose, cellobiose, or starch as a carbon source, the maximal level of benzoate reached 257, 337, and 460 mg/l, respectively. S. maritimus expressed β-glucosidase and high amylase-retaining activity compared to those of S. lividans and S. coelicolor. In addition, for effective benzoate production from cellulosic materials, we constructed endo-glucanase-secreting S. maritimus. This transformant efficiently degraded the phosphoric acid swollen cellulose (PASC and then produced 125 mg/l benzoate. Conclusions Wild-type S. maritimus produce benzoate via a plant-like β-oxidation pathway and can assimilate various carbon sources for benzoate production. In order to encourage cellulose degradation and improve benzoate productivity from cellulose, we constructed endo-glucanase-secreting S. maritimus. Using this transformant, we also demonstrated the direct fermentation of benzoate from cellulose. To achieve further benzoate productivity, the L-phenylalanine availability needs to be improved in future.
Zhang, Jianxia; He, Chunmei; Wu, Kunlin; Teixeira da Silva, Jaime A.; Zeng, Songjun; Zhang, Xinhua; Yu, Zhenming; Xia, Haoqiang; Duan, Jun
2016-01-01
Dendrobium officinale is one of the most important Chinese medicinal herbs. Polysaccharides are one of the main active ingredients of D. officinale. To identify the genes that maybe related to polysaccharides synthesis, two cDNA libraries were prepared from juvenile and adult D. officinale, and were named Dendrobium-1 and Dendrobium-2, respectively. Illumina sequencing for Dendrobium-1 generated 102 million high quality reads that were assembled into 93,881 unigenes with an average sequence length of 790 base pairs. The sequencing for Dendrobium-2 generated 86 million reads that were assembled into 114,098 unigenes with an average sequence length of 695 base pairs. Two transcriptome databases were integrated and assembled into a total of 145,791 unigenes. Among them, 17,281 unigenes were assigned to 126 KEGG pathways while 135 unigenes were involved in fructose and mannose metabolism. Gene Ontology analysis revealed that the majority of genes were associated with metabolic and cellular processes. Furthermore, 430 glycosyltransferase and 89 cellulose synthase genes were identified. Comparative analysis of both transcriptome databases revealed a total of 32,794 differential expression genes (DEGs), including 22,051 up-regulated and 10,743 down-regulated genes in Dendrobium-2 compared to Dendrobium-1. Furthermore, a total of 1142 and 7918 unigenes showed unique expression in Dendrobium-1 and Dendrobium-2, respectively. These DEGs were mainly correlated with metabolic pathways and the biosynthesis of secondary metabolites. In addition, 170 DEGs belonged to glycosyltransferase genes, 37 DEGs were related to cellulose synthase genes and 627 DEGs encoded transcription factors. This study substantially expands the transcriptome information for D. officinale and provides valuable clues for identifying candidate genes involved in polysaccharide biosynthesis and elucidating the mechanism of polysaccharide biosynthesis. PMID:26904032
Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika
2017-12-01
An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.
Xu, Yang; Wang, Guan; Li, Chunjie; Zhang, Min; Zhao, Hang; Sheng, Jun; Shi, Wei
2012-01-01
Pu-erh tea undergoes a unique fermentation process and contains theabrownins, polysaccharides and caffeine; although it is unclear about which component is associated with the down regulation of nitric oxide levels or how this process is mediated. To address this question we examined the effects of pu-erh tea on nitric oxide synthase (NOS) genes. Cohorts of rats were separately given four-week treatments of water as control, pu-erh tea, or the tea components: theabrownins, caffeine or polysaccharides. Five experimental groups were injected with lipopolysaccharides (LPS) to induce nitric oxide (NO) production, while the corresponding five control groups were injected with saline as a negative control. The serum and liver NO concentrations were examined and the NOS expression of both mRNA and protein was measured in liver. The results showed that the rats which were fed pu-erh tea or polysaccharides had lower levels of NO which corresponded with the down-regulation of inducible nitric oxide synthase (iNOS) expression. We further demonstrate that this effect is mediated through reduction of Toll-like receptor 4 (TLR4) signaling. Thus we find that the polysaccharide components in pu-erh tea reduce NO levels in an animal model by inhibiting the iNOS expression via signaling through TLR4. PMID:22837686
Directory of Open Access Journals (Sweden)
Senta Heiss-Blanquet
Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.
González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2015-01-01
Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.
Energy Technology Data Exchange (ETDEWEB)
Blanton, R.L.
1992-01-15
Various aspects of research concerning Dictyostelium discoideum are presented. The initial focus of this project was upon: the characterization of potential probes for the cellulose synthase (antibody and nucleic acid), the determination of the cultural induction conditions of cellulose synthesis, the solubilization of the enzyme activity, the development of a non-inhibitory disruption buffer, the generation and isolation of mutant strains deficient in cellulose synthesis, and the development of the capability to determine the degree of polymerization of the in vitro product. I have briefly summarized our most significant findings with only selected data sets being shown in this report in the interest of brevity.
Directory of Open Access Journals (Sweden)
Dullat Harpreet K
2011-03-01
Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.
International Nuclear Information System (INIS)
Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.
2008-01-01
Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)
Merkulov, S.; Assema, van F.; Springer, J.; Carmen, del A.F.; Mooibroek, H.
2000-01-01
The squalene synthase (SQS) gene encodes a key regulatory enzyme, farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21), in sterol biosynthesis. The SQS1 gene was isolated from a subgenomic library of the industrially important yeast Yarrowia lipolytica, using PCR-generated probes. Probes were
Florea, Michael; Hagemann, Henrik; Santosa, Gabriella; Micklem, Chris N.; Spencer-Milnes, Xenia; de Arroyo Garcia, Laura; Paschou, Despoina; Lazenbatt, Christopher; Kong, Deze; Chughtai, Haroon; Jensen, Kirsten; Freemont, Paul S.; Kitney, Richard; Reeve, Benjamin; Ellis, Tom
2016-01-01
Bacterial cellulose is a strong and ultrapure form of cellulose produced naturally by several species of the Acetobacteraceae. Its high strength, purity, and biocompatibility make it of great interest to materials science; however, precise control of its biosynthesis has remained a challenge for biotechnology. Here we isolate a strain of Komagataeibacter rhaeticus (K. rhaeticus iGEM) that can produce cellulose at high yields, grow in low-nitrogen conditions, and is highly resistant to toxic chemicals. We achieved external control over its bacterial cellulose production through development of a modular genetic toolkit that enables rational reprogramming of the cell. To further its use as an organism for biotechnology, we sequenced its genome and demonstrate genetic circuits that enable functionalization and patterning of heterologous gene expression within the cellulose matrix. This work lays the foundations for using genetic engineering to produce cellulose-based materials, with numerous applications in basic science, materials engineering, and biotechnology. PMID:27247386
Liu, Xia; Zhao, Bo; Zheng, Hua-Jun; Hu, Yan; Lu, Gang; Yang, Chang-Qing; Chen, Jie-Dan; Chen, Jun-Jian; Chen, Dian-Yang; Zhang, Liang; Zhou, Yan; Wang, Ling-Jian; Guo, Wang-Zhen; Bai, Yu-Lin; Ruan, Ju-Xin; Shangguan, Xiao-Xia; Mao, Ying-Bo; Shan, Chun-Min; Jiang, Jian-Ping; Zhu, Yong-Qiang; Jin, Lei; Kang, Hui; Chen, Shu-Ting; He, Xu-Lin; Wang, Rui; Wang, Yue-Zhu; Chen, Jie; Wang, Li-Jun; Yu, Shu-Ting; Wang, Bi-Yun; Wei, Jia; Song, Si-Chao; Lu, Xin-Yan; Gao, Zheng-Chao; Gu, Wen-Yi; Deng, Xiao; Ma, Dan; Wang, Sen; Liang, Wen-Hua; Fang, Lei; Cai, Cai-Ping; Zhu, Xie-Fei; Zhou, Bao-Liang; Jeffrey Chen, Z; Xu, Shu-Hua; Zhang, Yu-Gao; Wang, Sheng-Yue; Zhang, Tian-Zhen; Zhao, Guo-Ping; Chen, Xiao-Ya
2015-09-30
Of the two cultivated species of allopolyploid cotton, Gossypium barbadense produces extra-long fibers for the production of superior textiles. We sequenced its genome (AD)2 and performed a comparative analysis. We identified three bursts of retrotransposons from 20 million years ago (Mya) and a genome-wide uneven pseudogenization peak at 11-20 Mya, which likely contributed to genomic divergences. Among the 2,483 genes preferentially expressed in fiber, a cell elongation regulator, PRE1, is strikingly At biased and fiber specific, echoing the A-genome origin of spinnable fiber. The expansion of the PRE members implies a genetic factor that underlies fiber elongation. Mature cotton fiber consists of nearly pure cellulose. G. barbadense and G. hirsutum contain 29 and 30 cellulose synthase (CesA) genes, respectively; whereas most of these genes (>25) are expressed in fiber, genes for secondary cell wall biosynthesis exhibited a delayed and higher degree of up-regulation in G. barbadense compared with G. hirsutum, conferring an extended elongation stage and highly active secondary wall deposition during extra-long fiber development. The rapid diversification of sesquiterpene synthase genes in the gossypol pathway exemplifies the chemical diversity of lineage-specific secondary metabolites. The G. barbadense genome advances our understanding of allopolyploidy, which will help improve cotton fiber quality.
Lane, Courtney E; Benton, Michael G
2015-12-01
A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.
Ober, Dietrich; Hartmann, Thomas
1999-01-01
Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289
Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M
2005-06-01
Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.
Directory of Open Access Journals (Sweden)
Udaya C Kalluri
2016-10-01
Full Text Available A greater understanding of the genetic regulation of plant cell wall remodeling and the impact of modified cell walls on plant performance is important for the development of sustainable biofuel crops. Here, we studied the impact of down-regulating KORRIGAN-like cell wall biosynthesis genes, belonging to the endo-β-1,4-glucanase gene family, on Populus growth, metabolism and the ability to interact with symbiotic microbes. The reductions in cellulose content and lignin syringyl-to-guaiacyl unit ratio, and increase in cellulose crystallinity of cell walls of PdKOR RNAi plants corroborated the functional role of PdKOR in cell wall biosynthesis. Altered metabolism and reduced growth characteristics of RNAi plants revealed new implications on carbon allocation and partitioning. The distinctive metabolome phenotype comprised of a higher phenolic and salicylic acid content, and reduced lignin, shikimic acid and maleic acid content relative to control. Plant sustainability implications of modified cell walls on beneficial plant-microbe interactions were explored via co-culture with an ectomycorrhizal fungus, Laccaria bicolor. A significant increase in the mycorrhization rate was observed in transgenic plants, leading to measurable beneficial growth effects. These findings present new evidence for functional interconnectedness of cellulose biosynthesis pathway, metabolism and mycorrhizal association in plants, and further emphasize the consideration of the sustainability implications of plant trait improvement efforts.
Zhang, Jian; Zhu, Liuyang; Chen, Haoyu; Li, Min; Zhu, Xiaojuan; Gao, Qiang; Wang, Depei; Zhang, Ying
2016-12-28
The polyketide synthase gene An15g07920 was known in Aspergillus niger CBS 513.88 as putatively involved in the production of ochratoxin A (OTA). Genome resequencing analysis revealed that the gene An15g07920 is also present in the ochratoxin-producing A. niger strain 1062. Disruption of An15g07920 in A. niger 1062 removed its capacity to biosynthesize ochratoxin β (OTβ), ochratoxin α (OTα), and OTA. These results indicate that the polyketide synthase encoded by An15g07920 is a crucial player in the biosynthesis of OTA, in the pathway prior to the phenylalanine ligation step. The gene An15g07920 reached its maximum transcription level before OTA accumulation reached its highest level, confirming that gene transcription precedes OTA production. These findings will not only help explain the mechanism of OTA production in A. niger but also provide necessary information for the development of effective diagnostic, preventive, and control strategies to reduce the risk of OTA contamination in foods.
International Nuclear Information System (INIS)
Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.
2006-01-01
The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)
Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T
2016-12-01
Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Tajammul Hussain
2018-05-01
Full Text Available The liverwort Radula marginata belongs to the bryophyte division of land plants and is a prospective alternate source of cannabinoid-like compounds. However, mechanistic insights into the molecular pathways directing the synthesis of these cannabinoid-like compounds have been hindered due to the lack of genetic information. This prompted us to do deep sequencing, de novo assembly and annotation of R. marginata transcriptome, which resulted in the identification and validation of the genes for cannabinoid biosynthetic pathway. In total, we have identified 11,421 putative genes encoding 1,554 enzymes from 145 biosynthetic pathways. Interestingly, we have identified all the upstream genes of the central precursor of cannabinoid biosynthesis, cannabigerolic acid (CBGA, including its two first intermediates, stilbene acid (SA and geranyl diphosphate (GPP. Expression of all these genes was validated using quantitative real-time PCR. We have characterized the protein structure of stilbene synthase (STS, which is considered as a homolog of olivetolic acid in R. marginata. Moreover, the metabolomics approach enabled us to identify CBGA-analogous compounds using electrospray ionization mass spectrometry (ESI-MS/MS and gas chromatography mass spectrometry (GC-MS. Transcriptomic analysis revealed 1085 transcription factors (TF from 39 families. Comparative analysis showed that six TF families have been uniquely predicted in R. marginata. In addition, the bioinformatics analysis predicted a large number of simple sequence repeats (SSRs and non-coding RNAs (ncRNAs. Our results collectively provide mechanistic insights into the putative precursor genes for the biosynthesis of cannabinoid-like compounds and a novel transcriptomic resource for R. marginata. The large-scale transcriptomic resource generated in this study would further serve as a reference transcriptome to explore the Radulaceae family.
Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger
Energy Technology Data Exchange (ETDEWEB)
Rinker, Torri E.; Baker, Scott E.
2007-01-29
Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.
Ye, Yanfang; Fujii, Makoto; Hirata, Aiko; Kawamukai, Makoto; Shimoda, Chikashi; Nakamura, Taro
2007-09-01
Both farnesyl diphosphate synthase (FPS) and geranylgeranyl diphosphate synthase (GGPS) are key enzymes in the synthesis of various isoprenoid-containing compounds and proteins. Here, we describe two novel Schizosaccharomyces pombe genes, fps1(+) and spo9(+), whose products are similar to FPS in primary structure, but whose functions differ from one another. Fps1 is essential for vegetative growth, whereas, a spo9 null mutant exhibits temperature-sensitive growth. Expression of fps1(+), but not spo9(+), suppresses the lethality of a Saccharomyces cerevisiae FPS-deficient mutant and also restores ubiquinone synthesis in an Escherichia coli ispA mutant, which lacks FPS activity, indicating that S. pombe Fps1 in fact functions as an FPS. In contrast to a typical FPS gene, no apparent GGPS homologues have been found in the S. pombe genome. Interestingly, although neither fps1(+) nor spo9(+) expression alone in E. coli confers clear GGPS activity, coexpression of both genes induces such activity. Moreover, the GGPS activity is significantly reduced in the spo9 mutant. In addition, the spo9 mutation perturbs the membrane association of a geranylgeranylated protein, but not that of a farnesylated protein. Yeast two-hybrid and coimmunoprecipitation analyses indicate that Fps1 and Spo9 physically interact. Thus, neither Fps1 nor Spo9 alone functions as a GGPS, but the two proteins together form a complex with GGPS activity. Because spo9 was originally identified as a sporulation-deficient mutant, we show here that expansion of the forespore membrane is severely inhibited in spo9Delta cells. Electron microscopy revealed significant accumulation membrane vesicles in spo9Delta cells. We suggest that lack of GGPS activity in a spo9 mutant results in impaired protein prenylation in certain proteins responsible for secretory function, thereby inhibiting forespore membrane formation.
Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians
DEFF Research Database (Denmark)
Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh
2008-01-01
of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...
Zhou, Xiaojin; Li, Suzhen; Zhao, Qianqian; Liu, Xiaoqing; Zhang, Shaojun; Sun, Cheng; Fan, Yunliu; Zhang, Chunyi; Chen, Rumei
2013-01-01
Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families ...
Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei
2017-02-01
Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Linda Koshy
2008-01-01
Full Text Available Endothelial nitric oxide synthase (eNOS gene polymorphisms have been implicated as predisposing genetic factors that can predict aneurysmal subarachnoid hemorrhage (aSAH, but with controversial results from different populations. Using a case-control study design, we tested the hypothesis whether variants in eNOS gene can increase risk of aSAH among South Indian patients, either independently, or by interacting with other risk factors of the disease. We enrolled 122 patients, along with 224 ethnically matched controls. We screened the intron-4 27-bp VNTR, the promoter T-786C and the exon-7 G894T SNPs in the eNOS gene. We found marked interethnic differences in the genotype distribution of eNOS variants when comparing the South Indian population with the reported frequencies from Caucasian and Japanese populations. Genotype distributions in control and patient populations were found to be in Hardy-Weinberg equilibrium. In patients, the allele, genotype and estimated haplotype frequencies did not differ significantly from the controls. Multiple logistic regression indicated hypertension and smoking as risk factors for the disease, however the risk alleles did not have any interaction with these risk factors. Although the eNOS polymorphisms were not found to be a likely risk factor for aSAH, the role of factors such as ethnicity, gender, smoking and hypertension should be evaluated cautiously to understand the genotype to phenotype conversion.
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-10-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.
DEFF Research Database (Denmark)
Ramachandran, Roshni; Bhatt, Deepak Kumar; Ploug, Kenneth Beri
2014-01-01
BACKGROUND AND AIM: Infusion of glyceryltrinitrate (GTN), a nitric oxide (NO) donor, in awake, freely moving rats closely mimics a universally accepted human model of migraine and responds to sumatriptan treatment. Here we analyse the effect of nitric oxide synthase (NOS) and calcitonin gene-rela...
Griffiths, Jonathan S; North, Helen M
2017-05-01
The cell wall defines the shape of cells and ultimately plant architecture. It provides mechanical resistance to osmotic pressure while still being malleable and allowing cells to grow and divide. These properties are determined by the different components of the wall and the interactions between them. The major components of the cell wall are the polysaccharides cellulose, hemicellulose and pectin. Cellulose biosynthesis has been extensively studied in Arabidopsis hypocotyls, and more recently in the mucilage-producing epidermal cells of the seed coat. The latter has emerged as an excellent system to study cellulose biosynthesis and the interactions between cellulose and other cell wall polymers. Here we review some of the major advances in our understanding of cellulose biosynthesis in the seed coat, and how mucilage has aided our understanding of the interactions between cellulose and other cell wall components required for wall cohesion. Recently, 10 genes involved in cellulose or hemicellulose biosynthesis in mucilage have been identified. These discoveries have helped to demonstrate that xylan side-chains on rhamnogalacturonan I act to link this pectin directly to cellulose. We also examine other factors that, either directly or indirectly, influence cellulose organization or crystallization in mucilage. © 2017 INRA. New Phytologist © 2017 New Phytologist Trust.
Li, Fengcheng; Xie, Guosheng; Huang, Jiangfeng; Zhang, Ran; Li, Yu; Zhang, Miaomiao; Wang, Yanting; Li, Ao; Li, Xukai; Xia, Tao; Qu, Chengcheng; Hu, Fan; Ragauskas, Arthur J; Peng, Liangcai
2017-09-01
Genetic modification of plant cell walls has been posed to reduce lignocellulose recalcitrance for enhancing biomass saccharification. Since cellulose synthase (CESA) gene was first identified, several dozen CESA mutants have been reported, but almost all mutants exhibit the defective phenotypes in plant growth and development. In this study, the rice (Oryza sativa) Osfc16 mutant with substitutions (W481C, P482S) at P-CR conserved site in CESA9 shows a slightly affected plant growth and higher biomass yield by 25%-41% compared with wild type (Nipponbare, a japonica variety). Chemical and ultrastructural analyses indicate that Osfc16 has a significantly reduced cellulose crystallinity (CrI) and thinner secondary cell walls compared with wild type. CESA co-IP detection, together with implementations of a proteasome inhibitor (MG132) and two distinct cellulose inhibitors (Calcofluor, CGA), shows that CESA9 mutation could affect integrity of CESA4/7/9 complexes, which may lead to rapid CESA proteasome degradation for low-DP cellulose biosynthesis. These may reduce cellulose CrI, which improves plant lodging resistance, a major and integrated agronomic trait on plant growth and grain production, and enhances biomass enzymatic saccharification by up to 2.3-fold and ethanol productivity by 34%-42%. This study has for the first time reported a direct modification for the low-DP cellulose production that has broad applications in biomass industries. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Steven Steven; Yoni F Syukriani; Julius B Dewanto
2016-01-01
Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...
Directory of Open Access Journals (Sweden)
Marquez Rodolfo
2004-09-01
Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.
Energy Technology Data Exchange (ETDEWEB)
Li, Yongchao [ORNL; Tschaplinski, Timothy J [ORNL; Engle, Nancy L [ORNL; Hamilton, Choo Yieng [ORNL; Rodriguez, Jr., Miguel [ORNL; Liao, James C [ORNL; Schadt, Christopher Warren [ORNL; Guss, Adam M [ORNL; Yang, Yunfeng [ORNL; Graham, David E [ORNL
2012-01-01
Background: The model bacterium Clostridium cellulolyticum efficiently hydrolyzes crystalline cellulose and hemicellulose, using cellulosomes to degrade lignocellulosic biomass. Although it imports and ferments both pentose and hexose sugars to produce a mixture of ethanol, acetate, lactate, H2 and CO2, the proportion of ethanol is low, which impedes its use in consolidated bioprocessing for biofuels. Therefore genetic engineering will likely be required to improve the ethanol yield. Random mutagenesis, plasmid transformation, and heterologous expression systems have previously been developed for C. cellulolyticum, but targeted mutagenesis has not been reported for this organism. Results: The first targeted gene inactivation system was developed for C. cellulolyticum, based on a mobile group II intron originating from the Lactococcus lactis L1.LtrB intron. This markerless mutagenesis system was used to disrupt both the paralogous L-lactate dehydrogenase (Ccel_2485; ldh) and L-malate dehydrogenase (Ccel_0137; mdh) genes, distinguishing the overlapping substrate specificities of these enzymes. Both mutations were then combined in a single strain. This double mutant produced 8.5-times more ethanol than wild-type cells growing on crystalline cellulose. Ethanol constituted 93% of the major fermentation products (by molarity), corresponding to a molar ratio of ethanol to organic acids of 15, versus 0.18 in wild-type cells. During growth on acid-pretreated switchgrass, the double mutant also produced four-times as much ethanol as wild-type cells. Detailed metabolomic analyses identified increased flux through the oxidative branch of the mutant s TCA pathway. Conclusions: The efficient intron-based gene inactivation system produced the first gene-targeted mutations in C. cellulolyticum. As a key component of the genetic toolbox for this bacterium, markerless targeted mutagenesis enables functional genomic research in C. cellulolyticum and rapid genetic engineering to
Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).
Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes
2012-03-01
Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.
Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W
2015-03-31
Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.
Xiang, Lin; Zhao, Kaige; Chen, Longqing
2010-01-01
Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-01-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043
The Arabidopsis mutant cev1 links cell wall signaling to jasmonate and ethylene responses.
Ellis, Christine; Karafyllidis, Ioannis; Wasternack, Claus; Turner, John G
2002-07-01
Biotic and abiotic stresses stimulate the synthesis of jasmonates and ethylene, which, in turn, induce the expression of genes involved in stress response and enhance defense responses. The cev1 mutant has constitutive expression of stress response genes and has enhanced resistance to fungal pathogens. Here, we show that cev1 plants have increased production of jasmonate and ethylene and that its phenotype is suppressed by mutations that interrupt jasmonate and ethylene signaling. Genetic mapping, complementation analysis, and sequence analysis revealed that CEV1 is the cellulose synthase CeSA3. CEV1 was expressed predominantly in root tissues, and cev1 roots contained less cellulose than wild-type roots. Significantly, the cev1 mutant phenotype could be reproduced by treating wild-type plants with cellulose biosynthesis inhibitors, and the cellulose synthase mutant rsw1 also had constitutive expression of VSP. We propose that the cell wall can signal stress responses in plants.
Directory of Open Access Journals (Sweden)
Wenjing Zheng
Full Text Available Rice stripe, a virus disease, transmitted by a small brown planthopper (SBPH, has greatly reduced production of japonica rice in East Asia, especially in China. Although we have made great progress in mapping resistance genes, little is known about the mechanism of resistance. By de novo transcriptome assembling, we gained sufficient transcript data to analyze changes in gene expression of early interaction in response to SBPH and RSV infection in rice. Respectively 648 and 937 DEGs were detected from the disease-resistant (Liaonong 979 and the susceptible (Fengjin varieties, most of which were up-regulated. We found 37 genes related to insect resistance, which mainly included genes for jasmonate-induced protein, TIFY protein, lipoxygenase, as well as trypsin inhibitor genes and transcription factor genes. In the interaction process between RSV and rice, 87 genes were thought to be related to RSV resistance; these primarily included 12 peroxidase biosynthesis genes, 12 LRR receptor-like protein kinase genes, 6 genes coding pathogenesis-related proteins, 4 glycine-rich cell wall structural protein genes, 2 xyloglucan hydrolase genes and a cellulose synthase. The results indicate that the rice-pathogen interaction happened both in disease-resistant and susceptible varieties, and some genes related to JA biosynthesis played key roles in the interaction between SBPHs and rice. When rice was infected by RSV a hypersensitive reaction (HR in the disease-resistant variety was suppressed, which resulted from an increase in peroxidase expression and down-regulation of LRR receptor-like protein kinase and pathogenesis-related proteins, while, the changes of peroxidase biosynthesis, glycine-rich cell wall structural protein, cellulose synthase and xyloglucan endotransglucosylase/hydrolase could lead to the strengthening of physical barriers of rice, which may be an important resistance mechanism to RSV in rice.
Zheng, Wenjing; Ma, Li; Zhao, Jiaming; Li, Zhiqiang; Sun, Fuyu; Lu, Xiaochun
2013-01-01
Rice stripe, a virus disease, transmitted by a small brown planthopper (SBPH), has greatly reduced production of japonica rice in East Asia, especially in China. Although we have made great progress in mapping resistance genes, little is known about the mechanism of resistance. By de novo transcriptome assembling, we gained sufficient transcript data to analyze changes in gene expression of early interaction in response to SBPH and RSV infection in rice. Respectively 648 and 937 DEGs were detected from the disease-resistant (Liaonong 979) and the susceptible (Fengjin) varieties, most of which were up-regulated. We found 37 genes related to insect resistance, which mainly included genes for jasmonate-induced protein, TIFY protein, lipoxygenase, as well as trypsin inhibitor genes and transcription factor genes. In the interaction process between RSV and rice, 87 genes were thought to be related to RSV resistance; these primarily included 12 peroxidase biosynthesis genes, 12 LRR receptor-like protein kinase genes, 6 genes coding pathogenesis-related proteins, 4 glycine-rich cell wall structural protein genes, 2 xyloglucan hydrolase genes and a cellulose synthase. The results indicate that the rice-pathogen interaction happened both in disease-resistant and susceptible varieties, and some genes related to JA biosynthesis played key roles in the interaction between SBPHs and rice. When rice was infected by RSV a hypersensitive reaction (HR) in the disease-resistant variety was suppressed, which resulted from an increase in peroxidase expression and down-regulation of LRR receptor-like protein kinase and pathogenesis-related proteins, while, the changes of peroxidase biosynthesis, glycine-rich cell wall structural protein, cellulose synthase and xyloglucan endotransglucosylase/hydrolase could lead to the strengthening of physical barriers of rice, which may be an important resistance mechanism to RSV in rice.
Polyketide synthases of Diaporthe helianthi and involvement of DhPKS1 in virulence on sunflower.
Ruocco, Michelina; Baroncelli, Riccardo; Cacciola, Santa Olga; Pane, Catello; Monti, Maurilia Maria; Firrao, Giuseppe; Vergara, Mariarosaria; Magnano di San Lio, Gaetano; Vannacci, Giovanni; Scala, Felice
2018-01-06
The early phases of Diaporthe helianthi pathogenesis on sunflower are characterized by the production of phytotoxins that may play a role in host colonisation. In previous studies, phytotoxins of a polyketidic nature were isolated and purified from culture filtrates of virulent strains of D. helianthi isolated from sunflower. A highly aggressive isolate (7/96) from France contained a gene fragment of a putative nonaketide synthase (lovB) which was conserved in a virulent D. helianthi population. In order to investigate the role of polyketide synthases in D. helianthi 7/96, a draft genome of this isolate was examined. We were able to find and phylogenetically analyse 40 genes putatively coding for polyketide synthases (PKSs). Analysis of their domains revealed that most PKS genes of D. helianthi are reducing PKSs, whereas only eight lacked reducing domains. Most of the identified PKSs have orthologs shown to be virulence factors or genetic determinants for toxin production in other pathogenic fungi. One of the genes (DhPKS1) corresponded to the previously cloned D. helianthi lovB gene fragment and clustered with a nonribosomal peptide synthetase (NRPS) -PKS hybrid/lovastatin nonaketide like A. nidulans LovB. We used DhPKS1 as a case study and carried out its disruption through Agrobacterium-mediated transformation in the isolate 7/96. D. helianthi DhPKS1 deleted mutants were less virulent to sunflower compared to the wild type, indicating a role for this gene in the pathogenesis of the fungus. The PKS sequences analysed and reported here constitute a new genomic resource that will be useful for further research on the biology, ecology and evolution of D. helianthi and generally of fungal plant pathogens.
Ancient horizontal gene transfer from bacteria enhances biosynthetic capabilities of fungi.
Directory of Open Access Journals (Sweden)
Imke Schmitt
Full Text Available Polyketides are natural products with a wide range of biological functions and pharmaceutical applications. Discovery and utilization of polyketides can be facilitated by understanding the evolutionary processes that gave rise to the biosynthetic machinery and the natural product potential of extant organisms. Gene duplication and subfunctionalization, as well as horizontal gene transfer are proposed mechanisms in the evolution of biosynthetic gene clusters. To explain the amount of homology in some polyketide synthases in unrelated organisms such as bacteria and fungi, interkingdom horizontal gene transfer has been evoked as the most likely evolutionary scenario. However, the origin of the genes and the direction of the transfer remained elusive.We used comparative phylogenetics to infer the ancestor of a group of polyketide synthase genes involved in antibiotic and mycotoxin production. We aligned keto synthase domain sequences of all available fungal 6-methylsalicylic acid (6-MSA-type PKSs and their closest bacterial relatives. To assess the role of symbiotic fungi in the evolution of this gene we generated 24 6-MSA synthase sequence tags from lichen-forming fungi. Our results support an ancient horizontal gene transfer event from an actinobacterial source into ascomycete fungi, followed by gene duplication.Given that actinobacteria are unrivaled producers of biologically active compounds, such as antibiotics, it appears particularly promising to study biosynthetic genes of actinobacterial origin in fungi. The large number of 6-MSA-type PKS sequences found in lichen-forming fungi leads us hypothesize that the evolution of typical lichen compounds, such as orsellinic acid derivatives, was facilitated by the gain of this bacterial polyketide synthase.
Directory of Open Access Journals (Sweden)
Ro Dae-Kyun
2009-07-01
Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes
Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean
Good, Laura Lee
2001-01-01
The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...
Plant terpene synthase genes (TPSs) have roles in diverse biological processes. Here we report the functional characterization of one member of the soybean TP S gene family, which was designated GmAFS. Recombinant GmAFS produced in E.coli catalyzed the formation of a sesquiterpene (E,E)-a-farnesene....
DEFF Research Database (Denmark)
Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J
1999-01-01
Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth...... biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP....
MICROBIAL FERMENTATION OF ABUNDANT BIOPOLYMERS: CELLULOSE AND CHITIN
Energy Technology Data Exchange (ETDEWEB)
Leschine, Susan
2009-10-31
Our research has dealt with seven major areas of investigation: i) characterization of cellulolytic members of microbial consortia, with special attention recently given to Clostridium phytofermentans, a bacterium that decomposes cellulose and produces uncommonly large amounts of ethanol, ii) investigations of the chitinase system of Cellulomonas uda; including the purification and characterization of ChiA, the major component of this enzyme system, iii) molecular cloning, sequence and structural analysis of the gene that encodes ChiA in C. uda, iv) biofilm formation by C. uda on nutritive surfaces, v) investigations of the effects of humic substances on cellulose degradation by anaerobic cellulolytic microbes, vi) studies of nitrogen metabolism in cellulolytic anaerobes, and vii) understanding the molecular architecture of the multicomplex cellulase-xylanase system of Clostridium papyrosolvens. Also, progress toward completing the research of more recent projects is briefly summarized. Major accomplishments include: 1. Characterization of Clostridium phytofermentans, a cellulose-fermenting, ethanol-producing bacterium from forest soil. The characterization of a new cellulolytic species isolated from a cellulose-decomposing microbial consortium from forest soil was completed. This bacterium is remarkable for the high concentrations of ethanol produced during cellulose fermentation, typically more than twice the concentration produced by other species of cellulolytic clostridia. 2. Examination of the use of chitin as a source of carbon and nitrogen by cellulolytic microbes. We discovered that many cellulolytic anaerobes and facultative aerobes are able to use chitin as a source of both carbon and nitrogen. This major discovery expands our understanding of the biology of cellulose-fermenting bacteria and may lead to new applications for these microbes. 3. Comparative studies of the cellulase and chitinase systems of Cellulomonas uda. Results of these studies indicate
International Nuclear Information System (INIS)
Franchi, Nicola; Piccinni, Ester; Ferro, Diana; Basso, Giuseppe; Spolaore, Barbara; Santovito, Gianfranco; Ballarin, Loriano
2014-01-01
Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal
Energy Technology Data Exchange (ETDEWEB)
Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)
2014-07-01
Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.
DEFF Research Database (Denmark)
Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo
2014-01-01
The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...
Loosenin, a novel protein with cellulose-disrupting activity from Bjerkandera adusta.
Quiroz-Castañeda, Rosa E; Martínez-Anaya, Claudia; Cuervo-Soto, Laura I; Segovia, Lorenzo; Folch-Mallol, Jorge L
2011-02-11
Expansins and expansin-like proteins loosen cellulose microfibrils, possibly through the rupture of intramolecular hydrogen bonds. Together with the use of lignocellulolytic enzymes, these proteins are potential molecular tools to treat plant biomass to improve saccharification yields. Here we describe a new type of expansin-related fungal protein that we have called loosenin. Its corresponding gene, loos1, from the basidiomycete Bjerkandera adusta, was cloned and heterologously expressed in Saccharomyces cerevisiae. LOOS1 is distantly related to plant expansins through the shared presence of a DPBB domain, however domain II found in plant expansins is absent. LOOS1 binds tightly to cellulose and chitin, and we demonstrate that cotton fibers become susceptible to the action of a commercial cellulase following treatment with LOOS1. Natural fibers of Agave tequilana also become susceptible to hydrolysis by cellulases after loosenin treatment. LOOS1 is a new type of protein with disrupting activity on cellulose. LOOS1 binds polysaccharides, and given its enhancing properties on the action of hydrolytic enzymes, LOOS1 represents a potential additive in the production of fermentable sugars from lignocellulose.
Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.
Directory of Open Access Journals (Sweden)
Praveen Balabaskaran Nina
2010-07-01
Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a
Fitzpatrick, J; Kricka, W; James, T C; Bond, U
2014-07-01
To compare the production of recombinant cellulase enzymes in two Saccharomyces species so as to ascertain the most suitable heterologous host for the degradation of cellulose-based biomass and its conversion into bioethanol. cDNA copies of genes representing the three major classes of cellulases (Endoglucanases, Cellobiohydrolases and β-glucosidases) from Trichoderma reesei were expressed in Saccharomyces pastorianus and Saccharomyces cerevisiae. The recombinant enzymes were secreted by the yeast hosts into the medium and were shown to act in synergy to hydrolyse cellulose. The conditions required to achieve maximum release of glucose from cellulose by the recombinant enzymes were defined and the activity of the recombinant enzymes was compared to a commercial cocktail of T. reesei cellulases. We demonstrate that significantly higher levels of cellulase activity were achieved by expression of the genes in S. pastorianus compared to S. cerevisiae. Hydrolysis of cellulose by the combined activity of the recombinant enzymes was significantly better at 50°C than at 30°C, the temperature used for mesophilic yeast fermentations, reflecting the known temperature profiles of the native enzymes. The results demonstrate that host choice is important for the heterologous production of cellulases. On the basis of the low activity of the T. reesei recombinant enzymes at fermentation temperatures, we propose a two-step process for the hydrolysis of cellulose and its fermentation into alcohol using cellulases produced in situ. © 2014 The Society for Applied Microbiology.
Genetics and physiology of cell wall polysaccharides in the model C4 grass, Setaria viridis spp.
Ermawar, Riksfardini A; Collins, Helen M; Byrt, Caitlin S; Henderson, Marilyn; O'Donovan, Lisa A; Shirley, Neil J; Schwerdt, Julian G; Lahnstein, Jelle; Fincher, Geoffrey B; Burton, Rachel A
2015-10-02
Setaria viridis has emerged as a model species for the larger C4 grasses. Here the cellulose synthase (CesA) superfamily has been defined, with an emphasis on the amounts and distribution of (1,3;1,4)-β-glucan, a cell wall polysaccharide that is characteristic of the grasses and is of considerable value for human health. Orthologous relationship of the CesA and Poales-specific cellulose synthase-like (Csl) genes among Setaria italica (Si), Sorghum bicolor (Sb), Oryza sativa (Os), Brachypodium distachyon (Bradi) and Hordeum vulgare (Hv) were compared using bioinformatics analysis. Transcription profiling of Csl gene families, which are involved in (1,3;1,4)-β-glucan synthesis, was performed using real-time quantitative PCR (Q-PCR). The amount of (1,3;1,4)-β-glucan was measured using a modified Megazyme assay. The fine structures of the (1,3;1,4)-β-glucan, as denoted by the ratio of cellotriosyl to cellotetraosyl residues (DP3:DP4 ratio) was assessed by chromatography (HPLC and HPAEC-PAD). The distribution and deposition of the MLG was examined using the specific antibody BG-1 and captured using fluorescence and transmission electron microscopy (TEM). The cellulose synthase gene superfamily contains 13 CesA and 35 Csl genes in Setaria. Transcript profiling of CslF, CslH and CslJ gene families across a vegetative tissue series indicated that SvCslF6 transcripts were the most abundant relative to all other Csl transcripts. The amounts of (1,3;1,4)-β-glucan in Setaria vegetative tissues ranged from 0.2% to 2.9% w/w with much smaller amounts in developing grain (0.003% to 0.013% w/w). In general, the amount of (1,3;1,4)-β-glucan was greater in younger than in older tissues. The DP3:DP4 ratios varied between tissue types and across developmental stages, and ranged from 2.4 to 3.0:1. The DP3:DP4 ratios in developing grain ranged from 2.5 to 2.8:1. Micrographs revealing the distribution of (1,3;1,4)-β-glucan in walls of different cell types and the data were
Large-scale additive manufacturing with bioinspired cellulosic materials.
Sanandiya, Naresh D; Vijay, Yadunund; Dimopoulou, Marina; Dritsas, Stylianos; Fernandez, Javier G
2018-06-05
Cellulose is the most abundant and broadly distributed organic compound and industrial by-product on Earth. However, despite decades of extensive research, the bottom-up use of cellulose to fabricate 3D objects is still plagued with problems that restrict its practical applications: derivatives with vast polluting effects, use in combination with plastics, lack of scalability and high production cost. Here we demonstrate the general use of cellulose to manufacture large 3D objects. Our approach diverges from the common association of cellulose with green plants and it is inspired by the wall of the fungus-like oomycetes, which is reproduced introducing small amounts of chitin between cellulose fibers. The resulting fungal-like adhesive material(s) (FLAM) are strong, lightweight and inexpensive, and can be molded or processed using woodworking techniques. We believe this first large-scale additive manufacture with ubiquitous biological polymers will be the catalyst for the transition to environmentally benign and circular manufacturing models.
Directory of Open Access Journals (Sweden)
Emilia Wilmowicz
2016-03-01
Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.
Wilson, Richard A.; Wang, Zheng-Yi; Kershaw, Michael J.; Talbot, Nicholas J.
2013-01-01
The filamentous fungus Magnaporthe oryzae is the causal agent of rice blast disease. Here we show that glycogen metabolic genes play an important role in plant infection by M. oryzae. Targeted deletion of AGL1 and GPH1, which encode amyloglucosidase and glycogen phosphorylase, respectively, prevented mobilisation of glycogen stores during appressorium development and caused a significant reduction in the ability of M. oryzae to cause rice blast disease. By contrast, targeted mutation of GSN1, which encodes glycogen synthase, significantly reduced the synthesis of intracellular glycogen, but had no effect on fungal pathogenicity. We found that loss of AGL1 and GPH1 led to a reduction in expression of TPS1 and TPS3, which encode components of the trehalose-6-phosphate synthase complex, that acts as a genetic switch in M. oryzae. Tps1 responds to glucose-6-phosphate levels and the balance of NADP/NADPH to regulate virulence-associated gene expression, in association with Nmr transcriptional inhibitors. We show that deletion of the NMR3 transcriptional inhibitor gene partially restores virulence to a Δagl1Δgph1 mutant, suggesting that glycogen metabolic genes are necessary for operation of the NADPH-dependent genetic switch in M. oryzae. PMID:24098112
Ghosh, Subhabrata; Mandi, Swati Sen
2015-07-25
Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content. Copyright © 2015 Elsevier B.V. All rights reserved.
Guerriero, Gea; Giorno, Filomena; Ciccotti, Anna Maria; Schmidt, Silvia; Baric, Sanja
2016-01-01
Apple proliferation (AP) represents a serious threat to several fruit-growing areas and is responsible for great economic losses. Several studies have highlighted the key role played by the cell wall in response to pathogen attack. The existence of a cell wall integrity signaling pathway which senses perturbations in the cell wall architecture upon abiotic/biotic stresses and activates specific defence responses has been widely demonstrated in plants. More recently a role played by cell wall-related genes has also been reported in plants infected by phytoplasmas. With the aim of shedding light on the cell wall response to AP disease in the economically relevant fruit-tree Malus × domestica Borkh., we investigated the expression of the cellulose (CesA) and callose synthase (CalS) genes in different organs (i.e., leaves, roots and branch phloem) of healthy and infected symptomatic outdoor-grown trees, sampled over the course of two time points (i.e., spring and autumn 2011), as well as in in vitro micropropagated control and infected plantlets. A strong up-regulation in the expression of cell wall biosynthetic genes was recorded in roots from infected trees. Secondary cell wall CesAs showed up-regulation in the phloem tissue from branches of infected plants, while either a down-regulation of some genes or no major changes were observed in the leaves. Micropropagated plantlets also showed an increase in cell wall-related genes and constitute a useful system for a general assessment of gene expression analysis upon phytoplasma infection. Finally, we also report the presence of several ‘knot’-like structures along the roots of infected apple trees and discuss the occurrence of this interesting phenotype in relation to the gene expression results and the modalities of phytoplasma diffusion. PMID:23086810
Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K
1999-03-01
The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.
Directory of Open Access Journals (Sweden)
Elena Vismara
2013-05-01
Full Text Available High-grade cellulose (97% α-cellulose content of 48% crystallinity index was extracted from the renewable marine biomass waste Posidonia oceanica using H2O2 and organic peracids following an environmentally friendly and chlorine-free process. This cellulose appeared as a new high-grade cellulose of waste origin quite similar to the high-grade cellulose extracted from more noble starting materials like wood and cotton linters. The benefits of α-cellulose recovery from P. oceanica were enhanced by its transformation into cellulose acetate CA and cellulose derivative GMA-C. Fully acetylated CA was prepared by conventional acetylation method and easily transformed into a transparent film. GMA-C with a molar substitution (MS of 0.72 was produced by quenching Fenton’s reagent (H2O2/FeSO4 generated cellulose radicals with GMA. GMA grafting endowed high-grade cellulose from Posidonia with adsorption capability. GMA-C removes β-naphthol from water with an efficiency of 47%, as measured by UV-Vis spectroscopy. After hydrolysis of the glycidyl group to glycerol group, the modified GMA-C was able to remove p-nitrophenol from water with an efficiency of 92%, as measured by UV-Vis spectroscopy. α-cellulose and GMA-Cs from Posidonia waste can be considered as new materials of potential industrial and environmental interest.
Different patterns of gene expression in rice varieties undergoing a ...
African Journals Online (AJOL)
Some genes specifically up-regulated in infected 9804-Rxo1 were defenserelated, including the genes encoding pathogenesis-related protein, terpene synthase family, transcription factors (TFs) AP2 domain containing protein, myb-like deoxyribonucleic acid (DNA)- binding domain containing protein, and C2H2-type ...
Directory of Open Access Journals (Sweden)
Lin-Hui Gao
2018-01-01
Full Text Available Objective: To clone and investigate two dehydrodolichyl diphosphate synthase genes of Tripterygium wilfordii by bioinformatics and tissue expression analysis. Materials and Methods: According to the T. wifordii transcriptome database, specific primers were designed to clone the TwDHDDS1 and TwDHDDS2 genes via PCR. Based on the cloned sequences, protein structure prediction, multiple sequence alignment and phylogenetic tree construction were performed. The expression levels of the genes in different tissues of T. wilfordii were measured by real-time quantitative PCR. Results: The TwDHDDS1 gene encompassed a 873 bp open reading frame (ORF and encoded a protein of 290 amino acids. The calculated molecular weight of the translated protein was about 33.46 kDa, and the theoretical isoelectric point (pI was 8.67. The TwDHDDS2 encompassed a 768 bp ORF, encoding a protein of 255 amino acids with a calculated molecular weight of about 21.19 kDa, and a theoretical isoelectric point (pI of 7.72. Plant tissue expression analysis indicated that TwDHDDS1 and TwDHDDS2 both have relatively ubiquitous expression in all sampled organ tissues, but showed the highest transcription levels in the stems. Conclusions: The results of this study provide a basis for further functional studies of TwDHDDS1 and TwDHDDS2. Most importantly, these genes are promising genetic targets for the regulation of the biosynthetic pathways of important bioactive terpenoids such as triptolide.
Dubey, Amit; Biswas, Sanjay Kumar; Sinha, Ekata; Chakma, Joy Kumar; Kamal, Raj; Arora, Mamta; Sagar, Harish; Natarajan, Mohan; Bhagyawant, Sameer S; Mohanty, Keshar Kunja
2017-07-01
The pathogen Mycobacterium leprae causes leprosy that affects mainly skin and nerves. Polymorphisms of certain genes are substantiated to be associated with the susceptibility/resistance to leprosy. The present investigation addressed the association of Nitric Oxide Synthase2 gene polymorphisms and leprosy in a population from northern part of India. A total of 323 leprosy cases and 288 healthy controls were genotyped for four NOS2 promoter variants (rs1800482, rs2779249, rs8078340 and rs2301369) using FRET technology in Real Time PCR. None of these SNPs in promoter sites was associated with susceptibility/resistance to leprosy. NOS2 rs1800482 was found to be monomorphic with GG genotype. However, NOS2-1026T allele was observed to be in higher frequency with leprosy cases (BL and LL) who were not suffering from any reactional episodes compared to cases with ENL reaction {OR=0.30, 95% CI (0.10-0.86), p=0.024}. NOS2-1026GT genotype was more prevalent in cases without reaction (BT, BB and BL) compared to RR reactional patients {OR=0.38, 95% CI (0.17-0.86), p=0.02}. Although haplotype analysis revealed that no haplotype was associated with leprosy susceptibility/resistance with statistical significance, GTG haplotype was noted to be more frequent in healthy controls. These SNPs are observed to be in linkage disequilibrium. Although, these SNPs are not likely to influence leprosy vulnerability, -1026G>T SNP was indicated to have noteworthy role in leprosy reactions. Copyright © 2017 Elsevier B.V. All rights reserved.
Lievers, K.J.; Kluijtmans, L.A.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraay-Emmerzaal, van D.; Heijer, den M.; Trijbels, F.J.M.; Blom, H.J.
2001-01-01
Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine -synthase (CBS) deficiency has been excluded as a major
Directory of Open Access Journals (Sweden)
Smrati Mishra
Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.
Directory of Open Access Journals (Sweden)
T. Angeline
2011-01-01
Full Text Available The objective of the study is to find out whether the endothelial nitric oxide synthase (eNOS G894T single-nucleotide polymorphism is associated with type 2 diabetes mellitus in South Indian (Tamil population. A total number of 260 subjects comprising 100 type 2 diabetic mellitus patients and 160 healthy individuals with no documented history of diabetes were included for the study. DNA was isolated, and eNOS G894T genotyping was performed using the polymerase chain reaction followed by restriction enzyme analysis using Ban II. The genotype distribution in patients and controls were compatible with the Hardy-Weinberg expectations (P>0.05. Odds ratio indicates that the occurrence of mutant genotype (GT/TT was 7.2 times (95% CI = 4.09–12.71 more frequent in the cases than in controls. Thus, the present study demonstrates that there is an association of endothelial nitric oxide synthase gene (G894T polymorphism with diabetes mellitus among South Indians.
Lievers, K.J.; Kluijtmans, L.A.J.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraaij-Emmerzaal, D. van; Heijer, M. den; Trijbels, J.M.F.; Blom, H.J.
2001-01-01
Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine beta-synthase (CBS) deficiency has been excluded as a major
Directory of Open Access Journals (Sweden)
Larroque Mathieu
2012-11-01
Full Text Available Abstract Background Oomycetes are fungal-like microorganisms evolutionary distinct from true fungi, belonging to the Stramenopile lineage and comprising major plant pathogens. Both oomycetes and fungi express proteins able to interact with cellulose, a major component of plant and oomycete cell walls, through the presence of carbohydrate-binding module belonging to the family 1 (CBM1. Fungal CBM1-containing proteins were implicated in cellulose degradation whereas in oomycetes, the Cellulose Binding Elicitor Lectin (CBEL, a well-characterized CBM1-protein from Phytophthora parasitica, was implicated in cell wall integrity, adhesion to cellulosic substrates and induction of plant immunity. Results To extend our knowledge on CBM1-containing proteins in oomycetes, we have conducted a comprehensive analysis on 60 fungi and 7 oomycetes genomes leading to the identification of 518 CBM1-containing proteins. In plant-interacting microorganisms, the larger number of CBM1-protein coding genes is expressed by necrotroph and hemibiotrophic pathogens, whereas a strong reduction of these genes is observed in symbionts and biotrophs. In fungi, more than 70% of CBM1-containing proteins correspond to enzymatic proteins in which CBM1 is associated with a catalytic unit involved in cellulose degradation. In oomycetes more than 90% of proteins are similar to CBEL in which CBM1 is associated with a non-catalytic PAN/Apple domain, known to interact with specific carbohydrates or proteins. Distinct Stramenopile genomes like diatoms and brown algae are devoid of CBM1 coding genes. A CBM1-PAN/Apple association 3D structural modeling was built allowing the identification of amino acid residues interacting with cellulose and suggesting the putative interaction of the PAN/Apple domain with another type of glucan. By Surface Plasmon Resonance experiments, we showed that CBEL binds to glycoproteins through galactose or N-acetyl-galactosamine motifs. Conclusions This study
Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling
2016-01-01
Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Cloning and sequence analysis of putative type II fatty acid synthase ...
Indian Academy of Sciences (India)
Prakash
Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.
Directory of Open Access Journals (Sweden)
Patrick C Y Woo
Full Text Available BACKGROUND: The genome of P. marneffei, the most important thermal dimorphic fungus causing respiratory, skin and systemic mycosis in China and Southeast Asia, possesses 23 polyketide synthase (PKS genes and 2 polyketide synthase nonribosomal peptide synthase hybrid (PKS-NRPS genes, which is of high diversity compared to other thermal dimorphic pathogenic fungi. We hypothesized that the yellow pigment in the mold form of P. marneffei could also be synthesized by one or more PKS genes. METHODOLOGY/PRINCIPAL FINDINGS: All 23 PKS and 2 PKS-NRPS genes of P. marneffei were systematically knocked down. A loss of the yellow pigment was observed in the mold form of the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants. Sequence analysis showed that PKS11 and PKS12 are fungal non-reducing PKSs. Ultra high performance liquid chromatography-photodiode array detector/electrospray ionization-quadruple time of flight-mass spectrometry (MS and MS/MS analysis of the culture filtrates of wild type P. marneffei and the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants showed that the yellow pigment is composed of mitorubrinic acid and mitorubrinol. The survival of mice challenged with the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants was significantly better than those challenged with wild type P. marneffei (P<0.05. There was also statistically significant decrease in survival of pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants compared to wild type P. marneffei in both J774 and THP1 macrophages (P<0.05. CONCLUSIONS/SIGNIFICANCE: The yellow pigment of the mold form of P. marneffei is composed of mitorubrinol and mitorubrinic acid. This represents the first discovery of PKS genes responsible for mitorubrinol and mitorubrinic acid biosynthesis. pks12 and pks11 are probably responsible for sequential use in the biosynthesis of mitorubrinol and mitorubrinic acid
Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution
International Nuclear Information System (INIS)
Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi
2010-01-01
The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.
Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk
2014-02-01
Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Loosenin, a novel protein with cellulose-disrupting activity from Bjerkandera adusta
Directory of Open Access Journals (Sweden)
Segovia Lorenzo
2011-02-01
Full Text Available Abstract Background Expansins and expansin-like proteins loosen cellulose microfibrils, possibly through the rupture of intramolecular hydrogen bonds. Together with the use of lignocellulolytic enzymes, these proteins are potential molecular tools to treat plant biomass to improve saccharification yields. Results Here we describe a new type of expansin-related fungal protein that we have called loosenin. Its corresponding gene, loos1, from the basidiomycete Bjerkandera adusta, was cloned and heterologously expressed in Saccharomyces cerevisiae. LOOS1 is distantly related to plant expansins through the shared presence of a DPBB domain, however domain II found in plant expansins is absent. LOOS1 binds tightly to cellulose and chitin, and we demonstrate that cotton fibers become susceptible to the action of a commercial cellulase following treatment with LOOS1. Natural fibers of Agave tequilana also become susceptible to hydrolysis by cellulases after loosenin treatment. Conclusions LOOS1 is a new type of protein with disrupting activity on cellulose. LOOS1 binds polysaccharides, and given its enhancing properties on the action of hydrolytic enzymes, LOOS1 represents a potential additive in the production of fermentable sugars from lignocellulose.
Directory of Open Access Journals (Sweden)
Rita eSharma
2013-08-01
Full Text Available Glycoside hydrolases (GH catalyze the hydrolysis of glycosidic bonds in cell wall polymers and can have major effects on cell wall architecture. Taking advantage of the massive datasets available in public databases, we have constructed a rice phylogenomic database of GHs (http://ricephylogenomics.ucdavis.edu/cellwalls/gh/. This database integrates multiple data types including the structural features, orthologous relationships, mutant availability and gene expression patterns for each GH family in a phylogenomic context. The rice genome encodes 437 GH genes classified into 34 families. Based on pairwise comparison with eight dicot and four monocot genomes, we identified 138 GH genes that are highly diverged between monocots and dicots, 57 of which have diverged further in rice as compared with four monocot genomes scanned in this study. Chromosomal localization and expression analysis suggest a role for both whole-genome and localized gene duplications in expansion and diversification of GH families in rice. We examined the meta-profiles of expression patterns of GH genes in twenty different anatomical tissues of rice. Transcripts of 51 genes exhibit tissue or developmental stage-preferential expression, whereas, seventeen other genes preferentially accumulate in actively growing tissues. When queried in RiceNet, a probabilistic functional gene network that facilitates functional gene predictions, nine out of seventeen genes form a regulatory network with the well-characterized genes involved in biosynthesis of cell wall polymers including cellulose synthase and cellulose synthase-like genes of rice. Two-thirds of the GH genes in rice are up regulated in response to biotic and abiotic stress treatments indicating a role in stress adaptation. Our analyses identify potential GH targets for cell wall modification.
Directory of Open Access Journals (Sweden)
Hongxia Miao
Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.
Liu, Weixin; Xu, Biyu; Jin, Zhiqiang
2014-01-01
Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384
Functional Characterization of Sesquiterpene Synthase from Polygonum minus
Directory of Open Access Journals (Sweden)
Su-Fang Ee
2014-01-01
Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.
Evolutionary maintenance of filovirus-like genes in bat genomes
Directory of Open Access Journals (Sweden)
Taylor Derek J
2011-11-01
Full Text Available Abstract Background Little is known of the biological significance and evolutionary maintenance of integrated non-retroviral RNA virus genes in eukaryotic host genomes. Here, we isolated novel filovirus-like genes from bat genomes and tested for evolutionary maintenance. We also estimated the age of filovirus VP35-like gene integrations and tested the phylogenetic hypotheses that there is a eutherian mammal clade and a marsupial/ebolavirus/Marburgvirus dichotomy for filoviruses. Results We detected homologous copies of VP35-like and NP-like gene integrations in both Old World and New World species of Myotis (bats. We also detected previously unknown VP35-like genes in rodents that are positionally homologous. Comprehensive phylogenetic estimates for filovirus NP-like and VP35-like loci support two main clades with a marsupial and a rodent grouping within the ebolavirus/Lloviu virus/Marburgvirus clade. The concordance of VP35-like, NP-like and mitochondrial gene trees with the expected species tree supports the notion that the copies we examined are orthologs that predate the global spread and radiation of the genus Myotis. Parametric simulations were consistent with selective maintenance for the open reading frame (ORF of VP35-like genes in Myotis. The ORF of the filovirus-like VP35 gene has been maintained in bat genomes for an estimated 13. 4 MY. ORFs were disrupted for the NP-like genes in Myotis. Likelihood ratio tests revealed that a model that accommodates positive selection is a significantly better fit to the data than a model that does not allow for positive selection for VP35-like sequences. Moreover, site-by-site analysis of selection using two methods indicated at least 25 sites in the VP35-like alignment are under positive selection in Myotis. Conclusions Our results indicate that filovirus-like elements have significance beyond genomic imprints of prior infection. That is, there appears to be, or have been, functionally maintained
Cellulose-reinforced composites: from micro-to nanoscale
Directory of Open Access Journals (Sweden)
Alain Dufresne
2013-01-01
Full Text Available This paper present the most relevant advances in the fields of: i cellulose fibres surface modification; ii cellulose fibres-based composite materials; and iii nanocomposites based on cellulose whiskers or starch platelet-like nanoparticles. The real breakthroughs achieved in the first topic concern the use of solvent-free grafting process (plasma and the grafting of the matrix at the surface of cellulose fibres through isocyanate-mediated grafting or thanks to "click chemistry". Concerning the second topic, it is worth to mention that for some cellulose/matrix combination and in the presence of adequate aids or specific surface treatment, high performance composite materials could be obtained. Finally, nanocomposites allow using the semi-crystalline nature and hierarchical structure of lignocellulosic fibres and starch granules to more deeply achieve this goal profitably exploited by Mother Nature
Cloning and expression of pineapple sucrose- phosphate synthase ...
African Journals Online (AJOL)
hope&shola
2010-12-06
Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.
Identification and phylogenetic analysis of a novel starch synthase in maize
Directory of Open Access Journals (Sweden)
Hanmei eLiu
2015-11-01
Full Text Available Starch is an important reserve of carbon and energy in plants, providing the majority of calories in the human diet and animal feed. Its synthesis is orchestrated by several key enzymes, and the amount and structure of starch, affecting crop yield and quality, are determined mainly by starch synthase (SS activity. To date, five SS isoforms, including SSI-IV and Granule Bound Starch Synthase (GBSS have been identified and their physiological functions have been well characterized. Here, we report the identification of a new SS isoform in maize, designated SSV. By searching sequenced genomes, SSV has been found in all green plants with conserved sequences and gene structures. Our phylogenetic analysis based on 780 base pairs has suggested that SSIV and SSV resulted from a gene duplication event, which may have occurred before the algae formation. An expression profile analysis of SSV in maize has indicated that ZmSSV is mainly transcribed in the kernel and ear leaf during the grain filling stage, which is partly similar to other SS isoforms. Therefore, it is likely that SSV may play an important role in starch biosynthesis. Subsequent analysis of SSV function may facilitate understanding the mechanism of starch granules formation, number and structure.
Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei
Directory of Open Access Journals (Sweden)
Yue Ming
2009-06-01
Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.
DEFF Research Database (Denmark)
Yuhong, Huang; Busk, Peter Kamp; Lange, Lene
2015-01-01
in Fusarium commune. Prediction of the cellulose and hemicellulose-degrading enzymes in the F. commune transcriptome using peptide pattern recognition revealed 147 genes encoding glycoside hydrolases and six genes encoding lytic polysaccharide monooxygenases (AA9 and AA11), including all relevant cellulose...
Thomson, Errol M; Kumarathasan, Prem; Calderón-Garcidueñas, Lilian; Vincent, Renaud
2007-10-01
Recent work suggests that air pollution is a risk factor for cerebrovascular and neurodegenerative disease. Effects of inhaled pollutants on the production of vasoactive factors such as endothelin (ET) and nitric oxide (NO) in the brain may be relevant to disease pathogenesis. Inhaled pollutants increase circulating levels of ET-1 and ET-3, and the pituitary is a potential source of plasma ET, but the effects of pollutants on the expression of ET and NO synthase genes in the brain and pituitary are not known. In the present study, Fischer-344 rats were exposed by nose-only inhalation to particles (0, 5, 50mg/m3 EHC-93), ozone (0, 0.4, 0.8 ppm), or combinations of particles and ozone for 4 h. Real-time reverse transcription polymerase chain reaction was used to measure mRNA levels in the cerebral hemisphere and pituitary 0 and 24 h post-exposure. Ozone inhalation significantly increased preproET-1 but decreased preproET-3 mRNAs in the cerebral hemisphere, while increasing mRNA levels of preproET-1, preproET-3, and the ET-converting enzyme (ECE)-1 in the pituitary. Inducible NO synthase (iNOS) was initially decreased in the cerebral hemisphere after ozone inhalation, but increased 24 h post-exposure. Particles decreased tumour necrosis factor (TNF)-alpha mRNA in the cerebral hemisphere, and both particles and ozone decreased TNF-alpha mRNA in the pituitary. Our results show that ozone and particulate matter rapidly modulate the expression of genes involved in key vasoregulatory pathways in the brain and pituitary, substantiating the notion that inhaled pollutants induce cerebrovascular effects.
Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.
2013-01-01
Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150
Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng
2017-02-01
Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.
Zang, Xiangyun; Liu, Meiting; Fan, Yihong; Xu, Jie; Xu, Xiuhong; Li, Hongtao
2018-01-01
Compost habitats sustain a vast ensemble of microbes that engender the degradation of cellulose, which is an important part of global carbon cycle. β-Glucosidase is the rate-limiting enzyme of degradation of cellulose. Thus, analysis of regulation of β-glucosidase gene expression in composting is beneficial to a better understanding of cellulose degradation mechanism. Genetic diversity and expression of β-glucosidase-producing microbial communities, and relationships of cellulose degradation, metabolic products and the relative enzyme activity during natural composting and inoculated composting were evaluated. Compared with natural composting, adding inoculation agent effectively improved the degradation of cellulose, and maintained high level of the carboxymethyl cellulose (CMCase) and β-glucosidase activities in thermophilic phase. Gene expression analysis showed that glycoside hydrolase family 1 (GH1) family of β-glucosidase genes contributed more to β-glucosidase activity in the later thermophilic phase in inoculated compost. In the cooling phase of natural compost, glycoside hydrolase family 3 (GH3) family of β-glucosidase genes contributed more to β-glucosidase activity. Intracellular β-glucosidase activity played a crucial role in the regulation of β-glucosidase gene expression, and upregulation or downregulation was also determined by extracellular concentration of glucose. At sufficiently high glucose concentrations, the functional microbial community in compost was altered, which may contribute to maintaining β-glucosidase activity despite the high glucose content. This research provides an ecological functional map of microorganisms involved in carbon metabolism in cattle manure-rice straw composting. The performance of the functional microbial groups in the two composting treatments is different, which is related to the cellulase activity and cellulose degradation, respectively.
Xu, Yingchun; Wang, Yanjie; Mattson, Neil; Yang, Liu; Jin, Qijiang
2017-12-01
Trehalose-6-phosphate synthase (TPS) serves important functions in plant desiccation tolerance and response to environmental stimuli. At present, a comprehensive analysis, i.e. functional classification, molecular evolution, and expression patterns of this gene family are still lacking in Solanum tuberosum (potato). In this study, a comprehensive analysis of the TPS gene family was conducted in potato. A total of eight putative potato TPS genes (StTPSs) were identified by searching the latest potato genome sequence. The amino acid identity among eight StTPSs varied from 59.91 to 89.54%. Analysis of d N /d S ratios suggested that regions in the TPP (trehalose-6-phosphate phosphatase) domains evolved faster than the TPS domains. Although the sequence of the eight StTPSs showed high similarity (2571-2796 bp), their gene length is highly differentiated (3189-8406 bp). Many of the regulatory elements possibly related to phytohormones, abiotic stress and development were identified in different TPS genes. Based on the phylogenetic tree constructed using TPS genes of potato, and four other Solanaceae plants, TPS genes could be categorized into 6 distinct groups. Analysis revealed that purifying selection most likely played a major role during the evolution of this family. Amino acid changes detected in specific branches of the phylogenetic tree suggests relaxed constraints might have contributed to functional divergence among groups. Moreover, StTPSs were found to exhibit tissue and treatment specific expression patterns upon analysis of transcriptome data, and performing qRT-PCR. This study provides a reference for genome-wide identification of the potato TPS gene family and sets a framework for further functional studies of this important gene family in development and stress response.
Analysis of genetic variation of inducible nitric oxide synthase and ...
African Journals Online (AJOL)
The genetic diversity of 100 Malaysian native chickens was investigated using polymerase chain reaction-restriction fragment polymorphism (PCR-RFLP) for two candidate genes: inducible nitric oxide synthase (INOS) and natural resistance-associated macrophage protein 1 (NRAMP1). The two genes were selected ...
Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.
Jain, Parul; Tar'an, Bunyamin
2014-11-01
Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.
Cloning and Expression of the PHA Synthase Gene From a Locally Isolated Chromobacterium sp. USM2
Directory of Open Access Journals (Sweden)
Bhubalan, K.
2010-01-01
Full Text Available Chromobacterium sp. USM2, a locally isolated bacterium was found to synthesize poly(3-hydroxybutyrate-co-3-hydroxyvalerate, P(3HB-co-3HV copolymer with high 3HV monomer composition. The PHA synthase gene was cloned and expressed in Cupriavidus necator PHB¯4 to investigate the possibilities of incorporating other monomer. The recombinant successfully incorporated 3-hydroxyhexanoate (3HHx monomer when fed with crude palm kernel oil (CPKO as the sole carbon source. Approximately 63 ± 2 wt% of P(3HB-co-3HHx copolymer with 4 mol% of 3HHx was synthesized from 5 g/L of oil after 48 h of cultivation. In addition, P(3HB-co-3HV-co-3HHx terpolymer with 9 mol% 3HV and 4 mol% 3HHx could be synthesized with a mixture of CPKO and sodium valerate. The presence of 3HV and 3HHx monomers in the copolymer and terpolymer was further confirmed with +H-NMR analysis. This locally isolated PHA synthase has demonstrated its ability to synthesize P(3HB-co-3HHx copolymer from a readily available and renewable carbon source; CPKO, without the addition of 3HHx precursors.
Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA
2012-06-19
Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.
Energy Technology Data Exchange (ETDEWEB)
Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)
1995-08-28
Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.
International Nuclear Information System (INIS)
Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.
2017-01-01
Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)
Spatial regulation of a common precursor from two distinct genes generates metabolite diversity
Energy Technology Data Exchange (ETDEWEB)
Guo, Chun-Jun; Sun, Wei-Wen; Bruno, Kenneth S.; Oakley, Berl R.; Keller, Nancy P.; Wang, Clay C.
2015-07-13
In secondary metabolite biosynthesis, core synthetic genes such as polyketide synthase genes or non-ribosomal peptide synthase genes usually encode proteins that generate various backbone precursors. These precursors are modified by other tailoring enzymes to yield a large variety of different secondary metabolites. The number of core synthesis genes in a given species correlates, therefore, with the number of types of secondary metabolites the organism can produce. In our study, heterologous expression of all the A. terreus NRPS-like genes showed that two NRPS-like proteins, encoded by atmelA and apvA, release the same natural product, aspulvinone E. More interestingly, further experiments revealed that the aspulvinone E produced by two different genes accumulates in different fungal compartments. And this spatial control of aspulvinone E production is likely to be regulated by their own specific promoters. Comparative genomics indicates that atmelA and apvA might share a same ancestral gene and the gene apvA is inserted in a highly conserved region in Aspergillus species that contains genes coding for life-essential proteins. The study also identified one trans-prenyltransferase AbpB which is capable of prenylating two different substrates aspulvinones and butyrolactones. In total, our study shows the first example in which the locally distribution of the same natural product could lead to its incorporation into different SM pathways.
Arabidopsis CDS blastp result: AK110467 [KOME
Lifescience Database Archive (English)
Full Text Available AK110467 002-166-G08 At3g03050.1 cellulose synthase family protein (CslD3) similar to cellulose... synthase catalytic subunit gi:2827143 from [Arabidopsis thaliana], cellulose synthase-7 (gi:962
Safwat, Engie; Hassan, Mohammad L; Saniour, Sayed; Zaki, Dalia Yehia; Eldeftar, Mervat; Saba, Dalia; Zazou, Mohamed
2018-05-01
Nanofibrillated cellulose, obtained from rice straw agricultural wastes was used as a substrate for the preparation of a new injectable and mineralized hydrogel for bone regeneration. Tetramethyl pyridine oxyl (TEMPO) oxidized nanofibrillated cellulose, was mineralized through the incorporation of a prepared and characterized biphasic calcium phosphate at a fixed ratio of 50 wt%. The TEMPO-oxidized rice straw nanofibrillated cellulose was characterized using transmission electron microscopy, Fourier transform infrared, and carboxylic content determination. The injectability and viscosity of the prepared hydrogel were evaluated using universal testing machine and rheometer testing, respectively. Cytotoxicity and alkaline phosphatase level tests on osteoblast like-cells for in vitro assessment of the biocompatibility were investigated. Results revealed that the isolated rice straw nanofibrillated cellulose is a nanocomposite of the cellulose nanofibers and silica nanoparticles. Rheological properties of the tested materials are suitable for use as injectable material and of nontoxic effect on osteoblast-like cells, as revealed by the positive alkaline phosphate assay. However, nanofibrillated cellulose/ biphasic calcium phosphate hydrogel showed higher cytotoxicity and lower bioactivity test results when compared to that of nanofibrillated cellulose.
Directory of Open Access Journals (Sweden)
Bin Tang
2018-01-01
Full Text Available The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS and trehalose-6-phosphate phosphatase (TPP pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects.
Jin, Mei Lan; Lee, Dae Young; Um, Yurry; Lee, Jeong Hoon; Park, Chun Geun; Jetter, Reinhard; Kim, Ok Tae
2014-03-01
Expression of PtBS (Polygala tenuifolia β-amyrin synthase) led to the production of β-amyrin as sole product. Polygala tenuifolia Willdenow is a rich source of triterpene saponins, onjisaponins and polygalasaponins, used as herbal medicine to treat phlegms and for detumescence in traditional Asian healing. The Polygala saponins share the oleanane backbone structure and are, therefore, likely synthesized via β-amyrin as a common precursor. We hypothesized that, in analogy to diverse other plant species, this central intermediate should be formed by a β-amyrin synthase catalyzing the complex cyclization of oxidosqualene. This member of the oxidosqualene cyclase (OSC) family of enzymes is thus defining an important branch point between primary and secondary metabolisms, and playing a crucial role in the control of oleanane-type triterpene saponin biosynthesis. From P. tenuifolia roots, we isolated an OSC cDNA containing a reading frame of 2,289 bp nucleotides. The predicted protein of 763 amino acids (molecular weight 87.353 kDa) showed particularly high amino acid sequence identities to known β-amyrin synthases (85-87 %) and was, therefore, named PtBS. Expression of PtBS in the triterpenoid synthase-deficient yeast mutant GIL77 led to the production of β-amyrin as sole product. qRT-PCR analysis of various P. tenuifolia organs showed that PtBS transcript levels were highest in the roots, consistent with onjisaponin accumulation patterns. Therefore, we conclude that PtBS is the β-amyrin synthase enzyme catalyzing the first committed step in the biosynthesis of onjisaponins and polygalasaponins in P. tenuifolia.
Zhu, Yueming; Zhang, Jun; Wei, Dongsheng; Wang, Yufan; Chen, Xiaoyun; Xing, Laijun; Li, Mingchun
2008-08-01
A slightly thermophilic strain, CBS-01, producing trehalose synthase (TreS), was isolated from geothermal water in this study. According to the phenotypic characteristics and phylogenetic analysis of the 16s rRNA gene sequence, it was identified as Meiothermus ruber. The trehalose synthase gene of Meiothermus ruber CBS-01 was cloned by polymerase chain reaction and sequenced. The TreS gene consisted of 2,895 nucleotides, which specified a 964-amino-acid protein. This novel TreS catalyzed reversible interconversion of maltose and trehalose.
Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele
2015-08-01
Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Jiao, Yue; Wan, Caichao; Bao, Wenhui; Gao, He; Liang, Daxin; Li, Jian
2018-06-01
A magnetic cellulose aerogel-supported Fe 3 O 4 nanoparticles composite was designed as a highly efficient and eco-friendly catalyst for Fenton-like degradation of Rhodamine B (RhB). The composite (coded as Fe 3 O 4 @CA) was formed by embedding well-dispersed Fe 3 O 4 nanoparticles into the 3D structure of cellulose aerogels by virtue of a facile and cheap hydrothermal method. Comparative studies indicate that the RhB decolorization ratio is much higher in co-presence of Fe 3 O 4 and H 2 O 2 than that in presence of Fe 3 O 4 or H 2 O 2 only, revealing that the Fe 3 O 4 @CA-catalyzed Fenton-like reaction governed the RhB decolorization process. It was also found that almost 100% RhB removal was achieved in the Fenton-like system. Moreover, the composite exhibited higher catalytic activity than that of the individual Fe 3 O 4 particles. In addition, the Fe 3 O 4 @CA catalyst retained ∼97% of its ability to degrade RhB after the six successive degradation experiments, suggesting its excellent reusability. All these merits indicate that the green and low-cost catalyst with strong magnetic responsiveness possesses good potential for H 2 O 2 -driven Fenton-like treatment of organic dyestuff wastewater. Copyright © 2018 Elsevier Ltd. All rights reserved.
Yang, Ji; Gu, Hongya; Yang, Ziheng
2004-01-01
Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication.
Arabidopsis CDS blastp result: AK105393 [KOME
Lifescience Database Archive (English)
Full Text Available AK105393 001-123-B04 At5g16910.1 cellulose synthase family protein similar to gi:2827143 cellulose... synthase catalytic subunit, Arabidopsis thaliana, gi:9622886 cellulose synthase-7 from Zea mays 0.0 ...
Arabidopsis CDS blastp result: AK102695 [KOME
Lifescience Database Archive (English)
Full Text Available AK102695 J033103F21 At5g16910.1 cellulose synthase family protein similar to gi:2827143 cellulose... synthase catalytic subunit, Arabidopsis thaliana, gi:9622886 cellulose synthase-7 from Zea mays 0.0 ...
Arabidopsis CDS blastp result: AK100523 [KOME
Lifescience Database Archive (English)
Full Text Available AK100523 J023100P04 At5g16910.1 cellulose synthase family protein similar to gi:2827143 cellulose... synthase catalytic subunit, Arabidopsis thaliana, gi:9622886 cellulose synthase-7 from Zea mays 0.0 ...
Arabidopsis CDS blastp result: AK065259 [KOME
Lifescience Database Archive (English)
Full Text Available AK065259 J013002J18 At5g16910.1 cellulose synthase family protein similar to gi:2827143 cellulose... synthase catalytic subunit, Arabidopsis thaliana, gi:9622886 cellulose synthase-7 from Zea mays 0.0 ...
Arabidopsis CDS blastp result: AK102134 [KOME
Lifescience Database Archive (English)
Full Text Available AK102134 J033085F12 At5g16910.1 cellulose synthase family protein similar to gi:2827143 cellulose... synthase catalytic subunit, Arabidopsis thaliana, gi:9622886 cellulose synthase-7 from Zea mays 0.0 ...
Arabidopsis CDS blastp result: AK102766 [KOME
Lifescience Database Archive (English)
Full Text Available AK102766 J033107E04 At1g55850.1 cellulose synthase family protein similar to cellulose... synthase catalytic subunit [gi:13925881] from Nicotiana alata, cellulose synthase-5 [gi:9622882] from Zea mays 0.0 ...
Arabidopsis CDS blastp result: AK109812 [KOME
Lifescience Database Archive (English)
Full Text Available AK109812 002-147-H02 At5g16910.1 cellulose synthase family protein similar to gi:2827143 cellulose... synthase catalytic subunit, Arabidopsis thaliana, gi:9622886 cellulose synthase-7 from Zea mays 5e-90 ...
Arabidopsis CDS blastp result: AK110534 [KOME
Lifescience Database Archive (English)
Full Text Available AK110534 002-168-A07 At5g16910.1 cellulose synthase family protein similar to gi:2827143 cellulose... synthase catalytic subunit, Arabidopsis thaliana, gi:9622886 cellulose synthase-7 from Zea mays 1e-114 ...
Arabidopsis CDS blastp result: AK067424 [KOME
Lifescience Database Archive (English)
Full Text Available AK067424 J013107C16 At1g02730.1 cellulose synthase family protein similar to cellulose... synthase catalytic subunit [gi:13925881] from Nicotiana alata, cellulose synthase-4 [gi:9622880] from Zea mays 0.0 ...
Arabidopsis CDS blastp result: AK101487 [KOME
Lifescience Database Archive (English)
Full Text Available AK101487 J033042D19 At1g55850.1 cellulose synthase family protein similar to cellulose... synthase catalytic subunit [gi:13925881] from Nicotiana alata, cellulose synthase-5 [gi:9622882] from Zea mays 0.0 ...
Arabidopsis CDS blastp result: AK066835 [KOME
Lifescience Database Archive (English)
Full Text Available AK066835 J013087I16 At5g16910.1 cellulose synthase family protein similar to gi:2827143 cellulose... synthase catalytic subunit, Arabidopsis thaliana, gi:9622886 cellulose synthase-7 from Zea mays 1e-171 ...
Glycogen synthase kinase 3: more than a namesake.
Rayasam, Geetha Vani; Tulasi, Vamshi Krishna; Sodhi, Reena; Davis, Joseph Alex; Ray, Abhijit
2009-03-01
Glycogen synthase kinase 3 (GSK3), a constitutively acting multi-functional serine threonine kinase is involved in diverse physiological pathways ranging from metabolism, cell cycle, gene expression, development and oncogenesis to neuroprotection. These diverse multiple functions attributed to GSK3 can be explained by variety of substrates like glycogen synthase, tau protein and beta catenin that are phosphorylated leading to their inactivation. GSK3 has been implicated in various diseases such as diabetes, inflammation, cancer, Alzheimer's and bipolar disorder. GSK3 negatively regulates insulin-mediated glycogen synthesis and glucose homeostasis, and increased expression and activity of GSK3 has been reported in type II diabetics and obese animal models. Consequently, inhibitors of GSK3 have been demonstrated to have anti-diabetic effects in vitro and in animal models. However, inhibition of GSK3 poses a challenge as achieving selectivity of an over achieving kinase involved in various pathways with multiple substrates may lead to side effects and toxicity. The primary concern is developing inhibitors of GSK3 that are anti-diabetic but do not lead to up-regulation of oncogenes. The focus of this review is the recent advances and the challenges surrounding GSK3 as an anti-diabetic therapeutic target.
Directory of Open Access Journals (Sweden)
Berta Alquézar
2017-08-01
Full Text Available Citrus aroma and flavor, chief traits of fruit quality, are derived from their high content in essential oils of most plant tissues, including leaves, stems, flowers, and fruits. Accumulated in secretory cavities, most components of these oils are volatile terpenes. They contribute to defense against herbivores and pathogens, and perhaps also protect tissues against abiotic stress. In spite of their importance, our understanding of the physiological, biochemical, and genetic regulation of citrus terpene volatiles is still limited. The availability of the sweet orange (Citrus sinensis L. Osbeck genome sequence allowed us to characterize for the first time the terpene synthase (TPS family in a citrus type. CsTPS is one of the largest angiosperm TPS families characterized so far, formed by 95 loci from which just 55 encode for putative functional TPSs. All TPS angiosperm families, TPS-a, TPS-b, TPS-c, TPS-e/f, and TPS-g were represented in the sweet orange genome, with 28, 18, 2, 2, and 5 putative full length genes each. Additionally, sweet orange β-farnesene synthase, (Z-β-cubebene/α-copaene synthase, two β-caryophyllene synthases, and three multiproduct enzymes yielding β-cadinene/α-copaene, β-elemene, and β-cadinene/ledene/allo-aromandendrene as major products were identified, and functionally characterized via in vivo recombinant Escherichia coli assays.
International Nuclear Information System (INIS)
Ge Shimei; Xie Baoen; Chen Sanfeng
2006-01-01
The previous report from our laboratory has recently identified a new trpE gene (termed trpE 2 ) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE 1 (G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE 1 (G) while these sequence features did not exist in front of trpE 2 . The β-galactosidase activity of an A. brasilense strain carrying a trpE 2 -lacZ fusion remained constant at different tryptophan concentrations, but the β-galactosidase activity of the same strain carrying a trpE 1 (G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE 1 (G) is regulated at the transcriptional level by attenuation while trpE 2 is constantly expressed. The anthranilate synthase assays with trpE 1 (G) - and trpE 2 - mutants demonstrated that TrpE 1 (G) fusion protein is feedback inhibited by tryptophan while TrpE 2 protein is not. We also found that both trpE 1 (G) and trpE 2 gene products were involved in IAA synthesis
Arabidopsis CDS blastp result: AK242601 [KOME
Lifescience Database Archive (English)
Full Text Available AK242601 J090014G03 At4g24000.1 68417.m03449 cellulose synthase family protein similar to cellulose... synthase from Gossypium hirsutum [gi:1706956], cellulose synthase-5 from Zea mays [gi:9622882] 2e-27 ...
Arabidopsis CDS blastp result: AK121003 [KOME
Lifescience Database Archive (English)
Full Text Available AK121003 J023045B21 At2g32540.1 cellulose synthase family protein similar to cellulose... synthase catalytic subunit from Arabidopsis thaliana [gi:5230423], cellulose synthase-5 from Zea mays [gi:9622882] 1e-167 ...
Arabidopsis CDS blastp result: AK103810 [KOME
Lifescience Database Archive (English)
Full Text Available AK103810 J033147A19 At1g55850.1 cellulose synthase family protein similar to cellulose... synthase catalytic subunit [gi:13925881] from Nicotiana alata, cellulose synthase-5 [gi:9622882] from Zea mays 1e-179 ...
Arabidopsis CDS blastp result: AK120054 [KOME
Lifescience Database Archive (English)
Full Text Available AK120054 J013000L05 At1g55850.1 cellulose synthase family protein similar to cellulose... synthase catalytic subunit [gi:13925881] from Nicotiana alata, cellulose synthase-5 [gi:9622882] from Zea mays 1e-148 ...
Arabidopsis CDS blastp result: AK069071 [KOME
Lifescience Database Archive (English)
Full Text Available AK069071 J023010H01 At2g32540.1 cellulose synthase family protein similar to cellulose... synthase catalytic subunit from Arabidopsis thaliana [gi:5230423], cellulose synthase-5 from Zea mays [gi:9622882] 1e-167 ...
Arabidopsis CDS blastp result: AK107881 [KOME
Lifescience Database Archive (English)
Full Text Available AK107881 002-134-D06 At1g55850.1 cellulose synthase family protein similar to cellulose... synthase catalytic subunit [gi:13925881] from Nicotiana alata, cellulose synthase-5 [gi:9622882] from Zea mays 5e-51 ...
Arabidopsis CDS blastp result: AK242601 [KOME
Lifescience Database Archive (English)
Full Text Available AK242601 J090014G03 At4g24000.1 68417.m03449 cellulose synthase family protein similar to cellulose... synthase from Gossypium hirsutum [gi:1706956], cellulose synthase-5 from Zea mays [gi:9622882] 5e-27 ...
Arabidopsis CDS blastp result: AK242585 [KOME
Lifescience Database Archive (English)
Full Text Available AK242585 J090010M20 At4g24000.1 68417.m03449 cellulose synthase family protein similar to cellulose... synthase from Gossypium hirsutum [gi:1706956], cellulose synthase-5 from Zea mays [gi:9622882] 1e-123 ...
Arabidopsis CDS blastp result: AK242890 [KOME
Lifescience Database Archive (English)
Full Text Available AK242890 J090079L19 At4g24000.1 68417.m03449 cellulose synthase family protein similar to cellulose... synthase from Gossypium hirsutum [gi:1706956], cellulose synthase-5 from Zea mays [gi:9622882] 4e-48 ...
Arabidopsis CDS blastp result: AK061162 [KOME
Lifescience Database Archive (English)
Full Text Available AK061162 006-209-A01 At2g32540.1 cellulose synthase family protein similar to cellulose... synthase catalytic subunit from Arabidopsis thaliana [gi:5230423], cellulose synthase-5 from Zea mays [gi:9622882] 3e-35 ...
Arabidopsis CDS blastp result: AK111344 [KOME
Lifescience Database Archive (English)
Full Text Available AK111344 002-181-F12 At1g55850.1 cellulose synthase family protein similar to cellulose... synthase catalytic subunit [gi:13925881] from Nicotiana alata, cellulose synthase-5 [gi:9622882] from Zea mays 2e-15 ...
Arabidopsis CDS blastp result: AK242601 [KOME
Lifescience Database Archive (English)
Full Text Available AK242601 J090014G03 At4g24000.1 68417.m03449 cellulose synthase family protein similar to cellulose... synthase from Gossypium hirsutum [gi:1706956], cellulose synthase-5 from Zea mays [gi:9622882] 4e-25 ...
Arabidopsis CDS blastp result: AK061639 [KOME
Lifescience Database Archive (English)
Full Text Available AK061639 001-036-B01 At1g55850.1 cellulose synthase family protein similar to cellulose... synthase catalytic subunit [gi:13925881] from Nicotiana alata, cellulose synthase-5 [gi:9622882] from Zea mays 4e-49 ...
Arabidopsis CDS blastp result: AK060286 [KOME
Lifescience Database Archive (English)
Full Text Available AK060286 001-006-C08 At2g32540.1 cellulose synthase family protein similar to cellulose... synthase catalytic subunit from Arabidopsis thaliana [gi:5230423], cellulose synthase-5 from Zea mays [gi:9622882] 6e-78 ...
Energy Technology Data Exchange (ETDEWEB)
Chen, Guo-Yin; Yu, Hou-Yong, E-mail: phdyu@zstu.edu.cn; Zhang, Cai-Hong [Zhejiang Sci-Tech University, The Key Laboratory of Advanced Textile Materials and Manufacturing Technology of Ministry of Education, College of Materials and Textiles (China); Zhou, Ying; Yao, Ju-Ming, E-mail: yaoj@zstu.edu.cn [Zhejiang Sci-Tech University, National Engineering Lab for Textile Fiber Materials & Processing Technology (China)
2016-02-15
A simple route was designed to extract the cellulose nanocrystals (CNCs) with formate groups from industrial and agricultural celluloses like microcrystalline cellulose (MCC), viscose fiber, ginger fiber, and bamboo fiber. The effect of reaction time on the microstructure and properties of the CNCs was investigated in detail, while microstructure and properties of different CNCs were compared. The rod-like CNCs (MCC) with hundreds of nanometers in length and about 10 nm in width, nanofibrillated CNCs (ginger fiber bamboo fiber) with average width of 30 nm and the length of 1 μm, and spherical CNCs (viscose fiber) with the width of 56 nm were obtained by one-step HCOOH/HCl hydrolysis. The CNCs with improved thermal stability showed the maximum degradation temperature (T{sub max}) of 368.9–388.2 °C due to the introduction of formate groups (reducibility) and the increased crystallinity. Such CNCs may be used as an effective template for the synthesis of nanohybrids or reinforcing material for high-performance nanocomposites.
International Nuclear Information System (INIS)
Chen, Guo-Yin; Yu, Hou-Yong; Zhang, Cai-Hong; Zhou, Ying; Yao, Ju-Ming
2016-01-01
A simple route was designed to extract the cellulose nanocrystals (CNCs) with formate groups from industrial and agricultural celluloses like microcrystalline cellulose (MCC), viscose fiber, ginger fiber, and bamboo fiber. The effect of reaction time on the microstructure and properties of the CNCs was investigated in detail, while microstructure and properties of different CNCs were compared. The rod-like CNCs (MCC) with hundreds of nanometers in length and about 10 nm in width, nanofibrillated CNCs (ginger fiber bamboo fiber) with average width of 30 nm and the length of 1 μm, and spherical CNCs (viscose fiber) with the width of 56 nm were obtained by one-step HCOOH/HCl hydrolysis. The CNCs with improved thermal stability showed the maximum degradation temperature (T max ) of 368.9–388.2 °C due to the introduction of formate groups (reducibility) and the increased crystallinity. Such CNCs may be used as an effective template for the synthesis of nanohybrids or reinforcing material for high-performance nanocomposites
Cloning and functional characterization of β-phellandrene synthase from Lavandula angustifolia.
Demissie, Zerihun A; Sarker, Lukman S; Mahmoud, Soheil S
2011-04-01
En route to building genomics resources for Lavandula, we have obtained over 14,000 ESTs for leaves and flowers of L. angustifolia, a major essential oil crop, and identified a number of previously uncharacterized terpene synthase (TPS) genes. Here we report the cloning, expression in E. coli, and functional characterization of β-phellandrene synthase, LaβPHLS. The ORF--excluding the transit peptide--for this gene encoded a 62.3 kDa protein that contained all conserved motifs present in plant TPSs. Expression in bacteria resulted in the production of a soluble protein that was purified by Ni-NTA agarose affinity chromatography. While the recombinant LaβPHLS did not utilize FPP as a substrate, it converted GPP (the preferred substrate) and NPP into β-phellandrene as the major product, with K (m) and k (cat) of 6.55 μM and 1.75 × 10(-2) s(-1), respectively, for GPP. The LaβPHLS transcripts were highly abundant in young leaves where β-phellandrene is produced, but were barely detectable in flowers and older leaves, where β-phellandrene is not synthesized in significant quantities. This data indicate that β-phellandrene biosynthesis is transcriptionally and developmentally regulated. We also cloned and expressed in E. coli a second TPS-like protein, LaTPS-I, that lacks an internal stretch of 73 amino acids, including the signature DDxxD divalent metal binding motif, compared to other plant TPSs. The recombinant LaTPS-I did not produce detectable products in vitro when assayed with GPP, NPP or FPP as substrates. The lack of activity is most likely due to the absence of catalytically important amino acid residues within the missing region.
Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep
2015-10-01
GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.
Rui, Yue; Anderson, Charles T.
2016-01-01
Stomatal guard cells are pairs of specialized epidermal cells that control water and CO2 exchange between the plant and the environment. To fulfill the functions of stomatal opening and closure that are driven by changes in turgor pressure, guard cell walls must be both strong and flexible, but how the structure and dynamics of guard cell walls enable stomatal function remains poorly understood. To address this question, we applied cell biological and genetic analyses to investigate guard cell walls and their relationship to stomatal function in Arabidopsis (Arabidopsis thaliana). Using live-cell spinning disk confocal microscopy, we measured the motility of cellulose synthase (CESA)-containing complexes labeled by green fluorescent protein (GFP)-CESA3 and observed a reduced proportion of GFP-CESA3 particles colocalizing with microtubules upon stomatal closure. Imaging cellulose organization in guard cells revealed a relatively uniform distribution of cellulose in the open state and a more fibrillar pattern in the closed state, indicating that cellulose microfibrils undergo dynamic reorganization during stomatal movements. In cesa3je5 mutants defective in cellulose synthesis and xxt1 xxt2 mutants lacking the hemicellulose xyloglucan, stomatal apertures, changes in guard cell length, and cellulose reorganization were aberrant during fusicoccin-induced stomatal opening or abscisic acid-induced stomatal closure, indicating that sufficient cellulose and xyloglucan are required for normal guard cell dynamics. Together, these results provide new insights into how guard cell walls allow stomata to function as responsive mediators of gas exchange at the plant surface. PMID:26729799
Self-assembled cellulose materials for biomedicine: A review.
Yang, Jisheng; Li, Jinfeng
2018-02-01
Cellulose-based materials have reached a growing interest for the improvement of biomedicine, due to their good biocompatibility, biodegradability, and low toxicity. Self-assembly is a spontaneous process by which organized structures with particular functions and properties could be obtained without additional complicated processing steps. This article describes the modifications, properties and applications of cellulose and its derivatives, which including a detailed review of representative types of solvents such as NMMO, DMAc/LiCl, some molten salt hydrates, some aqueous solutions of metal complexes, ionic liquids and NaOH-water system etc. The modifications were frequently performed by esterification, etherification, ATRP, RAFT, ROP and other novel methods. Stimuli-responsive cellulose-based materials, such as temperature-, pH-, light- and redox-responsive, were synthesized for their superior performance. Additionally, the applications of cellulose-based materials which can self-assemble into micelles, vesicles and other aggregates, for drug/gene delivery, bioimaging, biosensor, are also discussed. Copyright © 2017 Elsevier Ltd. All rights reserved.
Cellulose- and xylan-degrading thermophilic anaerobic bacteria from biocompost.
Sizova, M V; Izquierdo, J A; Panikov, N S; Lynd, L R
2011-04-01
Nine thermophilic cellulolytic clostridial isolates and four other noncellulolytic bacterial isolates were isolated from self-heated biocompost via preliminary enrichment culture on microcrystalline cellulose. All cellulolytic isolates grew vigorously on cellulose, with the formation of either ethanol and acetate or acetate and formate as principal fermentation products as well as lactate and glycerol as minor products. In addition, two out of nine cellulolytic strains were able to utilize xylan and pretreated wood with roughly the same efficiency as for cellulose. The major products of xylan fermentation were acetate and formate, with minor contributions of lactate and ethanol. Phylogenetic analyses of 16S rRNA and glycosyl hydrolase family 48 (GH48) gene sequences revealed that two xylan-utilizing isolates were related to a Clostridium clariflavum strain and represent a distinct novel branch within the GH48 family. Both isolates possessed high cellulase and xylanase activity induced independently by either cellulose or xylan. Enzymatic activity decayed after growth cessation, with more-rapid disappearance of cellulase activity than of xylanase activity. A mixture of xylan and cellulose was utilized simultaneously, with a significant synergistic effect observed as a reduction of lag phase in cellulose degradation.
Arabidopsis CDS blastp result: AK242601 [KOME
Lifescience Database Archive (English)
Full Text Available AK242601 J090014G03 At4g38190.1 68417.m05391 cellulose synthase family protein similar to cellulose... synthase catalytic subunit gi:2827143 from [Arabidopsis thaliana], cellulose synthase-5 (gi:9622882) from Zea mays 0.0 ...
Arabidopsis CDS blastp result: AK242601 [KOME
Lifescience Database Archive (English)
Full Text Available AK242601 J090014G03 At1g32180.1 68414.m03958 cellulose synthase family protein similar to cellulose... synthase catalytic subunit gi:2827143 from [Arabidopsis thaliana], cellulose synthase-9 (gi:9622890) from Zea mays 0.0 ...
Arabidopsis CDS blastp result: AK242890 [KOME
Lifescience Database Archive (English)
Full Text Available AK242890 J090079L19 At1g02730.1 68414.m00226 cellulose synthase family protein similar to cellulose... synthase catalytic subunit [gi:13925881] from Nicotiana alata, cellulose synthase-4 [gi:9622880] from Zea mays 1e-131 ...
Arabidopsis CDS blastp result: AK242585 [KOME
Lifescience Database Archive (English)
Full Text Available AK242585 J090010M20 At4g38190.1 68417.m05391 cellulose synthase family protein similar to cellulose... synthase catalytic subunit gi:2827143 from [Arabidopsis thaliana], cellulose synthase-5 (gi:9622882) from Zea mays 8e-63 ...
Arabidopsis CDS blastp result: AK242601 [KOME
Lifescience Database Archive (English)
Full Text Available AK242601 J090014G03 At4g23990.1 68417.m03448 cellulose synthase family protein similar to cellulose... synthase catalytic subunit from Arabidopsis thaliana [gi:5230423], cellulose synthase-5 from Zea mays [gi:9622882] 2e-26 ...
Arabidopsis CDS blastp result: AK242601 [KOME
Lifescience Database Archive (English)
Full Text Available AK242601 J090014G03 At1g02730.1 68414.m00226 cellulose synthase family protein similar to cellulose... synthase catalytic subunit [gi:13925881] from Nicotiana alata, cellulose synthase-4 [gi:9622880] from Zea mays 0.0 ...
Arabidopsis CDS blastp result: AK242585 [KOME
Lifescience Database Archive (English)
Full Text Available AK242585 J090010M20 At1g02730.1 68414.m00226 cellulose synthase family protein similar to cellulose... synthase catalytic subunit [gi:13925881] from Nicotiana alata, cellulose synthase-4 [gi:9622880] from Zea mays 7e-27 ...
Arabidopsis CDS blastp result: AK242601 [KOME
Lifescience Database Archive (English)
Full Text Available AK242601 J090014G03 At1g55850.1 68414.m06405 cellulose synthase family protein similar to cellulose... synthase catalytic subunit [gi:13925881] from Nicotiana alata, cellulose synthase-5 [gi:9622882] from Zea mays 2e-22 ...
Arabidopsis CDS blastp result: AK242890 [KOME
Lifescience Database Archive (English)
Full Text Available AK242890 J090079L19 At2g32540.1 68415.m03975 cellulose synthase family protein similar to cellulose... synthase catalytic subunit from Arabidopsis thaliana [gi:5230423], cellulose synthase-5 from Zea mays [gi:9622882] 4e-47 ...
Arabidopsis CDS blastp result: AK242601 [KOME
Lifescience Database Archive (English)
Full Text Available AK242601 J090014G03 At2g32540.1 68415.m03975 cellulose synthase family protein similar to cellulose... synthase catalytic subunit from Arabidopsis thaliana [gi:5230423], cellulose synthase-5 from Zea mays [gi:9622882] 3e-31 ...
Arabidopsis CDS blastp result: AK242585 [KOME
Lifescience Database Archive (English)
Full Text Available AK242585 J090010M20 At5g16910.1 68418.m01982 cellulose synthase family protein similar to gi:2827143 cellulo...se synthase catalytic subunit, Arabidopsis thaliana, gi:9622886 cellulose synthase-7 from Zea mays 1e-28 ...
Arabidopsis CDS blastp result: AK242601 [KOME
Lifescience Database Archive (English)
Full Text Available AK242601 J090014G03 At4g23990.1 68417.m03448 cellulose synthase family protein similar to cellulose... synthase catalytic subunit from Arabidopsis thaliana [gi:5230423], cellulose synthase-5 from Zea mays [gi:9622882] 8e-25 ...
Arabidopsis CDS blastp result: AK242890 [KOME
Lifescience Database Archive (English)
Full Text Available AK242890 J090079L19 At1g32180.1 68414.m03958 cellulose synthase family protein similar to cellulose... synthase catalytic subunit gi:2827143 from [Arabidopsis thaliana], cellulose synthase-9 (gi:9622890) from Zea mays 1e-126 ...
Arabidopsis CDS blastp result: AK242890 [KOME
Lifescience Database Archive (English)
Full Text Available AK242890 J090079L19 At4g23990.1 68417.m03448 cellulose synthase family protein similar to cellulose... synthase catalytic subunit from Arabidopsis thaliana [gi:5230423], cellulose synthase-5 from Zea mays [gi:9622882] 1e-45 ...
Arabidopsis CDS blastp result: AK242601 [KOME
Lifescience Database Archive (English)
Full Text Available AK242601 J090014G03 At4g23990.1 68417.m03448 cellulose synthase family protein similar to cellulose... synthase catalytic subunit from Arabidopsis thaliana [gi:5230423], cellulose synthase-5 from Zea mays [gi:9622882] 5e-25 ...
Arabidopsis CDS blastp result: AK242585 [KOME
Lifescience Database Archive (English)
Full Text Available AK242585 J090010M20 At5g16910.1 68418.m01982 cellulose synthase family protein similar to gi:2827143 cellulo...se synthase catalytic subunit, Arabidopsis thaliana, gi:9622886 cellulose synthase-7 from Zea mays 2e-65 ...
Arabidopsis CDS blastp result: AK242585 [KOME
Lifescience Database Archive (English)
Full Text Available AK242585 J090010M20 At1g32180.1 68414.m03958 cellulose synthase family protein similar to cellulose... synthase catalytic subunit gi:2827143 from [Arabidopsis thaliana], cellulose synthase-9 (gi:9622890) from Zea mays 1e-24 ...
Arabidopsis CDS blastp result: AK242601 [KOME
Lifescience Database Archive (English)
Full Text Available AK242601 J090014G03 At2g32530.1 68415.m03974 cellulose synthase family protein similar to cellulose... synthase catalytic subunit from Arabidopsis thaliana [gi:5230423], cellulose synthase-5 from Zea mays [gi:9622882] 2e-29 ...
Arabidopsis CDS blastp result: AK242585 [KOME
Lifescience Database Archive (English)
Full Text Available AK242585 J090010M20 At1g32180.1 68414.m03958 cellulose synthase family protein similar to cellulose... synthase catalytic subunit gi:2827143 from [Arabidopsis thaliana], cellulose synthase-9 (gi:9622890) from Zea mays 3e-66 ...
Arabidopsis CDS blastp result: AK242585 [KOME
Lifescience Database Archive (English)
Full Text Available AK242585 J090010M20 At4g23990.1 68417.m03448 cellulose synthase family protein similar to cellulose... synthase catalytic subunit from Arabidopsis thaliana [gi:5230423], cellulose synthase-5 from Zea mays [gi:9622882] 1e-124 ...
Arabidopsis CDS blastp result: AK242601 [KOME
Lifescience Database Archive (English)
Full Text Available AK242601 J090014G03 At2g32540.1 68415.m03975 cellulose synthase family protein similar to cellulose... synthase catalytic subunit from Arabidopsis thaliana [gi:5230423], cellulose synthase-5 from Zea mays [gi:9622882] 2e-45 ...
Arabidopsis CDS blastp result: AK242890 [KOME
Lifescience Database Archive (English)
Full Text Available AK242890 J090079L19 At5g16910.1 68418.m01982 cellulose synthase family protein similar to gi:2827143 cellulo...se synthase catalytic subunit, Arabidopsis thaliana, gi:9622886 cellulose synthase-7 from Zea mays 1e-130 ...
Arabidopsis CDS blastp result: AK242890 [KOME
Lifescience Database Archive (English)
Full Text Available AK242890 J090079L19 At4g38190.1 68417.m05391 cellulose synthase family protein similar to cellulose... synthase catalytic subunit gi:2827143 from [Arabidopsis thaliana], cellulose synthase-5 (gi:9622882) from Zea mays 1e-125 ...
Arabidopsis CDS blastp result: AK242585 [KOME
Lifescience Database Archive (English)
Full Text Available AK242585 J090010M20 At2g32540.1 68415.m03975 cellulose synthase family protein similar to cellulose... synthase catalytic subunit from Arabidopsis thaliana [gi:5230423], cellulose synthase-5 from Zea mays [gi:9622882] 4e-98 ...
Arabidopsis CDS blastp result: AK242601 [KOME
Lifescience Database Archive (English)
Full Text Available AK242601 J090014G03 At1g55850.1 68414.m06405 cellulose synthase family protein similar to cellulose... synthase catalytic subunit [gi:13925881] from Nicotiana alata, cellulose synthase-5 [gi:9622882] from Zea mays 1e-61 ...
Arabidopsis CDS blastp result: AK242601 [KOME
Lifescience Database Archive (English)
Full Text Available AK242601 J090014G03 At5g16910.1 68418.m01982 cellulose synthase family protein similar to gi:2827143 cellulo...se synthase catalytic subunit, Arabidopsis thaliana, gi:9622886 cellulose synthase-7 from Zea mays 0.0 ...
Arabidopsis CDS blastp result: AK242585 [KOME
Lifescience Database Archive (English)
Full Text Available AK242585 J090010M20 At2g32530.1 68415.m03974 cellulose synthase family protein similar to cellulose... synthase catalytic subunit from Arabidopsis thaliana [gi:5230423], cellulose synthase-5 from Zea mays [gi:9622882] 8e-98 ...
Arabidopsis CDS blastp result: AK242585 [KOME
Lifescience Database Archive (English)
Full Text Available AK242585 J090010M20 At4g38190.1 68417.m05391 cellulose synthase family protein similar to cellulose... synthase catalytic subunit gi:2827143 from [Arabidopsis thaliana], cellulose synthase-5 (gi:9622882) from Zea mays 4e-27 ...
Arabidopsis CDS blastp result: AK242585 [KOME
Lifescience Database Archive (English)
Full Text Available AK242585 J090010M20 At1g02730.1 68414.m00226 cellulose synthase family protein similar to cellulose... synthase catalytic subunit [gi:13925881] from Nicotiana alata, cellulose synthase-4 [gi:9622880] from Zea mays 1e-69 ...
Arabidopsis CDS blastp result: AK242585 [KOME
Lifescience Database Archive (English)
Full Text Available AK242585 J090010M20 At1g55850.1 68414.m06405 cellulose synthase family protein similar to cellulose... synthase catalytic subunit [gi:13925881] from Nicotiana alata, cellulose synthase-5 [gi:9622882] from Zea mays 0.0 ...
Arabidopsis CDS blastp result: AK242890 [KOME
Lifescience Database Archive (English)
Full Text Available AK242890 J090079L19 At1g55850.1 68414.m06405 cellulose synthase family protein similar to cellulose... synthase catalytic subunit [gi:13925881] from Nicotiana alata, cellulose synthase-5 [gi:9622882] from Zea mays 1e-52 ...
Arabidopsis CDS blastp result: AK242890 [KOME
Lifescience Database Archive (English)
Full Text Available AK242890 J090079L19 At2g32530.1 68415.m03974 cellulose synthase family protein similar to cellulose... synthase catalytic subunit from Arabidopsis thaliana [gi:5230423], cellulose synthase-5 from Zea mays [gi:9622882] 4e-50 ...
Arabidopsis CDS blastp result: AK242601 [KOME
Lifescience Database Archive (English)
Full Text Available AK242601 J090014G03 At2g32530.1 68415.m03974 cellulose synthase family protein similar to cellulose... synthase catalytic subunit from Arabidopsis thaliana [gi:5230423], cellulose synthase-5 from Zea mays [gi:9622882] 5e-48 ...
Directory of Open Access Journals (Sweden)
Hiroaki Iwasaka
2018-04-01
Full Text Available Labyrinthulomycetes have been regarded as a promising industrial source of xanthophylls, including astaxanthin and canthaxanthin, polyunsaturated fatty acids such as docosahexaenoic acid and docosapentaenoic acid, ω-3 oils, and terpenic hydrocarbons, such as sterols and squalene. A Thraustochytrid, Aurantiochytrium sp. KH105 produces carotenoids, including astaxanthin, with strong antioxidant activity. To gain genomic insights into this capacity, we decoded its 97-Mbp genome and characterized genes for enzymes involved in carotenoid biosynthesis. Interestingly, all carotenogenic genes, as well as other eukaryotic genes, appeared duplicated, suggesting that this strain is diploid. In addition, among the five genes involved in the pathway from geranylgeranyl pyrophosphate to astaxanthin, geranylgeranyl phytoene synthase (crtB, phytoene desaturase (crtI and lycopene cyclase (crtY were fused into single gene (crtIBY with no internal stop codons. Functionality of the trifunctional enzyme, CrtIBY, to catalyze the reaction from geranylgeranyl diphosphate to β-carotene was confirmed using a yeast assay system and mass spectrometry. Furthermore, analyses of differential gene expression showed characteristic up-regulation of carotenoid biosynthetic genes during stationary and starvation phases under these culture conditions. This suggests genetic engineering events to promote more efficient production of carotenoids. We also showed an occurrence of crtIBY in other Thraustochytrid species.
Directory of Open Access Journals (Sweden)
Bjørge Westereng
Full Text Available Many fungi growing on plant biomass produce proteins currently classified as glycoside hydrolase family 61 (GH61, some of which are known to act synergistically with cellulases. In this study we show that PcGH61D, the gene product of an open reading frame in the genome of Phanerochaete chrysosporium, is an enzyme that cleaves cellulose using a metal-dependent oxidative mechanism that leads to generation of aldonic acids. The activity of this enzyme and its beneficial effect on the efficiency of classical cellulases are stimulated by the presence of electron donors. Experiments with reduced cellulose confirmed the oxidative nature of the reaction catalyzed by PcGH61D and indicated that the enzyme may be capable of penetrating into the substrate. Considering the abundance of GH61-encoding genes in fungi and genes encoding their functional bacterial homologues currently classified as carbohydrate binding modules family 33 (CBM33, this enzyme activity is likely to turn out as a major determinant of microbial biomass-degrading efficiency.
An Investigation of Cellulose Digesting Bacteria in the Panda Gut Microbiome
Lu, M.; Leung, F. C.
2014-12-01
The Giant Panda (Ailuropoda melanoleuca) diet consists primarily of bamboo leaves, stems and shoots. However, the Giant Panda lacks genes for the enzymes needed to digest cellulose, the core component of bamboo. Thus, it is hypothesized that the cellulolytic digestion necessary for maintaining the Giant Panda diet is carried out by microbial symbionts in the panda gut microbiota. Fecal microbiota is used as surrogate index for gut microbiota since the Giant Panda is listed by the World Conservation Union as a Threatened Species. Two bacterial isolates with potential cellulolytic activity were isolated from Giant Panda fecal samples and cultured on selective media CMC (carboxymethyl cellulose) agar and CMC-Congo Red agar using various methods of inoculation. After incubation, clearance zones around colonies were observed and used as qualitative assays for cellulose digestion. Polymerase chain reaction amplification of the 16S rRNA gene was completed and species identification was done based on the BLAST result of 16S rRNA sequence obtained using Sanger sequencing. Once the cellulase activity is confirmed, genomic DNA of the bacteria will be extracted and used for whole genome shotgun sequencing. Illumina next generation sequencing platform will be adopted as it yields high-throughput information, providing a better understanding of cellulose digestion and the molecular genetic pathways to renewable sources of biofuels. Researchers have identified multiple cellulose-digesting microbes in the Giant Panda gut, but few have applied such bacteria in converting cellulose into glucose to create biofuel. Cellulosic ethanol, a biofuel, is produced through the fermentation of lignocellulosic biomasses. This anaerobic process is aided by cellulose-digesting enzymes. Certain microbes, such as those present in the Giant Panda gut, can produce enzymes that cleave the glycosidic bonds of cellulose (C6H10O5) into glucose molecules (C6H12O6), which can then be fermented into ethanol
Han, Xuerong; Satoh, Yasuharu; Kuriki, Yumi; Seino, Teruyuki; Fujita, Shinji; Suda, Takanori; Kobayashi, Takanori; Tajima, Kenji
2014-11-01
We successfully isolated one microorganism (UMI-21) from Ulva, a green algae that contains starch. The strain UMI-21 can produce polyhydroxyalkanoate (PHA) from starch, maltotriose, or maltose as a sole carbon source. Taxonomic studies and 16S rDNA sequence analysis revealed that strain UMI-21 was phylogenetically related to species of the genus Massilia. The PHA content under the cultivation condition using a 10-L jar fermentor was 45.5% (w/w). This value was higher than that obtained after cultivation in a flask, suggesting the possibility of large-scale PHA production by UMI-21 from starch. A major issue for the industrial production of microbial PHAs is the very high production cost. Starch is a relatively inexpensive substrate that is also found in abundant seaweeds such as Ulva. Therefore, the strain isolated in this study may be very useful for producing PHA from seaweeds containing polysaccharides such as starch. In addition, a 3.7-kbp DNA fragment containing the whole PHA synthase gene (phaC) was obtained from the strain UMI-21. The results of open reading frame (ORF) analysis suggested that the DNA fragment contained two ORFs, which were composed of 1740 (phaC) and 564 bp (phaR). The deduced amino acid sequence of PhaC from strain UMI-21 shared high similarity with PhaC from Ralstonia eutropha, which is a representative PHA-producing bacterium with a class I PHA synthase. This is the first report for the cloning of the PHA synthase gene from Massilia species. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar
2016-04-01
Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.
Cellulose is not just cellulose
DEFF Research Database (Denmark)
Hidayat, Budi Juliman; Felby, Claus; Johansen, Katja Salomon
2012-01-01
are not regions where free cellulose ends are more abundant than in the bulk cell wall. In more severe cases cracks between fibrils form at dislocations and it is possible that the increased accessibility that these cracks give is the reason why hydrolysis of cellulose starts at these locations. If acid...... or enzymatic hydrolysis of plant cell walls is carried out simultaneously with the application of shear stress, plant cells such as fibers or tracheids break at their dislocations. At present it is not known whether specific carbohydrate binding modules (CBMs) and/or cellulases preferentially access cellulose...
Gupta, Dinesh; Ip, Tina; Summers, Michael L; Basu, Chhandak
2015-01-01
Phytol is a diterpene alcohol of medicinal importance and it also has potential to be used as biofuel. We found over production of phytol in Nostoc punctiforme by expressing a 2-Methyl-3-buten-2-ol (MBO) synthase gene. MBO synthase catalyzes the conversion of dimethylallyl pyrophosphate (DMAPP) into MBO, a volatile hemiterpene alcohol, in Pinus sabiniana. The result of enhanced phytol production in N. punctiforme, instead of MBO, could be explained by one of the 2 models: either the presence of a native prenyltransferase enzyme with a broad substrate specificity, or appropriation of a MBO synthase metabolic intermediate by a native geranyl diphosphate (GDP) synthase. In this work, an expression vector with an indigenous petE promoter for gene expression in the cyanobacterium N. punctiforme was constructed and MBO synthase gene expression was successfully shown using reverse transcriptase (RT)-PCR and SDS-PAGE. Gas chromatography--mass spectrophotometry (GC-MS) was performed to confirm phytol production from the transgenic N. punctiforme strains. We conclude that the expression of MBO synthase in N. punctiforme leads to overproduction of an economically important compound, phytol. This study provides insights about metabolic channeling of isoprenoids in cyanobacteria and also illustrates the challenges of bioengineering non-native hosts to produce economically important compounds.
Ionescu, Michael; Baccari, Clelia; Da Silva, Aline Maria; Garcia, Angelica; Yokota, Kenji; Lindow, Steven E.
2013-01-01
Xylella fastidiosa, like related Xanthomonas species, employs an Rpf cell-cell communication system consisting of a diffusible signal factor (DSF) synthase, RpfF, and a DSF sensor, RpfC, to coordinate expression of virulence genes. While phenotypes of a ΔrpfF strain in Xanthomonas campestris could be complemented by its own DSF, the DSF produced by X. fastidiosa (XfDSF) did not restore expression of the XfDSF-dependent genes hxfA and hxfB to a ΔrpfF strain of X. fastidiosa, suggesting that Rp...
NCBI nr-aa BLAST: CBRC-DDIS-01-0132 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-DDIS-01-0132 ref|XP_646256.1| cellulose synthase [Dictyostelium discoideum AX4...] gb|AAF00200.1|AF163835_1 cellulose synthase [Dictyostelium discoideum] gb|EAL71912.1| cellulose synthase [Dictyostelium discoideum AX4] XP_646256.1 0.0 99% ...
DEFF Research Database (Denmark)
Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny
2007-01-01
Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...
Amaryllidaceae Alkaloids as Potential Glycogen Synthase Kinase-3β Inhibitors
Directory of Open Access Journals (Sweden)
Daniela Hulcová
2018-03-01
Full Text Available Glycogen synthase kinase-3β (GSK-3β is a multifunctional serine/threonine protein kinase that was originally identified as an enzyme involved in the control of glycogen metabolism. It plays a key role in diverse physiological processes including metabolism, the cell cycle, and gene expression by regulating a wide variety of well-known substances like glycogen synthase, tau-protein, and β-catenin. Recent studies have identified GSK-3β as a potential therapeutic target in Alzheimer´s disease, bipolar disorder, stroke, more than 15 types of cancer, and diabetes. GSK-3β is one of the most attractive targets for medicinal chemists in the discovery, design, and synthesis of new selective potent inhibitors. In the current study, twenty-eight Amaryllidaceae alkaloids of various structural types were studied for their potency to inhibit GSK-3β. Promising results have been demonstrated by alkaloids of the homolycorine-{9-O-demethylhomolycorine (IC50 = 30.00 ± 0.71 µM, masonine (IC50 = 27.81 ± 0.01 μM}, and lycorine-types {caranine (IC50 = 30.75 ± 0.04 μM}.
Pankratov, Timofey A; Ivanova, Anastasia O; Dedysh, Svetlana N; Liesack, Werner
2011-07-01
Northern peatlands represent a major global carbon store harbouring approximately one-third of the global reserves of soil organic carbon. A large proportion of these peatlands consists of acidic Sphagnum-dominated ombrotrophic bogs, which are characterized by extremely low rates of plant debris decomposition. The degradation of cellulose, the major component of Sphagnum-derived litter, was monitored in long-term incubation experiments with acidic (pH 4.0) peat extracts. This process was almost undetectable at 10°C and occurred at low rates at 20°C, while it was significantly accelerated at both temperature regimes by the addition of available nitrogen. Cellulose breakdown was only partially inhibited in the presence of cycloheximide, suggesting that bacteria participated in this process. We aimed to identify these bacteria by a combination of molecular and cultivation approaches and to determine the factors that limit their activity in situ. The indigenous bacterial community in peat was dominated by Alphaproteobacteria and Acidobacteria. The addition of cellulose induced a clear shift in the community structure towards an increase in the relative abundance of the Bacteroidetes. Increasing temperature and nitrogen availability resulted in a selective development of bacteria phylogenetically related to Cytophaga hutchinsonii (94-95% 16S rRNA gene sequence similarity), which densely colonized microfibrils of cellulose. Among isolates obtained from this community only some subdivision 1 Acidobacteria were capable of degrading cellulose, albeit at a very slow rate. These Acidobacteria represent indigenous cellulolytic members of the microbial community in acidic peat and are easily out-competed by Cytophaga-like bacteria under conditions of increased nitrogen availability. Members of the phylum Firmicutes, known to be key players in cellulose degradation in neutral habitats, were not detected in the cellulolytic community enriched at low pH. © 2011 Society for
Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).
Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian
2013-12-01
Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.
Grafted Cellulose Based Adsorbents for Selective Separation Purposes
Energy Technology Data Exchange (ETDEWEB)
Takacs, E; Wojnarovits, L [Institute of Isotopes, Hungarian Academy of Sciences, Budapest (Hungary)
2012-09-15
The effect of high energy ionizing radiation on cotton-cellulose was studied. It was found that degradation of cellulose started at low doses, below 5 kGy, resulting in decrease in the degree of polymerization. However, the mechanical properties of cotton-cellulose samples only slightly changed with the dose up to 40 kGy. Acrylate type monomers were successfully grafted to cellulose by mutual and by pre-irradiation grafting technique. With both techniques the grafting yield increased with increasing dose and monomer concentration. In the case of pre-irradiation grafting the increase in grafting time also resulted in an increase in grafting percentage. Cotton-cellulose was functionalized using pre-irradiation grafting (PIG) and simultaneous grafting (SG) of glycidyl methacrylate (GMA). The adsorption properties of this material were further enhanced by {beta}-cyclodextrin (CD) immobilization. This molecule is known for its unique ability to form inclusion complexes among others with aromatic compounds like phenols, pesticide, dyes, etc. (author)
Directory of Open Access Journals (Sweden)
Yonghai Fan
2017-12-01
Full Text Available Galactinol synthase (GolS is a key enzyme in raffinose family oligosaccharide (RFO biosynthesis. The finding that GolS accumulates in plants exposed to abiotic stresses indicates RFOs function in environmental adaptation. However, the evolutionary relationships and biological functions of GolS family in rapeseed (Brassica napus and tobacco (Nicotiana tabacum remain unclear. In this study, we identified 20 BnGolS and 9 NtGolS genes. Subcellular localization predictions showed that most of the proteins are localized to the cytoplasm. Phylogenetic analysis identified a lost event of an ancient GolS copy in the Solanaceae and an ancient duplication event leading to evolution of GolS4/7 in the Brassicaceae. The three-dimensional structures of two GolS proteins were conserved, with an important DxD motif for binding to UDP-galactose (uridine diphosphate-galactose and inositol. Expression profile analysis indicated that BnGolS and NtGolS genes were expressed in most tissues and highly expressed in one or two specific tissues. Hormone treatments strongly induced the expression of most BnGolS genes and homologous genes in the same subfamilies exhibited divergent-induced expression. Our study provides a comprehensive evolutionary analysis of GolS genes among the Brassicaceae and Solanaceae as well as an insight into the biological function of GolS genes in hormone response in plants.
Directory of Open Access Journals (Sweden)
Jianrong Wang
2014-12-01
Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.
Energy Technology Data Exchange (ETDEWEB)
Zhou, Lei; Mu, Bo-Zhong [University of Science and Technology (China)], email: bzmu@ecust.edu.cn; Gu, Ji-Dong [The University of Hong Kong (China)], email: jdgu@hkucc.hku.hk
2011-07-01
Petroleum reservoirs represent a special ecosystem consisting of specific temperature, pressure, salt concentration, oil, gas, water, microorganisms and, enzymes among others. This paper presents the characterization of microbial community and the alkyl succinate synthase genes in petroleum reservoir fluids in China. A few samples were analyzed and the physical and chemical characteristics are given in a tabular form. A flow chart shows the methods and procedures for microbial activities. Six petroleum reservoirs were studied using an archaeal 16S rRNA gene-based approach to establish the presence of archaea and the results are given. The correlation of archaeal and bacterial communities with reservoir conditions and diversity of the arachaeal community in water-flooding petroleum reservoirs at different temperatures is also shown. From the study, it can be summarized that, among methane producers, CO2-reducing methanogens are mostly found in oil reservoir ecosystems and as more assA sequences are revealed, more comprehensive molecular probes can be designed to track the activity of anaerobic alkane-degrading organisms in the environment.
DEFF Research Database (Denmark)
Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P
1994-01-01
To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...
The Cellulose Nanofibers for Optoelectronic Conversion and Energy Storage
Directory of Open Access Journals (Sweden)
Yongfeng Luo
2014-01-01
Full Text Available Cellulose widely exists in plant tissues. Due to the large pores between the cellulose units, the regular paper is nontransparent that cannot be used in the optoelectronic devices. But some chemical and physical methods such as 2,2,6,6-tetramethylpiperidine-1-oxyl radical (TEMPO oxidation can be used to improve the pores scale between the cellulose units to reach nanometer level. The cellulose nanofibers (CNFs have good mechanical strength, flexibility, thermostability, and low thermal expansion. The paper made of these nanofibers represent a kind of novel nanostructured material with ultrahigh transparency, ultrahigh haze, conductivity, biodegradable, reproducible, low pollution, environment friendly and so on. These advantages make the novel nanostructured paper apply in the optoelectronic device possible, such as electronics energy storage devices. This kind of paper is considered most likely to replace traditional materials like plastics and glass, which is attracting widespread attention, and the related research has also been reported. The purpose of this paper is to review CNFs which are applied in optoelectronic conversion and energy storage.
Gas-Pascual, Elisabet; Berna, Anne; Bach, Thomas J; Schaller, Hubert
2014-01-01
The plant sterol pathway exhibits a major biosynthetic difference as compared with that of metazoans. The committed sterol precursor is the pentacyclic cycloartenol (9β,19-cyclolanost-24-en-3β-ol) and not lanosterol (lanosta-8,24-dien-3β-ol), as it was shown in the late sixties. However, plant genome mining over the last years revealed the general presence of lanosterol synthases encoding sequences (LAS1) in the oxidosqualene cyclase repertoire, in addition to cycloartenol synthases (CAS1) and to non-steroidal triterpene synthases that contribute to the metabolic diversity of C30H50O compounds on earth. Furthermore, plant LAS1 proteins have been unambiguously identified by peptidic signatures and by their capacity to complement the yeast lanosterol synthase deficiency. A dual pathway for the synthesis of sterols through lanosterol and cycloartenol was reported in the model Arabidopsis thaliana, though the contribution of a lanosterol pathway to the production of 24-alkyl-Δ(5)-sterols was quite marginal (Ohyama et al. (2009) PNAS 106, 725). To investigate further the physiological relevance of CAS1 and LAS1 genes in plants, we have silenced their expression in Nicotiana benthamiana. We used virus induced gene silencing (VIGS) based on gene specific sequences from a Nicotiana tabacum CAS1 or derived from the solgenomics initiative (http://solgenomics.net/) to challenge the respective roles of CAS1 and LAS1. In this report, we show a CAS1-specific functional sterol pathway in engineered yeast, and a strict dependence on CAS1 of tobacco sterol biosynthesis.
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2017-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2016-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
An Arabidopsis callose synthase
DEFF Research Database (Denmark)
Ostergaard, Lars; Petersen, Morten; Mattsson, Ole
2002-01-01
in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while...... expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant....
Bioconversion of cellulose into electrical energy in microbial fuel cells
Rismani-Yazdi, Hamid
In microbial fuel cells (MFCs), bacteria generate electricity by mediating the oxidation of organic compounds and transferring the resulting electrons to an anode electrode. The first objective of this study was to test the possibility of generating electricity with rumen microorganisms as biocatalysts and cellulose as the electron donor in two-compartment MFCs. Maximum power density reached 55 mW/m2 (1.5 mA, 313 mV) with cellulose as the electron donor. Cellulose hydrolysis and electrode reduction were shown to support the production of current. The electrical current was sustained for over two months with periodic cellulose addition. Clarified rumen fluid and a soluble carbohydrate mixture, serving as the electron donors, could also sustain power output. The second objective was to analyze the composition of the bacterial communities enriched in the cellulose-fed MFCs. Denaturing gradient gel electrophoresis of PCR amplified 16S rRNA genes revealed that the microbial communities differed when different substrates were used in the MFCs. The anode-attached and the suspended consortia were shown to be different within the same MFC. Cloning and analysis of 16S rRNA gene sequences indicated that the most predominant bacteria in the anode-attached consortia were related to Clostridium spp., while Comamonas spp. was abundant in the suspended consortia. The external resistance affects the characteristic outputs of MFCs by controlling the flow of electrons from the anode to the cathode. The third objective of this study was to determine the effect of various external resistances on power output and coulombic efficiency of cellulose-fed MFCs. Four external resistances (20, 249, 480, and 1000 ohms) were tested with a systematic approach of operating parallel MFCs independently at constant circuit loads for three months. A maximum power density of 66 mWm-2 was achieved by MFCs with 20 ohms circuit load, while MFCs with 249, 480 and1000 ohms external resistances produced 57
Directory of Open Access Journals (Sweden)
Rebecca S Bart
2010-09-01
Full Text Available Rice NH1 (NPR1 homolog 1 is a key mediator of innate immunity. In both plants and animals, the innate immune response is often accompanied by rapid cell death at the site of pathogen infection. Over-expression of NH1 in rice results in resistance to the bacterial pathogen, Xanthomonas oryzae pv. oryzae (Xoo, constitutive expression of defense related genes and enhanced benzothiadiazole (BTH- mediated cell death. Here we describe a forward genetic screen that identified a suppressor of NH1-mediated lesion formation and resistance, snl6. Comparative genome hybridization and fine mapping rapidly identified the genomic location of the Snl6 gene. Snl6 is a member of the cinnamoyl-CoA reductase (CCR-like gene family. We show that Snl6 is required for NH1-mediated resistance to Xoo. Further, we show that Snl6 is required for pathogenesis-related gene expression. In contrast to previously described CCR family members, disruption of Snl6 does not result in an obvious morphologic phenotype. Snl6 mutants have reduced lignin content and increased sugar extractability, an important trait for the production of cellulosic biofuels. These results suggest the existence of a conserved group of CCR-like genes involved in the defense response, and with the potential to alter lignin content without affecting development.
Effects and mechanism of acid rain on plant chloroplast ATP synthase.
Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua
2016-09-01
Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.
Grieco, Steven F.; Cheng, Yuyan; Eldar-Finkelman, Hagit; Jope, Richard S.; Beurel, Eléonore
2016-01-01
An antidepressant dose of the rapidly-acting ketamine inhibits glycogen synthase kinase-3 (GSK3) in mouse hippocampus, and this inhibition is required for the antidepressant effect of ketamine in learned helplessness depression-like behavior. Here we report that treatment with an antidepressant dose of ketamine (10 mg/kg) increased expression of insulin-like growth factor 2 (IGF2) in mouse hippocampus, an effect that required ketamine-induced inhibition of GSK3. Ketamine also inhibited hippocampal GSK3 and increased expression of hippocampal IGF2 in mice when administered after the induction of learned helplessness. Treatment with the specific GSK3 inhibitor L803-mts was sufficient to up-regulate hippocampal IGF2 expression. Administration of IGF2 siRNA reduced ketamine's antidepressant effect in the learned helplessness paradigm. Mice subjected to the learned helplessness paradigm were separated into two groups, those that were resilient (non-depressed) and those that were susceptible (depressed). Non-depressed resilient mice displayed higher expression of IGF2 than susceptible mice. These results indicate that IGF2 contributes to ketamine's antidepressant effect and that IGF2 may confer resilience to depression-like behavior. PMID:27542584
Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle
DEFF Research Database (Denmark)
Højlund, Kurt; Beck-Nielsen, Henning
2006-01-01
Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...
Directory of Open Access Journals (Sweden)
Tao Zhou
2015-01-01
Full Text Available The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides.
High magnetic field quantum transport in Au nanoparticle–cellulose films
International Nuclear Information System (INIS)
Turyanska, L; Makarovsky, O; Patanè, A; Kozlova, N V; Liu, Z; Li, M; Mann, S
2012-01-01
We report the magneto-transport properties of cellulose films comprising interconnected networks of gold nanoparticles (Au NPs). Cellulose is a biopolymer that can be made electrically conducting by cellulose regeneration in Au NP dispersions. The mechanism of electronic conduction in the Au–cellulose films changes from variable range hopping to metallic-like conduction with decreasing resistivity. Our experiments in high magnetic fields (up to 45 T) reveal negative magnetoresistance in the highly resistive films. This is attributed to the spin polarization of the Au NPs and the magnetic field induced suppression of electron spin flips during spin-polarized tunneling in the NP network. (paper)
DEFF Research Database (Denmark)
Müller, Christian; Hjort, C.M.; Hansen, K.
2002-01-01
In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...
Directory of Open Access Journals (Sweden)
Lydia J R Hunter
Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus
Properties of cellulose derivatives produced from radiation-Modified cellulose pulps
International Nuclear Information System (INIS)
Iller, Edward; Stupinska, Halina; Starostka, Pawel
2007-01-01
The aim of project was elaboration of radiation methods for properties modification of cellulose pulps using for derivatives production. The selected cellulose pulps were exposed to an electron beam with energy 10 MeV in a linear accelerator. After irradiation pulps underwent the structural and physico-chemical investigations. The laboratory test for manufacturing carboxymethylocellulose (CMC), cellulose carbamate (CC) and cellulose acetate (CA) with cellulose pulps irradiated dose 10 and 15 kGy have been performed. Irradiation of the pulp influenced its depolimerisation degree and resulted in the drop of viscosity of CMC. However, the expected level of cellulose activation expressed as a rise of the substitution degree or increase of the active substance content in the CMC sodium salt was not observed. In the case of cellulose esters (CC, CA) formation, the action of ionising radiation on cellulose pulps with the dose 10 and 15 kGy enables obtaiment of the average values of polimerisation degree as required for CC soluble in aqueous sodium hydroxide solution. The properties of derivatives prepared by means of radiation and classic methods were compared
Bua-In Saowaluck; Paisooksantivatana Yingyong; Weimer Bart C.; Chowpongpang Srimek
2014-01-01
Cassumunar ginger (Zingiber montanum (Koenig) Link ex Dietr.) is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant an...
Synthesis and characterization of cellulose derivatives obtained from bacterial cellulose
International Nuclear Information System (INIS)
Oliveira, Rafael L. de; Barud, Hernane; Ribeiro, Sidney J.L.; Messaddeq, Younes
2011-01-01
The chemical modification of cellulose leads to production of derivatives with different properties from those observed for the original cellulose, for example, increased solubility in more traditional solvents. In this work we synthesized four derivatives of cellulose: microcrystalline cellulose, cellulose acetate, methylcellulose and carboxymethylcellulose using bacterial cellulose as a source. These were characterized in terms of chemical and structural changes by examining the degree of substitution (DS), infrared spectroscopy (FTIR) and nuclear magnetic resonance spectroscopy - NMR 13 C. The molecular weight and degree of polymerization were evaluated by viscometry. The characterization of the morphology of materials and thermal properties were performed with the techniques of X-ray diffraction, electron microscopy images, differential scanning calorimetry (DSC) and thermogravimetric analysis. (author)
International Nuclear Information System (INIS)
Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua
2013-01-01
1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)
Directory of Open Access Journals (Sweden)
Shan Yuan
2016-11-01
Full Text Available Melatonin serves pleiotropic functions in prompting plant growth and resistance to various stresses. The accurate biosynthetic pathway of melatonin remains elusive in plant species, while the N-acetyltransferase and O-methyltransferase were considered to be the last two key enzymes during its biosynthesis. To investigate the biosynthesis and metabolic pathway of melatonin in plants, the RNA-seq profile of overexpression of the ovine HIOMT was analyzed and compared with the previous transcriptome of transgenic oAANAT gene in switchgrass, a model plant for cellulosic ethanol production. A total of 946, 405 and 807 differentially expressed unigenes were observed in AANAT vs. control, HIOMT vs. control, and AANAT vs. HIOMT, respectively. The significantly upregulated (F-box/kelch-repeat protein, zinc finger BED domain-containing protein-3 genes were consistent with enhanced phenotypes of shoot, stem and root growth in transgenic oHIOMT switchgrass. Early flowering in overexpression of oHIOMT switchgrass involved in the regulation of flowering-time genes (APETALA2. Several stress resistant related genes (SPX domain-containing membrane protein, copper transporter 1, late blight resistance protein homolog R1A-6 OS etc. were specifically and significantly upregulated in transgenic oHIOMT only, while metabolism-related genes (phenylalanine-4-hydroxylase, tyrosine decarboxylase 1, protein disulfide-isomerase and galactinol synthase 2 etc. were significantly upregulated in transgenic oAANAT only. These results provide new sights into the biosynthetic and physiological functional networks of melatonin in plants.
Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd.
Jin, Mei Lan; Lee, Woo Moon; Kim, Ok Tae
2017-11-15
Oxidosqualene cyclases (OSCs) are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA), RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated) were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG) values calculated by fragments per kilobase million (FPKM). In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1 , and PtCAS2 , were found, in addition to the PtBS (β-amyrin synthase) gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia . All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.
Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd
Directory of Open Access Journals (Sweden)
Mei Lan Jin
2017-11-01
Full Text Available Oxidosqualene cyclases (OSCs are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA, RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG values calculated by fragments per kilobase million (FPKM. In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1, and PtCAS2, were found, in addition to the PtBS (β-amyrin synthase gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia. All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.
Molecular characterization of two alkylresorcylic acid synthases from Sordariomycetes fungi
DEFF Research Database (Denmark)
Ramakrishnan, Dhivya; Tiwari, Manish Kumar; Manoharan, Gomathi
2018-01-01
Two putative type III polyketide synthase genes (PKS) were identified from Sordariomycetes fungi. These two type III PKS genes from Sordaria macrospora (SmPKS) and Chaetomium thermophilum (CtPKS), shared 59.8% sequence identity. Both, full-length and truncated versions of type III PKSs were...
Directory of Open Access Journals (Sweden)
Kawamukai Makoto
2004-11-01
Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.
Todde, Guido; Jha, Sanjiv K.; Subramanian, Gopinath; Shukla, Manoj K.
2018-02-01
Insensitive munitions (IM) compounds such as DNAN (2,4-dinitroanisole), NTO (3-nitro-1,2,4-triazol-5-one), NQ (nitroguanidine), and FOX7 (1,1-diamino-2,2-dinitroethene) reduce the risk of accidental explosions due to shock and high temperature exposure. These compounds are being used as replacements for sensitive munition compounds such as TNT (2,4,6-trinitromethylbenzene) and RDX (1,3,5-hexahydro-1,3,5-trinitro-1,3,5-triazine). NTO and NQ in IM compounds are more soluble than TNT or RDX, hence they can easily spread in the environment and get dissolved if exposed to precipitation. DNAN solubility is comparable to TNT solubility. Cellulosic biomass, due to its abundance in the environment and its chemical structure, has a high probability of adsorbing these IM compounds, and thus, it is important to investigate the interactions between cellulose and cellulose like biopolymers (e.g. cellulose triacetate and chitin) with IM compounds. Using Density Functional Theory methods, we have studied the adsorption of TNT, DNAN, NTO, NQ, and FOX7 onto cellulose Iα and Iβ, chitin, and cellulose triacetate I (CTA I). Solvent effects on the adsorption were also investigated. Our results show that all contaminants are more strongly adsorbed onto chitin and cellulose Iα than onto CTA I and cellulose Iβ. Dispersion forces were found to be the predominant contribution to the adsorption energies of all contaminants.
Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.
2017-01-01
Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...
INFLUENCE OF CELLULOSE POLYMERIZATION DEGREE AND CRYSTALLINITY ON KINETICS OF CELLULOSE DEGRADATION
Edita Jasiukaitytė-Grojzdek,; Matjaž Kunaver,; Ida Poljanšek
2012-01-01
Cellulose was treated in ethylene glycol with p-toluene sulfonic acid monohydrate as a catalyst at different temperatures. At the highest treatment temperature (150 °C) liquefaction of wood pulp cellulose was achieved and was dependant on cellulose polymerization degree (DP). Furthermore, the rate of amorphous cellulose weight loss was found to increase with cellulose degree of polymerization, while the rate of crystalline cellulose weight loss was reciprocal to the size of the crystallites. ...
International Nuclear Information System (INIS)
Chu, F.K.; Maley, F.; Martinez, J.; Maley, G.F.
1987-01-01
Southern hybridization analyses of procaryotic DNA from Escherchia coli, λ bacteriophage, and T1 to T7 phages were carried out. The hybridization probes used consisted of DNA restriction fragments derived from the T4 phage intron-containing thymidylate synthase gene (td) and short synthetic oligodeoxynucleotides defining specific exon and intron regions of the gene. It was shown that intact as well as restricted DNA from the T-even phages hybridized not only to both T4 phage td intron- and exon-specific probes but also to probes defining the td 5' (exon I-intron) and 3' (intron-exon II) presplice junctions. These data strongly suggest that, analogous to the T4 phage, only the T2 and T6 phages among the procaryotes tested contain interrupted td genes. The td intervening sequence in each phage is roughly 1 kilobase pair (kb) in size and interrupts the td gene at a site analogous to that in the T4 phage. This was confirmed by data from Northern (RNA) hybridization analysis of td-specific in vitro transcripts of these phage DNAs. [α- 32 P]GTP in vitro labeling of total RNA from T4 phage-infected cells produced five species of labeled RNAs that were 1, 0.9, 0.83, 0.75, and 0.6 kb in size. Only the 1-, 0.9-, and 0.75-kb species were labeled in RNA from T2- or T6-infected cells. The commonly present 1-kb RNA is the excised td intron, which exists in both linear and circular forms in the respective T-even-phage-infected cells, while the 0.6-kb RNA unique to T4 may be the excised intron derived from the ribonucleotide reductase small subunit gene (nrdB) of the phage. The remaining labeled RNA species are likely candidates for other self-splicing introns
Evaluation of cellulose-binding domain fused to a lipase for the lipase immobilization.
Hwang, Sangpill; Ahn, Jungoh; Lee, Sumin; Lee, Tai Gyu; Haam, Seungjoo; Lee, Kangtaek; Ahn, Ik-Sung; Jung, Joon-Ki
2004-04-01
A cellulose-binding domain (CBD) fragment of a cellulase gene of Trichoderma hazianum was fused to a lipase gene of Bacillus stearothermophilus L1 to make a gene cluster for CBD-BSL lipase. The specific activity of CBD-BSL lipase for oil hydrolysis increased by 33% after being immobilized on Avicel (microcrystalline cellulose), whereas those of CBD-BSL lipase and BSL lipase decreased by 16% and 54%, respectively, after being immobilized on silica gel. Although the loss of activity of an enzyme immobilized by adsorption has been reported previously, the loss of activity of the CBD-BSL lipase immobilized on Avicel was less than 3% after 12 h due to the irreversible binding of CBD to Avicel.
Energy Technology Data Exchange (ETDEWEB)
Mittal, Ashutosh [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Himmel, Michael E [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Kumar, Rajeev [University of California, Riverside; Oak Ridge National Laboratory;
2018-01-23
It has been previously shown that cellulose-lignin droplets' strong interactions, resulting from lignin coalescence and redisposition on cellulose surface during thermochemical pretreatments, increase cellulose recalcitrance to biological conversion, especially at commercially viable low enzyme loadings. However, information on the impact of cellulose-hemicellulose interactions on cellulose recalcitrance following relevant pretreatment conditions are scarce. Here, to investigate the effects of plausible hemicellulose precipitation and re-association with cellulose on cellulose conversion, different pretreatments were applied to pure Avicel(R) PH101 cellulose alone and Avicel mixed with model hemicellulose compounds followed by enzymatic hydrolysis of resulting solids at both low and high enzyme loadings. Solids produced by pretreatment of Avicel mixed with hemicelluloses (AMH) were found to contain about 2 to 14.6% of exogenous, precipitated hemicelluloses and showed a remarkably much lower digestibility (up to 60%) than their respective controls. However, the exogenous hemicellulosic residues that associated with Avicel following high temperature pretreatments resulted in greater losses in cellulose conversion than those formed at low temperatures, suggesting that temperature plays a strong role in the strength of cellulose-hemicellulose association. Molecular dynamics simulations of hemicellulosic xylan and cellulose were found to further support this temperature effect as the xylan-cellulose interactions were found to substantially increase at elevated temperatures. Furthermore, exogenous, precipitated hemicelluloses in pretreated AMH solids resulted in a larger drop in cellulose conversion than the delignified lignocellulosic biomass containing comparably much higher natural hemicellulose amounts. Increased cellulase loadings or supplementation of cellulase with xylanases enhanced cellulose conversion for most pretreated AMH solids; however, this approach
HAEM SYNTHASE AND COBALT PORPHYRIN SYNTHASE IN VARIOUS MICRO-ORGANISMS.
PORRA, R J; ROSS, B D
1965-03-01
1. The preparation of a crude extract of Clostridium tetanomorphum containing cobalt porphyrin synthase but little haem-synthase activity is described. 2. The properties of cobalt porphyrin synthase in the clostridial extracts is compared with the properties of a haem synthase present in crude extracts of the yeast Torulopsis utilis. 3. Cobalt porphyrin synthase in extracts of C. tetanomorphum inserts Co(2+) ions into the following dicarboxylic porphyrins in descending order of rate of insertion: meso-, deutero- and proto-porphyrins. Esterification renders meso- and deutero-porphyrins inactive as substrates. Neither the tetracarboxylic (coproporphyrin III) nor the octacarboxylic (uroporphyrin III) compounds are converted into cobalt porphyrins by the extract, but the non-enzymic incorporation of Co(2+) ions into these two porphyrins is rapid. These extracts are unable to insert Mn(2+), Zn(2+), Mg(2+) or Cu(2+) ions into mesoporphyrin. 4. Crude extracts of T. utilis readily insert both Co(2+) and Fe(2+) ions into deutero-, meso, and proto-porphyrins. Unlike the extracts of C. tetanomorphum, these preparations catalyse the insertion of Co(2+) ions into deuteroporphyrin more rapidly than into mesoporphyrin. This parallels the formation of haems by the T. utilis extract. 5. Cobalt porphyrin synthase is present in the particulate fraction of the extracts of C. tetanomorphum but requires a heat-stable factor present in the soluble fraction. This soluble factor can be replaced by GSH. 6. Cobalt porphyrin synthase in the clostridial extract is inhibited by iodoacetamide and to a smaller extent by p-chloromercuribenzoate and N-ethylmaleimide. The haem synthases of T. utilis and Micrococcus denitrificans are also inhibited by various thiol reagents.
Citric acid production and citrate synthase genes in distinct strains of ...
African Journals Online (AJOL)
SAM
2014-05-28
May 28, 2014 ... synthase in lactic acid production by A. niger and with the ... A number of microorganisms, including both bacteria and fungi, possess the capacity ..... citric acid production by solid-state fermentation from cassava bagasse and ...
Genome-wide identification, functional and evolutionary analysis of terpene synthases in pineapple.
Chen, Xiaoe; Yang, Wei; Zhang, Liqin; Wu, Xianmiao; Cheng, Tian; Li, Guanglin
2017-10-01
Terpene synthases (TPSs) are vital for the biosynthesis of active terpenoids, which have important physiological, ecological and medicinal value. Although terpenoids have been reported in pineapple (Ananas comosus), genome-wide investigations of the TPS genes responsible for pineapple terpenoid synthesis are still lacking. By integrating pineapple genome and proteome data, twenty-one putative terpene synthase genes were found in pineapple and divided into five subfamilies. Tandem duplication is the cause of TPS gene family duplication. Furthermore, functional differentiation between each TPS subfamily may have occurred for several reasons. Sixty-two key amino acid sites were identified as being type-II functionally divergence between TPS-a and TPS-c subfamily. Finally, coevolution analysis indicated that multiple amino acid residues are involved in coevolutionary processes. In addition, the enzyme activity of two TPSs were tested. This genome-wide identification, functional and evolutionary analysis of pineapple TPS genes provide a new insight into understanding the roles of TPS family and lay the basis for further characterizing the function and evolution of TPS gene family. Copyright © 2017 Elsevier Ltd. All rights reserved.
Santos-Lobato, Bruno Lopes; Borges, Vanderci; Ferraz, Henrique Ballalai; Mata, Ignacio Fernandez; Zabetian, Cyrus P; Tumas, Vitor
2018-04-01
Levodopa-induced dyskinesia (LID) is a common complication of advanced Parkinson's disease (PD). PD physiopathology is associated with dopaminergic and non-dopaminergic pathways, including the nitric oxide system. The present study aims to examine the association of a neuronal nitric oxide synthase gene (NOS1) single nucleotide polymorphism (rs2682826) with LID in PD patients. We studied 186 PD patients using levodopa. The presence of LID was defined as a MDS-UPDRS Part IV score ≥1 on item 4.1. We tested for association between NOS1 rs2682826 and the presence, daily frequency, and functional impact of LID using regression models, adjusting for important covariates. There was no significant association between genotype and any of the LID-related variables examined. Our results suggest that this NOS1 polymorphism does not contribute to LID susceptibility or severity. However, additional studies that include a comprehensive set of NOS1 variants will be needed to fully define the role of this gene in LID. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.
1991-01-01
Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate
Zarzycki, Jan; Kerfeld, Cheryl A
2013-11-09
Malyl-CoA lyase (MCL) is a promiscuous carbon-carbon bond lyase that catalyzes the reversible cleavage of structurally related Coenzyme A (CoA) thioesters. This enzyme plays a crucial, multifunctional role in the 3-hydroxypropionate bi-cycle for autotrophic CO2 fixation in Chloroflexus aurantiacus. A second, phylogenetically distinct MCL from Rhodobacter sphaeroides is involved in the ethylmalonyl-CoA pathway for acetate assimilation. Both MCLs belong to the large superfamily of CitE-like enzymes, which includes the name-giving β-subunit of citrate lyase (CitE), malyl-CoA thioesterases and other enzymes of unknown physiological function. The CitE-like enzyme superfamily also bears sequence and structural resemblance to the malate synthases. All of these different enzymes share highly conserved catalytic residues, although they catalyze distinctly different reactions: C-C bond formation and cleavage, thioester hydrolysis, or both (the malate synthases). Here we report the first crystal structures of MCLs from two different phylogenetic subgroups in apo- and substrate-bound forms. Both the C. aurantiacus and the R. sphaeroides MCL contain elaborations on the canonical β8/α8 TIM barrel fold and form hexameric assemblies. Upon ligand binding, changes in the C-terminal domains of the MCLs result in closing of the active site, with the C-terminal domain of one monomer forming a lid over and contributing side chains to the active site of the adjacent monomer. The distinctive features of the two MCL subgroups were compared to known structures of other CitE-like superfamily enzymes and to malate synthases, providing insight into the structural subtleties that underlie the functional versatility of these enzymes. Although the C. aurantiacus and the R. sphaeroides MCLs have divergent primary structures (~37% identical), their tertiary and quaternary structures are very similar. It can be assumed that the C-C bond formation catalyzed by the MCLs occurs as proposed for
Synthesis and characterization of amorphous cellulose from triacetate of cellulose
International Nuclear Information System (INIS)
Vega-Baudrit, Jose; Sibaja, Maria; Nikolaeva, Svetlana; Rivera A, Andrea
2014-01-01
It was carried-out a study for the synthesis and characterization of amorphous cellulose starting from cellulose triacetate. X-rays diffraction was used in order to obtain the cellulose crystallinity degree, also infrared spectroscopy FTIR was used. (author)
van der Leij, Feike R.; VISSER, RGF; Ponstein, Anne S.; Jacobsen, Evert; Feenstra, Willem
The genomic sequence of the potato gene for starch granule-bound starch synthase (GBSS; "waxy protein") has been determined for the wild-type allele of a monoploid genotype from which an amylose-free (amf) mutant was derived, and for the mutant part of the amf allele. Comparison of the wild-type
Directory of Open Access Journals (Sweden)
Linjie Wang
Full Text Available Glycogen synthase kinase 3 (GSK3α and GSK3β are serine/threonine kinases involved in numerous cellular processes and diverse diseases including mood disorders, Alzheimer's disease, diabetes, and cancer. However, in pigs, the information on GSK3 is very limited. Identification and characterization of pig GSK3 are not only important for pig genetic improvement, but also contribute to the understanding and development of porcine models for human disease prevention and treatment.Five different isoforms of GSK3β were identified in porcine different tissues, in which three isoforms are novel. These isoforms had differential expression patterns in the fetal and adult of the porcine different tissues. The mRNA expression level of GSK3β isoforms was differentially regulated during the course of the insulin treatment, suggesting that different GSK3β isoforms may have different roles in insulin signaling pathway. Moreover, GSK3β5 had a different role on regulating the glycogen synthase activity, phosphorylation and the expression of porcine GYS1 and GYS2 gene compared to other GSK3β isoforms.We are the first to report five different isoforms of GSK3β identified from the porcine different tissues. Splice variants of GSK3β exhibit differential activity towards glycogen synthase. These results provide new insight into roles of the GSK3β on regulating glycogen metabolism.
Hu, Chengguo; Bai, Xiaoyun; Wang, Yingkai; Jin, Wei; Zhang, Xuan; Hu, Shengshui
2012-04-17
A simple approach to the mass production of nanoporous gold electrode arrays on cellulose membranes for electrochemical sensing of oxygen using ionic liquid (IL) electrolytes was established. The approach, combining the inkjet printing of gold nanoparticle (GNP) patterns with the self-catalytic growth of these patterns into conducting layers, can fabricate hundreds of self-designed gold arrays on cellulose membranes within several hours using an inexpensive inkjet printer. The resulting paper-based gold electrode arrays (PGEAs) had several unique properties as thin-film sensor platforms, including good conductivity, excellent flexibility, high integration, and low cost. The porous nature of PGEAs also allowed the addition of electrolytes from the back cellulose membrane side and controllably produced large three-phase electrolyte/electrode/gas interfaces at the front electrode side. A novel paper-based solid-state electrochemical oxygen (O(2)) sensor was therefore developed using an IL electrolyte, 1-butyl-3-methylimidazolium hexafluorophosphate (BMIMPF(6)). The sensor looked like a piece of paper but possessed high sensitivity for O(2) in a linear range from 0.054 to 0.177 v/v %, along with a low detection limit of 0.0075% and a short response time of less than 10 s, foreseeing its promising applications in developing cost-effective and environment-friendly paper-based electrochemical gas sensors.
Q.Q. Wang; J.Y. Zhu; R.S. Reiner; S.P. Verrill; U. Baxa; S.E. McNeil
2012-01-01
This study demonstrated the potential of simultaneously recovering cellulosic solid residues (CSR) and producing cellulose nanocrystals (CNCs) by strong sulfuric acid hydrolysis to minimize cellulose loss to near zero. A set of slightly milder acid hydrolysis conditions than that considered as âoptimalâ were used to significantly minimize the degradation of cellulose...
Radiation modification of cellulose pulps. Preparation of cellulose derivatives
International Nuclear Information System (INIS)
Iller, E.; Zimek, Z.; Stupinska, H.; Mikolajczyk, W; Starostka, P.
2005-01-01
One of the most common methods of cellulose pulp modification (activation) applied in the production process of cellulose derivatives is the treatment of the pulp with NaOH solutions leading to the formation of alkalicellulose. The product then undergoes a prolonged process of maturation by its storage under specific conditions. The goal of the process is lowering of the molecular weight of cellulose down to the level resulting from various technological requirements. The process is time-consuming and costly; besides, it requires usage of large-capacity technological vessels and produces considerable amounts of liquid waste. Therefore, many attempts have been made to limit or altogether eliminate the highly disadvantageous stage of cellulose treatment with lye. One of the alternatives proposed so far is the radiation treatment of the cellulose pulp. In the pulp exposed to an electron beam, the bonds between molecules of D-antihydroglucopiranoses loosen and the local crystalline lattice becomes destroyed. This facilitates the access of chemical reagents to the inner structure of the cellulose and, in consequence, eliminates the need for the prolonged maturation of alkalicellulose, thus reducing the consumption of chemicals by the whole process. Research aimed at the application of radiation treatment of cellulose pulp for the production of cellulose derivatives has been conducted by a number of scientific institutions including the Institute of Nuclear Chemistry and Technology, Institute of Biopolymers and Chemical Fibres, and Pulp and Paper Research Institute. For the investigations and assessment of the molecular, hypermolecular, morphologic properties and the chemical reactivity, cellulose pulps used for chemical processing, namely Alicell, Borregaard and Ketchikan, as well as paper pulps made from pine and birch wood were selected. The selected cellulose pulps were exposed to an electron beam with an energy of 10 MeV generated in a linear electron accelerator
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics. MODHUMITA GHOSH DASGUPTA. Articles written in Journal of Genetics. Volume 93 Issue 2 August 2014 pp 403-414 Research Article. Isolation of developing secondary xylem specific cellulose synthase genes and their expression profiles during hormone signalling in Eucalyptus ...
The subcellular localization of yeast glycogen synthase is dependent upon glycogen content
Wilson, Wayne A.; Boyer, Michael P.; Davis, Keri D.; Burke, Michael; Roach, Peter J.
2010-01-01
The budding yeast, Saccharomyces cerevisiae, accumulates the storage polysaccharide glycogen in response to nutrient limitation. Glycogen synthase, the major form of which is encoded by the GSY2 gene, catalyzes the key regulated step in glycogen storage. Here, we utilize Gsy2p fusions to green fluorescent protein (GFP) to determine where glycogen synthase is located within cells. We demonstrate that the localization pattern of Gsy2-GFP depends upon the glycogen content of the cell. When glyco...
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
International Nuclear Information System (INIS)
Dotson, G.D.; Woodard, R.W.
1994-01-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3 2 H)PEP, (2- 13 C)PEP, and (2- 13 C, 18 O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our 1 H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3- 2 H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3- 2 H)PEP gave predominantly (3S)-(3 2 H)KDO 8-P and (E)-(3- 2 H)PEP gave predominantly (3R)-(3 2 H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2- 13 C, 18 O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both 13 C- and 31 P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the 18 O
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
Energy Technology Data Exchange (ETDEWEB)
Dotson, G.D.; Woodard, R.W. [Univ. of Michigan, Ann Arbor, MI (United States)
1994-12-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.
El-Garhy, Hoda A S; Khattab, Salah; Moustafa, Mahmoud M A; Abou Ali, Rania; Abdel Azeiz, Ahmed Z; Elhalwagi, Abeer; El Sherif, Fadia
2016-11-01
Silymarin, a Silybum marianum seed extract containing a mixture of flavonolignans including silybin, is being used as an antihepatotoxic therapy for liver diseases. In this study, the enhancing effect of gamma irradiation on plant growth parameters of S. marianum under salt stress was investigated. The effect of gamma irradiation, either as a single elicitor or coupled with salinity, on chalcone synthase (CHS) gene expression and silybin A + B yield was also evaluated. The silybin A + B content in S. marianum fruits was estimated by liquid chromatography-mass spectrometry (LC-MS/MS). An increase in silybin content was accompanied by up-regulation of the CHS1, CHS2 and CHS3 genes, which are involved in the silybin biosynthetic pathway. The highest silybin A + B production (0.77 g/100 g plant DW) and transcript levels of the three studied genes (100.2-, 91.9-, and 24.3-fold increase, respectively) were obtained with 100GY gamma irradiation and 4000 ppm salty water. The CHS2 and CHS3 genes were partially sequenced and submitted to the NCBI database under the accession numbers KT252908.1 and KT252909.1, respectively. Developing new approaches to stimulate silybin biosynthetic pathways could be a useful tool to potentiate the use of plants as renewable resources of medicinal compounds. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Arabidopsis CDS blastp result: AK242585 [KOME
Lifescience Database Archive (English)
Full Text Available AK242585 J090010M20 At3g03050.1 68416.m00301 cellulose synthase family protein (CslD3) similar to cellulose... synthase catalytic subunit gi:2827143 from [Arabidopsis thaliana], cellulose syntha
Arabidopsis CDS blastp result: AK242601 [KOME
Lifescience Database Archive (English)
Full Text Available AK242601 J090014G03 At3g03050.1 68416.m00301 cellulose synthase family protein (CslD3) similar to cellulose... synthase catalytic subunit gi:2827143 from [Arabidopsis thaliana], cellulose syntha
Arabidopsis CDS blastp result: AK242890 [KOME
Lifescience Database Archive (English)
Full Text Available AK242890 J090079L19 At3g03050.1 68416.m00301 cellulose synthase family protein (CslD3) similar to cellulose... synthase catalytic subunit gi:2827143 from [Arabidopsis thaliana], cellulose syntha
Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J
2013-12-05
The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.
of endothelial nitric oxide synthase gene and serum level of vascular ...
African Journals Online (AJOL)
uwerhiavwe
Davignon and Ganz, 2004). NO is synthe- sized via a reaction that includes the conversion of L- arginine to L-citruline catalyzed by endothelial nitric oxide synthase (eNOS), which is one of the three isoforms of the enzyme (Mayer and Hemmens, 1997) ...
Factors influencing gene silencing of granule-bound starch synthase in potato
Heilersig, H.J.B.
2005-01-01
In the past, antisense RNA technology was used to modify the composition of potato tuber starch. Potato starch comprises amylose and amylopectin, polymers of glucose. Amylose production in potato is completely dependent on the presence of granule-bound starch synthase I (GBSSI). Inhibition of GBSSI
Aspergillus oryzae-based cell factory for direct kojic acid production from cellulose.
Yamada, Ryosuke; Yoshie, Toshihide; Wakai, Satoshi; Asai-Nakashima, Nanami; Okazaki, Fumiyoshi; Ogino, Chiaki; Hisada, Hiromoto; Tsutsumi, Hiroko; Hata, Yoji; Kondo, Akihiko
2014-05-18
Kojic acid (5-Hydroxy-2-(hydroxymethyl)-4-pyrone) is one of the major secondary metabolites in Aspergillus oryzae. It is widely used in food, pharmaceuticals, and cosmetics. The production cost, however, is too high for its use in many applications. Thus, an efficient and cost-effective kojic acid production process would be valuable. However, little is known about the complete set of genes for kojic acid production. Currently, kojic acid is produced from glucose. The efficient production of kojic acid using cellulose as an inexpensive substrate would help establish cost-effective kojic acid production. A kojic acid transcription factor gene over-expressing the A. oryzae strain was constructed. Three genes related to kojic acid production in this strain were transcribed in higher amounts than those found in the wild-type strain. This strain produced 26.4 g/L kojic acid from 80 g/L glucose. Furthermore, this strain was transformed with plasmid harboring 3 cellulase genes. The resultant A. oryzae strain successfully produced 0.18 g/L of kojic acid in 6 days of fermentation from the phosphoric acid swollen cellulose. Kojic acid was produced directly from cellulose material using genetically engineered A. oryzae. Because A. oryzae has efficient protein secretion ability and secondary metabolite productivity, an A. oryzae-based cell factory could be a platform for the production of various kinds of bio-based chemicals.
myo-Inositol-1-phosphate synthase is required for polar auxin transport and organ development
Chen, Hao
2010-06-01
myo-Inositol-1-phosphate synthase is a conserved enzyme that catalyzes the first committed and rate-limiting step in inositol biosynthesis. Despite its wide occurrence in all eukaryotes, the role of myo-inositol-1-phosphate synthase and de novo inositol biosynthesis in cell signaling and organism development has been unclear. In this study, we isolated loss-of-function mutants in the Arabidopsis MIPS1 gene from different ecotypes. It was found that all mips1 mutants are defective in embryogenesis, cotyledon venation patterning, root growth, and root cap development. The mutant roots are also agravitropic and have reduced basipetal auxin transport. mips1 mutants have significantly reduced levels of major phosphatidylinositols and exhibit much slower rates of endocytosis. Treatment with brefeldin A induces slower PIN2 protein aggregation in mips1, indicating altered PIN2 trafficking. Our results demonstrate that MIPS1 is critical for maintaining phosphatidylinositol levels and affects pattern formation in plants likely through regulation of auxin distribution. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.
Salman-Minkov, Ayelet; Levi, Amnon; Wolf, Shmuel; Trebitsh, Tova
2008-05-01
The flowering pattern of watermelon species (Citrullus spp.) is either monoecious or andromonoecious. Ethylene is known to play a critical role in floral sex determination of cucurbit species. In contrast to its feminizing effect in cucumber and melon, in watermelon ethylene promotes male flower development. In cucumber, the rate-limiting enzyme of ethylene biosynthesis, 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS), regulates unisexual flower development. To investigate the role of ethylene in flower development, we isolated four genomic sequences of ACS from watermelon (CitACS1-4). Both CitACS1 and CitACS3 are expressed in floral tissue. CitACS1 is also expressed in vegetative tissue and it may be involved in cell growth processes. Expression of CitACS1 is up-regulated by exogenous treatment with auxin, gibberellin or ACC, the immediate precursor of ethylene. No discernible differential floral sex-dependent expression pattern was observed for this gene. The CitACS3 gene is expressed in open flowers and in young staminate floral buds (male or hermaphrodite), but not in female flowers. CitACS3 is also up-regulated by ACC, and is likely to be involved in ethylene-regulated anther development. The expression of CitACS2 was not detected in vegetative or reproductive organs but was up-regulated by auxin. CitACS4 transcript was not detected under our experimental conditions. Restriction fragment length polymorphism (RFLP) and sequence tagged site (STS) marker analyses of the CitACS genes showed polymorphism among and within the different Citrullus groups, including watermelon cultivars, Citrullus lanatus var. lanatus, the central subspecies Citrullus lanatus var. citroides, and the desert species Citrullus colocynthis (L).
Structure of native cellulose microfibrils, the starting point for nanocellulose manufacture
Jarvis, Michael C.
2017-12-01
There is an emerging consensus that higher plants synthesize cellulose microfibrils that initially comprise 18 chains. However, the mean number of chains per microfibril in situ is usually greater than 18, sometimes much greater. Microfibrils from woody tissues of conifers, grasses and dicotyledonous plants, and from organs like cotton hairs, all differ in detailed structure and mean diameter. Diameters increase further when aggregated microfibrils are isolated. Because surface chains differ, the tensile properties of the cellulose may be augmented by increasing microfibril diameter. Association of microfibrils with anionic polysaccharides in primary cell walls and mucilages leads to in vivo mechanisms of disaggregation that may be relevant to the preparation of nanofibrillar cellulose products. For the preparation of nanocrystalline celluloses, the key issue is the nature and axial spacing of disordered domains at which axial scission can be initiated. These disordered domains do not, as has often been suggested, take the form of large blocks occupying much of the length of the microfibril. They are more likely to be located at chain ends or at places where the microfibril has been mechanically damaged, but their structure and the reasons for their sensitivity to acid hydrolysis need better characterization. This article is part of a discussion meeting issue `New horizons for cellulose nanotechnology'.
Directory of Open Access Journals (Sweden)
Maiko Furubayashi
Full Text Available Terpene synthases catalyze the formation of a variety of terpene chemical structures. Systematic mutagenesis studies have been effective in providing insights into the characteristic and complex mechanisms of C-C bond formations and in exploring the enzymatic potential for inventing new chemical structures. In addition, there is growing demand to increase terpene synthase activity in heterologous hosts, given the maturation of metabolic engineering and host breeding for terpenoid synthesis. We have developed a simple screening method for the cellular activities of terpene synthases by scoring their substrate consumption based on the color loss of the cell harboring carotenoid pathways. We demonstrate that this method can be used to detect activities of various terpene synthase or prenyltransferase genes in a high-throughput manner, irrespective of the product type, enabling the mutation analysis and directed evolution of terpene synthases. We also report the possibility for substrate-specific screening system of terpene synthases by taking advantage of the substrate-size specificity of C30 and C40 carotenoid pathways.
González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2016-02-01
Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.
Inokuma, H; Brouqui, P; Drancourt, M; Raoult, D
2001-09-01
The sequence of the citrate synthase gene (gltA) of 13 ehrlichial species (Ehrlichia chaffeensis, Ehrlichia canis, Ehrlichia muris, an Ehrlichia species recently detected from Ixodes ovatus, Cowdria ruminantium, Ehrlichia phagocytophila, Ehrlichia equi, the human granulocytic ehrlichiosis [HGE] agent, Anaplasma marginale, Anaplasma centrale, Ehrlichia sennetsu, Ehrlichia risticii, and Neorickettsia helminthoeca) have been determined by degenerate PCR and the Genome Walker method. The ehrlichial gltA genes are 1,197 bp (E. sennetsu and E. risticii) to 1,254 bp (A. marginale and A. centrale) long, and GC contents of the gene vary from 30.5% (Ehrlichia sp. detected from I. ovatus) to 51.0% (A. centrale). The percent identities of the gltA nucleotide sequences among ehrlichial species were 49.7% (E. risticii versus A. centrale) to 99.8% (HGE agent versus E. equi). The percent identities of deduced amino acid sequences were 44.4% (E. sennetsu versus E. muris) to 99.5% (HGE agent versus E. equi), whereas the homology range of 16S rRNA genes was 83.5% (E. risticii versus the Ehrlichia sp. detected from I. ovatus) to 99.9% (HGE agent, E. equi, and E. phagocytophila). The architecture of the phylogenetic trees constructed by gltA nucleotide sequences or amino acid sequences was similar to that derived from the 16S rRNA gene sequences but showed more-significant bootstrap values. Based upon the alignment analysis of the ehrlichial gltA sequences, two sets of primers were designed to amplify tick-borne Ehrlichia and Neorickettsia genogroup Ehrlichia (N. helminthoeca, E. sennetsu, and E. risticii), respectively. Tick-borne Ehrlichia species were specifically identified by restriction fragment length polymorphism (RFLP) patterns of AcsI and XhoI with the exception of E. muris and the very closely related ehrlichia derived from I. ovatus for which sequence analysis of the PCR product is needed. Similarly, Neorickettsia genogroup Ehrlichia species were specifically identified by
International Nuclear Information System (INIS)
Sá-Moura, Bebiana; Albuquerque, Luciana; Empadinhas, Nuno; Costa, Milton S. da; Pereira, Pedro José Barbosa; Macedo-Ribeiro, Sandra
2008-01-01
The enzyme mannosyl-3-phosphoglycerate synthase from R. xylanophilus has been expressed, purified and crystallized. The crystals belong to the hexagonal space group P6 5 22 and diffract to 2.2 Å resolution. Rubrobacter xylanophilus is the only Gram-positive bacterium known to synthesize the compatible solute mannosylglycerate (MG), which is commonly found in hyperthermophilic archaea and some thermophilic bacteria. Unlike the salt-dependent pattern of accumulation observed in (hyper)thermophiles, in R. xylanophilus MG accumulates constitutively. The synthesis of MG in R. xylanophilus was tracked from GDP-mannose and 3-phosphoglycerate, but the genome sequence of the organism failed to reveal any of the genes known to be involved in this pathway. The native enzyme was purified and its N-terminal sequence was used to identify the corresponding gene (mpgS) in the genome of R. xylanophilus. The gene encodes a highly divergent mannosyl-3-phosphoglycerate synthase (MpgS) without relevant sequence homology to known mannosylphosphoglycerate synthases. In order to understand the specificity and enzymatic mechanism of this novel enzyme, it was expressed in Escherichia coli, purified and crystallized. The crystals thus obtained belonged to the hexagonal space group P6 5 22 and contained two protein molecules per asymmetric unit. The structure was solved by SIRAS using a mercury derivative
The cellulose resource matrix.
Keijsers, Edwin R P; Yılmaz, Gülden; van Dam, Jan E G
2013-03-01
The emerging biobased economy is causing shifts from mineral fossil oil based resources towards renewable resources. Because of market mechanisms, current and new industries utilising renewable commodities, will attempt to secure their supply of resources. Cellulose is among these commodities, where large scale competition can be expected and already is observed for the traditional industries such as the paper industry. Cellulose and lignocellulosic raw materials (like wood and non-wood fibre crops) are being utilised in many industrial sectors. Due to the initiated transition towards biobased economy, these raw materials are intensively investigated also for new applications such as 2nd generation biofuels and 'green' chemicals and materials production (Clark, 2007; Lange, 2007; Petrus & Noordermeer, 2006; Ragauskas et al., 2006; Regalbuto, 2009). As lignocellulosic raw materials are available in variable quantities and qualities, unnecessary competition can be avoided via the choice of suitable raw materials for a target application. For example, utilisation of cellulose as carbohydrate source for ethanol production (Kabir Kazi et al., 2010) avoids the discussed competition with easier digestible carbohydrates (sugars, starch) deprived from the food supply chain. Also for cellulose use as a biopolymer several different competing markets can be distinguished. It is clear that these applications and markets will be influenced by large volume shifts. The world will have to reckon with the increase of competition and feedstock shortage (land use/biodiversity) (van Dam, de Klerk-Engels, Struik, & Rabbinge, 2005). It is of interest - in the context of sustainable development of the bioeconomy - to categorize the already available and emerging lignocellulosic resources in a matrix structure. When composing such "cellulose resource matrix" attention should be given to the quality aspects as well as to the available quantities and practical possibilities of processing the
Macromolecular organization of xyloglucan and cellulose in pea epicotyls
International Nuclear Information System (INIS)
Hayashi, T.; Maclachlan, G.
1984-01-01
Xyloglucan is known to occur widely in the primary cell walls of higher plants. This polysaccharide in most dicots possesses a cellulose-like main chain with three of every four consecutive residues substituted with xylose and minor addition of other sugars. Xyloglucan and cellulose metabolism is regulated by different processes; since different enzyme systems are probably required for the synthesis of their 1,4-β-linkages. A macromolecular complex composed of xyloglucan and cellulose only was obtained from elongating regions of etiolated pea stems. It was examined by light microscopy using iodine staining, by radioautography after labeling with [ 3 H]fructose, by fluorescence microscopy using a fluorescein-lectin (fructose-binding) as probe, and by electron microscopy after shadowing. The techniques all demonstrated that the macromolecule was present in files of cell shapes, referred to here as cell-wall ghosts, in which xyloglucan was localized both on and between the cellulose microfibrils
Directory of Open Access Journals (Sweden)
Roman eGangl
2015-09-01
Full Text Available Stachyose is among the raffinose family oligosaccharides one of the major water-soluble carbohydrates next to sucrose in seeds of a number of plant species. Especially in leguminous seeds, e.g. chickpea, stachyose is reported as the major component. In contrast to their ambiguous potential as essential source of carbon for germination, raffinose family oligosaccharides are indigestible for humans and can contribute to diverse abdominal disorders.In the genome of Arabidopsis thaliana, six putative raffinose synthase genes are reported, whereas little is known about these putative raffinose synthases and their biochemical characteristics or their contribution to the raffinose family oligosaccharide physiology in A. thaliana.In this paper, we report on the molecular cloning, functional expression in Escherichia coli and purification of recombinant AtRS4 from A. thaliana and the biochemical characterisation of the putative stachyose synthase (AtSTS, At4g01970 as a raffinose and high affinity stachyose synthase (Km for raffinose 259.2 ± 21.15 µM as well as stachyose and galactinol specific galactosylhydrolase. A T-DNA insertional mutant in the AtRS4 gene was isolated. Only sqPCR from WT siliques showed a specific transcriptional AtRS4 PCR product. Metabolite measurements in seeds of ΔAtRS4 mutant plants revealed a total loss of stachyose in ΔAtRS4 mutant seeds. We conclude that AtRS4 is the only stachyose synthase in the genome of A. thaliana that AtRS4 represents a key regulation mechanism in the raffinose family oligosaccharide physiology of A. thaliana due to its multifunctional enzyme activity and that AtRS4 is possibly the second seed specific raffinose synthase beside AtRS5, which is responsible for Raf-accumulation under abiotic stress.
Monoterpene synthases from common sage (Salvia officinalis)
Energy Technology Data Exchange (ETDEWEB)
Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)
1999-01-01
cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.
Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko
2012-07-15
Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.
Yin, Jun-Lin; Wong, Woon-Seng; Jang, In-Cheol; Chua, Nam-Hai
2017-02-01
Monoterpenes are important for plant survival and useful to humans. In addition to their function in plant defense, monoterpenes are also used as flavors, fragrances and medicines. Several metabolic engineering strategies have been explored to produce monoterpene in tobacco but only trace amounts of monoterpenes have been detected. We investigated the effects of Solanum lycopersicum 1-deoxy-d-xylulose-5-phosphate synthase (SlDXS), Arabidopsis thaliana geranyl diphosphate synthase 1 (AtGPS) and Mentha × piperita geranyl diphosphate synthase small subunit (MpGPS.SSU) on production of monoterpene and geranylgeranyl diphosphate (GGPP) diversities, and plant morphology by transient expression in Nicotiana benthamiana and overexpression in transgenic Nicotiana tabacum. We showed that MpGPS.SSU could enhance the production of various monoterpenes such as (-)-limonene, (-)-linalool, (-)-α-pinene/β-pinene or myrcene, in transgenic tobacco by elevating geranyl diphosphate synthase (GPS) activity. In addition, overexpression of MpGPS.SSU in tobacco caused early flowering phenotype and increased shoot branching by elevating contents of GA 3 and cytokinins due to upregulated transcript levels of several plastidic 2-C-methyl-d-erythritol-4-phosphate (MEP) pathway genes, geranylgeranyl diphosphate synthases 3 (GGPPS3) and GGPPS4. Our method would allow the identification of new monoterpene synthase genes using transient expression in N. benthamiana and the improvement of monoterpene production in transgenic tobacco plants. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Directory of Open Access Journals (Sweden)
Chukwuemeka P. Azubuike
2012-09-01
Full Text Available α-Cellulose and microcrystalline cellulose powders, derived from agricultural waste products, that have for the pharmaceutical industry, desirable physical (flow properties were investigated. α–Cellulose (GCN was extracted from groundnut shell (an agricultural waste product using a non-dissolving method based on inorganic reagents. Modification of this α -cellulose was carried out by partially hydrolysing it with 2N hydrochloric acid under reflux to obtain microcrystalline cellulose (MCGN. The physical, spectroscopic and thermal properties of the derived α-cellulose and microcrystalline cellulose powders were compared with Avicel® PH 101, a commercial brand of microcrystalline cellulose (MCCA, using standard methods. X-ray diffraction and infrared spectroscopy analysis showed that the α-cellulose had lower crystallinity. This suggested that treatment with 2N hydrochloric acid led to an increase in the crystallinity index. Thermogravimetric analysis showed quite similar thermal behavior for all cellulose samples, although the α-cellulose had a somewhat lower stability. A comparison of the physical properties between the microcrystalline celluloses and the α-cellulose suggests that microcrystalline cellulose (MCGN and MCCA might have better flow properties. In almost all cases, MCGN and MCCA had similar characteristics. Since groundnut shells are agricultural waste products, its utilization as a source of microcrystalline cellulose might be a good low-cost alternative to the more expensive commercial brand.
Alencar, Valquíria Campos; Jabes, Daniela Leite; Menegidio, Fabiano Bezerra; Sassaki, Guilherme Lanzi; de Souza, Lucas Rodrigo; Puzer, Luciano; Meneghetti, Maria Cecília Zorél; Lima, Marcelo Andrade; Tersariol, Ivarne Luis Dos Santos; de Oliveira, Regina Costa; Nunes, Luiz R
2017-02-07
Xylella fastidiosa is a plant-infecting bacillus, responsible for many important crop diseases, such as Pierce's disease of vineyards, citrus variegated chlorosis, and coffee leaf scorch (CLS), among others. Recent genomic comparisons involving two CLS-related strains, belonging to X. fastidiosa subsp. pauca, revealed that one of them carries a frameshift mutation that inactivates a gene encoding an oxidoreductase of the short-chain dehydrogenase/reductase (SDR) superfamily, which may play important roles in determining structural variations in bacterial glycans and glycoconjugates. However, the exact nature of this SDR has been a matter of controversy, as different annotations of X. fastidiosa genomes have implicated it in distinct reactions. To confirm the nature of this mutated SDR, a comparative analysis was initially performed, suggesting that it belongs to a subgroup of SDR decarboxylases, representing a UDP-xylose synthase (Uxs). Functional assays, using a recombinant derivative of this enzyme, confirmed its nature as XfUxs, and carbohydrate composition analyses, performed with lipopolysaccharide (LPS) molecules obtained from different strains, indicate that inactivation of the X. fastidiosa uxs gene affects the LPS structure among CLS-related X. fastidiosa strains. Finally, a comparative sequence analysis suggests that this mutation is likely to result in a morphological and evolutionary hallmark that differentiates two subgroups of CLS-related strains, which may influence interactions between these bacteria and their plant and/or insect hosts.
Kojima, N; Sitthithaworn, W; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Sankaw, U
2000-07-01
cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene producing plants, Scoparia dulcis and Croton sublyratus, were isolated using the homology-based polymerase chain reaction method. Both cloned genes showed high amino acid sequence homology (60-70%) to other plant GGPPSs and contained highly conserved aspartate-rich motifs. The obtained clones were functionally expressed in Escherichia coli and showed sufficient GGPPS activity to catalyze the condensation of farnesyl diphosphate (FPP) and isopentenyl diphosphate to form geranylgeranyl diphosphate. To investigate the factor determining the product chain length of plant GGPPSs, S. dulcis GGPPS mutants in which either the small amino acids at the fourth and fifth positions before the first aspartate-rich motif (FARM) were replaced with aromatic amino acids or in which two additional amino acids in FARM were deleted were constructed. Both mutants behaved like FPPS-like enzymes and almost exclusively produced FPP when dimethylallyl diphosphate was used as a primer substrate, and failed to accept FPP as a primer substrate. These results indicate that both small amino acids at the fourth and fifth positions before FARM and the amino acid insertion in FARM play essential roles in product length determination in plant GGPPSs.
Liang, Jing; Han, Qian; Ding, Haizhen; Li, Jianyong
2017-12-01
In available insect genomes, there are several L-3,4-dihydroxyphenylalanine (L-dopa) decarboxylase (DDC)-like or aromatic amino acid decarboxylase (AAAD) sequences. This contrasts to those of mammals whose genomes contain only one DDC. Our previous experiments established that two DDC-like proteins from Drosophila actually mediate a complicated decarboxylation-oxidative deamination process of dopa in the presence of oxygen, leading to the formation of 3,4-dihydroxyphenylacetaldehyde (DHPA), CO 2 , NH 3, and H 2 O 2 . This contrasts to the typical DDC-catalyzed reaction, which produces CO 2 and dopamine. These DDC-like proteins were arbitrarily named DHPA synthases based on their critical role in insect soft cuticle formation. Establishment of reactions catalyzed by these AAAD-like proteins solved a puzzle that perplexed researchers for years, but to tell a true DHPA synthase from a DDC in the insect AAAD family remains problematic due to high sequence similarity. In this study, we performed extensive structural and biochemical comparisons between DHPA synthase and DDC. These comparisons identified several target residues potentially dictating DDC-catalyzed and DHPA synthase-catalyzed reactions, respectively. Comparison of DHPA synthase homology models with crystal structures of typical DDC proteins, particularly residues in the active sites, provided further insights for the roles these identified target residues play. Subsequent site-directed mutagenesis of the tentative target residues and activity evaluations of their corresponding mutants determined that active site His192 and Asn192 are essential signature residues for DDC- and DHPA synthase-catalyzed reactions, respectively. Oxygen is required in DHPA synthase-mediated process and this oxidizing agent is reduced to H 2 O 2 in the process. Biochemical assessment established that H 2 O 2 , formed in DHPA synthase-mediated process, can be reused as oxidizing agent and this active oxygen species is reduced to H 2
Isik, Mehmet; Sardon, Haritz; Mecerreyes, David
2014-01-01
Due to its abundance and a wide range of beneficial physical and chemical properties, cellulose has become very popular in order to produce materials for various applications. This review summarizes the recent advances in the development of new cellulose materials and technologies using ionic liquids. Dissolution of cellulose in ionic liquids has been used to develop new processing technologies, cellulose functionalization methods and new cellulose materials including blends, composites, fibers and ion gels. PMID:25000264
International Nuclear Information System (INIS)
Chaurasia, Neha; Mishra, Yogesh; Rai, Lal Chand
2008-01-01
Phytochelatin synthase (PCS) is involved in the synthesis of phytochelatins (PCs), plays role in heavy metal detoxification. The present study describes for first time the functional expression and characterization of pcs gene of Anabaena sp. PCC 7120 in Escherichia coli in terms of offering protection against heat, salt, carbofuron (pesticide), cadmium, copper, and UV-B stress. The involvement of pcs gene in tolerance to above abiotic stresses was investigated by cloning of pcs gene in expression vector pGEX-5X-2 and its transformation in E. coli BL21 (DE3). The E. coli cells transformed with pGEX-5X-pcs showed better growth than control cells (pGEX-5X-2) under temperature (47 deg. C), NaCl (6% w/v), carbofuron (0.025 mg ml -1 ), CdCl 2 (4 mM), CuCl 2 (1 mM), and UV-B (10 min) exposure. The enhanced expression of pcs gene revealed by RT-PCR analysis under above stresses at different time intervals further advocates its role in tolerance against above abiotic stresses
Li, Huige; Xia, Ning; Brausch, Isolde; Yao, Ying; Förstermann, Ulrich
2004-09-01
Nitric oxide (NO) produced by endothelial nitric-oxide synthase (eNOS) represents an antithrombotic and anti-atherosclerotic principle in the vasculature. Hence, an enhanced expression of eNOS in response to pharmacological interventions could provide protection against cardiovascular diseases. In EA.hy 926 cells, a cell line derived from human umbilical vein endothelial cells (HUVECs), an artichoke leaf extract (ALE) increased the activity of the human eNOS promoter (determined by luciferase reporter gene assay). An organic subfraction from ALE was more potent in this respect than the crude extract, whereas an aqueous subfraction of ALE was without effect. ALE and the organic subfraction thereof also increased eNOS mRNA expression (measured by an RNase protection assay) and eNOS protein expression (determined by Western blot) both in EA.hy 926 cells and in native HUVECs. NO production (measured by NO-ozone chemiluminescence) was increased by both extracts. In organ chamber experiments, ex vivo incubation (18 h) of rat aortic rings with the organic subfraction of ALE enhanced the NO-mediated vasodilator response to acetylcholine, indicating that the up-regulated eNOS remained functional. Caffeoylquinic acids and flavonoids are two major groups of constituents of ALE. Interestingly, the flavonoids luteolin and cynaroside increased eNOS promoter activity and eNOS mRNA expression, whereas the caffeoylquinic acids cynarin and chlorogenic acid were without effect. Thus, in addition to the lipid-lowering and antioxidant properties of artichoke, an increase in eNOS gene transcription may also contribute to its beneficial cardiovascular profile. Artichoke flavonoids are likely to represent the active ingredients mediating eNOS up-regulation.
Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R
1994-01-01
We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E...
Electrically conductive cellulose composite
Evans, Barbara R.; O'Neill, Hugh M.; Woodward, Jonathan
2010-05-04
An electrically conductive cellulose composite includes a cellulose matrix and an electrically conductive carbonaceous material incorporated into the cellulose matrix. The electrical conductivity of the cellulose composite is at least 10 .mu.S/cm at 25.degree. C. The composite can be made by incorporating the electrically conductive carbonaceous material into a culture medium with a cellulose-producing organism, such as Gluconoacetobacter hansenii. The composites can be used to form electrodes, such as for use in membrane electrode assemblies for fuel cells.
DEFF Research Database (Denmark)
Kadziola, Anders; Jepsen, Clemens H; Johansson, Eva
2005-01-01
The prs gene encoding phosphoribosyl diphosphate (PRPP) synthase of the hyperthermophilic autotrophic methanogenic archaeon Methanocaldococcus jannaschii has been cloned and expressed in Escherichia coli. Subsequently, M.jannaschii PRPP synthase has been purified, characterised, crystallised, and...
Directory of Open Access Journals (Sweden)
Mehmet Isik
2014-07-01
Full Text Available Due to its abundance and a wide range of beneficial physical and chemical properties, cellulose has become very popular in order to produce materials for various applications. This review summarizes the recent advances in the development of new cellulose materials and technologies using ionic liquids. Dissolution of cellulose in ionic liquids has been used to develop new processing technologies, cellulose functionalization methods and new cellulose materials including blends, composites, fibers and ion gels.
Lynch, Michael; Manly, Jody Todd; Cicchetti, Dante
2015-11-01
Physiological response to stress has been linked to a variety of healthy and pathological conditions. The current study conducted a multilevel examination of interactions among environmental toxins (i.e., neighborhood crime and child maltreatment) and specific genetic polymorphisms of the endothelial nitric oxide synthase gene (eNOS) and GABA(A) receptor subunit alpha-6 gene (GABRA6). One hundred eighty-six children were recruited at age 4. The presence or absence of child maltreatment as well as the amount of crime that occurred in their neighborhood during the previous year were determined at that time. At age 9, the children were brought to the lab, where their physiological response to a cognitive challenge (i.e., change in the amplitude of the respiratory sinus arrhythmia) was assessed and DNA samples were collected for subsequent genotyping. The results confirmed that complex Gene × Gene, Environment × Environment, and Gene × Environment interactions were associated with different patterns of respiratory sinus arrhythmia reactivity. The implications for future research and evidence-based intervention are discussed.
Schmiderer, Corinna; Grausgruber-Gröger, Sabine; Grassi, Paolo; Steinborn, Ralf; Novak, Johannes
2010-07-01
Common sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants, with antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, composed mainly of the monoterpenes 1,8-cineole, alpha-thujone, beta-thujone and camphor, is responsible for some of these effects. Gibberellins regulate diverse physiological processes in plants, such as seed germination, shoot elongation and cell division. In this study, we analyzed the effect of exogenously applied plant growth regulators, namely gibberellic acid (GA(3)) and daminozide, on leaf morphology and essential oil formation of two leaf stages during the period of leaf expansion. Essential oil content increased with increasing levels of gibberellins and decreased when gibberellin biosynthesis was blocked with daminozide. With increasing levels of gibberellins, 1,8-cineole and camphor contents increased. Daminozide blocked the accumulation of alpha- and beta-thujone. GA(3) at the highest level applied also led to a significant decrease of alpha- and beta-thujone. Monoterpene synthases are a class of enzymes responsible for the first step in monoterpene biosynthesis, competing for the same substrate geranylpyrophosphate. The levels of gene expression of the three most important monoterpene synthases in sage were investigated, 1,8-cineole synthase leading directly to 1,8-cineole, (+)-sabinene synthase responsible for the first step in the formation of alpha- and beta-thujone, and (+)-bornyl diphosphate synthase, the first step in camphor biosynthesis. The foliar application of GA(3) increased, while daminozide significantly decreased gene expression of the monoterpene synthases. The amounts of two of the end products, 1,8-cineole and camphor, were directly correlated with the levels of gene expression of the respective monoterpene synthases, indicating transcriptional control, while the formation of alpha- and beta
Contribution of granule bound starch synthase in kernel modification ...
African Journals Online (AJOL)
The role of gbssI and gbssII genes, encoding granule bound starch synthase enzyme I and II, respectively, in quality protein maize (QPM) were studied at different days after pollination (DAP). Total RNA was used for first strand cDNA synthesis using the ImpromIISriptTM reverse transcriptase. No detectable levels of gbssI ...
Oberding, Lisa K; Gieg, Lisa M
2018-01-01
Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important
Polyketide synthases from poison hemlock (Conium maculatum L.).
Hotti, Hannu; Seppänen-Laakso, Tuulikki; Arvas, Mikko; Teeri, Teemu H; Rischer, Heiko
2015-11-01
Coniine is a toxic alkaloid, the biosynthesis of which is not well understood. A possible route, supported by evidence from labelling experiments, involves a polyketide formed by the condensation of one acetyl-CoA and three malonyl-CoAs catalysed by a polyketide synthase (PKS). We isolated PKS genes or their fragments from poison hemlock (Conium maculatum L.) by using random amplification of cDNA ends (RACE) and transcriptome analysis, and characterized three full-length enzymes by feeding different starter-CoAs in vitro. On the basis of our in vitro experiments, two of the three characterized PKS genes in poison hemlock encode chalcone synthases (CPKS1 and CPKS2), and one encodes a novel type of PKS (CPKS5). We show that CPKS5 kinetically favours butyryl-CoA as a starter-CoA in vitro. Our results suggest that CPKS5 is responsible for the initiation of coniine biosynthesis by catalysing the synthesis of the carbon backbone from one butyryl-CoA and two malonyl-CoAs. © 2015 FEBS.
Directory of Open Access Journals (Sweden)
M. A. Slugina
2016-01-01
Full Text Available The potato is one of the main strategic crops in the Russian Federation, Belarus and Kazakhstan. Currently, we have achieved significant advances in the understanding of metabolic mechanism of carbohydrate and interconversion «sucrose – starch» in potato tubers. Sucrose synthase (Sus is a key enzyme in the breakdown of sucrose. Sucrose synthase (Sus is catalyzing a reversible reaction of conversion sucrose and UDP into fructose and UDP-glucose. The identification and subsequent characterization of the genes encoding plant sucrose synthase is the first step towards understanding their physiological roles and metabolic mechanism involved in carbohydrate accumulation in potato tubers. In the present work the nucleotide and amino acid polymorphism of the Sus4 gene fragments containing sequences of the sucrose synthase domain were analyzed. Sus4 gene fragments (intron III – exon VI in 9 potato cultivars of Russian, Kazakh and Belarusian breeding were analyzed. The polymorphism of the Sus4 sucrose synthase domain sequences was first examined. The length of analyzed fragment varied from 977 b.p. (cultivars Favorit, Karasaiskii, Miras to 1013 b.p. (cultivars Zorochka, Manifest, Elisaveta, Bashkirskii. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions. The common polymorphism level was 5.82%. It was shown that the examined sequences contained 58 SNPs and 4 indels. The most variable were introns IV (12.4% and V (9.18%. The most variable was exon IV. 7 allelic variants were detected. 6 different amino acid sequences specific to different varieties were also identified.
Köllner, Tobias G; Schnee, Christiane; Gershenzon, Jonathan; Degenhardt, Jörg
2004-05-01
The mature leaves and husks of Zea mays release a complex blend of terpene volatiles after anthesis consisting predominantly of bisabolane-, sesquithujane-, and bergamotane-type sesquiterpenes. The varieties B73 and Delprim release the same volatile constituents but in significantly different proportions. To study the molecular genetic and biochemical mechanisms controlling terpene diversity and distribution in these varieties, we isolated the closely related terpene synthase genes terpene synthase4 (tps4) and tps5 from both varieties. The encoded enzymes, TPS4 and TPS5, each formed the same complex mixture of sesquiterpenes from the precursor farnesyl diphosphate but with different proportions of products. These mixtures correspond to the sesquiterpene blends observed in the varieties B73 and Delprim, respectively. The differences in the stereoselectivity of TPS4 and TPS5 are determined by four amino acid substitutions with the most important being a Gly instead of an Ala residue at position 409 at the catalytic site of the enzyme. Although both varieties contain tps4 and tps5 alleles, their differences in terpene composition result from the fact that B73 has only a single functional allele of tps4 and no functional alleles of tps5, whereas Delprim has only a functional allele of tps5 and no functional alleles of tps4. Lack of functionality was shown to be attributable to frame-shift mutations or amino acid substitutions that greatly reduce the activity of their encoded proteins. Therefore, the diversity of sesquiterpenes in these two maize cultivars is strongly influenced by single nucleotide changes in the alleles of two terpene synthase genes.
Energy Technology Data Exchange (ETDEWEB)
Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail: ozapata@mda.cinvestav.mx
2007-08-01
To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.
Prasad, B. C. Narasimha; Kumar, Vinod; Gururaj, H. B.; Parimalan, R.; Giridhar, P.; Ravishankar, G. A.
2006-01-01
Capsaicin is a unique alkaloid of the plant kingdom restricted to the genus Capsicum. Capsaicin is the pungency factor, a bioactive molecule of food and of medicinal importance. Capsaicin is useful as a counterirritant, antiarthritic, analgesic, antioxidant, and anticancer agent. Capsaicin biosynthesis involves condensation of vanillylamine and 8-methyl nonenoic acid, brought about by capsaicin synthase (CS). We found that CS activity correlated with genotype-specific capsaicin levels. We purified and characterized CS (≈35 kDa). Immunolocalization studies confirmed that CS is specifically localized to the placental tissues of Capsicum fruits. Western blot analysis revealed concomitant enhancement of CS levels and capsaicin accumulation during fruit development. We determined the N-terminal amino acid sequence of purified CS, cloned the CS gene (csy1) and sequenced full-length cDNA (981 bp). The deduced amino acid sequence of CS from full-length cDNA was 38 kDa. Functionality of csy1 through heterologous expression in recombinant Escherichia coli was also demonstrated. Here we report the gene responsible for capsaicin biosynthesis, which is unique to Capsicum spp. With this information on the CS gene, speculation on the gene for pungency is unequivocally resolved. Our findings have implications in the regulation of capsaicin levels in Capsicum genotypes. PMID:16938870
International Nuclear Information System (INIS)
Fu, Jiapeng; Pang, Zengyuan; Yang, Jie; Huang, Fenglin; Cai, Yibing; Wei, Qufu
2015-01-01
Graphical abstract: - Highlights: • PANI nanorods have been grown onto the surface of CMC/cellulose nanofibers for the fabrication of biosensor substrate material. • The proposed laccase biosensor exhibited a low detection limit and high sensitivity in the detection of catechol. • Hierarchical PANI/CMC/cellulose nanofibers are the promising material in the design of high-efficient biosensors. - Abstract: We report a facile approach to synthesizing and immobilizing polyaniline nanorods onto carboxymethyl cellulose (CMC)-modified cellulose nanofibers for their biosensing application. Firstly, the hierarchical PANI/CMC/cellulose nanofibers were fabricated by in situ polymerization of aniline on the CMC-modified cellulose nanofiber. Subsequently, the PANI/CMC/cellulose nanofibrous mat modified with laccase (Lac) was used as biosensor substrate material for the detection of catechol. PANI/CMC/cellulose nanofibers with highly conductive and three dimensional nanostructure were characterized by scanning electron microscopy (SEM), transmission electron microscope (TEM), Fourier transform infrared spectra (FT-IR), cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). Under optimum conditions, the Lac/PANI/CMC/cellulose/glassy carbon electrode (GCE) exhibited a fast response time (within 8 s), a linear response range from 0.497 μM to 2.27 mM with a high sensitivity and low detection limit of 0.374 μM (3σ). The developed biosensor also displayed good repeatability, reproducibility as well as selectivity. The results indicated that the composite mat has potential application in enzyme biosensors
Energy Technology Data Exchange (ETDEWEB)
Fu, Jiapeng, E-mail: firgexiao@sina.cn; Pang, Zengyuan, E-mail: pangzengyuan1212@163.com; Yang, Jie, E-mail: young1993@126.com; Huang, Fenglin, E-mail: flhuang@jiangnan.edu.cn; Cai, Yibing, E-mail: yibingcai@jiangnan.edu.cn; Wei, Qufu, E-mail: qfwei@jiangnan.edu.cn
2015-09-15
Graphical abstract: - Highlights: • PANI nanorods have been grown onto the surface of CMC/cellulose nanofibers for the fabrication of biosensor substrate material. • The proposed laccase biosensor exhibited a low detection limit and high sensitivity in the detection of catechol. • Hierarchical PANI/CMC/cellulose nanofibers are the promising material in the design of high-efficient biosensors. - Abstract: We report a facile approach to synthesizing and immobilizing polyaniline nanorods onto carboxymethyl cellulose (CMC)-modified cellulose nanofibers for their biosensing application. Firstly, the hierarchical PANI/CMC/cellulose nanofibers were fabricated by in situ polymerization of aniline on the CMC-modified cellulose nanofiber. Subsequently, the PANI/CMC/cellulose nanofibrous mat modified with laccase (Lac) was used as biosensor substrate material for the detection of catechol. PANI/CMC/cellulose nanofibers with highly conductive and three dimensional nanostructure were characterized by scanning electron microscopy (SEM), transmission electron microscope (TEM), Fourier transform infrared spectra (FT-IR), cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). Under optimum conditions, the Lac/PANI/CMC/cellulose/glassy carbon electrode (GCE) exhibited a fast response time (within 8 s), a linear response range from 0.497 μM to 2.27 mM with a high sensitivity and low detection limit of 0.374 μM (3σ). The developed biosensor also displayed good repeatability, reproducibility as well as selectivity. The results indicated that the composite mat has potential application in enzyme biosensors.
Puspasari, Tiara
2018-04-11
Cellulose is widely regarded as an environmentally friendly, natural and low cost material which can significantly contribute the sustainable economic growth. In this study, cellulose composite membranes were prepared via regeneration of trimethylsilyl cellulose (TMSC), an easily synthesized cellulose derivative. The amorphous hydrophilic feature of the regenerated cellulose enabled fast permeation of water vapour. The pore-free cellulose layer thickness was adjustable by the initial TMSC concentration and acted as an efficient gas barrier. As a result, a 5,000 GPU water vapour transmission rate (WVTR) at the highest ideal selectivity of 1.1 x 106 was achieved by the membranes spin coated from a 7% (w/w) TMSC solution. The membranes maintained a 4,000 GPU WVTR with selectivity of 1.1 x 104 in the mixed-gas experiments, surpassing the performances of the previously reported composite membranes. This study provides a simple way to not only produce high performance membranes but also to advance cellulose as a low-cost and sustainable membrane material for dehumidification applications.
Degradation of γ-irradiated cellulose by the accumulating culture of a cellulose bacterium
International Nuclear Information System (INIS)
Namsaraev, B.B.; Kuznetsova, E.A.; Termkhitarova, N.G.
1987-01-01
Possibility of degradation of γ-irradiated cellulose by the accumulating culture of an anaerobic cellulose bacterium has been investigated. Cellulose irradiation by γ-quanta (Co 60 ) has been carried out using the RKh-30 device with 35.9 Gy/min dose rate. Radiation monitoring has been carried out by the standard ferrosulfate method. Samples have been irradiated in dry state or when water presenting with MGy. It is detected that the accumulating culture with the growth on the irradiated cellulose has a lag-phase, which duration reduces when the cellulose cleaning by flushing with distillation water. The culture has higher growth and substrate consumption rate when growing by cellulose irradiated in comparison with non-irradiated one. The economical coefficient is the same in using both the irradiated and non-irradiated cellulose. The quantity of forming reducing saccharides, organic acids, methane and carbon dioxide is the same both when cultivating by irradiated cellulose and by non-irradiated. pH of the culture liquid is shifted to the acid nature in the process of growth
DEFF Research Database (Denmark)
Egelund, Jack; Skjøt, Michael; Geshi, Naomi
2004-01-01
Plant cell wall (CW) synthesizing enzymes can be divided into the glycan (i.e. cellulose and callose) synthases, which are multimembrane spanning proteins located at the plasma membrane, and the glycosyltransferases (GTs), which are Golgi localized single membrane spanning proteins, believed....... Although much is known with regard to composition and fine structures of the plant CW, only a handful of CW biosynthetic GT genes-all classified in the CAZy system-have been characterized. In an effort to identify CW GTs that have not yet been classified in the CAZy database, a simple bioinformatics...... approach was adopted. First, the entire Arabidopsis proteome was run through the Transmembrane Hidden Markov Model 2.0 server and proteins containing one or, more rarely, two transmembrane domains within the N-terminal 150 amino acids were collected. Second, these sequences were submitted...
Molecular cloning and characterization of recA-like gene from Schizosaccharomyces pombe
International Nuclear Information System (INIS)
Lee, J.S.; Kang, J.K.; Yoon, S.M.; Park, Y.; Yang, Y.K.; Kim, S.W.; Park, J.K.; Park, J.G.; Hong, S.H.; Park, S.D.
1996-01-01
We have previously purified and characterized a RecA-like protein from Schizosaccharomyces pombe (S. pombe). In the present study, we have cloned a gene encoding the RecA-like protein. The S. pombe recA-like gene was isolated by immunological screening of the expression library of S. pombe using anti-Escherichia coli (E. coli) RecA antibody as a probe. From 10(6) plaques screened, 6 putative clones were finally isolated. Five of the clones screened contained the same kinds of DNA inserts, as determined by crosshybridization analysis. Among the clones, TC-2 was selected for further studies. The pGEM3Zf(-)Delta 17 vector harboring the 4.3 kb DNA insert of TC-2 clone was capable of producing abeta-gal/RecA-like fusion protein, suggesting that the cloned gene encodes the RecA-like protein of S. pombe. It was also revealed by Southern hybridization analysis that the same DNA sequence as the cloned recA-like gene is located within the S. pombe chromosomal DNA. In addition, the cloned recA-like gene was transcribed into a 3.0 kb RNA transcript, as judged by Northern blot analysis. The level of the RNA transcript of recA-like gene was increased approximately 1.6 to 2.4-fold upon treatment with DNA damaging agents such as ultraviolet (UV)-light, methyl methanesulfonate (MMS), and mitomycin-C (MMC). This data suggests that the cloned S. pombe recA-like gene is slightly inducible to DNAdamage as in E. coli recA gene. These results suggest that an inducible repair mechanism analogous to that of E. coli may exist in fission yeast S. pombe
Liquid crystalline solutions of cellulose in phosphoric acid for preparing cellulose yarns
Boerstoel, H.
2006-01-01
The presen thesis describes a new process for manufacturing high tenacity and high modulus cellulose yarns. A new direct solvent for cellulose has been discovered, leading to liquid crystalline solutions. This new solvent, superphosphoric acid, rapidly dissolves cellulose. These liquid crystalline
Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer
International Nuclear Information System (INIS)
Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.
2003-01-01
Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement
Koval, S.N.; Miloslavsky, D.K.; Snegurskaya, I.A.; Mysnichenko, O.V.; Penkova, M.Yu.
2017-01-01
Hormonal factors of adrenal origin belong to the pathophysiological mechanisms of the formation and progression of arterial hypertension (AH) and should be considered while developing differentiated approaches to the treatment and prevention of hypertensive states, their primary, secondary and resistant forms. The first thing we should point up is aldosterone (AL), enzyme aldosterone synthase (AS), which takes a direct part in the formation of this hormone, as well as gene polymorphisms of A...
Jeangkhwoa, Pattraporn; Bandhaya, Achirapa; Umpunjun, Puangpaka; Chuenboonngarm, Ngarmnij; Panvisavas, Nathinee
2017-03-01
This study reports a successful application of fluorescence in situ hybridization (FISH) technique in the identification of Cannabis sativa L. cells recovered from fresh and dried powdered plant materials. Two biotin-16-dUTP-labeled FISH probes were designed from the Cannabis-specific tetrahydrocannabinolic acid synthase (THCAS) gene and the ITS region of the 45S rRNA gene. Specificity of probe-target hybridization was tested against the target and 4 non-target plant species, i.e., Humulus lupulus, Mitragyna speciosa, Papaver sp., and Nicotiana tabacum. The 1-kb THCA synthase hybridization probe gave Cannabis-specific hybridization signals, unlike the 700-bp Cannabis-ITS hybridization probe. Probe-target hybridization was also confirmed against 20 individual Cannabis plant samples. The 1-kb THCA synthase and 700-bp Cannabis-ITS hybridization probes clearly showed 2 hybridization signals per cell with reproducibility. The 1-kb THCA synthase probe did not give any FISH signal when tested against H. lupulus, its closely related member of the Canabaceae family. It was also showed that 1-kb THCA synthase FISH probe can be applied to identify small amount of dried powdered Cannabis material with an addition of rehydration step prior to the experimental process. This study provided an alternative identification method for Cannabis trace. Copyright © 2016. Published by Elsevier B.V.
Shimizu, Masanori; Goto, Maki; Hanai, Moeko; Shimizu, Tsutomu; Izawa, Norihiko; Kanamoto, Hirosuke; Tomizawa, Ken-Ichi; Yokota, Akiho; Kobayashi, Hirokazu
2008-08-01
Strategies employed for the production of genetically modified (GM) crops are premised on (1) the avoidance of gene transfer in the field; (2) the use of genes derived from edible organisms such as plants; (3) preventing the appearance of herbicide-resistant weeds; and (4) maintaining transgenes without obstructing plant cell propagation. To this end, we developed a novel vector system for chloroplast transformation with acetolactate synthase (ALS). ALS catalyzes the first step in the biosynthesis of the branched amino acids, and its enzymatic activity is inhibited by certain classes of herbicides. We generated a series of Arabidopsis (Arabidopsis thaliana) mutated ALS (mALS) genes and introduced constructs with mALS and the aminoglycoside 3'-adenyltransferase gene (aadA) into the tobacco (Nicotiana tabacum) chloroplast genome by particle bombardment. Transplastomic plants were selected using their resistance to spectinomycin. The effects of herbicides on transplastomic mALS activity were examined by a colorimetric assay using the leaves of transplastomic plants. We found that transplastomic G121A, A122V, and P197S plants were specifically tolerant to pyrimidinylcarboxylate, imidazolinon, and sulfonylurea/pyrimidinylcarboxylate herbicides, respectively. Transplastomic plants possessing mALSs were able to grow in the presence of various herbicides, thus affirming the relationship between mALSs and the associated resistance to herbicides. Our results show that mALS genes integrated into the chloroplast genome are useful sustainable markers that function to exclude plants other than those that are GM while maintaining transplastomic crops. This investigation suggests that the resistance management of weeds in the field amid growing GM crops is possible using (1) a series of mALSs that confer specific resistance to herbicides and (2) a strategy that employs herbicide rotation.
Duedu, Kwabena O; French, Christopher E
2016-11-01
Effective degradation of cellulose requires multiple classes of enzyme working together. However, naturally occurring cellulases with multiple catalytic domains seem to be rather rare in known cellulose-degrading organisms. A fusion protein made from Cellulomonas fimi exo- and endo- glucanases, Cex and CenA which improves breakdown of cellulose is described. A homologous carbohydrate binding module (CBM-2) present in both glucanases was fused to give a fusion protein CxnA. CxnA or unfused constructs (Cex+CenA, Cex, or CenA) were expressed in Escherichia coli and Citrobacter freundii. The latter recombinant strains were cultured at the expense of cellulose filter paper. The expressed CxnA had both exo- and endo- glucanase activities. It was also exported to the supernatant as were the non-fused proteins. In addition, the hybrid CBM from the fusion could bind to microcrystalline cellulose. Growth of C. freundii expressing CxnA was superior to that of cells expressing the unfused proteins. Physical degradation of filter paper was also faster with the cells expressing fusion protein than the other constructs. Our results show that fusion proteins with multiple catalytic domains can improve the efficiency of cellulose degradation. Such fusion proteins could potentially substitute cloning of multiple enzymes as well as improving product yields. Copyright © 2016 Elsevier Inc. All rights reserved.
Cloning and bioinformatic analysis of lovastatin biosynthesis regulatory gene lovE.
Huang, Xin; Li, Hao-ming
2009-08-05
Lovastatin is an effective drug for treatment of hyperlipidemia. This study aimed to clone lovastatin biosynthesis regulatory gene lovE and analyze the structure and function of its encoding protein. According to the lovastatin synthase gene sequence from genebank, primers were designed to amplify and clone the lovastatin biosynthesis regulatory gene lovE from Aspergillus terrus genomic DNA. Bioinformatic analysis of lovE and its encoding animo acid sequence was performed through internet resources and software like DNAMAN. Target fragment lovE, almost 1500 bp in length, was amplified from Aspergillus terrus genomic DNA and the secondary and three-dimensional structures of LovE protein were predicted. In the lovastatin biosynthesis process lovE is a regulatory gene and LovE protein is a GAL4-like transcriptional factor.
Rupasree, Yedluri; Naushad, Shaik Mohammad; Varshaa, Ravi; Mahalakshmi, Govindaraj Swathika; Kumaraswami, Konda; Rajasekhar, Liza; Kutala, Vijay Kumar
2016-02-01
In view of our previous studies showing an independent association of genetic polymorphisms in folate, xenobiotic, and toll-like receptor (TLR) pathways with the risk for systemic lupus erythematosus (SLE), we have developed three statistical models to delineate complex gene-gene interactions between folate, xenobiotic, TLR, and signal transducer and activator of transcription 4 (STAT4) signaling pathways in association with the molecular pathophysiology of SLE. We developed additive, multifactor dimensionality reduction (MDR), and artificial neural network (ANN) models. The additive model, although the simplest, suggested a moderate predictability of 30 polymorphisms of these four pathways (area under the curve [AUC] 0.66). MDR analysis revealed significant gene-gene interactions among glutathione-S-transferase (GST)T1 and STAT4 (rs3821236 and rs7574865) polymorphisms, which account for moderate predictability of SLE. The MDR model for specific auto-antibodies revealed the importance of gene-gene interactions among cytochrome P450, family1, subfamily A, polypeptide 1 (CYP1A1) m1, catechol-O-methyltransferase (COMT) H108L, solute carrier family 19 (folate transporter), member 1 (SLC19A1) G80A, estrogen receptor 1 (ESR1), TLR5, 5-methyltetrahydrofolate-homocysteine methyltransferase reductase (MTRR), thymidylate synthase (TYMS). and STAT4 polymorphisms. The ANN model for disease prediction showed reasonably good predictability of SLE risk with 30 polymorphisms (AUC 0.76). These polymorphisms contribute towards the production of SSB and anti-dsDNA antibodies to the extent of 48 and 40%, respectively, while their contribution for the production of antiRNP, SSA, and anti-cardiolipin antibodies varies between 20 and 30%. The current study highlighted the importance of genetic polymorphisms in folate, xenobiotic, TLR, and STAT4 signaling pathways as moderate predictors of SLE risk and delineates the molecular pathophysiology associated with these single nucleotide
Directory of Open Access Journals (Sweden)
Lina Zheng
Full Text Available Validamycin A (Val-A is an effective antifungal agent widely used in Asian countries as crop protectant. Validoxylamine A, the core structure and intermediate of Val-A, consists of two C(7-cyclitol units connected by a rare C-N bond. In the Val-A biosynthetic gene cluster in Streptomyces hygroscopicus 5008, the ORF valL was initially annotated as a validoxylamine A 7'-phosphate(V7P synthase, whose encoded 497-aa protein shows high similarity with trehalose 6-phosphate(T6P synthase. Gene inactivation of valL abolished both validoxylamine A and validamycin A productivity, and complementation with a cloned valL recovered 10% production of the wild-type in the mutant, indicating the involvement of ValL in validoxylamine A biosynthesis. Also we determined the structures of ValL and ValL/trehalose complex. The structural data indicates that ValL adopts the typical fold of GT-B protein family, featuring two Rossmann-fold domains and an active site at domain junction. The residues in the active site are arranged in a manner homologous to that of Escherichia coli (E.coli T6P synthase OtsA. However, a significant discrepancy is found in the active-site loop region. Also noticeable structural variance is found around the active site entrance in the apo ValL structure while the region takes an ordered configuration upon binding of product analog trehalose. Furthermore, the modeling of V7P in the active site of ValL suggests that ValL might have a similar SNi-like mechanism as OtsA.
Park, Bum-Chan; Park, Yun-Hee; Yi, Soohyun; Choi, Yu Kyung; Kang, Eun-Hye; Park, Hee-Moon
2014-11-01
The temporal and spatial regulation of β-1,3-glucan synthesis plays an important role in morphogenesis during fungal growth and development. Northern blot analysis showed that the transcription of fksA, the gene encoding β-1,3-glucan synthase in Aspergillus nidulans, was cell-cycle-dependent and increased steadily over the duration of the vegetative period, but its overall expression during the asexual and sexual stages was fairly constant up until the time of transcription cessation. In an A. nidulans strain mutated in the eukaryotic bHLH-like APSES transcription factor stuA1, the transcriptional level of fksA, and consequently the content of alkali-insoluble cell wall β-glucan, significantly increased at the conidial chain formation and maturation stage. Electrophoretic mobility shift assays revealed that StuA was bound to StREs (StuA Response Elements) on the fksA promoter region. Promoter analysis with sGFP-fusion constructs also indicated the negative regulation of fksA expression by StuA, especially during asexual development. Taken together, these data suggest that StuA plays an important role in cell wall biogenesis during the development of A. nidulans, by controlling the transcription level of fksA.
Salard, Isabelle; Mercey, Emilie; Rekka, Eleni; Boucher, Jean-Luc; Nioche, Pierre; Mikula, Ivan; Martasek, Pavel; Raman, C S; Mansuy, Daniel
2006-12-01
Genome sequencing has recently shown the presence of genes coding for NO-synthase (NOS)-like proteins in bacteria. The roles of these proteins remain unclear. The interactions of a series of l-arginine (l-arg) analogs and iron ligands with two recombinant NOS-like proteins from Staphylococcus aureus (saNOS) and Bacillus anthracis (baNOS) have been studied by UV-visible spectroscopy. SaNOS and baNOS in their ferric native state, as well as their complexes with l-arg analogs and with various ligands, exhibit spectral characteristics highly similar to the corresponding complexes of heme-thiolate proteins such as cytochromes P450 and NOSs. However, saNOS greatly differs from baNOS at the level of three main properties: (i) native saNOS mainly exists under an hexacoordinated low-spin ferric state whereas native baNOS is mainly high-spin, (ii) the addition of tetrahydrobiopterin (H4B) or H4B analogs leads to an increase of the affinity of l-arg for saNOS but not for baNOS, and (iii) saNOS Fe(II), contrary to baNOS, binds relatively bulky ligands such as nitrosoalkanes and tert-butylisocyanide. Thus, saNOS exhibits properties very similar to those of the oxygenase domain of inducible NOS (iNOS(oxy)) not containing H4B, as expected for a NOSoxy-like protein that does not contain H4B. By contrast, the properties of baNOS which look like those of H4B-containing iNOS(oxy) are unexpected for a NOS-like protein not containing H4B. The origin of these surprising properties of baNOS remains to be determined.
Characterization of cellulose nanowhiskers
International Nuclear Information System (INIS)
Nascimento, Nayra R.; Pinheiro, Ivanei F.; Morales, Ana R.; Ravagnani, Sergio P.; Mei, Lucia
2015-01-01
Cellulose is the most abundant polymer earth. The cellulose nanowhiskers can be extracted from the cellulose. These have attracted attention for its use in nanostructured materials for various applications, such as nanocomposites, because they have peculiar characteristics, among them, high aspect ratio, biodegradability and excellent mechanical properties. This work aims to characterize cellulose nanowhiskers from microcrystalline cellulose. Therefore, these materials were characterized by X-ray diffraction (XRD) to assess the degree of crystallinity, infrared spectroscopy (FT-IR), transmission electron microscopy (TEM) to the morphology of nanowhiskers and thermal stability was evaluated by Thermogravimetric Analysis (TGA). (author)
CELLULOSIC NANOCOMPOSITES: A REVIEW
Directory of Open Access Journals (Sweden)
Martin A. Hubbe
2008-08-01
Full Text Available Because of their wide abundance, their renewable and environmentally benign nature, and their outstanding mechanical properties, a great deal of attention has been paid recently to cellulosic nanofibrillar structures as components in nanocomposites. A first major challenge has been to find efficient ways to liberate cellulosic fibrils from different source materials, including wood, agricultural residues, or bacterial cellulose. A second major challenge has involved the lack of compatibility of cellulosic surfaces with a variety of plastic materials. The water-swellable nature of cellulose, especially in its non-crystalline regions, also can be a concern in various composite materials. This review of recent work shows that considerable progress has been achieved in addressing these issues and that there is potential to use cellulosic nano-components in a wide range of high-tech applications.
Cheng, Jiujun; Charles, Trevor C
2016-09-01
Bacterially produced biodegradable polyhydroxyalkanoates (PHAs) with versatile properties can be achieved using different PHA synthases (PhaCs). This work aims to expand the diversity of known PhaCs via functional metagenomics and demonstrates the use of these novel enzymes in PHA production. Complementation of a PHA synthesis-deficient Pseudomonas putida strain with a soil metagenomic cosmid library retrieved 27 clones expressing either class I, class II, or unclassified PHA synthases, and many did not have close sequence matches to known PhaCs. The composition of PHA produced by these clones was dependent on both the supplied growth substrates and the nature of the PHA synthase, with various combinations of short-chain-length (SCL) and medium-chain-length (MCL) PHA. These data demonstrate the ability to isolate diverse genes for PHA synthesis by functional metagenomics and their use for the production of a variety of PHA polymer and copolymer mixtures.
Xiong, Wangdan; Wei, Qian; Wu, Pingzhi; Zhang, Sheng; Li, Jun; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang
2017-07-01
The β-ketoacyl-acyl carrier protein synthase I (KASI) is involved in de novo fatty acid biosynthesis in many organisms. Two putative KASI genes, JcKASI-1 and JcKASI-2, were isolated from Jatropha curcas. The deduced amino acid sequences of JcKASI-1 and JcKASI-2 exhibit around 83.8% and 72.5% sequence identities with AtKASI, respectively, and both contain conserved Cys-His-Lys-His-Phe catalytic active sites. Phylogenetic analysis indicated that JcKASI-2 belongs to a clade with several KASI proteins from dicotyledonous plants. Both JcKASI genes were expressed in multiple tissues, most strongly in filling stage seeds of J. curcas. Additionally, the JcKASI-1 and JcKASI-2 proteins were both localized to the plastids. Expressing JcKASI-1 in the Arabidopsis kasI mutant rescued the mutant's phenotype and restored the fatty acid composition and oil content in seeds to wild-type, but expressing JcKASI-2 in the Arabidopsis kasI mutant resulted in only partial rescue. This implies that JcKASI-1 and JcKASI-2 exhibit partial functional redundancy and KASI genes play a universal role in regulating fatty acid biosynthesis, growth, and development in plants. Copyright © 2017 Elsevier GmbH. All rights reserved.
Kitta, Ryo; Kuwamoto, Marina; Yamahama, Yumi; Mase, Keisuke; Sawada, Hiroshi
2016-12-01
To elucidate the mechanism for embryonic diapause or the breakdown of diapause in Bombyx mori, we biochemically analyzed nitric oxide synthase (NOS) during the embryogenesis of B. mori. The gene expression and enzyme activity of B. mori NOS (BmNOS) were examined in diapause, non-diapause, and HCl-treated diapause eggs. In the case of HCl-treated diapause eggs, the gene expression and enzyme activity of BmNOS were induced by HCl treatment. However, in the case of diapause and non-diapause eggs during embryogenesis, changes in the BmNOS activity and gene expressions did not coincide except 48-60 h after oviposition in diapause eggs. The results imply that changes in BmNOS activity during the embryogenesis of diapause and non-diapause eggs are regulated not only at the level of transcription but also post-transcription. The distribution and localization of BmNOS were also investigated with an immunohistochemical technique using antibodies against the universal NOS; the localization of BmNOS was observed mainly in the cytoplasm of yolk cells in diapause eggs and HCl-treated diapause eggs. These data suggest that BmNOS has an important role in the early embryonic development of the B. mori. © 2016 Japanese Society of Developmental Biologists.
Zhang, Hao; Li, Xueyan; Zhou, Li; Zhang, Keyong; Zhang, Qi; Li, Jingping; Wang, Ningning; Jin, Ming; Wu, Nan; Cong, Mingyu; Qiu, Changchun
2017-09-01
Low-frequency variants showed that there is more power to detect risk variants than to detect protective variants in complex diseases. Aldosterone plays an important role in the renin-angiotensin-aldosterone system, and aldosterone synthase catalyzes the speed-controlled steps of aldosterone biosynthesis. Polymorphisms of the aldosterone synthase gene (CYP11B2) have been reported to be associated with essential hypertension (EH). CYP11B2 polymorphisms such as -344T/C, have been extensively reported, but others are less well known. This study aimed to assess the association between human CYP11B2 and EH using a haplotype-based case-control study. A total of 1024 EH patients and 956 normotensive controls, which consist of north Han population peasants, were enrolled. Seven single nucleotide polymorphisms (SNPs) (rs28659182, rs10087214, rs73715282, rs542092383, rs4543, rs28491316, and rs7463212) covering the entire human CYP11B2 gene were genotyped as markers using the MassARRAY system. The major allele G frequency of rs542092383 was found to be risk against hypertension [odds ratio (OR) 3.478, 95% confidence interval (95% CI) 1.407-8.597, P = .004]. The AG genotype frequency of SNP rs542092383 was significantly associated with an increased risk of hypertension (OR 4.513, 95% CI 1.426-14.287, P = .010). In the haplotype-based case-control analysis, the frequency of the T-G-T haplotype was higher for EH patients than for controls (OR 5.729, 95% CI 1.889-17.371, P = .000495). All |D'| values of the seven SNPs were >0.9, and r values for rs28659182- rs10087214-rs28491316-rs7463212 SNPs were >0.8 and showed strong linkage intensity. Haplotype T-G-T may therefore be a useful genetic marker for EH.
Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.
Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi
2007-11-01
Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat.
Directory of Open Access Journals (Sweden)
G. V. Matyushin
2017-01-01
Full Text Available Background. The discovery of new genetic predictors of cardiovascular diseases can be used in predicting and diagnosing latent forms of the disease. Wolff-Parkinson-White syndrome (WPW occurs in all age groups and detected in 1-30 people per 10000, it manifests mainly in young age (on average 20 years, and the risk of sudden cardiac death is higher than in general population.Aim. To study the relationship of WPW syndrome with the polymorphism of endothelial nitric synthase gene (NOS3, and to identify genetic predictors of this syndrome.Material and methods. The study included 51 people with ECG proven WPW syndrome and 153 people with no cardiovascular disease. The patients were divided into subgroups according to sex: 21 women, 30 men. All patients underwent a standard cardiac examination (anamnesis, electrocardiography, echocardiography, bicycle ergometry, transesophageal electrical stimulation of the atria, Holter monitoring and blood was taken for molecular genetic testing of DNA.Results. The results showed a statistically significant prevalence of rare genotype 4b\\4b NOS3 gene in the control group of women (16.3%; р<0.05 compared with women from the main group, who did not have this genotype, while there was significant prevalence of genotype 4a\\4a in the main group of women (81.0%; р<0.05 compared with women from the control group. In men this prevalence was not found.Conclusion. The presence of genotype 4b\\4b NOS3 gene reduces the likelihood of WPW syndrome and its symptoms in females. In men, this prevalence is not found, presumably, in connection with some mechanisms of hormonal regulation. The results can be used in the genetic prediction of the course of the disease.
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
An investigation on the characteristics of cellulose nanocrystals from Pennisetum sinese
International Nuclear Information System (INIS)
Lu, Qi-lin; Tang, Li-rong; Wang, Siqun; Huang, Biao; Chen, Yan-dan; Chen, Xue-rong
2014-01-01
The aim of this study was to explore the utilization of Pennisetum sinese as cellulose source for the preparation of cellulose nanocrystals (CNC). The cellulose was extracted from P. sinese by chemical treatment and bleaching, and obtained cellulose nanocrystals by acid hydrolysis. Transmission electron microscopy (TEM) showed that CNC were rod-like with the diameter of 20–30 nm and the length of 200–300 nm. Fourier transform infrared (FTIR) showed that chemical treatment removed most of the lignin and hemicellulose from P. sinese, and CNC had similar structure to that of native cellulose. The crystallinity indexes calculated from X-ray diffraction (XRD) for P. sinese and CNC were 40.6% and 77.3%, respectively. The zeta-potential analysis showed that CNC had higher stability than P. sinese had. The thermal stability was investigated by thermogravimetric analysis (TGA), and the result showed that P. sinese had higher thermal stability than that of prepared CNC. - Highlights: • Pennisetum sinese Roxb is good raw material for preparing cellulose nanocrystals (CNC). • Crystallinity of prepared CNC is higher than that of P. sinese Roxb. • Thermal stability of prepared CNC is lower than that of P. sinese Roxb
Directory of Open Access Journals (Sweden)
Hongxiang Xie
2018-01-01
Full Text Available The recent strategies in preparation of cellulose nanocrystals (CNCs and cellulose nanofibrils (CNFs were described. CNCs and CNFs are two types of nanocelluloses (NCs, and they possess various superior properties, such as large specific surface area, high tensile strength and stiffness, low density, and low thermal expansion coefficient. Due to various applications in biomedical engineering, food, sensor, packaging, and so on, there are many studies conducted on CNCs and CNFs. In this review, various methods of preparation of CNCs and CNFs are summarized, including mechanical, chemical, and biological methods. The methods of pretreatment of cellulose are described in view of the benefits to fibrillation.
Puspasari, Tiara
2018-01-01
(TMSC), a highly soluble cellulose derivative, as a precursor for the fabrication of cellulose thin film composite membranes. TMSC is an attractive precursor to assemble thin cellulose films with good deposition behavior and film morphology; cumbersome
O.I. Kadykova; P.P. Kravchun
2016-01-01
The article reviewed the links between polymorphism of endothelial nitric oxide synthase gene (Glu298Asp) and the development and progression of chronic heart failure in patients with ischemic heart disease and obesity. There has been a comprehensive survey of 222 patients with ischemic heart disease. Comparison group consisted of 115 patients with ischemic heart disease with normal body weight. The control group included 35 healthy individuals. G allele and genotype G/G polymorphism of the g...
Erratum Aldosterone synthase C-344T, angiotensin II type 1 receptor ...
Indian Academy of Sciences (India)
Aldosterone synthase C-344T, angiotensin II type 1 receptor A1166C and 11-β hydroxysteroid dehydrogenase G534A gene polymorphisms and essential hypertension in the population of Odisha, India. Manisha Patnaik, Pallabi Pati, Surendra N. Swain, Manoj K. Mohapatra, Bhagirathi Dwibedi, Shantanu K. Kar.
Establishment of HeLa cell mutants deficient in sphingolipid-related genes using TALENs.
Directory of Open Access Journals (Sweden)
Toshiyuki Yamaji
Full Text Available Sphingolipids are essential components in eukaryotes and have various cellular functions. Recent developments in genome-editing technologies have facilitated gene disruption in various organisms and cell lines. We here show the disruption of various sphingolipid metabolic genes in human cervical carcinoma HeLa cells by using transcription activator-like effector nucleases (TALENs. A TALEN pair targeting the human CERT gene (alternative name COL4A3BP encoding a ceramide transport protein induced a loss-of-function phenotype in more than 60% of HeLa cells even though the cell line has a pseudo-triploid karyotype. We have isolated several loss-of-function mutant clones for CERT, UGCG (encoding glucosylceramide synthase, and B4GalT5 (encoding the major lactosylceramide synthase, and also a CERT/UGCG double-deficient clone. Characterization of these clones supported previous proposals that CERT primarily contributes to the synthesis of SM but not GlcCer, and that B4GalT5 is the major LacCer synthase. These newly established sphingolipid-deficient HeLa cell mutants together with our previously established stable transfectants provide a 'sphingolipid-modified HeLa cell panel,' which will be useful to elucidate the functions of various sphingolipid species against essentially the same genomic background.
DEFF Research Database (Denmark)
Gojkovic, Zoran; Sandrini, Michael; Piskur, Jure
2001-01-01
no pyrimidine catabolic pathway, it enabled growth on N-carbamyl- beta -alanine as the sole nitrogen source. The D. discoideum and D. melanogaster PYD3 gene products are similar to mammalian beta -alanine synthases. In contrast, the S. kluyveri protein is quite different from these and more similar to bacterial......beta -Alanine synthase (EC 3.5.1.6), which catalyzes the final step of pyrimidine catabolism, has only been characterized in mammals. A Saccharomyces kluyveri pyd3 mutant that is unable to grow on N-carbamy-beta -alanine as the sole nitrogen source and exhibits diminished beta -alanine synthase...... N- carbamyl amidohydrolases. All three beta -alanine synthases are to some degree related to various aspartate transcarbamylases, which catalyze the second step of the de novo pyrimidine biosynthetic pathway. PYD3 expression in yeast seems to be inducible by dihydrouracil and N...