Yeast cell differentiation: Lessons from pathogenic and non-pathogenic yeasts

Czech Academy of Sciences Publication Activity Database

Pálková, Z.; Váchová, Libuše

2016-01-01

Roč. 57, SEP (2016), s. 110-119 ISSN 1084-9521 R&D Projects: GA ČR GA13-08605S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : Pathogenic yeasts * Biofilms and colonies * Cell differentiation Subject RIV: EE - Microbiology, Virology Impact factor: 6.614, year: 2016

Metabolites produced by antagonistic microbes inhibit the principal avocado pathogens in vitro

Directory of Open Access Journals (Sweden)

Sara Ramírez R.

2015-04-01

Full Text Available The demand for Hass avocado in the global market exceeds the supply by over 50%. Colombia has a remarkable advantage as a producer in the region due to its high yields. However, the productivity of this crop can be seriously affected by diseases such as root rot, caused by Phytophthora cinnamomi, postharvest body rot and stem end rot, caused by Colletotrichum sp. and Phomopsis sp., respectively. The potential of 76 bacterial isolates obtained from avocado rhizosphere to produce inhibitory metabolites against avocado's pathogens was evaluated. The antagonistic effect of the rhizobacteria against P. cinnamomi, Colletotrichum sp. and Phomopsis sp. was tested through dual cultures. Thirty-six percent of the tested isolates presented inhibition halos against P. cinnamomi, 36% against Colletotrichum sp. and 67% against Phomopsis sp. Additionally, three isolates were selected for fermentation tests using different broth cultures. The extracts obtained from fermentations in the minimal medium of isolates ARP5.1 and AED06 showed inhibitory activity against the evaluated pathogens, but this effect was not observed with the AED26 extract. The media supplemented with copper chloride did not enhance activity of the extracts. These results suggest that using microbial metabolic extracts is a viable alternative for controlling avocado pathogens in vitro.

A hepatocellular carcinoma cell line producing mature hepatitis B viral particles

International Nuclear Information System (INIS)

Fellig, Yakov; Almogy, Gidon; Galun, Eithan; Ketzinel-Gilad, Mali

2004-01-01

Current in vitro models for hepatitis B virus (HBV) are based on human hepatoblastoma cell lines transfected with HBV genome. The objective of this work was to develop an in vitro, hepatocellular carcinoma (HCC)-based system supporting HBV full replication and producing mature viral particles. The FLC4 human HCC cell line was stably transfected with a plasmid carrying a head-to-tail dimer of the adwHBV genome. One of the clones, FLC4A10 II , exhibited prolonged expression of HBV, as was demonstrated by secreted levels of HBsAg, HBeAg, and HBV DNA in the culture medium of the growing cells. Furthermore, the cells produced HBV particles that were detected by a cesium chloride density gradient performed on the culture medium. Analysis by Southern blot revealed that HBV DNA has integrated into the FLC4A10 II cell genome. The presence of HBV in the FLC4A10 II cells did not cause alterations in cell morphology and the cells continued to resemble mature hepatocytes. They do exhibit a high mitotic activity. The new HBV stably transfected cell line, FLC4A10 II , can serve as an important tool for further exploration of HBV host-pathogen interaction, viral life cycle, and for assessing new antiviral agents

Different Use of Cell Surface Glycosaminoglycans As Adherence Receptors to Corneal Cells by Gram Positive and Gram Negative Pathogens

Science.gov (United States)

García, Beatriz; Merayo-Lloves, Jesús; Rodríguez, David; Alcalde, Ignacio; García-Suárez, Olivia; Alfonso, José F.; Baamonde, Begoña; Fernández-Vega, Andrés; Vazquez, Fernando; Quirós, Luis M.

2016-01-01

The epithelium of the cornea is continuously exposed to pathogens, and adhesion to epithelial cells is regarded as an essential first step in bacterial pathogenesis. In this article, the involvement of glycosaminoglycans in the adhesion of various pathogenic bacteria to corneal epithelial cells is analyzed. All microorganisms use glycosaminoglycans as receptors, but arranged in different patterns depending on the Gram-type of the bacterium. The heparan sulfate chains of syndecans are the main receptors, though other molecular species also seem to be involved, particularly in Gram-negative bacteria. Adherence is inhibited differentially by peptides, including heparin binding sequences, indicating the participation of various groups of Gram-positive, and -negative adhesins. The length of the saccharides produces a major effect, and low molecular weight chains inhibit the binding of Gram-negative microorganisms but increase the adherence of Gram-positives. Pathogen adhesion appears to occur preferentially through sulfated domains, and is very dependent on N- and 6-O-sulfation of the glucosamine residue and, to a lesser extent, 2-O sulfation of uronic acid. These data show the differential use of corneal receptors, which could facilitate the development of new anti-infective strategies. PMID:27965938

Pathogenic Assay of Probiotic Bacteria Producing Proteolytic Enzymes as Bioremediation Bacteria Against Vannamei Shrimp Larvae (Litopenaeus vannamei

Directory of Open Access Journals (Sweden)

Wilis Ari Setyati

2017-06-01

Full Text Available Application of bacteria in bioremediation of shrimp culture ponds is one of the methods used to clean internal pollutants. This study aimed to evaluate the pathogenicity of extracellular proteolytic enzyme produced by the probiotic bacteria as bioremediation bacteria on vannamei shrimp larvae culture. There were five probiotic bacteria, which were successfully isolated from the sediments served as substrate in mangrove area. The isolated bacteria were coded in number as 13, 19, 30, 33, and 36. Pathogenic bacteria Vibrio harveyi was used as positive control. Pathogenic assay was carried out in two different bacterial concentrations, i.e. 10⁸ and 10⁶ cells.mL-1. The results showed that the lowest survival rate (SR of shrimp larvae in positive control V. harveyi was 53 and 65%. Whereas isolates with the highest SR value (100% were obtained from bacteria coded as 13 and 30. Isolates no. 19, 33 and 36 had SR of more than 90%. Total plate count (TPC data showed that the bacteria increased significantly at the end of the study with an average increase value of 24%. The smallest TPC value was shown by bacterial isolate no. 19, while the largest was obtained from the isolate no. 13. These results suggest that all probiotic bacteria were not pathogenic to the vannamei shrimp larvae.   Keywords: aquaculture, shrimp, bioremediation, pathogenesis, vibrio.

The Gene tia, Harbored by the Subtilase-Encoding Pathogenicity Island, Is Involved in the Ability of Locus of Enterocyte Effacement-Negative Shiga Toxin-Producing Escherichia coli Strains To Invade Monolayers of Epithelial Cells

Science.gov (United States)

Chiani, Paola; Michelacci, Valeria; Minelli, Fabio; Caprioli, Alfredo; Morabito, Stefano

2017-01-01

ABSTRACT Locus of enterocyte effacement (LEE)-negative Shiga toxin (Stx)-producing Escherichia coli (STEC) strains are human pathogens that lack the LEE locus, a pathogenicity island (PAI) involved in the intimate adhesion of LEE-positive strains to the host gut epithelium. The mechanism used by LEE-negative STEC strains to colonize the host intestinal mucosa is still not clear. The cell invasion determinant tia, previously described in enterotoxigenic E. coli strains, has been identified in LEE-negative STEC strains that possess the subtilase-encoding pathogenicity island (SE-PAI). We evaluated the role of the gene tia, present in these LEE-negative STEC strains, in the invasion of monolayers of cultured cells. We observed that these strains were able to invade Caco-2 and HEp-2 cell monolayers and compared their invasion ability with that of a mutant strain in which the gene tia had been inactivated. Mutation of the gene tia resulted in a strong reduction of the invasive phenotype, and complementation of the tia mutation with a functional copy of the gene restored the invasion activity. Moreover, we show that the gene tia is overexpressed in bacteria actively invading cell monolayers, demonstrating that tia is involved in the ability to invade cultured monolayers of epithelial cells shown by SE-PAI-positive E. coli, including STEC, strains. However, the expression of the tia gene in the E. coli K-12 strain JM109 was not sufficient, in its own right, to confer to this strain the ability to invade cell monolayers, suggesting that at least another factor must be involved in the invasion ability displayed by the SE-PAI-positive strains. PMID:28893912

The Gene tia, Harbored by the Subtilase-Encoding Pathogenicity Island, Is Involved in the Ability of Locus of Enterocyte Effacement-Negative Shiga Toxin-Producing Escherichia coli Strains To Invade Monolayers of Epithelial Cells.

Science.gov (United States)

Bondì, Roslen; Chiani, Paola; Michelacci, Valeria; Minelli, Fabio; Caprioli, Alfredo; Morabito, Stefano

2017-12-01

Locus of enterocyte effacement (LEE)-negative Shiga toxin (Stx)-producing Escherichia coli (STEC) strains are human pathogens that lack the LEE locus, a pathogenicity island (PAI) involved in the intimate adhesion of LEE-positive strains to the host gut epithelium. The mechanism used by LEE-negative STEC strains to colonize the host intestinal mucosa is still not clear. The cell invasion determinant tia , previously described in enterotoxigenic E. coli strains, has been identified in LEE-negative STEC strains that possess the subtilase-encoding pathogenicity island (SE-PAI). We evaluated the role of the gene tia , present in these LEE-negative STEC strains, in the invasion of monolayers of cultured cells. We observed that these strains were able to invade Caco-2 and HEp-2 cell monolayers and compared their invasion ability with that of a mutant strain in which the gene tia had been inactivated. Mutation of the gene tia resulted in a strong reduction of the invasive phenotype, and complementation of the tia mutation with a functional copy of the gene restored the invasion activity. Moreover, we show that the gene tia is overexpressed in bacteria actively invading cell monolayers, demonstrating that tia is involved in the ability to invade cultured monolayers of epithelial cells shown by SE-PAI-positive E. coli , including STEC, strains. However, the expression of the tia gene in the E. coli K-12 strain JM109 was not sufficient, in its own right, to confer to this strain the ability to invade cell monolayers, suggesting that at least another factor must be involved in the invasion ability displayed by the SE-PAI-positive strains. Copyright © 2017 American Society for Microbiology.

The response of CD1d-restricted invariant NKT cells to microbial pathogens and their products

Directory of Open Access Journals (Sweden)

Luc eVan Kaer

2015-05-01

Full Text Available Invariant natural killer T (iNKT cells become activated during a wide variety of infections. This includes organisms lacking cognate CD1d-binding glycolipid antigens recognized by the semi-invariant T cell receptor of iNKT cells. Additional studies have shown that iNKT cells also become activated in vivo in response to microbial products such as bacterial lipopolysaccharide, a potent inducer of cytokine production in antigen-presenting cells (APCs. Other studies have shown that iNKT cells are highly responsive to stimulation by cytokines such as interleukin-12. These findings have led to the concept that microbial pathogens can activate iNKT cells either directly via glycolipids, or indirectly by inducing cytokine production in APCs. iNKT cells activated in this manner produce multiple cytokines that can influence the outcome of infection, usually in favor of the host, although potent iNKT cell activation may contribute to an uncontrolled cytokine storm and sepsis. One aspect of the response of iNKT cells to microbial pathogens is that it is short-lived and followed by an extended time period of unresponsiveness to reactivation. This refractory period may represent a means to avoid chronic activation and cytokine production by iNKT cells, thus protecting the host against some of the negative effects of iNKT cell activation, but potentially putting the host at risk for secondary infections. These effects of microbial pathogens and their products on iNKT cells are not only important for understanding the role of these cells in immune responses against infections but also for the development of iNKT cell-based therapies.

Enteric Pathogen Survival Varies Substantially in Irrigation Water from Belgian Lettuce Producers

Science.gov (United States)

Van Der Linden, Inge; Cottyn, Bart; Uyttendaele, Mieke; Berkvens, Nick; Vlaemynck, Geertrui; Heyndrickx, Marc; Maes, Martine

2014-01-01

It is accepted that irrigation water is a potential carrier of enteric pathogens, such as Salmonella and E. coli O157:H7 and, therefore, a source for contamination of fresh produce. We tested this by comparing irrigation water samples taken from five different greenhouses in Belgium. The water samples were inoculated with four zoonotic strains, two Salmonella and two E. coli O157:H7 strains, and pathogen survival and growth in the water were monitored up till 14 days. The influence of water temperature and chemical water quality was evaluated, and the survival tests were also performed in water samples from which the resident aquatic microbiota had previously been eliminated by filter sterilization. The pathogen’s survival differed greatly in the different irrigation waters. Three water samples contained nutrients to support important growth of the pathogens, and another enabled weaker growth. However, for all, growth was only observed in the samples that did not contain the resident aquatic microbiota. In the original waters with their specific water biota, pathogen levels declined. The same survival tendencies existed in water of 4 °C and 20 °C, although always more expressed at 20 °C. Low water temperatures resulted in longer pathogen survival. Remarkably, the survival capacity of two E. coli 0157:H7 strains differed, while Salmonella Thompson and Salmonella Typhimurium behaved similarly. The pathogens were also transferred to detached lettuce leaves, while suspended in two of the water samples or in a buffer. The effect of the water sample on the pathogen’s fitness was also reproduced on the leaves when stored at 100% relative humidity. Inoculation of the suspension in buffer or in one of the water samples enabled epiphytic growth and survival, while the pathogen level in the other water sample decreased once loaded on the leaves. Our results show that irrigation waters from different origin may have a different capacity to transmit enteric pathogens and

Jasmonate ZIM-domain (JAZ protein regulates host and nonhost pathogen-induced cell death in tomato and Nicotiana benthamiana.

Directory of Open Access Journals (Sweden)

Yasuhiro Ishiga

Full Text Available The nonhost-specific phytotoxin coronatine (COR produced by several pathovars of Pseudomonas syringae functions as a jasmonic acid-isoleucine (JA-Ile mimic and contributes to disease development by suppressing plant defense responses and inducing reactive oxygen species in chloroplast. It has been shown that the F-box protein CORONATINE INSENSITIVE 1 (COI1 is the receptor for COR and JA-Ile. JASMONATE ZIM DOMAIN (JAZ proteins act as negative regulators for JA signaling in Arabidopsis. However, the physiological significance of JAZ proteins in P. syringae disease development and nonhost pathogen-induced hypersensitive response (HR cell death is not completely understood. In this study, we identified JAZ genes from tomato, a host plant for P. syringae pv. tomato DC3000 (Pst DC3000, and examined their expression profiles in response to COR and pathogens. Most JAZ genes were induced by COR treatment or inoculation with COR-producing Pst DC3000, but not by the COR-defective mutant DB29. Tomato SlJAZ2, SlJAZ6 and SlJAZ7 interacted with SlCOI1 in a COR-dependent manner. Using virus-induced gene silencing (VIGS, we demonstrated that SlJAZ2, SlJAZ6 and SlJAZ7 have no effect on COR-induced chlorosis in tomato and Nicotiana benthamiana. However, SlJAZ2-, SlJAZ6- and SlJAZ7-silenced tomato plants showed enhanced disease-associated cell death to Pst DC3000. Furthermore, we found delayed HR cell death in response to the nonhost pathogen Pst T1 or a pathogen-associated molecular pattern (PAMP, INF1, in SlJAZ2- and SlJAZ6-silenced N. benthamiana. These results suggest that tomato JAZ proteins regulate the progression of cell death during host and nonhost interactions.

Development of a Selective Medium for the Fungal Pathogen Fusarium graminearum Using Toxoflavin Produced by the Bacterial Pathogen Burkholderia glumae

Directory of Open Access Journals (Sweden)

Boknam Jung

2013-12-01

Full Text Available The ascomycete fungus Fusarium graminearum is a major causal agent for Fusarium head blight in cereals and produces mycotoxins such as trichothecenes and zearalenone. Isolation of the fungal strains from air or cereals can be hampered by various other airborne fungal pathogens and saprophytic fungi. In this study, we developed a selective medium specific to F. graminearum using toxoflavin produced by the bacterial pathogen Burkholderia glumae. F. graminearum was resistant to toxoflavin, while other fungi were sensitive to this toxin. Supplementing toxoflavin into medium enhanced the isolation of F. graminearum from rice grains by suppressing the growth of saprophytic fungal species. In addition, a medium with or without toxoflavin exposed to wheat fields for 1 h had 84% or 25%, respectively, of colonies identified as F. graminearum. This selection medium provides an efficient tool for isolating F. graminearum, and can be adopted by research groups working on genetics and disease forecasting.

Pathogen Screening of Naturally Produced Yakima River Spring Chinook Smolts; Yakima/Klickitat Fisheries Project Monitoring and Evaluation, 2004-2005 Annual Report.

Energy Technology Data Exchange (ETDEWEB)

Thomas, Joan B. (Washington Department of Fish and Wildlife, Olympia, WA)

2005-05-01

In the spring of 2004 naturally produced smolts outmigrating from the Yakima River Basin were collected for the sixth year of pathogen screening. This component of the evaluation is to monitor whether introduction of hatchery produced smolts would impact the prevalence of specific pathogens in the naturally produced spring chinook smolts. Increases in prevalence of any of these pathogens could negatively impact the survival of these fish. Since 1999 the Cle Elum Hatchery has been releasing spring chinook salmon smolts into the upper Yakima River to increase natural production. In 1998 and 2000 through 2004 naturally produced smolts were collected for monitoring at the Chandler smolt collection facility on the lower Yakima River. Smolts were collected from mid to late outmigration, with a target of 200 fish each year. The pathogens monitored were infectious hematopoeitic necrosis virus, infectious pancreatic necrosis virus, viral hemorrhagic septicemia virus, Flavobacterium psychrophilum, Flavobacterium columnare, Aeromonas salmonicida, Yersinia ruckeri, Edwardsiella ictaluri, Renibacterium salmoninarum and Myxobolus cerebralis. Of these pathogens, only R. salmoninarum was detected in very low levels in the naturally produced smolts outmigrating in 2004. To date, only bacterial pathogens have been detected and prevalences have been low. There have been small variations each year and these changes are attributed to normal fluctuations in prevalence. All of the pathogens detected are widely distributed in Washington State.

Living biointerfaces based on non-pathogenic bacteria to direct cell differentiation

Science.gov (United States)

Rodrigo-Navarro, Aleixandre; Rico, Patricia; Saadeddin, Anas; Garcia, Andres J.; Salmeron-Sanchez, Manuel

2014-07-01

Genetically modified Lactococcus lactis, non-pathogenic bacteria expressing the FNIII7-10 fibronectin fragment as a protein membrane have been used to create a living biointerface between synthetic materials and mammalian cells. This FNIII7-10 fragment comprises the RGD and PHSRN sequences of fibronectin to bind α5β1 integrins and triggers signalling for cell adhesion, spreading and differentiation. We used L. lactis strain to colonize material surfaces and produce stable biofilms presenting the FNIII7-10 fragment readily available to cells. Biofilm density is easily tunable and remains stable for several days. Murine C2C12 myoblasts seeded over mature biofilms undergo bipolar alignment and form differentiated myotubes, a process triggered by the FNIII7-10 fragment. This biointerface based on living bacteria can be further modified to express any desired biochemical signal, establishing a new paradigm in biomaterial surface functionalisation for biomedical applications.

Efficacy of Peracetic Acid in Inactivating Foodborne Pathogens on Fresh Produce Surface.

Science.gov (United States)

Singh, Prashant; Hung, Yen-Con; Qi, Hang

2018-02-01

Washing treatment with effective sanitizer is one of the critical steps in ensuring fresh produce safety. This study was to evaluate the efficacy of peracetic acid (PAA; VigorOx® 15 F&V), chlorine-based sanitizers (acidic electrolyzed water [AEO], near neutral electrolyzed water and bleach), lactic acid, and deionized (DI) water to reduce Escherichia coli O157:H7, Listeria monocytogenes, and Salmonella Typhimurium DT104 from fresh produce surfaces. A 5-strain cocktail of E. coli O157:H7, L. monocytogenes, and S. Typhimurium DT104 was separately prepared and used for surface inoculation on produce samples (E. coli O157:H7 on romaine lettuce, lemons, tomatoes, and blueberries; L. monocytogenes on romaine lettuce and cantaloupe; S. Typhimurium DT104 on lemons, tomatoes, cantaloupe, and blueberries). PAA at 45, 85, and 100 mg/L; AEO, NNEO, and bleach at 100 mg/L of free chlorine; lactic acid at 2%; and DI water were used for washing inoculated produce in an automated produce washer for 5 min. In general, PAA at 100 mg/L achieved the highest microbial inactivation of E. coli O157:H7 (lettuce, lemon, tomato, and blueberry at 2.2, 5.7, 5.5, and 6.7 log CFU/g, respectively), S. Typhimurium DT104 (lemon, tomato, cantaloupe, blueberry at 5.4, 6.8, 4.5, and 5.9 log CFU/g, respectively), and L. monocytogenes (lettuce and cantaloupe at 2.4 and 4.4 log CFU/g, respectively). Efficacy of sanitizers on produce with coarse surface (for example, lettuce and cantaloupe) was lower than produce with smooth texture (lemon, tomato, and blueberry). Cross-contamination of E. coli O157:H7 among romaine lettuce heads during simulated retail crisping process was greatly reduced by the application of PAA and NNEO. NNEO and PAA showed high efficacy in foodborne pathogen removal from fresh produce. Produce surface texture plays an important role in pathogen removal. NNEO and PAA effectively prevented cross-contamination during the crisping process. © 2018 Institute of Food Technologists®.

IL-17-producing NKT cells depend exclusively on IL-7 for homeostasis and survival.

Science.gov (United States)

Webster, K E; Kim, H-O; Kyparissoudis, K; Corpuz, T M; Pinget, G V; Uldrich, A P; Brink, R; Belz, G T; Cho, J-H; Godfrey, D I; Sprent, J

2014-09-01

Natural killer T (NKT) cells are innate-like T cells that rapidly recognize pathogens and produce cytokines that shape the ensuing immune response. IL-17-producing NKT cells are enriched in barrier tissues, such as the lung, skin, and peripheral lymph nodes, and the factors that maintain this population in the periphery have not been elucidated. Here we show that NKT17 cells deviate from other NKT cells in their survival requirements. In contrast to conventional NKT cells that are maintained by IL-15, RORγt(+) NKT cells are IL-15 independent and instead rely completely on IL-7. IL-7 initiates a T-cell receptor-independent (TCR-independent) expansion of NKT17 cells, thus supporting their homeostasis. Without IL-7, survival is dramatically impaired, yet residual cells remain lineage committed with no downregulation of RORγt evident. Their preferential response to IL-7 does not reflect enhanced signaling through STAT proteins, but instead is modulated via the PI3K/AKT/mTOR signaling pathway. The ability to compete for IL-7 is dependent on high-density IL-7 receptor expression, which would promote uptake of low levels of IL-7 produced in the non-lymphoid sites of lung and skin. This dependence on IL-7 is also reported for RORγt(+) innate lymphoid cells and CD4(+) Th17 cells, and suggests common survival requirements for functionally similar cells.

Post irradiation effect on some antiphagocytic substances produced by pathogenic microorganisms

International Nuclear Information System (INIS)

Shehata, M.M.K.

2003-01-01

Some clinical isolated microorganiams can produce antiphagocytic virulence substance. In this study 43 bacterial strains were isolated from cervix of 50 patients. Escheruchia coli was the most common species isolated (39.53%) followed by Klebsiella pneumoniae (23.26), Pseudomonas aeruginosa (11.63%), Proteus mirabilis (9.30%), Klebsiella oxytoca (4.65%), Staphylococcus warneri (4.65%), Klebsiella group 47 (2.33%), Morganella morganii (2.33%) and Staphylococcus hominis (2.33%) four yeast fungal organisms were isolated in this study Candida albicans was the only Candida species isolated representing 8.51% of total number of pathogenic bacteria and yeast fungi isolated. Radiotherapy of these cancer patients had many effects on the microbial cells. The tested isolates were exposed to in-vivo multiple fractionated doses 10-50Gy and in-vitro single equivalent dose 7.04-20Gy. The isolated strains were tested for antimicrbial agent susceptibility using 18 different antibiotics for bacterial isolates and anystatin for Candida albicans. The effect of bacterial and yeast fungal virulence factors on neutrophil phagocytosis and antimicrobial activity was examined. Disk susceptibility testing suggested that, the isolated producer strains which were positive for extracellular proteinase enzyme and/or for slime production that correlate with infectivity were resistant to erythromycin, streptomycin, neomycin, kanamycin, tetracycline, cephalothin and sulphamethoxazol/trimethoprim and rarely susceptible to amoxicillin /clavulanic acid and cefotaxime. In contrast, many non-producer strains were susceptible to most of the tested antibiotics with marked variability among species. In case of Candida albicans all the tested strains were susceptible to the tested antimycotic agent used before and after in-vitro irradiation at a dose level of 20gy. It was found that slime substance and/or proteinase enzyme reduced the phagocytic activity of the leukocytes against the producer bacterial

Human neutrophil clearance of bacterial pathogens triggers anti-microbial γδ T cell responses in early infection.

Directory of Open Access Journals (Sweden)

Martin S Davey

2011-05-01

Full Text Available Human blood Vγ9/Vδ2 T cells, monocytes and neutrophils share a responsiveness toward inflammatory chemokines and are rapidly recruited to sites of infection. Studying their interaction in vitro and relating these findings to in vivo observations in patients may therefore provide crucial insight into inflammatory events. Our present data demonstrate that Vγ9/Vδ2 T cells provide potent survival signals resulting in neutrophil activation and the release of the neutrophil chemoattractant CXCL8 (IL-8. In turn, Vγ9/Vδ2 T cells readily respond to neutrophils harboring phagocytosed bacteria, as evidenced by expression of CD69, interferon (IFN-γ and tumor necrosis factor (TNF-α. This response is dependent on the ability of these bacteria to produce the microbial metabolite (E-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP, requires cell-cell contact of Vγ9/Vδ2 T cells with accessory monocytes through lymphocyte function-associated antigen-1 (LFA-1, and results in a TNF-α dependent proliferation of Vγ9/Vδ2 T cells. The antibiotic fosmidomycin, which targets the HMB-PP biosynthesis pathway, not only has a direct antibacterial effect on most HMB-PP producing bacteria but also possesses rapid anti-inflammatory properties by inhibiting γδ T cell responses in vitro. Patients with acute peritoneal-dialysis (PD-associated bacterial peritonitis--characterized by an excessive influx of neutrophils and monocytes into the peritoneal cavity--show a selective activation of local Vγ9/Vδ2 T cells by HMB-PP producing but not by HMB-PP deficient bacterial pathogens. The γδ T cell-driven perpetuation of inflammatory responses during acute peritonitis is associated with elevated peritoneal levels of γδ T cells and TNF-α and detrimental clinical outcomes in infections caused by HMB-PP positive microorganisms. Taken together, our findings indicate a direct link between invading pathogens, neutrophils, monocytes and microbe-responsive γδ T cells in

Human Neutrophil Clearance of Bacterial Pathogens Triggers Anti-Microbial γδ T Cell Responses in Early Infection

Science.gov (United States)

Roberts, Gareth W.; Heuston, Sinéad; Brown, Amanda C.; Chess, James A.; Toleman, Mark A.; Gahan, Cormac G. M.; Hill, Colin; Parish, Tanya; Williams, John D.; Davies, Simon J.; Johnson, David W.; Topley, Nicholas; Moser, Bernhard; Eberl, Matthias

2011-01-01

Human blood Vγ9/Vδ2 T cells, monocytes and neutrophils share a responsiveness toward inflammatory chemokines and are rapidly recruited to sites of infection. Studying their interaction in vitro and relating these findings to in vivo observations in patients may therefore provide crucial insight into inflammatory events. Our present data demonstrate that Vγ9/Vδ2 T cells provide potent survival signals resulting in neutrophil activation and the release of the neutrophil chemoattractant CXCL8 (IL-8). In turn, Vγ9/Vδ2 T cells readily respond to neutrophils harboring phagocytosed bacteria, as evidenced by expression of CD69, interferon (IFN)-γ and tumor necrosis factor (TNF)-α. This response is dependent on the ability of these bacteria to produce the microbial metabolite (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP), requires cell-cell contact of Vγ9/Vδ2 T cells with accessory monocytes through lymphocyte function-associated antigen-1 (LFA-1), and results in a TNF-α dependent proliferation of Vγ9/Vδ2 T cells. The antibiotic fosmidomycin, which targets the HMB-PP biosynthesis pathway, not only has a direct antibacterial effect on most HMB-PP producing bacteria but also possesses rapid anti-inflammatory properties by inhibiting γδ T cell responses in vitro. Patients with acute peritoneal-dialysis (PD)-associated bacterial peritonitis – characterized by an excessive influx of neutrophils and monocytes into the peritoneal cavity – show a selective activation of local Vγ9/Vδ2 T cells by HMB-PP producing but not by HMB-PP deficient bacterial pathogens. The γδ T cell-driven perpetuation of inflammatory responses during acute peritonitis is associated with elevated peritoneal levels of γδ T cells and TNF-α and detrimental clinical outcomes in infections caused by HMB-PP positive microorganisms. Taken together, our findings indicate a direct link between invading pathogens, neutrophils, monocytes and microbe-responsive γδ T cells in early

PRM1 and KAR5 function in cell-cell fusion and karyogamy to drive distinct bisexual and unisexual cycles in the Cryptococcus pathogenic species complex.

Directory of Open Access Journals (Sweden)

Ci Fu

2017-11-01

Full Text Available Sexual reproduction is critical for successful evolution of eukaryotic organisms in adaptation to changing environments. In the opportunistic human fungal pathogens, the Cryptococcus pathogenic species complex, C. neoformans primarily undergoes bisexual reproduction, while C. deneoformans undergoes both unisexual and bisexual reproduction. During both unisexual and bisexual cycles, a common set of genetic circuits regulates a yeast-to-hyphal morphological transition, that produces either monokaryotic or dikaryotic hyphae. As such, both the unisexual and bisexual cycles can generate genotypic and phenotypic diversity de novo. Despite the similarities between these two cycles, genetic and morphological differences exist, such as the absence of an opposite mating-type partner and monokaryotic instead of dikaryotic hyphae during C. deneoformans unisexual cycle. To better understand the similarities and differences between these modes of sexual reproduction, we focused on two cellular processes involved in sexual reproduction: cell-cell fusion and karyogamy. We identified orthologs of the plasma membrane fusion protein Prm1 and the nuclear membrane fusion protein Kar5 in both Cryptococcus species, and demonstrated their conserved roles in cell fusion and karyogamy during C. deneoformans α-α unisexual reproduction and C. deneoformans and C. neoformans a-α bisexual reproduction. Notably, karyogamy occurs inside the basidum during bisexual reproduction in C. neoformans, but often occurs earlier following cell fusion during bisexual reproduction in C. deneoformans. Characterization of these two genes also showed that cell fusion is dispensable for solo unisexual reproduction in C. deneoformans. The blastospores produced along hyphae during C. deneoformans unisexual reproduction are diploid, suggesting that diploidization occurs early during hyphal development, possibly through either an endoreplication pathway or cell fusion-independent karyogamy

Assessment of the pathogenicity of cell-culture-adapted Newcastle disease virus strain Komarov.

Science.gov (United States)

Visnuvinayagam, Sivam; Thangavel, K; Lalitha, N; Malmarugan, S; Sukumar, Kuppannan

2015-01-01

Newcastle disease vaccines hitherto in vogue are produced from embryonated chicken eggs. Egg-adapted mesogenic vaccines possess several drawbacks such as paralysis and mortality in 2-week-old chicks and reduced egg production in the egg-laying flock. Owing to these possible drawbacks, we attempted to reduce the vaccine virulence for safe vaccination by adapting the virus in a chicken embryo fibroblast cell culture (CEFCC) system. Eighteen passages were carried out by CEFCC, and the pathogenicity was assessed on the basis of the mean death time, intracerebral pathogenicity index, and intravenous pathogenicity index, at equal passage intervals. Although the reduction in virulence demonstrated with increasing passage levels in CEFCC was encouraging, 20% of the 2-week-old birds showed paralytic symptoms with the virus vaccine from the 18(th)(final) passage. Thus, a tissue-culture-adapted vaccine would demand a few more passages by CEFCC in order to achieve a complete reduction in virulence for use as a safe and effective vaccine, especially among younger chicks. Moreover, it can be safely administered even to unprimed 8-week-old birds.

Altered T-cell responses by the periodontal pathogen Porphyromonas gingivalis.

Directory of Open Access Journals (Sweden)

Hazem Khalaf

Full Text Available Several studies support an association between the chronic inflammatory diseases periodontitis and atherosclerosis with a crucial role for the periodontal pathogen Porphyromonas gingivalis. However, the interplay between this pathogen and the adaptive immune system, including T-cells, is sparsely investigated. Here we used Jurkat T-cells to determine the effects of P. gingivalis on T-cell-mediated adaptive immune responses. We show that viable P. gingivalis targets IL-2 expression at the protein level. Initial cellular events, including ROS production and [Ca(2+](i, were elevated in response to P. gingivalis, but AP-1 and NF-κB activity dropped below basal levels and T-cells were unable to sustain stable IL-2 accumulation. IL-2 was partially restored by Leupeptin, but not by Cathepsin B Inhibitor, indicating an involvement of Rgp proteinases in the suppression of IL-2 accumulation. This was further confirmed by purified Rgp that caused a dose-dependent decrease in IL-2 levels. These results provide new insights of how this periodontal pathogen evades the host adaptive immune system by inhibiting IL-2 accumulation and thus attenuating T-cell proliferation and cellular communication.

Genomewide analyses of pathogenic and regulatory T cells of NOD ...

Indian Academy of Sciences (India)

DANG SUN

Two regulatory T cell clones (Tregs) were used in this study. Treg1 cells were clone-derived from the previously described. Keywords. methylation; cDNA microarray; type 1 diabetes; pathogenic T cells; .... Gender-specific differences in.

Potential aquaculture probiont Lactococcus lactis TW34 produces nisin Z and inhibits the fish pathogen Lactococcus garvieae.

Science.gov (United States)

Sequeiros, Cynthia; Garcés, Marisa E; Vallejo, Marisol; Marguet, Emilio R; Olivera, Nelda L

2015-04-01

Bacteriocin-producing Lactococcus lactis TW34 was isolated from marine fish. TW34 bacteriocin inhibited the growth of the fish pathogen Lactococcus garvieae at 5 AU/ml (minimum inhibitory concentration), whereas the minimum bactericidal concentration was 10 AU/ml. Addition of TW34 bacteriocin to L. garvieae cultures resulted in a decrease of six orders of magnitude of viable cells counts demonstrating a bactericidal mode of action. The direct detection of the bacteriocin activity by Tricine-SDS-PAGE showed an active peptide with a molecular mass ca. 4.5 kDa. The analysis by MALDI-TOF-MS detected a strong signal at m/z 2,351.2 that corresponded to the nisin leader peptide mass without the initiating methionine, whose sequence STKDFNLDLVSVSKKDSGASPR was confirmed by MS/MS. Sequence analysis of nisin structural gene confirmed that L. lactis TW34 was a nisin Z producer. This nisin Z-producing strain with probiotic properties might be considered as an alternative in the prevention of lactococcosis, a global disease in aquaculture systems.

Organic metabolites produced by Vibrio parahaemolyticus strain ...

African Journals Online (AJOL)

Identification and action of several antibacterial metabolites produced by a fish pathogen Vibrio parahaemolyticus strain An3 from marine ecosystem of Goa has been demonstrated. Antibacterial activity of the crude cell extract of the test bacterium has been evaluated against indicator pathogenic bacterial strains such as ...

Inflammasome and Fas-Mediated IL-1β Contributes to Th17/Th1 Cell Induction in Pathogenic Bacterial Infection In Vivo.

Science.gov (United States)

Uchiyama, Ryosuke; Yonehara, Shin; Taniguchi, Shun'ichiro; Ishido, Satoshi; Ishii, Ken J; Tsutsui, Hiroko

2017-08-01

CD4 + Th cells play crucial roles in orchestrating immune responses against pathogenic microbes, after differentiating into effector subsets. Recent research has revealed the importance of IFN-γ and IL-17 double-producing CD4 + Th cells, termed Th17/Th1 cells, in the induction of autoimmune and inflammatory diseases. In addition, Th17/Th1 cells are involved in the regulation of infection caused by the intracellular bacterium Mycobacterium tuberculosis in humans. However, the precise mechanism of Th17/Th1 induction during pathogen infection is unclear. In this study, we showed that the inflammasome and Fas-dependent IL-1β induces Th17/Th1 cells in mice, in response to infection with the pathogenic intracellular bacterium Listeria monocytogenes In the spleens of infected wild-type mice, Th17/Th1 cells were induced, and expressed T-bet and Rorγt. In Pycard -/- mice, which lack the adaptor molecule of the inflammasome (apoptosis-associated speck-like protein containing a caspase recruitment domain), Th17/Th1 induction was abolished. In addition, the Fas-mediated IL-1β production was required for Th17/Th1 induction during bacterial infection: Th17/Th1 induction was abolished in Fas -/- mice, whereas supplementation with recombinant IL-1β restored Th17/Th1 induction via IL-1 receptor 1 (IL-1R1), and rescued the mortality of Fas -/- mice infected with Listeria IL-1R1, but not apoptosis-associated speck-like protein containing a caspase recruitment domain or Fas on T cells, was required for Th17/Th1 induction, indicating that IL-1β stimulates IL-1R1 on T cells for Th17/Th1 induction. These results indicate that IL-1β, produced by the inflammasome and Fas-dependent mechanisms, contributes cooperatively to the Th17/Th1 induction during bacterial infection. This study provides a deeper understanding of the molecular mechanisms underlying Th17/Th1 induction during pathogenic microbial infections in vivo. Copyright © 2017 by The American Association of Immunologists

Environmental E.coli isolate characterization and selection as improved indicators for pathogens associated with produce contamination

Science.gov (United States)

Contamination of food and water by pathogens is a substantial public health issue in the United States. According to the Centers for Disease Control and Prevention, 49% of foodborne illness is caused by produce, and despite efforts to reduce produce contamination, these issues persist. Escherichia c...

Indole-3-Acetic Acid Is Produced by Emiliania huxleyi Coccolith-Bearing Cells and Triggers a Physiological Response in Bald Cells.

Science.gov (United States)

Labeeuw, Leen; Khey, Joleen; Bramucci, Anna R; Atwal, Harjot; de la Mata, A Paulina; Harynuk, James; Case, Rebecca J

2016-01-01

Indole-3-acetic acid (IAA) is an auxin produced by terrestrial plants which influences development through a variety of cellular mechanisms, such as altering cell orientation, organ development, fertility, and cell elongation. IAA is also produced by bacterial pathogens and symbionts of plants and algae, allowing them to manipulate growth and development of their host. They do so by either producing excess exogenous IAA or hijacking the IAA biosynthesis pathway of their host. The endogenous production of IAA by algae remains contentious. Using Emiliania huxleyi, a globally abundant marine haptophyte, we investigated the presence and potential role of IAA in algae. Homologs of genes involved in several tryptophan-dependent IAA biosynthesis pathways were identified in E. huxleyi. This suggests that this haptophyte can synthesize IAA using various precursors derived from tryptophan. Addition of L-tryptophan to E. huxleyi stimulated IAA production, which could be detected using Salkowski's reagent and GC × GC-TOFMS in the C cell type (coccolith bearing), but not in the N cell type (bald). Various concentrations of IAA were exogenously added to these two cell types to identify a physiological response in E. huxleyi. The N cell type, which did not produce IAA, was more sensitive to it, showing an increased variation in cell size, membrane permeability, and a corresponding increase in the photosynthetic potential quantum yield of Photosystem II (PSII). A roseobacter (bacteria commonly associated with E. huxleyi) Ruegeria sp. R11, previously shown to produce IAA, was co-cultured with E. huxleyi C and N cells. IAA could not be detected from these co-cultures, and even when stimulated by addition of L-tryptophan, they produced less IAA than axenic C type culture similarly induced. This suggests that IAA plays a novel role signaling between different E. huxleyi cell types, rather than between a bacteria and its algal host.

Yeast cell differentiation: Lessons from pathogenic and non-pathogenic yeasts.

Science.gov (United States)

Palková, Zdena; Váchová, Libuše

2016-09-01

Yeasts, historically considered to be single-cell organisms, are able to activate different differentiation processes. Individual yeast cells can change their life-styles by processes of phenotypic switching such as the switch from yeast-shaped cells to filamentous cells (pseudohyphae or true hyphae) and the transition among opaque, white and gray cell-types. Yeasts can also create organized multicellular structures such as colonies and biofilms, and the latter are often observed as contaminants on surfaces in industry and medical care and are formed during infections of the human body. Multicellular structures are formed mostly of stationary-phase or slow-growing cells that diversify into specific cell subpopulations that have unique metabolic properties and can fulfill specific tasks. In addition to the development of multiple protective mechanisms, processes of metabolic reprogramming that reflect a changed environment help differentiated individual cells and/or community cell constituents to survive harmful environmental attacks and/or to escape the host immune system. This review aims to provide an overview of differentiation processes so far identified in individual yeast cells as well as in multicellular communities of yeast pathogens of the Candida and Cryptococcus spp. and the Candida albicans close relative, Saccharomyces cerevisiae. Molecular mechanisms and extracellular signals potentially involved in differentiation processes are also briefly mentioned. Copyright © 2016 Elsevier Ltd. All rights reserved.

Differential lung NK cell responses in avian influenza virus infected chickens correlate with pathogenicity

OpenAIRE

Jansen, C.A.; de Geus, E.D.; van Haarlem, D.A.; van de Haar, P.M.; Löndt, B.Z; Graham, S.P.; Göbel, T.W.; van Eden, W.; Brookes, S.M.; Vervelde, L.

2013-01-01

Infection of chickens with low pathogenicity avian influenza (LPAI) virus results in mild clinical signs while infection with highly pathogenic avian influenza (HPAI) viruses causes death of the birds within 36–48 hours. Since natural killer (NK) cells have been shown to play an important role in influenza-specific immunity, we hypothesise that NK cells are involved in this difference in pathogenicity. To investigate this, the role of chicken NK-cells in LPAI virus infection was studied. Next...

Pathogen-free, plasma-poor platelet lysate and expansion of human mesenchymal stem cells.

Science.gov (United States)

Iudicone, Paola; Fioravanti, Daniela; Bonanno, Giuseppina; Miceli, Michelina; Lavorino, Claudio; Totta, Pierangela; Frati, Luigi; Nuti, Marianna; Pierelli, Luca

2014-01-27

Supplements to support clinical-grade cultures of mesenchymal stem cells (MSC) are required to promote growth and expansion of these cells. Platelet lysate (PL) is a human blood component which may replace animal serum in MSC cultures being rich in various growth factors. Here, we describe a plasma poor pathogen-free platelet lysate obtained by pooling 12 platelet (PLT) units, to produce a standardized and safe supplement for clinical-grade expansion of MSC. PL lots were obtained by combining 2 6-unit PLT pools in additive solution (AS) following a transfusional-based procedure including pathogen inactivation (PI) by Intercept technology and 3 cycles of freezing/thawing, followed by membrane removal. Three PI-PL and 3 control PL lots were produced to compare their ability to sustain bone marrow derived MSC selection and expansion. Moreover, two further PL, subjected to PI or not, were also produced starting from the same initial PLT pools to evaluate the impact of PI on growth factor concentration and capacity to sustain cell growth. Additional PI-PL lots were used for comparison with fetal bovine serum (FBS) on MSC expansion. Immunoregulatory properties of PI-PL-generated MSC were documented in vitro by mixed lymphocyte culture (MLC) and peripheral blood mononuclear cells (PBMC) mitogen induced proliferation. PI-PL and PL control lots had similar concentrations of 4 well-described growth factors endowed with MSC stimulating ability. Initial growth and MSC expansion by PI-PL and PL controls were comparable either using different MSC populations or in head to head experiments. Moreover, PI-PL and PL control sustained similar MSC growth of frozen/thawed MSC. Multilineage differentiation of PI-derived and PI-PL-derived MSC were maintained in any MSC cultures as well as their immunoregulatory properties. Finally, no direct impact of PI on growth factor concentration and MSC growth support was observed, whereas the capacity of FBS to sustain MSC expansion in basic

The cereal pathogen Fusarium pseudograminearum produces a new class of active cytokinins during infection

DEFF Research Database (Denmark)

Sørensen, Jens Laurids; Benfield, Aurelie H.; Wollenberg, Rasmus Dam

2018-01-01

-senescence activities and the production of a cytokinin mimic by what was once considered a necrotrophic pathogen that promotes cell death and senescence challenges the simple view that this pathogen invades its hosts by employing a barrage of lytic enzymes and toxins. Through genome mining, a gene cluster in the F....... pseudograminearum genome for the production of Fusarium cytokinins was identified and the biosynthetic pathway established using gene knockouts. The Fusarium cytokinins could activate plant cytokinin signalling, demonstrating their genuine hormone mimicry. In planta analysis of the transcriptional response to one...

Associations between pathogen-specific clinical mastitis and somatic cell count patterns

NARCIS (Netherlands)

Haas, de Y.; Veerkamp, R.F.; Barkema, H.W.; Gröhn, Y.T.; Schukken, Y.H.

2004-01-01

Associations were estimated between pathogen-specific cases of clinical mastitis (CM) and somatic cell count (SCC) patterns based on deviations from the typical curve for SCC during lactation and compared with associations between pathogen-specific CM and lactation average SCC. Data from 274 Dutch

Host-pathogen interactions in bovine mammary epithelial cells and HeLa cells by Staphylococcus aureus isolated from subclinical bovine mastitis.

Science.gov (United States)

Castilho, Ivana G; Dantas, Stéfani Thais Alves; Langoni, Hélio; Araújo, João P; Fernandes, Ary; Alvarenga, Fernanda C L; Maia, Leandro; Cagnini, Didier Q; Rall, Vera L M

2017-08-01

Staphylococcus aureus is a common pathogen that causes subclinical bovine mastitis due to several virulence factors. In this study, we analyzed S. aureus isolates collected from the milk of cows with subclinical mastitis that had 8 possible combinations of bap, icaA, and icaD genes, to determine their capacity to produce biofilm on biotic (bovine primary mammary epithelial cells and HeLa cells) and abiotic (polystyrene microplates) surfaces, and their ability to adhere to and invade these cells. We also characterized isolates for microbial surface components recognizing adhesive matrix molecules (MSCRAMM) and agr genes, and for their susceptibility to cefquinome sulfate in the presence of biofilm. All isolates adhered to and invaded both cell types, but invasion indexes were higher in bovine primary mammary epithelial cells. Using tryptic soy broth + 1% glucose on abiotic surfaces, 5 out of 8 isolates were biofilm producers, but only the bap + icaA + icaD + isolate was positive in Dulbecco's Modified Eagle's medium. The production of biofilm on biotic surfaces occurred only with this isolate and only on HeLa cells, because the invasion index for bovine primary mammary epithelial cells was too high, making it impossible to use these cells in this assay. Of the 5 biofilm producers in tryptic soy broth + 1% glucose, 4 presented with the bap/fnbA/clfA/clfB/eno/fib/ebpS combination, and all were protected from cefquinome sulfate. We found no predominance of any agr group. The high invasive potential of S. aureus made it impossible to observe biofilm in bovine primary mammary epithelial cells, and we concluded that cells with lower invasion rates, such as HeLa cells, were more appropriate for this assay. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Melanin as a virulence factor of Paracoccidioides brasiliensis and other dimorphic pathogenic fungi: a minireview

OpenAIRE

Taborda, Carlos P.; da Silva, Marcelo B.; Nosanchuk, Joshua D.; Travassos, Luiz R.

2008-01-01

Melanin pigments are substances produced by a broad variety of pathogenic microorganisms, including bacteria, fungi, and helminths. Microbes predominantly produce melanin pigment via tyrosinases, laccases, catecholases, and the polyketide synthase pathway. In fungi, melanin is deposited in the cell wall and cytoplasm, and melanin particles (“ghosts”) can be isolated from these fungi that have the same size and shape of the original cells. Melanin has been reported in several human pathogenic ...

Contamination of cell phones by pathogenic microorganisms: Comparison between hospital staff and college students

Directory of Open Access Journals (Sweden)

PURNIMA R. CHITLANGE

2014-11-01

Full Text Available Chitlange PR. 2014. Contamination of cell phones by pathogenic microorganisms: Comparison between hospital staff and college students. Nusantara Bioscience 6: 203-206. Cell phone (CP is a long range portable electronic device. The cell phone is constantly exposed to arrays of micro organisms, making it a harbour and breeding ground for microbes especially those associated with skin. The adult human is covered with approximately 2m2 of skin with area supporting about 106 bacteria. To check whether the cell phone act as a vector for transmission of various pathogens, a potential study was carried out in microbiology department of Shri Radhakisan Laxminarayan Toshniwal College of Science, Akola. Total 20 cell samples were screened. Two parameters were considered: College students and hospital staff. The isolated bacteria Staphylococcus aureus, E. coli, Pseudomonas sp., Bacillus subtilis, Aerobacter aerogenes, Salmonella, Shigella, Streptococci, P. vulgaris were identified on the basis of morphological and cultural characteristics. The main aim of present study was to check the contamination by bacterial pathogens on cell phones and also to check role of cell phone for transmission of pathogens from person to person or not.

Involvement of Activating NK Cell Receptors and Their Modulation in Pathogen Immunity

Directory of Open Access Journals (Sweden)

Francesco Marras

2011-01-01

Full Text Available Natural Killer (NK cells are endowed with cell-structure-sensing receptors providing inhibitory protection from self-destruction (inhibitory NK receptors, iNKRs, including killer inhibitory receptors and other molecules and rapid triggering potential leading to functional cell activation by Toll-like receptors (TLRs, cytokine receptors, and activating NK cell receptors including natural cytotoxicity receptors (NCRs, i.e., NKp46, NKp46, and NKp44. NCR and NKG2D recognize ligands on infected cells which may be endogenous or may directly bind to some structures derived from invading pathogens. In this paper, we address the known direct or indirect interactions between activating receptors and pathogens and their expression during chronic HIV and HCV infections.

Effect of Disinfectants on Preventing the Cross-Contamination of Pathogens in Fresh Produce Washing Water

NARCIS (Netherlands)

Banach, J.L.; Sampers, I.; Haute, van S.; Fels, van der H.J.

2015-01-01

The potential cross-contamination of pathogens between clean and contaminated produce in the washing tank is highly dependent on the water quality. Process wash water disinfectants are applied to maintain the water quality during processing. The review examines the efficacy of process wash water

Effect of Disinfectants on Preventing the Cross-Contamination of Pathogens in Fresh Produce Washing Water

Directory of Open Access Journals (Sweden)

Jennifer L. Banach

2015-07-01

Full Text Available The potential cross-contamination of pathogens between clean and contaminated produce in the washing tank is highly dependent on the water quality. Process wash water disinfectants are applied to maintain the water quality during processing. The review examines the efficacy of process wash water disinfectants during produce processing with the aim to prevent cross-contamination of pathogens. Process wash water disinfection requires short contact times so microorganisms are rapidly inactivated. Free chlorine, chlorine dioxide, ozone, and peracetic acid were considered suitable disinfectants. A disinfectant’s reactivity with the organic matter will determine the disinfectant residual, which is of paramount importance for microbial inactivation and should be monitored in situ. Furthermore, the chemical and worker safety, and the legislative framework will determine the suitability of a disinfection technique. Current research often focuses on produce decontamination and to a lesser extent on preventing cross-contamination. Further research on a sanitizer’s efficacy in the washing water is recommended at the laboratory scale, in particular with experimental designs reflecting industrial conditions. Validation on the industrial scale is warranted to better understand the overall effects of a sanitizer.

Effect of Disinfectants on Preventing the Cross-Contamination of Pathogens in Fresh Produce Washing Water

Science.gov (United States)

Banach, Jennifer L.; Sampers, Imca; Van Haute, Sam; van der Fels-Klerx, H.J. (Ine)

2015-01-01

The potential cross-contamination of pathogens between clean and contaminated produce in the washing tank is highly dependent on the water quality. Process wash water disinfectants are applied to maintain the water quality during processing. The review examines the efficacy of process wash water disinfectants during produce processing with the aim to prevent cross-contamination of pathogens. Process wash water disinfection requires short contact times so microorganisms are rapidly inactivated. Free chlorine, chlorine dioxide, ozone, and peracetic acid were considered suitable disinfectants. A disinfectant’s reactivity with the organic matter will determine the disinfectant residual, which is of paramount importance for microbial inactivation and should be monitored in situ. Furthermore, the chemical and worker safety, and the legislative framework will determine the suitability of a disinfection technique. Current research often focuses on produce decontamination and to a lesser extent on preventing cross-contamination. Further research on a sanitizer’s efficacy in the washing water is recommended at the laboratory scale, in particular with experimental designs reflecting industrial conditions. Validation on the industrial scale is warranted to better understand the overall effects of a sanitizer. PMID:26213953

Genomewide analyses of pathogenic and regulatory T cells of NOD ...

Indian Academy of Sciences (India)

Reestablishing a well-balanced population of regulatory T cells (Tregs) and pathogenic T cells (Tpaths) is necessary for diabetic patients to regain glucose control. However, the molecular mechanisms modulating functional differentiation of Tpaths and Tregs remain unclear. In this study, we anal- ysed the gene expression ...

Glycosaminoglycans are involved in pathogen adherence to corneal epithelial cells differently for Gram-positive and Gram-negative bacteria

Directory of Open Access Journals (Sweden)

Beatriz García

2016-11-01

Full Text Available The epithelium of the cornea is continuously exposed to pathogens, and adhesion to epithelial cells is regarded as an essential first step in bacterial pathogenesis. In this article, the involvement of glycosaminoglycans in the adhesion of various pathogenic bacteria to corneal epithelial cells is analyzed. All microorganisms use glycosaminoglycans as receptors, but arranged in different patterns depending on the Gram-type of the bacterium. The heparan sulfate chains of syndecans are the main receptors, though other molecular species also seem to be involved, particularly in Gram-negative bacteria. Adherence is inhibited differentially by peptides, including heparin binding sequences, indicating the participation of various groups of Gram-positive and -negative adhesins. The length of the saccharides produces a major effect, and low molecular weight chains inhibit the binding of Gram-negative microorganisms but increase the adherence of Gram-positives. Pathogen adhesion appears to occur preferentially through sulfated domains, and is very dependent on N- and 6-O-sulfation of the glucosamine residue and, to a lesser extent, 2-O sulfation of uronic acid. These data show the differential use of corneal receptors, which could facilitate the development of new anti-infective strategies.

Follicular B Cells Promote Atherosclerosis via T Cell-Mediated Differentiation Into Plasma Cells and Secreting Pathogenic Immunoglobulin G.

Science.gov (United States)

Tay, Christopher; Liu, Yu-Han; Kanellakis, Peter; Kallies, Axel; Li, Yi; Cao, Anh; Hosseini, Hamid; Tipping, Peter; Toh, Ban-Hock; Bobik, Alex; Kyaw, Tin

2018-05-01

B cells promote or protect development of atherosclerosis. In this study, we examined the role of MHCII (major histocompatibility II), CD40 (cluster of differentiation 40), and Blimp-1 (B-lymphocyte-induced maturation protein) expression by follicular B (FO B) cells in development of atherosclerosis together with the effects of IgG purified from atherosclerotic mice. Using mixed chimeric Ldlr -/- mice whose B cells are deficient in MHCII or CD40, we demonstrate that these molecules are critical for the proatherogenic actions of FO B cells. During development of atherosclerosis, these deficiencies affected T-B cell interactions, germinal center B cells, plasma cells, and IgG. As FO B cells differentiating into plasma cells require Blimp-1, we also assessed its role in the development of atherosclerosis. Blimp-1-deficient B cells greatly attenuated atherosclerosis and immunoglobulin-including IgG production, preventing IgG accumulation in atherosclerotic lesions; Blimp-1 deletion also attenuated lesion proinflammatory cytokines, apoptotic cell numbers, and necrotic core. To determine the importance of IgG for atherosclerosis, we purified IgG from atherosclerotic mice. Their transfer but not IgG from nonatherosclerotic mice into Ldlr -/- mice whose B cells are Blimp-1-deficient increased atherosclerosis; transfer was associated with IgG accumulating in atherosclerotic lesions, increased lesion inflammatory cytokines, apoptotic cell numbers, and necrotic core size. The mechanism by which FO B cells promote atherosclerosis is highly dependent on their expression of MHCII, CD40, and Blimp-1. FO B cell differentiation into IgG-producing plasma cells also is critical for their proatherogenic actions. Targeting B-T cell interactions and pathogenic IgG may provide novel therapeutic strategies to prevent atherosclerosis and its adverse cardiovascular complications. © 2018 American Heart Association, Inc.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Directory of Open Access Journals (Sweden)

J.A. Khan

2013-09-01

Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

CD56 Is a Pathogen Recognition Receptor on Human Natural Killer Cells.

Science.gov (United States)

Ziegler, Sabrina; Weiss, Esther; Schmitt, Anna-Lena; Schlegel, Jan; Burgert, Anne; Terpitz, Ulrich; Sauer, Markus; Moretta, Lorenzo; Sivori, Simona; Leonhardt, Ines; Kurzai, Oliver; Einsele, Hermann; Loeffler, Juergen

2017-07-21

Aspergillus (A.) fumigatus is an opportunistic fungal mold inducing invasive aspergillosis (IA) in immunocompromised patients. Although antifungal activity of human natural killer (NK) cells was shown in previous studies, the underlying cellular mechanisms and pathogen recognition receptors (PRRs) are still unknown. Using flow cytometry we were able to show that the fluorescence positivity of the surface receptor CD56 significantly decreased upon fungal contact. To visualize the interaction site of NK cells and A. fumigatus we used SEM, CLSM and dSTORM techniques, which clearly demonstrated that NK cells directly interact with A. fumigatus via CD56 and that CD56 is re-organized and accumulated at this interaction site time-dependently. The inhibition of the cytoskeleton showed that the receptor re-organization was an active process dependent on actin re-arrangements. Furthermore, we could show that CD56 plays a role in the fungus mediated NK cell activation, since blocking of CD56 surface receptor reduced fungal mediated NK cell activation and reduced cytokine secretion. These results confirmed the direct interaction of NK cells and A. fumigatus, leading to the conclusion that CD56 is a pathogen recognition receptor. These findings give new insights into the functional role of CD56 in the pathogen recognition during the innate immune response.

Increased IL-35 producing Tregs and CD19+IL-35+ cells are associated with disease progression in leprosy patients.

Science.gov (United States)

Tarique, Mohd; Saini, Chaman; Naqvi, Raza Ali; Khanna, Neena; Rao, D N

2017-03-01

The clinical forms of leprosy consist of a spectrum that reflects the host's immune response to the M. leprae; it provides an ideal model to study the host pathogen interaction and immunological dysregulation in humans. IL-10 and TGF-β producing Tregs are high in leprosy patients and responsible for immune suppression and M. leprae specific T cells anergy. In leprosy, involvement of IL-35 producing Tregs and Bregs remain unstudied. To study the role of IL-35 producing Tregs and Bregs in the human leprosy. Peripheral blood mononuclear cells from leprosy patients were isolated and stimulated with M. leprae antigen (MLCwA) for 48h. Intracellular cytokine IL-35 was evaluated in CD4 + CD25 + Tregs, CD19 + cells by FACS. Expression of PD-1 on CD4 + CD25 + Tregs, CD19 + cells and its ligand (PD-L1) on B cells, CD11c cells were evaluated by flow cytometry (FACS). Serum IL-35 level was estimated by ELISA. The frequency of IL-35 producing Tregs and Bregs cells were found to be high in leprosy patients (pleprosy patients. This study point out a shift in our understanding of the immunological features that mediate and regulate the immune suppression and the disease progression in leprosy patients with a new paradigm (IL-35 producing Tregs and Bregs) that is beyond TGF-β and IL-10 producing Treg cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

O antigen modulates insect vector acquisition of the bacterial plant pathogen Xylella fastidiosa.

Science.gov (United States)

Rapicavoli, Jeannette N; Kinsinger, Nichola; Perring, Thomas M; Backus, Elaine A; Shugart, Holly J; Walker, Sharon; Roper, M Caroline

2015-12-01

Hemipteran insect vectors transmit the majority of plant pathogens. Acquisition of pathogenic bacteria by these piercing/sucking insects requires intimate associations between the bacterial cells and insect surfaces. Lipopolysaccharide (LPS) is the predominant macromolecule displayed on the cell surface of Gram-negative bacteria and thus mediates bacterial interactions with the environment and potential hosts. We hypothesized that bacterial cell surface properties mediated by LPS would be important in modulating vector-pathogen interactions required for acquisition of the bacterial plant pathogen Xylella fastidiosa, the causative agent of Pierce's disease of grapevines. Utilizing a mutant that produces truncated O antigen (the terminal portion of the LPS molecule), we present results that link this LPS structural alteration to a significant decrease in the attachment of X. fastidiosa to blue-green sharpshooter foreguts. Scanning electron microscopy confirmed that this defect in initial attachment compromised subsequent biofilm formation within vector foreguts, thus impairing pathogen acquisition. We also establish a relationship between O antigen truncation and significant changes in the physiochemical properties of the cell, which in turn affect the dynamics of X. fastidiosa adhesion to the vector foregut. Lastly, we couple measurements of the physiochemical properties of the cell with hydrodynamic fluid shear rates to produce a Comsol model that predicts primary areas of bacterial colonization within blue-green sharpshooter foreguts, and we present experimental data that support the model. These results demonstrate that, in addition to reported protein adhesin-ligand interactions, O antigen is crucial for vector-pathogen interactions, specifically in the acquisition of this destructive agricultural pathogen. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Biocontrol interventions for inactivation of foodborne pathogens on produce

Science.gov (United States)

Post-harvest interventions for control of foodborne pathogens on minimally processed foods are crucial for food safety. Biocontrol interventions have the primary objective of developing novel antagonists in combinations with physical and chemical interventions to inactivate pathogenic microbes. Ther...

Intervention technologies for food safety on minimally processed produce:Perspectives on food-borne and plant pathogens

Science.gov (United States)

Produce contamination associated with enteric pathogens such Escherichia coli O157:H7, salmonella spp., Listeria monocytogenes, Shigella and others are significant challenges to food safety. This is due to the illnesses and economic impacts resulting from the outbreaks. Innovative technologies for i...

In vitro and in vivo infectivity and pathogenicity of the lymphoid cell-derived woodchuck hepatitis virus.

Science.gov (United States)

Lew, Y Y; Michalak, T I

2001-02-01

Woodchuck hepatitis virus (WHV) and human hepatitis B virus are closely related, highly hepatotropic mammalian DNA viruses that also replicate in the lymphatic system. The infectivity and pathogenicity of hepadnaviruses propagating in lymphoid cells are under debate. In this study, hepato- and lymphotropism of WHV produced by naturally infected lymphoid cells was examined in specifically established woodchuck hepatocyte and lymphoid cell cultures and coculture systems, and virus pathogenicity was tested in susceptible animals. Applying PCR-based assays discriminating between the total pool of WHV genomes and covalently closed circular DNA (cccDNA), combined with enzymatic elimination of extracellular viral sequences potentially associated with the cell surface, our study documents that virus replicating in woodchuck lymphoid cells is infectious to homologous hepatocytes and lymphoid cells in vitro. The productive replication of WHV from lymphoid cells in cultured hepatocytes was evidenced by the appearance of virus-specific DNA, cccDNA, and antigens, transmissibility of the virus through multiple passages in hepatocyte cultures, and the ability of the passaged virus to infect virus-naive animals. The data also revealed that WHV from lymphoid cells can initiate classical acute viral hepatitis in susceptible animals, albeit small quantities (approximately 10(3) virions) caused immunovirologically undetectable (occult) WHV infection that engaged the lymphatic system but not the liver. Our results provide direct in vitro and in vivo evidence that lymphoid cells in the infected host support propagation of infectious hepadnavirus that has the potential to induce hepatitis. They also emphasize a principal role of the lymphatic system in the maintenance and dissemination of hepadnavirus infection, particularly when infection is induced by low virus doses.

Translocation of cell-penetrating peptides into Candida fungal pathogens.

Science.gov (United States)

Gong, Zifan; Karlsson, Amy J

2017-09-01

Cell-penetrating peptides (CPPs) are small peptides capable of crossing cellular membranes while carrying molecular cargo. Although they have been widely studied for their ability to translocate nucleic acids, small molecules, and proteins into mammalian cells, studies of their interaction with fungal cells are limited. In this work, we evaluated the translocation of eleven fluorescently labeled peptides into the important human fungal pathogens Candida albicans and C. glabrata and explored the mechanisms of translocation. Seven of these peptides (cecropin B, penetratin, pVEC, MAP, SynB, (KFF) 3 K, and MPG) exhibited substantial translocation (>80% of cells) into both species in a concentration-dependent manner, and an additional peptide (TP-10) exhibiting strong translocation into only C. glabrata. Vacuoles were involved in translocation and intracellular trafficking of the peptides in the fungal cells and, for some peptides, escape from the vacuoles and localization in the cytosol were correlated to toxicity toward the fungal cells. Endocytosis was involved in the translocation of cecropin B, MAP, SynB, MPG, (KFF) 3 K, and TP-10, and cecropin B, penetratin, pVEC, and MAP caused membrane permeabilization during translocation. These results indicate the involvement of multiple translocation mechanisms for some CPPs. Although high levels of translocation were typically associated with toxicity of the peptides toward the fungal cells, SynB was translocated efficiently into Candida cells at concentrations that led to minimal toxicity. Our work highlights the potential of CPPs in delivering antifungal molecules and other bioactive cargo to Candida pathogens. © 2017 The Protein Society.

AMPK in Pathogens

OpenAIRE

Mesquita, Inês Morais; Moreira, Diana; Marques, Belém Sampaio; Laforge, Mireille; Cordeiro-da-Silva, Anabela; Ludovico, Paula; Estaquier, Jérôme; Silvestre, Ricardo Jorge Leal

2016-01-01

During host–pathogen interactions, a complex web of events is crucial for the outcome of infection. Pathogen recognition triggers powerful cellular signaling events that is translated into the induction and maintenance of innate and adaptive host immunity against infection. In opposition, pathogens employ active mechanisms to manipulate host cell regulatory pathways toward their proliferation and survival. Among these, subversion of host cell energy metabolism by pathogens is currently recogn...

DMPD: Innate immune sensing of pathogens and danger signals by cell surface Toll-likereceptors. [Dynamic Macrophage Pathway CSML Database

Lifescience Database Archive (English)

Full Text Available 17275324 Innate immune sensing of pathogens and danger signals by cell surface Toll... Show Innate immune sensing of pathogens and danger signals by cell surface Toll-likereceptors. PubmedID 172...75324 Title Innate immune sensing of pathogens and danger signals by cell surface

Adhesion of Human Probiotic Lactobacillus rhamnosus to Cervical and Vaginal Cells and Interaction with Vaginosis-Associated Pathogens

Directory of Open Access Journals (Sweden)

Sophie Coudeyras

2008-01-01

Full Text Available Objectives. The ability of a probiotic Lactobacillus rhamnosus strain (Lcr35 to adhere to cervical and vaginal cells and to affect the viability of two main vaginosis-associated pathogens, Prevotella bivia, Gardnerella vaginalis, as well as Candida albicans was investigated. Methods. Adhesion ability was determined in vitro with immortalized epithelial cells from the endocervix, ectocervix, and vagina. Coculture experiments were performed to count viable pathogens cells in the presence of Lcr35. Results. Lcr35 was able to specifically and rapidly adhere to the three cell lines. In coculture assays, a decrease in pathogen cell division rate was observed as from 4 hours of incubation and bactericidal activity after a longer period of incubation, mostly with P. bivia. Conclusion. The ability of Lcr35 to adhere to cervicovaginal cells and its antagonist activities against vaginosis-associated pathogens suggest that this probiotic strain is a promising candidate for use in therapy.

Exploration and conservation of bacterial genetic resources as bacteriocin producing inhibitory microorganisms to pathogen bacteria in livestock

Directory of Open Access Journals (Sweden)

Chotiah S

2013-06-01

Full Text Available Exploration and conservation of microorganisms producing bacteriocin was done as the primary study towards the collection of potential bacteria and its application in improving livestock health condition and inhibit food borne pathogens. Diferent kinds of samples such as beef cattle rectal swab, rumen fluids, cow’s milk, chicken gut content, goat’s milk were collected at Bogor cattle slaughter houses, poultry slaughter houses, dairy cattle and goat farms. A total of 452 bacterial isolates consisted of 73 Gram negative bacteria and 379 Gram positive bacteria were isolated from samples collected and screened for bacteriocin activity. Determination of bacteriocin activity with bioassay using agar spot tests were carried out on liquid and semisolid medium assessing 8 kins of indicators of pathogenic bacteria and food borne pathogens. A total of 51 bacteriocin producing strains were collected and some of the strains had high inhibitory zone such as Lactobacillus casei SS14C (26 mm, Enterobacter cloacae SRUT (24mm, Enterococcus faecalis SK39 (21mm and Bifidobacterium dentium SS14T (20mm respectively, to Salmonella typhimurium BCC B0046/ATCC 13311, E. coli O157 hemolytic BCC B2717, Listeria monocytogenes BCC B2767/ATCC 7764 and Escherichia coli VTEC O157 BCC B2687. Evaluation after conservation ex situ to all bacterocin producing strain at 5oC for 1 year in freeze drying ampoules in vacuum and dry condition revealed the decreasing viability starting from log 0.8 CFU/ml for Lactococcus and Leuconostoc to log 2.2. CFU/ml for Streptococcus. Result of the study showed that the bacteriocin producing strains obtained were offered a potential resource for preventing disease of livestock and food borne diseases.

The modular nature of dendritic cell responses to commensal and pathogenic fungi.

Directory of Open Access Journals (Sweden)

Lisa Rizzetto

Full Text Available The type of adaptive immune response following host-fungi interaction is largely determined at the level of the antigen-presenting cells, and in particular by dendritic cells (DCs. The extent to which transcriptional regulatory events determine the decision making process in DCs is still an open question. By applying the highly structured DC-ATLAS pathways to analyze DC responses, we classified the various stimuli by revealing the modular nature of the different transcriptional programs governing the recognition of either pathogenic or commensal fungi. Through comparison of the network parts affected by DC stimulation with fungal cells and purified single agonists, we could determine the contribution of each receptor during the recognition process. We observed that initial recognition of a fungus creates a temporal window during which the simultaneous recruitment of cell surface receptors can intensify, complement and sustain the DC activation process. The breakdown of the response to whole live cells, through the purified components, showed how the response to invading fungi uses a set of specific modules. We find that at the start of fungal recognition, DCs rapidly initiate the activation process. Ligand recognition is further enhanced by over-expression of the receptor genes, with a significant correspondence between gene expression and protein levels and function. Then a marked decrease in the receptor levels follows, suggesting that at this moment the DC commits to a specific fate. Overall our pathway based studies show that the temporal window of the fungal recognition process depends on the availability of ligands and is different for pathogens and commensals. Modular analysis of receptor and signalling-adaptor expression changes, in the early phase of pathogen recognition, is a valuable tool for rapid and efficient dissection of the pathogen derived components that determine the phenotype of the DC and thereby the type of immune response

Antagonistics against pathogenic Bacillus cereus in milk fermentation by Lactobacillus plantarum ZDY2013 and its anti-adhesion effect on Caco-2 cells against pathogens.

Science.gov (United States)

Zhang, Zhihong; Tao, Xueying; Shah, Nagendra P; Wei, Hua

2016-04-01

Lactobacillus plantarum ZDY2013 is a potential probiotic isolated from fermented bean acid. In this study, we aimed to evaluate the in vitro antimicrobial activity of this organism against Bacillus cereus in milk fermentation, the antiadhesion ability on intestinal epithelial cells, as well as its ability to abrogate the cytotoxic effect and expression levels of genes. We found no antimicrobial activity produced by L. plantarum once the pH was adjusted to 6.0 and 7.0. The pH decreased continuously when L. plantarum and B. cereus were co-incubated during milk fermentation, which caused a decrease in the B. cereus counts. Antiadhesion assays showed that L. plantarum can significantly inhibit the adhesion of enterotoxin-producing B. cereus ATCC14579 and pathogenic B. cereus HN001 by inhibition, competition, and displacement. The supernatants of B. cereus, either alone or in conjunction with L. plantarum, caused damage to the membrane integrity of Caco-2 cells to release lactate dehydrogenase. In addition, L. plantarum tended to attenuate proinflammatory cytokine and oxidative stress gene expression on Caco-2 cells, inducing with B. cereus HN001 supernatants. This study provided systematic insights into the antagonistic effect of L. plantarum ZDY2013, and the information may be helpful to explore potential control measures for preventing food poisoning by lactic acid bacteria. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Prevalence and concentration of bacterial pathogens in raw produce and minimally processed packaged salads produced in and for the Netherlands.

Science.gov (United States)

Wijnands, Lucas M; Delfgou-van Asch, Ellen H M; Beerepoot-Mensink, Marieke E; van der Meij-Florijn, Alice; Fitz-James, Ife; van Leusden, Frans M; Pielaat, Annemarie

2014-03-01

Recent outbreaks with vegetable or fruits as vehicles have raised interest in the characterization of the public health risk due to microbial contamination of these commodities. Because qualitative and quantitative data regarding prevalence and concentration of various microbes are lacking, we conducted a survey to estimate the prevalence and contamination level of raw produce and the resulting minimally processed packaged salads as sold in The Netherlands. A dedicated sampling plan accounted for the amount of processed produce in relation to the amount of products, laboratory capacity, and seasonal influences. Over 1,800 samples of produce and over 1,900 samples of ready-to-eat mixed salads were investigated for Salmonella enterica serovars, Campylobacter spp., Escherichia coli O157, and Listeria monocytogenes. The overall prevalence in raw produce varied between 0.11% for E. coli O157 and L. monocytogenes and 0.38% for Salmonella. Prevalence point estimates for specific produce/pathogen combinations ranged for Salmonella from 0.53% in iceberg lettuce to 5.1% in cucumber. For Campylobacter, this ranged from 0.83% in endive to 2.7% in oak tree lettuce. These data will be used to determine the public health risk posed by the consumption of ready-to-eat mixed salads in The Netherlands.

Pathogen Screening of Naturally Produced Yakima River Spring Chinook Smolts; Yakima/Klickitat Fisheries Project Monitoring and Evaluation Report 6 of 7, 2003-2004 Annual Report.

Energy Technology Data Exchange (ETDEWEB)

Thomas, Joan B. (Washington Department of Fish and Wildlife, Olympia, WA)

2004-05-01

In 1999 the Cle Elum Hatchery began releasing spring chinook salmon smolts into the upper Yakima River to increase natural production. Part of the evaluation of this program is to monitor whether introduction of hatchery produced smolts would impact the prevalence of specific pathogens in the naturally produced spring chinook smolts. Increases in prevalence of any of these pathogens could negatively impact the survival of these fish. In 1998 and 2000 through 2003 naturally produced smolts were collected for monitoring at the Chandler smolt collection facility on the lower Yakima River. Smolts were collected from mid to late outmigration, with a target of 200 fish each year. The pathogens monitored were infectious hematopoeitic necrosis virus, infectious pancreatic necrosis virus, viral hemorrhagic septicemia virus, Flavobacterium psychrophilum, Flavobacterium columnare, Aeromonas salmonicida, Yersinia ruckeri, Edwardsiella ictaluri, Renibacterium salmoninarum and Myxobolus cerebralis. To date, only the bacterial pathogens have been detected and prevalences have been low. Prevalences have varied each year and these changes are attributed to normal fluctuation of prevalence. All of the pathogens detected are widely distributed in Washington State.

MR1-restricted MAIT cells display ligand discrimination and pathogen selectivity through distinct T cell receptor usage

DEFF Research Database (Denmark)

Gold, Marielle C.; McLaren, James E.; Reistetter, Joseph A.

2015-01-01

with this interpretation, MAIT cell clones with distinct TCRs responded differentially to a riboflavin metabolite. These results suggest that MAIT cells can discriminate between pathogen-derived ligands in a clonotype-dependent manner, providing a basis for adaptive memory via recruitment of specific repertoires shaped...

Nisin Z produced by Lactococcus lactis from bullfrog hatchery is active against Citrobacter freundii, a red-leg syndrome related pathogen.

Science.gov (United States)

Quintana, Gabriel; Niederle, Maria V; Minahk, Carlos J; Picariello, Gianluca; Nader-Macías, María E F; Pasteris, Sergio E

2017-09-27

Lactococcus lactis subsp. lactis CRL 1584 isolated from a bullfrog hatchery produces a bacteriocin that inhibits both indigenous Citrobacter freundii (a Red-Leg Syndrome related pathogen) and Lactobacillus plantarum, and Listeria monocytogenes as well. Considering that probiotics requires high cell densities and/or bacteriocin concentrations, the effect of the temperature on L. lactis growth and bacteriocin production was evaluated to find the optimal conditions. Thus, the growth rate was maximal at 36 °C, whereas the highest biomass and bacteriocin activity was achieved between 20 and 30 °C and 20-25 °C, respectively. The bacteriocin synthesis was closely growth associated reaching the maximal values at the end of the exponential phase. Since bacteriocins co-production has been evidenced in bacterial genera, a purification of the bacteriocin/s from L. lactis culture supernatants was carried out. The active fraction was purified by cationic-exchange chromatography and then, a RP-HPLC was carried out. The purified sample was a peptide with a 3353.05 Da, a molecular mass that matches nisin Z, which turned out to be the only bacteriocin produced by L. lactis CRL 1584. Nisin Z showed bactericidal effect on C. freundii and L. monocytogenes, which increased in the presence L-lactic acid + H 2 O 2 . This is the first report on nisin Z production by L. lactis from a bullfrog hatchery that resulted active on a Gram-negative pathogen. This peptide has potential probiotic for raniculture and as food biopreservative for bullfrog meat.

Challenges and Strategies for Proteome Analysis of the Interaction of Human Pathogenic Fungi with Host Immune Cells.

Science.gov (United States)

Krüger, Thomas; Luo, Ting; Schmidt, Hella; Shopova, Iordana; Kniemeyer, Olaf

2015-12-14

Opportunistic human pathogenic fungi including the saprotrophic mold Aspergillus fumigatus and the human commensal Candida albicans can cause severe fungal infections in immunocompromised or critically ill patients. The first line of defense against opportunistic fungal pathogens is the innate immune system. Phagocytes such as macrophages, neutrophils and dendritic cells are an important pillar of the innate immune response and have evolved versatile defense strategies against microbial pathogens. On the other hand, human-pathogenic fungi have sophisticated virulence strategies to counteract the innate immune defense. In this context, proteomic approaches can provide deeper insights into the molecular mechanisms of the interaction of host immune cells with fungal pathogens. This is crucial for the identification of both diagnostic biomarkers for fungal infections and therapeutic targets. Studying host-fungal interactions at the protein level is a challenging endeavor, yet there are few studies that have been undertaken. This review draws attention to proteomic techniques and their application to fungal pathogens and to challenges, difficulties, and limitations that may arise in the course of simultaneous dual proteome analysis of host immune cells interacting with diverse morphotypes of fungal pathogens. On this basis, we discuss strategies to overcome these multifaceted experimental and analytical challenges including the viability of immune cells during co-cultivation, the increased and heterogeneous protein complexity of the host proteome dynamically interacting with the fungal proteome, and the demands on normalization strategies in terms of relative quantitative proteome analysis.

B cells promote obesity-associated periodontitis and oral pathogen-associated inflammation.

Science.gov (United States)

Zhu, Min; Belkina, Anna C; DeFuria, Jason; Carr, Jordan D; Van Dyke, Thomas E; Gyurko, Robert; Nikolajczyk, Barbara S

2014-08-01

Individuals with T2D and PD suffer significantly from the ability of one disease to intensify the other. Disease-associated inflammation is one mechanism thought to fuel this pathogenic feed-forward loop. Several lines of evidence indicate that proinflammatory B cells promote T2D and PD; thus, B cells are top candidates for a cell type that predisposes PD in T2D. To test directly the role of B cells in T2D-associated PD, we compared outcomes from oral Porphyromonas gingivalis challenge of lean WT or B cell-null mice with outcomes from mice that were obese and insulin-resistant before challenge. Obese WT mice responded to oral P. gingivalis challenge with significant periodontal bone loss, whereas obese B cell-null mice were protected completely from PD. By contrast, lean WT and B cell-null mice suffer similar periodontal bone loss in response to oral pathogen. B cells from obese/insulin-resistant hosts also support oral osteoclastogenesis and both oral and systemic production of inflammatory cytokines, including pro-osteoclastogenic TNF-α and MIP-2, an ortholog of human IL-8. B cells furthermore impact AT inflammation in obese, P. gingivalis-infected hosts. Taken together, these data show that fundamentally different mechanisms regulate PD in lean and obese hosts, with B cells able to promote PD only if the hosts are "primed" by obesity. These results justify more intense analysis of obesity-associated changes in B cells that predispose PD in human T2D. © 2014 Society for Leukocyte Biology.

Composition of Mineral Produced by Dental Mesenchymal Stem Cells.

Science.gov (United States)

Volponi, A A; Gentleman, E; Fatscher, R; Pang, Y W Y; Gentleman, M M; Sharpe, P T

2015-11-01

Mesenchymal stem cells isolated from different dental tissues have been described to have osteogenic/odontogenic-like differentiation capacity, but little attention has been paid to the biochemical composition of the material that each produces. Here, we used Raman spectroscopy to analyze the mineralized materials produced in vitro by different dental cell populations, and we compared them with the biochemical composition of native dental tissues. We show that different dental stem cell populations produce materials that differ in their mineral and matrix composition and that these differ from those of native dental tissues. In vitro, BCMP (bone chip mass population), SCAP (stem cells from apical papilla), and SHED (stem cells from human-exfoliated deciduous teeth) cells produce a more highly mineralized matrix when compared with that produced by PDL (periodontal ligament), DPA (dental pulp adult), and GF (gingival fibroblast) cells. Principal component analyses of Raman spectra further demonstrated that the crystallinity and carbonate substitution environments in the material produced by each cell type varied, with DPA cells, for example, producing a more carbonate-substituted mineral and with SCAP, SHED, and GF cells creating a less crystalline material when compared with other dental stem cells and native tissues. These variations in mineral composition reveal intrinsic differences in the various cell populations, which may in turn affect their specific clinical applications. © International & American Associations for Dental Research 2015.

[The Advances in the Contamination and Detection of Foodborne Pathogen Noroviruses in Fresh Produce].

Science.gov (United States)

Xie, Yajing; Liu, Xianjin

2015-11-01

This article reviewed the researches proceeding on the contamination and detection of the foodborne pathogen noroviruses (NoVs) in fresh produce, which involved the NoVs contaminations in fresh produce, the special attachment of NoVs in fresh produce, the NoVs outbreaks associated with fresh produce and the NoVs detection in fresh produce. There had been an increase in reported infectious disease risks associated with the consumptions of fresh produce for recent 30 years. Because the NoVs, as a primary cause of viral gastroenteritis thoughout the world, were highly contagious, had a low infectious dose, and were persistent in the environment. And also the methods for NoVs detection in food had significantly developed over the last 15 years. Currently NoVs were the most common pathogen accounting for 40% of outbreaks associated with fresh produce (i. e., fruits and vegetables). Data from outbreaks investigations verified fresh produce as the high risk food products for NoVs. The fresh produce were typically eaten raw with no thermal processing, can be contaminated at any step during production and processing from faecally polluted water and fertilizers, the poor hygiene practices by food handlers and the cross-contamination. The attachment of NoVs to the fresh produce was due to the physio-chemical factors of virus protein coat, the special attachment to different fresh produce, and the possibility for internalization of NoVs. It might provide answers to why those high risk foods were more frequently implicated (i. e., lettuce and raspberries). According to the data of foodborne NoVs outbreaks which were associated with fresh produce from EU countries and the USA, the outbreaks in EU countries were mainly associated with NoVs contaminated raspberries and lettuce, while in USA which were associated with NoVs contaminated lettuce. Unfortunately, there were no NoVs detection methods for fresh produce or the data of foodborne NoVs outbreaks which were associated with

Hotspot autoimmune T cell receptor binding underlies pathogen and insulin peptide cross-reactivity

Science.gov (United States)

Cole, David K.; Bulek, Anna M.; Dolton, Garry; Schauenberg, Andrea J.; Szomolay, Barbara; Trimby, Andrew; Jothikumar, Prithiviraj; Fuller, Anna; Skowera, Ania; Rossjohn, Jamie; Zhu, Cheng; Miles, John J.; Wooldridge, Linda; Rizkallah, Pierre J.; Sewell, Andrew K.

2016-01-01

The cross-reactivity of T cells with pathogen- and self-derived peptides has been implicated as a pathway involved in the development of autoimmunity. However, the mechanisms that allow the clonal T cell antigen receptor (TCR) to functionally engage multiple peptide–major histocompatibility complexes (pMHC) are unclear. Here, we studied multiligand discrimination by a human, preproinsulin reactive, MHC class-I–restricted CD8+ T cell clone (1E6) that can recognize over 1 million different peptides. We generated high-resolution structures of the 1E6 TCR bound to 7 altered peptide ligands, including a pathogen-derived peptide that was an order of magnitude more potent than the natural self-peptide. Evaluation of these structures demonstrated that binding was stabilized through a conserved lock-and-key–like minimal binding footprint that enables 1E6 TCR to tolerate vast numbers of substitutions outside of this so-called hotspot. Highly potent antigens of the 1E6 TCR engaged with a strong antipathogen-like binding affinity; this engagement was governed though an energetic switch from an enthalpically to entropically driven interaction compared with the natural autoimmune ligand. Together, these data highlight how T cell cross-reactivity with pathogen-derived antigens might break self-tolerance to induce autoimmune disease. PMID:27183389

The viable but non-culturable state in pathogenic Escherichia coli: A general review

Directory of Open Access Journals (Sweden)

Jennifer A. Pienaar

2016-05-01

Objectives: This review discusses various general aspects of the VBNC state, the mechanisms and possible public health impact of indicator and pathogenic E. coli entering into the VBNC state. Method: A literature review was conducted to ascertain the possibleimpact of E. coli entering into the VBNC state. Results: Escherichia coli enter into the VBNC state by means of several induction mechanisms. Various authors have found that E. coli can be resuscitated post-VBNC. Certain strains of pathogenic E. coli are still able to produce toxins in the VBNC state, whilst others are avirulent during the VBNC state but are able to regain virulence after resuscitation. Conclusion: Pathogenic and indicator E. coli entering into the VBNC state could have an adverse effect on public health if conventional detection methods are used, where the number of viable cells could be underestimated and the VBNC cells still produce toxins or could, at anytime, be resuscitated and become virulent again.

Antimicrobial resistance prevalence of pathogenic and commensal Escherichia coli in food-producing animals in Belgium

OpenAIRE

Chantziaras, Ilias; Dewulf, Jeroen; Boyen, Filip; Callens, Benedicte; Butaye, Patrick

2014-01-01

In this article, detailed studies on antimicrobial resistance to commensal E. coli (in pigs, meat-producing bovines, broiler chickens and veal calves) and pathogenic E. coli (in pigs and bovines) in Belgium are presented for 2011. Broiler chicken and veal calf isolates of commensal E. coli demonstrated higher antimicrobial resistance prevalence than isolates from pigs and bovines. Fifty percent of E. coli isolates from broiler chickens were resistant to at least five antimicrobials, whereas s...

AMPK in Pathogens.

Science.gov (United States)

Mesquita, Inês; Moreira, Diana; Sampaio-Marques, Belém; Laforge, Mireille; Cordeiro-da-Silva, Anabela; Ludovico, Paula; Estaquier, Jérôme; Silvestre, Ricardo

2016-01-01

During host-pathogen interactions, a complex web of events is crucial for the outcome of infection. Pathogen recognition triggers powerful cellular signaling events that is translated into the induction and maintenance of innate and adaptive host immunity against infection. In opposition, pathogens employ active mechanisms to manipulate host cell regulatory pathways toward their proliferation and survival. Among these, subversion of host cell energy metabolism by pathogens is currently recognized to play an important role in microbial growth and persistence. Extensive studies have documented the role of AMP-activated protein kinase (AMPK) signaling, a central cellular hub involved in the regulation of energy homeostasis, in host-pathogen interactions. Here, we highlight the most recent advances detailing how pathogens hijack cellular metabolism by suppressing or increasing the activity of the host energy sensor AMPK. We also address the role of lower eukaryote AMPK orthologues in the adaptive process to the host microenvironment and their contribution for pathogen survival, differentiation, and growth. Finally, we review the effects of pharmacological or genetic AMPK modulation on pathogen growth and persistence.

[Ultrastructure and molecular biochemistry on pathogenic fungal cells: the architecture of septal cell walls of dermatophytes].

Science.gov (United States)

Kitajima, Y

2001-01-01

This review provides abstracts of our research for which the year 2000 prize of The Japanese Society for Medical Mycology was awarded. The study consists of 4 fields: 1)Ultrastructure and biochemistry of the cell walls of dermatophytes. 2) Freeze-fracture electron microscopic study on the membrane systems of pathogenic fungi. 3) Action mechanisms of antifungal agents in terms of membrane structure and functions. 4) Dimorphism and virulence of pathogenic fungi in terms of molecular biology of membrane lipids. Since the detailed contents of these studies were reported in my previous review article (Jpn J Med Mycol 41: 211-217, 2000), I would like to mention these studies only briefly here, together with a detailed review of the septal cell wall architecture of dermatophytes, which I did not cover in my earlier articles.

Panax ginseng has anti-infective activity against opportunistic pathogen Pseudomonas aeruginosa by inhibiting quorum sensing, a bacterial communication process critical for establishing infection

DEFF Research Database (Denmark)

Song, Z; Kong, K F; Wu, H

2010-01-01

Virulent factors produced by pathogens play an important role in the infectious process, which is regulated by a cell-to-cell communication mechanism called quorum sensing (QS). Pseudomonas aeruginosa is an important opportunistic human pathogen, which causes infections in patients with compromis...

Evolution of structural diversity of trichothecenes, a family of toxins produced by plant pathogenic and entomopathogenic fungi.

Science.gov (United States)

Proctor, Robert H; McCormick, Susan P; Kim, Hye-Seon; Cardoza, Rosa E; Stanley, April M; Lindo, Laura; Kelly, Amy; Brown, Daren W; Lee, Theresa; Vaughan, Martha M; Alexander, Nancy J; Busman, Mark; Gutiérrez, Santiago

2018-04-01

Trichothecenes are a family of terpenoid toxins produced by multiple genera of fungi, including plant and insect pathogens. Some trichothecenes produced by the fungus Fusarium are among the mycotoxins of greatest concern to food and feed safety because of their toxicity and frequent occurrence in cereal crops, and trichothecene production contributes to pathogenesis of some Fusarium species on plants. Collectively, fungi produce over 150 trichothecene analogs: i.e., molecules that share the same core structure but differ in patterns of substituents attached to the core structure. Here, we carried out genomic, phylogenetic, gene-function, and analytical chemistry studies of strains from nine fungal genera to identify genetic variation responsible for trichothecene structural diversity and to gain insight into evolutionary processes that have contributed to the variation. The results indicate that structural diversity has resulted from gain, loss, and functional changes of trichothecene biosynthetic (TRI) genes. The results also indicate that the presence of some substituents has arisen independently in different fungi by gain of different genes with the same function. Variation in TRI gene duplication and number of TRI loci was also observed among the fungi examined, but there was no evidence that such genetic differences have contributed to trichothecene structural variation. We also inferred ancestral states of the TRI cluster and trichothecene biosynthetic pathway, and proposed scenarios for changes in trichothecene structures during divergence of TRI cluster homologs. Together, our findings provide insight into evolutionary processes responsible for structural diversification of toxins produced by pathogenic fungi.

Dissecting HIV Virulence: Heritability of Setpoint Viral Load, CD4+ T-Cell Decline, and Per-Parasite Pathogenicity.

Science.gov (United States)

Bertels, Frederic; Marzel, Alex; Leventhal, Gabriel; Mitov, Venelin; Fellay, Jacques; Günthard, Huldrych F; Böni, Jürg; Yerly, Sabine; Klimkait, Thomas; Aubert, Vincent; Battegay, Manuel; Rauch, Andri; Cavassini, Matthias; Calmy, Alexandra; Bernasconi, Enos; Schmid, Patrick; Scherrer, Alexandra U; Müller, Viktor; Bonhoeffer, Sebastian; Kouyos, Roger; Regoes, Roland R

2018-01-01

Pathogen strains may differ in virulence because they attain different loads in their hosts, or because they induce different disease-causing mechanisms independent of their load. In evolutionary ecology, the latter is referred to as "per-parasite pathogenicity". Using viral load and CD4+ T-cell measures from 2014 HIV-1 subtype B-infected individuals enrolled in the Swiss HIV Cohort Study, we investigated if virulence-measured as the rate of decline of CD4+ T cells-and per-parasite pathogenicity are heritable from donor to recipient. We estimated heritability by donor-recipient regressions applied to 196 previously identified transmission pairs, and by phylogenetic mixed models applied to a phylogenetic tree inferred from HIV pol sequences. Regressing the CD4+ T-cell declines and per-parasite pathogenicities of the transmission pairs did not yield heritability estimates significantly different from zero. With the phylogenetic mixed model, however, our best estimate for the heritability of the CD4+ T-cell decline is 17% (5-30%), and that of the per-parasite pathogenicity is 17% (4-29%). Further, we confirm that the set-point viral load is heritable, and estimate a heritability of 29% (12-46%). Interestingly, the pattern of evolution of all these traits differs significantly from neutrality, and is most consistent with stabilizing selection for the set-point viral load, and with directional selection for the CD4+ T-cell decline and the per-parasite pathogenicity. Our analysis shows that the viral genotype affects virulence mainly by modulating the per-parasite pathogenicity, while the indirect effect via the set-point viral load is minor. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Comparison of the disinfection efficacy of chlorine-based products for inactivation of viral indicators and pathogenic bacteria in produce wash water.

Science.gov (United States)

Chaidez, Cristobal; Moreno, Maria; Rubio, Werner; Angulo, Miguel; Valdez, Benigno

2003-09-01

Outbreaks of pathogenic bacteria infections associated with the consumption of fresh produce has occurred with increased frequency in recent years. This study was undertaken to determine the efficacy of three commonly used disinfectants in packing-houses of Culiacan, Mexico (sodium hypochlorite [NaOCl], trichlor-s-triazinetrione [TST] and thrichlormelamine [TCM]) for inactivation of viral indicators and pathogenic bacteria inoculated onto produce wash water. Each microbial challenge consisted of 2 L of water containing approximately 8 log10 bacterial CFU ml(-1), and 8 log10 viral PFU ml(-1) treated with 100 and 300 mg l(-1) of total chlorine with modified turbidity. Water samples were taken after 2 min of contact with chlorine-based products and assayed for the particular microorganisms. TST and NaOCl were found to effectively reduce for bacterial pathogens and viral indicators 8 log10 and 7 log10, respectively (alpha=0.05). The highest inactivation rate was observed when the turbidity was low and the disinfectant was applied at 300 mg l(-1). TCM did not show effective results when compared with the TST and NaOCl (Pturbidity created by the organic and inorganic material present in the water tanks carried by the fresh produce may affect the efficacy of the chlorine-based products.

The varieties of immunological experience: of pathogens, stress, and dendritic cells.

Science.gov (United States)

Pulendran, Bali

2015-01-01

In the 40 years since their discovery, dendritic cells (DCs) have been recognized as central players in immune regulation. DCs sense microbial stimuli through pathogen-recognition receptors (PRRs) and decode, integrate, and present information derived from such stimuli to T cells, thus stimulating immune responses. DCs can also regulate the quality of immune responses. Several functionally specialized subsets of DCs exist, but DCs also display functional plasticity in response to diverse stimuli. In addition to sensing pathogens via PRRs, emerging evidence suggests that DCs can also sense stress signals, such as amino acid starvation, through ancient stress and nutrient sensing pathways, to stimulate adaptive immunity. Here, I discuss these exciting advances in the context of a historic perspective on the discovery of DCs and their role in immune regulation. I conclude with a discussion of emerging areas in DC biology in the systems immunology era and suggest that the impact of DCs on immunity can be usefully contextualized in a hierarchy-of-organization model in which DCs, their receptors and signaling networks, cell-cell interactions, tissue microenvironment, and the host macroenvironment represent different levels of the hierarchy. Immunity or tolerance can then be represented as a complex function of each of these hierarchies.

Pathogenic features of heterotrophic plate count bacteria from drinking-water boreholes.

Science.gov (United States)

Horn, Suranie; Pieters, Rialet; Bezuidenhout, Carlos

2016-12-01

Evidence suggests that heterotrophic plate count (HPC) bacteria may be hazardous to humans with weakened health. We investigated the pathogenic potential of HPC bacteria from untreated borehole water, consumed by humans, for: their haemolytic properties, the production of extracellular enzymes such as DNase, proteinase, lipase, lecithinase, hyaluronidase and chondroitinase, the effect simulated gastric fluid has on their survival, as well as the bacteria's antibiotic-susceptible profile. HuTu-80 cells acted as model for the human intestine and were exposed to the HPC isolates to determine their effects on the viability of the cells. Several HPC isolates were α- or β-haemolytic, produced two or more extracellular enzymes, survived the SGF treatment, and showed resistance against selected antibiotics. The isolates were also harmful to the human intestinal cells to varying degrees. A novel pathogen score was calculated for each isolate. Bacillus cereus had the highest pathogen index: the pathogenicity of the other bacteria declined as follows: Aeromonas taiwanensis > Aeromonas hydrophila > Bacillus thuringiensis > Alcaligenes faecalis > Pseudomonas sp. > Bacillus pumilus > Brevibacillus sp. > Bacillus subtilis > Bacillus sp. These results demonstrated that the prevailing standards for HPCs in drinking water may expose humans with compromised immune systems to undue risk.

Lactobacillus crispatus L1: high cell density cultivation and exopolysaccharide structure characterization to highlight potentially beneficial effects against vaginal pathogens.

Science.gov (United States)

Donnarumma, Giovanna; Molinaro, Antonio; Cimini, Donatella; De Castro, Cristina; Valli, Vivien; De Gregorio, Vincenza; De Rosa, Mario; Schiraldi, Chiara

2014-05-30

Vaginal lactic acid bacteria defend the host against pathogens through a combination of competitive exclusion, competition for nutrients, production of antimicrobial substances and through the activation of the immune system. A new human isolate named Lactobacillus crispatus L1 was characterized in this work, and a preliminary evaluation of its probiotic potential is described together with a process to obtain a high productivity of viable biomass. In a simulated digestion process 1.8⋅10(10) cells∙ml(-1) survived the gastric environment with 80% viability, without being affected by small intestine juices. Experiments on six different C sources were performed to analyze growth and organic acids production and, glucose, provided the best performances. A microfiltration strategy was exploited to improve the cellular yield in 2 L-fermentation processes, reaching 27 g · l(-1) of dry biomass. Moreover, L. crispatus L1 demonstrated a greater stability to high concentrations of lactic acid, compared to other lactobacilli. The specific L. crispatus L1 exopolysaccharide was purified from the fermentation broth and characterized by NMR showing structural features and similarity to exopolysaccharides produced by pathogenic strains. Live L. crispatus L1 cells strongly reduced adhesion of a yeast pathogenic strain, Candida albicans in particular, in adherence assays. Interestingly a higher expression of the human defensin HBD-2 was also observed in vaginal cells treated with the purified exopolysaccharide, indicating a possible correlation with C. albicans growth inhibition. The paper describes the evaluation of L. crispatus L1 as potential vaginal probiotic and the fermentation processes to obtain high concentrations of viable cells.

Molecular mapping of the cell wall polysaccharides of the human pathogen Streptococcus agalactiae

Science.gov (United States)

Beaussart, Audrey; Péchoux, Christine; Trieu-Cuot, Patrick; Hols, Pascal; Mistou, Michel-Yves; Dufrêne, Yves F.

2014-11-01

The surface of many bacterial pathogens is covered with polysaccharides that play important roles in mediating pathogen-host interactions. In Streptococcus agalactiae, the capsular polysaccharide (CPS) is recognized as a major virulence factor while the group B carbohydrate (GBC) is crucial for peptidoglycan biosynthesis and cell division. Despite the important roles of CPS and GBC, there is little information available on the molecular organization of these glycopolymers on the cell surface. Here, we use atomic force microscopy (AFM) and transmission electron microscopy (TEM) to analyze the nanoscale distribution of CPS and GBC in wild-type (WT) and mutant strains of S. agalactiae. TEM analyses reveal that in WT bacteria, peptidoglycan is covered with a very thin (few nm) layer of GBC (the ``pellicle'') overlaid by a 15-45 nm thick layer of CPS (the ``capsule''). AFM-based single-molecule mapping with specific antibody probes shows that CPS is exposed on WT cells, while it is hardly detected on mutant cells impaired in CPS production (ΔcpsE mutant). By contrast, both TEM and AFM show that CPS is over-expressed in mutant cells altered in GBC expression (ΔgbcO mutant), indicating that the production of the two surface glycopolymers is coordinated in WT cells. In addition, AFM topographic imaging and molecular mapping with specific lectin probes demonstrate that removal of CPS (ΔcpsE), but not of GBC (ΔgbcO), leads to the exposure of peptidoglycan, organized into 25 nm wide bands running parallel to the septum. These results indicate that CPS forms a homogeneous barrier protecting the underlying peptidoglycan from environmental exposure, while the presence of GBC does not prevent peptidoglycan detection. This work shows that single-molecule AFM, combined with high-resolution TEM, represents a powerful platform for analysing the molecular arrangement of the cell wall polymers of bacterial pathogens.

CRN13 candidate effectors from plant and animal eukaryotic pathogens are DNA-binding proteins which trigger host DNA damage response.

Science.gov (United States)

Ramirez-Garcés, Diana; Camborde, Laurent; Pel, Michiel J C; Jauneau, Alain; Martinez, Yves; Néant, Isabelle; Leclerc, Catherine; Moreau, Marc; Dumas, Bernard; Gaulin, Elodie

2016-04-01

To successfully colonize their host, pathogens produce effectors that can interfere with host cellular processes. Here we investigated the function of CRN13 candidate effectors produced by plant pathogenic oomycetes and detected in the genome of the amphibian pathogenic chytrid fungus Batrachochytrium dendrobatidis (BdCRN13). When expressed in Nicotiana, AeCRN13, from the legume root pathogen Aphanomyces euteiches, increases the susceptibility of the leaves to the oomycete Phytophthora capsici. When transiently expressed in amphibians or plant cells, AeCRN13 and BdCRN13 localize to the cell nuclei, triggering aberrant cell development and eventually causing cell death. Using Förster resonance energy transfer experiments in plant cells, we showed that both CRN13s interact with nuclear DNA and trigger plant DNA damage response (DDR). Mutating key amino acid residues in a predicted HNH-like endonuclease motif abolished the interaction of AeCRN13 with DNA, the induction of DDR and the enhancement of Nicotiana susceptibility to P. capsici. Finally, H2AX phosphorylation, a marker of DNA damage, and enhanced expression of genes involved in the DDR were observed in A. euteiches-infected Medicago truncatula roots. These results show that CRN13 from plant and animal eukaryotic pathogens promotes host susceptibility by targeting nuclear DNA and inducing DDR. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

The effect of bacteriocin-producing Lactobacillus plantarum strains on the intracellular pH of sessile and planktonic Listeria monocytongenes single cells

DEFF Research Database (Denmark)

Nielsen, Dennis Sandris; Cho, Gyu-Sung; Hanak, Alexander

2010-01-01

and/or bacteriocin-producing LAB as “natural” food preservatives in foods such as cheese, meat and ready-to-eat products. Some strains of Lactobacillus plantarum produce bacteriocins termed plantaricins. Using a single-cell based approach, the effect on the intracellular pH as a measure......A wide range of lactic acid bacteria (LAB) produce bacteriocins mainly active against other closely related LAB, but some bacteriocins are also active against the food-borne pathogen Listeria monocytogenes. With the aim of increasing food safety it has thus been considered to utilise bacteriocins...

ROS signaling and stomatal movement in plant responses to drought stress and pathogen attack.

Science.gov (United States)

Qi, Junsheng; Song, Chun-Peng; Wang, Baoshan; Zhou, Jianmin; Kangasjärvi, Jaakko; Zhu, Jian-Kang; Gong, Zhizhong

2018-04-16

Stomata, the pores formed by a pair of guard cells, are the main gateways for water transpiration and photosynthetic CO 2 exchange, as well as pathogen invasion in land plants. Guard cell movement is regulated by a combination of environmental factors including water status, light, CO 2 levels and pathogen attack, as well as endogenous signals such as abscisic acid and apoplastic reactive oxygen species (ROS). Under abiotic and biotic stress conditions, extracellular ROS are mainly produced by plasma membrane-localized NADPH oxidases, whereas intracellular ROS are produced in multiple organelles. These ROS form a sophisticated cellular signaling network, with the accumulation of apoplastic ROS an early hallmark of stomatal movement. Here, we review recent progress in understanding the molecular mechanisms of the ROS signaling network, primarily during drought stress and pathogen attack. We summarize the roles of apoplastic ROS in regulating stomatal movement, ABA and CO 2 signaling, and immunity responses. Finally, we discuss ROS accumulation and communication between organelles and cells. This information provides a conceptual framework for understanding how ROS signaling is integrated with various signaling pathways during plant responses to abiotic and biotic stress stimuli. This article is protected by copyright. All rights reserved.

IL-9-Producing Mast Cell Precursors and Food Allergy

Science.gov (United States)

2017-10-01

AWARD NUMBER: W81XWH-15-1-0517 TITLE: IL-9-Producing Mast Cell Precursors and Food Allergy PRINCIPAL INVESTIGATOR: Dr. Simon P. Hogan PhD...IL-9-Producing Mast Cell Precursors and Food Allergy 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Yui Hsi Wang, Sunil...threatening anaphylaxis. We have identified a novel multi-functional IL-9-producing mucosal mast cells (MMC9s) that produce large amounts of IL-9, IL

Two is better than one: advances in pathogen-boosted immunotherapy and adoptive T-cell therapy.

Science.gov (United States)

Xin, Gang; Schauder, David M; Zander, Ryan; Cui, Weiguo

2017-09-01

The recent tremendous successes in clinical trials take cancer immunotherapy into a new era and have attracted major attention from both academia and industry. Among the variety of immunotherapy strategies developed to boost patients' own immune systems to fight against malignant cells, the pathogen-based and adoptive cell transfer therapies have shown the most promise for treating multiple types of cancer. Pathogen-based therapies could either break the immune tolerance to enhance the effectiveness of cancer vaccines or directly infect and kill cancer cells. Adoptive cell transfer can induce a strong durable antitumor response, with recent advances including engineering dual specificity into T cells to recognize multiple antigens and improving the metabolic fitness of transferred cells. In this review, we focus on the recent prospects in these two areas and summarize some ongoing studies that represent potential advancements for anticancer immunotherapy, including testing combinations of these two strategies.

Uncovering plant-pathogen crosstalk through apoplastic proteomic studies.

Science.gov (United States)

Delaunois, Bertrand; Jeandet, Philippe; Clément, Christophe; Baillieul, Fabienne; Dorey, Stéphan; Cordelier, Sylvain

2014-01-01

Plant pathogens have evolved by developing different strategies to infect their host, which in turn have elaborated immune responses to counter the pathogen invasion. The apoplast, including the cell wall and extracellular space outside the plasma membrane, is one of the first compartments where pathogen-host interaction occurs. The plant cell wall is composed of a complex network of polysaccharides polymers and glycoproteins and serves as a natural physical barrier against pathogen invasion. The apoplastic fluid, circulating through the cell wall and intercellular spaces, provides a means for delivering molecules and facilitating intercellular communications. Some plant-pathogen interactions lead to plant cell wall degradation allowing pathogens to penetrate into the cells. In turn, the plant immune system recognizes microbial- or damage-associated molecular patterns (MAMPs or DAMPs) and initiates a set of basal immune responses, including the strengthening of the plant cell wall. The establishment of defense requires the regulation of a wide variety of proteins that are involved at different levels, from receptor perception of the pathogen via signaling mechanisms to the strengthening of the cell wall or degradation of the pathogen itself. A fine regulation of apoplastic proteins is therefore essential for rapid and effective pathogen perception and for maintaining cell wall integrity. This review aims to provide insight into analyses using proteomic approaches of the apoplast to highlight the modulation of the apoplastic protein patterns during pathogen infection and to unravel the key players involved in plant-pathogen interaction.

Use of an optical trap for study of host-pathogen interactions for dynamic live cell imaging.

Science.gov (United States)

Tam, Jenny M; Castro, Carlos E; Heath, Robert J W; Mansour, Michael K; Cardenas, Michael L; Xavier, Ramnik J; Lang, Matthew J; Vyas, Jatin M

2011-07-28

Dynamic live cell imaging allows direct visualization of real-time interactions between cells of the immune system(1, 2); however, the lack of spatial and temporal control between the phagocytic cell and microbe has rendered focused observations into the initial interactions of host response to pathogens difficult. Historically, intercellular contact events such as phagocytosis(3) have been imaged by mixing two cell types, and then continuously scanning the field-of-view to find serendipitous intercellular contacts at the appropriate stage of interaction. The stochastic nature of these events renders this process tedious, and it is difficult to observe early or fleeting events in cell-cell contact by this approach. This method requires finding cell pairs that are on the verge of contact, and observing them until they consummate their contact, or do not. To address these limitations, we use optical trapping as a non-invasive, non-destructive, but fast and effective method to position cells in culture. Optical traps, or optical tweezers, are increasingly utilized in biological research to capture and physically manipulate cells and other micron-sized particles in three dimensions(4). Radiation pressure was first observed and applied to optical tweezer systems in 1970(5, 6), and was first used to control biological specimens in 1987(7). Since then, optical tweezers have matured into a technology to probe a variety of biological phenomena(8-13). We describe a method(14) that advances live cell imaging by integrating an optical trap with spinning disk confocal microscopy with temperature and humidity control to provide exquisite spatial and temporal control of pathogenic organisms in a physiological environment to facilitate interactions with host cells, as determined by the operator. Live, pathogenic organisms like Candida albicans and Aspergillus fumigatus, which can cause potentially lethal, invasive infections in immunocompromised individuals(15, 16) (e.g. AIDS

GM-CSF-Producing Th Cells in Rats Sensitive and Resistant to Experimental Autoimmune Encephalomyelitis.

Science.gov (United States)

Stojić-Vukanić, Zorica; Pilipović, Ivan; Vujnović, Ivana; Nacka-Aleksić, Mirjana; Petrović, Raisa; Arsenović-Ranin, Nevena; Dimitrijević, Mirjana; Leposavić, Gordana

2016-01-01

Given that granulocyte macrophage colony-stimulating factor (GM-CSF) is identified as the key factor to endow auto-reactive Th cells with the potential to induce neuroinflammation in experimental autoimmune encephalomyelitis (EAE) models, the frequency and phenotype of GM-CSF-producing (GM-CSF+) Th cells in draining lymph nodes (dLNs) and spinal cord (SC) of Albino Oxford (AO) and Dark Agouti (DA) rats immunized for EAE were examined. The generation of neuroantigen-specific GM-CSF+ Th lymphocytes was impaired in dLNs of AO rats (relatively resistant to EAE induction) compared with their DA counterparts (susceptible to EAE) reflecting impaired CD4+ lymphocyte proliferation and less supportive of GM-CSF+ Th cell differentiation dLN cytokine microenvironment. Immunophenotyping of GM-CSF+ Th cells showed their phenotypic heterogeneity in both strains and revealed lower frequency of IL-17+IFN-γ+, IL-17+IFN-γ-, and IL-17-IFN-γ+ cells accompanied by higher frequency of IL-17-IFN-γ- cells among them in AO than in DA rats. Compared with DA, in AO rats was also found (i) slightly lower surface density of CCR2 (drives accumulation of highly pathogenic GM-CSF+IFN-γ+ Th17 cells in SC) on GM-CSF+IFN-γ+ Th17 lymphocytes from dLNs, and (ii) diminished CCL2 mRNA expression in SC tissue, suggesting their impaired migration into the SC. Moreover, dLN and SC cytokine environments in AO rats were shown to be less supportive of GM-CSF+IFN-γ+ Th17 cell differentiation (judging by lower expression of mRNAs for IL-1β, IL-6 and IL-23/p19). In accordance with the (i) lower frequency of GM-CSF+ Th cells in dLNs and SC of AO rats and their lower GM-CSF production, and (ii) impaired CCL2 expression in the SC tissue, the proportion of proinflammatory monocytes among peripheral blood cells and their progeny (CD45hi cells) among the SC CD11b+ cells were reduced in AO compared with DA rats. Collectively, the results indicate that the strain specificities in efficacy of several mechanisms

Differentiation, distribution and gammadelta T cell-driven regulation of IL-22-producing T cells in tuberculosis.

Directory of Open Access Journals (Sweden)

Shuyu Yao

2010-02-01

Full Text Available Differentiation, distribution and immune regulation of human IL-22-producing T cells in infections remain unknown. Here, we demonstrated in a nonhuman primate model that M. tuberculosis infection resulted in apparent increases in numbers of T cells capable of producing IL-22 de novo without in vitro Ag stimulation, and drove distribution of these cells more dramatically in lungs than in blood and lymphoid tissues. Consistently, IL-22-producing T cells were visualized in situ in lung tuberculosis (TB granulomas by confocal microscopy and immunohistochemistry, indicating that mature IL-22-producing T cells were present in TB granuloma. Surprisingly, phosphoantigen HMBPP activation of Vgamma2Vdelta2 T cells down-regulated the capability of T cells to produce IL-22 de novo in lymphocytes from blood, lung/BAL fluid, spleen and lymph node. Up-regulation of IFNgamma-producing Vgamma2Vdelta2 T effector cells after HMBPP stimulation coincided with the down-regulated capacity of these T cells to produce IL-22 de novo. Importantly, anti-IFNgamma neutralizing Ab treatment reversed the HMBPP-mediated down-regulation effect on IL-22-producing T cells, suggesting that Vgamma2Vdelta2 T-cell-driven IFNgamma-networking function was the mechanism underlying the HMBPP-mediated down-regulation of the capability of T cells to produce IL-22. These novel findings raise the possibility to ultimately investigate the function of IL-22 producing T cells and to target Vgamma2Vdelta2 T cells for balancing potentially hyper-activating IL-22-producing T cells in severe TB.

Occurrence of mastitis pathogens in relation to somatic cells

Directory of Open Access Journals (Sweden)

Marcela Vyletělová Klimešová

2013-01-01

Full Text Available There were examined 161 cows from 4 farms in total. The suspect animals were selected according to viscosity test results, clinical symptoms and somatic cell count (SCC. Milk samples were examined for the presence of pathogens and for SCC. 55 mastitis pathogens were identified. The most frequently isolated species was Enterococcus faecalis (n = 20, followed by Staphylococcus aureus (n = 6 and Streptococcus uberis (n = 5. The SCC ranged from 9 to 24 204 ths.ml−1. There was positive occurrence of bacteria genus Staphylococcus and Enterococcus at lower SCC (50 ths.ml−1 and at higher SCC numbers (> 300 ths. ml−1 bacteria genus Streptococcus, Enterobacter and Escherichia coli. Differences in SCC were significant (P < 0.001 in negative samples xg 131 SCC versus 491 for positive, 611 for staphylococci and 464 ths.ml−1 for other positive. SCC discrimination limit for practical likelihood of pathogen occurrence estimation in infectious sample groups was calculated. This limit for suspicion of infection is 159 for positive group, 113 for staphylococci and 174 ths.ml−1 for other positive. This could be possible to recommend the value 174 ths.ml−1 for practical use with target to apply preventive or curative measures.

Anaerobic co-culture of mesenchymal stem cells and anaerobic pathogens - a new in vitro model system.

Directory of Open Access Journals (Sweden)

Katja Kriebel

Full Text Available BACKGROUND: Human mesenchymal stem cells (hMSCs are multipotent by nature and are originally isolated from bone marrow. In light of a future application of hMSCs in the oral cavity, a body compartment with varying oxygen partial pressures and an omnipresence of different bacterial species i.e. periodontitis pathogens, we performed this study to gain information about the behavior of hMSC in an anaerobic system and the response in interaction with oral bacterial pathogens. METHODOLOGY/PRINCIPAL FINDINGS: We established a model system with oral pathogenic bacterial species and eukaryotic cells cultured in anaerobic conditions. The facultative anaerobe bacteria Fusobacterium nucleatum, Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans were studied. Their effects on hMSCs and primary as well as permanent gingival epithelial cells (Ca9-22, HGPEC were comparatively analyzed. We show that hMSCs cope with anoxic conditions, since 40% vital cells remain after 72 h of anaerobic culture. The Ca9-22 and HGPEC cells are significantly more sensitive to lack of oxygen. All bacterial species reveal a comparatively low adherence to and internalization into hMSCs (0.2% and 0.01% of the initial inoculum, respectively. In comparison, the Ca9-22 and HGPEC cells present better targets for bacterial adherence and internalization. The production of the pro-inflammatory chemokine IL-8 is higher in both gingival epithelial cell lines compared to hMSCs and Fusobacterium nucleatum induce a time-dependent cytokine secretion in both cell lines. Porphyromonas gingivalis is less effective in stimulating secretion of IL-8 in the co-cultivation experiments. CONCLUSIONS/SIGNIFICANCE: HMSCs are suitable for use in anoxic regions of the oral cavity. The interaction with local pathogenic bacteria does not result in massive pro-inflammatory cytokine responses. The test system established in this study allowed further investigation of parameters prior to set up of

Microbial Inhibition of Fusarium Pathogens and Biological Modification of Trichothecenes in Cereal Grains

Directory of Open Access Journals (Sweden)

Urszula Wachowska

2017-12-01

Full Text Available Fungi of the genus Fusarium infect cereal crops during the growing season and cause head blight and other diseases. Their toxic secondary metabolites (mycotoxins contaminate grains. Several dozen toxic compounds produced by fungal pathogens have been identified to date. Type B trichothecenes—deoxynivalenol, its acetyl derivatives and nivalenol (produced mainly by F. graminearum and F. culmorum—are most commonly detected in cereal grains. “T-2 toxin” (produced by, among others, F. sporotrichioides belongs to type-A trichothecenes which are more toxic than other trichothecenes. Antagonistic bacteria and fungi can affect pathogens of the genus Fusarium via different modes of action: direct (mycoparasitism or hyperparasitism, mixed-path (antibiotic secretion, production of lytic enzymes and indirect (induction of host defense responses. Microbial modification of trichothecenes involves acetylation, deacetylation, oxidation, de-epoxidation, and epimerization, and it lowers the pathogenic potential of fungi of the genus Fusarium. Other modifing mechanisms described in the paper involve the physical adsorption of mycotoxins in bacterial cells and the conjugation of mycotoxins to glucose and other compounds in plant and fungal cells. The development of several patents supports the commercialization and wider application of microorganisms biodegrading mycotoxins in grains and, consequently, in feed additives.

Children with asthma by school age display aberrant immune responses to pathogenic airway bacteria as infants

DEFF Research Database (Denmark)

Larsen, Jeppe Madura; Pedersen, Susanne Brix; Thysen, Anna Hammerich

2014-01-01

childhood asthma. We hypothesized that children with asthma have an abnormal immune response to pathogenic bacteria in infancy. ObjectiveWe aimed to assess the bacterial immune response in asymptomatic infants and the association with later development of asthma by age 7 years. MethodsThe Copenhagen...... was assessed based on the pattern of cytokines produced and T-cell activation. ResultsThe immune response to pathogenic bacteria was different in infants with asthma by 7 years of age (P = .0007). In particular, prospective asthmatic subjects had aberrant production of IL-5 (P = .008), IL-13 (P = .057), IL-17...... (P = .001), and IL-10 (P = .028), whereas there were no differences in T-cell activation or peripheral T-cell composition. ConclusionsChildren with asthma by school age exhibited an aberrant immune response to pathogenic bacteria in infancy. We propose that an abnormal immune response to pathogenic...

Pathogen inactivation techniques.

Science.gov (United States)

Pelletier, J P R; Transue, S; Snyder, E L

2006-01-01

The desire to rid the blood supply of pathogens of all types has led to the development of many technologies aimed at the same goal--eradication of the pathogen(s) without harming the blood cells or generating toxic chemical agents. This is a very ambitious goal, and one that has yet to be achieved. One approach is to shun the 'one size fits all' concept and to target pathogen-reduction agents at the Individual component types. This permits the development of technologies that might be compatible with, for example, plasma products but that would be cytocidal and thus incompatible with platelet concentrates or red blood cell units. The technologies to be discussed include solvent detergent and methylene blue treatments--designed to inactivate plasma components and derivatives; psoralens (S-59--amotosalen) designed to pathogen-reduce units of platelets; and two products aimed at red blood cells, S-303 (a Frale--frangible anchor-linker effector compound) and Inactine (a binary ethyleneimine). A final pathogen-reduction material that might actually allow one material to inactivate all three blood components--riboflavin (vitamin B2)--is also under development. The sites of action of the amotosalen (S-59), the S-303 Frale, Inactine, and riboflavin are all localized in the nucleic acid part of the pathogen. Solvent detergent materials act by dissolving the plasma envelope, thus compromising the integrity of the pathogen membrane and rendering it non-infectious. By disrupting the pathogen's ability to replicate or survive, its infectivity is removed. The degree to which bacteria and viruses are affected by a particular pathogen-reducing technology relates to its Gram-positive or Gram-negative status, to the sporulation characteristics for bacteria, and the presence of lipid or protein envelopes for viruses. Concerns related to photoproducts and other breakdown products of these technologies remain, and the toxicology of pathogen-reduction treatments is a major ongoing area

Pathogen-expanded CD11b+ invariant NKT cells feedback inhibit T cell proliferation via membrane-bound TGF-β1.

Science.gov (United States)

Han, Yanmei; Jiang, Zhengping; Chen, Zhubo; Gu, Yan; Liu, Yanfang; Zhang, Xiang; Cao, Xuetao

2015-04-01

Natural killer T cells (NKT cells) are effector cells, but also regulator of immune response, which either promote or suppress immune response through production of different cytokines. However, the subsets of NKT cells with definite phenotype and regulatory function need to be further identified. Furthermore, the mechanisms for NKT cells to regulate immune response remain to be fully elucidated. Here we identified CD11b(+) invariant NKT (CD11b(+) iNKT) cells as a new subset of regulatory NKT cells in mouse models with infection. αGalCer:CD1d complex(+)TCRβ(+)NK1.1(+) NKT cells could be categorized to CD11b(+) and CD11b(-) subsets. NKT cells are enriched in liver. During Listeria monocytogenes infection, hepatic CD11b(+) iNKT cells were significantly induced and expanded, with peak expansion on day 8. CD11b(+) iNKT cells were also expanded significantly in spleen and mesenteric lymph nodes. As compared to CD11b(-) iNKT cells, CD11b(+) iNKT cells expressed higher levels of CD27, FasL, B7H1, CD69, and particularly higher level of membrane-bound TGF-β1 (mTGF-β1), but produced less IFN-γ, IL-4, IL-10 and TGF-β1. Hepatic CD11b(+) iNKT cells suppressed antigen-nonspecific and OVA-specific CD4 and CD8 T cell proliferation through mTGF-β1 both in vitro and in vivo, meanwhile, they did not interfere with activation of CD4 T cells and cytotoxicity of the activated CD8 T cells. Thus, we have identified a new subset of pathogen-expanded CD11b(+) invariant NKT cells which can feedback inhibit T cell response through cell-to-cell contact via cell surface (membrane-bound) TGF-β1, especially at the late stage of immune response against infection. CD11b(+) regulatory iNKT cells may contribute to protect host from pathological injure by preventing immune overactivation. Copyright © 2015 Elsevier Ltd. All rights reserved.

Aspergillus flavus: human pathogen, allergen and mycotoxin producer.

Science.gov (United States)

Hedayati, M T; Pasqualotto, A C; Warn, P A; Bowyer, P; Denning, D W

2007-06-01

Aspergillus infections have grown in importance in the last years. However, most of the studies have focused on Aspergillus fumigatus, the most prevalent species in the genus. In certain locales and hospitals, Aspergillus flavus is more common in air than A. fumigatus, for unclear reasons. After A. fumigatus, A. flavus is the second leading cause of invasive aspergillosis and it is the most common cause of superficial infection. Experimental invasive infections in mice show A. flavus to be 100-fold more virulent than A. fumigatus in terms of inoculum required. Particularly common clinical syndromes associated with A. flavus include chronic granulomatous sinusitis, keratitis, cutaneous aspergillosis, wound infections and osteomyelitis following trauma and inoculation. Outbreaks associated with A. flavus appear to be associated with single or closely related strains, in contrast to those associated with A. fumigatus. In addition, A. flavus produces aflatoxins, the most toxic and potent hepatocarcinogenic natural compounds ever characterized. Accurate species identification within Aspergillus flavus complex remains difficult due to overlapping morphological and biochemical characteristics, and much taxonomic and population genetics work is necessary to better understand the species and related species. The flavus complex currently includes 23 species or varieties, including two sexual species, Petromyces alliaceus and P. albertensis. The genome of the highly related Aspergillus oryzae is completed and available; that of A. flavus in the final stages of annotation. Our understanding of A. flavus lags far behind that of A. fumigatus. Studies of the genomics, taxonomy, population genetics, pathogenicity, allergenicity and antifungal susceptibility of A. flavus are all required.

Inhibitory effect of Xenorhabdus nematophila TB on plant pathogens Phytophthora capsici and Botrytis cinerea in vitro and in planta.

Science.gov (United States)

Fang, Xiangling; Zhang, Manrang; Tang, Qian; Wang, Yonghong; Zhang, Xing

2014-03-06

Entomopathogenic bacteria Xenorhabdus spp. produce secondary metabolites with potential antimicrobial activity for use in agricultural productions. This study evaluated the inhibitory effect of X. nematophila TB culture on plant pathogens Botrytis cinerea and Phytophthora capsici. The cell-free filtrate of TB culture showed strong inhibitory effects (>90%) on mycelial growth of both pathogens. The methanol-extracted bioactive compounds (methanol extract) of TB culture also had strong inhibitory effects on mycelial growth and spore germinations of both pathogens. The methanol extract (1000 μg/mL) and cell-free filtrate both showed strong therapeutic and protective effects (>70%) on grey mold both in detached tomato fruits and plants, and leaf scorch in pepper plants. This study demonstrates X. nematophila TB produces antimicrobial metabolites of strong activity on plant pathogens, with great potential for controlling tomato grey mold and pepper leaf scorch and being used in integrated disease control to reduce chemical application.

Lipoteichoic Acid (LTA) and Lipopolysaccharides (LPS) from Periodontal Pathogenic Bacteria Facilitate Oncogenic Herpesvirus Infection within Primary Oral Cells

Science.gov (United States)

Dai, Lu; DeFee, Michael R.; Cao, Yueyu; Wen, Jiling; Wen, Xiaofei; Noverr, Mairi C.; Qin, Zhiqiang

2014-01-01

Kaposi’s sarcoma (KS) remains the most common tumor arising in patients with HIV/AIDS, and involvement of the oral cavity represents one of the most common clinical manifestations of this tumor. HIV infection incurs an increased risk for periodontal diseases and oral carriage of a variety of bacteria. Whether interactions involving pathogenic bacteria and oncogenic viruses in the local environment facilitate replication or maintenance of these viruses in the oral cavity remains unknown. In the current study, our data indicate that pretreatment of primary human oral fibroblasts with two prototypical pathogen-associated molecular patterns (PAMPs) produced by oral pathogenic bacteria–lipoteichoic acid (LTA) and lipopolysaccharide (LPS), increase KSHV entry and subsequent viral latent gene expression during de novo infection. Further experiments demonstrate that the underlying mechanisms induced by LTA and/or LPS include upregulation of cellular receptor, increasing production of reactive oxygen species (ROS), and activating intracellular signaling pathways such as MAPK and NF-κB, and all of which are closely associated with KSHV entry or gene expression within oral cells. Based on these findings, we hope to provide the framework of developing novel targeted approaches for treatment and prevention of oral KSHV infection and KS development in high-risk HIV-positive patients. PMID:24971655

Streptococcus dysgalactiae subsp. dysgalactiae isolated from milk of the bovine udder as emerging pathogens: In vitro and in vivo infection of human cells and zebrafish as biological models.

Science.gov (United States)

Alves-Barroco, Cinthia; Roma-Rodrigues, Catarina; Raposo, Luís R; Brás, Catarina; Diniz, Mário; Caço, João; Costa, Pedro M; Santos-Sanches, Ilda; Fernandes, Alexandra R

2018-03-25

Streptococcus dysgalactiae subsp. dysgalactiae (SDSD) is a major cause of bovine mastitis and has been regarded as an animal-restricted pathogen, although rare infections have been described in humans. Previous studies revealed the presence of virulence genes encoded by phages of the human pathogen Group A Streptococcus pyogenes (GAS) in SDSD isolated from the milk of bovine udder with mastitis. The isolates SDSD VSD5 and VSD13 could adhere and internalize human primary keratinocyte cells, suggesting a possible human infection potential of bovine isolates. In this work, the in vitro and in vivo potential of SDSD to internalize/adhere human cells of the respiratory track and zebrafish as biological models was evaluated. Our results showed that, in vitro, bovine SDSD strains could interact and internalize human respiratory cell lines and that this internalization was dependent on an active transport mechanism and that, in vivo, SDSD are able to cause invasive infections producing zebrafish morbidity and mortality. The infectious potential of these isolates showed to be isolate-specific and appeared to be independent of the presence or absence of GAS phage-encoded virulence genes. Although the infection ability of the bovine SDSD strains was not as strong as the human pathogenic S. pyogenes in the zebrafish model, results suggested that these SDSD isolates are able to interact with human cells and infect zebrafish, a vertebrate infectious model, emerging as pathogens with zoonotic capability. © 2018 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Methods for detecting pathogens in the beef food chain: detecting particular pathogens

Science.gov (United States)

The main food-borne pathogens of concern in the beef food chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella spp.; however, the presence of other pathogens, including Listeria monocytogenes, Campylobacter spp., Clostridium spp., Bacillus cereus, and Mycobacterium avium subsp. par...

Cell cycle and cell death are not necessary for appressorium formation and plant infection in the fungal plant pathogen Colletotrichum gloeosporioides

Directory of Open Access Journals (Sweden)

Barhoom Sima

2008-02-01

Full Text Available Abstract Background In order to initiate plant infection, fungal spores must germinate and penetrate into the host plant. Many fungal species differentiate specialized infection structures called appressoria on the host surface, which are essential for successful pathogenic development. In the model plant pathogen Magnaporthe grisea completion of mitosis and autophagy cell death of the spore are necessary for appressoria-mediated plant infection; blocking of mitosis prevents appressoria formation, and prevention of autophagy cell death results in non-functional appressoria. Results We found that in the closely related plant pathogen Colletotrichum gloeosporioides, blocking of the cell cycle did not prevent spore germination and appressoria formation. The cell cycle always lagged behind the morphogenetic changes that follow spore germination, including germ tube and appressorium formation, differentiation of the penetrating hypha, and in planta formation of primary hyphae. Nuclear division was arrested following appressorium formation and was resumed in mature appressoria after plant penetration. Unlike in M. grisea, blocking of mitosis had only a marginal effect on appressoria formation; development in hydroxyurea-treated spores continued only for a limited number of cell divisions, but normal numbers of fully developed mature appressoria were formed under conditions that support appressoria formation. Similar results were also observed in other Colletotrichum species. Spores, germ tubes, and appressoria retained intact nuclei and remained viable for several days post plant infection. Conclusion We showed that in C. gloeosporioides the differentiation of infection structures including appressoria precedes mitosis and can occur without nuclear division. This phenomenon was also found to be common in other Colletotrichum species. Spore cell death did not occur during plant infection and the fungus primary infection structures remained viable

Antagonistic activity of antibiotic producing Streptomyces sp. against fish and human pathogenic bacteria

Directory of Open Access Journals (Sweden)

Nazmul Hossain

2014-04-01

Full Text Available In this study, attempts were made to isolate Streptomyces sp. from soil samples of two different regions of Bangladesh and evaluate their antagonistic activity against fish and human pathogenic bacteria. A total of 10 isolates were identified as Streptomyces sp. based on several morphological, physiological and biochemical tests. Cross streak method was used to observe the antagonistic activity of the Streptomyces sp. isolates against different fish pathogens belonging to the genus Aeromonas, Pseudomonas and Edwardsiella and human clinical isolates belonging to the genus Klebsiella, Salmonella and Streptococcus. Seven Streptomyces sp. isolates showed antagonism against both fish and human pathogenic bacteria. Four isolates viz., N24, N26, N28 and N47 showed broad spectrum of antagonistic activity (80-100% against all genera of fish and human pathogenic bacteria. The isolate N49 exhibited highest spectrum of antagonism against all fish pathogens (90-100% but comparatively lower degree of antagonism against human pathogens (50-60%. Rest of the two isolates (N21 and N23 showed variability in their antagonism. Results showed that broad spectrum antibiotic(s could be developed from the isolates N24, N26, N28 and N47against several human and fish pathogens. The isolate N49 could be a potential source of antibiotic, especially for fish pathogenic bacteria.

How pathogens use linear motifs to perturb host cell networks

KAUST Repository

Via, Allegra; Uyar, Bora; Brun, Christine; Zanzoni, Andreas

2015-01-01

Molecular mimicry is one of the powerful stratagems that pathogens employ to colonise their hosts and take advantage of host cell functions to guarantee their replication and dissemination. In particular, several viruses have evolved the ability to interact with host cell components through protein short linear motifs (SLiMs) that mimic host SLiMs, thus facilitating their internalisation and the manipulation of a wide range of cellular networks. Here we present convincing evidence from the literature that motif mimicry also represents an effective, widespread hijacking strategy in prokaryotic and eukaryotic parasites. Further insights into host motif mimicry would be of great help in the elucidation of the molecular mechanisms behind host cell invasion and the development of anti-infective therapeutic strategies.

Cytotoxic and pathogenic properties of Klebsiella oxytoca isolated from laboratory animals.

Directory of Open Access Journals (Sweden)

Alison Darby

Full Text Available Klebsiella oxytoca is an opportunistic pathogen implicated in various clinical diseases in animals and humans. Studies suggest that in humans K. oxytoca exerts its pathogenicity in part through a cytotoxin. However, cytotoxin production in animal isolates of K. oxytoca and its pathogenic properties have not been characterized. Furthermore, neither the identity of the toxin nor a complete repertoire of genes involved in K. oxytoca pathogenesis have been fully elucidated. Here, we showed that several animal isolates of K. oxytoca, including the clinical isolates, produced secreted products in bacterial culture supernatant that display cytotoxicity on HEp-2 and HeLa cells, indicating the ability to produce cytotoxin. Cytotoxin production appears to be regulated by the environment, and soy based product was found to have a strong toxin induction property. The toxin was identified, by liquid chromatography-mass spectrometry and NMR spectroscopy, as low molecular weight heat labile benzodiazepine, tilivalline, previously shown to cause cytotoxicity in several cell lines, including mouse L1210 leukemic cells. Genome sequencing and analyses of a cytotoxin positive K. oxytoca strain isolated from an abscess of a mouse, identified genes previously shown to promote pathogenesis in other enteric bacterial pathogens including ecotin, several genes encoding for type IV and type VI secretion systems, and proteins that show sequence similarity to known bacterial toxins including cholera toxin. To our knowledge, these results demonstrate for the first time, that animal isolates of K. oxytoca, produces a cytotoxin, and that cytotoxin production is under strict environmental regulation. We also confirmed tilivalline as the cytotoxin present in animal K. oxytoca strains. These findings, along with the discovery of a repertoire of genes with virulence potential, provide important insights into the pathogenesis of K. oxytoca. As a novel diagnostic tool, tilivalline

Efficient Differentiation of Mouse Embryonic Stem Cells into Insulin-Producing Cells

Directory of Open Access Journals (Sweden)

Szu-Hsiu Liu

2012-01-01

Full Text Available Embryonic stem (ES cells are a potential source of a variety of differentiated cells for cell therapy, drug discovery, and toxicology screening. Here, we present an efficacy strategy for the differentiation of mouse ES cells into insulin-producing cells (IPCs by a two-step differentiation protocol comprising of (i the formation of definitive endoderm in monolayer culture by activin A, and (ii this monolayer endoderm being induced to differentiate into IPCs by nicotinamide, insulin, and laminin. Differentiated cells can be obtained within approximately 7 days. The differentiation IPCs combined application of RT-PCR, ELISA, and immunofluorescence to characterize phenotypic and functional properties. In our study, we demonstrated that IPCs produced pancreatic transcription factors, endocrine progenitor marker, definitive endoderm, pancreatic β-cell markers, and Langerhans α and δ cells. The IPCs released insulin in a manner that was dose dependent upon the amount of glucose added. These techniques may be able to be applied to human ES cells, which would have very important ramifications for treating human disease.

An endogenously produced fragment of cardiac myosin-binding protein C is pathogenic and can lead to heart failure.

Science.gov (United States)

Razzaque, Md Abdur; Gupta, Manish; Osinska, Hanna; Gulick, James; Blaxall, Burns C; Robbins, Jeffrey

2013-08-16

A stable 40-kDa fragment is produced from cardiac myosin-binding protein C when the heart is stressed using a stimulus, such as ischemia-reperfusion injury. Elevated levels of the fragment can be detected in the diseased mouse and human heart, but its ability to interfere with normal cardiac function in the intact animal is unexplored. To understand the potential pathogenicity of the 40-kDa fragment in vivo and to investigate the molecular pathways that could be targeted for potential therapeutic intervention. We generated cardiac myocyte-specific transgenic mice using a Tet-Off inducible system to permit controlled expression of the 40-kDa fragment in cardiomyocytes. When expression of the 40-kDa protein is induced by crossing the responder animals with tetracycline transactivator mice under conditions in which substantial quantities approximating those observed in diseased hearts are reached, the double-transgenic mice subsequently experience development of sarcomere dysgenesis and altered cardiac geometry, and the heart fails between 12 and 17 weeks of age. The induced double-transgenic mice had development of cardiac hypertrophy with myofibrillar disarray and fibrosis, in addition to activation of pathogenic MEK-ERK pathways. Inhibition of MEK-ERK signaling was achieved by injection of the mitogen-activated protein kinase (MAPK)/ERK inhibitor U0126. The drug effectively improved cardiac function, normalized heart size, and increased probability of survival. These results suggest that the 40-kDa cardiac myosin-binding protein C fragment, which is produced at elevated levels during human cardiac disease, is a pathogenic fragment that is sufficient to cause hypertrophic cardiomyopathy and heart failure.

Tropism and pathogenicity of rickettsiae

Directory of Open Access Journals (Sweden)

Tsuneo eUchiyama

2012-06-01

Full Text Available Rickettsiae are obligate intracellular parasitic bacteria that cause febrile exanthematous illnesses such as Rocky Mountain spotted fever, Mediterranean spotted fever, epidemic and murine typhus, etc. Although the vector ranges of each Rickettsia species are rather restricted; i.e., ticks belonging to Arachnida and lice and fleas belonging to Insecta usually act as vectors for spotted fever group and typhus group rickettsiae, respectively, it would be interesting to elucidate the mechanisms controlling the vector tropism of rickettsiae. This review discusses the factors determining the vector tropism of rickettsiae. In brief, the vector tropism of rickettsiae species is basically consistent with their tropism towards cultured tick and insect cells. The mechanisms responsible for rickettsiae pathogenicity are also described. Recently, genomic analyses of rickettsiae have revealed that they possess several genes that are homologous to those affecting the pathogenicity of other bacteria. Analyses comparing the genomes of pathogenic and nonpathogenic strains of rickettsiae have detected many factors that are related to rickettsial pathogenicity. It is also known that a reduction in the rickettsial genome has occurred during the course of its evolution. Interestingly, Rickettsia species with small genomes, such as Rickettsia prowazekii, are more pathogenic to humans than those with larger genomes. This review also examines the growth kinetics of pathogenic and nonpathogenic species of spotted fever group rickettsiae in mammalian cells. The growth of nonpathogenic species is restricted in these cells, which is mediated, at least in part, by autophagy. The superinfection of nonpathogenic rickettsiae-infected cells with pathogenic rickettsiae results in an elevated yield of the nonpathogenic rickettsiae and the growth of the pathogenic rickettsiae. Autophagy is restricted in these cells. These results are discussed in this review.

Pathogenic Assay of Probiotic Bacteria Producing Proteolytic Enzymes as Bioremediation Bacteria Against Vannamei Shrimp Larvae (Litopenaeus vannamei)

OpenAIRE

Wilis Ari Setyati; Muhammad Zainuddin; Person Pesona Renta

2017-01-01

Application of bacteria in bioremediation of shrimp culture ponds is one of the methods used to clean internal pollutants. This study aimed to evaluate the pathogenicity of extracellular proteolytic enzyme produced by the probiotic bacteria as bioremediation bacteria on vannamei shrimp larvae culture. There were five probiotic bacteria, which were successfully isolated from the sediments served as substrate in mangrove area. The isolated bacteria were coded in number as 13, 19, 30, 33, and 36...

Ex-Th17 (Nonclassical Th1) Cells Are Functionally Distinct from Classical Th1 and Th17 Cells and Are Not Constrained by Regulatory T Cells.

Science.gov (United States)

Basdeo, Sharee A; Cluxton, Deborah; Sulaimani, Jamal; Moran, Barry; Canavan, Mary; Orr, Carl; Veale, Douglas J; Fearon, Ursula; Fletcher, Jean M

2017-03-15

Th17 cells are an important therapeutic target in autoimmunity. However, it is known that Th17 cells exhibit considerable plasticity, particularly at sites of autoimmune inflammation. Th17 cells can switch to become ex-Th17 cells that no longer produce IL-17 but produce IFN-γ. These ex-Th17 cells are also called nonclassical Th1 cells because of their ability to produce IFN-γ, similar to Th1 cells; however, it is unclear whether they resemble Th1 or Th17 cells in terms of their function and regulation, and whether they have a pathogenic role in autoimmunity. We compared the phenotypic and functional features of human Th17, Th1, and ex-Th17 cell populations. Our data showed that despite their loss of IL-17 expression, ex-Th17 cells were more polyfunctional in terms of cytokine production than either Th1 or bona fide Th17 cells, and produced increased amounts of proinflammatory cytokines. The proliferative brake on Th17 cells appeared to be lifted because ex-Th17 cells proliferated more than Th17 cells after stimulation. In contrast with Th1 and Th17 cells, ex-Th17 cells were highly resistant to suppression of proliferation and cytokines by regulatory T cells. Finally, we showed that ex-Th17 cells accumulated in the joints of rheumatoid arthritis patients. Taken together, these data indicate that human ex-Th17 cells are functionally distinct from Th1 and Th17 cells, and suggest that they may play a pathogenic role at sites of autoimmunity, such as the rheumatoid arthritis joint where they accumulate. These findings have implications for therapeutic strategies that target IL-17, because these may not inhibit pathogenic ex-Th17 cells. Copyright © 2017 by The American Association of Immunologists, Inc.

Bright fluorescent Streptococcus pneumoniae for live cell imaging of host-pathogen interactions

NARCIS (Netherlands)

Kjos, M.; Aprianto, R.; Fernandes, V.E.; Andrew, P.W.; Strijp, van J.A.G.; Nijland, R.; Veening, J.W.

2015-01-01

Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people, but at the same time one of the major causes of infectious diseases such as pneumonia, meningitis and sepsis. The shift from commensal to pathogen and its interaction with host cells is poorly understood. One of the

Bright Fluorescent Streptococcus pneumoniae for Live-Cell Imaging of Host-Pathogen Interactions

NARCIS (Netherlands)

Kjos, Morten; Aprianto, Rieza; Fernandes, Vitor E.; Andrew, Peter W.; van Strijp, Jos A. G.; Nijland, Reindert; Veening, Jan-Willem

Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people but, at the same time, one of the major causes of infectious diseases such as pneumonia, meningitis, and sepsis. The shift from commensal to pathogen and its interaction with host cells are poorly understood. One of the

De novo identification of viral pathogens from cell culture hologenomes

Directory of Open Access Journals (Sweden)

Patowary Ashok

2012-01-01

Full Text Available Abstract Background Fast, specific identification and surveillance of pathogens is the cornerstone of any outbreak response system, especially in the case of emerging infectious diseases and viral epidemics. This process is generally tedious and time-consuming thus making it ineffective in traditional settings. The added complexity in these situations is the non-availability of pure isolates of pathogens as they are present as mixed genomes or hologenomes. Next-generation sequencing approaches offer an attractive solution in this scenario as it provides adequate depth of sequencing at fast and affordable costs, apart from making it possible to decipher complex interactions between genomes at a scale that was not possible before. The widespread application of next-generation sequencing in this field has been limited by the non-availability of an efficient computational pipeline to systematically analyze data to delineate pathogen genomes from mixed population of genomes or hologenomes. Findings We applied next-generation sequencing on a sample containing mixed population of genomes from an epidemic with appropriate processing and enrichment. The data was analyzed using an extensive computational pipeline involving mapping to reference genome sets and de-novo assembly. In depth analysis of the data generated revealed the presence of sequences corresponding to Japanese encephalitis virus. The genome of the virus was also independently de-novo assembled. The presence of the virus was in addition, verified using standard molecular biology techniques. Conclusions Our approach can accurately identify causative pathogens from cell culture hologenome samples containing mixed population of genomes and in principle can be applied to patient hologenome samples without any background information. This methodology could be widely applied to identify and isolate pathogen genomes and understand their genomic variability during outbreaks.

Phenotypic and genotypic characteristics of enterocin producing enterococci against pathogenic bacteria

Directory of Open Access Journals (Sweden)

Sandra Mojsova

2015-10-01

Full Text Available The study investigated the antimicrobial activity of 13 enterococcal strains (E. faecalis -8, E. faecium-2, E. hirae-2, E. spp.-1 isolated from our traditional cheeses against pathogen microorganisms. Also, it includes the detection of the following enterocin structural genes: enterocin A, enterocin B, enterocin P, enterocin L50A/B, bacteriocin 31, enterocin AS48, enterocin Q, enterocin EJ97 and cytolysin by using PCR method. All isolates inhibited growth of L. monocytogenes and L.innocua. One isolate had a broader antimicrobial activity. None of the isolates showed inhibitory activity against S. enteritidis, E. coli and Y. enterocolitica. The genes enterocin P, cytolysin and enterocin A were the most frequently detected structural genes among the PCR positive strains. No amplification was obtained in two strains E. faecalis-25 and E. faecalis-86. Three different genes were identified in some strains. With the exclusion of strains possessing a virulence factor, such as cytolysin, producers of more than one enterocins could be of a great technological potential as protective cultures in the cheese industry.

Contamination of knives and graters by bacterial foodborne pathogens during slicing and grating of produce.

Science.gov (United States)

Erickson, Marilyn C; Liao, Jean; Cannon, Jennifer L; Ortega, Ynes R

2015-12-01

Poor hygiene and improper food preparation practices in consumers' homes have previously been demonstrated as contributing to foodborne diseases. To address potential cross-contamination by kitchen utensils in the home, a series of studies was conducted to determine the extent to which the use of a knife or grater on fresh produce would lead to the utensil's contamination with Escherichia coli O157:H7 or Salmonella enterica. When shredding inoculated carrots (ca. 5.3 log CFU/carrot), all graters became contaminated and the number of E. coli O157:H7 present on the utensil was significantly greater than Salmonella (p Contamination of knives after slicing inoculated produce (4.9-5.4 log CFU/produce item) could only be detected by enrichment culture. After slicing tomatoes, honeydew melons, strawberries, cucumbers, and cantaloupes, the average prevalence of knife contamination by the two pathogens was 43%, 17%, 15%, 7%, and 3%, respectively. No significant increase in the incidence or level of contamination occurred on the utensils when residues were present (p > 0.05); however, subsequent contamination of 7 produce items processed with the contaminated utensils did occur. These results highlight the necessity of proper sanitization of these utensils when used in preparation of raw produce. Copyright © 2015 Elsevier Ltd. All rights reserved.

Methyl esterification of pectin plays a role during plant-pathogen interactions and affects plant resistance to diseases.

Science.gov (United States)

Lionetti, Vincenzo; Cervone, Felice; Bellincampi, Daniela

2012-11-01

The cell wall is a complex structure mainly composed by a cellulose-hemicellulose network embedded in a cohesive pectin matrix. Pectin is synthesized in a highly methyl esterified form and is de-esterified in muro by pectin methyl esterases (PMEs). The degree and pattern of methyl esterification affect the cell wall structure and properties with consequences on both the physiological processes of the plants and their resistance to pathogens. PME activity displays a crucial role in the outcome of the plant-pathogen interactions by making pectin more susceptible to the action of the enzymes produced by the pathogens. This review focuses on the impact of pectin methyl esterification in plant-pathogen interactions and on the dynamic role of its alteration during pathogenesis. Copyright © 2012 Elsevier GmbH. All rights reserved.

The B cell death function of obinutuzumab-HDEL produced in plant (Nicotiana benthamiana L. is equivalent to obinutuzumab produced in CHO cells.

Directory of Open Access Journals (Sweden)

Jin Won Lee

Full Text Available Plants have attracted attention as bio-drug production platforms because of their economical and safety benefits. The preliminary efficacy of ZMapp, a cocktail of antibodies produced in N. benthamiana (Nicotiana benthamiana L., suggested plants may serve as a platform for antibody production. However, because the amino acid sequences of the Fab fragment are diverse and differences in post-transcriptional processes between animals and plants remain to be elucidated, it is necessary to confirm functional equivalence of plant-produced antibodies to the original antibody. In this study, Obinutuzumab, a third generation anti-CD20 antibody, was produced in N. benthamiana leaves (plant-obinutuzumab and compared to the original antibody produced in glyco-engineered Chinese hamster ovary (CHO cells (CHO-obinutuzumab. Two forms (with or without an HDEL tag were generated and antibody yields were compared. The HDEL-tagged form was more highly expressed than the non-HDEL-tagged form which was cleaved in the N-terminus. To determine the equivalence in functions of the Fab region between the two forms, we compared the CD20 binding affinities and direct binding induced cell death of a CD20-positive B cells. Both forms showed similar CD20 binding affinities and direct cell death of B cell. The results suggested that plant-obinutuzumab was equivalent to CHO-obinutuzumab in CD20 binding, cell aggregation, and direct cell death via binding. Therefore, our findings suggest that Obinutuzumab is a promising biosimilar candidate that can be produced efficiently in plants.

Exceptional Antibodies Produced by Successive Immunizations.

Directory of Open Access Journals (Sweden)

Patricia J Gearhart

2015-12-01

Full Text Available Antibodies stand between us and pathogens. Viruses mutate quickly to avoid detection, and antibodies mutate at similar rates to hunt them down. This death spiral is fueled by specialized proteins and error-prone polymerases that change DNA sequences. Here, we explore how B lymphocytes stay in the race by expressing activation-induced deaminase, which unleashes a tsunami of mutations in the immunoglobulin loci. This produces random DNA substitutions, followed by selection for the highest affinity antibodies. We may be able to manipulate the process to produce better antibodies by expanding the repertoire of specific B cells through successive vaccinations.

Pathogen inactivation of Dengue virus in red blood cells using amustaline and glutathione.

Science.gov (United States)

Aubry, Maite; Laughhunn, Andrew; Santa Maria, Felicia; Lanteri, Marion C; Stassinopoulos, Adonis; Musso, Didier

2017-12-01

Dengue virus (DENV) is an arbovirus primarily transmitted through mosquito bite; however, DENV transfusion-transmitted infections (TTIs) have been reported and asymptomatic DENV RNA-positive blood donors have been identified in endemic countries. DENV is considered a high-risk pathogen for blood safety. One of the mitigation strategies to prevent arbovirus TTIs is pathogen inactivation. In this study we demonstrate that the amustaline and glutathione (S-303/GSH) treatment previously found effective against Zika virus in red blood cells (RBCs) is also effective in inactivating DENV. Red blood cells were spiked with high levels of DENV. Viral RNA loads and infectious titers were measured in the untreated control and before and after pathogen inactivation treatment of RBC samples. DENV infectivity was also assessed over five successive cell culture passages to detect any potential residual replicative virus. The mean ± SD DENV titer in RBCs before inactivation was 6.61 ± 0.19 log 50% tissue culture infectious dose (TCID 50 )/mL and the mean viral RNA load was 8.42 log genome equivalents/mL. No replicative DENV was detected either immediately after completion of treatment using S-303/GSH or after cell culture passages. Treatment using S-303/GSH inactivated high levels of DENV in RBCs to the limit of detection. In combination with previous studies showing the effective inactivation of DENV in plasma and platelets using the licensed amotosalen/UVA system, this study demonstrates that high levels of DENV can be inactivated in all blood components. © 2017 The Authors Transfusion published by Wiley Periodicals, Inc. on behalf of AABB.

Genetic associations for pathogen-specific clinical mastitis and patterns of peaks in somatic cell count

NARCIS (Netherlands)

Haas, de Y.; Barkema, H.W.; Schukken, Y.H.; Veerkamp, R.F.

2003-01-01

Genetic associations were estimated between pathogen-specific cases of clinical mastitis (CM), lactational average somatic cell score (LACSCS), and patterns of peaks in somatic cell count (SCC) which were based on deviations from the typical lactation curve for SCC. The dataset contained test-day

Insight of Genus Corynebacterium: Ascertaining the Role of Pathogenic and Non-pathogenic Species.

Science.gov (United States)

Oliveira, Alberto; Oliveira, Leticia C; Aburjaile, Flavia; Benevides, Leandro; Tiwari, Sandeep; Jamal, Syed B; Silva, Arthur; Figueiredo, Henrique C P; Ghosh, Preetam; Portela, Ricardo W; De Carvalho Azevedo, Vasco A; Wattam, Alice R

2017-01-01

This review gathers recent information about genomic and transcriptomic studies in the Corynebacterium genus, exploring, for example, prediction of pathogenicity islands and stress response in different pathogenic and non-pathogenic species. In addition, is described several phylogeny studies to Corynebacterium , exploring since the identification of species until biological speciation in one species belonging to the genus Corynebacterium . Important concepts associated with virulence highlighting the role of Pld protein and Tox gene. The adhesion, characteristic of virulence factor, was described using the sortase mechanism that is associated to anchorage to the cell wall. In addition, survival inside the host cell and some diseases, were too addressed for pathogenic corynebacteria, while important biochemical pathways and biotechnological applications retain the focus of this review for non-pathogenic corynebacteria. Concluding, this review broadly explores characteristics in genus Corynebacterium showing to have strong relevance inside the medical, veterinary, and biotechnology field.

Control of epithelial cell function by interleukin-22-producing RORγt+ innate lymphoid cells

Science.gov (United States)

Sanos, Stephanie L; Vonarbourg, Cedric; Mortha, Arthur; Diefenbach, Andreas

2011-01-01

It is rapidly emerging that the defence system of innate lymphocytes is more diverse than previously recognized. In addition to natural killer (NK) cells, lymphoid tissue inducer (LTi) cells, and natural helper cells have now been identified. LTi cells are developmentally dependent on the orphan transcription factor RORγt and instruct lymph node development during embryogenesis. More recently, it has become evident, that in addition to their role for lymph organ development, LTi cells are also potent producers of cytokines such as interleukin-22 (IL-22) and IL-17 in adult mice. In addition to LTi cells, another RORγt-dependent innate lymphocyte subset co-expressing RORγt and NK cell receptors (NKRs) has been identified. These NKR+ RORγt+ cells are also potent producers of IL-22 but it is unclear whether they are part of the NK cell or LTi cell lineage. This review will highlight recent progress in understanding development and function of innate IL-22-producing lymphocyte subsets. PMID:21391996

Targeting development of incretin-producing cells increases insulin secretion

DEFF Research Database (Denmark)

Petersen, Natalia; Reimann, Frank; van Es, Johan H

2015-01-01

the number of intestinal L cells, which produce GLP-1, is an alternative strategy to augment insulin responses and improve glucose tolerance. Blocking the NOTCH signaling pathway with the γ-secretase inhibitor dibenzazepine increased the number of L cells in intestinal organoid-based mouse and human culture...... of the development of incretin-producing cells in the intestine has potential as a therapeutic strategy to improve glycemic control....

Serine/Threonine Protein Phosphatase PstP of Mycobacterium tuberculosis Is Necessary for Accurate Cell Division and Survival of Pathogen*

Science.gov (United States)

Sharma, Aditya K.; Arora, Divya; Singh, Lalit K.; Gangwal, Aakriti; Sajid, Andaleeb; Molle, Virginie; Singh, Yogendra; Nandicoori, Vinay Kumar

2016-01-01

Protein phosphatases play vital roles in phosphorylation-mediated cellular signaling. Although there are 11 serine/threonine protein kinases in Mycobacterium tuberculosis, only one serine/threonine phosphatase, PstP, has been identified. Although PstP has been biochemically characterized and multiple in vitro substrates have been identified, its physiological role has not yet been elucidated. In this study, we have investigated the impact of PstP on cell growth and survival of the pathogen in the host. Overexpression of PstP led to elongated cells and partially compromised survival. We find that depletion of PstP is detrimental to cell survival, eventually leading to cell death. PstP depletion results in elongated multiseptate cells, suggesting a role for PstP in regulating cell division events. Complementation experiments performed with PstP deletion mutants revealed marginally compromised survival, suggesting that all of the domains, including the extracellular domain, are necessary for complete rescue. On the other hand, the catalytic activity of PstP is absolutely essential for the in vitro growth. Mice infection experiments establish a definitive role for PstP in pathogen survival within the host. Depletion of PstP from established infections causes pathogen clearance, indicating that the continued presence of PstP is necessary for pathogen survival. Taken together, our data suggest an important role for PstP in establishing and maintaining infection, possibly via the modulation of cell division events. PMID:27758870

Human Cells as Platform to Produce Gamma-Carboxylated Proteins.

Science.gov (United States)

de Sousa Bomfim, Aline; de Freitas, Marcela Cristina Corrêa; Covas, Dimas Tadeu; de Sousa Russo, Elisa Maria

2018-01-01

The gamma-carboxylated proteins belong to a family of proteins that depend on vitamin K for normal biosynthesis. The major representative gamma-carboxylated proteins are the coagulation system proteins, for example, factor VII, factor IX, factor X, prothrombin, and proteins C, S, and Z. These molecules have harbored posttranslational modifications, such as glycosylation and gamma-carboxylation, and for this reason they need to be produced in mammalian cell lines. Human cells lines have emerged as the most promising alternative to the production of gamma-carboxylated proteins. In this chapter, the methods to generate human cells as a platform to produce gamma-carboxylated proteins, for example the coagulation factors VII and IX, are presented. From the cell line modification up to the vitamin K adaptation of the produced cells is described in the protocols presented in this chapter.

Evaluation of minor pathogen intramammary infection, susceptibility parameters, and somatic cell counts on the development of new intramammary infections with major mastitis pathogens.

Science.gov (United States)

Reyher, K K; Dohoo, I R; Scholl, D T; Keefe, G P

2012-07-01

Major mastitis pathogens such as Staphylococcus aureus, Streptococcus uberis, Streptococcus dysgalactiae, and coliforms are usually considered more virulent and damaging to the udder than minor mastitis pathogens such as Corynebacterium spp. and coagulase-negative staphylococci (CNS). The current literature comprises several studies (n=38) detailing analyses with conflicting results as to whether intramammary infections (IMI) with the minor pathogens decrease, increase, or have no effect on the risk of a quarter acquiring a new IMI (NIMI) with a major pathogen. The Canadian Bovine Mastitis Research Network has a large mastitis database derived from a 2-yr data collection on a national cohort of dairy farms, and data from this initiative were used to further investigate the effect of IMI with minor pathogens on the acquisition of new major pathogen infections (defined as a culture-positive quarter sample in a quarter that had been free of that major pathogen in previous samples in the sampling period). Longitudinal milk samplings of clinically normal udders taken over several 6-wk periods as well as samples from cows pre-dry-off and postcalving were used to this end (n=80,397 quarter milk samples). The effects of CNS and Corynebacterium spp. on the major mastitis pathogens Staph. aureus, Strep. uberis, Strep. dysgalactiae, and coliform bacteria (Escherichia coli and Klebsiella spp.) were investigated using risk ratio analyses and multilevel logistic regression models. Quarter-, cow- and herd-level susceptibility parameters were also evaluated and were able to account for the increased susceptibility that exists within herds, cows and quarters, removing it from estimates for the effects of the minor pathogens. Increased quarter-level susceptibility was associated with increased risk of major pathogen NIMI for all pathogens except the coliforms. Increased somatic cell count was consistently associated with elevated risk of new major pathogen infections, but this was

Mechanisms of Disease: Host-Pathogen Interactions between Burkholderia Species and Lung Epithelial Cells

Science.gov (United States)

David, Jonathan; Bell, Rachel E.; Clark, Graeme C.

2015-01-01

Members of the Burkholderia species can cause a range of severe, often fatal, respiratory diseases. A variety of in vitro models of infection have been developed in an attempt to elucidate the mechanism by which Burkholderia spp. gain entry to and interact with the body. The majority of studies have tended to focus on the interaction of bacteria with phagocytic cells with a paucity of information available with regard to the lung epithelium. However, the lung epithelium is becoming more widely recognized as an important player in innate immunity and the early response to infections. Here we review the complex relationship between Burkholderia species and epithelial cells with an emphasis on the most pathogenic species, Burkholderia pseudomallei and Burkholderia mallei. The current gaps in knowledge in our understanding are highlighted along with the epithelial host-pathogen interactions that offer potential opportunities for therapeutic intervention. PMID:26636042

Cultivating Insect Cells To Produce Recombinant Proteins

Science.gov (United States)

Spaulding, Glenn; Goodwin, Thomas; Prewett, Tacey; Andrews, Angela; Francis, Karen; O'Connor, Kim

1996-01-01

Method of producing recombinant proteins involves growth of insect cells in nutrient solution in cylindrical bioreactor rotating about cylindrical axis, oriented horizontally and infecting cells with viruses into which genes of selected type cloned. Genes in question those encoding production of desired proteins. Horizontal rotating bioreactor preferred for use in method, denoted by acronym "HARV", described in "High-Aspect-Ratio Rotating Cell-Culture Vessel" (MSC-21662).

Host cells and methods for producing isoprenyl alkanoates

Energy Technology Data Exchange (ETDEWEB)

Lee, Taek Soon; Fortman, Jeffrey L.; Keasling, Jay D.

2015-12-01

The invention provides for a method of producing an isoprenyl alkanoate in a genetically modified host cell. In one embodiment, the method comprises culturing a genetically modified host cell which expresses an enzyme capable of catalyzing the esterification of an isoprenol and a straight-chain fatty acid, such as an alcohol acetyltransferase (AAT), wax ester synthase/diacylglycerol acyltransferase (WS/DGAT) or lipase, under a suitable condition so that the isoprenyl alkanoate is produced.

Establishment of immortalized human erythroid progenitor cell lines able to produce enucleated red blood cells.

Directory of Open Access Journals (Sweden)

Ryo Kurita

Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.

[Pathogenic Mechanism and Diagnostic Testing for Drug Allergies].

Science.gov (United States)

Uno, Katsuji

2018-01-01

　Three stages of the pathogenic mechanism of drug allergies can be considered: antigen formation, immune reaction and inflammation/disorder reaction. Drugs are thought to form 4 types of antigens: drug only, polymers, drug-carrier conjugates, and metabolite-carrier complexes. Antigens are recognized by B cell receptors and T cell receptors. Helper T cells (Th) are differentiated into four subsets, namely, Th1, Th2, Th17 and regulatory T cells (Treg). Th1 produces interleukin (IL)-2 and interferon (IFN)-γ, and activates macrophages and cytotoxic T cells (Tc). Macrophages induce type IV allergies, and Tc lead to serious type IV allergies. On the other hand, Th2 produces IL-4, IL-5, and IL-6, etc., and activates B cells. B cells produce IgE antibodies, and the IgE antibody affects mast cells and induces type I allergies. Activated eosinophil leads to the chronic state of type I allergy. Diagnostic testing for allergenic drugs is necessary for patients with drug allergies. Because in vivo diagnostic tests for allergenic drugs are associated with a risk and burden to the patient, in vitro allergy tests are recommended to identify allergenic drugs. In allergy tests performed in vitro, cytological tests are more effective than serological tests, and the leukocyte migration test (LMT) presently has the highest efficacy. An LMT-chamber is better than LMT-agarose in terms of usability and sensitivity, and it can detect about 80% of allergenic drugs.

Microstructure of Cell Wall-Associated Melanin in the Human Pathogenic Fungus cryptococcus neoformans

OpenAIRE

Eisenman, H.C.; Nosanchuk, J.D.; Webber, J. Beau W.; Emerson, T.A.; Casadevall, A.

2005-01-01

Melanin is a virulence factor for many pathogenic fungal species,including Cryptococcus neoformans. Melanin is deposited in the cell wall, and melanin isolated from this fungus retains the shape of the cells, resulting in hollow spheres called ``ghosts''. In this study, atomic force, scanning electron, and transmission electron microscopy revealed that melanin ghosts are covered with roughly spherical granular particles approximately 40-130 nm in diameter, and that the melanin is arranged in ...

Contamination of cell phones by pathogenic microorganisms: Comparison between hospital staff and college students

OpenAIRE

PURNIMA R. CHITLANGE

2014-01-01

Chitlange PR. 2014. Contamination of cell phones by pathogenic microorganisms: Comparison between hospital staff and college students. Nusantara Bioscience 6: 203-206. Cell phone (CP) is a long range portable electronic device. The cell phone is constantly exposed to arrays of micro organisms, making it a harbour and breeding ground for microbes especially those associated with skin. The adult human is covered with approximately 2m2 of skin with area supporting about 106 bacteria. To check wh...

Cells and methods for producing fatty alcohols

Science.gov (United States)

Pfleger, Brian F.; Youngquist, Tyler J.

2017-07-18

Recombinant cells and methods for improved yield of fatty alcohols. The recombinant cells harbor a recombinant thioesterase gene, a recombinant acyl-CoA synthetase gene, and a recombinant acyl-CoA reductase gene. In addition, a gene product from one or more of an acyl-CoA dehydrogenase gene, an enoyl-CoA hydratase gene, a 3-hydroxyacyl-CoA dehydrogenase gene, and a 3-ketoacyl-CoA thiolase gene in the recombinant cells is functionally deleted. Culturing the recombinant cells produces fatty alcohols at high yields.

B-cell exposure to self-antigen induces IL-10 producing B cells as well as IL-6- and TNF-α-producing B-cell subsets in healthy humans

DEFF Research Database (Denmark)

Langkjær, Anina; Kristensen, Birte; Hansen, Bjarke E

2012-01-01

Human B cells are able to secrete IL-10 after stimulation with mitogens, but their ability to produce IL-10 and regulate T-cell responses after stimulation with self-antigens is unclear. We co-cultured thyroglobulin-pulsed B cells from healthy donors with autologous T cells and observed production...... of IL-10 and TGF-β, in addition to TNF-α and IL-6. Pulsing with foreign antigen, tetanus toxoid (TT), induced a Th1-response with minimal IL-10 production. After thyroglobulin-pulsing, 1.10±0.50% of B cells and 1.00±0.20% of CD4(+) T cells produced IL-10, compared to 0.29±0.19% of B cells (P=0.01) and 0.......13±0.15% of CD4(+) T cells (P=0.006) following TT-pulsing. Thyroglobulin-stimulated, IL-10-secreting B cells were enriched within CD5(+) and CD24(high) cells. While thyroglobulin-pulsed B cells induced only modest proliferation of CD4(+) T cells, B cells pulsed with TT induced vigorous proliferation. Thus, B...

Dual Targeting of Intracellular Pathogenic Bacteria with a Cleavable Conjugate of Kanamycin and an Antibacterial Cell-Penetrating Peptide.

Science.gov (United States)

Brezden, Anna; Mohamed, Mohamed F; Nepal, Manish; Harwood, John S; Kuriakose, Jerrin; Seleem, Mohamed N; Chmielewski, Jean

2016-08-31

Bacterial infection caused by intracellular pathogens, such as Mycobacterium, Salmonella, and Brucella, is a burgeoning global health epidemic that necessitates urgent action. However, the therapeutic value of a number of antibiotics, including aminoglycosides, against intracellular pathogenic bacteria is compromised due to their inability to traverse eukaryotic membranes. For this significant problem to be addressed, a cleavable conjugate of the antibiotic kanamycin and a nonmembrane lytic, broad-spectrum antimicrobial peptide with efficient mammalian cell penetration, P14LRR, was prepared. This approach allows kanamycin to enter mammalian cells as a conjugate linked via a tether that breaks down in the reducing environment within cells. Potent antimicrobial activity of the P14KanS conjugate was demonstrated in vitro, and this reducible conjugate effectively cleared intracellular pathogenic bacteria within macrophages more potently than that of a conjugate lacking the disulfide moiety. Notably, successful clearance of Mycobacterium tuberculosis within macrophages was observed with the dual antibiotic conjugate, and Salmonella levels were significantly reduced in an in vivo Caenorhabditis elegans model.

Living biointerfaces based on non-pathogenic bacteria support stem cell differentiation

Science.gov (United States)

Hay, Jake J.; Rodrigo-Navarro, Aleixandre; Hassi, Karoliina; Moulisova, Vladimira; Dalby, Matthew J.; Salmeron-Sanchez, Manuel

2016-02-01

Lactococcus lactis, a non-pathogenic bacteria, has been genetically engineered to express the III7-10 fragment of human fibronectin as a membrane protein. The engineered L. lactis is able to develop biofilms on different surfaces (such as glass and synthetic polymers) and serves as a long-term substrate for mammalian cell culture, specifically human mesenchymal stem cells (hMSC). This system constitutes a living interface between biomaterials and stem cells. The engineered biofilms remain stable and viable for up to 28 days while the expressed fibronectin fragment induces hMSC adhesion. We have optimised conditions to allow long-term mammalian cell culture, and found that the biofilm is functionally equivalent to a fibronectin-coated surface in terms of osteoblastic differentiation using bone morphogenetic protein 2 (BMP-2) added to the medium. This living bacteria interface holds promise as a dynamic substrate for stem cell differentiation that can be further engineered to express other biochemical cues to control hMSC differentiation.

Signaling network of dendritic cells in response to pathogens: a community-input supported knowledgebase.

Science.gov (United States)

Patil, Sonali; Pincas, Hanna; Seto, Jeremy; Nudelman, German; Nudelman, Irina; Sealfon, Stuart C

2010-10-07

Dendritic cells are antigen-presenting cells that play an essential role in linking the innate and adaptive immune systems. Much research has focused on the signaling pathways triggered upon infection of dendritic cells by various pathogens. The high level of activity in the field makes it desirable to have a pathway-based resource to access the information in the literature. Current pathway diagrams lack either comprehensiveness, or an open-access editorial interface. Hence, there is a need for a dependable, expertly curated knowledgebase that integrates this information into a map of signaling networks. We have built a detailed diagram of the dendritic cell signaling network, with the goal of providing researchers with a valuable resource and a facile method for community input. Network construction has relied on comprehensive review of the literature and regular updates. The diagram includes detailed depictions of pathways activated downstream of different pathogen recognition receptors such as Toll-like receptors, retinoic acid-inducible gene-I-like receptors, C-type lectin receptors and nucleotide-binding oligomerization domain-like receptors. Initially assembled using CellDesigner software, it provides an annotated graphical representation of interactions stored in Systems Biology Mark-up Language. The network, which comprises 249 nodes and 213 edges, has been web-published through the Biological Pathway Publisher software suite. Nodes are annotated with PubMed references and gene-related information, and linked to a public wiki, providing a discussion forum for updates and corrections. To gain more insight into regulatory patterns of dendritic cell signaling, we analyzed the network using graph-theory methods: bifan, feedforward and multi-input convergence motifs were enriched. This emphasis on activating control mechanisms is consonant with a network that subserves persistent and coordinated responses to pathogen detection. This map represents a navigable

Modeling the intracellular pathogen-immune interaction with cure rate

Science.gov (United States)

Dubey, Balram; Dubey, Preeti; Dubey, Uma S.

2016-09-01

Many common and emergent infectious diseases like Influenza, SARS, Hepatitis, Ebola etc. are caused by viral pathogens. These infections can be controlled or prevented by understanding the dynamics of pathogen-immune interaction in vivo. In this paper, interaction of pathogens with uninfected and infected cells in presence or absence of immune response are considered in four different cases. In the first case, the model considers the saturated nonlinear infection rate and linear cure rate without absorption of pathogens into uninfected cells and without immune response. The next model considers the effect of absorption of pathogens into uninfected cells while all other terms are same as in the first case. The third model incorporates innate immune response, humoral immune response and Cytotoxic T lymphocytes (CTL) mediated immune response with cure rate and without absorption of pathogens into uninfected cells. The last model is an extension of the third model in which the effect of absorption of pathogens into uninfected cells has been considered. Positivity and boundedness of solutions are established to ensure the well-posedness of the problem. It has been found that all the four models have two equilibria, namely, pathogen-free equilibrium point and pathogen-present equilibrium point. In each case, stability analysis of each equilibrium point is investigated. Pathogen-free equilibrium is globally asymptotically stable when basic reproduction number is less or equal to unity. This implies that control or prevention of infection is independent of initial concentration of uninfected cells, infected cells, pathogens and immune responses in the body. The proposed models show that introduction of immune response and cure rate strongly affects the stability behavior of the system. Further, on computing basic reproduction number, it has been found to be minimum for the fourth model vis-a-vis other models. The analytical findings of each model have been exemplified by

Effects of single- and multi-strain probiotics on biofilm formation and in vitro adhesion to bladder cells by urinary tract pathogens.

Science.gov (United States)

Chapman, C M C; Gibson, G R; Rowland, I

2014-06-01

There is increasing evidence that probiotic bacteria can inhibit and/or prevent urinary tract infections. Possible mechanisms include prevention of adhesion of pathogens to the bladder epithelium and inhibition of biofilm formation. Currently there is interest in the comparative efficacy of single probiotics vs. strain mixtures. We have therefore tested the inhibitory activity of four single probiotics and four probiotic mixtures towards the urinary tract pathogens Escherichia coli NCTC 9001 and Enterococcus faecalis NCTC 00775. Inhibition of biofilm formation by cell-free supernatants was tested using the Crystal Violet assay, while prevention of pathogen adhesion to host cells was tested by using bladder cancer cells as a model for the human urinary tract. Under pH-controlled conditions, there was no significant inhibition of biofilm formation by any treatment. Without pH control, 5/8 treatments significantly inhibited biofilm production by E. coli, while 5/8 treatments inhibited production by E. faecalis. Using data from all Crystal Violet assays, there was no significant difference in the ability of single- and multi-strain probiotics to inhibit biofilm formation. In the cell culture assays, all treatments were able to significantly reduce numbers of pathogenic cells adhering to host cells by 2.5-3.5 logs. No significant difference was observed between the displacement caused by single strains and mixtures for either pathogen. Inhibition of biofilm seems to be a major mechanism of urinary tract pathogen exclusion, related to, and possibly dependent upon, the probiotic ability to reduce environmental pH. Exclusion via competition of binding sites is a possible in vivo mechanism for these probiotics. If an additive or synergistic effect exists between strains within a mixture, it does not manifest itself in a greater effect through these two inhibitory mechanisms. Copyright © 2014 Elsevier Ltd. All rights reserved.

Pathogenic Chlamydia Lack a Classical Sacculus but Synthesize a Narrow, Mid-cell Peptidoglycan Ring, Regulated by MreB, for Cell Division.

Science.gov (United States)

Liechti, George; Kuru, Erkin; Packiam, Mathanraj; Hsu, Yen-Pang; Tekkam, Srinivas; Hall, Edward; Rittichier, Jonathan T; VanNieuwenhze, Michael; Brun, Yves V; Maurelli, Anthony T

2016-05-01

The peptidoglycan (PG) cell wall is a peptide cross-linked glycan polymer essential for bacterial division and maintenance of cell shape and hydrostatic pressure. Bacteria in the Chlamydiales were long thought to lack PG until recent advances in PG labeling technologies revealed the presence of this critical cell wall component in Chlamydia trachomatis. In this study, we utilize bio-orthogonal D-amino acid dipeptide probes combined with super-resolution microscopy to demonstrate that four pathogenic Chlamydiae species each possess a ≤ 140 nm wide PG ring limited to the division plane during the replicative phase of their developmental cycles. Assembly of this PG ring is rapid, processive, and linked to the bacterial actin-like protein, MreB. Both MreB polymerization and PG biosynthesis occur only in the intracellular form of pathogenic Chlamydia and are required for cell enlargement, division, and transition between the microbe's developmental forms. Our kinetic, molecular, and biochemical analyses suggest that the development of this limited, transient, PG ring structure is the result of pathoadaptation by Chlamydia to an intracellular niche within its vertebrate host.

Pathogenic Chlamydia Lack a Classical Sacculus but Synthesize a Narrow, Mid-cell Peptidoglycan Ring, Regulated by MreB, for Cell Division.

Directory of Open Access Journals (Sweden)

George Liechti

2016-05-01

Full Text Available The peptidoglycan (PG cell wall is a peptide cross-linked glycan polymer essential for bacterial division and maintenance of cell shape and hydrostatic pressure. Bacteria in the Chlamydiales were long thought to lack PG until recent advances in PG labeling technologies revealed the presence of this critical cell wall component in Chlamydia trachomatis. In this study, we utilize bio-orthogonal D-amino acid dipeptide probes combined with super-resolution microscopy to demonstrate that four pathogenic Chlamydiae species each possess a ≤ 140 nm wide PG ring limited to the division plane during the replicative phase of their developmental cycles. Assembly of this PG ring is rapid, processive, and linked to the bacterial actin-like protein, MreB. Both MreB polymerization and PG biosynthesis occur only in the intracellular form of pathogenic Chlamydia and are required for cell enlargement, division, and transition between the microbe's developmental forms. Our kinetic, molecular, and biochemical analyses suggest that the development of this limited, transient, PG ring structure is the result of pathoadaptation by Chlamydia to an intracellular niche within its vertebrate host.

Detection of bacteriocins produced by plant pathogenic bacteria from the general Erwinia, Pseudomonas and Xanthomonas

International Nuclear Information System (INIS)

Biagi, C.M.R. de

1992-01-01

Detection of bacteriocin production was studied under distinct conditions using strains of plant pathogenic bacteria from the genera Erwinia, Pseudomonas and Xanthomonas. 58.06%, 79.31% and 40.00% of producing strains were found respectively in the three groups of bacteria using the 523 medium which was the best for the detection of bacteriocin production. Increasing agar concentrations added to the medium up to 1,5% improved the detection. The amount of medium added to the Petri dishes did not affect bacteriocin production. The longest incubation time (72 h.) improved the detection of haloes production. Ultra-violet irradiation in low dosages seems to improve the visualization of haloes production but this is dependent on the tested strains. (author)

Zika virus produces noncoding RNAs using a multi-pseudoknot structure that confounds a cellular exonuclease

International Nuclear Information System (INIS)

Akiyama, Benjamin M.; Laurence, Hannah M.; University of Colorado, Aurora, CO; University of California, Davis, CA; Massey, Aaron R.

2016-01-01

The outbreak of Zika virus (ZIKV) and associated fetal microcephaly mandates efforts to understand the molecular processes of infection. Related flaviviruses produce noncoding subgenomic flaviviral RNAs (sfRNAs) that are linked to pathogenicity in fetal mice. These viruses make sfRNAs by co-opting a cellular exonuclease via structured RNAs called xrRNAs. We found that ZIKV-infected monkey and human epithelial cells, mouse neurons, and mosquito cells produce sfRNAs. The RNA structure that is responsible for ZIKV sfRNA production forms a complex fold that is likely found in many pathogenic flaviviruses. Mutations that disrupt the structure affect exonuclease resistance in vitro and sfRNA formation during infection. The complete ZIKV xrRNA structure clarifies the mechanism of exonuclease resistance and identifies features that may modulate function in diverse flaviviruses.

Development, upscaling and validation of the purification process for human-cl rhFVIII (Nuwiq®), a new generation recombinant factor VIII produced in a human cell-line.

Science.gov (United States)

Winge, Stefan; Yderland, Louise; Kannicht, Christoph; Hermans, Pim; Adema, Simon; Schmidt, Torben; Gilljam, Gustav; Linhult, Martin; Tiemeyer, Maya; Belyanskaya, Larisa; Walter, Olaf

2015-11-01

Human-cl rhFVIII (Nuwiq®), a new generation recombinant factor VIII (rFVIII), is the first rFVIII produced in a human cell-line approved by the European Medicines Agency. To describe the development, upscaling and process validation for industrial-scale human-cl rhFVIII purification. The purification process involves one centrifugation, two filtration, five chromatography columns and two dedicated pathogen clearance steps (solvent/detergent treatment and 20 nm nanofiltration). The key purification step uses an affinity resin (VIIISelect) with high specificity for FVIII, removing essentially all host-cell proteins with >80% product recovery. The production-scale multi-step purification process efficiently removes process- and product-related impurities and results in a high-purity rhFVIII product, with an overall yield of ∼50%. Specific activity of the final product was >9000 IU/mg, and the ratio between active FVIII and total FVIII protein present was >0.9. The entire production process is free of animal-derived products. Leaching of potential harmful compounds from chromatography resins and all pathogens tested were below the limit of quantification in the final product. Human-cl rhFVIII can be produced at 500 L bioreactor scale, maintaining high purity and recoveries. The innovative purification process ensures a high-purity and high-quality human-cl rhFVIII product with a high pathogen safety margin. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Anaplasma phagocytophilum MSP4 and HSP70 Proteins Are Involved in Interactions with Host Cells during Pathogen Infection

Directory of Open Access Journals (Sweden)

Marinela Contreras

2017-07-01

Full Text Available Anaplasma phagocytophilum transmembrane and surface proteins play a role during infection and multiplication in host neutrophils and tick vector cells. Recently, A. phagocytophilum Major surface protein 4 (MSP4 and Heat shock protein 70 (HSP70 were shown to be localized on the bacterial membrane, with a possible role during pathogen infection in ticks. In this study, we hypothesized that A. phagocytophilum MSP4 and HSP70 have similar functions in tick-pathogen and host-pathogen interactions. To address this hypothesis, herein we characterized the role of these bacterial proteins in interaction and infection of vertebrate host cells. The results showed that A. phagocytophilum MSP4 and HSP70 are involved in host-pathogen interactions, with a role for HSP70 during pathogen infection. The analysis of the potential protective capacity of MSP4 and MSP4-HSP70 antigens in immunized sheep showed that MSP4-HSP70 was only partially protective against pathogen infection. This limited protection may be associated with several factors, including the recognition of non-protective epitopes by IgG in immunized lambs. Nevertheless, these antigens may be combined with other candidate protective antigens for the development of vaccines for the control of human and animal granulocytic anaplasmosis. Focusing on the characterization of host protective immune mechanisms and protein-protein interactions at the host-pathogen interface may lead to the discovery and design of new effective protective antigens.

Targeting of histamine producing cells by EGCG: a green dart against inflammation?

Science.gov (United States)

Melgarejo, Esther; Medina, Miguel Angel; Sánchez-Jiménez, Francisca; Urdiales, José Luis

2010-09-01

The human body is made of some 250 different cell types. From them, only a small subset of cell types is able to produce histamine. They include some neurons, enterochromaffin-like cells, gastrin-containing cells, mast cells, basophils, and monocytes/macrophages, among others. In spite of the reduced number of these histamine-producing cell types, they are involved in very different physiological processes. Their deregulation is related with many highly prevalent, as well as emergent and rare diseases, mainly those described as inflammation-dependent pathologies, including mastocytosis, basophilic leukemia, gastric ulcer, Crohn disease, and other inflammatory bowel diseases. Furthermore, oncogenic transformation switches some non-histamine-producing cells to a histamine producing phenotype. This is the case of melanoma, small cell lung carcinoma, and several types of neuroendocrine tumors. The bioactive compound epigallocatechin-3-gallate (EGCG), a major component of green tea, has been shown to target histamine-producing cells producing great alterations in their behavior, with relevant effects on their proliferative potential, as well as their adhesion, migration, and invasion potentials. In fact, EGCG has been shown to have potent anti-inflammatory, anti-tumoral, and anti-angiogenic effects and to be a potent inhibitor of the histamine-producing enzyme, histidine decarboxylase. Herein, we review the many specific effects of EGCG on concrete molecular targets of histamine-producing cells and discuss the relevance of these data to support the potential therapeutic interest of this compound to treat inflammation-dependent diseases.

Pathogenicity of Shigella in chickens.

Science.gov (United States)

Shi, Run; Yang, Xia; Chen, Lu; Chang, Hong-tao; Liu, Hong-ying; Zhao, Jun; Wang, Xin-wei; Wang, Chuan-qing

2014-01-01

Shigellosis in chickens was first reported in 2004. This study aimed to determine the pathogenicity of Shigella in chickens and the possibility of cross-infection between humans and chickens. The pathogenicity of Shigella in chickens was examined via infection of three-day-old SPF chickens with Shigella strain ZD02 isolated from a human patient. The virulence and invasiveness were examined by infection of the chicken intestines and primary chicken intestinal epithelial cells. The results showed Shigella can cause death via intraperitoneal injection in SPF chickens, but only induce depression via crop injection. Immunohistochemistry and transmission electron microscopy revealed the Shigella can invade the intestinal epithelia. Immunohistochemistry of the primary chicken intestinal epithelial cells infected with Shigella showed the bacteria were internalized into the epithelial cells. Electron microscopy also confirmed that Shigella invaded primary chicken intestinal epithelia and was encapsulated by phagosome-like membranes. Our data demonstrate that Shigella can invade primary chicken intestinal epithelial cells in vitro and chicken intestinal mucosa in vivo, resulting in pathogenicity and even death. The findings suggest Shigella isolated from human or chicken share similar pathogenicity as well as the possibility of human-poultry cross-infection, which is of public health significance.

A cell culture model for Nosema ceranae and Nosema apis allows new insights into the life cycle of these important honey bee-pathogenic microsporidia.

Science.gov (United States)

Gisder, Sebastian; Möckel, Nadine; Linde, Andreas; Genersch, Elke

2011-02-01

The population of managed honey bees has been dramatically declining in the recent past in many regions of the world. Consensus now seems to be that pathogens and parasites (e.g. the ectoparasitic mite Varroa destructor, the microsporidium Nosema ceranae and viruses) play a major role in this demise. However, little is known about host-pathogen interactions for bee pathogens and attempts to develop novel strategies to combat bee diseases have been hampered by this gap in our knowledge. One reason for this dire situation is the complete lack of cell cultures for the propagation and study of bee pathogens. Here we present a cell culture model for two honey bee-pathogenic microsporidian species, Nosema apis and N. ceranae. Our cell culture system is based on a lepidopteran cell line, which proved to be susceptible to infection by both N. ceranae and N. apis and enabled us to illustrate the entire life cycle of these microsporidia. We observed hitherto undescribed spindle-shaped meronts and confirmed our findings in infected bees. Our cell culture model provides a previously unavailable means to explore the nature of interactions between the honey bee and its pathogen complex at a mechanistic level and will allow the development of novel treatment strategies.

Host cells and methods for producing diacid compounds

Energy Technology Data Exchange (ETDEWEB)

Steen, Eric J.; Fortman, Jeffrey L.; Dietrich, Jeffrey A.; Keasling, Jay D.

2018-04-24

The present invention provides for a method of producing one or more fatty acid derived dicarboxylic acids in a genetically modified host cell which does not naturally produce the one or more derived fatty acid derived dicarboxylic acids. The invention provides for the biosynthesis of dicarboxylic acid ranging in length from C3 to C26. The host cell can be further modified to increase fatty acid production or export of the desired fatty acid derived compound, and/or decrease fatty acid storage or metabolism.

Targeting of the hydrophobic metabolome by pathogens.

Science.gov (United States)

Helms, J Bernd; Kaloyanova, Dora V; Strating, Jeroen R P; van Hellemond, Jaap J; van der Schaar, Hilde M; Tielens, Aloysius G M; van Kuppeveld, Frank J M; Brouwers, Jos F

2015-05-01

The hydrophobic molecules of the metabolome - also named the lipidome - constitute a major part of the entire metabolome. Novel technologies show the existence of a staggering number of individual lipid species, the biological functions of which are, with the exception of only a few lipid species, unknown. Much can be learned from pathogens that have evolved to take advantage of the complexity of the lipidome to escape the immune system of the host organism and to allow their survival and replication. Different types of pathogens target different lipids as shown in interaction maps, allowing visualization of differences between different types of pathogens. Bacterial and viral pathogens target predominantly structural and signaling lipids to alter the cellular phenotype of the host cell. Fungal and parasitic pathogens have complex lipidomes themselves and target predominantly the release of polyunsaturated fatty acids from the host cell lipidome, resulting in the generation of eicosanoids by either the host cell or the pathogen. Thus, whereas viruses and bacteria induce predominantly alterations in lipid metabolites at the host cell level, eukaryotic pathogens focus on interference with lipid metabolites affecting systemic inflammatory reactions that are part of the immune system. A better understanding of the interplay between host-pathogen interactions will not only help elucidate the fundamental role of lipid species in cellular physiology, but will also aid in the generation of novel therapeutic drugs. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Interleukin-10 is produced by a specific subset of taste receptor cells and critical for maintaining structural integrity of mouse taste buds.

Science.gov (United States)

Feng, Pu; Chai, Jinghua; Zhou, Minliang; Simon, Nirvine; Huang, Liquan; Wang, Hong

2014-02-12

Although inflammatory responses are a critical component in defense against pathogens, too much inflammation is harmful. Mechanisms have evolved to regulate inflammation, including modulation by the anti-inflammatory cytokine interleukin-10 (IL-10). Previously we have shown that taste buds express various molecules involved in innate immune responses, including the proinflammatory cytokine tumor necrosis factor (TNF). Here, using a reporter mouse strain, we show that taste cells also express the anti-inflammatory cytokine IL-10. Remarkably, IL-10 is produced by only a specific subset of taste cells, which are different from the TNF-producing cells in mouse circumvallate and foliate taste buds: IL-10 expression was found exclusively in the G-protein gustducin-expressing bitter receptor cells, while TNF was found in sweet and umami receptor cells as reported previously. In contrast, IL-10R1, the ligand-binding subunit of the IL-10 receptor, is predominantly expressed by TNF-producing cells, suggesting a novel cellular hierarchy for regulating TNF production and effects in taste buds. In response to inflammatory challenges, taste cells can increase IL-10 expression both in vivo and in vitro. These findings suggest that taste buds use separate populations of taste receptor cells that coincide with sweet/umami and bitter taste reception to modulate local inflammatory responses, a phenomenon that has not been previously reported. Furthermore, IL-10 deficiency in mice leads to significant reductions in the number and size of taste buds, as well as in the number of taste receptor cells per taste bud, suggesting that IL-10 plays critical roles in maintaining structural integrity of the peripheral gustatory system.

The Cell Wall-Associated Proteins in the Dimorphic Pathogenic Species of Paracoccidioides.

Science.gov (United States)

Puccia, Rosana; Vallejo, Milene C; Longo, Larissa V G

2017-01-01

Paracoccidioides brasiliensis and P. lutzii cause human paracoccidioidomycosis (PCM). They are dimorphic ascomycetes that grow as filaments at mild temperatures up to 28oC and as multibudding pathogenic yeast cells at 37oC. Components of the fungal cell wall have an important role in the interaction with the host because they compose the cell outermost layer. The Paracoccidioides cell wall is composed mainly of polysaccharides, but it also contains proportionally smaller rates of proteins, lipids, and melanin. The polysaccharide cell wall composition and structure of Paracoccidioides yeast cells, filamentous and transition phases were studied in detail in the past. Other cell wall components have been better analyzed in the last decades. The present work gives to the readers a detailed updated view of cell wall-associated proteins. Proteins that have been localized at the cell wall compartment using antibodies are individually addressed. We also make an overview about PCM, the Paracoccidioides cell wall structure, secretion mechanisms, and fungal extracellular vesicles. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Pathogenic mechanisms of intracellular bacteria.

Science.gov (United States)

Niller, Hans Helmut; Masa, Roland; Venkei, Annamária; Mészáros, Sándor; Minarovits, Janos

2017-06-01

We wished to overview recent data on a subset of epigenetic changes elicited by intracellular bacteria in human cells. Reprogramming the gene expression pattern of various host cells may facilitate bacterial growth, survival, and spread. DNA-(cytosine C5)-methyltransferases of Mycoplasma hyorhinis targeting cytosine-phosphate-guanine (CpG) dinucleotides and a Mycobacterium tuberculosis methyltransferase targeting non-CpG sites methylated the host cell DNA and altered the pattern of gene expression. Gene silencing by CpG methylation and histone deacetylation, mediated by cellular enzymes, also occurred in M. tuberculosis-infected macrophages. M. tuberculosis elicited cell type-specific epigenetic changes: it caused increased DNA methylation in macrophages, but induced demethylation, deposition of euchromatic histone marks and activation of immune-related genes in dendritic cells. A secreted transposase of Acinetobacter baumannii silenced a cellular gene, whereas Mycobacterium leprae altered the epigenotype, phenotype, and fate of infected Schwann cells. The 'keystone pathogen' oral bacterium Porphyromonas gingivalis induced local DNA methylation and increased the level of histone acetylation in host cells. These epigenetic changes at the biofilm-gingiva interface may contribute to the development of periodontitis. Epigenetic regulators produced by intracellular bacteria alter the epigenotype and gene expression pattern of host cells and play an important role in pathogenesis.

Multidrug-resistant Enterobacteriaceae including metallo-β-lactamase producers are predominant pathogens of healthcare-associated infections in an Indian teaching hospital

Directory of Open Access Journals (Sweden)

J B Sarma

2011-01-01

Full Text Available Purpose: A study was carried out in an Indian teaching hospital in 2009 to detect the rate of surgical site infections (SSI and peripheral vascular access site infections. Materials and Methods: The study was a point-prevalence study involving over 300 patients. The presence of infection was determined according to the CDC criteria. Swabs were taken from the infected sites and identification and sensitivity were carried out using VITEK® 2 automated system. Characterisation of β-lactamase was carried out at ARRML, Colindale, London. Results: The rate of SSI was 15% for the clean and clean-contaminated categories while that for the dirty contaminated category was 85% (NNIS risk index 0. Cultures yielded definite or probable pathogens from 64% (9/14 of the patients with SSI. In 1/3 rd of the cultures, Staphylococcus aureus was grown and the rest had Enterobacteriaceae, either extended-spectrum β-lactamase (ESBL producers or Amp-C hyperproducers and, alarmingly, three isolates were positive for newly recognised New Delhi metallo-β-lactamase-1 (NDM-1. In medicine, 87% (n = 99 of the patients had a peripheral IV access device, 55% developed associated phlebitis/infection and, in seven, probable pathogens were isolated (Candida species and Escherichia coli producing ESBL and NDM-1, respectively, Staphylococcus aureus and Enterococcus faecium. All ESBL and metallo-β-lactamase producers were resistant to multiple classes of antimicrobials, the latter being sensitive only to colistin and tigecycline. The study also found that all post-operative patients were on antibiotics, 92% on IV [213 defined daily doses (DDD/100 post-op patients] limited mainly to the third-generation cephalosporins (26% and aminoglycosides (24% and imidazole derivatives (30%. In medicine, 83% (n = 82 were on IV antibiotics (123 DDD/100 bed-days, limited mainly to the third-generation cephalosporins (74%. Conclusion: Indiscriminate use of antibiotics is a major problem

Use of an Optical Trap for Study of Host-Pathogen Interactions for Dynamic Live Cell Imaging

OpenAIRE

Tam, Jenny M.; Castro, Carlos E.; Heath, Robert J. W.; Mansour, Michael K.; Cardenas, Michael L.; Xavier, Ramnik J.; Lang, Matthew J.; Vyas, Jatin M.

2011-01-01

Dynamic live cell imaging allows direct visualization of real-time interactions between cells of the immune system1, 2; however, the lack of spatial and temporal control between the phagocytic cell and microbe has rendered focused observations into the initial interactions of host response to pathogens difficult. Historically, intercellular contact events such as phagocytosis3 have been imaged by mixing two cell types, and then continuously scanning the field-of-view to find serendipitous int...

Differentiation of human-induced pluripotent stem cells into insulin-producing clusters.

Science.gov (United States)

Shaer, Anahita; Azarpira, Negar; Vahdati, Akbar; Karimi, Mohammad Hosein; Shariati, Mehrdad

2015-02-01

In diabetes mellitus type 1, beta cells are mostly destroyed; while in diabetes mellitus type 2, beta cells are reduced by 40% to 60%. We hope that soon, stem cells can be used in diabetes therapy via pancreatic beta cell replacement. Induced pluripotent stem cells are a kind of stem cell taken from an adult somatic cell by "stimulating" certain genes. These induced pluripotent stem cells may be a promising source of cell therapy. This study sought to produce isletlike clusters of insulin-producing cells taken from induced pluripotent stem cells. A human-induced pluripotent stem cell line was induced into isletlike clusters via a 4-step protocol, by adding insulin, transferrin, and selenium (ITS), N2, B27, fibroblast growth factor, and nicotinamide. During differentiation, expression of pancreatic β-cell genes was evaluated by reverse transcriptase-polymerase chain reaction; the morphologic changes of induced pluripotent stem cells toward isletlike clusters were observed by a light microscope. Dithizone staining was used to stain these isletlike clusters. Insulin produced by these clusters was evaluated by radio immunosorbent assay, and the secretion capacity was analyzed with a glucose challenge test. Differentiation was evaluated by analyzing the morphology, dithizone staining, real-time quantitative polymerase chain reaction, and immunocytochemistry. Gene expression of insulin, glucagon, PDX1, NGN3, PAX4, PAX6, NKX6.1, KIR6.2, and GLUT2 were documented by analyzing real-time quantitative polymerase chain reaction. Dithizone-stained cellular clusters were observed after 23 days. The isletlike clusters significantly produced insulin. The isletlike clusters could increase insulin secretion after a glucose challenge test. This work provides a model for studying the differentiation of human-induced pluripotent stem cells to insulin-producing cells.

Comparative in vitro inhibition of urinary tract pathogens by single- and multi-strain probiotics.

Science.gov (United States)

Chapman, C M C; Gibson, G R; Todd, S; Rowland, I

2013-09-01

Multi-species probiotic preparations have been suggested as having a wide spectrum of application, although few studies have compared their efficacy with that of individual component strains at equal concentrations. We therefore tested the ability of 4 single probiotics and 4 probiotic mixtures to inhibit the urinary tract pathogens Escherichia coli NCTC 9001 and Enterococcus faecalis NCTC 00775. We used an agar spot test to test the ability of viable cells to inhibit pathogens, while a broth inhibition assay was used to assess inhibition by cell-free probiotic supernatants in both pH-neutralised and non-neutralised forms. In the agar spot test, all probiotic treatments showed inhibition, L. acidophilus was the most inhibitory single strain against E. faecalis, L. fermentum the most inhibitory against E. coli. A commercially available mixture of 14 strains (Bio-Kult(®)) was the most effective mixture, against E. faecalis, the 3-lactobacillus mixture the most inhibitory against E. coli. Mixtures were not significantly more inhibitory than single strains. In the broth inhibition assays, all probiotic supernatants inhibited both pathogens when pH was not controlled, with only 2 treatments causing inhibition at a neutral pH. Both viable cells of probiotics and supernatants of probiotic cultures were able to inhibit growth of two urinary tract pathogens. Probiotic mixtures prevented the growth of urinary tract pathogens but were not significantly more inhibitory than single strains. Probiotics appear to produce metabolites that are inhibitory towards urinary tract pathogens. Probiotics display potential to reduce the incidence of urinary tract infections via inhibition of colonisation.

Monoclonal IgG in MGUS and multiple myeloma targets infectious pathogens

Science.gov (United States)

Bosseboeuf, Adrien; Feron, Delphine; Tallet, Anne; Rossi, Cédric; Charlier, Cathy; Garderet, Laurent; Caillot, Denis; Moreau, Philippe; Cardó-Vila, Marina; Pasqualini, Renata; Nelson, Alfreda Destea; Wilson, Bridget S.; Perreault, Hélène; Piver, Eric; Weigel, Pierre; Harb, Jean; Bigot-Corbel, Edith; Hermouet, Sylvie

2017-01-01

Subsets of mature B cell neoplasms are linked to infection with intracellular pathogens such as Epstein-Barr virus (EBV), hepatitis C virus (HCV), or Helicobacter pylori. However, the association between infection and the immunoglobulin-secreting (Ig-secreting) B proliferative disorders remains largely unresolved. We investigated whether the monoclonal IgG (mc IgG) produced by patients diagnosed with monoclonal gammopathy of undetermined significance (MGUS) or multiple myeloma (MM) targets infectious pathogens. Antigen specificity of purified mc IgG from a large patient cohort (n = 244) was determined using a multiplex infectious-antigen array (MIAA), which screens for reactivity to purified antigens or lysates from 9 pathogens. Purified mc IgG from 23.4% of patients (57 of 244) specifically recognized 1 pathogen in the MIAA. EBV was the most frequent target (15.6%), with 36 of 38 mc IgGs recognizing EBV nuclear antigen-1 (EBNA-1). MM patients with EBNA-1–specific mc IgG (14.0%) showed substantially greater bone marrow plasma cell infiltration and higher β2-microglobulin and inflammation/infection–linked cytokine levels compared with other smoldering myeloma/MM patients. Five other pathogens were the targets of mc IgG: herpes virus simplex-1 (2.9%), varicella zoster virus (1.6%), cytomegalovirus (0.8%), hepatitis C virus (1.2%), and H. pylori (1.2%). We conclude that a dysregulated immune response to infection may underlie disease onset and/or progression of MGUS and MM for subsets of patients. PMID:28978808

Generation of insulin-producing cells from gnotobiotic porcine skin-derived stem cells

International Nuclear Information System (INIS)

Yang, Ji Hoon; Lee, Sung Ho; Heo, Young Tae; Uhm, Sang Jun; Lee, Hoon Taek

2010-01-01

A major problem in the treatment of type 1 diabetes mellitus is the limited availability of alternative sources of insulin-producing cells for islet transplantation. In this study, we investigated the effect of bone morphogenetic protein 4 (BMP-4) treatments of gnotobiotic porcine skin-derived stem cells (gSDSCs) on their reprogramming and subsequent differentiation into insulin-producing cells (IPCs). We isolated SDSCs from the ear skin of a gnotobiotic pig. During the proliferation period, the cells expressed stem-cell markers Oct-4, Sox-2, and CD90; nestin expression also increased significantly. The cells could differentiate into IPCs after treatments with activin-A, glucagon-like peptide-1 (GLP-1), and nicotinamide. After 15 days in the differentiation medium, controlled gSDSCs began expressing endocrine progenitor genes and proteins (Ngn3, Neuro-D, PDX-1, NKX2.2, NKX6.1, and insulin). The IPCs showed increased insulin synthesis after glucose stimulation. The results indicate that stem cells derived from the skin of gnotobiotic pigs can differentiate into IPCs under the appropriate conditions in vitro. Our three-stage induction protocol could be applied without genetic modification to source IPCs from stem cells in the skin of patients with diabetes for autologous transplantation.

Generation of insulin-producing cells from gnotobiotic porcine skin-derived stem cells

Energy Technology Data Exchange (ETDEWEB)

Yang, Ji Hoon; Lee, Sung Ho; Heo, Young Tae [Department of Bioscience and Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 143-701 (Korea, Republic of); Uhm, Sang Jun [Department of Animal Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 143-701 (Korea, Republic of); Lee, Hoon Taek, E-mail: htl3675@konkuk.ac.kr [Department of Animal Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 143-701 (Korea, Republic of)

2010-07-09

A major problem in the treatment of type 1 diabetes mellitus is the limited availability of alternative sources of insulin-producing cells for islet transplantation. In this study, we investigated the effect of bone morphogenetic protein 4 (BMP-4) treatments of gnotobiotic porcine skin-derived stem cells (gSDSCs) on their reprogramming and subsequent differentiation into insulin-producing cells (IPCs). We isolated SDSCs from the ear skin of a gnotobiotic pig. During the proliferation period, the cells expressed stem-cell markers Oct-4, Sox-2, and CD90; nestin expression also increased significantly. The cells could differentiate into IPCs after treatments with activin-A, glucagon-like peptide-1 (GLP-1), and nicotinamide. After 15 days in the differentiation medium, controlled gSDSCs began expressing endocrine progenitor genes and proteins (Ngn3, Neuro-D, PDX-1, NKX2.2, NKX6.1, and insulin). The IPCs showed increased insulin synthesis after glucose stimulation. The results indicate that stem cells derived from the skin of gnotobiotic pigs can differentiate into IPCs under the appropriate conditions in vitro. Our three-stage induction protocol could be applied without genetic modification to source IPCs from stem cells in the skin of patients with diabetes for autologous transplantation.

Anaerobic Co-Culture of Mesenchymal Stem Cells and Anaerobic Pathogens - A New In Vitro Model System

OpenAIRE

Kriebel, Katja; Biedermann, Anne; Kreikemeyer, Bernd; Lang, Hermann

2013-01-01

BACKGROUND: Human mesenchymal stem cells (hMSCs) are multipotent by nature and are originally isolated from bone marrow. In light of a future application of hMSCs in the oral cavity, a body compartment with varying oxygen partial pressures and an omnipresence of different bacterial species i.e. periodontitis pathogens, we performed this study to gain information about the behavior of hMSC in an anaerobic system and the response in interaction with oral bacterial pathogens. METHODOLOGY/PRINCIP...

Pathogen-specific effects of quantitative trait loci affecting clinical mastitis and somatic cell count in danish holstein cattle

DEFF Research Database (Denmark)

Sørensen, Lars Peter; Guldbrandtsen, Bernt; Thomasen, J.R.

2008-01-01

The aim of this study was to investigate whether quantitative trait loci (QTL) affecting the risk of clinical mastitis (CM) and QTL affecting somatic cell score (SCS) exhibit pathogen-specific effects on the incidence of mastitis. Bacteriological data on mastitis pathogens were used to investigate...... pathogen specificity of QTL affecting treatments of mastitis in first parity (CM1), second parity (CM2), and third parity (CM3), and QTL affecting SCS. The 5 most common mastitis pathogens in the Danish dairy population were analyzed: Streptococcus dysgalactiae, Escherichia coli, coagulase...... against coagulase-negative staphylococci and Strep. uberis. Our results show that particular mastitis QTL are highly likely to exhibit pathogen-specificity. However, the results should be interpreted carefully because the results are sensitive to the sampling method and method of analysis. Field data were...

Signaling network of dendritic cells in response to pathogens: a community-input supported knowledgebase

Directory of Open Access Journals (Sweden)

Nudelman Irina

2010-10-01

Full Text Available Abstract Background Dendritic cells are antigen-presenting cells that play an essential role in linking the innate and adaptive immune systems. Much research has focused on the signaling pathways triggered upon infection of dendritic cells by various pathogens. The high level of activity in the field makes it desirable to have a pathway-based resource to access the information in the literature. Current pathway diagrams lack either comprehensiveness, or an open-access editorial interface. Hence, there is a need for a dependable, expertly curated knowledgebase that integrates this information into a map of signaling networks. Description We have built a detailed diagram of the dendritic cell signaling network, with the goal of providing researchers with a valuable resource and a facile method for community input. Network construction has relied on comprehensive review of the literature and regular updates. The diagram includes detailed depictions of pathways activated downstream of different pathogen recognition receptors such as Toll-like receptors, retinoic acid-inducible gene-I-like receptors, C-type lectin receptors and nucleotide-binding oligomerization domain-like receptors. Initially assembled using CellDesigner software, it provides an annotated graphical representation of interactions stored in Systems Biology Mark-up Language. The network, which comprises 249 nodes and 213 edges, has been web-published through the Biological Pathway Publisher software suite. Nodes are annotated with PubMed references and gene-related information, and linked to a public wiki, providing a discussion forum for updates and corrections. To gain more insight into regulatory patterns of dendritic cell signaling, we analyzed the network using graph-theory methods: bifan, feedforward and multi-input convergence motifs were enriched. This emphasis on activating control mechanisms is consonant with a network that subserves persistent and coordinated responses to

First Report of Pseudobodo sp, a New Pathogen for a Potential Energy-Producing Algae: Chlorella vulgaris Cultures

Science.gov (United States)

Zhang, Bangzhou; Yang, Luxi; Zhang, Huajun; Zhang, Jingyan; Li, Yi; Zheng, Wei; Tian, Yun; Liu, Jingwen; Zheng, Tianling

2014-01-01

Chlorella vulgaris, is a kind of single-celled green algae, which could serve as a potential source of food and energy because of its photosynthetic efficiency. In our study, a pathogenic organism targeting C. vulgaris was discovered. The algae-lytic activity relates to a fraction from lysates of infected C. vulgaris that was blocked upon filtration through a 3 µm filter. 18S rRNA gene sequence analysis revealed that it shared 99.0% homology with the protist Pseudobodo tremulans. Scanning electron microscope analysis showed that Pseudobodo sp. KD51 cells were approximately 4–5 µm long, biflagellate with an anterior collar around the anterior part of the cell in unstressed feeding cells. Besides the initial host, Pseudobodo sp. KD51 could also kill other algae, indicating its relatively wide predatory spectrum. Heat stability, pH and salinity tolerance experiments were conducted to understand their effects on its predatory activities, and the results showed that Pseudobodo sp. KD51 was heat-sensitive, and pH and salinity tolerant. PMID:24599263

First report of Pseudobodo sp, a new pathogen for a potential energy-producing algae: Chlorella vulgaris cultures.

Directory of Open Access Journals (Sweden)

Zhangran Chen

Full Text Available Chlorella vulgaris, is a kind of single-celled green algae, which could serve as a potential source of food and energy because of its photosynthetic efficiency. In our study, a pathogenic organism targeting C. vulgaris was discovered. The algae-lytic activity relates to a fraction from lysates of infected C. vulgaris that was blocked upon filtration through a 3 µm filter. 18S rRNA gene sequence analysis revealed that it shared 99.0% homology with the protist Pseudobodo tremulans. Scanning electron microscope analysis showed that Pseudobodo sp. KD51 cells were approximately 4-5 µm long, biflagellate with an anterior collar around the anterior part of the cell in unstressed feeding cells. Besides the initial host, Pseudobodo sp. KD51 could also kill other algae, indicating its relatively wide predatory spectrum. Heat stability, pH and salinity tolerance experiments were conducted to understand their effects on its predatory activities, and the results showed that Pseudobodo sp. KD51 was heat-sensitive, and pH and salinity tolerant.

Leaf-cutting ant fungi produce cell wall degrading pectinase complexes reminiscent of phytopathogenic fungi.

Science.gov (United States)

Schiøtt, Morten; Rogowska-Wrzesinska, Adelina; Roepstorff, Peter; Boomsma, Jacobus J

2010-12-31

Leaf-cutting (attine) ants use their own fecal material to manure fungus gardens, which consist of leaf material overgrown by hyphal threads of the basidiomycete fungus Leucocoprinus gongylophorus that lives in symbiosis with the ants. Previous studies have suggested that the fecal droplets contain proteins that are produced by the fungal symbiont to pass unharmed through the digestive system of the ants, so they can enhance new fungus garden growth. We tested this hypothesis by using proteomics methods to determine the gene sequences of fecal proteins in Acromyrmex echinatior leaf-cutting ants. Seven (21%) of the 33 identified proteins were pectinolytic enzymes that originated from the fungal symbiont and which were still active in the fecal droplets produced by the ants. We show that these enzymes are found in the fecal material only when the ants had access to fungus garden food, and we used quantitative polymerase chain reaction analysis to show that the expression of six of these enzyme genes was substantially upregulated in the fungal gongylidia. These unique structures serve as food for the ants and are produced only by the evolutionarily advanced garden symbionts of higher attine ants, but not by the fungi reared by the basal lineages of this ant clade. Pectinolytic enzymes produced in the gongylidia of the fungal symbiont are ingested but not digested by Acromyrmex leaf-cutting ants so that they end up in the fecal fluid and become mixed with new garden substrate. Substantial quantities of pectinolytic enzymes are typically found in pathogenic fungi that attack live plant tissue, where they are known to breach the cell walls to allow the fungal mycelium access to the cell contents. As the leaf-cutting ant symbionts are derived from fungal clades that decompose dead plant material, our results suggest that their pectinolytic enzymes represent secondarily evolved adaptations that are convergent to those normally found in phytopathogens.

Leaf-cutting ant fungi produce cell wall degrading pectinase complexes reminiscent of phytopathogenic fungi

Directory of Open Access Journals (Sweden)

Boomsma Jacobus J

2010-12-01

Full Text Available Abstract Background Leaf-cutting (attine ants use their own fecal material to manure fungus gardens, which consist of leaf material overgrown by hyphal threads of the basidiomycete fungus Leucocoprinus gongylophorus that lives in symbiosis with the ants. Previous studies have suggested that the fecal droplets contain proteins that are produced by the fungal symbiont to pass unharmed through the digestive system of the ants, so they can enhance new fungus garden growth. Results We tested this hypothesis by using proteomics methods to determine the gene sequences of fecal proteins in Acromyrmex echinatior leaf-cutting ants. Seven (21% of the 33 identified proteins were pectinolytic enzymes that originated from the fungal symbiont and which were still active in the fecal droplets produced by the ants. We show that these enzymes are found in the fecal material only when the ants had access to fungus garden food, and we used quantitative polymerase chain reaction analysis to show that the expression of six of these enzyme genes was substantially upregulated in the fungal gongylidia. These unique structures serve as food for the ants and are produced only by the evolutionarily advanced garden symbionts of higher attine ants, but not by the fungi reared by the basal lineages of this ant clade. Conclusions Pectinolytic enzymes produced in the gongylidia of the fungal symbiont are ingested but not digested by Acromyrmex leaf-cutting ants so that they end up in the fecal fluid and become mixed with new garden substrate. Substantial quantities of pectinolytic enzymes are typically found in pathogenic fungi that attack live plant tissue, where they are known to breach the cell walls to allow the fungal mycelium access to the cell contents. As the leaf-cutting ant symbionts are derived from fungal clades that decompose dead plant material, our results suggest that their pectinolytic enzymes represent secondarily evolved adaptations that are convergent to

Interaction of pathogens with host cholesterol metabolism.

Science.gov (United States)

Sviridov, Dmitri; Bukrinsky, Michael

2014-10-01

Pathogens of different taxa, from prions to protozoa, target cellular cholesterol metabolism to advance their own development and to impair host immune responses, but also causing metabolic complications, for example, atherosclerosis. This review describes recent findings of how pathogens do it. A common theme in interaction between pathogens and host cholesterol metabolism is pathogens targeting lipid rafts of the host plasma membrane. Many intracellular pathogens use rafts as an entry gate, taking advantage of the endocytic machinery and high abundance of outward-looking molecules that can be used as receptors. At the same time, disruption of the rafts' functional capacity, achieved by the pathogens through a number of various means, impairs the ability of the host to generate immune response, thus helping pathogen to thrive. Pathogens cannot synthesize cholesterol, and salvaging host cholesterol helps pathogens build advanced cholesterol-containing membranes and assembly platforms. Impact on cholesterol metabolism is not limited to the infected cells; proteins and microRNAs secreted by infected cells affect lipid metabolism systemically. Given an essential role that host cholesterol metabolism plays in pathogen development, targeting this interaction may be a viable strategy to fight infections, as well as metabolic complications of the infections.

Isolate-dependent growth, virulence, and cell wall composition in the human pathogen Aspergillus fumigatus.

Directory of Open Access Journals (Sweden)

Nansalmaa Amarsaikhan

Full Text Available The ubiquitous fungal pathogen Aspergillus fumigatus is a mediator of allergic sensitization and invasive disease in susceptible individuals. The significant genetic and phenotypic variability between and among clinical and environmental isolates are important considerations in host-pathogen studies of A. fumigatus-mediated disease. We observed decreased radial growth, rate of germination, and ability to establish colony growth in a single environmental isolate of A. fumigatus, Af5517, when compared to other clinical and environmental isolates. Af5517 also exhibited increased hyphal diameter and cell wall β-glucan and chitin content, with chitin most significantly increased. Morbidity, mortality, lung fungal burden, and tissue pathology were decreased in neutropenic Af5517-infected mice when compared to the clinical isolate Af293. Our results support previous findings that suggest a correlation between in vitro growth rates and in vivo virulence, and we propose that changes in cell wall composition may contribute to this phenotype.

Macropinocytosis is responsible for the uptake of pathogenic and non-pathogenic mycobacteria by B lymphocytes (Raji cells

Directory of Open Access Journals (Sweden)

García-Pérez Blanca Estela

2012-10-01

Full Text Available Abstract Background The classical roles of B cells include the production of antibodies and cytokines and the generation of immunological memory, these being key factors in the adaptive immune response. However, their role in innate immunity is currently being recognised. Traditionally, B cells have been considered non-phagocytic cells; therefore, the uptake of bacteria by B cells is not extensively documented. In this study, we analysed some of the features of non-specific bacterial uptake by B lymphocytes from the Raji cell line. In our model, B cells were infected with Mycobacterium tuberculosis (MTB, Mycobacterium smegmatis (MSM, and Salmonella typhimurium (ST. Results Our observations revealed that the Raji B cells were readily infected by the three bacteria that were studied. All of the infections induced changes in the cellular membrane during bacterial internalisation. M. smegmatis and S. typhimurium were able to induce important membrane changes that were characterised by abundant filopodia and lamellipodia formation. These membrane changes were driven by actin cytoskeletal rearrangements. The intracellular growth of these bacteria was also controlled by B cells. M. tuberculosis infection also induced actin rearrangement-driven membrane changes; however, the B cells were not able to control this infection. The phorbol 12-myristate 13-acetate (PMA treatment of B cells induced filopodia and lamellipodia formation, the production of spacious vacuoles (macropinosomes, and the fluid-phase uptake that is characteristic of macropinocytosis. S. typhimurium infection induced the highest fluid-phase uptake, although both mycobacteria also induced fluid uptake. A macropinocytosis inhibitor such as amiloride was used and abolished the bacterial uptake and the fluid-phase uptake that is triggered during the bacterial infection. Conclusions Raji B cells can internalise S. typhimurium and mycobacteria through an active process, such as

Characterization and isolation of an extracellular serine protease from the tomato pathogen Colletotrichum coccodes, and it's role in pathogenicity

Science.gov (United States)

Redman, Regina S.; Rodriguez, Rusty J.

2002-01-01

Extracellular enzymes play an important role in the pathogenicity and virulence of phytopathogenic fungi. Several isolates of Colletotrichum coccodes causal agent of anthracnose on tomato, were screened to determine the relationship between protease activity and virulence. A direct relationship was observed between extracellular protease activity and the induction of disease symptoms of fruit and mortality in plants. Isolate Cc155 exhibited the highest protease activity after five days of growth in protease induction medium and produced an extracellular serine protease (sp78) that was 78 kDa, auto-degradative, glucose repressible, and non-glycosylated. To determine the role of sp78 in pathogenicity, a UV-induced extracellular protease deficient mutant (np155) was generated from the wildtype isolate Cc155. Np155 maintained growth rates comparable to Cc155 and produced wildtype levels of extracellular cellulase but did not produce extracellular protease. Unlike Cc155, np155 caused no disease symptoms on tomato fruit and 0% mortality on tomato seedlings. These results suggest that extracellular protease activity is required for pathogenicity and virulence of C. coccodes and that the elimination of protease activity transforms a virulent pathogen to a non-pathogenic endophyte.

Modulation of pathogen recognition by autophagy

Directory of Open Access Journals (Sweden)

Ji Eun eOh

2012-03-01

Full Text Available Autophagy is an ancient biological process for maintaining cellular homeostasis by degradation of long-lived cytosolic proteins and organelles. Recent studies demonstrated that autophagy is availed by immune cells to regulate innate immunity. On the one hand, cells exert direct effector function by degrading intracellular pathogens; on the other hand, autophagy modulates pathogen recognition and downstream signaling for innate immune responses. Pathogen recognition via pattern recognition receptors induces autophagy. The function of phagocytic cells is enhanced by recruitment of autophagy-related proteins. Moreover, autophagy acts as a delivery system for viral replication complexes to migrate to the endosomal compartments where virus sensing occurs. In another case, key molecules of the autophagic pathway have been found to negatively regulate immune signaling, thus preventing aberrant activation of cytokine production and consequent immune responses. In this review, we focus on the recent advances in the role of autophagy in pathogen recognition and modulation of innate immune responses.

Induction of Interleukin-10 Producing Dendritic Cells As a Tool to Suppress Allergen-Specific T Helper 2 Responses

Directory of Open Access Journals (Sweden)

Stefan Schülke

2018-03-01

Full Text Available Dendritic cells (DCs are gatekeepers of the immune system that control induction and polarization of primary, antigen-specific immune responses. Depending on their maturation/activation status, the molecules expressed on their surface, and the cytokines produced DCs have been shown to either elicit immune responses through activation of effector T cells or induce tolerance through induction of either T cell anergy, regulatory T cells, or production of regulatory cytokines. Among the cytokines produced by tolerogenic DCs, interleukin 10 (IL-10 is a key regulatory cytokine limiting und ultimately terminating excessive T-cell responses to microbial pathogens to prevent chronic inflammation and tissue damage. Because of their important role in preventing autoimmune diseases, transplant rejection, allergic reactions, or in controlling chronic inflammation DCs have become an interesting tool to modulate antigen-specific immune responses. For the treatment of allergic inflammation, the aim is to downregulate allergen-specific T helper 2 (Th2 responses and the associated clinical symptoms [allergen-driven Th2 activation, Th2-driven immunoglobulin E (IgE production, IgE-mediated mast cell and basophil activation, allergic inflammation]. Here, combining the presentation of allergens by DCs with a pro-tolerogenic, IL-10-producing phenotype is of special interest to modulate allergen-specific immune responses in the treatment of allergic diseases. This review discusses the reported strategies to induce DC-derived IL-10 secretion for the suppression of allergen-specific Th2-responses with a focus on IL-10 treatment, IL-10 transduction, and the usage of both whole bacteria and bacteria-derived components. Interestingly, while IL-10-producing DCs induced either by IL-10 treatment or IL-10 transduction are arrested in an immature/semi-mature state, treatment of DCs with live or killed bacteria as well as isolated bacterial components results in the induction of

NREL Scientists Report First Solar Cell Producing More Electrons In

Science.gov (United States)

measured in operating quantum dot solar cells at low light intensity; these cells showed significant power Photocurrent Than Solar Photons Entering Cell | News | NREL NREL Scientists Report First Solar Cell Producing More Electrons In Photocurrent Than Solar Photons Entering Cell News Release: NREL

Pathogen Trojan Horse Delivers Bioactive Host Protein to Alter Maize Anther Cell Behavior in Situ.

Science.gov (United States)

van der Linde, Karina; Timofejeva, Ljudmilla; Egger, Rachel L; Ilau, Birger; Hammond, Reza; Teng, Chong; Meyers, Blake C; Doehlemann, Gunther; Walbot, Virginia

2018-03-01

Small proteins are crucial signals during development, host defense, and physiology. The highly spatiotemporal restricted functions of signaling proteins remain challenging to study in planta. The several month span required to assess transgene expression, particularly in flowers, combined with the uncertainties from transgene position effects and ubiquitous or overexpression, makes monitoring of spatiotemporally restricted signaling proteins lengthy and difficult. This situation could be rectified with a transient assay in which protein deployment is tightly controlled spatially and temporally in planta to assess protein functions, timing, and cellular targets as well as to facilitate rapid mutagenesis to define functional protein domains. In maize ( Zea mays ), secreted ZmMAC1 (MULTIPLE ARCHESPORIAL CELLS1) was proposed to trigger somatic niche formation during anther development by participating in a ligand-receptor module. Inspired by Homer's Trojan horse myth, we engineered a protein delivery system that exploits the secretory capabilities of the maize smut fungus Ustilago maydis , to allow protein delivery to individual cells in certain cell layers at precise time points. Pathogen-supplied ZmMAC1 cell-autonomously corrected both somatic cell division and differentiation defects in mutant Zm mac1-1 anthers. These results suggest that exploiting host-pathogen interactions may become a generally useful method for targeting host proteins to cell and tissue types to clarify cellular autonomy and to analyze steps in cell responses. © 2018 American Society of Plant Biologists. All rights reserved.

The Legionella pneumophila Collagen-Like Protein Mediates Sedimentation, Autoaggregation, and Pathogen-Phagocyte Interactions

Science.gov (United States)

Abdel-Nour, Mena; Duncan, Carla; Prashar, Akriti; Rao, Chitong; Ginevra, Christophe; Jarraud, Sophie; Low, Donald E.; Ensminger, Alexander W.; Terebiznik, Mauricio R.

2014-01-01

Although only partially understood, multicellular behavior is relatively common in bacterial pathogens. Bacterial aggregates can resist various host defenses and colonize their environment more efficiently than planktonic cells. For the waterborne pathogen Legionella pneumophila, little is known about the roles of autoaggregation or the parameters which allow cell-cell interactions to occur. Here, we determined the endogenous and exogenous factors sufficient to allow autoaggregation to take place in L. pneumophila. We show that isolates from Legionella species which do not produce the Legionella collagen-like protein (Lcl) are deficient in autoaggregation. Targeted deletion of the Lcl-encoding gene (lpg2644) and the addition of Lcl ligands impair the autoaggregation of L. pneumophila. In addition, Lcl-induced autoaggregation requires divalent cations. Escherichia coli producing surface-exposed Lcl is able to autoaggregate and shows increased biofilm production. We also demonstrate that L. pneumophila infection of Acanthamoeba castellanii and Hartmanella vermiformis is potentiated under conditions which promote Lcl dependent autoaggregation. Overall, this study shows that L. pneumophila is capable of autoaggregating in a process that is mediated by Lcl in a divalent-cation-dependent manner. It also reveals that Lcl potentiates the ability of L. pneumophila to come in contact, attach, and infect amoebae. PMID:24334670

Pathogen Decontamination of Food Crop Soil: A Review.

Science.gov (United States)

Gurtler, Joshua B

2017-09-01

The purpose of this review is to delineate means of decontaminating soil. This information might be used to mitigate soil-associated risks of foodborne pathogens. The majority of the research in the published literature involves inactivation of plant pathogens in soil, i.e., those pathogens harmful to fruit and vegetable production and ornamental plants. Very little has been published regarding the inactivation of foodborne human pathogens in crop soil. Nevertheless, because decontamination techniques for plant pathogens might also be useful methods for eliminating foodborne pathogens, this review also includes inactivation of plant pathogens, with appropriate discussion and comparisons, in the hopes that these methods may one day be validated against foodborne pathogens. Some of the major soil decontamination methods that have been investigated and are covered include chemical decontamination (chemigation), solarization, steaming, biofumigation, bacterial competitive exclusion, torch flaming, microwave treatment, and amendment with biochar. Other innovative means of inactivating foodborne pathogens in soils may be discovered and explored in the future, provided that these techniques are economically feasible in terms of chemicals, equipment, and labor. Food microbiology and food safety researchers should reach out to soil scientists and plant pathologists to create links where they do not currently exist and strengthen relationships where they do exist to take advantage of multidisciplinary skills. In time, agricultural output and the demand for fresh produce will increase. With advances in the sensitivity of pathogen testing and epidemiological tracebacks, the need to mitigate preharvest bacterial contamination of fresh produce will become paramount. Hence, soil decontamination technologies may become more economically feasible and practical in light of increasing the microbial safety of fresh produce.

Pathogenic agents in freshwater resources

Science.gov (United States)

Geldreich, Edwin E.

1996-02-01

Numerous pathogenic agents have been found in freshwaters used as sources for water supplies, recreational bathing and irrigation. These agents include bacterial pathogens, enteric viruses, several protozoans and parasitic worms more common to tropical waters. Although infected humans are a major source of pathogens, farm animals (cattle, sheep, pigs), animal pets (dogs, cats) and wildlife serve as significant reservoirs and should not be ignored. The range of infected individuals within a given warm-blooded animal group (humans included) may range from 1 to 25%. Survival times for pathogens in the water environment may range from a few days to as much as a year (Ascaris, Taenia eggs), with infective dose levels varying from one viable cell for several primary pathogenic agents to many thousands of cells for a given opportunistic pathogen.As pathogen detection in water is complex and not readily incorporated into routine monitoring, a surrogate is necessary. In general, indicators of faecal contamination provide a positive correlation with intestinal pathogen occurrences only when appropriate sample volumes are examined by sensitive methodology.Pathways by which pathogens reach susceptible water users include ingestion of contaminated water, body contact with polluted recreational waters and consumption of salad crops irrigated by polluted freshwaters. Major contributors to the spread of various water-borne pathogens are sewage, polluted surface waters and stormwater runoff. All of these contributions are intensified during periods of major floods. Several water-borne case histories are cited as examples of breakdowns in public health protection related to water supply, recreational waters and the consumption of contaminated salad crops. In the long term, water resource management must focus on pollution prevention from point sources of waste discharges and the spread of pathogens in watershed stormwater runoff.

[In vitro generation of insulin-producing cells from the neonatal rat bone marrow mesenchymal stem cells].

Science.gov (United States)

Li, Xiaohu; Huang, Haiyan; Liu, Xirong; Xia, Hongxia; Li, Mincai

2015-03-01

To observe the differentiation of the neonatal rat bone marrow mesenchymal stem cells (MSCs) into insulin-producing cells and detect the expressions of insulin, pancreatic duodenal homebox-1 (PDX-1) and nestin. MSCs were isolated from the neonatal rats and cultured in the modified medium composed of 10 μg/L human epidermal growth factor (EGF), 10 μg/L basic fibroblast growth factor (bFGF), 10 μg/L hepatocyte growth factor (HGF), 10 μg/L human B cell regulin, 20 mmol/L nicotinamide and 20 g/L B27. After the induction, the mRNA expressions of insulin, PDX-1 and nestin were examined by reverse transcription-PCR, and the insulin, PDX-1 and nestin protein levels were detected by immunocytochemistry. The insulin and PDX-1 mRNA expressions increased and the nestin mRNA expression decreased in the differentiation of the neonatal rat MSCs into insulin-producing cells. The nestin, PDX-1 and insulin proteins were co-expressed in insulin-producing cells. MSCs can be induced to differentiate into insulin-producing cells.

Human Liver Cells Expressing Albumin and Mesenchymal Characteristics Give Rise to Insulin-Producing Cells

Directory of Open Access Journals (Sweden)

Irit Meivar-Levy

2011-01-01

Full Text Available Activation of the pancreatic lineage in the liver has been suggested as a potential autologous cell replacement therapy for diabetic patients. Transcription factors-induced liver-to-pancreas reprogramming has been demonstrated in numerous species both in vivo and in vitro. However, human-derived liver cells capable of acquiring the alternate pancreatic repertoire have never been characterized. It is yet unknown whether hepatic-like stem cells or rather adult liver cells give rise to insulin-producing cells. Using an in vitro experimental system, we demonstrate that proliferating adherent human liver cells acquire mesenchymal-like characteristics and a considerable level of cellular plasticity. However, using a lineage-tracing approach, we demonstrate that insulin-producing cells are primarily generated in cells enriched for adult hepatic markers that coexpress both albumin and mesenchymal markers. Taken together, our data suggest that adult human hepatic tissue retains a substantial level of developmental plasticity, which could be exploited in regenerative medicine approaches.

Phylogenetic Analysis of the Synnema-Producing Genus Synnemapestaloides

Directory of Open Access Journals (Sweden)

Kyoko Watanabe

2016-11-01

Full Text Available Synnemapestaloides rhododendri, the type species of the genus Synnemapestaloides, is a pathogen of Rhododendron brachycarpum. This fungus produces six-celled conidia with appendages at both end cells, and are generated by annellidic conidiogenous cells on the synnema. These conidial structures are similar to those of the genus Pestalotia. The monotypic genus Synnemapestaloides is currently classified in the family Amphisphaeriaceae solely based on conidial morphology. Here we demonstrate that Synnemapestaloides represents a distinct genus in the family Sporocadaceae (Amphisphaeriales based on differences in the nucleotide sequences of the partial large subunit rDNA gene, the rDNA internal transcribed spacer, and the partial β-tubulin. The genus most closely related to Synnemapestaloides is Seimatosporium and the species most similar to Synnemapestaloides rhododendri is Seim. foliicola which produces short synnema-like conidiomata (sporodochia. These results demonstrate that Seim. foliicola should be transferred to Synnemapestaloides, and also demonstrate that Sporocadaceae can have synnematal in addition to pycnidial and acervular conidiomata.

Resistance to cereal rusts at the plant cell wall - what can we learn from other host-pathogen systems?

NARCIS (Netherlands)

Collins, N.C.; Niks, R.E.; Schulze-Lefert, P.

2007-01-01

The ability of plant cells to resist invasion by pathogenic fungi at the cell periphery (pre-invasion resistance) differs from other types of resistance that are generally triggered after parasite entry and during differentiation of specialised intracellular feeding structures. Genetic sources of

A modified method of insulin producing cells' generation from bone marrow-derived mesenchymal stem cells.

Science.gov (United States)

Czubak, Paweł; Bojarska-Junak, Agnieszka; Tabarkiewicz, Jacek; Putowski, Lechosław

2014-01-01

Type 1 diabetes mellitus is a result of autoimmune destruction of pancreatic insulin producing β-cells and so far it can be cured only by insulin injection, by pancreas transplantation, or by pancreatic islet cells' transplantation. The methods are, however, imperfect and have a lot of disadvantages. Therefore new solutions are needed. The best one would be the use of differentiated mesenchymal stem cells (MSCs). In the present study, we investigated the potential of the bone marrow-derived MSCs line for in vitro differentiation into insulin producing cells (IPSs). We applied an 18-day protocol to differentiate MSCs. Differentiating cells formed cell clusters some of which resembled pancreatic islet-like cells. Using dithizone we confirmed the presence of insulin in the cells. What is more, the expression of proinsulin C-peptide in differentiated IPCs was analyzed by flow cytometry. For the first time, we investigated the influence of growth factors' concentration on IPCs differentiation efficiency. We have found that an increase in the concentration of growth factors up to 60 ng/mL of β-FGF/EGF and 30 ng/mL of activin A/β-cellulin increases the percentage of IPCs. Further increase of growth factors does not show any increase of the percentage of differentiated cells. Our findings suggest that the presented protocol can be adapted for differentiation of insulin producing cells from stem cells.

Brain transcriptomes of honey bees (Apis mellifera experimentally infected by two pathogens: Black queen cell virus and Nosema ceranae

Directory of Open Access Journals (Sweden)

Vincent Doublet

2016-12-01

Full Text Available Regulation of gene expression in the brain plays an important role in behavioral plasticity and decision making in response to external stimuli. However, both can be severely affected by environmental factors, such as parasites and pathogens. In honey bees, the emergence and re-emergence of pathogens and potential for pathogen co-infection and interaction have been suggested as major components that significantly impaired social behavior and survival. To understand how the honey bee is affected and responds to interacting pathogens, we co-infected workers with two prevalent pathogens of different nature, the positive single strand RNA virus Black queen cell virus (BQCV, and the Microsporidia Nosema ceranae, and explored gene expression changes in brains upon single infections and co-infections. Our data provide an important resource for research on honey bee diseases, and more generally on insect host-pathogen and pathogen-pathogen interactions. Raw and processed data are publicly available in the NCBI/GEO database: (http://www.ncbi.nlm.nih.gov/geo/ under accession number GSE81664.

IL-1β promotes the differentiation of polyfunctional human CCR6+CXCR3+ Th1/17 cells that are specific for pathogenic and commensal microbes1

Science.gov (United States)

Duhen, Thomas; Campbell, Daniel J

2014-01-01

In humans, Th1/17 cells, identified by co-expression of the chemokine receptors CCR6 and CXCR3, have been proposed to be highly pathogenic in several autoimmune disorders due in part to their expression of the pro-inflammatory cytokines IL-17, IFN-γ and GM-CSF. However, their developmental requirements, relationship with “classic” Th17 and Th1 cells and physiological role in normal immune responses are not well understood. Here, we examined CCR6+CXCR3+ Th1/17 cells from healthy individuals, and found that ex vivo those cells produced the effector cytokines IL-17, IL-22 and IFN-γ in all possible combinations, and were highly responsive to both IL-12 and IL-23. Moreover, although the antigen specificity of CCR6+CXCR3+ Th1/17 cells showed substantial overlap with that of Th1 and Th17 cells, this population was enriched in cells recognizing certain extracellular bacteria and expressing the intestinal homing receptor integrin β7. Finally, we identified IL-1β as a key cytokine that renders Th17 cells sensitive to IL-12, and both cytokines together potently induced the differentiation of cells that produce IL-17, IFN-γ and GM-CSF. Therefore, interfering with IL-1β and IL-12 signaling in Th17 cells during inflammation may be a promising therapeutic approach to reduce their differentiation into “pathogenic” CCR6+CXCR3+ Th1/17 cells in patients with autoimmune diseases. PMID:24890729

Transgenic plants producing the bacterial pheromone N-acyl-homoserine lactone exhibit enhanced resistance to the bacterial phytopathogen Erwinia carotovora.

Science.gov (United States)

Mäe, A; Montesano, M; Koiv, V; Palva, E T

2001-09-01

Bacterial pheromones, mainly different homoserine lactones, are central to a number of bacterial signaling processes, including those involved in plant pathogenicity. We previously demonstrated that N-oxoacyl-homoserine lactone (OHL) is essential for quorum sensing in the soft-rot phytopathogen Erwinia carotovora. In this pathogen, OHL controls the coordinate activation of genes encoding the main virulence determinants, extracellular plant cell wall degrading enzymes (PCWDEs), in a cell density-dependent manner. We suggest that E. carotovora employ quorum sensing to avoid the premature production of PCWDEs and subsequent activation of plant defense responses. To test whether modulating this sensory system would affect the outcome of a plant-pathogen interaction, we generated transgenic tobacco, producing OHL. This was accomplished by ectopic expression in tobacco of the E. carotovora gene expI, which is responsible for OHL biosynthesis. We show that expI-positive transgenic tobacco lines produced the active pheromone and partially complemented the avirulent phenotype of expI mutants. The OHL-producing tobacco lines exhibited enhanced resistance to infection by wild-type E. carotovora. The results were confirmed by exogenous addition of OHL to wild-type plants, which also resulted in increased resistance to E. carotovora.

Luminal epithelial cells within the mammary gland can produce basal cells upon oncogenic stress.

Science.gov (United States)

Hein, S M; Haricharan, S; Johnston, A N; Toneff, M J; Reddy, J P; Dong, J; Bu, W; Li, Y

2016-03-17

In the normal mammary gland, the basal epithelium is known to be bipotent and can generate either basal or luminal cells, whereas the luminal epithelium has not been demonstrated to contribute to the basal compartment in an intact and normally developed mammary gland. It is not clear whether cellular heterogeneity within a breast tumor results from transformation of bipotent basal cells or from transformation and subsequent basal conversion of the more differentiated luminal cells. Here we used a retroviral vector to express an oncogene specifically in a small number of the mammary luminal epithelial cells and tested their potential to produce basal cells during tumorigenesis. This in-vivo lineage-tracing work demonstrates that luminal cells are capable of producing basal cells on activation of either polyoma middle T antigen or ErbB2 signaling. These findings reveal the plasticity of the luminal compartment during tumorigenesis and provide an explanation for cellular heterogeneity within a cancer.

Staphylococcus aureus produces membrane-derived vesicles that induce host cell death.

Directory of Open Access Journals (Sweden)

Mamata Gurung

Full Text Available Gram-negative bacteria produce outer membrane vesicles that play a role in the delivery of virulence factors to host cells. However, little is known about the membrane-derived vesicles (MVs produced by gram-positive bacteria. The present study examined the production of MVs from Staphylococcus aureus and investigated the delivery of MVs to host cells and subsequent cytotoxicity. Four S. aureus strains tested, two type strains and two clinical isolates, produced spherical nanovesicles during in vitro culture. MVs were also produced during in vivo infection of a clinical S. aureus isolate in a mouse pneumonia model. Proteomic analysis showed that 143 different proteins were identified in the S. aureus-derived MVs. S. aureus MVs were interacted with the plasma membrane of host cells via a cholesterol-rich membrane microdomain and then delivered their component protein A to host cells within 30 min. Intact S. aureus MVs induced apoptosis of HEp-2 cells in a dose-dependent manner, whereas lysed MVs neither delivered their component into the cytosol of host cells nor induced cytotoxicity. In conclusion, this study is the first report that S. aureus MVs are an important vehicle for delivery of bacterial effector molecules to host cells.

Probiotic Bifidobacterium breve induces IL-10-producing Tr1 cells in the colon.

Directory of Open Access Journals (Sweden)

Seong Gyu Jeon

Full Text Available Specific intestinal microbiota has been shown to induce Foxp3(+ regulatory T cell development. However, it remains unclear how development of another regulatory T cell subset, Tr1 cells, is regulated in the intestine. Here, we analyzed the role of two probiotic strains of intestinal bacteria, Lactobacillus casei and Bifidobacterium breve in T cell development in the intestine. B. breve, but not L. casei, induced development of IL-10-producing Tr1 cells that express cMaf, IL-21, and Ahr in the large intestine. Intestinal CD103(+ dendritic cells (DCs mediated B. breve-induced development of IL-10-producing T cells. CD103(+ DCs from Il10(-/-, Tlr2(-/-, and Myd88(-/- mice showed defective B. breve-induced Tr1 cell development. B. breve-treated CD103(+ DCs failed to induce IL-10 production from co-cultured Il27ra(-/- T cells. B. breve treatment of Tlr2(-/- mice did not increase IL-10-producing T cells in the colonic lamina propria. Thus, B. breve activates intestinal CD103(+ DCs to produce IL-10 and IL-27 via the TLR2/MyD88 pathway thereby inducing IL-10-producing Tr1 cells in the large intestine. Oral B. breve administration ameliorated colitis in immunocompromised mice given naïve CD4(+ T cells from wild-type mice, but not Il10(-/- mice. These findings demonstrate that B. breve prevents intestinal inflammation through the induction of intestinal IL-10-producing Tr1 cells.

Probiotic Bifidobacterium breve induces IL-10-producing Tr1 cells in the colon.

Science.gov (United States)

Jeon, Seong Gyu; Kayama, Hisako; Ueda, Yoshiyasu; Takahashi, Takuya; Asahara, Takashi; Tsuji, Hirokazu; Tsuji, Noriko M; Kiyono, Hiroshi; Ma, Ji Su; Kusu, Takashi; Okumura, Ryu; Hara, Hiromitsu; Yoshida, Hiroki; Yamamoto, Masahiro; Nomoto, Koji; Takeda, Kiyoshi

2012-01-01

Specific intestinal microbiota has been shown to induce Foxp3(+) regulatory T cell development. However, it remains unclear how development of another regulatory T cell subset, Tr1 cells, is regulated in the intestine. Here, we analyzed the role of two probiotic strains of intestinal bacteria, Lactobacillus casei and Bifidobacterium breve in T cell development in the intestine. B. breve, but not L. casei, induced development of IL-10-producing Tr1 cells that express cMaf, IL-21, and Ahr in the large intestine. Intestinal CD103(+) dendritic cells (DCs) mediated B. breve-induced development of IL-10-producing T cells. CD103(+) DCs from Il10(-/-), Tlr2(-/-), and Myd88(-/-) mice showed defective B. breve-induced Tr1 cell development. B. breve-treated CD103(+) DCs failed to induce IL-10 production from co-cultured Il27ra(-/-) T cells. B. breve treatment of Tlr2(-/-) mice did not increase IL-10-producing T cells in the colonic lamina propria. Thus, B. breve activates intestinal CD103(+) DCs to produce IL-10 and IL-27 via the TLR2/MyD88 pathway thereby inducing IL-10-producing Tr1 cells in the large intestine. Oral B. breve administration ameliorated colitis in immunocompromised mice given naïve CD4(+) T cells from wild-type mice, but not Il10(-/-) mice. These findings demonstrate that B. breve prevents intestinal inflammation through the induction of intestinal IL-10-producing Tr1 cells.

Vaccines based on the cell surface carbohydrates of pathogenic bacteria

Directory of Open Access Journals (Sweden)

Jones Christopher

2005-01-01

Full Text Available Glycoconjugate vaccines, in which a cell surface carbohydrate from a micro-organism is covalently attached to an appropriate carrier protein are proving to be the most effective means to generate protective immune responses to prevent a wide range of diseases. The technology appears to be generic and applicable to a wide range of pathogens, as long as antibodies against surface carbohydrates help protect against infection. Three such vaccines, against Haemophilus influenzae type b, Neisseria meningitidis Group C and seven serotypes of Streptococcus pneumoniae, have already been licensed and many others are in development. This article discusses the rationale for the development and use of glycoconjugate vaccines, the mechanisms by which they elicit T cell-dependent immune responses and the implications of this for vaccine development, the role of physicochemical methods in the characterisation and quality control of these vaccines, and the novel products which are under development.

Immune Recognition of Latency-insitigating Pathogens by Human Dendritic Cells

DEFF Research Database (Denmark)

Søndergaard, Jonas Nørskov

for society. Consequently there is a pressing need to search for new treatment strategies. Nowadays it is known that HIV-1 and Mtb have acquired the ability to escape the removal from the body by exploiting the immune system for their own benefits. Dendritic cells (DCs) determine the way the immune response......Latent infections with the human pathogenic microorganisms Mycobacterium tuberculosis (Mtb) and the human immunodeficiency virus (HIV) are creating some of the most devastating pandemics to date, with great impact on the infected people’s lives, their expected lifetime, as well as general costs...... unfolds by signaling other immune cells how to respond. An early deregulation of the DCs may therefore propagate into detrimental effects in later stages of the immune response, and may permit HIV-1 and Mtb to become latent. Hence, understanding the way HIV-1 and Mtb interacts with DCs could lead to novel...

Rice terpene synthase 24 (OsTPS24) encodes a jasmonate-responsive monoterpene synthase that produces an antibacterial γ-terpinene against rice pathogen.

Science.gov (United States)

Yoshitomi, Kayo; Taniguchi, Shiduku; Tanaka, Keiichiro; Uji, Yuya; Akimitsu, Kazuya; Gomi, Kenji

2016-02-01

Rice is one of the most important crops worldwide and is widely used as a model plant for molecular studies of monocotyledonous species. The plant hormone jasmonic acid (JA) is involved in rice-pathogen interactions. In addition, volatile compounds, including terpenes, whose production is induced by JA, are known to be involved in the rice defense system. In this study, we analyzed the JA-induced terpene synthase OsTPS24 in rice. We found that OsTPS24 was localized in chloroplasts and produced a monoterpene, γ-terpinene. The amount of γ-terpinene increased after JA treatment. γ-Terpinene had significant antibacterial activity against Xanthomonas oryzae pv. oryzae (Xoo); however, it did not show significant antifungal activity against Magnaporthe oryzae. The antibacterial activity of the γ-terpinene against Xoo was caused by damage to bacterial cell membranes. These results suggest that γ-terpinene plays an important role in JA-induced resistance against Xoo, and that it functions as an antibacterial compound in rice. Copyright © 2015 Elsevier GmbH. All rights reserved.

Th17 Polarization under Hypoxia Results in Increased IL-10 Production in a Pathogen-Independent Manner

Directory of Open Access Journals (Sweden)

Roman Volchenkov

2017-06-01

Full Text Available The IL-17-producing CD4+ T helper cell (Th17 differentiation is affected by stimulation of the aryl hydrocarbon receptor (AhR pathway and by hypoxia-inducible factor 1 alpha (HIF-1α. In some cases, Th17 become non-pathogenic and produce IL-10. However, the initiating events triggering this phenotype are yet to be fully understood. Here, we show that such cells may be differentiated at low oxygen and regardless of AhR ligand treatment such as cigarette smoke extract. Hypoxia led to marked alterations of the transcriptome of IL-10-producing Th17 cells affecting genes involved in metabolic, anti-apoptotic, cell cycle, and T cell functional pathways. Moreover, we show that oxygen regulates the expression of CD52, which is a cell surface protein that has been shown to suppress the activation of other T cells upon release. Taken together, these findings suggest a novel ability for Th17 cells to regulate immune responses in vivo in an oxygen-dependent fashion.

Origin of Matrix-Producing Cells That Contribute to Aortic Fibrosis in Hypertension.

Science.gov (United States)

Wu, Jing; Montaniel, Kim Ramil C; Saleh, Mohamed A; Xiao, Liang; Chen, Wei; Owens, Gary K; Humphrey, Jay D; Majesky, Mark W; Paik, David T; Hatzopoulos, Antonis K; Madhur, Meena S; Harrison, David G

2016-02-01

Various hypertensive stimuli lead to exuberant adventitial collagen deposition in large arteries, exacerbating blood pressure elevation and end-organ damage. Collagen production is generally attributed to resident fibroblasts; however, other cells, including resident and bone marrow-derived stem cell antigen positive (Sca-1(+)) cells and endothelial and vascular smooth muscle cells, can produce collagen and contribute to vascular stiffening. Using flow cytometry and immunofluorescence, we found that adventitial Sca-1(+) progenitor cells begin to produce collagen and acquire a fibroblast-like phenotype in hypertension. We also found that bone marrow-derived cells represent more than half of the matrix-producing cells in hypertension, and that one-third of these are Sca-1(+). Cell sorting and lineage-tracing studies showed that cells of endothelial origin contribute to no more than one fourth of adventitial collagen I(+) cells, whereas those of vascular smooth muscle lineage do not contribute. Our findings indicate that Sca-1(+) progenitor cells and bone marrow-derived infiltrating fibrocytes are major sources of arterial fibrosis in hypertension. Endothelial to mesenchymal transition likely also contributes, albeit to a lesser extent and pre-existing resident fibroblasts represent a minority of aortic collagen-producing cells in hypertension. This study shows that vascular stiffening represents a complex process involving recruitment and transformation of multiple cells types that ultimately elaborate adventitial extracellular matrix. © 2015 American Heart Association, Inc.

Modulation of pathogen-induced CCL20 secretion from HT-29 human intestinal epithelial cells by commensal bacteria.

LENUS (Irish Health Repository)

Sibartie, Shomik

2009-01-01

BACKGROUND: Human intestinal epithelial cells (IECs) secrete the chemokine CCL20 in response to infection by various enteropathogenic bacteria or exposure to bacterial flagellin. CCL20 recruits immature dendritic cells and lymphocytes to target sites. Here we investigated IEC responses to various pathogenic and commensal bacteria as well as the modulatory effects of commensal bacteria on pathogen-induced CCL20 secretion. HT-29 human IECs were incubated with commensal bacteria (Bifidobacterium infantis or Lactobacillus salivarius), or with Salmonella typhimurium, its flagellin, Clostridium difficile, Mycobacterium paratuberculosis, or Mycobacterium smegmatis for varying times. In some studies, HT-29 cells were pre-treated with a commensal strain for 2 hr prior to infection or flagellin stimulation. CCL20 and interleukin (IL)-8 secretion and nuclear factor (NF)-kappaB activation were measured using enzyme-linked immunosorbent assays. RESULTS: Compared to untreated cells, S. typhimurium, C. difficile, M. paratuberculosis, and flagellin activated NF-kappaB and stimulated significant secretion of CCL20 and IL-8 by HT-29 cells. Conversely, B. infantis, L. salivarius or M. smegmatis did not activate NF-kappaB or augment CCL20 or IL-8 production. Treatment with B. infantis, but not L. salivarius, dose-dependently inhibited the baseline secretion of CCL20. In cells pre-treated with B. infantis, C. difficile-, S. typhimurium-, and flagellin-induced CCL20 were significantly attenuated. B. infantis did not limit M. Paratuberculosis-induced CCL20 secretion. CONCLUSION: This study is the first to demonstrate that a commensal strain can attenuate CCL20 secretion in HT-29 IECs. Collectively, the data indicate that M. paratuberculosis may mediate mucosal damage and that B. infantis can exert immunomodulatory effects on IECs that mediate host responses to flagellin and flagellated enteric pathogens.

Human pluripotent stem cell-derived erythropoietin-producing cells ameliorate renal anemia in mice.

Science.gov (United States)

Hitomi, Hirofumi; Kasahara, Tomoko; Katagiri, Naoko; Hoshina, Azusa; Mae, Shin-Ichi; Kotaka, Maki; Toyohara, Takafumi; Rahman, Asadur; Nakano, Daisuke; Niwa, Akira; Saito, Megumu K; Nakahata, Tatsutoshi; Nishiyama, Akira; Osafune, Kenji

2017-09-27

The production of erythropoietin (EPO) by the kidneys, a principal hormone for the hematopoietic system, is reduced in patients with chronic kidney disease (CKD), eventually resulting in severe anemia. Although recombinant human EPO treatment improves anemia in patients with CKD, returning to full red blood cell production without fluctuations does not always occur. We established a method to generate EPO-producing cells from human induced pluripotent stem cells (hiPSCs) by modifying previously reported hepatic differentiation protocols. These cells showed increased EPO expression and secretion in response to low oxygen conditions, prolyl hydroxylase domain-containing enzyme inhibitors, and insulin-like growth factor 1. The EPO protein secreted from hiPSC-derived EPO-producing (hiPSC-EPO) cells induced the erythropoietic differentiation of human umbilical cord blood progenitor cells in vitro. Furthermore, transplantation of hiPSC-EPO cells into mice with CKD induced by adenine treatment improved renal anemia. Thus, hiPSC-EPO cells may be a useful tool for clarifying the mechanisms of EPO production and may be useful as a therapeutic strategy for treating renal anemia. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

Combined effect of enterocin and lipase from Enterococcus faecium NCIM5363 against food borne pathogens: mode of action studies.

Science.gov (United States)

Ramakrishnan, Vrinda; Narayan, Bhaskar; Halami, Prakash M

2012-08-01

Food borne diseases have a major impact on public health whose epidemiology is rapidly changing. The whole cells of pathogens involved or their toxins/metabolites affect the human health apart from spoiling sensory properties of the food products finally affecting the food industry as well as consumer health. With pathogens developing mechanisms of antibiotic resistance, there has been an increased need to replace antibiotics as well as chemical additives with naturally occurring bacteriocins. Bacteriocins are known to act mainly against Gram-positive pathogens and with little or no effect towards Gram-negative enteric bacteria. In the present study, combination effect of lipase and bacteriocin produced by Enterococcus faecium NCIM5363, a highly lipolytic lactic acid bacterium against various food pathogens was assessed. The lipase in combination with enterocin exhibited a lethal effect against Gram-negative pathogens. Scanning electron microscopy studies carried out to ascertain the constitutive mode of action of lipase and enterocin revealed that the lipase degrades the cell wall of Gram-negative bacteria and creates a pore through which enterocin enters thereby resulting in cell death. The novelty of this work is the fact that this is the first report revealing the synergistic effect of lipase with enterocin against Gram-negative bacteria.

Pathogen-induced ERF68 regulates hypersensitive cell death in tomato.

Science.gov (United States)

Liu, An-Chi; Cheng, Chiu-Ping

2017-10-01

Ethylene response factors (ERFs) are a large plant-specific transcription factor family and play diverse important roles in various plant functions. However, most tomato ERFs have not been characterized. In this study, we showed that the expression of an uncharacterized member of the tomato ERF-IX subgroup, ERF68, was significantly induced by treatments with different bacterial pathogens, ethylene (ET) and salicylic acid (SA), but only slightly induced by bacterial mutants defective in the type III secretion system (T3SS) or non-host pathogens. The ERF68-green fluorescent protein (ERF68-GFP) fusion protein was localized in the nucleus. Transactivation and electrophoretic mobility shift assays (EMSAs) further showed that ERF68 was a functional transcriptional activator and was bound to the GCC-box. Moreover, transient overexpression of ERF68 led to spontaneous lesions in tomato and tobacco leaves and enhanced the expression of genes involved in ET, SA, jasmonic acid (JA) and hypersensitive response (HR) pathways, whereas silencing of ERF68 increased tomato susceptibility to two incompatible Xanthomonas spp. These results reveal the involvement of ERF68 in the effector-triggered immunity (ETI) pathway. To identify ERF68 target genes, chromatin immunoprecipitation combined with high-throughput sequencing (ChIP-seq) was performed. Amongst the confirmed target genes, a few genes involved in cell death or disease defence were differentially regulated by ERF68. Our study demonstrates the function of ERF68 in the positive regulation of hypersensitive cell death and disease defence by modulation of multiple signalling pathways, and provides important new information on the complex regulatory function of ERFs. © 2016 BSPP AND JOHN WILEY & SONS LTD.

The level of PPD-specific IFN-gamma-producing CD4+ T cells in the blood predicts the in vivo response to PPD.

Science.gov (United States)

Martins, Marcia Valéria B S; Lima, Mônica Cristina B S; Duppre, Nadia C; Matos, Haroldo J; Spencer, John S; Brennan, Patrick J; Sarno, Euzenir N; Fonseca, Leila; Pereira, Geraldo M B; Pessolani, Maria Cristina V

2007-05-01

There are no reliable means for detecting subclinical mycobacterial infections. The recent sequencing of several mycobacterial genomes has now afforded new opportunities for the development of pathogen-specific diagnostic tests, critical in the context of leprosy and tuberculosis control. In the present study, we applied a multi-parametric flow cytometric analysis that allowed the investigation of T-cell functions in order to define immunological markers that measure previous exposure to mycobacteria. We compared the in vivo response to PPD, the gold standard skin test reagent for measuring previous exposure to Mycobacterium tuberculosis, with in vitro parameters of leukocyte activation in five PPD positive and five PPD negative healthy volunteers. PPD-stimulated peripheral leukocytes expressing CD4, CD69, cutaneous lymphocyte-associated antigen (CLA) and intracellular IFN-gamma were enumerated in whole blood and compared with the size of in vivo PPD-induced induration and IFN-gamma production levels as measured by ELISA in supernatants of PPD-stimulated peripheral blood mononuclear cells. The reactivity to the tuberculin skin test (TST) was associated with markedly increased frequencies of PPD-responsive activated (CD69+) and IFN-gamma-producing CD4+T cells. Detection of PPD-specific IFN-gamma producing leukocytes was restricted to CD4+T cells and a subset of these cells was shown to express the skin homing molecule CLA. Multiple linear regression modeling of responses to PPD showed the highest association between skin test indurations and frequencies of PPD-responsive IFN-gamma-producing CD4+CD69+ T cells. Our data show that the in vitro enumeration of antigen-specific IFN-gamma-producing CD4+ T cells can provide an alternative to the in vivo tuberculin test for the detection of latent Mycobacterium tuberculosis infection. Moreover, the measurement of these immunological parameters can be useful for the screening of new specific antigens defined by the genome

Commensal-induced regulatory T cells mediate protection against pathogen-stimulated NF-kappaB activation.

Directory of Open Access Journals (Sweden)

Caitlin O'Mahony

Full Text Available Host defence against infection requires a range of innate and adaptive immune responses that may lead to tissue damage. Such immune-mediated pathologies can be controlled with appropriate T regulatory (Treg activity. The aim of the present study was to determine the influence of gut microbiota composition on Treg cellular activity and NF-kappaB activation associated with infection. Mice consumed the commensal microbe Bifidobacterium infantis 35624 followed by infection with Salmonella typhimurium or injection with LPS. In vivo NF-kappaB activation was quantified using biophotonic imaging. CD4+CD25+Foxp3+ T cell phenotypes and cytokine levels were assessed using flow cytometry while CD4+ T cells were isolated using magnetic beads for adoptive transfer to naïve animals. In vivo imaging revealed profound inhibition of infection and LPS induced NF-kappaB activity that preceded a reduction in S. typhimurium numbers and murine sickness behaviour scores in B. infantis-fed mice. In addition, pro-inflammatory cytokine secretion, T cell proliferation, and dendritic cell co-stimulatory molecule expression were significantly reduced. In contrast, CD4+CD25+Foxp3+ T cell numbers were significantly increased in the mucosa and spleen of mice fed B. infantis. Adoptive transfer of CD4+CD25+ T cells transferred the NF-kappaB inhibitory activity. Consumption of a single commensal micro-organism drives the generation and function of Treg cells which control excessive NF-kappaB activation in vivo. These cellular interactions provide the basis for a more complete understanding of the commensal-host-pathogen trilogue that contribute to host homeostatic mechanisms underpinning protection against aberrant activation of the innate immune system in response to a translocating pathogen or systemic LPS.

The plant cell nucleus: a true arena for the fight between plants and pathogens.

Science.gov (United States)

Deslandes, Laurent; Rivas, Susana

2011-01-01

Communication between the cytoplasm and the nucleus is a fundamental feature shared by both plant and animal cells. Cellular factors involved in the transport of macromolecules through the nuclear envelope, including nucleoporins, importins and Ran-GTP related components, are conserved among a variety of eukaryotic systems. Interestingly, mutations in these nuclear components compromise resistance signalling, illustrating the importance of nucleocytoplasmic trafficking in plant innate immunity. Indeed, spatial restriction of defence regulators by the nuclear envelope and stimulus-induced nuclear translocation constitute an important level of defence-associated gene regulation in plants. A significant number of effectors from different microbial pathogens are targeted to the plant cell nucleus. In addition, key host factors, including resistance proteins, immunity components, transcription factors and transcriptional regulators shuttle between the cytoplasm and the nucleus, and their level of nuclear accumulation determines the output of the defence response, further confirming the crucial role played by the nucleus during the interaction between plants and pathogens. Here, we discuss recent findings that situate the nucleus at the frontline of the mutual recognition between plants and invading microbes.

CCR6+ Th cells in the cerebrospinal fluid of persons with multiple sclerosis are dominated by pathogenic non-classic Th1 cells and GM-CSF-only-secreting Th cells.

Science.gov (United States)

Restorick, S M; Durant, L; Kalra, S; Hassan-Smith, G; Rathbone, E; Douglas, M R; Curnow, S J

2017-08-01

Considerable attention has been given to CCR6 + IL-17-secreting CD4 + T cells (Th17) in the pathology of a number of autoimmune diseases including multiple sclerosis (MS). However, other Th subsets also play important pathogenic roles, including those that secrete IFNγ and GM-CSF. CCR6 expression by Th17 cells allows their migration across the choroid plexus into the cerebrospinal fluid (CSF), where they are involved in the early phase of experimental autoimmune encephalomyelitis (EAE), and in MS these cells are elevated in the CSF during relapses and contain high frequencies of autoreactive cells. However, the relatively low frequency of Th17 cells suggests they cannot by themselves account for the high percentage of CCR6 + cells in MS CSF. Here we identify the dominant CCR6 + T cell subsets in both the blood and CSF as non-classic Th1 cells, including many that secrete GM-CSF, a key encephalitogenic cytokine. In addition, we show that Th cells secreting GM-CSF but not IFNγ or IL-17, a subset termed GM-CSF-only-secreting Th cells, also accumulate in the CSF. Importantly, in MS the proportion of IFNγ- and GM-CSF-secreting T cells expressing CCR6 was significantly enriched in the CSF, and was elevated in MS, suggesting these cells play a pathogenic role in this disease. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Bioactivity of glycolipopeptide cell-bound biosurfactants against skin pathogens.

Science.gov (United States)

Vecino, X; Rodríguez-López, L; Ferreira, D; Cruz, J M; Moldes, A B; Rodrigues, L R

2018-04-01

The antimicrobial and anti-adhesive activities of the cell-bound biosurfactants, produced by Lactobacillus pentosus (PEB), characterized as glycolipopeptide macromolecules, were evaluated against several microorganisms present in the skin microflora, envisaging its potential use as a "natural" ingredient in cosmetic and personal care formulations. Their performance was compared with another cell-bound biosurfactants also characterized as glycolipopeptides produced by Lactobacillus paracasei (PAB). At concentrations of 50mg/mL, the PEB showed an important antimicrobial activity against Pseudomonas aeruginosa (85% when extracted with phosphate buffer (PB) and 100% when extracted with phosphate buffer saline (PBS)), Streptococcus agalactiae (100% for both extracts), Staphylococcus aureus (67% when extracted with PBS and 100% when extracted with PB), Escherichia coli (72% when extracted with PB and 89% when extracted with PBS), Streptococcus pyogenes (about 85% for both extracts) and Candida albicans (around 70% for both extracts), comparable with that obtained for the PAB. However, at lower concentrations the PAB exhibited in general higher antimicrobial activities. Biosurfactants produced by both microorganisms also showed significant anti-adhesive properties against all the microorganisms under study, except for E. coli and C. albicans (less than 30%). Overall, these cell-bound biosurfactants could be used as potential antimicrobial and anti-adhesive agents in cosmetic and pharmaceutical formulations. Copyright © 2017 Elsevier B.V. All rights reserved.

Culture of human cell lines by a pathogen-inactivated human platelet lysate.

Science.gov (United States)

Fazzina, R; Iudicone, P; Mariotti, A; Fioravanti, D; Procoli, A; Cicchetti, E; Scambia, G; Bonanno, G; Pierelli, L

2016-08-01

Alternatives to the use of fetal bovine serum (FBS) have been investigated to ensure xeno-free growth condition. In this study we evaluated the efficacy of human platelet lysate (PL) as a substitute of FBS for the in vitro culture of some human cell lines. PL was obtained by pools of pathogen inactivated human donor platelet (PLT) concentrates. Human leukemia cell lines (KG-1, K562, JURKAT, HL-60) and epithelial tumor cell lines (HeLa and MCF-7) were cultured with either FBS or PL. Changes in cell proliferation, viability, morphology, surface markers and cell cycle were evaluated for each cell line. Functional characteristics were analysed by drug sensitivity test and cytotoxicity assay. Our results demonstrated that PL can support growth and expansion of all cell lines, although the cells cultured in presence of PL experienced a less massive proliferation compared to those grown with FBS. We found a comparable percentage of viable specific marker-expressing cells in both conditions, confirming lineage fidelity in all cultures. Functionality assays showed that cells in both FBS- and PL-supported cultures maintained their normal responsiveness to adriamycin and NK cell-mediated lysis. Our findings indicate that PL is a feasible serum substitute for supporting growth and propagation of haematopoietic and epithelial cell lines with many advantages from a perspective of process standardization, ethicality and product safety.

C5a regulates IL-12+ DC migration to induce pathogenic Th1 and Th17 cells in sepsis.

Directory of Open Access Journals (Sweden)

Ning Ma

Full Text Available OBJECTIVE: It is well known that complement system C5a is excessively activated during the onset of sepsis. However, it is unclear whether C5a can regulate dentritic cells (DCs to stimulate adaptive immune cells such as Th1 and Th17 in sepsis. METHODS: Sepsis was induced by cecal ligation and puncture (CLP. CLP-induced sepsis was treated with anti-C5a or IL-12. IL-12(+DC, IFNγ(+Th1, and IL-17(+Th17 cells were analyzed by flow cytometry. IL-12 was measured by ELISA. RESULTS: Our studies here showed that C5a induced IL-12(+DC cell migration from the peritoneal cavity to peripheral blood and lymph nodes. Furthermore, IL-12(+DC cells induced the expansion of pathogenic IFNγ(+Th1 and IL-17(+Th17 cells in peripheral blood and lymph nodes. Moreover, IL-12, secreted by DC cells in the peritoneal cavity, is an important factor that prevents the development of sepsis. CONCLUSION: Our data suggests that C5a regulates IL-12(+DC cell migration to induce pathogenic Th1 and Th17 cells in sepsis.

InvA protein is a Nudix hydrolase required for infection by pathogenic Leptospira in cell lines and animals.

Science.gov (United States)

Luo, Yihui; Liu, Yan; Sun, Dexter; Ojcius, David M; Zhao, Jinfang; Lin, Xuai; Wu, Dong; Zhang, Rongguang; Chen, Ming; Li, Lanjuan; Yan, Jie

2011-10-21

Leptospirosis caused by pathogenic species of the genus Leptospira is a re-emerging zoonotic disease, which affects a wide variety of host species and is transmitted by contaminated water. The genomes of several pathogenic Leptospira species contain a gene named invA, which contains a Nudix domain. However, the function of this gene has never been characterized. Here, we demonstrated that the invA gene was highly conserved in protein sequence and present in all tested pathogenic Leptospira species. The recombinant InvA protein of pathogenic L. interrogans strain Lai hydrolyzed several specific dinucleoside oligophosphate substrates, reflecting the enzymatic activity of Nudix in Leptospira species. Pathogenic leptospires did not express this protein in media but temporarily expressed it at early stages (within 60 min) of infection of macrophages and nephric epithelial cells. Comparing with the wild type, the invA-deficient mutant displayed much lower infectivity and a significantly reduced survival rate in macrophages and nephric epithelial cells. Moreover, the invA-deficient leptospires presented an attenuated virulence in hamsters, caused mild histopathological damage, and were transmitted in lower numbers in the urine, compared with the wild-type strain. The invA revertant, made by complementing the invA-deficient mutant with the invA gene, reacquired virulence similar to the wild type in vitro and in vivo. The LD(50) in hamsters was 1000-fold higher for the invA-deficient mutant than for the invA revertant and wild type. These results demonstrate that the InvA protein is a Nudix hydrolase, and the invA gene is essential for virulence in pathogenic Leptospira species.

Polarized Th2 like cells, in the absence of Th0 cells, are responsible for lymphocyte produced IL-4 in high IgE-producer schistosomiasis patients

Directory of Open Access Journals (Sweden)

Soares-Silveira Alda

2002-07-01

Full Text Available Abstract Background Human resistance to re-infection with S. mansoni is correlated with high levels of anti-soluble adult worm antigens (SWAP IgE. Although it has been shown that IL-4 and IL-5 are crucial in establishing IgE responses in vitro, the active in vivo production of these cytokines by T cells, and the degree of polarization of Th2 vs. Th0 in human schistosomiasis is not known. To address this question, we determined the frequency of IL-4 and IFN-γ or IL-5 and IL-2 producing lymphocytes from schistosomiasis patients with high or low levels of IgE anti-SWAP. Results Our analysis showed that high and low IgE-producers responded equally to schistosomiasis antigens as determined by proliferation. Moreover, patients from both groups displayed similar percentages of circulating lymphocytes. However, high IgE-producers had an increased percentage of activated CD4+ T cells as compared to the low IgE-producers. Moreover, intracellular cytokine analysis, after short-term stimulation with anti-CD3/CD28 mAbs, showed that IgE high-producers display an increase in the percentage of T lymphocytes expressing IL-4 and IL-5 as compared to IgE low-responders. A coordinate control of the frequency of IL-4 and IL-5 producing lymphocytes in IgE high, but not IgE low-responders, was observed. Conclusions High IgE phenotype human schistosomiasis patients exhibit a coordinate regulation of IL-4 and IL-5 producing cells and the lymphocyte derived IL-4 comes from true polarized Th2 like cells, in the absence of measurable Th0 cells as measured by co-production of IL-4 and IFN-γ.

Effects of Chinese Propolis in Protecting Bovine Mammary Epithelial Cells against Mastitis Pathogens-Induced Cell Damage.

Science.gov (United States)

Wang, Kai; Jin, Xiao-Lu; Shen, Xiao-Ge; Sun, Li-Ping; Wu, Li-Ming; Wei, Jiang-Qin; Marcucci, Maria Cristina; Hu, Fu-Liang; Liu, Jian-Xin

2016-01-01

Chinese propolis (CP), an important hive product, can alleviate inflammatory responses. However, little is known regarding the potential of propolis treatment for mastitis control. To investigate the anti-inflammatory effects of CP on bovine mammary epithelial cells (MAC-T), we used a range of pathogens to induce cellular inflammatory damage. Cell viability was determined and expressions of inflammatory/antioxidant genes were measured. Using a cell-based reporter assay system, we evaluated CP and its primary constituents on the NF-κB and Nrf2-ARE transcription activation. MAC-T cells treated with bacterial endotoxin (lipopolysaccharide, LPS), heat-inactivated Escherichia coli, and Staphylococcus aureus exhibited significant decreases in cell viability while TNF-α and lipoteichoic acid (LTA) did not. Pretreatment with CP prevented losses in cell viability associated with the addition of killed bacteria or bacterial endotoxins. There were also corresponding decreases in expressions of proinflammatory IL-6 and TNF-α mRNA. Compared with the mastitis challenged cells, enhanced expressions of antioxidant genes HO-1, Txnrd-1, and GCLM were observed in CP-treated cells. CP and its polyphenolic active components (primarily caffeic acid phenethyl ester and quercetin) had strong inhibitive effects against NF-κB activation and increased the transcriptional activity of Nrf2-ARE. These findings suggest that propolis may be valuable in the control of bovine mastitis.

Effects of Chinese Propolis in Protecting Bovine Mammary Epithelial Cells against Mastitis Pathogens-Induced Cell Damage

Directory of Open Access Journals (Sweden)

Kai Wang

2016-01-01

Full Text Available Chinese propolis (CP, an important hive product, can alleviate inflammatory responses. However, little is known regarding the potential of propolis treatment for mastitis control. To investigate the anti-inflammatory effects of CP on bovine mammary epithelial cells (MAC-T, we used a range of pathogens to induce cellular inflammatory damage. Cell viability was determined and expressions of inflammatory/antioxidant genes were measured. Using a cell-based reporter assay system, we evaluated CP and its primary constituents on the NF-κB and Nrf2-ARE transcription activation. MAC-T cells treated with bacterial endotoxin (lipopolysaccharide, LPS, heat-inactivated Escherichia coli, and Staphylococcus aureus exhibited significant decreases in cell viability while TNF-α and lipoteichoic acid (LTA did not. Pretreatment with CP prevented losses in cell viability associated with the addition of killed bacteria or bacterial endotoxins. There were also corresponding decreases in expressions of proinflammatory IL-6 and TNF-α mRNA. Compared with the mastitis challenged cells, enhanced expressions of antioxidant genes HO-1, Txnrd-1, and GCLM were observed in CP-treated cells. CP and its polyphenolic active components (primarily caffeic acid phenethyl ester and quercetin had strong inhibitive effects against NF-κB activation and increased the transcriptional activity of Nrf2-ARE. These findings suggest that propolis may be valuable in the control of bovine mastitis.

AIDS Kaposi sarcoma-derived cells produce and respond to interleukin 6

International Nuclear Information System (INIS)

Miles, S.A.; Rezai, A.R.; Salazar-Gonzalez, J.F.; Meyden, M.V.; Stevens, R.H.; Mitsuyasu, R.T.; Martinez-Maza, O.; Logan, D.M.; Taga, Tetsuya; Hirano, Toshio; Kishimoto, Tadamitsu

1990-01-01

Cell lines derived from Kaposi sarcoma lesions of patients with AIDS (AIDS-KS cells) produce several cytokines, including an endothelial cell growth factor, interleukin 1β, and basic fibroblast growth factor. Since exposure to human immunodeficiency virus increases interleukin 6 (IL-6) production in monocytes and endothelial cells produce IL-6, the authors examined IL-6 expression and response in AIDS-KS cell lines and IL-6 expression in AIDS Kaposi sarcoma tissue. The AIDS-KS cell lines (N521J and EKS3) secreted large amounts of immunoreactive and biologically active IL-6. The authors found both IL-6 and IL-6 receptor (IL-6-R) RNA by slot blot hybridization analysis of AIDS-KS cells. The IL-6-R was functional, as [ 3 H]thymidine incorporation by AIDS-KS cells increased significantly after exposure to human recombinant IL-6 (hrIL-6) at >10 units/ml. When AIDS-KS cells (EKS3) were exposed to IL-6 antisense oligonucleotide, cellular proliferation decreased by nearly two-thirds, with a corresponding decrease in the production of IL-6. These results show that both IL-6 and IL-6-R are produced by AIDS-KS cells and that IL-6 is required for optimal AIDS-KS cell proliferation, and they suggest that IL-6 is an autocrine growth factor for AIDS-KS cells

Intraportal injection of insulin-producing cells generated from human bone marrow mesenchymal stem cells decreases blood glucose level in diabetic rats.

Science.gov (United States)

Tsai, Pei-Jiun; Wang, Hwai-Shi; Lin, Chi-Hung; Weng, Zen-Chung; Chen, Tien-Hua; Shyu, Jia-Fwu

2014-01-01

We studied the process of trans-differentiation of human bone marrow mesenchymal stem cells (hBM-MSCs) into insulin-producing cells. Streptozotocin (STZ)-induced diabetic rat model was used to study the effect of portal vein transplantation of these insulin-producing cells on blood sugar levels. The BM-MSCs were differentiated into insulin-producing cells under defined conditions. Real-time PCR, immunocytochemistry and glucose challenge were used to evaluate in vitro differentiation. Flow cytometry showed that hBM-MSCs were strongly positive for CD44, CD105 and CD73 and negative for hematopoietic markers CD34, CD38 and CD45. Differentiated cells expressed C-peptide as well as β-cells specific genes and hormones. Glucose stimulation increased C-peptide secretion in these cells. The insulin-producing, differentiated cells were transplanted into the portal vein of STZ-induced diabetic rats using a Port-A catheter. The insulin-producing cells were localized in the liver of the recipient rat and expressed human C-peptide. Blood glucose levels were reduced in diabetic rats transplanted with insulin-producing cells. We concluded that hBM-MSCs could be trans-differentiated into insulin-producing cells in vitro. Portal vein transplantation of insulin-producing cells alleviated hyperglycemia in diabetic rats.

Swiss Army Pathogen: The Salmonella Entry Toolkit

Directory of Open Access Journals (Sweden)

Peter J. Hume

2017-08-01

Full Text Available Salmonella causes disease in humans and animals ranging from mild self-limiting gastroenteritis to potentially life-threatening typhoid fever. Salmonellosis remains a considerable cause of morbidity and mortality globally, and hence imposes a huge socio-economic burden worldwide. A key property of all pathogenic Salmonella strains is the ability to invade non-phagocytic host cells. The major determinant of this invasiveness is a Type 3 Secretion System (T3SS, a molecular syringe that injects virulence effector proteins directly into target host cells. These effectors cooperatively manipulate multiple host cell signaling pathways to drive pathogen internalization. Salmonella does not only rely on these injected effectors, but also uses several other T3SS-independent mechanisms to gain entry into host cells. This review summarizes our current understanding of the methods used by Salmonella for cell invasion, with a focus on the host signaling networks that must be coordinately exploited for the pathogen to achieve its goal.

The Shewanella algae strain YM8 produces volatiles with strong inhibition activity against Aspergillus pathogens and aflatoxins

Directory of Open Access Journals (Sweden)

Andong eGong

2015-10-01

Full Text Available Aflatoxigenic Aspergillus fungi and associated aflatoxins are ubiquitous in the production and storage of food/feed commodities. Controlling these pests is a challenge. In this study, the Shewanella algae strain YM8 was found to produce volatiles that have strong antifungal activity against Aspergillus pathogens. Gas chromatography-mass spectrometry profiling revealed 15 volatile organic compounds (VOCs emitted from YM8, of which dimethyl trisulfide was the most abundant. We obtained authentic reference standards for six of the VOCs; these all significantly reduced mycelial growth and conidial germination in Aspergillus; dimethyl trisulfide and 2,4-bis(1,1-dimethylethyl-phenol showed the strongest inhibitory activity. YM8 completely inhibited Aspergillus growth and aflatoxin biosynthesis in maize and peanut samples stored at different water activity levels, and scanning electron microscopy revealed severely damaged conidia and a complete lack of mycelium development and conidiogenesis. YM8 also completely inhibited the growth of eight other agronomically important species of phytopathogenic fungi: A. parasiticus, A. niger, Alternaria alternate, Botrytis cinerea, Fusarium graminearum, Fusarium oxysporum, Monilinia fructicola, and Sclerotinia sclerotiorum. This study demonstrates the susceptibility of Aspergillus and other fungi to VOCs from marine bacteria and indicates a new strategy for effectively controlling these pathogens and the associated mycotoxin production in the field and during storage.

Detection of mastitis pathogens by analysis of volatile bacterial metabolites.

Science.gov (United States)

Hettinga, K A; van Valenberg, H J F; Lam, T J G M; van Hooijdonk, A C M

2008-10-01

The ability to detect mastitis pathogens based on their volatile metabolites was studied. Milk samples from cows with clinical mastitis, caused by Staphylococcus aureus, coagulase-negative staphylococci, Streptococcus uberis, Streptococcus dysgalactiae, and Escherichia coli were collected. In addition, samples from cows without clinical mastitis and with low somatic cell count (SCC) were collected for comparison. All mastitis samples were examined by using classical microbiological methods, followed by headspace analysis for volatile metabolites. Milk from culture-negative samples contained a lower number and amount of volatile components compared with cows with clinical mastitis. Because of variability between samples within a group, comparisons between pathogens were not sufficient for classification of the samples by univariate statistics. Therefore, an artificial neural network was trained to classify the pathogen in the milk samples based on the bacterial metabolites. The trained network differentiated milk from uninfected and infected quarters very well. When comparing pathogens, Staph. aureus produced a very different pattern of volatile metabolites compared with the other samples. Samples with coagulase-negative staphylococci and E. coli had enough dissimilarity with the other pathogens, making it possible to separate these 2 pathogens from each other and from the other samples. The 2 streptococcus species did not show significant differences between each other but could be identified as a different group from the other pathogens. Five groups can thus be identified based on the volatile bacterial metabolites: Staph. aureus, coagulase-negative staphylococci, streptococci (Strep. uberis and Strep. dysgalactiae as one group), E. coli, and uninfected quarters.

Multiplex identification of sepsis-causing Gram-negative pathogens from the plasma of infected blood.

Science.gov (United States)

Chung, Boram; Park, Chulmin; Cho, Sung-Yeon; Shin, Juyoun; Shin, Sun; Yim, Seon-Hee; Lee, Dong-Gun; Chung, Yeun-Jung

2018-02-01

Early and accurate detection of bacterial pathogens in the blood is the most crucial step for sepsis management. Gram-negative bacteria are the most common organisms causing severe sepsis and responsible for high morbidity and mortality. We aimed to develop a method for rapid multiplex identification of clinically important Gram-negative pathogens and also validated whether our system can identify Gram-negative pathogens with the cell-free plasm DNA from infected blood. We designed five MLPA probe sets targeting the genes specific to major Gram-negative pathogens (uidA and lacY for E. coli, ompA for A. baumannii, phoE for K. pneumoniae, and ecfX for P. aeruginosa) and one set targeting the CTX-M group 1 to identify the ESBL producing Gram-negative pathogens. All six target-specific peaks were clearly separated without any non-specific peaks in a multiplex reaction condition. The minimum detection limit was 100 fg of pathogen DNA. When we tested 28 Gram-negative clinical isolates, all of them were successfully identified without any non-specific peaks. To evaluate the clinical applicability, we tested seven blood samples from febrile patients. Three blood culture positive cases showed E. coli specific peaks, while no peak was detected in the other four culture negative samples. This technology can be useful for detection of major sepsis-causing, drug-resistant Gram-negative pathogens and also the major ESBL producing Gram-negatives from the blood of sepsis patients in a clinical setting. This system can help early initiation of effective antimicrobial treatment against Gram-negative pathogens for sepsis patients, which is very crucial for better treatment outcomes. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Antimicrobial Activity of Bacteriophage Endolysin Produced in Nicotiana benthamiana Plants.

Science.gov (United States)

Kovalskaya, Natalia; Foster-Frey, Juli; Donovan, David M; Bauchan, Gary; Hammond, Rosemarie W

2016-01-01

The increasing spread of antibiotic-resistant pathogens has raised the interest in alternative antimicrobial treatments. In our study, the functionally active gram-negative bacterium bacteriophage CP933 endolysin was produced in Nicotiana benthamiana plants by a combination of transient expression and vacuole targeting strategies, and its antimicrobial activity was investigated. Expression of the cp933 gene in E. coli led to growth inhibition and lysis of the host cells or production of trace amounts of CP933. Cytoplasmic expression of the cp933 gene in plants using Potato virus X-based transient expression vectors (pP2C2S and pGR107) resulted in death of the apical portion of experimental plants. To protect plants against the toxic effects of the CP933 protein, the cp933 coding region was fused at its Nterminus to an N-terminal signal peptide from the potato proteinase inhibitor I to direct CP933 to the delta-type vacuoles. Plants producing the CP933 fusion protein did not exhibit the severe toxic effects seen with the unfused protein and the level of expression was 0.16 mg/g of plant tissue. Antimicrobial assays revealed that, in contrast to gram-negative bacterium E. coli (BL21(DE3)), the gram-positive plant pathogenic bacterium Clavibacter michiganensis was more susceptible to the plant-produced CP933, showing 18% growth inhibition. The results of our experiments demonstrate that the combination of transient expression and protein targeting to the delta vacuoles is a promising approach to produce functionally active proteins that exhibit toxicity when expressed in plant cells.

Extrinsic Factors Involved in the Differentiation of Stem Cells into Insulin-Producing Cells: An Overview

Directory of Open Access Journals (Sweden)

Rebecca S. Y. Wong

2011-01-01

Full Text Available Diabetes mellitus is a chronic disease with many debilitating complications. Treatment of diabetes mellitus mainly revolves around conventional oral hypoglycaemic agents and insulin replacement therapy. Recently, scientists have turned their attention to the generation of insulin-producing cells (IPCs from stem cells of various sources. To date, many types of stem cells of human and animal origins have been successfully turned into IPCs in vitro and have been shown to exert glucose-lowering effect in vivo. However, scientists are still faced with the challenge of producing a sufficient number of IPCs that can in turn produce sufficient insulin for clinical use. A careful choice of stem cells, methods, and extrinsic factors for induction may all be contributing factors to successful production of functional beta-islet like IPCs. It is also important that the mechanism of differentiation and mechanism by which IPCs correct hyperglycaemia are carefully studied before they are used in human subjects.

Purification and characterization of two new cell-bound bioactive compounds produced by wild Lactococcus lactis strain.

Science.gov (United States)

Saraiva, Margarete Alice Fontes; Brede, Dag Anders; Nes, Ingolf Figved; Baracat-Pereira, Maria Cristina; de Queiroz, Marisa Vieira; de Moraes, Célia Alencar

2017-07-03

Novel compounds and innovative methods are required considering that antibiotic resistance has reached a crisis point. In the study, two cell-bound antimicrobial compounds produced by Lactococcus lactis ID1.5 were isolated and partially characterized. Following purification by cationic exchange and a solid-phase C18 column, antimicrobial activity was recovered after three runs of RPC using 60% (v/v) and 100% (v/v) of 2-propanol for elution, suggesting that more than one antimicrobial compound were produced by L. lactis ID1.5, which were in this study called compounds AI and AII. The mass spectrum of AI and AII showed major intensity ions at m/z 1070.05 and 955.9 Da, respectively. The compound AI showed a spectrum of antimicrobial activity mainly against L. lactis species, while the organisms most sensitive to compound AII were Bacillus subtilis, Listeria innocua, Streptococcus pneumoniae and Pseudomonas aeruginosa. The antimicrobial activity of both compounds was suppressed by treatment with Tween 80. Nevertheless, both compounds showed high stability to heat and proteases treatments. The isolated compounds, AI and AII, showed distinct properties from other antimicrobial substances already reported as produced by L. lactis, and have a significant inhibitory effect against two clinically important respiratory pathogens. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Search for microRNAs expressed by intracellular bacterial pathogens in infected mammalian cells.

Science.gov (United States)

Furuse, Yuki; Finethy, Ryan; Saka, Hector A; Xet-Mull, Ana M; Sisk, Dana M; Smith, Kristen L Jurcic; Lee, Sunhee; Coers, Jörn; Valdivia, Raphael H; Tobin, David M; Cullen, Bryan R

2014-01-01

MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼ 23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin.

Search for microRNAs expressed by intracellular bacterial pathogens in infected mammalian cells.

Directory of Open Access Journals (Sweden)

Yuki Furuse

Full Text Available MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼ 23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin.

Comparative pathology of chickens experimentally inoculated with avian influenza viruses of low and high pathogenicity.

Science.gov (United States)

Mo, I P; Brugh, M; Fletcher, O J; Rowland, G N; Swayne, D E

1997-01-01

Pathologic changes and distribution of viral antigen as determined by immunohistochemistry were compared among 4-wk-old specific-pathogen-free chickens inoculated intratracheally with avian influenza virus (AIV) isolates of either low or high pathogenicity. Viruses of low pathogenicity, previously characterized as mildly pathogenic (MP), included A/chicken/Pennsylvania/21525/83 (H5N2) (MP-Penn) and A/chicken/Alabama/7395/75 (H4N8) (MP-Alab). Viruses of high pathogenicity included A/chicken/Pennsylvania/1370/83 (H5N2), A/chicken/Victoria/A185/85 (H7N7), and A/turkey/Ontario/7732/66 (H5N9). Extremely variable clinical signs ranging from mild respiratory distress to high mortality were present among chickens inoculated with these viruses. Chickens inoculated with highly pathogenic (HP) virus had histologic lesions of necrosis and inflammation in cloacal bursa, thymus, spleen, heart, pancreas, kidney, brain, trachea, lung, and skeletal muscle, whereas chickens inoculated with MP virus had histologic lesions most frequently in lung and trachea or lacked histologic lesions. Immunospecific staining for avian influenza viral proteins was most common in cells within heart, lung, kidney, brain, and pancreas of chicken inoculated with HP viruses, but immunospecific staining was present only and infrequently in trachea and lung of chickens inoculated with MP-Penn AIV. MP-Alab did not produce lesions nor have viral antigen in inoculated chickens but did produce serologic evidence of infection. The pattern of organ involvement and viral antigen distribution in chickens intratracheally inoculated with HP AIV isolates indicates a common capability to spread beyond the respiratory tract and confirms the pantrophic replicative, pathobiologic, and lethal nature of the viruses. However, variability in severity and lesion distribution exists between different HP AIVs. By contrast, MP viruses had the ability to replicate in respiratory or enteric tracts or both and produce lesions

Cytolethal distending toxin: a conserved bacterial genotoxin that blocks cell cycle progression, leading to apoptosis of a broad range of mammalian cell lineages.

Science.gov (United States)

Jinadasa, Rasika N; Bloom, Stephen E; Weiss, Robert S; Duhamel, Gerald E

2011-07-01

Cytolethal distending toxin (CDT) is a heterotrimeric AB-type genotoxin produced by several clinically important Gram-negative mucocutaneous bacterial pathogens. Irrespective of the bacterial species of origin, CDT causes characteristic and irreversible cell cycle arrest and apoptosis in a broad range of cultured mammalian cell lineages. The active subunit CdtB has structural homology with the phosphodiesterase family of enzymes including mammalian DNase I, and alone is necessary and sufficient to account for cellular toxicity. Indeed, mammalian cells treated with CDT initiate a DNA damage response similar to that elicited by ionizing radiation-induced DNA double strand breaks resulting in cell cycle arrest and apoptosis. The mechanism of CDT-induced apoptosis remains incompletely understood, but appears to involve both p53-dependent and -independent pathways. While epithelial, endothelial and fibroblast cell lines respond to CDT by undergoing arrest of cell cycle progression resulting in nuclear and cytoplasmic distension that precedes apoptotic cell death, cells of haematopoietic origin display rapid apoptosis following a brief period of cell cycle arrest. In this review, the ecology of pathogens producing CDT, the molecular biology of bacterial CDT and the molecular mechanisms of CDT-induced cytotoxicity are critically appraised. Understanding the contribution of a broadly conserved bacterial genotoxin that blocks progression of the mammalian cell cycle, ultimately causing cell death, should assist with elucidating disease mechanisms for these important pathogens.

Development of a high-titer retrovirus producer cell line capable of gene transfer into rhesus monkey hematopoietic stem cells

International Nuclear Information System (INIS)

Bodine, D.M.; McDonagh, K.T.; Brandt, S.J.; Ney, P.A.; Agricola, B.; Byrne, E.; Nienhuis, A.W.

1990-01-01

Retroviral-mediated gene transfer into primitive hematopoietic cells has been difficult to achieve in large-animal models. The authors have developed an amphotropic producer clone that generates >10 10 recombinant retroviral particles (colony-forming units) per ml of culture medium. Autologous rhesus monkey bone marrow cells were cocultured with either high or low titer producer clones for 4-6 days and reinfused into sublethally irradiated animals. The proviral genome was detected in blood and bone-marrow cells from all three animals reconstituted with cells cocultured with the high-titer producer cells. In contrast, three animals reconstituted with bone marrow cocultured with the low-titer producer clone exhibited no evidence of gene transfer

Differentiation of insulin-producing cells from human neural progenitor cells.

Directory of Open Access Journals (Sweden)

Yuichi Hori

2005-04-01

Full Text Available BACKGROUND: Success in islet-transplantation-based therapies for type 1 diabetes, coupled with a worldwide shortage of transplant-ready islets, has motivated efforts to develop renewable sources of islet-replacement tissue. Islets and neurons share features, including common developmental programs, and in some species brain neurons are the principal source of systemic insulin. METHODS AND FINDINGS: Here we show that brain-derived human neural progenitor cells, exposed to a series of signals that regulate in vivo pancreatic islet development, form clusters of glucose-responsive insulin-producing cells (IPCs. During in vitro differentiation of neural progenitor cells with this novel method, genes encoding essential known in vivo regulators of pancreatic islet development were expressed. Following transplantation into immunocompromised mice, IPCs released insulin C-peptide upon glucose challenge, remained differentiated, and did not form detectable tumors. CONCLUSION: Production of IPCs solely through extracellular factor modulation in the absence of genetic manipulations may promote strategies to derive transplantable islet-replacement tissues from human neural progenitor cells and other types of multipotent human stem cells.

Pathogenicity and cell wall-degrading enzyme activities of some ...

African Journals Online (AJOL)

Dr. J. T. Ekanem

2005-12-17

Dec 17, 2005 ... be attributed to the activities of these cell wall degrading enzymes. Keywords: Cowpea ... bacteria have long been known to produce enzymes capable of ... Inoculated seeds were sown in small plastic pots filled with steam- ...

CD11b⁺, Ly6G⁺ cells produce type I interferon and exhibit tissue protective properties following peripheral virus infection.

Directory of Open Access Journals (Sweden)

Matthew A Fischer

2011-11-01

Full Text Available The goal of the innate immune system is containment of a pathogen at the site of infection prior to the initiation of an effective adaptive immune response. However, effector mechanisms must be kept in check to combat the pathogen while simultaneously limiting undesirable destruction of tissue resulting from these actions. Here we demonstrate that innate immune effector cells contain a peripheral poxvirus infection, preventing systemic spread of the virus. These innate immune effector cells are comprised primarily of CD11b⁺Ly6C⁺Ly6G⁻ monocytes that accumulate initially at the site of infection, and are then supplemented and eventually replaced by CD11b⁺Ly6C⁺Ly6G⁺ cells. The phenotype of the CD11b⁺Ly6C⁺Ly6G⁺ cells resembles neutrophils, but the infiltration of neutrophils typically occurs prior to, rather than following, accumulation of monocytes. Indeed, it appears that the CD11b⁺Ly6C⁺Ly6G⁺ cells that infiltrated the site of VACV infection in the ear are phenotypically distinct from the classical description of both neutrophils and monocyte/macrophages. We found that CD11b⁺Ly6C⁺Ly6G⁺ cells produce Type I interferons and large quantities of reactive oxygen species. We also observed that depletion of Ly6G⁺ cells results in a dramatic increase in tissue damage at the site of infection. Tissue damage is also increased in the absence of reactive oxygen species, although reactive oxygen species are typically thought to be damaging to tissue rather than protective. These data indicate the existence of a specialized population of CD11b⁺Ly6C⁺Ly6G⁺ cells that infiltrates a site of virus infection late and protects the infected tissue from immune-mediated damage via production of reactive oxygen species. Regulation of the action of this population of cells may provide an intervention to prevent innate immune-mediated tissue destruction.

Scanning electron microscopy as a tool for the analysis of colony architecture produced by phenotypic switching of a human pathogenic yeast Candida tropicalis

International Nuclear Information System (INIS)

Furlaneto, M C; França, E J G; Moralez, A T P; Ferreira, L C S; Andrade, C G T J; Aragão, P H A

2012-01-01

Candida tropicalis has been identified as one of the most prevalent pathogenic yeast species of the Candida-non-albicans group. Phenotypic switching is a biological phenomenon related to the occurrence of spontaneous emergence of colonies with different morphologies that provides variability within colonizing populations in order to adapt to different environments. Currently, studies of the microstructure of switching variant colonies are not subject of extensive research. SEM analysis was used to verify the architecture of whole Candida colonies. The strain 49/07 exhibited a hemispherical shape character, while the strain 335/07 showed a volcano shape with mycelated-edge colony. The ring switch variant is characterized by a highly wrinkled centre and an irregular periphery. The rough phenotype exhibited a three-dimensional architecture and was characterized by the presence of deep central and peripheral depressions areas. The ultrastructural analysis also allowed the observation of the arrangement of individual cells within the colonies. The whole smooth colony consisted entirely of yeast cells. Differently, aerial filaments were found all around the colony periphery of the volcano shape colony. For this colony type the mycelated-edge consisted mainly of hyphae, although yeast cells are also seen. The ring and rough colonies phenotypes comprised mainly yeast cells with the presence of extracellular material connecting neighbouring cells. This study has shown that SEM can be used effectively to examine the microarchitecture of colonies morphotypes of the yeast C. tropicalis and further our understanding of switching event in this pathogen.

COXIELLA BURNETII PATHOGENICITY MOLECULAR BASIS

Directory of Open Access Journals (Sweden)

Yu. A. Panferova

2016-01-01

Full Text Available Coxiella burnetii is an obligate intracellular gram-negative bacterial pathogen, an ethiological agent of Q-fever, a zoonotic disease, elapsing as an acute (mostly atypical pneumonia or a chronic (mostly endocarditis form. The host range is represented by wide range of mammal, avian and arthropod species, but the main source of human infection are farm animals. The main route of infection is aerosolic. In case of contact with organism pathogen binds with phagocytal monocytic-macrophagal cell line. C. burnetii promotes maturation of specific phagolysosome-like compartment in host cell, called coxiella-containing vacuole, within this vacuole pathogen becames metabolically activated and actively replicates. Coxiella persists as metabolically inactive spore-like form in environment. Internalisation of C. burnetii occurs using actin-mediated phagocytosis and zipper mechanism. After internalization of bacteria maturation of phagolysosome-like compartment and large coxiella-containing vacuole formation occure, and vacuole can occupy nearly the whole cytoplasm of the host cell. Survivance of infected cells is important for chronic infection with C. burnetii. C. burnetii elongate the viability of host cell by two ways: it actively inhibits apoptotic signal cascades and induce pro-survival factors. Exceptthat C. burnetii involves autophagic pathway during coxiella-containing vacuole formation, and induction of autophagy promotes pathogen replication. During infection C. burnetii translocates effector substrates from bacterial cytosole to euca ryotic host cell cytosole using type IV secretion system, where effectors modulate host cell proteins. Overall approximately 130 secreted effectors of type IV transport system, but function of most of them remains unknown to date. Specific sec reted proteins for variety of strains and isolates were identified, confirmed that certain pathotypes of C. burnetii can exist. Identification and

Imbalance between IL-17A-Producing Cells and Regulatory T Cells during Ischemic Stroke

Directory of Open Access Journals (Sweden)

Yuehua Hu

2014-01-01

Full Text Available Immune responses and inflammation are key elements in the pathogenesis of ischemic stroke (IS. Although the involvement of IL-17A in IS has been demonstrated using animal models, the involvement of IL-17A and IL-17-secreting T cell subsets in IS patients has not been verified, and whether the balance of Treg/IL-17-secreting T cells is altered in IS patients remains unknown. In the present study, we demonstrated that the proportion of peripheral Tregs and the levels of IL-10 and TGF-β were reduced in patients with IS compared with controls using flow cytometry (FCM, real-time PCR, and ELISA assays. However, the proportions of Th17 and γδ T cells, the primary IL-17A-secreting cells, increased dramatically, and these effects were accompanied by increases in the levels of IL-17A, IL-23, IL-6, and IL-1β in IS patients. These studies suggest that the increase in IL-17A-producing cells and decrease in Treg cells might contribute to the pathogenesis of IS. Manipulating the balance between Tregs and IL-17A-producing cells might be helpful for the treatment of IS.

Arginase activity in pathogenic and non-pathogenic species of Leishmania parasites.

Science.gov (United States)

Badirzadeh, Alireza; Taheri, Tahereh; Taslimi, Yasaman; Abdossamadi, Zahra; Heidari-Kharaji, Maryam; Gholami, Elham; Sedaghat, Baharehsadat; Niyyati, Maryam; Rafati, Sima

2017-07-01

Proliferation of Leishmania (L.) parasites depends on polyamine availability, which can be generated by the L-arginine catabolism and the enzymatic activity of arginase (ARG) of the parasites and of the mammalian hosts. In the present study, we characterized and compared the arginase (arg) genes from pathogenic L. major and L. tropica and from non-pathogenic L. tarentolae. We quantified the level of the ARG activity in promastigotes and macrophages infected with pathogenic L. major and L. tropica and non-pathogenic L. tarentolae amastigotes. The ARG's amino acid sequences of the pathogenic and non-pathogenic Leishmania demonstrated virtually 98.6% and 88% identities with the reference L. major Friedlin ARG. Higher ARG activity was observed in all pathogenic promastigotes as compared to non-pathogenic L. tarentolae. In vitro infection of human macrophage cell line (THP1) with pathogenic and non-pathogenic Leishmania spp. resulted in increased ARG activities in the infected macrophages. The ARG activities present in vivo were assessed in susceptible BALB/c and resistant C57BL/6 mice infected with L. major, L. tropica and L. tarentolae. We demonstrated that during the development of the infection, ARG is induced in both strains of mice infected with pathogenic Leishmania. However, in L. major infected BALB/c mice, the induction of ARG and parasite load increased simultaneously according to the time course of infection, whereas in C57BL/6 mice, the enzyme is upregulated solely during the period of footpad swelling. In L. tropica infected mice, the footpads' swellings were slow to develop and demonstrated minimal cutaneous pathology and ARG activity. In contrast, ARG activity was undetectable in mice inoculated with the non-pathogenic L. tarentolae. Our data suggest that infection by Leishmania parasites can increase ARG activity of the host and provides essential polyamines for parasite salvage and its replication. Moreover, the ARG of Leishmania is vital for parasite

Innate B cells: oxymoron or validated concept? [v1; ref status: indexed, http://f1000r.es/T4CAVP

Directory of Open Access Journals (Sweden)

Carl F Ware

2012-08-01

Full Text Available B lymphocytes promote the initial innate interferon response to viral pathogens without the need for antigen receptor activation. B cell dependent IFN production requires the cytokine, lymphotoxin-β. The LTβ pathway is well known to regulate lymphoid organogenesis and homeostasis by differentiating stromal cells and macrophages. However, in response to viral pathogens these same B cell-regulated populations rapidly produce type 1 interferons. Thus, B cells act as innate effector cells via LTβ homeostatic pathways, which serve as innate host barriers to viral pathogens.

Mucosal-Associated Invariant T Cell Interactions with Commensal and Pathogenic Bacteria: Potential Role in Antimicrobial Immunity in the Child

Directory of Open Access Journals (Sweden)

Liana Ghazarian

2017-12-01

Full Text Available Mucosal-associated invariant T (MAIT cells are unconventional CD3+CD161high T lymphocytes that recognize vitamin B2 (riboflavin biosynthesis precursor derivatives presented by the MHC-I related protein, MR1. In humans, their T cell receptor is composed of a Vα7.2-Jα33/20/12 chain, combined with a restricted set of Vβ chains. MAIT cells are very abundant in the liver (up to 40% of resident T cells and in mucosal tissues, such as the lung and gut. In adult peripheral blood, they represent up to 10% of circulating T cells, whereas they are very few in cord blood. This large number of MAIT cells in the adult likely results from their gradual expansion with age following repeated encounters with riboflavin-producing microbes. Upon recognition of MR1 ligands, MAIT cells have the capacity to rapidly eliminate bacterially infected cells through the production of inflammatory cytokines (IFNγ, TNFα, and IL-17 and cytotoxic effector molecules (perforin and granzyme B. Thus, MAIT cells may play a crucial role in antimicrobial defense, in particular at mucosal sites. In addition, MAIT cells have been implicated in diseases of non-microbial etiology, including autoimmunity and other inflammatory diseases. Although their participation in various clinical settings has received increased attention in adults, data in children are scarce. Due to their innate-like characteristics, MAIT cells might be particularly important to control microbial infections in the young age, when long-term protective adaptive immunity is not fully developed. Herein, we review the data showing how MAIT cells may control microbial infections and how they discriminate pathogens from commensals, with a focus on models relevant for childhood infections.

Adaptive response to starvation in the fish pathogen Flavobacterium columnare: cell viability and ultrastructural changes

Directory of Open Access Journals (Sweden)

Arias Covadonga R

2012-11-01

Full Text Available Abstract Background The ecology of columnaris disease, caused by Flavobacterium columnare, is poorly understood despite the economic losses that this disease inflicts on aquaculture farms worldwide. Currently, the natural reservoir for this pathogen is unknown but limited data have shown its ability to survive in water for extended periods of time. The objective of this study was to describe the ultrastructural changes that F. columnare cells undergo under starvation conditions. Four genetically distinct strains of this pathogen were monitored for 14 days in media without nutrients. Culturability and cell viability was assessed throughout the study. In addition, cell morphology and ultrastructure was analyzed using light microscopy, scanning electron microscopy, and transmission electron microscopy. Revival of starved cells under different nutrient conditions and the virulence potential of the starved cells were also investigated. Results Starvation induced unique and consistent morphological changes in all strains studied. Cells maintained their length and did not transition into a shortened, coccus shape as observed in many other Gram negative bacteria. Flavobacterium columnare cells modified their shape by morphing into coiled forms that comprised more than 80% of all the cells after 2 weeks of starvation. Coiled cells remained culturable as determined by using a dilution to extinction strategy. Statistically significant differences in cell viability were found between strains although all were able to survive in absence of nutrients for at least 14 days. In later stages of starvation, an extracellular matrix was observed covering the coiled cells. A difference in growth curves between fresh and starved cultures was evident when cultures were 3-months old but not when cultures were starved for only 1 month. Revival of starved cultures under different nutrients revealed that cells return back to their original elongated rod shape upon

Ontogeny and localization of the cells produce IL-2 in healthy animals.

Science.gov (United States)

Yamamoto, Mutsumi; Seki, Yoichi; Iwai, Kazuyuki; Ko, Iei; Martin, Alicia; Tsuji, Noriko; Miyagawa, Shuji; Love, Robert B; Iwashima, Makio

2013-03-01

IL-2 is a growth factor for activated T cells and is required for maintenance of naturally arising regulatory T cells (nTregs). Mice defective in IL-2/IL-2 receptor signaling pathways have impaired nTregs and suffer from lymphoproliferative disorders, suggesting that IL-2 is present and functional in healthy animals. However, the cellular source of IL-2 is currently unknown. To determine which cells produce IL-2 in healthy animals, we established mice carrying cre gene knock in at the il-2 locus (termed IL-2(cre)). When IL-2(cre) mice were crossed with EGFP reporter mice, EGFP was exclusively expressed by a fraction of CD4 T cells present in both lymphoid and non-lymphoid tissues. Live imaging of IL-2(cre) mice that carry the luciferase reporter showed concentrated localization of luciferase(+) cells in Peyer's patches. These cells were not observed in new born mice but appeared within 3days after birth. Reduction of antigen receptor repertoire by transgene expression reduced their number, indicating that recognition of environmental antigens is necessary for generation of these IL-2 producers in healthy animals. A substantial fraction of EGFP(+) cells also produce IL-10 and IFN-γ, a characteristic profile of type 1 regulatory T cells (Tr1). The data suggest that a group of Tr1 cells have addition roles in immune homeostasis by producing IL-2 along with other cytokines and help maintaining Tregs. Copyright © 2012 Elsevier Ltd. All rights reserved.

Suppression of immune-mediated liver injury after vaccination with attenuated pathogenic cells.

Science.gov (United States)

Mei, Yunhua; Wang, Ying; Xu, Lingyun

2007-05-15

Cell vaccination via immunization with attenuated pathogenic cells is an effective preventive method that has been successfully applied in several animal models of inflammatory or autoimmune diseases. Concanavalin A (Con A)-induced hepatitis (CIH) is a commonly used experimental model to study immune-mediated liver injury. Multiple cell types including T lymphocytes, macrophages and neutrophils have been found to be involved in the pathogenesis of CIH. In this study, we used attenuated spleen lymphocytes or peripheral blood lymphocytes as vaccines to investigate whether they could induce protective immune responses to prevent mice from developing CIH. We found that mice receiving such vaccination before CIH induction developed much milder diseases, exhibited a lower level of alanine aminotransferase (ALT) released into their plasma and had less inflammatory lesions in their livers. Such CIH-suppression is dose- and frequency-dependent. The suppressive effect was associated with inhibition of several major inflammatory mediators, pro-inflammatory cytokines and chemokines.

Children with asthma by school age display aberrant immune responses to pathogenic airway bacteria as infants.

Science.gov (United States)

Larsen, Jeppe Madura; Brix, Susanne; Thysen, Anna Hammerich; Birch, Sune; Rasmussen, Morten Arendt; Bisgaard, Hans

2014-04-01

Asthma is a highly prevalent chronic lung disease that commonly originates in early childhood. Colonization of neonatal airways with the pathogenic bacterial strains Haemophilus influenzae, Moraxella catarrhalis, and Streptococcus pneumoniae is associated with increased risk of later childhood asthma. We hypothesized that children with asthma have an abnormal immune response to pathogenic bacteria in infancy. We aimed to assess the bacterial immune response in asymptomatic infants and the association with later development of asthma by age 7 years. The Copenhagen Prospective Studies on Asthma in Childhood birth cohort was followed prospectively, and asthma was diagnosed at age 7 years. The immune response to H influenzae, M catarrhalis, and S pneumoniae was analyzed in 292 infants using PBMCs isolated and stored since the age of 6 months. The immune response was assessed based on the pattern of cytokines produced and T-cell activation. The immune response to pathogenic bacteria was different in infants with asthma by 7 years of age (P = .0007). In particular, prospective asthmatic subjects had aberrant production of IL-5 (P = .008), IL-13 (P = .057), IL-17 (P = .001), and IL-10 (P = .028), whereas there were no differences in T-cell activation or peripheral T-cell composition. Children with asthma by school age exhibited an aberrant immune response to pathogenic bacteria in infancy. We propose that an abnormal immune response to pathogenic bacteria colonizing the airways in early life might lead to chronic airway inflammation and childhood asthma. Copyright © 2014 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

Mast Cells Produce a Unique Chondroitin Sulfate Epitope.

Science.gov (United States)

Farrugia, Brooke L; Whitelock, John M; O'Grady, Robert; Caterson, Bruce; Lord, Megan S

2016-02-01

The granules of mast cells contain a myriad of mediators that are stored and protected by the sulfated glycosaminoglycan (GAG) chains that decorate proteoglycans. Whereas heparin is the GAG predominantly associated with mast cells, mast cell proteoglycans are also decorated with heparan sulfate and chondroitin sulfate (CS). This study investigated a unique CS structure produced by mast cells that was detected with the antibody clone 2B6 in the absence of chondroitinase ABC digestion. Mast cells in rodent tissue sections were characterized using toluidine blue, Leder stain and the presence of mast cell tryptase. The novel CS epitope was identified in rodent tissue sections and localized to cells that were morphologically similar to cells chemically identified as mast cells. The rodent mast cell-like line RBL-2H3 was also shown to express the novel CS epitope. This epitope co-localized with multiple CS proteoglycans in both rodent tissue and RBL-2H3 cultured cells. These findings suggest that the novel CS epitope that decorates mast cell proteoglycans may play a role in the way these chains are structured in mast cells. © 2016 The Histochemical Society.

AMP-activated Protein Kinase As a Target For Pathogens: Friends Or Foes?

Science.gov (United States)

Moreira, Diana; Silvestre, Ricardo; Cordeiro-da-Silva, Anabela; Estaquier, Jérôme; Foretz, Marc; Viollet, Benoit

2016-01-01

Intracellular pathogens are known to manipulate host cell regulatory pathways to establish an optimal environment for their growth and survival. Pathogens employ active mechanisms to hijack host cell metabolism and acquire existing nutrient and energy store. The role of the cellular energy sensor AMP-activated protein kinase (AMPK) in the regulation of cellular energy homeostasis is well documented. Here, we highlight recent advances showing the importance of AMPK signaling in pathogen-host interactions. Pathogens interact with AMPK by a variety of mechanisms aimed at reprogramming host cell metabolism to their own benefit. Stimulation of AMPK activity provides an efficient process to rapidly adapt pathogen metabolism to the major nutritional changes often encountered during the different phases of infection. However, inhibition of AMPK is also used by pathogens to manipulate innate host response, indicating that AMPK appears relevant to restriction of pathogen infection. We also document the effects of pharmacological AMPK modulators on pathogen proliferation and survival. This review illustrates intricate pathogen-AMPK interactions that may be exploited to the development of novel anti-pathogen therapies.

Regulatory Proteolysis in Arabidopsis-Pathogen Interactions.

Science.gov (United States)

Pogány, Miklós; Dankó, Tamás; Kámán-Tóth, Evelin; Schwarczinger, Ildikó; Bozsó, Zoltán

2015-09-24

Approximately two and a half percent of protein coding genes in Arabidopsis encode enzymes with known or putative proteolytic activity. Proteases possess not only common housekeeping functions by recycling nonfunctional proteins. By irreversibly cleaving other proteins, they regulate crucial developmental processes and control responses to environmental changes. Regulatory proteolysis is also indispensable in interactions between plants and their microbial pathogens. Proteolytic cleavage is simultaneously used both by plant cells, to recognize and inactivate invading pathogens, and by microbes, to overcome the immune system of the plant and successfully colonize host cells. In this review, we present available results on the group of proteases in the model plant Arabidopsis thaliana whose functions in microbial pathogenesis were confirmed. Pathogen-derived proteolytic factors are also discussed when they are involved in the cleavage of host metabolites. Considering the wealth of review papers available in the field of the ubiquitin-26S proteasome system results on the ubiquitin cascade are not presented. Arabidopsis and its pathogens are conferred with abundant sets of proteases. This review compiles a list of those that are apparently involved in an interaction between the plant and its pathogens, also presenting their molecular partners when available.

Intracellular and extracellular phosphatidylinositol 3-phosphate produced by Phytophthora species is important for infection.

Science.gov (United States)

Lu, Shan; Chen, Linlin; Tao, Kai; Sun, Nannan; Wu, Yuren; Lu, Xiaoxue; Wang, Yuanchao; Dou, Daolong

2013-09-01

RxLR effectors produced by Phytophthora pathogens have been proposed to bind to phosphatidylinositol 3-phosphate (PtdIns(3)P) to mediate their translocation into host cells and/or to increase their stability in planta. Since the levels of PtdIns(3)P in plants are low, we examined whether Phytophthora species may produce PtdIns(3)P to promote infection. We observed that PtdIns(3)P-specific GFP biosensors could bind to P. parasitica and P. sojae hyphae during infection of Nicotiana benthamiana leaves transiently secreting the biosensors, suggesting that the hyphae exposed PtdIns(3)P on their plasma membrane and/or secreted PtdIns(3)P. Silencing of the phosphatidylinositol 3-kinases (PI3K) genes, treatment with LY294002, or expression of PtdIns(3)P-binding proteins by P. sojae reduced the virulence of the pathogen on soybean, indicating that pathogen-synthesized PtdIns(3)P was required for full virulence. Secretion of PtdIns(3)P-binding proteins or of a PI3P-5-kinase by N. benthamiana leaves significantly increased the level of resistance to infection by P. parasitica and P. capsici. Together, our results support the hypothesis that Phytophthora species produce external PtdIns(3)P to aid in infection, such as to promote entry of RxLR effectors into host cells. Our results derived from P. sojae RxLR effector Avr1b confirm that both the N-terminus and the C-terminus of this effector can bind PtdIns(3)P.

Discovery of Ubiquitin Deamidases in the Pathogenic Arsenal of Legionella pneumophila

Directory of Open Access Journals (Sweden)

Dylan Valleau

2018-04-01

Full Text Available Summary: Legionella pneumophila translocates the largest known arsenal of over 330 pathogenic factors, called “effectors,” into host cells during infection, enabling L. pneumophila to establish a replicative niche inside diverse amebas and human macrophages. Here, we reveal that the L. pneumophila effectors MavC (Lpg2147 and MvcA (Lpg2148 are structural homologs of cycle inhibiting factor (Cif effectors and that the adjacent gene, lpg2149, produces a protein that directly inhibits their activity. In contrast to canonical Cifs, both MavC and MvcA contain an insertion domain and deamidate the residue Gln40 of ubiquitin but not Gln40 of NEDD8. MavC and MvcA are functionally diverse, with only MavC interacting with the human E2-conjugating enzyme UBE2N (Ubc13. MavC deamidates the UBE2N∼Ub conjugate, disrupting Lys63 ubiquitination and dampening NF-κB signaling. Combined, our data reveal a molecular mechanism of host manipulation by pathogenic bacteria and highlight the complex regulatory mechanisms integral to L. pneumophila’s pathogenic strategy. : Legionella pneumophila, possessing the largest known arsenal of effectors, continues to reveal unique approaches to host cell control. Valleau et al. decrypt the functions of a trio of effectors, discovering a pair of ubiquitin-specific deamidases, their regulation by a neighboring dual-specificity protein inhibitor, and a mechanism of NF-κB suppression. Keywords: pathogen-host interaction, ubiquitination, Legionella, UBE2N/Ubc13, NF-κB signaling, Type IV secretion system, effectors, metaeffector, cycle inhibiting factor

Ticks and tick-borne pathogens at the cutaneous interface: host defenses, tick countermeasures, and a suitable environment for pathogen establishment

Directory of Open Access Journals (Sweden)

Stephen eWikel

2013-11-01

Full Text Available Ticks are unique among hematophagous arthropods by continuous attachment to host skin and blood feeding for days; complexity and diversity of biologically active molecules differentially expressed in saliva of tick species; their ability to modulate the host defenses of pain and itch, hemostasis, inflammation, innate and adaptive immunity, and wound healing; and, the diverse array of infectious agents they transmit. All of these interactions occur at the cutaneous interface in a complex sequence of carefully choreographed host defense responses and tick countermeasures resulting in an environment that facilitates successful blood feeding and establishment of tick-borne infectious agents within the host. Here, we examine diverse patterns of tick attachment to host skin, blood feeding mechanisms, salivary gland transcriptomes, bioactive molecules in tick saliva, timing of pathogen transmission, and host responses to tick bite. Ticks engage and modulate cutaneous and systemic immune defenses involving keratinocytes, natural killer cells, dendritic cells, T cell subpopulations (Th1, Th2, Th17, Treg , B cells, neutrophils, mast cells, basophils, endothelial cells, cytokines, chemokines, complement, and extracellular matrix. A framework is proposed that integrates tick induced changes of skin immune effectors with their ability to respond to tick-borne pathogens. Implications of these changes are addressed. What are the consequences of tick modulation of host cutaneous defenses? Does diversity of salivary gland transcriptomes determine differential modulation of host inflammation and immune defenses and therefore, in part, the clades of pathogens effectively transmitted by different tick species? Do ticks create an immunologically modified cutaneous environment that enhances specific pathogen establishment? Can tick saliva molecules be used to develop vaccines that block pathogen transmission?

Isolation, Characterization and Biological Properties of Membrane Vesicles Produced by the Swine Pathogen Streptococcus suis.

Directory of Open Access Journals (Sweden)

Bruno Haas

Full Text Available Streptococcus suis, more particularly serotype 2, is a major swine pathogen and an emerging zoonotic agent worldwide that mainly causes meningitis, septicemia, endocarditis, and pneumonia. Although several potential virulence factors produced by S. suis have been identified in the last decade, the pathogenesis of S. suis infections is still not fully understood. In the present study, we showed that S. suis produces membrane vesicles (MVs that range in diameter from 13 to 130 nm and that appear to be coated by capsular material. A proteomic analysis of the MVs revealed that they contain 46 proteins, 9 of which are considered as proven or suspected virulence factors. Biological assays confirmed that S. suis MVs possess active subtilisin-like protease (SspA and DNase (SsnA. S. suis MVs degraded neutrophil extracellular traps, a property that may contribute to the ability of the bacterium to escape the host defense response. MVs also activated the nuclear factor-kappa B (NF-κB signaling pathway in both monocytes and macrophages, inducing the secretion of pro-inflammatory cytokines, which may in turn contribute to increase the permeability of the blood brain barrier. The present study brought evidence that S. suis MVs may play a role as a virulence factor in the pathogenesis of S. suis infections, and given their composition be an excellent candidate for vaccine development.

Pathogen recognition in the innate immune response.

Science.gov (United States)

Kumar, Himanshu; Kawai, Taro; Akira, Shizuo

2009-04-28

Immunity against microbial pathogens primarily depends on the recognition of pathogen components by innate receptors expressed on immune and non-immune cells. Innate receptors are evolutionarily conserved germ-line-encoded proteins and include TLRs (Toll-like receptors), RLRs [RIG-I (retinoic acid-inducible gene-I)-like receptors] and NLRs (Nod-like receptors). These receptors recognize pathogens or pathogen-derived products in different cellular compartments, such as the plasma membrane, the endosomes or the cytoplasm, and induce the expression of cytokines, chemokines and co-stimulatory molecules to eliminate pathogens and instruct pathogen-specific adaptive immune responses. In the present review, we will discuss the recent progress in the study of pathogen recognition by TLRs, RLRs and NLRs and their signalling pathways.

[Exosomes and Immune Cells].

Science.gov (United States)

Seo, Naohiro

2017-05-01

In addition to the cytokines and cytotoxic granules, exosomes have been known as the intercellular communicator and cytotoxic missile of immune cells for the past decade. It has been well known that mature dendritic cell(DC)-derived exosomes participate in the T cell and natural killer(NK)cell activation, while immature DCs secrete tolerogenic exosomes for regulatory T(Treg)cell generation. Treg cell-derived EVs act as a suppressor against pathogenic type-1 T helper(Th1)cell responses. CD8+ T cells produce tumoricidal exosomes for preventing tumor invasion and metastasis transiently after T cell receptor(TCR)-mediated stimulation. Thus, immune cells produce functional exosomes in the activation state- and/or differentiation stage-dependent manner. In this review, the role of immune cell-derived exosomes will be introduced, focusing mainly on immune reaction against tumor.

Generation of high-yield insulin producing cells from human bone marrow mesenchymal stem cells.

Science.gov (United States)

Jafarian, Arefeh; Taghikhani, Mohammad; Abroun, Saeid; Pourpak, Zahra; Allahverdi, Amir; Soleimani, Masoud

2014-07-01

Allogenic islet transplantation is a most efficient approach for treatment of diabetes mellitus. However, the scarcity of islets and long term need for an immunosuppressant limits its application. Recently, cell replacement therapies that generate of unlimited sources of β cells have been developed to overcome these limitations. In this study we have described a stage specific differentiation protocol for the generation of insulin producing islet-like clusters from human bone marrow mesenchymal stem cells (hBM-MSCs). This specific stepwise protocol induced differentiation of hMSCs into definitive endoderm, pancreatic endoderm and pancreatic endocrine cells that expressed of sox17, foxa2, pdx1, ngn3, nkx2.2, insulin, glucagon, somatostatin, pancreatic polypeptide, and glut2 transcripts respectively. In addition, immunocytochemical analysis confirmed protein expression of the above mentioned genes. Western blot analysis discriminated insulin from proinsulin in the final differentiated cells. In derived insulin producing cells (IPCs), secreted insulin and C-peptide was in a glucose dependent manner. We have developed a protocol that generates effective high-yield human IPCs from hBM-MSCs in vitro. These finding suggest that functional IPCs generated by this procedure can be used as a cell-based approach for insulin dependent diabetes mellitus.

Riboflavin-ultraviolet light pathogen reduction treatment does not impact the immunogenicity of murine red blood cells.

Science.gov (United States)

Tormey, Christopher A; Santhanakrishnan, Manjula; Smith, Nicole H; Liu, Jingchun; Marschner, Susanne; Goodrich, Raymond P; Hendrickson, Jeanne E

2016-04-01

Ultraviolet (UV) illumination/pathogen reduction effectively inactivates white blood cells (WBCs) in whole blood. Given that cotransfused WBCs may impact recipient immune responses, we hypothesized that pathogen reduction of whole blood may alter responses to RBC antigens. Transgenic mice expressing a model (HOD) antigen, authentic human (hGPA or KEL) antigens, or natural fluorescence (uGFP) on their RBCs were utilized as blood donors. Recipients were transfused with fresh whole blood to which riboflavin had been added or fresh whole blood treated by UV illumination/pathogen reduction treatment after the addition of riboflavin. Posttransfusion RBC recovery, survival, and alloimmunization were measured by flow cytometry. UV illumination/pathogen reduction treatment did not alter RBC antigen expression, and recipients of treated syngeneic RBCs had persistently negative direct antiglobulin tests. Greater than 75% of treated and untreated syngeneic RBCs were recovered 24 hours posttransfusion in all experiments, although alterations in the long-term posttransfusion survival of treated RBCs were observed. Treated and untreated KEL RBCs induced similar recipient alloimmune responses, with all recipients making anti-KEL glycoprotein immunoglobulins (p > 0.05). Alloimmune responses to treated HOD or hGPA RBCs were no different from untreated RBCs (p > 0.05). Pathogen inactivation treatment of fresh whole murine blood with riboflavin and UV illumination does not impact the rate or magnitude of RBC alloimmunization to three distinct RBC antigens. Further, UV illumination/pathogen reduction appears safe from an immunohematologic standpoint, with no immunogenic neoantigens detected on treated murine RBCs. Future studies with fresh and stored human RBCs are warranted to confirm these findings. © 2015 AABB.

In Vitro Assessment of the Probiotic Potential of Lactococcus lactis LMG 7930 against Ruminant Mastitis-Causing Pathogens.

Science.gov (United States)

Armas, Federica; Camperio, Cristina; Marianelli, Cinzia

2017-01-01

Mastitis in dairy ruminants is considered to be the most expensive disease to farmers worldwide. Recently, the intramammary infusion of lactic acid bacteria has emerged as a potential new alternative to antibiotics for preventing and treating bovine mastitis. In this study we have investigated in vitro the probiotic potential of Lactococcus lactis LMG 7930, a food-grade and nisin-producing strain, against mastitis-causing pathogens. We have characterized its carbohydrate fermentation and antibiotic susceptibility profiles, cell surface properties and antimicrobial activity, as well as its capabilities to adhere to and inhibit the invasion of pathogens into the bovine mammary epithelial cell line BME-UV1d. We found that L. lactis LMG 7930 was sensitive to tested drugs, according to the EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP), and showed an improved carbohydrate fermentation capacity compared to starter strains. Moreover, the strain exhibited antagonistic properties towards many of the pathogens tested. It presented medium surface hydrophobicity, a low basic property and no electron acceptor capability. It showed low auto-aggregation and no co-aggregation abilities towards any of the tested pathogens. The strain was one of the most adhesive to bovine mammary epithelial cells among tested bacteria, but its internalisation was low. The strain did not affect significantly pathogen invasion; however, a trend to decrease internalization of some pathogens tested was observed. In conclusion, our results suggest that this strain might be a promising candidate for the development of new strategies of mastitis control in ruminants. Future investigations are needed to evaluate its safety and efficacy under field conditions.

In Vitro Assessment of the Probiotic Potential of Lactococcus lactis LMG 7930 against Ruminant Mastitis-Causing Pathogens.

Directory of Open Access Journals (Sweden)

Federica Armas

Full Text Available Mastitis in dairy ruminants is considered to be the most expensive disease to farmers worldwide. Recently, the intramammary infusion of lactic acid bacteria has emerged as a potential new alternative to antibiotics for preventing and treating bovine mastitis. In this study we have investigated in vitro the probiotic potential of Lactococcus lactis LMG 7930, a food-grade and nisin-producing strain, against mastitis-causing pathogens. We have characterized its carbohydrate fermentation and antibiotic susceptibility profiles, cell surface properties and antimicrobial activity, as well as its capabilities to adhere to and inhibit the invasion of pathogens into the bovine mammary epithelial cell line BME-UV1d. We found that L. lactis LMG 7930 was sensitive to tested drugs, according to the EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP, and showed an improved carbohydrate fermentation capacity compared to starter strains. Moreover, the strain exhibited antagonistic properties towards many of the pathogens tested. It presented medium surface hydrophobicity, a low basic property and no electron acceptor capability. It showed low auto-aggregation and no co-aggregation abilities towards any of the tested pathogens. The strain was one of the most adhesive to bovine mammary epithelial cells among tested bacteria, but its internalisation was low. The strain did not affect significantly pathogen invasion; however, a trend to decrease internalization of some pathogens tested was observed. In conclusion, our results suggest that this strain might be a promising candidate for the development of new strategies of mastitis control in ruminants. Future investigations are needed to evaluate its safety and efficacy under field conditions.

Generation of a Chinese Hamster Ovary Cell Line Producing Recombinant Human Glucocerebrosidase

Science.gov (United States)

Novo, Juliana Branco; Morganti, Ligia; Moro, Ana Maria; Paes Leme, Adriana Franco; Serrano, Solange Maria de Toledo; Raw, Isaias; Ho, Paulo Lee

2012-01-01

Impaired activity of the lysosomal enzyme glucocerebrosidase (GCR) results in the inherited metabolic disorder known as Gaucher disease. Current treatment consists of enzyme replacement therapy by administration of exogenous GCR. Although effective, it is exceptionally expensive, and patients worldwide have a limited access to this medicine. In Brazil, the public healthcare system provides the drug free of charge for all Gaucher's patients, which reaches the order of $ 84 million per year. However, the production of GCR by public institutions in Brazil would reduce significantly the therapy costs. Here, we describe a robust protocol for the generation of a cell line producing recombinant human GCR. The protein was expressed in CHO-DXB11 (dhfr−) cells after stable transfection and gene amplification with methotrexate. As expected, glycosylated GCR was detected by immunoblotting assay both as cell-associated (~64 and 59 kDa) and secreted (63–69 kDa) form. Analysis of subclones allowed the selection of stable CHO cells producing a secreted functional enzyme, with a calculated productivity of 5.14 pg/cell/day for the highest producer. Although being laborious, traditional methods of screening high-producing recombinant cells may represent a valuable alternative to generate expensive biopharmaceuticals in countries with limited resources. PMID:23091360

Generation of a Chinese Hamster Ovary Cell Line Producing Recombinant Human Glucocerebrosidase

Directory of Open Access Journals (Sweden)

Juliana Branco Novo

2012-01-01

Full Text Available Impaired activity of the lysosomal enzyme glucocerebrosidase (GCR results in the inherited metabolic disorder known as Gaucher disease. Current treatment consists of enzyme replacement therapy by administration of exogenous GCR. Although effective, it is exceptionally expensive, and patients worldwide have a limited access to this medicine. In Brazil, the public healthcare system provides the drug free of charge for all Gaucher’s patients, which reaches the order of $ 84 million per year. However, the production of GCR by public institutions in Brazil would reduce significantly the therapy costs. Here, we describe a robust protocol for the generation of a cell line producing recombinant human GCR. The protein was expressed in CHO-DXB11 (dhfr− cells after stable transfection and gene amplification with methotrexate. As expected, glycosylated GCR was detected by immunoblotting assay both as cell-associated (~64 and 59 kDa and secreted (63–69 kDa form. Analysis of subclones allowed the selection of stable CHO cells producing a secreted functional enzyme, with a calculated productivity of 5.14 pg/cell/day for the highest producer. Although being laborious, traditional methods of screening high-producing recombinant cells may represent a valuable alternative to generate expensive biopharmaceuticals in countries with limited resources.

Lactobacillus protects the integrity of intestinal epithelial barrier damaged by pathogenic bacteria

Directory of Open Access Journals (Sweden)

Qinghua eYu

2015-03-01

Full Text Available Pathogens invade intestinal mucosal barrier through phagocytosis of antigen presenting cells (dendritic cell, microfold cells, or through the invasion into the intestinal epithelial directly. Some pathogens could damage the cell junction between epithelial cells and use the paracellular pathway as an entrance to invade. Moreover, some Lactobacillus could inhibit the adhesion of the pathogens and protect the integrity of the cell junction and mucosal barrier. This research focused on the potential therapeutic effect of Lactobacillus fructosus (L. fructosus C2 to attenuate ETEC K88 or S. typhimurium SL1344 induced changes to mucosal barrier. The results demonstrated that treatment of polarized Caco-2 cells with L. fructosus C2 reduced the permeation of dextran, and expression of IL-8, p-ERK and p-JNK when cells were infected with pathogenic bacteria. The findings indicated that L. fructosus C2 exerted a protective effect against the damage to the integrity of Caco-2 cells by ETEC or S. typhimurium infection.

Relationship of blood and milk cell counts with mastitic pathogens in Murrah buffaloes

Directory of Open Access Journals (Sweden)

C. Singh

2010-02-01

Full Text Available The present study was undertaken to see the effect of mastitic pathogens on the blood and milk counts of Murrah buffaloes. Milk and blood samples were collected from 9 mastitic Murrah buffaloes. The total leucocyte Counts (TLC and Differential leucocyte counts (DLC in blood were within normal range and there was a non-significant change in blood counts irrespective of different mastitic pathogens. Normal milk quarter samples had significantly (P<0.01 less Somatic cell counts (SCC. Lymphocytes were significantly higher in normal milk samples, whereas infected samples had a significant increase (P<0.01 in milk neutrophils. S. aureus infected buffaloes had maximum milk SCC, followed by E. coli and S. agalactiae. Influx of neutrophils in the buffalo mammary gland was maximum for S. agalactiae, followed by E.cli and S. aureus. The study indicated that level of mastitis had no affect on blood counts but it influenced the milk SCC of normal quarters.

Diplopimarane, a 20-nor-ent-pimarane produced by the oak pathogen Diplodia quercivora.

Science.gov (United States)

Andolfi, Anna; Maddau, Lucia; Basso, Sara; Linaldeddu, Benedetto T; Cimmino, Alessio; Scanu, Bruno; Deidda, Antonio; Tuzi, Angela; Evidente, Antonio

2014-11-26

In this study a new 20-nor-ent-pimarane, named diplopimarane, was isolated together with sphaeropsidins A (9) and C (10), and (+)-epiepoformin (11) from organic crude extracts of Diplodia quercivora, a recently described oak pathogen originally found on declining Quercus canariensis trees in Tunisia. Diplopimarane was characterized as (1S,2R)-2,8,8-trimethyl-2-vinyl-1,2,3,4,5,6,7,8-octahydrophenanthrene-1,9,10-triol by spectroscopic, X-ray, optical, and chemical methods. It exhibited a wide range of activities including remarkable phytotoxicity on nonhost plants such as tomato cuttings, moderate antifungal activity against important plant pathogens, and moderate zootoxicity against Artemia salina. Its derivatives (2-4 and 6) were also tested for their phytotoxic and zootoxic activities. All these derivatives proved to be active against A. salina at 200 μg/mL, while 2 and 6 were also active on tomato cuttings. The other secondary metabolites (9, 10, and 11) herein reported for D. quercivora exhibited phytotoxic, antifungal, and zootoxic activity. This is the first report on the secondary metabolites secreted in vitro by this oak pathogen that could be key components of its adaptative strategies.

Insulin-Producing Endocrine Cells Differentiated In Vitro From Human Embryonic Stem Cells Function in Macroencapsulation Devices In Vivo.

Science.gov (United States)

Agulnick, Alan D; Ambruzs, Dana M; Moorman, Mark A; Bhoumik, Anindita; Cesario, Rosemary M; Payne, Janice K; Kelly, Jonathan R; Haakmeester, Carl; Srijemac, Robert; Wilson, Alistair Z; Kerr, Justin; Frazier, Mauro A; Kroon, Evert J; D'Amour, Kevin A

2015-10-01

The PEC-01 cell population, differentiated from human embryonic stem cells (hESCs), contains pancreatic progenitors (PPs) that, when loaded into macroencapsulation devices (to produce the VC-01 candidate product) and transplanted into mice, can mature into glucose-responsive insulin-secreting cells and other pancreatic endocrine cells involved in glucose metabolism. We modified the protocol for making PEC-01 cells such that 73%-80% of the cell population consisted of PDX1-positive (PDX1+) and NKX6.1+ PPs. The PPs were further differentiated to islet-like cells (ICs) that reproducibly contained 73%-89% endocrine cells, of which approximately 40%-50% expressed insulin. A large fraction of these insulin-positive cells were single hormone-positive and expressed the transcription factors PDX1 and NKX6.1. To preclude a significant contribution of progenitors to the in vivo function of ICs, we used a simple enrichment process to remove remaining PPs, yielding aggregates that contained 93%-98% endocrine cells and 1%-3% progenitors. Enriched ICs, when encapsulated and implanted into mice, functioned similarly to the VC-01 candidate product, demonstrating conclusively that in vitro-produced hESC-derived insulin-producing cells can mature and function in vivo in devices. A scaled version of our suspension culture was used, and the endocrine aggregates could be cryopreserved and retain functionality. Although ICs expressed multiple important β cell genes, the cells contained relatively low levels of several maturity-associated markers. Correlating with this, the time to function of ICs was similar to PEC-01 cells, indicating that ICs required cell-autonomous maturation after delivery in vivo, which would occur concurrently with graft integration into the host. Type 1 diabetes (T1D) affects approximately 1.25 million people in the U.S. alone and is deadly if not managed with insulin injections. This paper describes the production of insulin-producing cells in vitro and a new

Heat Shock Protein 47: A Novel Biomarker of Phenotypically Altered Collagen-Producing Cells

International Nuclear Information System (INIS)

Taguchi, Takashi; Nazneen, Arifa; Al-Shihri, Abdulmonem A.; Turkistani, Khadijah A.; Razzaque, Mohammed S.

2011-01-01

Heat shock protein 47 (HSP47) is a collagen-specific molecular chaperone that helps the molecular maturation of various types of collagens. A close association between increased expression of HSP47 and the excessive accumulation of collagens is found in various human and experimental fibrotic diseases. Increased levels of HSP47 in fibrotic diseases are thought to assist in the increased assembly of procollagen, and thereby contribute to the excessive deposition of collagens in fibrotic areas. Currently, there is not a good universal histological marker to identify collagen-producing cells. Identifying phenotypically altered collagen-producing cells is essential for the development of cell-based therapies to reduce the progression of fibrotic diseases. Since HSP47 has a single substrate, which is collagen, the HSP47 cellular expression provides a novel universal biomarker to identify phenotypically altered collagen-producing cells during wound healing and fibrosis. In this brief article, we explained why HSP47 could be used as a universal marker for identifying phenotypically altered collagen-producing cells

Exploring NAD+ metabolism in host-pathogen interactions.

Science.gov (United States)

Mesquita, Inês; Varela, Patrícia; Belinha, Ana; Gaifem, Joana; Laforge, Mireille; Vergnes, Baptiste; Estaquier, Jérôme; Silvestre, Ricardo

2016-03-01

Nicotinamide adenine dinucleotide (NAD(+)) is a vital molecule found in all living cells. NAD(+) intracellular levels are dictated by its synthesis, using the de novo and/or salvage pathway, and through its catabolic use as co-enzyme or co-substrate. The regulation of NAD(+) metabolism has proven to be an adequate drug target for several diseases, including cancer, neurodegenerative or inflammatory diseases. Increasing interest has been given to NAD(+) metabolism during innate and adaptive immune responses suggesting that its modulation could also be relevant during host-pathogen interactions. While the maintenance of NAD(+) homeostatic levels assures an adequate environment for host cell survival and proliferation, fluctuations in NAD(+) or biosynthetic precursors bioavailability have been described during host-pathogen interactions, which will interfere with pathogen persistence or clearance. Here, we review the double-edged sword of NAD(+) metabolism during host-pathogen interactions emphasizing its potential for treatment of infectious diseases.

The regulation of function, growth and survival of GLP-1-producing L-cells

DEFF Research Database (Denmark)

Kuhre, Rune Ehrenreich; Holst, Jens Juul; Kappe, Camilla

2016-01-01

that regulate the growth, survival and function of these cells are largely unknown. We recently showed that prolonged exposure to high concentrations of the fatty acid palmitate induced lipotoxic effects, similar to those operative in insulin-producing cells, in an in vitro model of GLP-1-producing cells...... absorption and disposal, as well as cell proliferation and survival. In Type 2 Diabetes (T2D) reduced plasma levels of GLP-1 have been observed, and plasma levels of GLP-1, as well as reduced numbers of GLP-1 producing cells, have been correlated to obesity and insulin resistance. Increasing endogenous...... secretion of GLP-1 by selective targeting of the molecular mechanisms regulating secretion from the L-cell has been the focus of much recent research. An additional and promising strategy for enhancing endogenous secretion may be to increase the L-cell mass in the intestinal epithelium, but the mechanisms...

Nucleic acid probes in the diagnosis of human microbial pathogens

International Nuclear Information System (INIS)

Hyypia, T.; Huovinen, P.; Holmberg, M.; Pettersson, U.

1989-01-01

The development of effective vaccines and antimicrobial drugs against infectious diseases has been among the most successful achievements in modern medicine. The control of these diseases requires efficient diagnostic methods for the evaluation of the prevalence of diseases and for initiation of specific treatment. Virtually all known microbes can be specifically identified today but in many cases further development is needed for more accurate, rapid, easy-to-use, and inexpensive diagnostic assays. Cell culture facilities are needed for the isolation of viruses in clinical specimens. Any gene of any known microorganism can be cloned in a vector and produced in large amounts economically and then used in diagnostic assays for the identification of the pathogen. The application of the nucleic acid hybridization methods in detection of human pathogens has received considerable attention during the past few years. This paper presents examples of this application of gene technology

Luminescence, virulence and quorum sensing signal production by pathogenic Vibrio campbellii and Vibrio harveyi isolates

OpenAIRE

Defoirdt, T.; Verstraete, W.; Bossier, P.

2008-01-01

Aims: To study the relationship between luminescence, autoinducer production and virulence of pathogenic vibrios.Methods and Results: Luminescence, quorum sensing signal production and virulence towards brine shrimp nauplii of 13 Vibrio campbellii and Vibrio harveyi strains were studied. Although only two of the tested strains were brightly luminescent, all of them were shown to produce the three different types of quorum sensing signals known to be produced by Vibrio harveyi. Cell-free cultu...

AAVS1-Targeted Plasmid Integration in AAV Producer Cell Lines.

Science.gov (United States)

Luo, Yuxia; Frederick, Amy; Martin, John M; Scaria, Abraham; Cheng, Seng H; Armentano, Donna; Wadsworth, Samuel C; Vincent, Karen A

2017-06-01

Adeno-associated virus (AAV) producer cell lines are created via transfection of HeLaS3 cells with a single plasmid containing three components (the vector sequence, the AAV rep and cap genes, and a selectable marker gene). As this plasmid contains both the cis (Rep binding sites) and trans (Rep protein encoded by the rep gene) elements required for site-specific integration, it was predicted that plasmid integration might occur within the AAVS1 locus on human chromosome 19 (chr19). The objective of this study was to investigate whether integration in AAVS1 might be correlated with vector yield. Plasmid integration sites within several independent cell lines were assessed via Southern, fluorescence in situ hybridization (FISH) and PCR analyses. In the Southern analyses, the presence of fragments detected by both rep- and AAVS1-specific probes suggested that for several mid- and high-producing lines, plasmid DNA had integrated into the AAVS1 locus. Analysis with puroR and AAVS1-specific probes suggested that integration in AAVS1 was a more widespread phenomenon. High-producing AAV2-secreted alkaline phosphatase (SEAP) lines (masterwell 82 [MW82] and MW278) were evaluated via FISH using probes specific for the plasmid, AAVS1, and a chr19 marker. FISH analysis detected two plasmid integration sites in MW278 (neither in AAVS1), while a total of three sites were identified in MW82 (two in AAVS1). An inverse PCR assay confirmed integration within AAVS1 for several mid- and high-producing lines. In summary, the FISH, Southern, and PCR data provide evidence of site-specific integration of the plasmid within AAVS1 in several AAV producer cell lines. The data also suggest that integration in AAVS1 is a general phenomenon that is not necessarily restricted to high producers. The results also suggest that plasmid integration within the AAVS1 locus is not an absolute requirement for a high vector yield.

Cell culture based production of avian influenza vaccines

NARCIS (Netherlands)

Wielink, van R.

2012-01-01

Vaccination of poultry can be used as a tool to control outbreaks of avian influenza, including that of highly pathogenic H5 and H7 strains. Influenza vaccines are traditionally produced in embryonated chicken eggs. Continuous cell lines have been suggested as an alternative substrate to produce

Interaction of Staphylococci with Human B cells.

Directory of Open Access Journals (Sweden)

Tyler K Nygaard

Full Text Available Staphylococcus aureus is a leading cause of human infections worldwide. The pathogen produces numerous molecules that can interfere with recognition and binding by host innate immune cells, an initial step required for the ingestion and subsequent destruction of microbes by phagocytes. To better understand the interaction of this pathogen with human immune cells, we compared the association of S. aureus and S. epidermidis with leukocytes in human blood. We found that a significantly greater proportion of B cells associated with S. epidermidis relative to S. aureus. Complement components and complement receptors were important for the binding of B cells with S. epidermidis. Experiments using staphylococci inactivated by ultraviolet radiation and S. aureus isogenic deletion mutants indicated that S. aureus secretes molecules regulated by the SaeR/S two-component system that interfere with the ability of human B cells to bind this bacterium. We hypothesize that the relative inability of B cells to bind S. aureus contributes to the microbe's success as a human pathogen.

Pathogen reduction by ultraviolet C light effectively inactivates human white blood cells in platelet products.

Science.gov (United States)

Pohler, Petra; Müller, Meike; Winkler, Carla; Schaudien, Dirk; Sewald, Katherina; Müller, Thomas H; Seltsam, Axel

2015-02-01

Residual white blood cells (WBCs) in cellular blood components induce a variety of adverse immune events, including nonhemolytic febrile transfusion reactions, alloimmunization to HLA antigens, and transfusion-associated graft-versus-host disease (TA-GVHD). Pathogen reduction (PR) methods such as the ultraviolet C (UVC) light-based THERAFLEX UV-Platelets system were developed to reduce the risk of transfusion-transmitted infection. As UVC light targets nucleic acids, it interferes with the replication of both pathogens and WBCs. This preclinical study aimed to evaluate the ability of UVC light to inactivate contaminating WBCs in platelet concentrates (PCs). The in vitro and in vivo function of WBCs from UVC-treated PCs was compared to that of WBCs from gamma-irradiated and untreated PCs by measuring cell viability, proliferation, cytokine secretion, antigen presentation in vitro, and xenogeneic GVHD responses in a humanized mouse model. UVC light was at least as effective as gamma irradiation in preventing GVHD in the mouse model. It was more effective in suppressing T-cell proliferation (>5-log reduction in the limiting dilution assay), cytokine secretion, and antigen presentation than gamma irradiation. The THERAFLEX UV-Platelets (MacoPharma) PR system can substitute gamma irradiation for TA-GVHD prophylaxis in platelet (PLT) transfusion. Moreover, UVC treatment achieves suppression of antigen presentation and inhibition of cytokine accumulation during storage of PCs, which has potential benefits for transfusion recipients. © 2014 AABB.

Genetic characteristics and pathogenic mechanisms of periodontal pathogens.

Science.gov (United States)

Amano, A; Chen, C; Honma, K; Li, C; Settem, R P; Sharma, A

2014-05-01

Periodontal disease is caused by a group of bacteria that utilize a variety of strategies and molecular mechanisms to evade or overcome host defenses. Recent research has uncovered new evidence illuminating interesting aspects of the virulence of these bacteria and their genomic variability. This paper summarizes some of the strategies utilized by the major species - Aggregatibacter actinomycetemcomitans, Tannerella forsythia, Treponema denticola, and Porphyromonas gingivalis - implicated in the pathogenesis of periodontal disease. Whole-genome sequencing of 14 diverse A. actinomycetemcomitans strains has revealed variations in their genetic content (ranging between 0.4% and 19.5%) and organization. Strikingly, isolates from human periodontal sites showed no genomic changes during persistent colonization. T. forsythia manipulates the cytokine responses of macrophages and monocytes through its surface glycosylation. Studies have revealed that bacterial surface-expressed O-linked glycans modulate T-cell responses during periodontal inflammation. Periodontal pathogens belonging to the "red complex" consortium express neuraminidases, which enables them to scavenge sialic acid from host glycoconjugates. Analysis of recent data has demonstrated that the cleaved sialic acid acts as an important nutrient for bacterial growth and a molecule for the decoration of bacteria surfaces to help evade the host immune attack. In addition, bacterial entry into host cells is also an important prerequisite for the lifestyle of periodontal pathogens such as P. gingivalis. Studies have shown that, after its entry into the cell, this bacterium uses multiple sorting pathways destined for autophagy, lysosomes, or recycling pathways. In addition, P. gingivalis releases outer membrane vesicles which enter cells via endocytosis and cause cellular functional impairment.

Extrolites of Aspergillus fumigatus and Other Pathogenic Species in Aspergillus Section Fumigati

Science.gov (United States)

Frisvad, Jens C.; Larsen, Thomas O.

2016-01-01

Aspergillus fumigatus is an important opportunistic human pathogen known for its production of a large array of extrolites. Up to 63 species have been described in Aspergillus section Fumigati, some of which have also been reliably reported to be pathogenic, including A. felis, A. fischeri, A. fumigatiaffinis, A. fumisynnematus, A. hiratsukae, A. laciniosus, A. lentulus, A. novofumigatus, A. parafelis, A. pseudofelis, A. pseudoviridinutans, A. spinosus, A. thermomutatus, and A. udagawae. These species share the production of hydrophobins, melanins, and siderophores and ability to grow well at 37°C, but they only share some small molecule extrolites, that could be important factors in pathogenicity. According to the literature gliotoxin and other exometabolites can be contributing factors to pathogenicity, but these exometabolites are apparently not produced by all pathogenic species. It is our hypothesis that species unable to produce some of these metabolites can produce proxy-exometabolites that may serve the same function. We tabulate all exometabolites reported from species in Aspergillus section Fumigati and by comparing the profile of those extrolites, suggest that those producing many different kinds of exometabolites are potential opportunistic pathogens. The exometabolite data also suggest that the profile of exometabolites are highly specific and can be used for identification of these closely related species. PMID:26779142

Subversion of inflammasome activation and pyroptosis by pathogenic bacteria

Directory of Open Access Journals (Sweden)

Larissa D Cunha

2013-11-01

Full Text Available Activation of the inflammasome occurs in response to a notably high number of pathogenic microbes and is a broad innate immune response that effectively contributes to restriction of pathogen replication and generation of adaptive immunity. Activation of these platforms leads to caspase-1- and/or caspase-11-dependent secretion of proteins, including cytokines, and induction of a specific form of cell death called pyroptosis, which directly or indirectly contribute for restriction of pathogen replication. Not surprisingly, bona fide intracellular pathogens developed strategies for manipulation of cell death to guarantee intracellular replication. In this sense, the remarkable advances in the knowledge of the inflammasome field have been accompanied by several reports characterizing the inhibition of this platform by several pathogenic bacteria. Herein, we review some processes used by pathogenic bacteria, including Yersinia spp., Pseudomonas aeruginosa, Vibrio parahaemolyticus, Chlamydia trachomatis, Francisella tularensis, Shigella flexneri, Legionella pneumophila and Coxiella burnetii to evade the activation of the inflammasome and the induction of pyroptosis.

The opportunistic pathogen Pseudomonas aeruginosa activates the DNA double-strand break signaling and repair pathway in infected cells

International Nuclear Information System (INIS)

Elsen, S.; Collin-Faure, V.; Gidrol, X.; Lemercier, C.

2013-01-01

Highly hazardous DNA double-strand breaks can be induced in eukaryotic cells by a number of agents including pathogenic bacterial strains. We have investigated the genotoxic potential of Pseudomonas aeruginosa, an opportunistic pathogen causing devastating nosocomial infections in cystic fibrosis or immunocompromised patients. Our data revealed that infection of immune or epithelial cells by P. aeruginosa triggered DNA strand breaks and phosphorylation of histone H2AX (γH2AX), a marker of DNA double-strand breaks. Moreover, it induced formation of discrete nuclear repair foci similar to gamma-irradiation-induced foci, and containing γH2AX and 53BP1, an adaptor protein mediating the DNA-damage response pathway. Gene deletion, mutagenesis, and complementation in P. aeruginosa identified ExoS bacterial toxin as the major factor involved in γH2AX induction. Chemical inhibition of several kinases known to phosphorylate H2AX demonstrated that Ataxia Telangiectasia Mutated (ATM) was the principal kinase in P. aeruginosa-induced H2AX phosphorylation. Finally, infection led to ATM kinase activation by an auto-phosphorylation mechanism. Together, these data show for the first time that infection by P. aeruginosa activates the DNA double-strand break repair machinery of the host cells. This novel information sheds new light on the consequences of P. aeruginosa infection in mammalian cells. As pathogenic Escherichia coli or carcinogenic Helicobacter pylori can alter genome integrity through DNA double-strand breaks, leading to chromosomal instability and eventually cancer, our findings highlight possible new routes for further investigations of P. aeruginosa in cancer biology and they identify ATM as a potential target molecule for drug design. (authors)

The membrane as the gatekeeper of infection: Cholesterol in host-pathogen interaction.

Science.gov (United States)

Kumar, G Aditya; Jafurulla, Md; Chattopadhyay, Amitabha

2016-09-01

The cellular plasma membrane serves as a portal for the entry of intracellular pathogens. An essential step for an intracellular pathogen to gain entry into a host cell therefore is to be able to cross the cell membrane. In this review, we highlight the role of host membrane cholesterol in regulating the entry of intracellular pathogens using insights obtained from work on the interaction of Leishmania and Mycobacterium with host cells. The entry of these pathogens is known to be dependent on host membrane cholesterol. Importantly, pathogen entry is inhibited either upon depletion (or complexation), or enrichment of membrane cholesterol. In other words, an optimum level of host membrane cholesterol is necessary for efficient infection by pathogens. In this overall context, we propose a general mechanism, based on cholesterol-induced conformational changes, involving cholesterol binding sites in host cell surface receptors that are implicated in this process. A therapeutic strategy targeting modulation of membrane cholesterol would have the advantage of avoiding the commonly encountered problem of drug resistance in tackling infection by intracellular pathogens. Insights into the role of host membrane cholesterol in pathogen entry would be instrumental in the development of novel therapeutic strategies to effectively tackle intracellular pathogenesis. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Rapid detection of Shigella and enteroinvasive Escherichia coli in produce enrichments by a conventional multiplex PCR assay.

Science.gov (United States)

Binet, Rachel; Deer, Deanne M; Uhlfelder, Samantha J

2014-06-01

Faster detection of contaminated foods can prevent adulterated foods from being consumed and minimize the risk of an outbreak of foodborne illness. A sensitive molecular detection method is especially important for Shigella because ingestion of as few as 10 of these bacterial pathogens can cause disease. The objectives of this study were to compare the ability of four DNA extraction methods to detect Shigella in six types of produce, post-enrichment, and to evaluate a new and rapid conventional multiplex assay that targets the Shigella ipaH, virB and mxiC virulence genes. This assay can detect less than two Shigella cells in pure culture, even when the pathogen is mixed with background microflora, and it can also differentiate natural Shigella strains from a control strain and eliminate false positive results due to accidental laboratory contamination. The four DNA extraction methods (boiling, PrepMan Ultra [Applied Biosystems], InstaGene Matrix [Bio-Rad], DNeasy Tissue kit [Qiagen]) detected 1.6 × 10(3)Shigella CFU/ml post-enrichment, requiring ∼18 doublings to one cell in 25 g of produce pre-enrichment. Lower sensitivity was obtained, depending on produce type and extraction method. The InstaGene Matrix was the most consistent and sensitive and the multiplex assay accurately detected Shigella in less than 90 min, outperforming, to the best of our knowledge, molecular assays currently in place for this pathogen. Published by Elsevier Ltd.

Pseudomonas fluorescens filamentous hemagglutinin, an iron-regulated protein, is an important virulence factor that modulates bacterial pathogenicity

Directory of Open Access Journals (Sweden)

Yuan-yuan Sun

2016-08-01

Full Text Available Pseudomonas fluorescens is a common bacterial pathogen to a wide range of aquaculture animals including various species of fish. In this study, we employed proteomic analysis and identified filamentous hemagglutinin (FHA as an iron-responsive protein secreted by TSS, a pathogenic P. fluorescens isolate. In vitro study showed that compared to the wild type, the fha mutant TSSfha (i exhibited a largely similar vegetative growth profile but significantly retarded in the ability of biofilm growth and producing extracellular matrix, (ii displayed no apparent flagella and motility, (iii was defective in the attachment to host cells and unable to form self-aggregation, (iv displayed markedly reduced capacity of hemagglutination and surviving in host serum. In vivo infection analysis revealed that TSSfha was significantly attenuated in the ability of dissemination in fish tissues and inducing host mortality, and that antibody blocking of the natural FHA produced by the wild type TSS impaired the infectivity of the pathogen. Furthermore, when introduced into turbot as a subunit vaccine, recombinant FHA elicited a significant protection against lethal TSS challenge. Taken together, these results indicate for the first time that P. fluorescens FHA is a key virulence factor essential to multiple biological processes associated with pathogenicity.

Biological activity of the non-microbial fraction of kefir: antagonism against intestinal pathogens.

Science.gov (United States)

Iraporda, Carolina; Abatemarco Júnior, Mário; Neumann, Elisabeth; Nunes, Álvaro Cantini; Nicoli, Jacques R; Abraham, Analía G; Garrote, Graciela L

2017-08-01

Kefir is a fermented milk obtained by the activity of kefir grains which are composed of lactic and acetic acid bacteria, and yeasts. Many beneficial health effects have been associated with kefir consumption such as stimulation of the immune system and inhibition of pathogenic microorganisms. The biological activity of kefir may be attributed to the presence of a complex microbiota as well as the microbial metabolites that are released during fermentation. The aim of this work was to characterise the non-microbial fraction of kefir and to study its antagonism against Escherichia coli, Salmonella spp. and Bacillus cereus. During milk fermentation there was a production of organic acids, mainly lactic and acetic acid, with a consequent decrease in pH and lactose content. The non-microbial fraction of kefir added to nutrient broth at concentrations above 75% v/v induced a complete inhibition of pathogenic growth that could be ascribed to the presence of un-dissociated lactic acid. In vitro assays using an intestinal epithelial cell model indicated that pre-incubation of cells with the non-microbial fraction of kefir did not modify the association/invasion of Salmonella whereas pre-incubation of Salmonella with this fraction under conditions that did not affect their viability significantly decreased the pathogen's ability to invade epithelial cells. Lactate exerted a protective effect against Salmonella in a mouse model, demonstrating the relevance of metabolites present in the non-microbial fraction of kefir produced during milk fermentation.

Adenoid Reservoir for Pathogenic Biofilm Bacteria▿

Science.gov (United States)

Nistico, L.; Kreft, R.; Gieseke, A.; Coticchia, J. M.; Burrows, A.; Khampang, P.; Liu, Y.; Kerschner, J. E.; Post, J. C.; Lonergan, S.; Sampath, R.; Hu, F. Z.; Ehrlich, G. D.; Stoodley, P.; Hall-Stoodley, L.

2011-01-01

Biofilms of pathogenic bacteria are present on the middle ear mucosa of children with chronic otitis media (COM) and may contribute to the persistence of pathogens and the recalcitrance of COM to antibiotic treatment. Controlled studies indicate that adenoidectomy is effective in the treatment of COM, suggesting that the adenoids may act as a reservoir for COM pathogens. To investigate the bacterial community in the adenoid, samples were obtained from 35 children undergoing adenoidectomy for chronic OM or obstructive sleep apnea. We used a novel, culture-independent molecular diagnostic methodology, followed by confocal microscopy, to investigate the in situ distribution and organization of pathogens in the adenoids to determine whether pathogenic bacteria exhibited criteria characteristic of biofilms. The Ibis T5000 Universal Biosensor System was used to interrogate the extent of the microbial diversity within adenoid biopsy specimens. Using a suite of 16 broad-range bacterial primers, we demonstrated that adenoids from both diagnostic groups were colonized with polymicrobial biofilms. Haemophilus influenzae was present in more adenoids from the COM group (P = 0.005), but there was no significant difference between the two patient groups for Streptococcus pneumoniae or Staphylococcus aureus. Fluorescence in situ hybridization, lectin binding, and the use of antibodies specific for host epithelial cells demonstrated that pathogens were aggregated, surrounded by a carbohydrate matrix, and localized on and within the epithelial cell surface, which is consistent with criteria for bacterial biofilms. PMID:21307211

Raft-like membrane domains in pathogenic microorganisms.

Science.gov (United States)

Farnoud, Amir M; Toledo, Alvaro M; Konopka, James B; Del Poeta, Maurizio; London, Erwin

2015-01-01

The lipid bilayer of the plasma membrane is thought to be compartmentalized by the presence of lipid-protein microdomains. In eukaryotic cells, microdomains composed of sterols and sphingolipids, commonly known as lipid rafts, are believed to exist, and reports on the presence of sterol- or protein-mediated microdomains in bacterial cell membranes are also appearing. Despite increasing attention, little is known about microdomains in the plasma membrane of pathogenic microorganisms. This review attempts to provide an overview of the current state of knowledge of lipid rafts in pathogenic fungi and bacteria. The current literature on characterization of microdomains in pathogens is reviewed, and their potential role in growth, pathogenesis, and drug resistance is discussed. Better insight into the structure and function of membrane microdomains in pathogenic microorganisms might lead to a better understanding of their pathogenesis and development of raft-mediated approaches for therapy. Copyright © 2015 Elsevier Inc. All rights reserved.

B-cell infiltration and frequency of cytokine producing cells differ between localized and disseminated human cutaneous leishmaniases

Directory of Open Access Journals (Sweden)

MGS Vieira

2002-10-01

Full Text Available Biopsies from human localized cutaneous lesions (LCL n = 7 or disseminated lesions (DL n = 8 cases were characterized according to cellular infiltration,frequency of cytokine (IFN-g, TNF-alpha or iNOS enzyme producing cells. LCL, the most usual form of the disease with usually one or two lesions, exhibits extensive tissue damage. DL is a rare form with widespread lesions throughout the body; exhibiting poor parasite containment but less tissue damage. We demonstrated that LCL lesions exhibit higher frequency of B lymphocytes and a higher intensity of IFN-gamma expression. In both forms of the disease CD8+ were found in higher frequency than CD4+ T cells. Frequency of TNF-alpha and iNOS producing cells, as well as the frequency of CD68+ macrophages, did not differ between LCL and DL. Our findings reinforce the link between an efficient control of parasite and tissue damage, implicating higher frequency of IFN-gamma producing cells, as well as its possible counteraction by infiltrated B cells and hence possible humoral immune response in situ.

Swainsonine biosynthesis genes in diverse symbiotic and pathogenic fungi

Science.gov (United States)

Swainsonine, a cytotoxic fungal alkaloid and a potential cancer therapy drug, is produced by the insect pathogen and plant symbiont, Metarhizium robertsii, the clover pathogen Slafractonia leguminicola, locoweed symbionts belonging to Alternaria sect. Undifilum, and a recently discovered morning glo...

Mucin-producing signet ring cell adenoma of the thyroid

Directory of Open Access Journals (Sweden)

Gulwani Hanni

2008-10-01

Full Text Available Signet ring cell adenoma of the thyroid, though rare, is well documented. This change is chiefly due to intracellular accumulation of thyroglobulin that appears mucinous. Awareness of this entity is important as it may closely simulate a metastatic mucin-secreting signet ring cell carcinoma. Although the mucinous material in signet ring cells has been reported to stain positive with thyroglobulin, in some cases it may not be so. We herein describe a rare case of a 46-year-old man who was hypothyroid and the mass removed from the thyroid showed a mucin-producing signet ring cell adenoma of the thyroid.

A novel system of cytoskeletal elements in the human pathogen Helicobacter pylori.

Directory of Open Access Journals (Sweden)

Barbara Waidner

2009-11-01

Full Text Available Pathogenicity of the human pathogen Helicobacter pylori relies upon its capacity to adapt to a hostile environment and to escape from the host response. Therefore, cell shape, motility, and pH homeostasis of these bacteria are specifically adapted to the gastric mucus. We have found that the helical shape of H. pylori depends on coiled coil rich proteins (Ccrp, which form extended filamentous structures in vitro and in vivo, and are differentially required for the maintenance of cell morphology. We have developed an in vivo localization system for this pathogen. Consistent with a cytoskeleton-like structure, Ccrp proteins localized in a regular punctuate and static pattern within H. pylori cells. Ccrp genes show a high degree of sequence variation, which could be the reason for the morphological diversity between H. pylori strains. In contrast to other bacteria, the actin-like MreB protein is dispensable for viability in H. pylori, and does not affect cell shape, but cell length and chromosome segregation. In addition, mreB mutant cells displayed significantly reduced urease activity, and thus compromise a major pathogenicity factor of H. pylori. Our findings reveal that Ccrp proteins, but not MreB, affect cell morphology, while both cytoskeletal components affect the development of pathogenicity factors and/or cell cycle progression.

Factors influencing the microbial safety of fresh produce: a review.

Science.gov (United States)

Olaimat, Amin N; Holley, Richard A

2012-10-01

Increased consumption, larger scale production and more efficient distribution of fresh produce over the past two decades have contributed to an increase in the number of illness outbreaks caused by this commodity. Pathogen contamination of fresh produce may originate before or after harvest, but once contaminated produce is difficult to sanitize. The prospect that some pathogens invade the vascular system of plants and establish "sub-clinical" infection needs to be better understood to enable estimation of its influence upon risk of human illness. Conventional surface sanitation methods can reduce the microbial load, but cannot eliminate pathogens if present. Chlorine dioxide, electrolyzed water, UV light, cold atmospheric plasma, hydrogen peroxide, organic acids and acidified sodium chlorite show promise, but irradiation at 1 kGy in high oxygen atmospheres may prove to be the most effective means to assure elimination of both surface and internal contamination of produce by pathogens. Pathogens of greatest current concern are Salmonella (tomatoes, seed sprouts and spices) and Escherichia coli O157:H7 on leafy greens (spinach and lettuce). This review considers new information on illness outbreaks caused by produce, identifies factors which influence their frequency and size and examines intervention effectiveness. Research needed to increase our understanding of the factors influencing microbial safety of fresh produce is addressed. Copyright © 2012 Elsevier Ltd. All rights reserved.

Generation of a transplantable erythropoietin-producer derived from human mesenchymal stem cells.

Science.gov (United States)

Yokoo, Takashi; Fukui, Akira; Matsumoto, Kei; Ohashi, Toya; Sado, Yoshikazu; Suzuki, Hideaki; Kawamura, Tetsuya; Okabe, Masataka; Hosoya, Tatsuo; Kobayashi, Eiji

2008-06-15

Differentiation of autologous stem cells into functional transplantable tissue for organ regeneration is a promising regenerative therapeutic approach for cancer, diabetes, and many human diseases. Yet to be established, however, is differentiation into tissue capable of producing erythropoietin (EPO), which has a critical function in anemia. We report a novel EPO-producing organ-like structure (organoid) derived from human mesenchymal stem cells. Using our previously established relay culture system, a human mesenchymal stem cell-derived, human EPO-competent organoid was established in rat omentum. The organoid-derived levels of human EPO increased in response to anemia induced by rapid blood withdrawal. In addition, the presence of an organoid in rats suppressed for native (rat) EPO production enhanced recovery from anemia when compared with control animals lacking the organoid. Together these results confirmed the generation of a stem cell-derived organoid that is capable of producing EPO and sensitive to physiological regulation.

Test characteristics of milk amyloid A ELISA, somatic cell count, and bacteriological culture for detection of intramammary pathogens that cause subclinical mastitis.

Science.gov (United States)

Jaeger, S; Virchow, F; Torgerson, P R; Bischoff, M; Biner, B; Hartnack, S; Rüegg, S R

2017-09-01

Bovine mastitis is an important disease in the dairy industry, causing economic losses as a result of withheld milk and treatment costs. Several studies have suggested milk amyloid A (MAA) as a promising biomarker in the diagnosis of mastitis. In the absence of a gold standard for diagnosis of subclinical mastitis, we estimated the diagnostic test accuracy of a commercial MAA-ELISA, somatic cell count (SCC), and bacteriological culture using Bayesian latent class modeling. We divided intramammary infections into 2 classes: those caused by major pathogens (e.g., Escherichia coli, Staphylococcus aureus, streptococci, and lacto-/enterococci) and those caused by all pathogens (major pathogens plus Corynebacterium bovis, coagulase-negative staphylococci, Bacillus spp., Streptomyces spp.). We applied the 3 diagnostic tests to all samples. Of 433 composite milk samples included in this study, 275 (63.5%) contained at least 1 colony of any bacterial species; of those, 56 contained major pathogens and 219 contained minor pathogens. The remaining 158 samples (36.5%) were sterile. We determined 2 different thresholds for the MAA-ELISA using Bayesian latent class modeling: 3.9 µg/mL to detect mastitis caused by major pathogens and 1.6 µg/mL to detect mastitis caused by all pathogens. The optimal SCC threshold for identification of subclinical mastitis was 150,000 cells/mL; this threshold led to higher specificity (Sp) than 100,000 cells/mL. Test accuracy for major-pathogen intramammary infections was as follows: SCC, sensitivity (Se) 92.6% and Sp 72.9%; MAA-ELISA, Se 81.4% and Sp 93.4%; bacteriological culture, Se 23.8% and Sp 95.2%. Test accuracy for all-pathogen intramammary infections was as follows: SCC, sensitivity 90.3% and Sp 71.8%; MAA-ELISA, Se 88.0% and Sp 65.2%; bacteriological culture, Se 83.8% and Sp 54.8%. We suggest the use of SCC and MAA-ELISA as a combined screening procedure for situations such as a Staphylococcus aureus control program. With Bayesian

Quantification of residual host cell DNA in adenoviral vectors produced on PER.C6 cells

NARCIS (Netherlands)

Gijsbers, Linda; Koel, Björn; Weggeman, Miranda; Goudsmit, Jaap; Havenga, Menzo; Marzio, Giuseppe

2005-01-01

Recombinant adenoviral vectors for gene therapy and vaccination are routinely prepared on cultures of immortalized cells, allowing the production of vector batches of high titer and consistent quality. Quantification of residual DNA from the producing cell line is part of the purity tests for

Aflatoxins produced by Aspergillus nomius ASR3, a pathogen isolated from the leaf-cutter ant Atta sexdens rubropilosa

Directory of Open Access Journals (Sweden)

Eduardo Afonso da Silva-Junior

Full Text Available ABSTRACT Aspergillus spp. cause economic impacts due to aflatoxins production. Although the toxicity of aflatoxins is already known, little information about their ecological roles is available. Here we investigated the compounds produced by Aspergillus nomius ASR3 directly from a dead leaf-cutter queen ant Atta sexdens rubropilosa and the fungal axenic culture. Chemical analyses were carried out by high-resolution mass spectrometry and tandem mass spectrometry techniques. Aflatoxins B1 and G1 were detected in both the axenic culture and in the dead leaf-cutter queen ant. The presence of these mycotoxins in the dead leaf-cutter queen ant suggests that these compounds can be related to the insect pathogenicity of A. nomius against A. sexdens rubropilosa.

Programmed death-1 receptor suppresses γ-IFN producing NKT cells in human tuberculosis.

Science.gov (United States)

Singh, Amar; Dey, Aparajit Ballav; Mohan, Anant; Mitra, Dipendra Kumar

2014-05-01

IFN-γ biased Th1 effector immune response is crucial for containment of Mycobacterium tuberculosis infection. Various T cell subsets with regulatory function dictate the generation of Th1 like cells. NKT cells are a specialized T cell subset known to be activated early in immune response and control T cell response via release of immunoregulatory cytokines like IFN-γ, IL-4 and IL-10. M. tuberculosis, with abundance of its cell wall lipids may potently activate NKT cells resulting in cytokine production and PD-1 expression. In this study, among 49 treatment naive active pulmonary tuberculosis patients, we found a higher percentage of PD1(+) NKT cells correlating with sputum bacillary load. Furthermore, blocking PD-1 increased the number of IFN-γ producing NKT cells by inhibiting their apoptosis. Moreover, peripheral frequency of NKT cells declined with therapy suggesting their role in host T cell response. In this study, we concluded that PD-1 preferentially induces apoptosis of IFN-γ producing NKT cells while sparing NKT cells that produce IL-4. Such a polarized NKT cell function may impose a Th2 bias on the ensuing effector T cell response leading to inefficient clearance of M. tuberculosis. Inhibiting PD-1 may therefore alter the T cell response in favor of the host by rescuing type 1 NKT cells from apoptosis and boosting Th1 effector T cell functions against M. tuberculosis. Copyright © 2014 Elsevier Ltd. All rights reserved.

Reactive oxygen species, essential molecules, during plant-pathogen interactions.

Science.gov (United States)

Camejo, Daymi; Guzmán-Cedeño, Ángel; Moreno, Alexander

2016-06-01

Reactive oxygen species (ROS) are continually generated as a consequence of the normal metabolism in aerobic organisms. Accumulation and release of ROS into cell take place in response to a wide variety of adverse environmental conditions including salt, temperature, cold stresses and pathogen attack, among others. In plants, peroxidases class III, NADPH oxidase (NOX) locates in cell wall and plasma membrane, respectively, may be mainly enzymatic systems involving ROS generation. It is well documented that ROS play a dual role into cells, acting as important signal transduction molecules and as toxic molecules with strong oxidant power, however some aspects related to its function during plant-pathogen interactions remain unclear. This review focuses on the principal enzymatic systems involving ROS generation addressing the role of ROS as signal molecules during plant-pathogen interactions. We described how the chloroplasts, mitochondria and peroxisomes perceive the external stimuli as pathogen invasion, and trigger resistance response using ROS as signal molecule. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

From Human Mesenchymal Stem Cells to Insulin-Producing Cells: Comparison between Bone Marrow- and Adipose Tissue-Derived Cells.

Science.gov (United States)

Gabr, Mahmoud M; Zakaria, Mahmoud M; Refaie, Ayman F; Abdel-Rahman, Engy A; Reda, Asmaa M; Ali, Sameh S; Khater, Sherry M; Ashamallah, Sylvia A; Ismail, Amani M; Ismail, Hossam El-Din A; El-Badri, Nagwa; Ghoneim, Mohamed A

2017-01-01

The aim of this study is to compare human bone marrow-derived mesenchymal stem cells (BM-MSCs) and adipose tissue-derived mesenchymal stem cells (AT-MSCs), for their differentiation potentials to form insulin-producing cells. BM-MSCs were obtained during elective orthotopic surgery and AT-MSCs from fatty aspirates during elective cosmetics procedures. Following their expansion, cells were characterized by phenotyping, trilineage differentiation ability, and basal gene expression of pluripotency genes and for their metabolic characteristics. Cells were differentiated according to a Trichostatin-A based protocol. The differentiated cells were evaluated by immunocytochemistry staining for insulin and c-peptide. In addition the expression of relevant pancreatic endocrine genes was determined. The release of insulin and c-peptide in response to a glucose challenge was also quantitated. There were some differences in basal gene expression and metabolic characteristics. After differentiation the proportion of the resulting insulin-producing cells (IPCs), was comparable among both cell sources. Again, there were no differences neither in the levels of gene expression nor in the amounts of insulin and c-peptide release as a function of glucose challenge. The properties, availability, and abundance of AT-MSCs render them well-suited for applications in regenerative medicine. Conclusion . BM-MSCs and AT-MSCs are comparable regarding their differential potential to form IPCs. The availability and properties of AT-MSCs render them well-suited for applications in regenerative medicine.

Effect of Producing Different Phenazines on Bacterial Fitness and Biological Control in Pseudomonas chlororaphis 30-84

Directory of Open Access Journals (Sweden)

Jun Myoung Yu

2018-02-01

Full Text Available Pseudomonas chlororaphis 30-84 is a biological control agent selected for its ability to suppress diseases caused by fungal pathogens. P. chlororaphis 30-84 produces three phenazines: phenazine-1-carboxylic acid (PCA, 2-hydroxy-phenazine-1-carboxylic acid (2OHPCA and a small amount of 2-hydroxy-phenazine (2OHPHZ, and these are required for fungal pathogen inhibition and wheat rhizosphere competence. The two, 2-hydroxy derivatives are produced from PCA via the activity of a phenazine-modifying enzyme encoded by phzO. In addition to the seven biosynthetic genes responsible for the production of PCA, many other Pseudomonas strains possess one or more modifying genes, which encode enzymes that act independently or together to convert PCA into other phenazine derivatives. In order to understand the fitness effects of producing different phenazines, we constructed isogenic derivatives of P. chlororaphis 30-84 that differed only in the type of phenazines produced. Altering the type of phenazines produced by P. chlororaphis 30-84 enhanced the spectrum of fungal pathogens inhibited and altered the degree of take-all disease suppression. These strains also differed in their ability to promote extracellular DNA release, which may contribute to the observed differences in the amount of biofilm produced. All derivatives were equally important for survival over repeated plant/harvest cycles, indicating that the type of phenazines produced is less important for persistence in the wheat rhizosphere than whether or not cells produce phenazines. These findings provide a better understanding of the effects of different phenazines on functions important for biological control activity with implications for applications that rely on introduced or native phenazine producing populations.

High prevalence of extended-spectrum β-lactamase-producing pathogens: results of a surveillance study in two hospitals in Ujjain, India

Directory of Open Access Journals (Sweden)

Pathak A

2012-04-01

Full Text Available Ashish Pathak1,2, Yogyata Marothi3, Vandana Kekre4, Kalpana Mahadik5, Ragini Macaden6, Cecilia Stålsby Lundborg11Division of Global Health, Department of Public Health Sciences, Karolinska Institutet, Stockholm, Sweden; 2Department of Pediatrics, 3Department of Microbiology, 4Department of Medicine, 5Department of Obstetrics and Gynecology, RD Gardi Medical College, Ujjain, India; 6St Johns Research Institute, Bangalore, IndiaBackground: Recent reports of the rapid evolution of bacterial resistance in India require urgent antibiotic stewardship programs. This study aimed to define the magnitude and pattern of resistance of bacterial pathogens to guide empirical therapy.Methods: We prospectively collected consecutive, clinically significant, and nonduplicate bacterial isolates from each patient from two hospitals in Ujjain, India. The antibiotic susceptibility of the bacteria was tested using a disc diffusion method as recommended by the Clinical and Laboratory Standards Institute.Results: A total of 716 pathogens were isolated from 2568 patients (median age, 25 years; range, 0 days to 92 years. Gram-negative infections were predominant (62%. The isolated pathogens included Staphylococcus aureus (n = 221; 31%, Escherichia coli (n = 149; 21%, Pseudomonas aeruginosa (n = 127; 18%, and Klebsiella pneumoniae (n = 107; 15%. Common diagnoses included abscesses (56%, urinary tract infections (14%, blood stream infections (10%, pneumonia (10%, and vaginal infections (10%. In E. coli isolates, 69% (95% confidence interval [CI] 61.6–76.6 were extended-spectrum β-lactamase (ESBL producers and 41% (95% CI 31.6–50.5 of K. pneumoniae isolates were ESBL producers. These isolates had a high resistance to fluoroquinolones and β-lactams, except for imipenem and piperacillin-tazobactam. Salmonella typhi remained sensitive to third-generation cephalosporins. Methicillin-resistant S. aureus (MRSA constituted 30% of all S. aureus isolates and showed resistance

The apolipoprotein L family of programmed cell death and immunity genes rapidly evolved in primates at discrete sites of host-pathogen interactions.

Science.gov (United States)

Smith, Eric E; Malik, Harmit S

2009-05-01

Apolipoprotein L1 (APOL1) is a human protein that confers immunity to Trypanosoma brucei infections but can be countered by a trypanosome-encoded antagonist SRA. APOL1 belongs to a family of programmed cell death genes whose proteins can initiate host apoptosis or autophagic death. We report here that all six members of the APOL gene family (APOL1-6) present in humans have rapidly evolved in simian primates. APOL6, furthermore, shows evidence of an adaptive sweep during recent human evolution. In each APOL gene tested, we found rapidly evolving codons in or adjacent to the SRA-interacting protein domain (SID), which is the domain of APOL1 that interacts with SRA. In APOL6, we also found a rapidly changing 13-amino-acid cluster in the membrane-addressing domain (MAD), which putatively functions as a pH sensor and regulator of cell death. We predict that APOL genes are antagonized by pathogens by at least two distinct mechanisms: SID antagonists, which include SRA, that interact with the SID of various APOL proteins, and MAD antagonists that interact with the MAD hinge base of APOL6. These antagonists either block or prematurely cause APOL-mediated programmed cell death of host cells to benefit the infecting pathogen. These putative interactions must occur inside host cells, in contrast to secreted APOL1 that trafficks to the trypanosome lysosome. Hence, the dynamic APOL gene family appears to be an important link between programmed cell death of host cells and immunity to pathogens.

Comparative analysis of lipopolysaccharides of pathogenic and intermediately pathogenic Leptospira species.

Science.gov (United States)

Patra, Kailash P; Choudhury, Biswa; Matthias, Michael M; Baga, Sheyenne; Bandyopadhya, Keya; Vinetz, Joseph M

2015-10-30

Lipopolysaccharides (LPS) are complex, amphipathic biomolecules that constitute the major surface component of Gram-negative bacteria. Leptospira, unlike other human-pathogenic spirochetes, produce LPS, which is fundamental to the taxonomy of the genus, involved in host-adaption and also the target of diagnostic antibodies. Despite its significance, little is known of Leptospira LPS composition and carbohydrate structure among different serovars. LPS from Leptospira interrogans serovar Copenhageni strain L1-130, a pathogenic species, and L. licerasiae serovar Varillal strain VAR 010, an intermediately pathogenic species, were studied. LPS prepared from aqueous and phenol phases were analyzed separately. L. interrogans serovar Copenhageni has additional sugars not found in L. licerasiae serovar Varillal, including fucose (2.7%), a high amount of GlcNAc (12.3%), and two different types of dideoxy HexNAc. SDS-PAGE indicated that L. interrogans serovar Copenhageni LPS had a far higher molecular weight and complexity than that of L. licerasiae serovar Varillal. Chemical composition showed that L. interrogans serovar Copenhageni LPS has an extended O-antigenic polysaccharide consisting of sugars, not present in L. licerasiae serovar Varillal. Arabinose, xylose, mannose, galactose and L-glycero-D-mannoheptose were detected in both the species. Fatty acid analysis by gas chromatography-mass spectrometry (GC-MS) showed the presence of hydroxypalmitate (3-OH-C16:0) only in L. interrogans serovar Copenhageni. Negative staining electron microscopic examination of LPS showed different filamentous morphologies in L. interrogans serovar Copenhageni vs. L. licerasiae serovar Varillal. This comparative biochemical analysis of pathogenic and intermediately pathogenic Leptospira LPS reveals important carbohydrate and lipid differences that underlie future work in understanding the mechanisms of host-adaptation, pathogenicity and vaccine development in leptospirosis.

Downregulation of IL-17-producing T cells is associated with regulatory T cell expansion and disease progression in chronic lymphocytic leukemia.

Science.gov (United States)

Jadidi-Niaragh, Farhad; Ghalamfarsa, Ghasem; Memarian, Ali; Asgarian-Omran, Hossein; Razavi, Seyed Mohsen; Sarrafnejad, Abdolfattah; Shokri, Fazel

2013-04-01

Little is known about the immunobiology of interleukin-17 (IL-17)-producing T cells and regulatory T cells (Treg) in chronic lymphocytic leukemia (CLL). In this study, the frequencies of Th17, Tc17, and CD39(+) Treg cells were enumerated in peripheral T cells isolated from 40 CLL patients and 15 normal subjects by flow cytometry. Our results showed a lower frequency of Th17 and Tc17 cells in progressive (0.99 ± 0.12 % of total CD3(+)CD4(+) cells; 0.44 ± 0.09 % of total CD8(+) cells) compared to indolent patients (1.57 ± 0.24 %, p = 0.042; 0.82 ± 0.2 %, p = 0.09) and normal subjects (1.78 ± 0.2 %, p = 0.003; 0.71 ± 0.09 %, p = 0.04). Decrease in IL-17-producing T cells was associated with CD39(+) Treg cells expansion. Variation of IL-17-producing cells and Treg cells in indolent and progressive patients was neither associated to the expression levels of Th1- and Th2-specific transcription factors T-bet and GATA-3 nor to the frequencies of IFN-γ and IL-4-producing CD4(+) T cells in a selected number of samples. Additionally, suppressive potential of CD4(+) Treg was similar in CLL patients and normal subjects. Our data indicate that progression of CLL is associated with downregulation of IL-17-producing T cells and expansion of Treg cells, implying contribution of these subsets of T cells in the progression of CLL.

The Role of Pathogenic Autoantibodies in Autoimmunity

Directory of Open Access Journals (Sweden)

Merrill J. Rowley

2015-11-01

Full Text Available The serological presence of autoantibodies is diagnostic of autoimmunity, and these autoantibodies may be present for many years before the presentation of autoimmune disease (AID. Although a pathogenic role has been demonstrated for various autoantibodies reactive with cell surface and extracellular autoantigens, studies using monoclonal antibodies (mAb show not all antibodies in the polyclonal response are pathogenic. Differences depend on Fab-mediated diversity in epitope specificity, Fc-mediated effects based on immunoglobulin (Ig class and subclass, activation of complement, and the milieu in which the reaction occurs. These autoantibodies often occur in organ-specific AID and this review illustrates their pathogenic and highly specific effects. The role of autoantibodies associated with intracellular antigens is less clear. In vitro they may inhibit or adversely affect well-defined intracellular biochemical pathways, yet, in vivo they are separated from their autoantigens by multiple cellular barriers. Recent evidence that Ig can traverse cell membranes, interact with intracellular proteins, and induce apoptosis has provided new evidence for a pathogenic role for such autoantibodies. An understanding of how autoantibodies behave in the polyclonal response and their role in pathogenesis of AID may help identify populations of culprit B-cells and selection of treatments that suppress or eliminate them.

Embryonic stem-like cells derived from in vitro produced bovine blastocysts

Directory of Open Access Journals (Sweden)

Erika Regina Leal de Freitas

2011-06-01

Full Text Available The aim of this work was to study the derivation of bovine embryonic stem-like (ES-like cells from the inner cell mass (ICM of in vitro produced blastocysts. The ICMs were mechanically isolated and six out of seventeen (35% ICMs could attach to a monolayer of murine embryonic fibroblasts (MEF. Ten days after, primary outgrowths were mechanically dissected into several small clumps and transferred to a new MEF layer. Cells were further propagated and passaged by physical dissociation over a 60 days period. The pluripotency of the bovine ES-like cells was confirmed by RT-PCR of Oct-4 and STAT-3 gene markers. The colonies were weakly stained for alkaline phosphatase and the mesoderm and endoderm differentiation gene markers such as GATA-4 and Flk-1, respectively, were not expressed. Embryoid bodies were spontaneously formed at the seventh passage. Results showed that bovine ES-like cells could be obtained and passaged by mechanical procedures from the fresh in vitro produced blastocysts.

Identification and characterization of smallest pore-forming protein in the cell wall of pathogenic Corynebacterium urealyticum DSM 7109.

Science.gov (United States)

Abdali, Narges; Younas, Farhan; Mafakheri, Samaneh; Pothula, Karunakar R; Kleinekathöfer, Ulrich; Tauch, Andreas; Benz, Roland

2018-05-09

Corynebacterium urealyticum, a pathogenic, multidrug resistant member of the mycolata, is known as causative agent of urinary tract infections although it is a bacterium of the skin flora. This pathogenic bacterium shares with the mycolata the property of having an unusual cell envelope composition and architecture, typical for the genus Corynebacterium. The cell wall of members of the mycolata contains channel-forming proteins for the uptake of solutes. In this study, we provide novel information on the identification and characterization of a pore-forming protein in the cell wall of C. urealyticum DSM 7109. Detergent extracts of whole C. urealyticum cultures formed in lipid bilayer membranes slightly cation-selective pores with a single-channel conductance of 1.75 nS in 1 M KCl. Experiments with different salts and non-electrolytes suggested that the cell wall pore of C. urealyticum is wide and water-filled and has a diameter of about 1.8 nm. Molecular modelling and dynamics has been performed to obtain a model of the pore. For the search of the gene coding for the cell wall pore of C. urealyticum we looked in the known genome of C. urealyticum for a similar chromosomal localization of the porin gene to known porH and porA genes of other Corynebacterium strains. Three genes are located between the genes coding for GroEL2 and polyphosphate kinase (PKK2). Two of the genes (cur_1714 and cur_1715) were expressed in different constructs in C. glutamicum ΔporAΔporH and in porin-deficient BL21 DE3 Omp8 E. coli strains. The results suggested that the gene cur_1714 codes alone for the cell wall channel. The cell wall porin of C. urealyticum termed PorACur was purified to homogeneity using different biochemical methods and had an apparent molecular mass of about 4 kDa on tricine-containing sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Biophysical characterization of the purified protein (PorACur) suggested indeed that cur_1714 is the gene

Ultraviolet-Mediated Activation of Photo toxins from Peganum Harmala L. Seedlings to Control both Human-and Phyto-Pathogenic Microorganisms and Tumor Cells

International Nuclear Information System (INIS)

Kord, M.; Khafagi, I.; Dewedar, A.

2003-01-01

The medicinal plant Peganum harmala L. (zygophyllaceae) contains a number of Beta-carboline alkaloids, which are photosensitizers to bacteria, yeasts and eukaryotic cells in the presence of sunlight and artificial sources of long-wave UV radiation (365 nm). Ultraviolet irradiation of ten-day old aseptically germinated Peganum harmala inoculated on bacterial and yeast bioassay plates elicits strong phototoxic antimicrobials. Callus as well as crude methanol extracts of in vitro cultures were also investigated for the accumulation of photosensitizers. High performance liquid chromatographic analyses of irradiated and control tissues followed by fluorescent detection at 302 nm revealed the formation of serotonin (5-hydroxytryptamine) in irradiated tissues only. Eluted compounds detected at 330 nm revealed more than ten-fold accumulation of harmine, isoharmine and harmol in irradiated tissues. Moreover, several simple beta-carboline alkaloids were produced through irradiation with UV such as harmalanine and harmalacidine. UV-induced phototoxicity was proven against phyto pathogenic bacteria and human-pathogenic bacteria and yeasts. Photo-induced cytotoxicity was observed from two different toxicity bioassays, which are Artemia saline and potato discs tumor assay. The selective UV-dependent biological activities may imply a pharmacological potential of Peganum harmala in the control of infectious diseases and tumor tissues

Cerebellar stem cells do not produce neurons and astrocytes in adult mouse

International Nuclear Information System (INIS)

Su, Xin; Guan, Wuqiang; Yu, Yong-Chun; Fu, Yinghui

2014-01-01

Highlights: • No new neurons and astrocytes are generated in adult mouse cerebellum. • Very few mash1 + or nestin + stem cells exist, and most of them are quiescent. • Cell proliferation rate is diversified among cerebellar regions and decreases over time. - Abstract: Although previous studies implied that cerebellar stem cells exist in some adult mammals, little is known about whether these stem cells can produce new neurons and astrocytes. In this study by bromodeoxyuridine (BrdU) intraperitoneal (i.p.) injection, we found that there are abundant BrdU + cells in adult mouse cerebellum, and their quantity and density decreases significantly over time. We also found cell proliferation rate is diversified in different cerebellar regions. Among these BrdU + cells, very few are mash1 + or nestin + stem cells, and the vast majority of cerebellar stem cells are quiescent. Data obtained by in vivo retrovirus injection indicate that stem cells do not produce neurons and astrocytes in adult mouse cerebellum. Instead, some cells labeled by retrovirus are Iba1 + microglia. These results indicate that very few stem cells exist in adult mouse cerebellum, and none of these stem cells contribute to neurogenesis and astrogenesis under physiological condition

Enhanced production and isotope enrichment of recombinant glycoproteins produced in cultured mammalian cells

Energy Technology Data Exchange (ETDEWEB)

Skelton, David; Goodyear, Abbey [Florida State University, Department of Chemistry and Biochemistry (United States); Ni, DaQun; Walton, Wendy J.; Rolle, Myron; Hare, Joan T. [Florida State University, Institute of Molecular Biophysics (United States); Logan, Timothy M., E-mail: tlogan@fsu.ed [Florida State University, Department of Chemistry and Biochemistry (United States)

2010-10-15

NMR studies of post-translationally modified proteins are complicated by the lack of an efficient method to produce isotope enriched recombinant proteins in cultured mammalian cells. We show that reducing the glucose concentration and substituting glutamate for glutamine in serum-free medium increased cell viability while simultaneously increasing recombinant protein yield and the enrichment of non-essential amino acids compared to culture in unmodified, serum-free medium. Adding dichloroacetate, a pyruvate dehydrogenase kinase inhibitor, further improves cell viability, recombinant protein yield, and isotope enrichment. We demonstrate the method by producing partially enriched recombinant Thy1 glycoprotein from Lec1 Chinese hamster ovary (CHO) cells using U-{sup 13}C-glucose and {sup 15}N-glutamate as labeled precursors. This study suggests that uniformly {sup 15}N,{sup 13}C-labeled recombinant proteins may be produced in cultured mammalian cells starting from a mixture of labeled essential amino acids, glucose, and glutamate.

Enhanced production and isotope enrichment of recombinant glycoproteins produced in cultured mammalian cells

International Nuclear Information System (INIS)

Skelton, David; Goodyear, Abbey; Ni, DaQun; Walton, Wendy J.; Rolle, Myron; Hare, Joan T.; Logan, Timothy M.

2010-01-01

NMR studies of post-translationally modified proteins are complicated by the lack of an efficient method to produce isotope enriched recombinant proteins in cultured mammalian cells. We show that reducing the glucose concentration and substituting glutamate for glutamine in serum-free medium increased cell viability while simultaneously increasing recombinant protein yield and the enrichment of non-essential amino acids compared to culture in unmodified, serum-free medium. Adding dichloroacetate, a pyruvate dehydrogenase kinase inhibitor, further improves cell viability, recombinant protein yield, and isotope enrichment. We demonstrate the method by producing partially enriched recombinant Thy1 glycoprotein from Lec1 Chinese hamster ovary (CHO) cells using U- 13 C-glucose and 15 N-glutamate as labeled precursors. This study suggests that uniformly 15 N, 13 C-labeled recombinant proteins may be produced in cultured mammalian cells starting from a mixture of labeled essential amino acids, glucose, and glutamate.

Calcineurin orchestrates dimorphic transitions, antifungal drug responses and host-pathogen interactions of the pathogenic mucoralean fungus Mucor circinelloides.

Science.gov (United States)

Lee, Soo Chan; Li, Alicia; Calo, Silvia; Inoue, Makoto; Tonthat, Nam K; Bain, Judith M; Louw, Johanna; Shinohara, Mari L; Erwig, Lars P; Schumacher, Maria A; Ko, Dennis C; Heitman, Joseph

2015-09-01

Calcineurin plays essential roles in virulence and growth of pathogenic fungi and is a target of the natural products FK506 and Cyclosporine A. In the pathogenic mucoralean fungus Mucor circinelloides, calcineurin mutation or inhibition confers a yeast-locked phenotype indicating that calcineurin governs the dimorphic transition. Genetic analysis in this study reveals that two calcineurin A catalytic subunits (out of three) are functionally diverged. Homology modeling illustrates modes of resistance resulting from amino substitutions in the interface between each calcineurin subunit and the inhibitory drugs. In addition, we show how the dimorphic transition orchestrated by calcineurin programs different outcomes during host-pathogen interactions. For example, when macrophages phagocytose Mucor yeast, subsequent phagosomal maturation occurs, indicating host cells respond appropriately to control the pathogen. On the other hand, upon phagocytosis of spores, macrophages fail to form mature phagosomes. Cytokine production from immune cells differs following exposure to yeast versus spores (which germinate into hyphae). Thus, the morphogenic transition can be targeted as an efficient treatment option against Mucor infection. In addition, genetic analysis (including gene disruption and mutational studies) further strengthens the understanding of calcineurin and provides a foundation to develop antifungal agents targeting calcineurin to deploy against Mucor and other pathogenic fungi. © 2015 John Wiley & Sons Ltd.

Ebola virus-like particles produced in insect cells exhibit dendritic cell stimulating activity and induce neutralizing antibodies

International Nuclear Information System (INIS)

Ye Ling; Lin Jianguo; Sun Yuliang; Bennouna, Soumaya; Lo, Michael; Wu Qingyang; Bu Zhigao; Pulendran, Bali; Compans, Richard W.; Yang Chinglai

2006-01-01

Recombinant baculoviruses (rBV) expressing Ebola virus VP40 (rBV-VP40) or GP (rBV-GP) proteins were generated. Infection of Sf9 insect cells by rBV-VP40 led to assembly and budding of filamentous particles from the cell surface as shown by electron microscopy. Ebola virus-like particles (VLPs) were produced by coinfection of Sf9 cells with rBV-VP40 and rBV-GP, and incorporation of Ebola GP into VLPs was demonstrated by SDS-PAGE and Western blot analysis. Recombinant baculovirus infection of insect cells yielded high levels of VLPs, which were shown to stimulate cytokine secretion from human dendritic cells similar to VLPs produced in mammalian cells. The immunogenicity of Ebola VLPs produced in insect cells was evaluated by immunization of mice. Analysis of antibody responses showed that most of the GP-specific antibodies were of the IgG2a subtype, while no significant level of IgG1 subtype antibodies specific for GP was induced, indicating the induction of a Th1-biased immune response. Furthermore, sera from Ebola VLP immunized mice were able to block infection by Ebola GP pseudotyped HIV virus in a single round infection assay, indicating that a neutralizing antibody against the Ebola GP protein was induced. These results show that production of Ebola VLPs in insect cells using recombinant baculoviruses represents a promising approach for vaccine development against Ebola virus infection

Comparison of the virulence of exopolysaccharide-producing Prevotella intermedia to exopolysaccharide non-producing periodontopathic organisms.

Science.gov (United States)

Yamanaka, Takeshi; Yamane, Kazuyoshi; Furukawa, Tomoyo; Matsumoto-Mashimo, Chiho; Sugimori, Chieko; Nambu, Takayuki; Obata, Noboru; Walker, Clay B; Leung, Kai-Poon; Fukushima, Hisanori

2011-08-25

Evidence in the literature suggests that exopolysaccharides (EPS) produced by bacterial cells are essential for the expression of virulence in these organisms. Secreted EPSs form the framework in which microbial biofilms are built. This study evaluates the role of EPS in Prevotella intermedia for the expression of virulence. This evaluation was accomplished by comparing EPS-producing P. intermedia strains 17 and OD1-16 with non-producing P. intermedia ATCC 25611 and Porphyromonas gingivalis strains ATCC 33277, 381 and W83 for their ability to induce abscess formation in mice and evade phagocytosis. EPS-producing P. intermedia strains 17 and OD1-16 induced highly noticeable abscess lesions in mice at 107 colony-forming units (CFU). In comparison, P. intermedia ATCC 25611 and P. gingivalis ATCC 33277, 381 and W83, which all lacked the ability to produce viscous materials, required 100-fold more bacteria (109 CFU) in order to induce detectable abscess lesions in mice. Regarding antiphagocytic activity, P. intermedia strains 17 and OD1-16 were rarely internalized by human polymorphonuclear leukocytes, but other strains were readily engulfed and detected in the phagosomes of these phagocytes. These results demonstrate that the production of EPS by P. intermedia strains 17 and OD1-16 could contribute to the pathogenicity of this organism by conferring their ability to evade the host's innate defence response.

Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence

Energy Technology Data Exchange (ETDEWEB)

Manning, Viola A.; Pandelova, Iovanna; Dhillon, Braham; Wilhelm, Larry J.; Goodwin, Stephen B.; Berlin, Aaron M.; Figueroa, Melania; Freitag, Michael; Hane, James K.; Henrissat, Bernard; Holman, Wade H.; Kodira, Chinnappa D.; Martin, Joel; Oliver, Richard P.; Robbertse, Barbara; Schackwitz, Wendy; Schwartz, David C.; Spatafora, Joseph W.; Turgeon, B. Gillian; Yandava, Chandri; Young, Sarah; Zhou, Shiguo; Zeng, Qiandong; Grigoriev, Igor V.; Ma, Li-Jun; Ciuffetti, Lynda M.

2012-08-16

Pyrenophora tritici-repentis is a necrotrophic fungus causal to the disease tan spot of wheat, whose contribution to crop loss has increased significantly during the last few decades. Pathogenicity by this fungus is attributed to the production of host-selective toxins (HST), which are recognized by their host in a genotype-specific manner. To better understand the mechanisms that have led to the increase in disease incidence related to this pathogen, we sequenced the genomes of three P. tritici-repentis isolates. A pathogenic isolate that produces two known HSTs was used to assemble a reference nuclear genome of approximately 40 Mb composed of 11 chromosomes that encode 12,141 predicted genes. Comparison of the reference genome with those of a pathogenic isolate that produces a third HST, and a nonpathogenic isolate, showed the nonpathogen genome to be more diverged than those of the two pathogens. Examination of gene-coding regions has provided candidate pathogen-specific proteins and revealed gene families that may play a role in a necrotrophic lifestyle. Analysis of transposable elements suggests that their presence in the genome of pathogenic isolates contributes to the creation of novel genes, effector diversification, possible horizontal gene transfer events, identified copy number variation, and the first example of transduplication by DNA transposable elements in fungi. Overall, comparative analysis of these genomes provides evidence that pathogenicity in this species arose through an influx of transposable elements, which created a genetically flexible landscape that can easily respond to environmental changes.

Molecular mimicry modulates plant host responses to pathogens.

Science.gov (United States)

Ronald, Pamela; Joe, Anna

2018-01-25

Pathogens often secrete molecules that mimic those present in the plant host. Recent studies indicate that some of these molecules mimic plant hormones required for development and immunity. This Viewpoint reviews the literature on microbial molecules produced by plant pathogens that functionally mimic molecules present in the plant host. This article includes examples from nematodes, bacteria and fungi with emphasis on RaxX, a microbial protein produced by the bacterial pathogen Xanthomonas oryzae pv. oryzae. RaxX mimics a plant peptide hormone, PSY (plant peptide containing sulphated tyrosine). The rice immune receptor XA21 detects sulphated RaxX but not the endogenous peptide PSY. Studies of the RaxX/XA21 system have provided insight into both host and pathogen biology and offered a framework for future work directed at understanding how XA21 and the PSY receptor(s) can be differentially activated by RaxX and endogenous PSY peptides. © The Author 2017. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Aquaporins facilitate hydrogen peroxide entry into guard cells to mediate ABA- and pathogen-triggered stomatal closure.

Science.gov (United States)

Rodrigues, Olivier; Reshetnyak, Ganna; Grondin, Alexandre; Saijo, Yusuke; Leonhardt, Nathalie; Maurel, Christophe; Verdoucq, Lionel

2017-08-22

Stomatal movements are crucial for the control of plant water status and protection against pathogens. Assays on epidermal peels revealed that, similar to abscisic acid (ABA), pathogen-associated molecular pattern (PAMP) flg22 requires the At PIP2;1 aquaporin to induce stomatal closure. Flg22 also induced an increase in osmotic water permeability ( P f ) of guard cell protoplasts through activation of At PIP2;1. The use of HyPer, a genetic probe for intracellular hydrogen peroxide (H 2 O 2 ), revealed that both ABA and flg22 triggered an accumulation of H 2 O 2 in wild-type but not pip2;1 guard cells. Pretreatment of guard cells with flg22 or ABA facilitated the influx of exogenous H 2 O 2 Brassinosteroid insensitive 1-associated receptor kinase 1 (BAK1) and open stomata 1 (OST1)/Snf1-related protein kinase 2.6 (SnRK2.6) were both necessary to flg22-induced P f and both phosphorylated At PIP2;1 on Ser121 in vitro. Accumulation of H 2 O 2 and stomatal closure as induced by flg22 was restored in pip2;1 guard cells by a phosphomimetic form (Ser121Asp) but not by a phosphodeficient form (Ser121Ala) of At PIP2;1. We propose a mechanism whereby phosphorylation of At PIP2;1 Ser121 by BAK1 and/or OST1 is triggered in response to flg22 to activate its water and H 2 O 2 transport activities. This work establishes a signaling role of plasma membrane aquaporins in guard cells and potentially in other cellular context involving H 2 O 2 signaling.

Investigating the Swimming of Microbial Pathogens Using Digital Holography.

Science.gov (United States)

Thornton, K L; Findlay, R C; Walrad, P B; Wilson, L G

2016-01-01

To understand much of the behaviour of microbial pathogens, it is necessary to image living cells, their interactions with each other and with host cells. Species such as Escherichia coli are difficult subjects to image: they are typically microscopic, colourless and transparent. Traditional cell visualisation techniques such as fluorescent tagging or phase-contrast microscopy give excellent information on cell behaviour in two dimensions, but no information about cells moving in three dimensions. We review the use of digital holographic microscopy for three-dimensional imaging at high speeds, and demonstrate its use for capturing the shape and swimming behaviour of three important model pathogens: E. coli, Plasmodium spp. and Leishmania spp.

Life history tradeoffs of pathogens and the treatment principle of antibiogenesis

Directory of Open Access Journals (Sweden)

Rui-An Wang

2017-09-01

Full Text Available There are no eternal individual lives so life continues by relaying with reproduction. Consequently, lifespan and fecundity are two essential genetic traits of life. The life history tradeoffs theory holds that there is an inverse relationship between lifespan and fecundity. This paper proposes two new concepts, i.e., “lifespan of pathogens” and treatment of infections by “antibiogenesis”. The lifespan of pathogens is the time limitation of those tiny lives just as other large creatures. Notably, the lifespan of bacterium is the time interval from the cell division by which it is produced to next division by then its life ends and transforms to two new lives, or dies. Antibiogenesis means inhibiting generation of new lives. By the principle of life history tradeoffs, the lifespan of pathogens determines the speed of their proliferations and consequently the modality of infection. The treatment principle of antibiogenesis requires the duration of treatment to be determined by the lifespan of infected pathogens. The life history tradeoffs theory and the two concepts are helpful to understanding the pathobiology and shaping the clinical aspects of infectious diseases.

Do we really need to differentiate mesenchymal stem cells into insulin-producing cells for attenuation of the autoimmune responses in type 1 diabetes: immunoprophylactic effects of precursors to insulin-producing cells.

Science.gov (United States)

Sharma, Anshu; Rani, Rajni

2017-07-12

Type 1 diabetes (T1D) is a multifactorial autoimmune disorder where pancreatic beta cells are lost before the clinical manifestations of the disease. Administration of mesenchymal stem cells (MSCs) or MSCs differentiated into insulin-producing cells (IPCs) have yielded limited success when used therapeutically. We have evaluated the immunoprophylactic potentials of precursors to insulin-producing cells (pIPCs) and IPCs in nonobese diabetic (NOD) mice to ask a basic question: do we need to differentiate MSCs into IPCs or will pIPCs suffice to attenuate autoimmune responses in T1D? Bone marrow-derived MSCs from Balb/c mice were characterized following the International Society for Cellular Therapy (ISCT) guidelines. MSCs cultured in high-glucose media for 11 to 13 passages were characterized for the expression of pancreatic lineage genes using real-time polymerase chain reaction. Expression of the PDX1 gene in pIPCs was assessed using Western blot and fluorescence-activated cell sorting (FACS). Triple-positive MSCs were differentiated into IPCs using a three-step protocol after sorting them for cell surface markers, i.e. CD29, CD44, and SCA-1. Nonobese diabetic mice were administered pIPCs, IPCs, or phosphate-buffered saline (PBS) into the tail vein at weeks 9 or 10 and followed-up for 29-30 weeks for fasting blood glucose levels. Two consecutive blood sugar levels of more than 250 mg/dl were considered diabetic. MSCs grown in high-glucose media for 11 to 13 passages expressed genes of the pancreatic lineage such as PDX1, beta2, neurogenin, PAX4, Insulin, and glucagon. Furthermore, Western blot and FACS analysis for PDX-1, a transcription factor necessary for beta cell maturation, confirmed that these cells were precursors of insulin-producing cells (pIPCs). NOD mice administered with pIPCs were better protected from developing diabetes with a protective efficacy of 78.4% (p cells seem to have better potential to arrest autoimmune response in type 1 diabetes when

Phenotypic and genotypic characteristics of enterocin producing enterococci against pathogenic bacteria

OpenAIRE

Sandra Mojsova; Kiril Krstevski; Igor Dzadzovski; Zagorka Popova; Pavle Sekulovski

2015-01-01

The study investigated the antimicrobial activity of 13 enterococcal strains (E. faecalis -8, E. faecium-2, E. hirae-2, E. spp.-1) isolated from our traditional cheeses against pathogen microorganisms. Also, it includes the detection of the following enterocin structural genes: enterocin A, enterocin B, enterocin P, enterocin L50A/B, bacteriocin 31, enterocin AS48, enterocin Q, enterocin EJ97 and cytolysin by using PCR method. All isolates inhibited growth of L. monocytogenes and L.innocua...

CD4(+) T cells producing interleukin (IL)-17, IL-22 and interferon-? are major effector T cells in nickel allergy

DEFF Research Database (Denmark)

Dyring Andersen, Beatrice; Skov, Lone; Løvendorf, Marianne B

2013-01-01

the frequencies of CD4(+) , CD8(+) and γδ T cells producing IL-17, IL-22 and interferon (IFN)-γ in the blood and skin from nickel-allergic patients. Patients/materials/methods Blood samples were collected from 14 patients and 17 controls, and analysed by flow cytometry. Biopsies were taken from 5 patients and 6......-allergic patients, there was massive cellular infiltration dominated by CD4(+) T cells producing IL-17, IL-22 and IFN-γ in nickel-challenged skin but not in vehicle-challenged skin. Conclusion CD4(+) T cells producing IL-17, IL-22 and IFN-γ are important effector cells in the eczematous reactions of nickel......Background It has been suggested that interleukin (IL)-17 and IL-22 play important roles in the elicitation of human allergic contact dermatitis; however, the frequencies of T cell subtypes producing IL-17 and IL-22 in human allergic contact dermatitis are unknown. Objectives To determine...

From Human Mesenchymal Stem Cells to Insulin-Producing Cells: Comparison between Bone Marrow- and Adipose Tissue-Derived Cells

Directory of Open Access Journals (Sweden)

Mahmoud M. Gabr

2017-01-01

Full Text Available The aim of this study is to compare human bone marrow-derived mesenchymal stem cells (BM-MSCs and adipose tissue-derived mesenchymal stem cells (AT-MSCs, for their differentiation potentials to form insulin-producing cells. BM-MSCs were obtained during elective orthotopic surgery and AT-MSCs from fatty aspirates during elective cosmetics procedures. Following their expansion, cells were characterized by phenotyping, trilineage differentiation ability, and basal gene expression of pluripotency genes and for their metabolic characteristics. Cells were differentiated according to a Trichostatin-A based protocol. The differentiated cells were evaluated by immunocytochemistry staining for insulin and c-peptide. In addition the expression of relevant pancreatic endocrine genes was determined. The release of insulin and c-peptide in response to a glucose challenge was also quantitated. There were some differences in basal gene expression and metabolic characteristics. After differentiation the proportion of the resulting insulin-producing cells (IPCs, was comparable among both cell sources. Again, there were no differences neither in the levels of gene expression nor in the amounts of insulin and c-peptide release as a function of glucose challenge. The properties, availability, and abundance of AT-MSCs render them well-suited for applications in regenerative medicine. Conclusion. BM-MSCs and AT-MSCs are comparable regarding their differential potential to form IPCs. The availability and properties of AT-MSCs render them well-suited for applications in regenerative medicine.

Bet-hedging in bacteriocin producing Escherichia coli populations: the single cell perspective

Science.gov (United States)

Bayramoglu, Bihter; Toubiana, David; van Vliet, Simon; Inglis, R. Fredrik; Shnerb, Nadav; Gillor, Osnat

2017-02-01

Production of public goods in biological systems is often a collaborative effort that may be detrimental to the producers. It is therefore sustainable only if a small fraction of the population shoulders the cost while the majority reap the benefits. We modelled this scenario using Escherichia coli populations producing colicins, an antibiotic that kills producer cells’ close relatives. Colicin expression is a costly trait, and it has been proposed that only a small fraction of the population actively expresses the antibiotic. Colicinogenic populations were followed at the single-cell level using time-lapse microscopy, and showed two distinct, albeit dynamic, subpopulations: the majority silenced colicin expression, while a small fraction of elongated, slow-growing cells formed colicin-expressing hotspots, placing a significant burden on expressers. Moreover, monitoring lineages of individual colicinogenic cells showed stochastic switching between expressers and non-expressers. Hence, colicin expressers may be engaged in risk-reducing strategies—or bet-hedging—as they balance the cost of colicin production with the need to repel competitors. To test the bet-hedging strategy in colicin-mediated interactions, competitions between colicin-sensitive and producer cells were simulated using a numerical model, demonstrating a finely balanced expression range that is essential to sustaining the colicinogenic population.

Phenotypes and functions of persistent Sendai virus-induced antibody forming cells and CD8+ T cells in diffuse nasal-associated lymphoid tissue typify lymphocyte responses of the gut.

Science.gov (United States)

Rudraraju, Rajeev; Surman, Sherri; Jones, Bart; Sealy, Robert; Woodland, David L; Hurwitz, Julia L

2011-02-20

Lymphocytes of the diffuse nasal-associated lymphoid tissue (d-NALT) are uniquely positioned to tackle respiratory pathogens at their point-of-entry, yet are rarely examined after intranasal (i.n.) vaccinations or infections. Here we evaluate an i.n. inoculation with Sendai virus (SeV) for elicitation of virus-specific antibody forming cells (AFCs) and CD8(+) T cells in the d-NALT. Virus-specific AFCs and CD8(+) T cells each appeared by day 7 after SeV inoculation and persisted for 8 months, explaining the long-sustained protection against respiratory virus challenge conferred by this vaccine. AFCs produced IgM, IgG1, IgG2a, IgG2b and IgA, while CD8+ T cells were cytolytic and produced low levels of cytokines. Phenotypic analyses of virus-specific T cells revealed striking similarities with pathogen-specific immune responses in the intestine, highlighting some key features of adaptive immunity at a mucosal site. Copyright © 2010 Elsevier Inc. All rights reserved.

Differential Signaling and Sugar Exchanges in Response to Avirulent Pathogen- and Symbiont-Derived Molecules in Tobacco Cells

Directory of Open Access Journals (Sweden)

Carole Pfister

2017-11-01

Full Text Available Plants interact with microbes whose ultimate aim is to exploit plant carbohydrates for their reproduction. Plant–microbe interactions (PMIs are classified according to the nature of their trophic exchanges: while mutualistic microbes trade nutrients with plants, pathogens unilaterally divert carbohydrates. The early responses following microbe recognition and the subsequent control of plant sugar distribution are still poorly understood. To further decipher PMI functionality, we used tobacco cells treated with microbial molecules mimicking pathogenic or mutualistic PMIs, namely cryptogein, a defense elicitor, and chitotetrasaccharide (CO4, which is secreted by mycorrhizal fungi. CO4 was perceived by tobacco cells and triggered widespread transient signaling components such as a sharp cytosolic Ca2+ elevation, NtrbohD-dependent H2O2 production, and MAP kinase activation. These CO4-induced events differed from those induced by cryptogein, i.e., sustained events leading to cell death. Furthermore, cryptogein treatment inhibited glucose and sucrose uptake but not fructose uptake, and promoted the expression of NtSUT and NtSWEET sugar transporters, whereas CO4 had no effect on sugar uptake and only a slight effect on NtSWEET2B expression. Our results suggest that microbial molecules induce different signaling responses that reflect microbial lifestyle and the subsequent outcome of the interaction.

Pathogen reduction of blood components.

Science.gov (United States)

Solheim, Bjarte G

2008-08-01

Thanks to many blood safety interventions introduced in developed countries the risk of transfusion transmitted infections has become exceedingly small in these countries. However, emerging pathogens still represent a serious challenge, as demonstrated by West Nile virus in the US and more recently by Chikungunya virus in the Indian Ocean. In addition bacterial contamination, particularly in platelets, and protozoa transmitted by blood components still represent sizeable risks in developed countries. In developing countries the risk of all transfusion transmitted infections is still high due to insufficient funding and organisation of the health service. Pathogen reduction of pooled plasma products has virtually eliminated the risk of transfusion transmitted infections, without compromising the quality of the products significantly. Pathogen reduction of blood components has been much more challenging. Solvent detergent treatment which has been so successfully applied for plasma products dissolves cell membranes, and can, therefore, only be applied for plasma and not for cellular blood components. Targeting of nucleic acids has been another method for pathogen inactivation of plasma and the only approach possible for cellular blood products. As documented in more than 15 year's track record, solvent detergent treatment of pooled plasma can yield high quality plasma. The increased risk for contamination by unknown viruses due to pooling is out weighed by elimination of TRALI, significant reduction in allergic reactions and standardisation of the product. Recently, a promising method for solvent detergent treatment of single donor plasma units has been published. Methylene blue light treatment of single donor plasma units has a similar long track record as pooled solvent detergent treated plasma; but the method is less well documented and affects coagulation factor activity more. Psoralen light treated plasma has only recently been introduced (CE marked in Europe

Synthesis and Characterization of Cefotaxime Conjugated Gold Nanoparticles and Their Use to Target Drug-Resistant CTX-M-Producing Bacterial Pathogens.

Science.gov (United States)

Shaikh, Sibhghatulla; Rizvi, Syed Mohd Danish; Shakil, Shazi; Hussain, Talib; Alshammari, Thamir M; Ahmad, Waseem; Tabrez, Shams; Al-Qahtani, Mohammad H; Abuzenadah, Adel M

2017-09-01

Multidrug-resistance due to "β lactamases having the expanded spectrum" (ESBLs) in members of Enterobacteriaceae is a matter of continued clinical concern. CTX-M is among the most common ESBLs in Enterobacteriaceae family. In the present study, a nanoformulation of cefotaxime was prepared using gold nanoparticles to combat drug-resistance in ESBL producing strains. Here, two CTX-M-15 positive cefotaxime resistant bacterial strains (i.e., one Escherichia coli and one Klebsiella pneumoniae strain) were used for testing the efficacy of "cefotaxime loaded gold-nanoparticles." Bromelain was used for both reduction and capping in the process of synthesis of gold-nanoparticles. Thereafter, cefotaxime was conjugated onto it with the help of activator 1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide. For characterization of both unconjugated and cefotaxime conjugated gold nanoparticles; UV-Visible spectroscopy, Scanning, and Transmission type Electron Microscopy methods accompanied with Dynamic Light Scattering were used. We used agar diffusion method plus microbroth-dilution method for the estimation of the antibacterial-activity and determination of minimum inhibitory concentration or MIC values, respectively. MIC values of cefotaxime loaded gold nanoparticles against E. coli and K. pneumoniae were obtained as 1.009 and 2.018 mg/L, respectively. These bacterial strains were completely resistant to cefotaxime alone. These results reinforce the utility of conjugating an old unresponsive antibiotic with gold nanoparticles to restore its efficacy against otherwise resistant bacterial pathogens. J. Cell. Biochem. 118: 2802-2808, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Use of Green Fluorescent Protein-Transgenic Strains to Study Pathogenic and Nonpathogenic Lifestyles in Colletotrichum acutatum.

Science.gov (United States)

Horowitz, Sigal; Freeman, Stanley; Sharon, Amir

2002-07-01

ABSTRACT Colletotrichum acutatum, which causes anthracnose disease on strawberry, can also persist on several other plant species without causing disease symptoms. The genetic and molecular bases that determine pathogenic and nonpathogenic lifestyles in C. acutatum are unclear. We developed a transformation system for C. acutatum by electroporation of germinating conidia, and transgenic isolates that express the green fluorescent protein (GFP) were produced. Details of the pathogenic and nonpathogenic lifestyles of C. acutatum were determined by using GFP-transgenic isolates. Major differences between colonization-mediating processes of strawberry and of other plants were observed. On the main host, strawberry, the germinating conidia formed branched, thick hyphae, and large numbers of appressoria were produced that were essential for plant penetration. In strawberry, the fungus developed rapidly, filling the mesophyll with dense mycelium that invaded the cells and caused necrosis of the tissue. In nonpathogenic interactions on pepper, eggplant, and tomato, the conidia germinated, producing thin, straight germ tubes. Appressoria were produced but failed to germinate and penetrate leaf tissue, resulting in epiphytic growth without invasion of the plant. Penetration of the plant occurred only several days after inoculation and was restricted to the intercellular spaces of the first cell layers of infected tissue without causing any visible damage. Much of the new fungal biomass continued to develop on the surface of inoculated organs in the nonpathogenic interaction. The differences in fungal development on strawberry compared with the other plant species suggest that signal molecules, which may be present only in strawberry, trigger appressorial germination and penetration of the primary host.

Alkane-grown Beauveria bassiana produce mycelial pellets displaying peroxisome proliferation, oxidative stress, and cell surface alterations.

Science.gov (United States)

Huarte-Bonnet, Carla; Paixão, Flávia R S; Ponce, Juan C; Santana, Marianela; Prieto, Eduardo D; Pedrini, Nicolás

2018-06-01

The entomopathogenic fungus Beauveria bassiana is able to grow on insect cuticle hydrocarbons, inducing alkane assimilation pathways and concomitantly increasing virulence against insect hosts. In this study, we describe some physiological and molecular processes implicated in growth, nutritional stress response, and cellular alterations found in alkane-grown fungi. The fungal cytology was investigated using light and transmission electron microscopy while the surface topography was examined using atomic force microscopy. Additionally, the expression pattern of several genes associated with oxidative stress, peroxisome biogenesis, and hydrophobicity were analysed by qPCR. We found a novel type of growth in alkane-cultured B. bassiana similar to mycelial pellets described in other alkane-free fungi, which were able to produce viable conidia and to be pathogenic against larvae of the beetles Tenebrio molitor and Tribolium castaneum. Mycelial pellets were formed by hyphae cumulates with high peroxidase activity, exhibiting peroxisome proliferation and an apparent surface thickening. Alkane-grown conidia appeared to be more hydrophobic and cell surfaces displayed different topography than glucose-grown cells. We also found a significant induction in several genes encoding for peroxins, catalases, superoxide dismutases, and hydrophobins. These results show that both morphological and metabolic changes are triggered in mycelial pellets derived from alkane-grown B. bassiana. Copyright © 2017 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Ultrastructural changes produced in Ehrlich ascites carcinoma cells by ultraviolet-visible radiation in the presence of melanins

Energy Technology Data Exchange (ETDEWEB)

Lea, P.J.; Pawlowski, A.; Persad, S.D.; Menon, I.A.; Haberman, H.F.

1988-01-01

Irradiation of Ehrlich ascites carcinoma (EAC) cells in the presence of pheomelanin, i.e., red hair melanin (RHM), has been reported to produce extensive cell lysis. Irradiation in the presence of eumelanin, i.e., black hair melanin (BHM), or irradiation in the absence of either type of melanin did not produce this effect. We observed that RHM particles penetrated the cell membrane without apparent structural damage to the cell or the cell membrane. Irradiation of the cells in the absence of melanin did not produce any changes in the ultrastructure of the cells. Incubation of the cells in the dark in the presence of RHM produced only minor structural, mainly cytoplasmic changes. Irradiation of the cells in the presence of RHM produced extensive ultrastructural changes prior to complete cell lysis; these changes were more severe than the effects of incubation of the cells in the dark in the presence of RHM. When the cells incubated in the dark or irradiated in the presence of latex particles or either one of the eumelanins particles, viz. BHM or synthetic dopa melanin, these particles did not penetrate into the cells or produce any ultrastructural changes. These particles were in fact not even ingested by the cells.

Immune system handling time may alter the outcome of competition between pathogens and the immune system.

Science.gov (United States)

Greenspoon, Philip B; Banton, Sydney; Mideo, Nicole

2018-06-14

Predators may be limited in their ability to kill prey (i.e., have type II or III functional responses), an insight that has had far-reaching consequences in the ecological literature. With few exceptions, however, this possibility has not been extended to the behaviour of immune cells, which kill pathogens much as predators kill their prey. Rather, models of the within-host environment have tended to tacitly assume that immune cells have an unlimited ability to target and kill pathogens (i.e., a type I functional response). Here we explore the effects of changing this assumption on infection outcomes (i.e., pathogen loads). We incorporate immune cell handling time into an ecological model of the within-host environment that considers both the predatory nature of the pathogen-immune cell interaction as well as competition between immune cells and pathogens for host resources. Unless pathogens can preempt immune cells for host resources, adding an immune cell handling time increases equilibrium pathogen load. We find that the shape of the relationship between energy intake and pathogen load can change: with a type I functional response, pathogen load is maximised at intermediate inputs, while for a type II or III functional response, pathogen load is solely increasing. With a type II functional response, pathogen load can fluctuate rather than settling to an equilibrium, a phenomenon unobserved with type I or III functional responses. Our work adds to a growing literature highlighting the role of resource availability in host-parasite interactions. Implications of our results for adaptive anorexia are discussed. Copyright © 2018 Elsevier Ltd. All rights reserved.

miR-375 induces human decidua basalis-derived stromal cells to become insulin-producing cells.

Science.gov (United States)

Shaer, Anahita; Azarpira, Negar; Vahdati, Akbar; Karimi, Mohammad Hosein; Shariati, Mehrdad

2014-09-01

This paper focuses on the development of renewable sources of isletreplacement tissue for the treatment of type I diabetes mellitus. Placental tissue-derived mesenchymal stem cells (MSCs) are a promising source for regenerative medicine due to their plasticity and easy availability. They have the potential to differentiate into insulin-producing cells. miR-375 is a micro RNA that is expressed in the pancreas and involved in islet development. Human placental decidua basalis MSCs (PDB-MSCs) were cultured from full-term human placenta. The immunophenotype of the isolated cells was checked for CD90, CD105, CD44, CD133 and CD34 markers. The MSCs (P3) were chemically transfected with hsa-miR-375. Total RNA was extracted 4 and 6 days after transfection. The expressions of insulin, NGN3, GLUT2, PAX4, PAX6, KIR6.2, NKX6.1, PDX1, and glucagon genes were evaluated using real-time qPCR. On day 6, we tested the potency of the clusters in response to the high glucose challenge and assessed the presence of insulin and NGN3 proteins via immunocytochemistry. Flow cytometry analysis confirmed that more than 90% of the cells were positive for CD90, CD105 and CD44 and negative for CD133 and CD34. Morphological changes were followed from day 2. Cell clusters formed during day 6. Insulin-producing clusters showed a deep red color with DTZ. The expression of pancreatic-specific transcription factors increased remarkably during the four days after transfection and significantly increased on day 7. The clusters were positive for insulin and NGN3 proteins, and C-peptide and insulin secretion increased in response to changes in the glucose concentration (2.8 mM and 16.7 mM). In conclusion, the MSCs could be programmed into functional insulin-producing cells by transfection of miR-375.

Inactivation of bacterial pathogens in yoba mutandabota, a dairy product fermented with the probiotic Lactobacillus rhamnosus yoba.

Science.gov (United States)

Mpofu, Augustine; Linnemann, Anita R; Nout, Martinus J R; Zwietering, Marcel H; Smid, Eddy J; den Besten, Heidy M W

2016-01-18

Mutandabota is a dairy product consumed as a major source of proteins and micronutrients in Southern Africa. In this study the microbial safety of traditional and a variant of mutandabota fermented with the probiotic Lactobacillus rhamnosus yoba (yoba mutandabota) was investigated by challenging the products with five important food pathogens: Listeria monocytogenes, Salmonella spp., Campylobacter jejuni, Escherichia coli O157:H7 and Bacillus cereus. Pasteurized full-fat cow's milk was used for producing traditional and yoba mutandabota, and was inoculated with a cocktail of strains of the pathogens at an inoculum level of 5.5 log cfu/mL. Survival of the pathogens was monitored over a potential consumption time of 24h for traditional mutandabota, and over 24h of fermentation followed by 24h of potential consumption time for yoba mutandabota. In traditional mutandabota (pH3.4 ± 0.1) no viable cells of B. cereus and C. jejuni were detected 3h after inoculation, while L. monocytogenes, E. coli O157:H7 and Salmonella spp. significantly declined (Pfermentation, mainly due to organic acids produced during fermentation. Only Salmonella spp. was able to grow in yoba mutandabota during the first 9h of fermentation, but then decreased in viable plate count. None of the tested pathogens were detected (>3.5 log inactivation) after 3h into potential consumption time of yoba mutandabota. Inactivation of pathogens in mutandabota is of public health significance because food-borne pathogens endanger public health upon consumption of contaminated food, especially in Southern Africa where there are many vulnerable consumers of mutandabota such as children, elderly and immuno-compromised people with HIV/AIDS. The findings of this study demonstrate that mutandabota fermented with L. rhamnosus yoba has antimicrobial properties against the tested pathogens and it is safer compared to the traditional mutandabota. Copyright © 2015 Elsevier B.V. All rights reserved.

Highly pathogenic avian influenza.

Science.gov (United States)

Swayne, D E; Suarez, D L

2000-08-01

Highly pathogenic (HP) avian influenza (AI) (HPAI) is an extremely contagious, multi-organ systemic disease of poultry leading to high mortality, and caused by some H5 and H7 subtypes of type A influenza virus, family Orthomyxoviridae. However, most AI virus strains are mildly pathogenic (MP) and produce either subclinical infections or respiratory and/or reproductive diseases in a variety of domestic and wild bird species. Highly pathogenic avian influenza is a List A disease of the Office International des Epizooties, while MPAI is neither a List A nor List B disease. Eighteen outbreaks of HPAI have been documented since the identification of AI virus as the cause of fowl plague in 1955. Mildly pathogenic avian influenza viruses are maintained in wild aquatic bird reservoirs, occasionally crossing over to domestic poultry and causing outbreaks of mild disease. Highly pathogenic avian influenza viruses do not have a recognised wild bird reservoir, but can occasionally be isolated from wild birds during outbreaks in domestic poultry. Highly pathogenic avian influenza viruses have been documented to arise from MPAI viruses through mutations in the haemagglutinin surface protein. Prevention of exposure to the virus and eradication are the accepted methods for dealing with HPAI. Control programmes, which imply allowing a low incidence of infection, are not an acceptable method for managing HPAI, but have been used during some outbreaks of MPAI. The components of a strategy to deal with MPAI or HPAI include surveillance and diagnosis, biosecurity, education, quarantine and depopulation. Vaccination has been used in some control and eradication programmes for AI.

Human pathogenic Mycoplasma species induced cytokine gene expression in Epstein-Barr virus (EBV)-positive lymphoblastoid cell lines.

Science.gov (United States)

Schäffner, E; Opitz, O; Pietsch, K; Bauer, G; Ehlers, S; Jacobs, E

1998-04-01

We addressed the question whether the in vitro interaction of two Epstein-Barr virus (EBV)-genome-positive B cell lines (EB-3 and HilB-gamma) with either Mycoplasma pneumoniae or M. hominis, with the mycoplasma species (M. fermentans, M. fermentans subsp. incognitus, M. penetrans, M. genitalium) or with mycoplasma species known to be mere commensals of the respiratory tract (M. orale and M. salivarium) would result in expression of mRNAs for IL-2, IL-2R, IL-4 and IL-6 as determined by reverse transcriptase (RT)-PCR after 4 and 24 h of cocultivation. The pattern of cytokine gene expression observed depended on (i) the origin of the transformed cell line, (ii) the pathogenicity of the Mycoplasma species, and (iii) the length of cocultivation. The EBV-immortalized lymphoblastoid cell line HilB-gamma showed mRNA expression for IL-2, IL-2-receptor, IL-4 and IL-6 peaking 24 h after stimulation with M. pneumoniae and all AIDS-related mycoplasma species tested. The Burkitt lymphoma cell line EB-3 showed a distinct and isolated strong II-2/IL-2 R-mRNA expression within 4 h after contact with the pathogenic and all of the AIDS related mycoplasma species. In neither EBV-containing cell line cytokine was gene expression detectable after stimulation with the commensal mycoplasma species, M. orale and M. salivarium, indicating species differences in the ability of mycoplasmas to interact with and stimulate B-cell lines. Our data suggest that some mcyoplasma species may act as immunomodulatory cofactors by eliciting inappropriate cytokine gene expression in B cells latently infected with EBV. Therefore, this cultivation model may prove useful in evaluating the pathogenetic potential of novel isolated mycoplasma species. Copyright 1998 Academic Press Limited.

A novel Arabidopsis CHITIN ELICITOR RECEPTOR KINASE 1 (CERK1) mutant with enhanced pathogen-induced cell death and altered receptor processing.

Science.gov (United States)

Petutschnig, Elena K; Stolze, Marnie; Lipka, Ulrike; Kopischke, Michaela; Horlacher, Juliane; Valerius, Oliver; Rozhon, Wilfried; Gust, Andrea A; Kemmerling, Birgit; Poppenberger, Brigitte; Braus, Gerhard H; Nürnberger, Thorsten; Lipka, Volker

2014-12-01

Plants detect pathogens by sensing microbe-associated molecular patterns (MAMPs) through pattern recognition receptors. Pattern recognition receptor complexes also have roles in cell death control, but the underlying mechanisms are poorly understood. Here, we report isolation of cerk1-4, a novel mutant allele of the Arabidopsis chitin receptor CERK1 with enhanced defense responses. We identified cerk1-4 in a forward genetic screen with barley powdery mildew and consequently characterized it by pathogen assays, mutant crosses and analysis of defense pathways. CERK1 and CERK1-4 proteins were analyzed biochemically. The cerk1-4 mutation causes an amino acid exchange in the CERK1 ectodomain. Mutant plants maintain chitin signaling capacity but exhibit hyper-inducible salicylic acid concentrations and deregulated cell death upon pathogen challenge. In contrast to chitin signaling, the cerk1-4 phenotype does not require kinase activity and is conferred by the N-terminal part of the receptor. CERK1 undergoes ectodomain shedding, a well-known process in animal cell surface proteins. Wild-type plants contain the full-length CERK1 receptor protein as well as a soluble form of the CERK1 ectodomain, whereas cerk1-4 plants lack the N-terminal shedding product. Our work suggests that CERK1 may have a chitin-independent role in cell death control and is the first report of ectodomain shedding in plants. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

Chlorine-rich plasma polymer coating for the prevention of attachment of pathogenic fungal cells onto materials surfaces

International Nuclear Information System (INIS)

Lamont-Friedrich, Stephanie J; Michl, Thomas D; Giles, Carla; Griesser, Hans J; Coad, Bryan R

2016-01-01

The attachment of pathogenic fungal cells onto materials surfaces, which is often followed by biofilm formation, causes adverse consequences in a wide range of areas. Here we have investigated the ability of thin film coatings from chlorinated molecules to deter fungal colonization of solid materials by contact killing of fungal cells reaching the surface of the coating. Coatings were deposited onto various substrate materials via plasma polymerization, which is a substrate-independent process widely used for industrial coating applications, using 1,1,2-trichloroethane as the process vapour. XPS surface analysis showed that the coatings were characterized by a highly chlorinated hydrocarbon polymer nature, with only a very small amount of oxygen incorporated. The activity of these coatings against human fungal pathogens was quantified using a recently developed, modified yeast assay and excellent antifungal activity was observed against Candida albicans and Candida glabrata . Plasma polymer surface coatings derived from chlorinated hydrocarbon molecules may therefore offer a promising solution to preventing yeast and mould biofilm formation on materials surfaces, for applications such as air conditioners, biomedical devices, food processing equipment, and others. (paper)

Development of tissue singular complex marking process on outer layer of insect skin and it's application to virulence evaluation of insect pathogens

International Nuclear Information System (INIS)

Ihara, F.; Toyama, M.; Sato, T.; Umemiya, Y.

2004-01-01

A relation between virulence of insect pathogenic filament germ, Metarhizium anisopliae, on bug and the germ enzyme productivity was investigated by API-ZYM process, in which several kinds of enzyme, such as alkaline phosphatase, esterase, lipase, galactosidase, glucosidase, and so on, were used. Epidermal protein on the bug was marked with L -35 S cysteine. The relations between eleven kinds of the enzyme activity pattern and the virulence of insect pathogen germ on bug, however were not cleared. An enzyme, which was produced at the outside of germ cell by the insect pathogen germ, reacted on the marked epidermis. The relations between resolution process and virulence of the enzyme, however were not cleared yet. (M. Suetake)

Effector-triggered immunity: from pathogen perception to robust defense.

Science.gov (United States)

Cui, Haitao; Tsuda, Kenichi; Parker, Jane E

2015-01-01

In plant innate immunity, individual cells have the capacity to sense and respond to pathogen attack. Intracellular recognition mechanisms have evolved to intercept perturbations by pathogen virulence factors (effectors) early in host infection and convert it to rapid defense. One key to resistance success is a polymorphic family of intracellular nucleotide-binding/leucine-rich-repeat (NLR) receptors that detect effector interference in different parts of the cell. Effector-activated NLRs connect, in various ways, to a conserved basal resistance network in order to transcriptionally boost defense programs. Effector-triggered immunity displays remarkable robustness against pathogen disturbance, in part by employing compensatory mechanisms within the defense network. Also, the mobility of some NLRs and coordination of resistance pathways across cell compartments provides flexibility to fine-tune immune outputs. Furthermore, a number of NLRs function close to the nuclear chromatin by balancing actions of defense-repressing and defense-activating transcription factors to program cells dynamically for effective disease resistance.

A novel approach for differentiating pathogenic and non-pathogenic Leptospira based on molecular fingerprinting.

Science.gov (United States)

Xiao, Di; Zhang, Cuicai; Zhang, Huifang; Li, Xiuwen; Jiang, Xiugao; Zhang, Jianzhong

2015-04-24

disease that has become an important public health problem. Traditional serological methods are the gold standard for the detection of pathogenic strains of Leptospira. However, serological procedures are cumbersome, require more complex experimental techniques, and are based on a large number of international and domestic reference strains. Additionally, these experiments involve the immunization of animals with antigens from different serotypes to produce immune serum, and improper techniques may result in a rapid decrease in antibody titer, which would affect the final results. It is difficult to perform cumbersome detection procedures in a basic laboratory. Therefore, the use of conventional serological methods is limited, which significantly impacts daily leptospirosis epidemic surveillance, prevention, and control. Molecular biology methods, such as 16S rRNA and PCR-based methods, can be used to identify the pathogenic Leptospira. However, DNA extraction and gene sequencing methods are laborious and time consuming. Therefore, more rapid and reliable high-throughput identification methods are urgently needed for the clinical diagnosis of leptospirosis to improve epidemic control. Here, molecular fingerprinting technique was use to identify the pathogenicity. We constructed the reference spectra database and the super reference spectra of pathogenic and non-pathogenic Leptospira, which can rapidly identified Leptospira at the species level and the pathogenicity of these isolates can be simultaneously confirmed. Furthermore, the protein components of Leptospira pathogenicity were revealed. These findings thus provide a new way for Leptospira pathogenicity identification. Copyright © 2014. Published by Elsevier B.V.

Cell intrinsic immunity spreads to bystander cells via the intercellular transfer of cGAMP.

Science.gov (United States)

Ablasser, Andrea; Schmid-Burgk, Jonathan L; Hemmerling, Inga; Horvath, Gabor L; Schmidt, Tobias; Latz, Eicke; Hornung, Veit

2013-11-28

The innate immune defence of multicellular organisms against microbial pathogens requires cellular collaboration. Information exchange allowing immune cells to collaborate is generally attributed to soluble protein factors secreted by pathogen-sensing cells. Cytokines, such as type I interferons (IFNs), serve to alert non-infected cells to the possibility of pathogen challenge. Moreover, in conjunction with chemokines they can instruct specialized immune cells to contain and eradicate microbial infection. Several receptors and signalling pathways exist that couple pathogen sensing to the induction of cytokines, whereas cytosolic recognition of nucleic acids seems to be exquisitely important for the activation of type I IFNs, master regulators of antiviral immunity. Cytosolic DNA is sensed by the receptor cyclic GMP-AMP (cGAMP) synthase (cGAS), which catalyses the synthesis of the second messenger cGAMP(2'-5'). This molecule in turn activates the endoplasmic reticulum (ER)-resident receptor STING, thereby inducing an antiviral state and the secretion of type I IFNs. Here we find in murine and human cells that cGAS-synthesized cGAMP(2'-5') is transferred from producing cells to neighbouring cells through gap junctions, where it promotes STING activation and thus antiviral immunity independently of type I IFN signalling. In line with the limited cargo specificity of connexins, the proteins that assemble gap junction channels, most connexins tested were able to confer this bystander immunity, thus indicating a broad physiological relevance of this local immune collaboration. Collectively, these observations identify cGAS-triggered cGAMP(2'-5') transfer as a novel host strategy that serves to rapidly convey antiviral immunity in a transcription-independent, horizontal manner.

Purification and proteomics of pathogen-modified vacuoles and membranes

Directory of Open Access Journals (Sweden)

Jo-Ana eHerweg

2015-06-01

Full Text Available Certain pathogenic bacteria adopt an intracellular lifestyle and proliferate in eukaryotic host cells. The intracellular niche protects the bacteria from cellular and humoral components of the mammalian immune system, and at the same time, allows the bacteria to gain access to otherwise restricted nutrient sources. Yet, intracellular protection and access to nutrients comes with a price, i.e. the bacteria need to overcome cell-autonomous defense mechanisms, such as the bactericidal endocytic pathway. While a few bacteria rupture the early phagosome and escape into the host cytoplasm, most intracellular pathogens form a distinct, degradation-resistant and replication-permissive membranous compartment. Intracellular bacteria that form unique pathogen vacuoles include Legionella, Mycobacterium, Chlamydia, Simkania and Salmonella species. In order to understand the formation of these pathogen niches on a global scale and in a comprehensive and quantitative manner, an inventory of compartment-associated host factors is required. To this end, the intact pathogen compartments need to be isolated, purified and biochemically characterized. Here, we review recent progress on the isolation and purification of pathogen-modified vacuoles and membranes, as well as their proteomic characterization by mass spectrometry and different validation approaches. These studies provide the basis for further investigations on the specific mechanisms of pathogen-driven compartment formation.

From the Cover: Cell-replacement therapy for diabetes: Generating functional insulin-producing tissue from adult human liver cells

Science.gov (United States)

Sapir, Tamar; Shternhall, Keren; Meivar-Levy, Irit; Blumenfeld, Tamar; Cohen, Hamutal; Skutelsky, Ehud; Eventov-Friedman, Smadar; Barshack, Iris; Goldberg, Iris; Pri-Chen, Sarah; Ben-Dor, Lya; Polak-Charcon, Sylvie; Karasik, Avraham; Shimon, Ilan; Mor, Eytan; Ferber, Sarah

2005-05-01

Shortage in tissue availability from cadaver donors and the need for life-long immunosuppression severely restrict the large-scale application of cell-replacement therapy for diabetic patients. This study suggests the potential use of adult human liver as alternate tissue for autologous beta-cell-replacement therapy. By using pancreatic and duodenal homeobox gene 1 (PDX-1) and soluble factors, we induced a comprehensive developmental shift of adult human liver cells into functional insulin-producing cells. PDX-1-treated human liver cells express insulin, store it in defined granules, and secrete the hormone in a glucose-regulated manner. When transplanted under the renal capsule of diabetic, immunodeficient mice, the cells ameliorated hyperglycemia for prolonged periods of time. Inducing developmental redirection of adult liver offers the potential of a cell-replacement therapy for diabetics by allowing the patient to be the donor of his own insulin-producing tissue. pancreas | transdifferentiation

Generation of insulin-producing human mesenchymal stem cells using recombinant adeno-associated virus.

Science.gov (United States)

Kim, Jeong Hwan; Park, Si-Nae; Suh, Hwal

2007-02-28

The purpose of current experiment is the generation of insulin-producing human mesenchymal stem cells as therapeutic source for the cure of type 1 diabetes. Type 1 diabetes is generally caused by insulin deficiency accompanied by the destruction of islet beta-cells. In various trials for the treatment of type 1 diabetes, cell-based gene therapy using stem cells is considered as one of the most useful candidate for the treatment. In this experiment, human mesenchymal stem cells were transduced with AAV which is containing furin-cleavable human preproinsulin gene to generate insulin-producing cells as surrogate beta-cells for the type 1 diabetes therapy. In the rAAV production procedure, rAAV was generated by transfection of AD293 cells. Human mesenchymal stems cells were transduced using rAAV with a various multiplicity of infection. Transduction of recombinant AAV was also tested using beta-galactosidse expression. Cell viability was determined by using MTT assay to evaluate the toxicity of the transduction procedure. Expression and production of Insulin were tested using reverse transcriptase-polymerase chain reaction and immunocytochemistry. Secretion of human insulin and C-peptide from the cells was assayed using enzyme-linked immunosorbent assay. Production of insulin and C-peptide from the test group represented a higher increase compared to the control group. In this study, we examined generation of insulin-producing cells from mesenchymal stem cells by genetic engineering for diabetes therapy. This work might be valuable to the field of tissue engineering for diabetes treatment.

Immunity to intestinal pathogens: lessons learned from Salmonella

Science.gov (United States)

McSorley, Stephen J.

2014-01-01

Summary Salmonella are a common source of food or water-borne infection and cause a wide range of clinical disease in human and animal hosts. Salmonella are relatively easy to culture and manipulate in a laboratory setting, and the infection of laboratory animals induces robust innate and adaptive immune responses. Thus, immunologists have frequently turned to Salmonella infection models to expand understanding of immunity to intestinal pathogens. In this review, I summarize current knowledge of innate and adaptive immunity to Salmonella and highlight features of this response that have emerged from recent studies. These include the heterogeneity of the antigen-specific T-cell response to intestinal infection, the prominence of microbial mechanisms to impede T and B-cell responses, and the contribution of non-cognate pathways for elicitation of T-cell effector functions. Together, these different issues challenge an overly simplistic view of host-pathogen interaction during mucosal infection but also allow deeper insight into the real-world dynamic of protective immunity to intestinal pathogens. PMID:24942689

Characterisation of insulin-producing cells differentiated from tonsil derived mesenchymal stem cells.

Science.gov (United States)

Kim, So-Yeon; Kim, Ye-Ryung; Park, Woo-Jae; Kim, Han Su; Jung, Sung-Chul; Woo, So-Youn; Jo, Inho; Ryu, Kyung-Ha; Park, Joo-Won

2015-01-01

Tonsil-derived (T-) mesenchymal stem cells (MSCs) display mutilineage differentiation potential and self-renewal capacity and have potential as a banking source. Diabetes mellitus is a prevalent disease in modern society, and the transplantation of pancreatic progenitor cells or various stem cell-derived insulin-secreting cells has been suggested as a novel therapy for diabetes. The potential of T-MSCs to trans-differentiate into pancreatic progenitor cells or insulin-secreting cells has not yet been investigated. We examined the potential of human T-MSCs to trans-differentiate into pancreatic islet cells using two different methods based on β-mercaptoethanol and insulin-transferin-selenium, respectively. First, we compared the efficacy of the two methods for inducing differentiation into insulin-producing cells. We demonstrated that the insulin-transferin-selenium method is more efficient for inducing differentiation into insulin-secreting cells regardless of the source of the MSCs. Second, we compared the differentiation potential of two different MSC types: T-MSCs and adipose-derived MSCs (A-MSCs). T-MSCs had a differentiation capacity similar to that of A-MSCs and were capable of secreting insulin in response to glucose concentration. Islet-like clusters differentiated from T-MSCs had lower synaptotagmin-3, -5, -7, and -8 levels, and consequently lower secreted insulin levels than cells differentiated from A-MSCs. These results imply that T-MSCs can differentiate into functional pancreatic islet-like cells and could provide a novel, alternative cell therapy for diabetes mellitus. Copyright © 2015 International Society of Differentiation. Published by Elsevier B.V. All rights reserved.

SILAC-based comparative analysis of pathogenic Escherichia coli secretomes

DEFF Research Database (Denmark)

Boysen, Anders; Borch, Jonas; Krogh, Thøger Jensen

2015-01-01

Comparative studies of pathogenic bacteria and their non-pathogenic counterparts has led to the discovery of important virulence factors thereby generating insight into mechanisms of pathogenesis. Protein-based antigens for vaccine development are primarily selected among unique virulence...... experimental approach. In addition we find proteins that are not unique to the pathogenic strains but expressed at levels different from the commensal strain, including the colonization factor YghJ and the surface adhesin antigen 43, which is involved in pathogenesis of other Gram-negative bacteria......-related factors produced by the pathogen of interest. However, recent work indicates that proteins that are not unique to the pathogen but instead selectively expressed compared to its non-pathogenic counterpart could also be vaccine candidates or targets for drug development. Modern methods in quantitative...

Pathogenicity of Human ST23 Streptococcus agalactiae to Fish and Genomic Comparison of Pathogenic and Non-pathogenic Isolates

Directory of Open Access Journals (Sweden)

Rui Wang

2017-10-01

Full Text Available Streptococcus agalactiae, or Group B Streptococcus (GBS, is a major pathogen causing neonatal sepsis and meningitis, bovine mastitis, and fish meningoencephalitis. CC23, including its namesake ST23, is not only the predominant GBS strain derived from human and cattle, but also can infect a variety of homeothermic and poikilothermic species. However, it has never been characterized in fish. This study aimed to determine the pathogenicity of ST23 GBS to fish and explore the mechanisms causing the difference in the pathogenicity of ST23 GBS based on the genome analysis. Infection of tilapia with 10 human-derived ST23 GBS isolates caused tissue damage and the distribution of pathogens within tissues. The mortality rate of infection was ranged from 76 to 100%, and it was shown that the mortality rate caused by only three human isolates had statistically significant difference compared with fish-derived ST7 strain (P < 0.05, whereas the mortality caused by other seven human isolates did not show significant difference compared with fish-derived ST7 strain. The genome comparison and prophage analysis showed that the major genome difference between virulent and non-virulent ST23 GBS was attributed to the different prophage sequences. The prophage in the P1 region contained about 43% GC and encoded 28–39 proteins, which can mediate the acquisition of YafQ/DinJ structure for GBS by phage recombination. YafQ/DinJ belongs to one of the bacterial toxin–antitoxin (TA systems and allows cells to cope with stress. The ST23 GBS strains carrying this prophage were not pathogenic to tilapia, but the strains without the prophage or carrying the pophage that had gene mutation or deletion, especially the deletion of YafQ/DinJ structure, were highly pathogenic to tilapia. In conclusion, human ST23 GBS is highly pathogenic to fish, which may be related to the phage recombination.

From deep-sea volcanoes to human pathogens: a conserved quorum-sensing signal in Epsilonproteobacteria.

Science.gov (United States)

Pérez-Rodríguez, Ileana; Bolognini, Marie; Ricci, Jessica; Bini, Elisabetta; Vetriani, Costantino

2015-05-01

Chemosynthetic Epsilonproteobacteria from deep-sea hydrothermal vents colonize substrates exposed to steep thermal and redox gradients. In many bacteria, substrate attachment, biofilm formation, expression of virulence genes and host colonization are partly controlled via a cell density-dependent mechanism involving signal molecules, known as quorum sensing. Within the Epsilonproteobacteria, quorum sensing has been investigated only in human pathogens that use the luxS/autoinducer-2 (AI-2) mechanism to control the expression of some of these functions. In this study we showed that luxS is conserved in Epsilonproteobacteria and that pathogenic and mesophilic members of this class inherited this gene from a thermophilic ancestor. Furthermore, we provide evidence that the luxS gene is expressed--and a quorum-sensing signal is produced--during growth of Sulfurovum lithotrophicum and Caminibacter mediatlanticus, two Epsilonproteobacteria from deep-sea hydrothermal vents. Finally, we detected luxS transcripts in Epsilonproteobacteria-dominated biofilm communities collected from deep-sea hydrothermal vents. Taken together, our findings indicate that the epsiloproteobacterial lineage of the LuxS enzyme originated in high-temperature geothermal environments and that, in vent Epsilonproteobacteria, luxS expression is linked to the production of AI-2 signals, which are likely produced in situ at deep-sea vents. We conclude that the luxS gene is part of the ancestral epsilonproteobacterial genome and represents an evolutionary link that connects thermophiles to human pathogens.

Brucella abortus Induces a Warburg Shift in Host Metabolism That Is Linked to Enhanced Intracellular Survival of the Pathogen.

Science.gov (United States)

Czyż, Daniel M; Willett, Jonathan W; Crosson, Sean

2017-08-01

Intracellular bacterial pathogens exploit host cell resources to replicate and survive inside the host. Targeting these host systems is one promising approach to developing novel antimicrobials to treat intracellular infections. We show that human macrophage-like cells infected with Brucella abortus undergo a metabolic shift characterized by attenuated tricarboxylic acid cycle metabolism, reduced amino acid consumption, altered mitochondrial localization, and increased lactate production. This shift to an aerobic glycolytic state resembles the Warburg effect, a change in energy production that is well described in cancer cells and also occurs in activated inflammatory cells. B. abortus efficiently uses lactic acid as its sole carbon and energy source and requires the ability to metabolize lactate for normal survival in human macrophage-like cells. We demonstrate that chemical inhibitors of host glycolysis and lactate production do not affect in vitro growth of B. abortus in axenic culture but decrease its survival in the intracellular niche. Our data support a model in which infection shifts host metabolism to a Warburg-like state, and B. abortus uses this change in metabolism to promote intracellular survival. Pharmacological perturbation of these features of host cell metabolism may be a useful strategy to inhibit infection by intracellular pathogens. IMPORTANCE Brucella spp. are intracellular bacterial pathogens that cause disease in a range of mammals, including livestock. Transmission from livestock to humans is common and can lead to chronic human disease. Human macrophage-like cells infected with Brucella abortus undergo a Warburg-like metabolic shift to an aerobic glycolytic state where the host cells produce lactic acid and have reduced amino acid catabolism. We provide evidence that the pathogen can exploit this change in host metabolism to support growth and survival in the intracellular niche. Drugs that inhibit this shift in host cell metabolism

Inhibition of osteoclastogenesis by osteoblast-like cells genetically engineered to produce interleukin-10.

Science.gov (United States)

Fujioka, Kazuki; Kishida, Tsunao; Ejima, Akika; Yamamoto, Kenta; Fujii, Wataru; Murakami, Ken; Seno, Takahiro; Yamamoto, Aihiro; Kohno, Masataka; Oda, Ryo; Yamamoto, Toshiro; Fujiwara, Hiroyoshi; Kawahito, Yutaka; Mazda, Osam

2015-01-16

Bone destruction at inflamed joints is an important complication associated with rheumatoid arthritis (RA). Interleukin-10 (IL-10) may suppress not only inflammation but also induction of osteoclasts that play key roles in the bone destruction. If IL-10-producing osteoblast-like cells are induced from patient somatic cells and transplanted back into the destructive bone lesion, such therapy may promote bone remodeling by the cooperative effects of IL-10 and osteoblasts. We transduced mouse fibroblasts with genes for IL-10 and Runx2 that is a crucial transcription factor for osteoblast differentiation. The IL-10-producing induced osteoblast-like cells (IL-10-iOBs) strongly expressed osteoblast-specific genes and massively produced bone matrix that were mineralized by calcium phosphate in vitro and in vivo. Culture supernatant of IL-10-iOBs significantly suppressed induction of osteoclast from RANKL-stimulated Raw264.7 cells as well as LPS-induced production of inflammatory cytokine by macrophages. The IL-10-iOBs may be applicable to novel cell-based therapy against bone destruction associated with RA. Copyright © 2014 Elsevier Inc. All rights reserved.

Analysis of pathogenic factors of Proteus mirabilis isolated from urinary tract infection

OpenAIRE

室谷,勝久

1991-01-01

Proteus mirabilis has several pathogenic factors such as adherent ability to urinary tract epitherial cells, urease, motility and resistance to urine. The pathogenic activities of clinically isolated P. mirabilis were analyzed. Higher pathogenic strains (No. 25 and No. 30) which had morphologically different pili but had a higher density of pili showed strong adherent activity to bladder epithelial cells of mouse and rat. These strains also showed a clear chemotaxis to urinary tract tissue ex...

Hijacking of the host SCF ubiquitin ligase machinery by plant pathogens

Directory of Open Access Journals (Sweden)

Shimpei eMagori

2011-11-01

Full Text Available The SCF (SKP1-CUL1-F-box protein ubiquitin ligase complex mediates polyubiquitination of proteins targeted for degradation, thereby controlling a plethora of biological processes in eukaryotic cells. Although this ubiquitination machinery is found and functional only in eukaryotes, many non-eukaryotic pathogens also encode F-box proteins, the critical subunits of the SCF complex. Increasing evidence indicates that such non-eukaryotic F-box proteins play an essential role in subverting or exploiting the host ubiquitin/proteasome system for efficient pathogen infection. A recent bioinformatic analysis has identified more than 70 F-box proteins in 22 different bacterial species, suggesting that use of pathogen-encoded F-box effectors in the host cell may be a widespread infection strategy. In this review, we focus on plant pathogen-encoded F-box effectors, such as VirF of Agrobacterium tumefaciens, GALAs of Ralstonia solanacearum, and P0 of Poleroviruses, and discuss the molecular mechanism by which plant pathogens use these factors to manipulate the host cell for their own benefit.

In vitro generation of functional insulin-producing cells from lipoaspirated human adipose tissue-derived stem cells.

Science.gov (United States)

Mohamad Buang, Mohamad Lizan; Seng, Heng Kien; Chung, Lee Han; Saim, Aminuddin Bin; Idrus, Ruszymah Bt Hj

2012-01-01

Tissue engineering strategy has been considered as an alternative treatment for diabetes mellitus due to lack of permanent pharmaceutical treatment and islet donors for transplantation. Various cell lines have been used to generate functional insulin-producing cells (IPCs) including progenitor pancreatic cell lines, embryonic stem cells (ESCs), umbilical cord blood stem cells (UCB-SCs), adult bone marrow stem cells (BMSCs), and adipose tissue-derived stem cells (ADSCs). Human ADSCs from lipoaspirated abdominal fat tissue was differentiated into IPCs following a two-step induction protocol based on a combination of alternating high and low glucose, nicotinamide, activin A and glucagon-like peptide 1 (GLP-1) for a duration of 3 weeks. During differentiation, histomorphological changes of the stem cells towards pancreatic β-islet characteristics were observed via light microscope and transmission electron microscope (TEM). Dithizone (DTZ) staining, which is selective towards IPCs, was used to stain the new islet-like cells. Production of insulin hormone by the cells was analyzed via enzyme-linked immunosorbent assay (ELISA), whereas its hormonal regulation was tested via a glucose challenge test. Histomorphological changes of the differentiated cells were noted to resemble pancreatic β-cells, whereas DTZ staining positively stained the cells. The differentiated cells significantly produced human insulin as compared to the undifferentiated ADSCs, and its production was increased with an increase of glucose concentration in the culture medium. These initial data indicate that human lipoaspirated ADSCs have the potential to differentiate into functional IPCs, and could be used as a therapy to treat diabetes mellitus in the future. Copyright © 2012 IMSS. Published by Elsevier Inc. All rights reserved.

Bifidobacterial surface-exopolysaccharide facilitates commensal-host interaction through immune modulation and pathogen protection

Science.gov (United States)

Fanning, Saranna; Hall, Lindsay J.; Cronin, Michelle; Zomer, Aldert; MacSharry, John; Goulding, David; O'Connell Motherway, Mary; Shanahan, Fergus; Nally, Kenneth; Dougan, Gordon; van Sinderen, Douwe

2012-01-01

Bifidobacteria comprise a significant proportion of the human gut microbiota. Several bifidobacterial strains are currently used as therapeutic interventions, claiming various health benefits by acting as probiotics. However, the precise mechanisms by which they maintain habitation within their host and consequently provide these benefits are not fully understood. Here we show that Bifidobacterium breve UCC2003 produces a cell surface-associated exopolysaccharide (EPS), the biosynthesis of which is directed by either half of a bidirectional gene cluster, thus leading to production of one of two possible EPSs. Alternate transcription of the two opposing halves of this cluster appears to be the result of promoter reorientation. Surface EPS provided stress tolerance and promoted in vivo persistence, but not initial colonization. Marked differences were observed in host immune response: strains producing surface EPS (EPS+) failed to elicit a strong immune response compared with EPS-deficient variants. Specifically, EPS production was shown to be linked to the evasion of adaptive B-cell responses. Furthermore, presence of EPS+ B. breve reduced colonization levels of the gut pathogen Citrobacter rodentium. Our data thus assigns a pivotal and beneficial role for EPS in modulating various aspects of bifidobacterial–host interaction, including the ability of commensal bacteria to remain immunologically silent and in turn provide pathogen protection. This finding enforces the probiotic concept and provides mechanistic insights into health-promoting benefits for both animal and human hosts. PMID:22308390

Molecular detection of blood pathogens and their impacts on levels of packed cell volume in stray dogs from Thailand

Directory of Open Access Journals (Sweden)

Supawadee Piratae

2017-04-01

Full Text Available Objective: To evaluate the prevalence of blood parasite infection in stray dogs by PCR technique and the association between levels of packed cell volume (PCV and blood parasitic infection in stray dogs. Methods: A total of 65 blood samples were collected from stray dogs in animal quarantine station from Mahasarakham, Thailand to evaluate the levels of PCV before molecular screening for tick-borne pathogens infection. Results: Stray dogs were positive with one or more pathogens in 44 (67.69% out of 65 blood samples. Ehrlichia canis [43.1%, 95% confidence interval (CI: 38.1–48.1] was the most common blood pathogen found infecting in stray dogs in Mahasarakham Province, followed by Anaplasma platys (29.2%, 95% CI: 24.2–34.2, Hepatozoon canis (12.3%, 95% CI: 7.3–17.3 and Babesia canis vogeli (6.2%, 95% CI: 1.2–11.2, respectively. Moreover, co-infections with two pathogens were identified in 11 (16.9% of dogs examined and two (2.9% dogs were coinfections with three pathogens. Statistically significant relationship between the PCV levels and Ehrlichia canis infection was found (P < 0.05. Conclusions: This study indicated that blood pathogens are spreading in stray dogs and they are potentially high risk of agent transmission to human via exposure with tick vectors. It was also the first report of Anaplasma platys infection in dogs in north-eastern part of Thailand.

Thioredoxin 80-Activated-Monocytes (TAMs) Inhibit the Replication of Intracellular Pathogens

DEFF Research Database (Denmark)

Cortes-Bratti, Ximena; Brasseres, Eugenie; Herrera-Rodriquez, Fabiola

2011-01-01

Background: Thioredoxin 80 (Trx80) is an 80 amino acid natural cleavage product of Trx, produced primarily by monocytes. Trx80 induces differentiation of human monocytes into a novel cell type, named Trx80-activated-monocytes (TAMs). Principal Findings: In this investigation we present evidence...... for a role of TAMs in the control of intracellular bacterial infections. As model pathogens we have chosen Listeria monocytogenes and Brucella abortus which replicate in the cytosol and the endoplasmic reticulum respectively. Our data indicate that TAMs efficiently inhibit intracellular growth of both L...... in TAMs compared to that observed in control cells 24 h post-infection, indicating that TAMs kill bacteria by preventing their escape from the endosomal compartments, which progress into a highly degradative phagolysosome. Significance: Our results show that Trx80 potentiates the bactericidal activities...

Sensitizing pathogens to antibiotics using the CRISPR-Cas system.

Science.gov (United States)

Goren, Moran; Yosef, Ido; Qimron, Udi

2017-01-01

The extensive use of antibiotics over the last century has resulted in a significant artificial selection pressure for antibiotic-resistant pathogens to evolve. Various strategies to fight these pathogens have been introduced including new antibiotics, naturally-derived enzymes/peptides that specifically target pathogens and bacteriophages that lyse these pathogens. A new tool has recently been introduced in the fight against drug-resistant pathogens-the prokaryotic defense mechanism-clustered regularly interspaced short palindromic repeats-CRISPR associated (CRISPR-Cas) system. The CRISPR-Cas system acts as a nuclease that can be guided to cleave any target DNA, allowing sophisticated, yet feasible, manipulations of pathogens. Here, we review pioneering studies that use the CRISPR-Cas system to specifically edit bacterial populations, eliminate their resistance genes and combine these two strategies in order to produce an artificial selection pressure for antibiotic-sensitive pathogens. We suggest that intelligent design of this system, along with efficient delivery tools into pathogens, may significantly reduce the threat of antibiotic-resistant pathogens. Copyright © 2016 Elsevier Ltd. All rights reserved.

Production of cross-kingdom oxylipins by pathogenic fungi: An update on their role in development and pathogenicity.

Science.gov (United States)

Fischer, Gregory J; Keller, Nancy P

2016-03-01

Oxylipins are a class of molecules derived from the incorporation of oxygen into polyunsaturated fatty acid substrates through the action of oxygenases. While extensively investigated in the context of mammalian immune responses, over the last decade it has become apparent that oxylipins are a common means of communication among and between plants, animals, and fungi to control development and alter host-microbe interactions. In fungi, some oxylipins are derived nonenzymatically while others are produced by lipoxygenases, cyclooxygenases, and monooxygenases with homology to plant and human enzymes. Recent investigations of numerous plant and human fungal pathogens have revealed oxylipins to be involved in the establishment and progression of disease. This review highlights oxylipin production by pathogenic fungi and their role in fungal development and pathogen/host interactions.

Recognition Strategies of Group 3 Innate Lymphoid Cells

OpenAIRE

Killig, Monica; Glatzer, Timor; Romagnani, Chiara

2014-01-01

During the early phase of an inflammatory response, innate cells can use different strategies to sense environmental danger. These include the direct interaction of specific activating receptors (actR) with pathogen-encoded/danger molecules or the engagement of cytokine receptors by pro-inflammatory mediators produced by antigen presenting cells (APC) in the course of the infection. These general recognition strategies, which have been extensively described for innate myeloid cells, are share...

Advances and Challenges in Viability Detection of Foodborne Pathogens

Directory of Open Access Journals (Sweden)

Dexin Zeng

2016-11-01

Full Text Available Foodborne outbreaks are a serious public health and food safety concern worldwide. There is a great demand for rapid, sensitive, specific, and accurate methods to detect microbial pathogens in foods. Conventional methods based on cultivation of pathogens have been the gold standard protocols; however, they take up to a week to complete. Molecular assays such as polymerase chain reaction (PCR, sequencing, microarray technologies have been widely used in detection of foodborne pathogens. Among molecular assays, PCR technology conventional and real-time PCR (qPCR is most commonly used in the foodborne pathogen detection because of its high sensitivity and specificity. However, a major drawback of PCR is its inability to differentiate the DNA from dead and viable cells, and this is a critical factor for the food industry, regulatory agencies and the consumer. To remedy this shortcoming, researchers have used biological dyes such as ethidium monoazide (EMA and propidium monoazide (PMA to pretreat samples before DNA extraction to intercalate the DNA of dead cells in food samples, and then proceed with regular DNA preparation and qPCR. By combining PMA treatment with qPCR (PMA-qPCR, scientists have applied this technology to detect viable cells of various bacterial pathogens in foods. The incorporation of PMA into PCR-based assays for viability detection of pathogens in foods has increased significantly in the last decade. On the other hand, some downsides with this approach have been noted, particularly to achieve complete suppression of signal of DNA from the dead cells present in some particular food matrix. Nowadays, there is a tendency of more and more researchers adapting this approach for viability detection; and a few commercial kits based on PMA are available in the market. As time goes on, more scientists apply this approach to a broader range of pathogen detections, this viability approach (PMA or other chemicals such as platinum compound

Contamination of infectious RD-114 virus in vaccines produced using non-feline cell lines.

Science.gov (United States)

Yoshikawa, Rokusuke; Sato, Eiji; Miyazawa, Takayuki

2011-01-01

All domestic cats have a replication-competent endogenous retrovirus, termed RD-114 virus, in their genome and several feline cell lines produce RD-114 viruses. Recently, we found that a portion of live attenuated feline and canine vaccines produced using feline cell lines was contaminated with infectious RD-114 viruses. In this study, we expanded our survey and examined canine vaccines produced using 'non-feline' cell lines. Consequently, we found two vaccines containing RD-114 viral RNA by reverse transcriptase (RT)-polymerase chain reaction (PCR) and real-time RT-PCR. We also confirmed the presence of infectious RD-114 virus in the vaccines by the LacZ marker rescue assay and PCR to detect proviral DNA in TE671 cells (human rhabdomyosarcoma cells) inoculated with the vaccines. It is impossible to investigate the definitive cause of contamination with RD-114 virus; however, we suspect that a seed canine parvovirus type 2 was contaminated with RD-114 virus, because many canine parvoviruses have been isolated and attenuated using feline cell lines. To exclude RD-114 virus from live attenuated vaccines, we must pay attention to the contamination of seed viruses with RD-114 virus in addition to avoiding feline cell lines producing RD-114 virus when manufacturing vaccines. Copyright © 2010 The International Association for Biologicals. Published by Elsevier Ltd. All rights reserved.

The role of natural killer T cells in dendritic cell licensing, cross-priming and memory CD8+ T cell generation

Directory of Open Access Journals (Sweden)

Catherine eGottschalk

2015-07-01

Full Text Available New vaccination strategies focus on achieving CD8+ T cell (CTL immunity rather than on induction of protective antibody responses. While the requirement of CD4+ T (Th cell help in dendritic cell (DC activation and licensing, and in CTL memory induction has been described in several disease models, CTL responses may occur in a Th cell help independent manner. Natural Killer T cells (NKT cells can substitute for Th cell help and license DC as well. NKT cells produce a broad spectrum of Th1 and Th2 cytokines, thereby inducing a similar set of costimulatory molecules and cytokines in DC. This form of licensing differs from Th cell help by inducing other chemokines: while Th cell licensed DC produce CCR5 ligands, NKT cell-licensed DC produce CCL17 which attracts CCR4+ CD8+ T cells for subsequent activation. It has recently been shown that iNKT cells do not only enhance immune responses against bacterial pathogens or parasites, but also play a role in viral infections. The inclusion of NKT cell ligands in Influenza virus vaccines enhanced memory CTL generation and protective immunity in a mouse model. This review will focus on the role of iNKT cells in the cross-talk with cross-priming DC and memory CD8+ T cell formation.

Escaping Underground Nets: Extracellular DNases Degrade Plant Extracellular Traps and Contribute to Virulence of the Plant Pathogenic Bacterium Ralstonia solanacearum

Science.gov (United States)