WorldWideScience

Sample records for cells expressing keratinocyte

  1. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  2. Podoplanin expression in peritumoral keratinocytes predicts aggressive behavior in extramammary Paget's disease.

    Science.gov (United States)

    Cho, Zaigen; Konishi, Eiichi; Kanemaru, Mai; Isohisa, Taro; Arita, Takahiro; Kawai, Minako; Tsutsumi, Miho; Mizutani, Hiromi; Takenaka, Hideya; Ozawa, Toshiyuki; Tsuruta, Daisuke; Katoh, Norito; Asai, Jun

    2017-07-01

    Recent studies have demonstrated podoplanin expression in several tumors, which has been associated with lymph node metastasis and poor prognosis. Podoplanin expression in peritumoral cells such as cancer-associated fibroblasts also correlates with tumor progression in several cancers. However, podoplanin expression and its association with extramammary Paget's disease (EMPD) remain unclear. In this study, we examined whether the presence of podoplanin expression in tumor cells or peritumoral basal keratinocytes correlated with aggressive behavior in patients with EMPD and investigated the mechanisms of podoplanin-mediated tumor invasion in this disorder. Skin samples of 37 patients with EMPD were investigated by immunohistochemical analysis. The functions of podoplanin in keratinocytes were examined in vitro by RT-PCR and with invadopodia gelatin-degradation assays using HaCaT cells. Podoplanin was not identified in tumor cells in all cases. Podoplanin expression in peritumoral basal keratinocytes was observed in 25 patients (67.6%). In in situ EMPD, 50% of cases (9 in 18) exhibited podoplanin-positive keratinocytes, whereas 84.2% (16 in 19) demonstrated positive staining in invasive EMPD (P<0.05). Podoplanin expression in peritumoral keratinocytes was also associated with tumor thickness (P<0.005). By immunohistochemical analysis, podoplanin-positive peritumoral keratinocytes were found to be negative for E-cadherin, one of the major adhesion molecules of keratinocytes, which might contribute to tumor invasion into the dermis through a crack in the basal cell layer induced by down-regulation of cell adhesion therein. We further found that podoplanin-positive keratinocytes exhibited invadopodia, which are thought to function in the migration of cancer cells through tissue barriers, indicating that podoplanin-positive peritumoral basal keratinocytes might assist tumor invasion by degrading the extracellular matrix. The presence of podoplanin expression in

  3. Modulation of interferon-gamma-induced HLA-DR expression on the human keratinocyte cell line SCC-13 by ultraviolet radiation

    International Nuclear Information System (INIS)

    Khan, I.U.; Boehm, K.D.; Elmets, C.A.

    1993-01-01

    Cell surface expression of major histocompatibility determinants on epidermal keratinocytes is a characteristic feature of a number of inflammatory dermatoses and in all likelihood is caused by diffusion of human leukocyte antigen (HLA)-DR-inducing cytokines from cells present in the dermal mononuclear cell infiltrate. Many of these same disorders respond to ultraviolet (UV) radiation phototherapy. Using the human SCC-13 keratinocyte cell line as a model, UV radiation was found to inhibit interferon-gamma-induced HLA-DR expression. Inhibition correlated closely with decreased steady-state levels of HLA-DR mRNA. These findings provide evidence that the therapeutic effect of UV radiation phototherapy may be mediated by its capacity to down-regulate cytokine-induced keratinocyte HLA-DR expression. (Author)

  4. Enhanced expression of IL-8 in normal human keratinocytes and human keratinocyte cell line HaCaT in vitro after stimulation with contact sensitizers, tolerogens and irritants.

    Science.gov (United States)

    Mohamadzadeh, M; Müller, M; Hultsch, T; Enk, A; Saloga, J; Knop, J

    1994-12-01

    To investigate the interleukin-8 production of keratinocytes after stimulation in vitro we have used various agents: (i) contact sensitizer (2,4-dinitrofluorobenzene, 3-n-pentadecylcatechol); (ii) tolerogen (5-methyl-3-n-pentadecylcatechol); (iii) irritant (sodium lauryl sulfate). Interleukin-8 gene expression was assessed by northern blot hybridization of the total cytoplasmic RNA extracted from subconfluent normal human keratinocyte cultures and the keratinocyte cell line HaCaT using a radiolabeled DNA probe specific for human interleukin-8. Interleukin-8 gene expression was markedly increased upon in vitro stimulation after 1-6 h with contact sensitizers, tolerogen and the irritant. In contrast, interleukin-8 production was not detectable in unstimulated normal human keratinocytes or the HaCaT keratinocyte cell line. These results suggest that the induction and production of interleukin-8 is a response to nonspecific stimuli and may play a critical role in the early response to immunogenic or inflammatory signals in man.

  5. Analysis of aquaporin 9 expression in human epidermis and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Yoshinori Sugiyama

    2014-01-01

    Full Text Available Aquaporin 9 (AQP9 is a member of the aquaglyceroporin family that transports glycerol, urea and other small solutes as well as water. Compared to the expression and function in epidermal keratinocytes of AQP3, another aquaglyceroporin, our knowledge of epidermal AQP9 remains elusive. In this study, we investigated the expression of AQP9 in the human epidermis and cultured keratinocytes. Immunofluorescence studies revealed that AQP9 expression is highly restricted to the stratum granulosum of the human epidermis, where occludin is also expressed at the tight junctions. Interestingly, the AQP3 staining decreased sharply below the cell layers in which AQP9 is expressed. In cultured normal human epidermal keratinocytes (NHEK, knock-down of AQP9 expression in the differentiated cells induced by RNA interference reduced glycerol uptake, which was not as pronounced as was the case with AQP3 knock-down cells. In contrast, similar reduction of urea uptake was detected in AQP9 and AQP3 knock-down cells. These findings suggested that AQP9 expression in NHEK facilitates at least the transport of glycerol and urea. Finally, we analyzed the effect of retinoic acid (RA, a potent stimulator of keratinocyte proliferation, on AQP3 and AQP9 mRNA expression in differentiated NHEK. Stimulation with RA at 1 μM for 24 h augmented AQP3 expression and down-regulated AQP9 expression. Collectively, these results indicate that AQP9 expression in epidermal keratinocytes is regulated in a different manner from that of AQP3.

  6. Fos and jun proteins are specifically expressed during differentiation of human keratinocytes.

    Science.gov (United States)

    Mehic, Denis; Bakiri, Latifa; Ghannadan, Minoo; Wagner, Erwin F; Tschachler, Erwin

    2005-01-01

    Activator protein 1 (AP-1) proteins play key roles in the regulation of cell proliferation and differentiation. In this study we investigated the expression of Fos and Jun proteins in different models of terminal differentiation of human keratinocytes and in skin from psoriasis patients. All Jun and Fos proteins, with the exception of FosB, were efficiently expressed in keratinocytes in monolayer cultures. In contrast, in normal epidermis as well as in organotypic epidermal cultures, the expression pattern of AP-1 proteins was dependent on the differentiation stage. Fos proteins were readily detected in nuclei of keratinocytes of basal and suprabasal layers. JunB and JunD were expressed in all layers of normal epidermis. Interestingly, expression of c-Jun started suprabasally, then disappeared and became detectable again in distinct cells of the outermost granular layer directly at the transition zone to the stratum corneum. In psoriatic epidermis, c-Jun expression was prominent in both hyperproliferating basal and suprabasal keratinocytes, whereas c-Fos expression was unchanged. These data indicate that AP-1 proteins are expressed in a highly specific manner during terminal differentiation of keratinocytes and that the enhanced expression of c-Jun in basal and suprabasal keratinocytes might contribute to the pathogenesis of psoriasis.

  7. Th17 cell-mediated immune responses promote mast cell proliferation by triggering stem cell factor in keratinocytes

    International Nuclear Information System (INIS)

    Cho, Kyung-Ah; Park, Minhwa; Kim, Yu-Hee; Woo, So-Youn

    2017-01-01

    Although mast cells are traditionally thought to function as effector cells in allergic responses, they have increasingly been recognized as important regulators of various immune responses. Mast cells mature locally; thus, tissue-specific influences are important for promoting mast cell accumulation and survival in the skin and the gastrointestinal tract. In this study, we determined the effects of keratinocytes on mast cell accumulation during Th17-mediated skin inflammation. We observed increases in dermal mast cells in imiquimod-induced psoriatic dermatitis in mice accompanied by the expression of epidermal stem cell factor (SCF), a critical mast cell growth factor. Similar to mouse epidermal keratinocytes, SCF was highly expressed in the human HaCaT keratinocyte cell line following stimulation with IL−17. Further, keratinocytes promoted mast cell proliferation following stimulation with IL−17 in vitro. However, the effects of keratinocytes on mast cells were significantly diminished in the presence of anti−CD117 (stem cell factor receptor) blocking antibodies. Taken together, our results revealed that the Th17-mediated inflammatory environment promotes mast cell accumulation through keratinocyte-derived SCF. - Highlights: • Psoriasis-like skin inflammation increase dermal mast cells. • Keratinocyte produce stem cell factor in psoriasis-like skin inflammation. • Keratinocyte promote mast cell proliferation by stem cell factor dependent manner

  8. T-plastin expression downstream to the calcineurin/NFAT pathway is involved in keratinocyte migration.

    Directory of Open Access Journals (Sweden)

    Cécilia Brun

    Full Text Available Cutaneous wound healing requires keratinocyte proliferation, migration and differentiation to restore the barrier function of the skin. The calcineurin/nuclear factor of activated-T-cell (NFAT signaling pathway has been recently shown to be involved in keratinocyte growth, differentiation and migration. It is induced by an increased intracellular calcium rate and its inhibition results in decreased capacities of keratinocytes to migrate. Nevertheless, the link between calcineurin activation and keratinocyte migration remains unknown. Recently, Orai1, a pore subunit of a store-operated calcium channel that favors calcium influx, was shown to play a critical role to control proliferation and migration of basal keratinocytes. Of interest, the actin-bundling T-plastin is crucial in cell motility through cross-linking to actin filament and its synthesis was shown to be induced by calcium influx and regulated by the calcineurin/NFAT pathway in tumor Sezary cells. We investigated herein the role of the calcineurin/NFAT pathway-dependent T-plastin in keratinocyte migration, by quantifying T-plastin expression in keratinocytes and by analyzing their migration under calcineurin inhibition or knockdown of NFAT2 or T-plastin. We did confirm the role of the calcineurin/NFAT pathway in keratinocyte migration as shown by their decreased capacities to migrate after FK506 treatment or siNFAT2 transfection in both scratching and Boyden assays. The expression of NFAT2 and T-plastin in keratinocytes was decreased under FK506 treatment, suggesting that T-plastin plays a role in keratinocyte migration downstream to the calcineurin/NFAT pathway. Accordingly, siRNA knockdown of T-plastin expression also decreased their migration capacities. Actin lamellipodia formation as well as FAK and β6-integrin expression were also significantly decreased after treatment with FK506 or siRNA, reinforcing that NFAT2-dependent T-plastin expression plays a role in keratinocyte

  9. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  10. Ca2+-dependent localization of integrin-linked kinase to cell junctions in differentiating keratinocytes.

    Science.gov (United States)

    Vespa, Alisa; Darmon, Alison J; Turner, Christopher E; D'Souza, Sudhir J A; Dagnino, Lina

    2003-03-28

    Integrin complexes are necessary for proper proliferation and differentiation of epidermal keratinocytes. Differentiation of these cells is accompanied by down-regulation of integrins and focal adhesions as well as formation of intercellular adherens junctions through E-cadherin homodimerization. A central component of integrin adhesion complexes is integrin-linked kinase (ILK), which can induce loss of E-cadherin expression and epithelial-mesenchymal transformation when ectopically expressed in intestinal and mammary epithelia. In cultured primary mouse keratinocytes, we find that ILK protein levels are independent of integrin expression and signaling, since they remain constant during Ca(2+)-induced differentiation. In contrast, keratinocyte differentiation is accompanied by marked reduction in kinase activity in ILK immunoprecipitates and altered ILK subcellular distribution. Specifically, ILK distributes in close apposition to actin fibers along intercellular junctions in differentiated but not in undifferentiated keratinocytes. ILK localization to cell-cell borders occurs independently of integrin signaling and requires Ca(2+) as well as an intact actin cytoskeleton. Further, and in contrast to what is observed in other epithelial cells, ILK overexpression in differentiated keratinocytes does not promote E-cadherin down-regulation and epithelial-mesenchymal transition. Thus, novel tissue-specific mechanisms control the formation of ILK complexes associated with cell-cell junctions in differentiating murine epidermal keratinocytes.

  11. Modulation of keratinocyte expression of antioxidants by 4-hydroxynonenal, a lipid peroxidation end product

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Ruijin [Pharmacology and Toxicology and Pharmaceutics, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, NJ (United States); Heck, Diane E. [Environmental Health Science, New York Medical College, Valhalla, NY (United States); Mishin, Vladimir; Black, Adrienne T. [Pharmacology and Toxicology and Pharmaceutics, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, NJ (United States); Shakarjian, Michael P. [Environmental Health Science, New York Medical College, Valhalla, NY (United States); Kong, Ah-Ng Tony; Laskin, Debra L. [Pharmacology and Toxicology and Pharmaceutics, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, NJ (United States); Laskin, Jeffrey D., E-mail: jlaskin@eohsi.rutgers.edu [Environmental and Occupational Medicine, Rutgers University-Robert Wood Johnson Medical School, Piscataway, NJ (United States)

    2014-03-01

    4-Hydroxynonenal (4-HNE) is a lipid peroxidation end product generated in response to oxidative stress in the skin. Keratinocytes contain an array of antioxidant enzymes which protect against oxidative stress. In these studies, we characterized 4-HNE-induced changes in antioxidant expression in mouse keratinocytes. Treatment of primary mouse keratinocytes and PAM 212 keratinocytes with 4-HNE increased mRNA expression for heme oxygenase-1 (HO-1), catalase, NADPH:quinone oxidoreductase (NQO1) and glutathione S-transferase (GST) A1-2, GSTA3 and GSTA4. In both cell types, HO-1 was the most sensitive, increasing 86–98 fold within 6 h. Further characterization of the effects of 4-HNE on HO-1 demonstrated concentration- and time-dependent increases in mRNA and protein expression which were maximum after 6 h with 30 μM. 4-HNE stimulated keratinocyte Erk1/2, JNK and p38 MAP kinases, as well as PI3 kinase. Inhibition of these enzymes suppressed 4-HNE-induced HO-1 mRNA and protein expression. 4-HNE also activated Nrf2 by inducing its translocation to the nucleus. 4-HNE was markedly less effective in inducing HO-1 mRNA and protein in keratinocytes from Nrf2 −/− mice, when compared to wild type mice, indicating that Nrf2 also regulates 4-HNE-induced signaling. Western blot analysis of caveolar membrane fractions isolated by sucrose density centrifugation demonstrated that 4-HNE-induced HO-1 is localized in keratinocyte caveolae. Treatment of the cells with methyl-β-cyclodextrin, which disrupts caveolar structure, suppressed 4-HNE-induced HO-1. These findings indicate that 4-HNE modulates expression of antioxidant enzymes in keratinocytes, and that this can occur by different mechanisms. Changes in expression of keratinocyte antioxidants may be important in protecting the skin from oxidative stress. - Highlights: • Lipid peroxidation generates 4-hydroxynonenal, a reactive aldehyde. • 4-HNE induces antioxidant proteins in mouse keratinocytes. • Induction of

  12. miR-24 and miR-205 expression is dependent on HPV onco-protein expression in keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    McKenna, Declan J., E-mail: dj.mckenna@ulster.ac.uk [Biomedical Sciences Research Institute, University of Ulster, Coleraine, Co. Derry BT52 1SA (United Kingdom); Centre for Cancer Research and Cell Biology, School of Medicine, Dentistry and Biomedical Science, Queen' s University Belfast, Belfast BT9 7BL (United Kingdom); Patel, Daksha, E-mail: d.patel@qub.ac.uk [Centre for Cancer Research and Cell Biology, School of Medicine, Dentistry and Biomedical Science, Queen' s University Belfast, Belfast BT9 7BL (United Kingdom); McCance, Dennis J., E-mail: d.mccance@qub.ac.uk [Centre for Cancer Research and Cell Biology, School of Medicine, Dentistry and Biomedical Science, Queen' s University Belfast, Belfast BT9 7BL (United Kingdom)

    2014-01-05

    A screen of microRNA (miRNA) expression following differentiation in human foreskin keratinocytes (HFKs) identified changes in several miRNAs, including miR-24 and miR-205. We investigated how expression of Human Papilloma Virus Type-16 (HPV16) onco-proteins E6 and E7 affected expression of miR-24 and miR-205 during proliferation and differentiation of HFKs. We show that the induction of both miR-24 and miR-205 observed during differentiation of HFKs is lost in HFKs expressing E6 and E7. We demonstrate that the effect on miR-205 is due to E7 activity, as miR-205 expression is dependent on pRb expression. Finally, we provide evidence that miR-24 effects in the cell may be due to targeting of cyclin dependent kinase inhibitor p27. In summary, these results indicate that expression of both miR-24 and miR-205 are impacted by E6 and/or E7 expression, which may be one mechanism by which HPV onco-proteins can disrupt the balance between proliferation and differentiation in keratinocytes. - Highlights: • miR-24 and miR-205 are induced during keratinocyte differentiation. • This induction is lost in keratinocytes expressing HPV onco-proteins E6 and E7. • miR-205 is dependent upon pRb expression. • miR-24 targets p27 in cycling keratinocytes.

  13. miR-24 and miR-205 expression is dependent on HPV onco-protein expression in keratinocytes

    International Nuclear Information System (INIS)

    McKenna, Declan J.; Patel, Daksha; McCance, Dennis J.

    2014-01-01

    A screen of microRNA (miRNA) expression following differentiation in human foreskin keratinocytes (HFKs) identified changes in several miRNAs, including miR-24 and miR-205. We investigated how expression of Human Papilloma Virus Type-16 (HPV16) onco-proteins E6 and E7 affected expression of miR-24 and miR-205 during proliferation and differentiation of HFKs. We show that the induction of both miR-24 and miR-205 observed during differentiation of HFKs is lost in HFKs expressing E6 and E7. We demonstrate that the effect on miR-205 is due to E7 activity, as miR-205 expression is dependent on pRb expression. Finally, we provide evidence that miR-24 effects in the cell may be due to targeting of cyclin dependent kinase inhibitor p27. In summary, these results indicate that expression of both miR-24 and miR-205 are impacted by E6 and/or E7 expression, which may be one mechanism by which HPV onco-proteins can disrupt the balance between proliferation and differentiation in keratinocytes. - Highlights: • miR-24 and miR-205 are induced during keratinocyte differentiation. • This induction is lost in keratinocytes expressing HPV onco-proteins E6 and E7. • miR-205 is dependent upon pRb expression. • miR-24 targets p27 in cycling keratinocytes

  14. Effects of UVB irradiation on keratinocyte growth factor (KGF) and receptor (KGFR) expression in cultured human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Y.; Lee, H.S.T.; Kooshesh, F.; Fujisawa, H.; Sauder, D.N.; Kondo, S. [Univ. of Toronto, Sunnybrook Health Science Centre, Div. of Dermatology, Toronto (Canada)

    1996-06-01

    Keratinocyte growth factor (KGF) and its receptor (KGFR) are thought to play important roles in normal keratinocyte growth and differentiation. Since UVB radiation is known to influence keratinocyte growth, we sought to determine whether UVB would alter the expression of KGF and KGFR. Using a reverse-transcription coupled polymerase chain reaction (RT-PCR), the present study examined the expression of KGF and KGFR mRNA in cultured normal human keratinocytes exposed to UVB irradiation. Total cellular RNA was extracted from cultured keratinocytes at various time points after irradiation, reverse transcribed and used for PCR amplification using primers specific for KGF and KGFR. Constitutive expression of KGFR mRNA, but not KGF mRNA, was detected in normal cultured human keratinocytes. After UVB irradiation at 300 J/m{sup 2}, the KGF mRNA remained undetectable while the KGFR mRNA level was significantly decreased. The down-regulation of KGFR mRNA expression was also confirmed by Northern blot analysis. Immunohistochemical studies demonstrated a decreased positive signal of KGFR in human keratinocytes after UVB irradiation. Our results suggest a possible role for the KGF-KGFR signalling pathway in the skin after exposure to UVB, and that UVB-induced growth inhibition of keratinocytes in hyperproliferative skin disorders may be related to downregulation of KGFR. (au) 39 refs.

  15. Differential Gene Expression in Primary Human Skin Keratinocytes and Fibroblasts in Response to Ionizing Radiation

    Science.gov (United States)

    Warters, Raymond L.; Packard, Ann T.; Kramer, Gwen F.; Gaffney, David K.; Moos, Philip J.

    2009-01-01

    Although skin is usually exposed during human exposures to ionizing radiation, there have been no thorough examinations of the transcriptional response of skin fibroblasts and keratinocytes to radiation. The transcriptional response of quiescent primary fibroblasts and keratinocytes exposed to from 10 cGy to 5 Gy and collected 4 h after treatment was examined. RNA was isolated and examined by microarray analysis for changes in the levels of gene expression. Exposure to ionizing radiation altered the expression of 279 genes across both cell types. Changes in RNA expression could be arranged into three main categories: (1) changes in keratinocytes but not in fibroblasts, (2) changes in fibroblasts but not in keratinocytes, and (3) changes in both. All of these changes were primarily of p53 target genes. Similar radiation-induced changes were induced in immortalized fibroblasts or keratinocytes. In separate experiments, protein was collected and analyzed by Western blotting for expression of proteins observed in microarray experiments to be overexpressed at the mRNA level. Both Q-PCR and Western blot analysis experiments validated these transcription changes. Our results are consistent with changes in the expression of p53 target genes as indicating the magnitude of cell responses to ionizing radiation. PMID:19580510

  16. Derivation of keratinocytes from chicken embryonic stem cells: Establishment and characterization of differentiated proliferative cell populations

    Directory of Open Access Journals (Sweden)

    Mathilde Couteaudier

    2015-03-01

    Full Text Available A common challenge in avian cell biology is the generation of differentiated cell-lines, especially in the keratinocyte lineage. Only a few avian cell-lines are available and very few of them show an interesting differentiation profile. During the last decade, mammalian embryonic stem cell-lines were shown to differentiate into almost all lineages, including keratinocytes. Although chicken embryonic stem cells had been obtained in the 1990s, few differentiation studies toward the ectodermal lineage were reported. Consequently, we explored the differentiation of chicken embryonic stem cells toward the keratinocyte lineage by using a combination of stromal induction, ascorbic acid, BMP4 and chicken serum. During the induction period, we observed a downregulation of pluripotency markers and an upregulation of epidermal markers. Three homogenous cell populations were derived, which were morphologically similar to chicken primary keratinocytes, displaying intracellular lipid droplets in almost every pavimentous cell. These cells could be serially passaged without alteration of their morphology and showed gene and protein expression profiles of epidermal markers similar to chicken primary keratinocytes. These cells represent an alternative to the isolation of chicken primary keratinocytes, being less cumbersome to handle and reducing the number of experimental animals used for the preparation of primary cells.

  17. miR-125b inhibits keratinocyte proliferation and promotes keratinocyte apoptosis in oral lichen planus by targeting MMP-2 expression through PI3K/Akt/mTOR pathway.

    Science.gov (United States)

    Wang, Jing; Luo, Hong; Xiao, Yan; Wang, Luyao

    2016-05-01

    Oral lichen planus (OLP) is a chronic inflammatory mucosal disease that involves the degeneration of keratinocytes. However, the etiology and mechanisms of OLP pathogenesis have not been fully elucidated. In this study, we used keratinocytes HaCaT stimulated with lipopolysaccharide (LPS) to mimic a local OLP immune environment, and investigated the regulatory role of miR-125b in keratinocyte proliferation and apoptosis under OLP conditions. Immunohistochemical analysis and quantitative real-time PCR (qRT-PCR) assay showed that MMP-2 expression was up-regulated and miR-125b expression was down-regulated in both OLP mucosa tissues and LPS-incubated HaCaT cells. Western blot analysis indicated that miR-125b overexpression suppressed LPS-induced MMP-2 expression in HaCaT cells. Molecularly, our results confirmed that MMP-2 is a target gene of miR-125b in HaCaT cells. The effect of miR-125b on cell proliferation was revealed by CCK-8 assay, BrdU assay and cell cycle analysis, which illustrated that miR-125b overexpression impeded LPS-induced HaCaT cell proliferation. Flow cytometry analysis further demonstrated that miR-125b overexpression promoted HaCaT cell apoptosis. Moreover, these effects were involved in PI3K/Akt/mTOR activation, as miR-125b overexpression inhibited LPS-enhanced expression of p-Akt and p-mTOR proteins. Taken together, these data confirm that miR-125b might inhibit keratinocyte proliferation and promote keratinocyte apoptosis in OLP pathogenesis by targeting MMP-2 through PI3K/Akt/mTOR pathway. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  18. Pimecrolimus enhances TLR2/6-induced expression of antimicrobial peptides in keratinocytes.

    Science.gov (United States)

    Büchau, Amanda S; Schauber, Jürgen; Hultsch, Thomas; Stuetz, Anton; Gallo, Richard L

    2008-11-01

    Calcineurin inhibitors are potent inhibitors of T-cell-receptor mediated activation of the adaptive immune system. The effects of this class of drug on the innate immune response system are not known. Keratinocytes are essential to innate immunity in skin and rely on toll-like receptors (TLRs) and antimicrobial peptides to appropriately recognize and respond to injury or microbes. In this study we examined the response of cultured human keratinocytes to pimecrolimus. We observed that pimecrolimus enhances distinct expression of cathelicidin, CD14, and human beta-defensin-2 and beta-defensin-3 in response to TLR2/6 ligands. Some of these responses were further enhanced by 1,25 vitamin D3. Pimecrolimus also increased the functional capacity of keratinocytes to inhibit growth of Staphylococcus aureus and decreased TLR2/6-induced expression of IL-10 and IL-1beta. Furthermore, pimecrolimus inhibited nuclear translocation of NFAT and NF-kappaB in keratinocytes. These observations uncover a previously unreported function for pimecrolimus in cutaneous innate host defense.

  19. Markedly diminished epidermal keratinocyte expression of intercellular adhesion molecule-1 (ICAM-1) in Sezary syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Nickoloff, B.J.; Griffiths, E.M.; Baadsgaard, O.; Voorhees, J.J.; Hanson, C.A.; Cooper, K.D. (Univ. of Michigan Medical Center, Ann Arbor (USA))

    1989-04-21

    In mucosis fungoides the malignant T cells express lymphocyte function-associated antigen-1, which allows them to bind to epidermal keratinocytes expressing the gamma interferon-inducible intercellular adhesion molecule-1. In this report, a patient with leukemic-stage mucosis fungoides (Sezary syndrome) had widespread erythematous dermal infiltrates containing malignant T cells, but without any epidermotropism. The authors discovered that the T cells expressed normal amounts of functional lymphocyte function-associated antigen-1, but the keratinocytes did not express significant levels of intercellular adhesion molecule-1, which was probably due to the inability of the malignant T cells to produce gamma interferon. These results support the concept that the inability of malignant T cells to enter the epidermis may contribute to emergence of more clinically aggressive T-cell clones that are no longer confined to the skin, but infiltrate the blood, lymph nodes, and viscera, as is seen in Sezary syndrome.

  20. Increased oxidative stress and antioxidant expression in mouse keratinocytes following exposure to paraquat

    International Nuclear Information System (INIS)

    Black, Adrienne T.; Gray, Joshua P.; Shakarjian, Michael P.; Laskin, Debra L.; Heck, Diane E.; Laskin, Jeffrey D.

    2008-01-01

    Paraquat (1,1'-dimethyl-4,4'-bipyridinium) is a widely used herbicide known to induce skin toxicity. This is thought to be due to oxidative stress resulting from the generation of cytotoxic reactive oxygen intermediates (ROI) during paraquat redox cycling. The skin contains a diverse array of antioxidant enzymes which protect against oxidative stress including superoxide dismutase (SOD), catalase, glutathione peroxidase-1 (GPx-1), heme oxygenase-1 (HO-1), metallothionein-2 (MT-2), and glutathione-S-transferases (GST). In the present studies we compared paraquat redox cycling in primary cultures of undifferentiated and differentiated mouse keratinocytes and determined if this was associated with oxidative stress and altered expression of antioxidant enzymes. We found that paraquat readily undergoes redox cycling in both undifferentiated and differentiated keratinocytes, generating superoxide anion and hydrogen peroxide as well as increased protein oxidation which was greater in differentiated cells. Paraquat treatment also resulted in increased expression of HO-1, Cu,Zn-SOD, catalase, GSTP1, GSTA3 and GSTA4. However, no major differences in expression of these enzymes were evident between undifferentiated and differentiated cells. In contrast, expression of GSTA1-2 was significantly greater in differentiated relative to undifferentiated cells after paraquat treatment. No changes in expression of MT-2, Mn-SOD, GPx-1, GSTM1 or the microsomal GST's mGST1, mGST2 and mGST3, were observed in response to paraquat. These data demonstrate that paraquat induces oxidative stress in keratinocytes leading to increased expression of antioxidant genes. These intracellular proteins may be important in protecting the skin from paraquat-mediated cytotoxicity

  1. Curcuma longa Is Able to Induce Apoptotic Cell Death of Pterygium-Derived Human Keratinocytes.

    Science.gov (United States)

    Sancilio, Silvia; Di Staso, Silvio; Sebastiani, Stefano; Centurione, Lucia; Di Girolamo, Nick; Ciancaglini, Marco; Di Pietro, Roberta

    2017-01-01

    Pterygium is a relatively common eye disease that can display an aggressive clinical behaviour. To evaluate the in vitro effects of Curcuma longa on human pterygium-derived keratinocytes, specimens of pterygium from 20 patients undergoing pterygium surgical excision were collected. Pterygium explants were put into culture and derived keratinocytes were treated with an alcoholic extract of 1.3% Curcuma longa in 0.001% Benzalkonium Chloride for 3, 6, and 24 h. Cultured cells were examined for CAM5.2 (anti-cytokeratin antibody) and CD140 (anti-fibroblast transmembrane glycoprotein antibody) expression between 3th and 16th passage to assess cell homogeneity. TUNEL technique and Annexin-V/PI staining in flow cytometry were used to detect keratinocyte apoptosis. We showed that Curcuma longa exerts a proapoptotic effect on pterygium-derived keratinocytes already after 3 h treatment. Moreover, after 24 h treatment, Curcuma longa induces a significant increase in TUNEL as well as Annexin-V/PI positive cells in comparison to untreated samples. Our study confirms previous observations highlighting the expression, in pterygium keratinocytes, of nuclear VEGF and gives evidence for the first time to the expression of nuclear and cytoplasmic VEGF-R1. All in all, these findings suggest that Curcuma longa could have some therapeutic potential in the treatment and prevention of human pterygium.

  2. Curcuma longa Is Able to Induce Apoptotic Cell Death of Pterygium-Derived Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Silvia Sancilio

    2017-01-01

    Full Text Available Pterygium is a relatively common eye disease that can display an aggressive clinical behaviour. To evaluate the in vitro effects of Curcuma longa on human pterygium-derived keratinocytes, specimens of pterygium from 20 patients undergoing pterygium surgical excision were collected. Pterygium explants were put into culture and derived keratinocytes were treated with an alcoholic extract of 1.3% Curcuma longa in 0.001% Benzalkonium Chloride for 3, 6, and 24 h. Cultured cells were examined for CAM5.2 (anti-cytokeratin antibody and CD140 (anti-fibroblast transmembrane glycoprotein antibody expression between 3th and 16th passage to assess cell homogeneity. TUNEL technique and Annexin-V/PI staining in flow cytometry were used to detect keratinocyte apoptosis. We showed that Curcuma longa exerts a proapoptotic effect on pterygium-derived keratinocytes already after 3 h treatment. Moreover, after 24 h treatment, Curcuma longa induces a significant increase in TUNEL as well as Annexin-V/PI positive cells in comparison to untreated samples. Our study confirms previous observations highlighting the expression, in pterygium keratinocytes, of nuclear VEGF and gives evidence for the first time to the expression of nuclear and cytoplasmic VEGF-R1. All in all, these findings suggest that Curcuma longa could have some therapeutic potential in the treatment and prevention of human pterygium.

  3. Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo

    2011-01-01

    Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

  4. Upregulation of cathepsin S in psoriatic keratinocytes.

    Science.gov (United States)

    Schönefuss, Alexander; Wendt, Wiebke; Schattling, Benjamin; Schulten, Roxane; Hoffmann, Klaus; Stuecker, Markus; Tigges, Christian; Lübbert, Hermann; Stichel, Christine

    2010-08-01

    Cathepsin S (CATS) is a cysteine protease, well known for its role in MHC class II-mediated antigen presentation and extracellular matrix degradation. Disturbance of the expression or metabolism of this protease is a concomitant feature of several diseases. Given this importance we studied the localization and regulation of CATS expression in normal and pathological human/mouse skin. In normal human skin CATS-immunostaining is mainly present in the dermis and is localized in macrophages, Langerhans, T- and endothelial cells, but absent in keratinocytes. In all analyzed pathological skin biopsies, i.e. atopic dermatitis, actinic keratosis and psoriasis, CATS staining is strongly increased in the dermis. But only in psoriasis, CATS-immunostaining is also detectable in keratinocytes. We show that cocultivation with T-cells as well as treatment with cytokines can trigger expression and secretion of CATS, which is involved in MHC II processing in keratinocytes. Our data provide first evidence that CATS expression (i) is selectively induced in psoriatic keratinocytes, (ii) is triggered by T-cells and (iii) might be involved in keratinocytic MHC class II expression, the processing of the MHC class II-associated invariant chain and remodeling of the extracellular matrix. This paper expands our knowledge on the important role of keratinocytes in dermatological disease.

  5. Interaction of Mycobacterium leprae with the HaCaT human keratinocyte cell line: new frontiers in the cellular immunology of leprosy.

    Science.gov (United States)

    Lyrio, Eloah C D; Campos-Souza, Ivy C; Corrêa, Luiz C D; Lechuga, Guilherme C; Verícimo, Maurício; Castro, Helena C; Bourguignon, Saulo C; Côrte-Real, Suzana; Ratcliffe, Norman; Declercq, Wim; Santos, Dilvani O

    2015-07-01

    Leprosy is a chronic granulomatous disease caused by Mycobacterium leprae affecting the skin and peripheral nerves. Despite M. leprae invasion of the skin and keratinocytes importance in innate immunity, the interaction of these cells in vitro during M. leprae infection is poorly understood. Conventional and fluorescence optical microscopy, transmission electronic microscopy, flow cytometry and ELISA were used to study the in vitro interaction of M. leprae with the HaCaT human keratinocyte cell line. Keratinocytes uptake of M. leprae is described, and modulation of the surface expression of CD80 and CD209, cathelicidin expression and TNF-α and IL-1β production of human keratinocytes are compared with dendritic cells and macrophages during M. leprae interaction. This study demonstrated that M. leprae interaction with human keratinocytes enhanced expression of cathelicidin and greatly increased TNF-α production. The highest spontaneous expression of cathelicidin was by dendritic cells which are less susceptible to M. leprae infection. In contrast, keratinocytes displayed low spontaneous cathelicidin expression and were more susceptible to M. leprae infection than dendritic cells. The results show, for the first time, an active role for keratinocytes during infection by irradiated whole cells of M. leprae and the effect of vitamin D on this process. They also suggest that therapies which target cathelicidin modulation may provide novel approaches for treatment of leprosy. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. The herpes simplex virus-induced demise of keratinocytes is associated with a dysregulated pattern of p63 expression.

    Science.gov (United States)

    Megyeri, Klára; Orosz, László; Kormos, Bernadett; Pásztor, Katalin; Seprényi, György; Ocsovszki, Imre; Mándi, Yvette; Bata-Csörgo, Zsuzsanna; Kemény, Lajos

    2009-01-01

    p63 plays a pivotal role in the development and maintenance of stratified epithelial tissues. In an effort to gain insight into the pathogenic mechanisms of skin infections caused by HSV-1 and HSV-2, we determined the patterns of p63 expression in primary keratinocytes and in the HaCaT cell line. The levels of DeltaNp63alpha and a 50kDa p73 isoform were decreased, Bax-alpha remained unaffected, while the expressions of the Bax-beta, TAp63gamma and a 44.5kDa p73 isoform were highly increased in both HSV-1-infected HaCaT cells and primary keratinocytes. In contrast, in response to HSV-2 infection the levels of DeltaNp63alpha, a 50kDa p73 isoform and a 44.5kDa p73 protein were decreased, Bax-alpha and TAp63gamma remained unaffected, while the expression of Bax-beta was slightly increased. The knockdown of TAp63 expression enhanced the viability of HSV-1-infected cells. Thus, HSV-1 and HSV-2 modulate the patterns of p63 and Bax expression in a serotype-specific manner. The dysregulated pattern of p63 expression observed in HSV-infected keratinocytes may comprise part of a mechanism by which these viruses perturb the functions of keratinocytes and lead to their demise.

  7. Single Low-Dose Radiation Induced Regulation of Keratinocyte Differentiation in Calcium-Induced HaCaT Cells

    Science.gov (United States)

    Hahn, Hyung Jin; Youn, Hae Jeong; Cha, Hwa Jun; Kim, Karam; An, Sungkwan

    2016-01-01

    Background We are continually exposed to low-dose radiation (LDR) in the range 0.1 Gy from natural sources, medical devices, nuclear energy plants, and other industrial sources of ionizing radiation. There are three models for the biological mechanism of LDR: the linear no-threshold model, the hormetic model, and the threshold model. Objective We used keratinocytes as a model system to investigate the molecular genetic effects of LDR on epidermal cell differentiation. Methods To identify keratinocyte differentiation, we performed western blots using a specific antibody for involucrin, which is a precursor protein of the keratinocyte cornified envelope and a marker for keratinocyte terminal differentiation. We also performed quantitative polymerase chain reaction. We examined whether LDR induces changes in involucrin messenger RNA (mRNA) and protein levels in calcium-induced keratinocyte differentiation. Results Exposure of HaCaT cells to LDR (0.1 Gy) induced p21 expression. p21 is a key regulator that induces growth arrest and represses stemness, which accelerates keratinocyte differentiation. We correlated involucrin expression with keratinocyte differentiation, and examined the effects of LDR on involucrin levels and keratinocyte development. LDR significantly increased involucrin mRNA and protein levels during calcium-induced keratinocyte differentiation. Conclusion These studies provide new evidence for the biological role of LDR, and identify the potential to utilize LDR to regulate or induce keratinocyte differentiation. PMID:27489424

  8. Efficient generation of integration-free human induced pluripotent stem cells from keratinocytes by simple transfection of episomal vectors.

    Science.gov (United States)

    Piao, Yulan; Hung, Sandy Shen-Chi; Lim, Shiang Y; Wong, Raymond Ching-Bong; Ko, Minoru S H

    2014-07-01

    Keratinocytes represent an easily accessible cell source for derivation of human induced pluripotent stem (hiPS) cells, reportedly achieving higher reprogramming efficiency than fibroblasts. However, most studies utilized a retroviral or lentiviral method for reprogramming of keratinocytes, which introduces undesirable transgene integrations into the host genome. Moreover, current protocols of generating integration-free hiPS cells from keratinocytes are mostly inefficient. In this paper, we describe a more efficient, simple-to-use, and cost-effective method for generating integration-free hiPS cells from keratinocytes. Our improved method using lipid-mediated transfection achieved a reprogramming efficiency of ∼0.14% on average. Keratinocyte-derived hiPS cells showed no integration of episomal vectors, expressed stem cell-specific markers and possessed potentials to differentiate into all three germ layers by in vitro embryoid body formation as well as in vivo teratoma formation. To our knowledge, this represents the most efficient method to generate integration-free hiPS cells from keratinocytes. ©AlphaMed Press.

  9. Sustainability of keratinocyte gene transfer and cell survival in vivo.

    Science.gov (United States)

    Choate, K A; Khavari, P A

    1997-05-20

    The epidermis is an attractive site for therapeutic gene delivery because it is accessible and capable of delivering polypeptides to the systemic circulation. A number of difficulties, however, have emerged in attempts at cutaneous gene delivery, and central among these is an inability to sustain therapeutic gene production. We have examined two major potential contributing factors, viral vector stamina and involvement of long-lived epidermal progenitor cells. Human keratinocytes were either untreated or transduced with a retroviral vector for beta-galactosidase (beta-Gal) at > 99% efficiency and then grafted onto immunodeficient mice to regenerate human epidermis. Human epidermis was monitored in vivo after grafting for clinical and histologic appearance as well as for gene expression. Although integrated vector sequences persisted unchanged in engineered epidermis at 10 weeks post-grafting, retroviral long terminal repeat (LTR)-driven beta-Gal expression ceased in vivo after approximately 4 weeks. Endogenous cellular promoters, however, maintained consistently normal gene expression levels without evidence of time-dependent decline, as determined by immunostaining with species-specific antibodies for human involucrin, filaggrin, keratinocyte transglutaminase, keratin 10, type VII collagen, and Laminin 5 proteins out to week 14 post-grafting. Transduced human keratinocytes generated multilayer epidermis sustained through multiple epidermal turnover cycles; this epidermis demonstrated retention of a spatially appropriate pattern of basal and suprabasal epidermal marker gene expression. These results confirm previous findings suggesting that viral promoter-driven gene expression is not durable and demonstrate that keratinocytes passaged in vitro can regenerate and sustain normal epidermis for prolonged periods.

  10. Exogenous hydrogen sulfide promotes cell proliferation and differentiation by modulating autophagy in human keratinocytes

    International Nuclear Information System (INIS)

    Xie, Xin; Dai, Hui; Zhuang, Binyu; Chai, Li; Xie, Yanguang; Li, Yuzhen

    2016-01-01

    The effects and the underlying mechanisms of hydrogen sulfide (H 2 S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H 2 S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H 2 S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H 2 S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H 2 S promotes keratinocyte proliferation and differentiation. • The effects of H 2 S on proliferation and differentiation is modulated by autophagy. • Exogenous H 2 S has no effect on keratinocyte apoptosis.

  11. Expression of paired-like homeodomain transcription factor 2c (PITX2c) in epidermal keratinocytes

    International Nuclear Information System (INIS)

    Shi, Ge; Sohn, Kyung-Cheol; Choi, Tae-Young; Choi, Dae-Kyoung; Lee, Sang-Sin; Ou, Bai-sheng; Kim, Sooil; Lee, Young Ho; Yoon, Tae-Jin; Kim, Seong-Jin; Lee, Young; Seo, Young-Joon; Lee, Jeung-Hoon; Kim, Chang Deok

    2010-01-01

    Paired-like homeodomain transcription factor 2 (PITX2) has been implicated as one of the genes responsible for Rieger syndrome. It has been also shown to play a central role during development. In this study, we investigated the functional role of PITX2 in keratinocyte differentiation. RT-PCR analysis showed that PITX2c isoform was predominantly expressed in a differentiation-dependent manner. Consistent with, immunohistochemical staining showed that PITX2 expression was increased in the upper layer of epidermis. When PITX2c was overexpressed in cultured keratinocytes by a recombinant adenovirus, the differentiation markers such as involucrin and loricrin were significantly increased at both mRNA and protein levels. In addition, PITX2c overexpression led to the decrease of cell growth, concomitantly with the upregulation of cell cycle-related genes p21. To investigate the effect of PITX2c in vivo, we microinjected PITX2c expression vector into zebrafish embryo. Interestingly, overexpression of PITX2c in zebrafish embryo led to the formation of horn-like structure and thickening of epidermis, together with the increase of keratin 8 (K8) expression. These results suggest that PITX2c has a role in proliferation and differentiation of epidermal keratinocytes.

  12. Expression of paired-like homeodomain transcription factor 2c (PITX2c) in epidermal keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Ge [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Department of Dermatology, The First Affiliated Hospital, Guangxi Traditional Chinese Medical University, Guangxi, Nanning, 530023 (China); Sohn, Kyung-Cheol; Choi, Tae-Young; Choi, Dae-Kyoung; Lee, Sang-Sin [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Ou, Bai-sheng [Department of Dermatology, The First Affiliated Hospital, Guangxi Traditional Chinese Medical University, Guangxi, Nanning, 530023 (China); Kim, Sooil; Lee, Young Ho [Department of Anatomy, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Yoon, Tae-Jin [Department of Dermatology, School of Medicine, Gyeongsang National University, Jinju, 660-702 (Korea, Republic of); Institute of Health Sciences, School of Medicine, Gyeongsang National University, Jinju, 660-702 (Korea, Republic of); Kim, Seong-Jin [Department of Dermatology, Chonnam National University Medical School, Gwangju, 501-757 (Korea, Republic of); Lee, Young; Seo, Young-Joon; Lee, Jeung-Hoon [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Kim, Chang Deok, E-mail: cdkimd@cnu.ac.kr [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of)

    2010-11-15

    Paired-like homeodomain transcription factor 2 (PITX2) has been implicated as one of the genes responsible for Rieger syndrome. It has been also shown to play a central role during development. In this study, we investigated the functional role of PITX2 in keratinocyte differentiation. RT-PCR analysis showed that PITX2c isoform was predominantly expressed in a differentiation-dependent manner. Consistent with, immunohistochemical staining showed that PITX2 expression was increased in the upper layer of epidermis. When PITX2c was overexpressed in cultured keratinocytes by a recombinant adenovirus, the differentiation markers such as involucrin and loricrin were significantly increased at both mRNA and protein levels. In addition, PITX2c overexpression led to the decrease of cell growth, concomitantly with the upregulation of cell cycle-related genes p21. To investigate the effect of PITX2c in vivo, we microinjected PITX2c expression vector into zebrafish embryo. Interestingly, overexpression of PITX2c in zebrafish embryo led to the formation of horn-like structure and thickening of epidermis, together with the increase of keratin 8 (K8) expression. These results suggest that PITX2c has a role in proliferation and differentiation of epidermal keratinocytes.

  13. Exogenous hydrogen sulfide promotes cell proliferation and differentiation by modulating autophagy in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Xin [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Dai, Hui [Department of Cardiology, The First Affiliated Hospital of Harbin Medical University, Harbin, 150001, Heilongjiang Province (China); Zhuang, Binyu [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Chai, Li; Xie, Yanguang [Institute of Dermatology of Heilongjiang Province, Harbin, 150001, Heilongjiang Province (China); Li, Yuzhen, E-mail: liyuzhen@medmail.com.cn [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China)

    2016-04-08

    The effects and the underlying mechanisms of hydrogen sulfide (H{sub 2}S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H{sub 2}S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H{sub 2}S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H{sub 2}S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H{sub 2}S promotes keratinocyte proliferation and differentiation. • The effects of H{sub 2}S on proliferation and differentiation is modulated by autophagy. • Exogenous H{sub 2}S has no effect on keratinocyte apoptosis.

  14. Elevated YAP and its downstream targets CCN1 and CCN2 in basal cell carcinoma: impact on keratinocyte proliferation and stromal cell activation.

    Science.gov (United States)

    Quan, Taihao; Xu, Yiru; Qin, Zhaoping; Robichaud, Patrick; Betcher, Stephanie; Calderone, Ken; He, Tianyuan; Johnson, Timothy M; Voorhees, John J; Fisher, Gary J

    2014-04-01

    Yes-associated protein (YAP) is a transcriptional co-activator of hippo signaling pathway, which plays an important role in organ size control and tumorigenesis. Here we report that YAP and its downstream transcriptional targets CCN1 and CCN2 are markedly elevated in keratinocytes in human skin basal cell carcinoma tumor islands. In human keratinocytes, knockdown of YAP significantly reduced expression of CCN1 and CCN2, and repressed proliferation and survival. This inhibition of proliferation and survival was rescued by restoration of CCN1 expression, but not by CCN2 expression. In basal cell carcinoma stroma, CCN2-regulated genes type I collagen, fibronectin, and α-smooth muscle actin were highly expressed. Furthermore, atomic force microscopy revealed increased tissue stiffness in basal cell carcinoma stroma compared to normal dermis. These data provide evidence that up-regulation of YAP in basal cell carcinoma impacts both aberrant keratinocyte proliferation, via CCN1, and tumor stroma cell activation and stroma remodeling, via CCN2. Targeting YAP and/or CCN1 and CCN2 may provide clinical benefit in basal cell carcinoma. Copyright © 2014 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  15. Interleukin 1 gene expression in cultured human keratinocytes is augmented by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Kupper, T.S.; Chua, A.O.; Flood, P.; McGuire, J.; Gubler, U.

    1987-01-01

    Interleukin 1 (IL-1) is a family of polypeptides initially found to be produced by activated monocytes and macrophages that mediate a wide variety of cellular responses to injury and infection. Epidermal epithelial cells (keratinocytes) produce ''epidermal cell-derived thymocyte activating factor'' or ETAF, which has been recently shown to be identical to IL-1. Human epidermis is normally exposed to significant amounts of solar ultraviolet radiation. Certain ultraviolet wavelengths (UVB, 290-320 nm) are thought to be responsible for most of the immediate and long-term pathological consequences of excessive exposure to sunlight. In this study, we asked whether exposure to UVB irradiation induced IL-1 gene expression in cultured human keratinocytes. Cultured human keratinocytes contain detectable amounts of IL-1 alpha and beta mRNA and protein in the absence of apparent stimulation; these levels could be significantly enhanced 6 h after exposure to 10 ng/ml of 12-O-tetradecanoyl-phorbol-13-acetate (TPA). Exposure to UVB irradiation with an emission spectrum comparable to that of sunlight (as opposed to that of an unfiltered artificial UV light source) significantly increased the steady state levels IL-1 alpha and beta mRNA in identical populations of human keratinocytes. This was reflected in the production of increased IL-1 activity by these cultures in vitro. In the same cell population, exposures to UVB irradiation did not alter the level of actin mRNA; therefore, the effect of UV irradiation on IL-1 represents a specific enhancement of IL-1 gene expression. Local increases of IL-1 may mediate the inflammation and vasodilation characteristic of acute UVB-injured skin, and systemic release of this epidermal IL-1 may account for fever, leukocytosis, and the acute phase response seen after excessive sun exposure

  16. The stress caused by nitrite with titanium dioxide nanoparticles under UVA irradiation in human keratinocyte cell

    International Nuclear Information System (INIS)

    Tu, Min; Huang, Yi; Li, Hai-Ling; Gao, Zhong-Hong

    2012-01-01

    Highlights: ► Nitrite increased photo-toxicity of nano-TiO 2 on human keratinocyte cells in a dose-dependant manner. ► Morphological study suggested the cell death may be mediated by apoptosis inducing factor. ► Protein nitration was generated in the cells, and the most abundant nitrated protein was identified as cystatin-A. ► Tyr35 was the most likely site to be nitrated in cystatin-A. -- Abstract: Our previous work found that in the presence of nitrite, titanium dioxide nanoparticles can cause protein tyrosine nitration under UVA irradiation in vivo. In this paper, the human keratinocyte cells was used as a skin cell model to further study the photo-toxicity of titanium dioxide nanoparticles when nitrite was present. The results showed that nitrite increased the photo-toxicity of titanium dioxide in a dose-dependant manner, and generated protein tyrosine nitration in keratinocyte cells. Morphological study of keratinocyte cells suggested a specific apoptosis mediated by apoptosis inducing factor. It was also found the main target nitrated in cells was cystatin-A, which expressed abundantly in cytoplasm and functioned as a cysteine protease inhibitor. The stress induced by titanium dioxide with nitrite under UVA irradiation in human keratinocyte cells appeared to trigger the apoptosis inducing factor mediated cell death and lose the inhibition of active caspase by cystatin-A. We conclude that nitrite can bring new damage and stress to human keratinocyte cells with titanium dioxide nanoparticles under UVA irradiation.

  17. FOXO1 expression in keratinocytes promotes connective tissue healing

    Science.gov (United States)

    Zhang, Chenying; Lim, Jason; Liu, Jian; Ponugoti, Bhaskar; Alsadun, Sarah; Tian, Chen; Vafa, Rameen; Graves, Dana T.

    2017-01-01

    Wound healing is complex and highly orchestrated. It is well appreciated that leukocytes, particularly macrophages, are essential for inducing the formation of new connective tissue, which requires the generation of signals that stimulate mesenchymal stem cells (MSC), myofibroblasts and fibroblasts. A key role for keratinocytes in this complex process has yet to be established. To this end, we investigated possible involvement of keratinocytes in connective tissue healing. By lineage-specific deletion of the forkhead box-O 1 (FOXO1) transcription factor, we demonstrate for the first time that keratinocytes regulate proliferation of fibroblasts and MSCs, formation of myofibroblasts and production of collagen matrix in wound healing. This stimulation is mediated by a FOXO1 induced TGFβ1/CTGF axis. The results provide direct evidence that epithelial cells play a key role in stimulating connective tissue healing through a FOXO1-dependent mechanism. Thus, FOXO1 and keratinocytes may be an important therapeutic target where healing is deficient or compromised by a fibrotic outcome. PMID:28220813

  18. Effect of irradiation on cell cycle, cell death and expression of its related proteins in normal human oral keratinocytes

    International Nuclear Information System (INIS)

    Kang, Mi Ae; Heo, Min Suk; Lee, Sam Sun; Oh, Sung Ook; Choi, Soon Chul; Park, Tae Won; Lee, Sul Mi; Jeon, In Seong

    2003-01-01

    To investigate the radiosensitivity of the normal human oral keratinocytes (NHOK), and the effect of irradiation on cell cycle and protein expression. To evaluate the radiosensitivity of NHOK, the number of colonies and cells were counted after irradiation and the SF2 (survival fraction as 2 Gy) value, and the cell survival curve fitted on a linear-quadratic model were obtained. LDH analysis was carried out to evaluate the necrosis of NHOK at 1, 2,3, and 4 days after 2, 10, and 20 Gy irradiation. Cell cycle arrest and the induction of apoptosis were analyzed using flow cytometry at 1, 2, 3, and 4 days after 2, 10, and 20 Gy irradiation. Finally, proteins related cell cycle arrest and apoptosis were analysed by Western blot. The number of survival cell was significantly decreased in a dose-dependent manner. The cell survival curve showed SF2, α, and β values to be 0.568, 0.209, and 0.020 respectively. At 20 Gy irradiated cells showed higher optical density than the control group. After irradiation, apoptosis was not observed but G2 arrest was observed in the NHOK cells. 1 day after 10 Gy irradiation, the expression of p53 remained unchanged, the p21 WAF1/Cip1 increased and the mdm2 decreased. The expression of bax, bcl-2, cyclin B1, and cyclin D remained unchanged. These results indicate that NHOK responds to irradiation by G2 arrest, which is possibly mediated by the expression of p21 WAF1/Cip1 , and that cell necrosis occurs by high dose irradiation.

  19. Laser capture microdissection-based in vivo genomic profiling of wound keratinocytes identifies similarities and differences to squamous cell carcinoma

    DEFF Research Database (Denmark)

    Pedersen, Tanja Xenia; Leethanakul, Chidchanop; Patel, Vyomesh

    2003-01-01

    keratinocytes from incisional mouse skin wounds and adjacent normal skin keratinocytes. Changes in gene expression were determined by comparative cDNA array analyses, and the approach was validated by in situ hybridization. The analyses identified 48 candidate genes not previously associated with wound...... reepithelialization. Furthermore, the analyses revealed that the phenotypic resemblance of wound keratinocytes to squamous cell carcinoma is mimicked at the level of gene expression, but notable differences between the two tissue-remodeling processes were also observed. The combination of laser capture...

  20. Filaggrin-dependent secretion of sphingomyelinase protects against staphylococcal α-toxin-induced keratinocyte death.

    Science.gov (United States)

    Brauweiler, Anne M; Bin, Lianghua; Kim, Byung Eui; Oyoshi, Michiko K; Geha, Raif S; Goleva, Elena; Leung, Donald Y M

    2013-02-01

    The skin of patients with atopic dermatitis (AD) has defects in keratinocyte differentiation, particularly in expression of the epidermal barrier protein filaggrin. AD skin lesions are often exacerbated by Staphylococcus aureus-mediated secretion of the virulence factor α-toxin. It is unknown whether lack of keratinocyte differentiation predisposes to enhanced lethality from staphylococcal toxins. We investigated whether keratinocyte differentiation and filaggrin expression protect against cell death induced by staphylococcal α-toxin. Filaggrin-deficient primary keratinocytes were generated through small interfering RNA gene knockdown. RNA expression was determined by using real-time PCR. Cell death was determined by using the lactate dehydrogenase assay. Keratinocyte cell survival in filaggrin-deficient (ft/ft) mouse skin biopsies was determined based on Keratin 5 staining. α-Toxin heptamer formation and acid sphingomyelinase expression were determined by means of immunoblotting. We found that filaggrin expression, occurring as the result of keratinocyte differentiation, significantly inhibits staphylococcal α-toxin-mediated pathogenicity. Furthermore, filaggrin plays a crucial role in protecting cells by mediating the secretion of sphingomyelinase, an enzyme that reduces the number of α-toxin binding sites on the keratinocyte surface. Finally, we determined that sphingomyelinase enzymatic activity directly prevents α-toxin binding and protects keratinocytes against α-toxin-induced cytotoxicity. The current study introduces the novel concept that S aureus α-toxin preferentially targets and destroys filaggrin-deficient keratinocytes. It also provides a mechanism to explain the increased propensity for S aureus-mediated exacerbation of AD skin disease. Copyright © 2012 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

  1. Psoriatic T cells reduce epidermal turnover time and affect cell proliferation contributed from differential gene expression.

    Science.gov (United States)

    Li, Junqin; Li, Xinhua; Hou, Ruixia; Liu, Ruifeng; Zhao, Xincheng; Dong, Feng; Wang, Chunfang; Yin, Guohua; Zhang, Kaiming

    2015-09-01

    Psoriasis is mediated primarily by T cells, which reduce epidermal turnover time and affect keratinocyte proliferation. We aimed to identify differentially expressed genes (DEG) in T cells from normal, five pairs of monozygotic twins concordant or discordant for psoriasis, to determine whether these DEG may account for the influence to epidermal turnover time and keratinocyte proliferation. The impact of T cells on keratinocyte proliferation and epidermal turnover time were investigated separately by immunohistochemistry and cultured with (3) H-TdR. mRNA expression patterns were investigated by RNA sequencing and verified by real-time reverse transcription polymerase chain reaction. After co-culture with psoriatic T cells, the expression of Ki-67, c-Myc and p53 increased, while expression of Bcl-2 and epidermal turnover time decreased. There were 14 DEG which were found to participate in the regulation of cell proliferation or differentiation. Psoriatic T cells exhibited the ability to decrease epidermal turnover time and affect keratinocyte proliferation because of the differential expression of PPIL1, HSPH1, SENP3, NUP54, FABP5, PLEKHG3, SLC9A9 and CHCHD4. © 2015 Japanese Dermatological Association.

  2. Keratinocyte growth factor mRNA expression in periodontal ligament fibroblasts

    DEFF Research Database (Denmark)

    Dabelsteen, S; Wandall, H H; Grøn, B

    1997-01-01

    Keratinocyte growth factor (KGF) is a fibroblast growth factor which mediates epithelial growth and differentiation. KGF is expressed in subepithelial fibroblasts, but generally not in fibroblasts of deep connective tissue, such as fascia and ligaments. Here we demonstrate that KGF mRNA is expres......Keratinocyte growth factor (KGF) is a fibroblast growth factor which mediates epithelial growth and differentiation. KGF is expressed in subepithelial fibroblasts, but generally not in fibroblasts of deep connective tissue, such as fascia and ligaments. Here we demonstrate that KGF m......RNA is expressed in periodontal ligament fibroblasts, and that the expression is increased upon serum stimulation. Fibroblasts from human periodontal ligament, from buccal mucosa, from gingiva, and from skin were established from explants. Alkaline phosphatase activity was used as an indicator of the periodontal...

  3. Identification of p63+ keratinocyte progenitor cells in circulation and their matrix-directed differentiation to epithelial cells.

    Science.gov (United States)

    Nair, Renjith P; Krishnan, Lissy K

    2013-04-11

    In the event of chronic diabetes or burn wounds, accomplishing skin regeneration is a major concern. Autologous skin grafting is the most effective remedy, but the tissue harvest may create more nonhealing wounds. Currently available skin substitutes have a limited clinical outcome because of immune reactions arising from the xenobiotic scaffold or allogenous cells. Autologous stem cells that can be collected without an additional injury may be a viable option for skin-tissue engineering. Presence of a low number of keratinocyte progenitor cells (KPCs) within the peripheral blood mononuclear cell (PBMNC) population has been indicated. Identification, isolation, expansion, and differentiation of KPCs is necessary before they are considered for skin regeneration, which is the focus of this study. Culture of isolated human PBMNCs on a cell-specific matrix was carried out to induce differentiation of KPCs. Flow cytometry and reverse transcriptase polymerase chain reaction were done for epithelial stem cell marker p63 and lineage markers cytokeratin 5 and cytokeratin 14, to track differentiation. Proliferation was confirmed by quantifying the proliferating cell nuclear antigen-expressing cells. Immunostaining with epithelial cell markers, involucrin and filaggrin, was carried out to establish terminal differentiation. Microscopic analysis confirmed growth and survival of KPCs on the dermal fibroblast monolayer and on a transplantable fibrin sheet. We demonstrated that KPCs are p63(+) and CD34-. The specifically designed composition of the extracellular matrix was found to support selective adhesion, proliferation, and differentiation of p63(+) KPCs. The PBMNC culture for 12 days under controlled conditions resulted in a homogenous population that expressed cytokeratins, and >90% of the cells were found to proliferate. Subculture for 5 days resulted in expression of filaggrin and involucrin, suggesting terminal differentiation. Transfer of matrix-selected KPCs to a

  4. Mitogen activated protein kinases selectively regulate palytoxin-stimulated gene expression in mouse keratinocytes

    International Nuclear Information System (INIS)

    Zeliadt, Nicholette A.; Warmka, Janel K.; Wattenberg, Elizabeth V.

    2003-01-01

    We have been investigating how the novel skin tumor promoter palytoxin transmits signals through mitogen activated protein kinases (MAPKs). Palytoxin activates three major MAPKs, extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK), and p38, in a keratinocyte cell line derived from initiated mouse skin (308). We previously showed that palytoxin requires ERK to increase matrix metalloproteinase-13 (MMP-13) gene expression, an enzyme implicated in carcinogenesis. Diverse stimuli require JNK and p38 to increase MMP-13 gene expression, however. We therefore used the JNK and p38 inhibitors SP 600125 and SB 202190, respectively, to investigate the role of these MAPKs in palytoxin-induced MMP-13 gene expression. Surprisingly, palytoxin does not require JNK and p38 to increase MMP-13 gene expression. Accordingly, ERK activation, independent of palytoxin and in the absence of JNK and p38 activation, is sufficient to induce MMP-13 gene expression in 308 keratinocytes. Dexamethasone, a synthetic glucocorticoid that inhibits activator protein-1 (AP-1), blocked palytoxin-stimulated MMP-13 gene expression. Therefore, the AP-1 site present in the promoter of the MMP-13 gene appears to be functional and to play a key role in palytoxin-stimulated gene expression. Previous studies showed that palytoxin simulates an ERK-dependent selective increase in the c-Fos content of AP-1 complexes that bind to the promoter of the MMP-13 gene. JNK and p38 can also modulate c-Fos. Palytoxin does not require JNK or p38 to increase c-Fos binding, however. Altogether, these studies indicate that ERK plays a distinctly essential role in transmitting palytoxin-stimulated signals to specific nuclear targets in keratinocytes derived from initiated mouse skin

  5. HaCaT Keratinocytes and Primary Epidermal Keratinocytes Have Different Transcriptional Profiles of Cornified Envelope-Associated Genes to T Helper Cell Cytokines

    Science.gov (United States)

    Seo, Min-Duk; Kang, Tae Jin; Lee, Chang Hoon; Lee, Ai-Young; Noh, Minsoo

    2012-01-01

    HaCaT cells are the immortalized human keratinocytes and have been extensively used to study the epidermal homeostasis and its pathophysiology. T helper cells play a role in various chronic dermatological conditions and they can affect skin barrier homeostasis. To evaluate whether HaCaT cells can be used as a model cell system to study abnormal skin barrier development in various dermatologic diseases, we analyzed the gene expression profile of epidermal differentiation markers of HaCaT cells in response to major T helper (Th) cell cytokines, such as IFNγ, IL-4, IL-17A and IL-22. The gene transcriptional profile of cornified envelope-associated proteins, such as filaggrin, loricrin, involucrin and keratin 10 (KRT10), in HaCaT cells was generally different from that in normal human keratinocytes (NHKs). This suggests that HaCaT cells have a limitation as a model system to study the pathophysiological mechanism associated with the Th cell cytokine-dependent changes in cornified envelope-associated proteins which are essential for normal skin barrier development. In contrast, the gene transcription profile change of human β2-defensin (HBD2) in response to IFNγ, IL-4 or IL-17A in HaCaT cells was consistent with the expression pattern of NHKs. IFNγ also up-regulated transglutaminase 2 (TGM2) gene transcription in both HaCaT cells and NHKs. As an alternative cell culture system for NHKs, HaCaT cells can be used to study molecular mechanisms associated with abnormal HBD2 and TGM2 expression in response to IFNγ, IL-4 or IL-17A. PMID:24116291

  6. Oral keratinocytes support non-replicative infection and transfer of harbored HIV-1 to permissive cells.

    Science.gov (United States)

    Vacharaksa, Anjalee; Asrani, Anil C; Gebhard, Kristin H; Fasching, Claudine E; Giacaman, Rodrigo A; Janoff, Edward N; Ross, Karen F; Herzberg, Mark C

    2008-07-17

    Oral keratinocytes on the mucosal surface are frequently exposed to HIV-1 through contact with infected sexual partners or nursing mothers. To determine the plausibility that oral keratinocytes are primary targets of HIV-1, we tested the hypothesis that HIV-1 infects oral keratinocytes in a restricted manner. To study the fate of HIV-1, immortalized oral keratinocytes (OKF6/TERT-2; TERT-2 cells) were characterized for the fate of HIV-specific RNA and DNA. At 6 h post inoculation with X4 or R5-tropic HIV-1, HIV-1gag RNA was detected maximally within TERT-2 cells. Reverse transcriptase activity in TERT-2 cells was confirmed by VSV-G-mediated infection with HIV-NL4-3Deltaenv-EGFP. AZT inhibited EGFP expression in a dose-dependent manner, suggesting that viral replication can be supported if receptors are bypassed. Within 3 h post inoculation, integrated HIV-1 DNA was detected in TERT-2 cell nuclei and persisted after subculture. Multiply spliced and unspliced HIV-1 mRNAs were not detectable up to 72 h post inoculation, suggesting that HIV replication may abort and that infection is non-productive. Within 48 h post inoculation, however, virus harbored by CD4 negative TERT-2 cells trans infected co-cultured peripheral blood mononuclear cells (PBMCs) or MOLT4 cells (CD4+ CCR5+) by direct cell-to-cell transfer or by releasing low levels of infectious virions. Primary tonsil epithelial cells also trans infected HIV-1 to permissive cells in a donor-specific manner. Oral keratinocytes appear, therefore, to support stable non-replicative integration, while harboring and transmitting infectious X4- or R5-tropic HIV-1 to permissive cells for up to 48 h.

  7. Oral keratinocytes support non-replicative infection and transfer of harbored HIV-1 to permissive cells

    Directory of Open Access Journals (Sweden)

    Giacaman Rodrigo A

    2008-07-01

    Full Text Available Abstract Background Oral keratinocytes on the mucosal surface are frequently exposed to HIV-1 through contact with infected sexual partners or nursing mothers. To determine the plausibility that oral keratinocytes are primary targets of HIV-1, we tested the hypothesis that HIV-1 infects oral keratinocytes in a restricted manner. Results To study the fate of HIV-1, immortalized oral keratinocytes (OKF6/TERT-2; TERT-2 cells were characterized for the fate of HIV-specific RNA and DNA. At 6 h post inoculation with X4 or R5-tropic HIV-1, HIV-1gag RNA was detected maximally within TERT-2 cells. Reverse transcriptase activity in TERT-2 cells was confirmed by VSV-G-mediated infection with HIV-NL4-3Δenv-EGFP. AZT inhibited EGFP expression in a dose-dependent manner, suggesting that viral replication can be supported if receptors are bypassed. Within 3 h post inoculation, integrated HIV-1 DNA was detected in TERT-2 cell nuclei and persisted after subculture. Multiply spliced and unspliced HIV-1 mRNAs were not detectable up to 72 h post inoculation, suggesting that HIV replication may abort and that infection is non-productive. Within 48 h post inoculation, however, virus harbored by CD4 negative TERT-2 cells trans infected co-cultured peripheral blood mononuclear cells (PBMCs or MOLT4 cells (CD4+ CCR5+ by direct cell-to-cell transfer or by releasing low levels of infectious virions. Primary tonsil epithelial cells also trans infected HIV-1 to permissive cells in a donor-specific manner. Conclusion Oral keratinocytes appear, therefore, to support stable non-replicative integration, while harboring and transmitting infectious X4- or R5-tropic HIV-1 to permissive cells for up to 48 h.

  8. Synthetic antimicrobial and LPS-neutralising peptides suppress inflammatory and immune responses in skin cells and promote keratinocyte migration.

    Science.gov (United States)

    Pfalzgraff, Anja; Heinbockel, Lena; Su, Qi; Gutsmann, Thomas; Brandenburg, Klaus; Weindl, Günther

    2016-08-11

    The stagnation in the development of new antibiotics and the concomitant high increase of resistant bacteria emphasize the urgent need for new therapeutic options. Antimicrobial peptides are promising agents for the treatment of bacterial infections and recent studies indicate that Pep19-2.5, a synthetic anti-lipopolysaccharide (LPS) peptide (SALP), efficiently neutralises pathogenicity factors of Gram-negative (LPS) and Gram-positive (lipoprotein/-peptide, LP) bacteria and protects against sepsis. Here, we investigated the potential of Pep19-2.5 and the structurally related compound Pep19-4LF for their therapeutic application in bacterial skin infections. SALPs inhibited LP-induced phosphorylation of NF-κB p65 and p38 MAPK and reduced cytokine release and gene expression in primary human keratinocytes and dermal fibroblasts. In LPS-stimulated human monocyte-derived dendritic cells and Langerhans-like cells, the peptides blocked IL-6 secretion, downregulated expression of maturation markers and inhibited dendritic cell migration. Both SALPs showed a low cytotoxicity in all investigated cell types. Furthermore, SALPs markedly promoted cell migration via EGFR transactivation and ERK1/2 phosphorylation and accelerated artificial wound closure in keratinocytes. Peptide-induced keratinocyte migration was mediated by purinergic receptors and metalloproteases. In contrast, SALPs did not affect proliferation of keratinocytes. Conclusively, our data suggest a novel therapeutic target for the treatment of patients with acute and chronic skin infections.

  9. The Pseudomonas aeruginosa quorum sensing signal molecule N-(3-oxododecanoyl) homoserine lactone enhances keratinocyte migration and induces Mmp13 gene expression in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Paes, Camila, E-mail: camilaquinetti@gmail.com [University of Tokyo, Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Nakagami, Gojiro, E-mail: gojiron-tky@umin.ac.jp [University of Tokyo, Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Minematsu, Takeo, E-mail: tminematsu-tky@umin.ac.jp [University of Tokyo, Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Nagase, Takashi, E-mail: tnagase@fb3.so-net.ne.jp [University of Tokyo, Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Huang, Lijuan, E-mail: koureikenhlj@gmail.com [University of Tokyo, Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Sari, Yunita, E-mail: yunita-tky@umin.ac.jp [University of Tokyo, Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Sanada, Hiromi, E-mail: hsanada-tky@umin.ac.jp [University of Tokyo, Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan)

    2012-10-19

    Highlights: Black-Right-Pointing-Pointer An evidence of the positive effect of AHL on epithelialization process is provided. Black-Right-Pointing-Pointer AHL enhances keratinocyte's ability to migrate in an in vitro scratch wound model. Black-Right-Pointing-Pointer AHL induces the expression of Mmp13. Black-Right-Pointing-Pointer Topical application of AHL represents a possible strategy to treat chronic wounds. -- Abstract: Re-epithelialization is an essential step of wound healing involving three overlapping keratinocyte functions: migration, proliferation and differentiation. While quorum sensing (QS) is a cell density-dependent signaling system that enables bacteria to regulate the expression of certain genes, the QS molecule N-(3-oxododecanoyl) homoserine lactone (AHL) exerts effects also on mammalian cells in a process called inter-kingdom signaling. Recent studies have shown that AHL improves epithelialization in in vivo wound healing models but detailed understanding of the molecular and cellular mechanisms are needed. The present study focused on the AHL as a candidate reagent to improve wound healing through direct modulation of keratinocyte's activity in the re-epithelialization process. Results indicated that AHL enhances the keratinocyte's ability to migrate in an in vitro scratch wound healing model probably due to the high Mmp13 gene expression analysis after AHL treatment that was revealed by real-time RT-PCR. Inhibition of activator protein 1 (AP-1) signaling pathway completely prevented the migration of keratinocytes, and also resulted in a diminished Mmp13 gene expression, suggesting that AP-1 might be essential in the AHL-induced migration. Taken together, these results imply that AHL is a promising candidate molecule to improve re-epithelialization through the induction of migration of keratinocytes. Further investigation is needed to clarify the mechanism of action and molecular pathway of AHL on the keratinocyte migration

  10. Changes in localization of human discs large (hDlg) during keratinocyte differentiation is associated with expression of alternatively spliced hDlg variants

    International Nuclear Information System (INIS)

    Roberts, S.; Calautti, E.; Vanderweil, S.; Nguyen, H.O.; Foley, A.; Baden, H.P.; Viel, A.

    2007-01-01

    Alternative spliced variants of the human discs large (hDlg) tumour suppressor are characterized by combinations of insertions. Here, using insertions I2- and I3-specific antibodies, we show that I2 and I3 variants have distinct distributions in epidermal and cervical epithelia. In skin and cervix, I3 variants are found in the cytoplasm. Cytoplasmic localization of I3 variants decreases as cervical keratinocytes differentiate, concomitant with relocalization to the cell periphery. I2 variants are found at the cell periphery of differentiated epidermal and cervical keratinocytes. Nuclear localization of I2 variants was evident in both tissues, with concentration of nuclear I2 variants in basal and parabasal cervical keratinocytes. A prominent nuclear localization of hDlg in cells of hyperproliferative layers of psoriatic lesions, but not in mature differentiated keratinocytes, together with I2 redistribution in differentiating keratinocytes, suggests that nuclear hDlg functions may be pertinent to growth of undifferentiated cells. Supporting our findings in squamous tissues, a decrease of nuclear hDlg and an increase of membrane-bound and cytoplasmic hDlg upon calcium-induced keratinocyte differentiation were not concomitant processes. Furthermore, we confirm that the exit of I2 variants from the nucleus is linked to stimulation of epithelial differentiation. The dynamic redistribution of hDlg also correlated with a marked increase in the expression of I3 variants while the level of I2 variants showed only a moderate decrease. Because changes in the intracellular distribution of hDlg splice variants, and in their expression levels, correlate with changes in differentiation state we hypothesize that the different hDlg isoforms play distinct roles at various stages of epithelial differentiation

  11. Keratinocyte-derived laminin-332 protein promotes melanin synthesis via regulation of tyrosine uptake.

    Science.gov (United States)

    Chung, Heesung; Jung, Hyejung; Lee, Jung-Hyun; Oh, Hye Yun; Kim, Ok Bin; Han, Inn-Oc; Oh, Eok-Soo

    2014-08-01

    Melanocytes, which produce the pigment melanin, are known to be closely regulated by neighboring keratinocytes. However, how keratinocytes regulate melanin production is unclear. Here we report that melanin production in melanoma cells (B16F10 and MNT-1) was increased markedly on a keratinocyte-derived extracellular matrix compared with a melanoma cell-derived extracellular matrix. siRNA-mediated reduction of keratinocyte-derived laminin-332 expression decreased melanin synthesis in melanoma cells, and laminin-332, but not fibronectin, enhanced melanin content and α-melanocyte-stimulating hormone-regulated melanin production in melanoma cells. Similar effects were observed in human melanocytes. Interestingly, however, laminin-332 did not affect the expression or activity of tyrosinase. Instead, laminin-332 promoted the uptake of extracellular tyrosine and, subsequently, increased intracellular levels of tyrosine in both melanocytes and melanoma cells. Taken together, these data strongly suggest that keratinocyte-derived laminin-332 contributes to melanin production by regulating tyrosine uptake. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Eicosapentaenoic acid inhibits TNF-α-induced matrix metalloproteinase-9 expression in human keratinocytes, HaCaT cells

    International Nuclear Information System (INIS)

    Kim, Hyeon Ho; Lee, Youngae; Eun, Hee Chul; Chung, Jin Ho

    2008-01-01

    Eicosapentaenoic acid (EPA) is an omega-3 (ω-3) polyunsaturated fatty acid (PUFA), which has anti-inflammatory and anti-cancer properties. Some reports have demonstrated that EPA inhibits NF-κB activation induced by tumor necrosis factor (TNF)-α or lipopolysaccharide (LPS) in various cells. However, its detailed mode of action is unclear. In this report, we investigated whether EPA inhibits the expression of TNF-α-induced matrix metalloproteinases (MMP)-9 in human immortalized keratinocytes (HaCaT). TNF-α induced MMP-9 expression by NF-κB-dependent pathway. Pretreatment of EPA inhibited TNF-α-induced MMP-9 expression and p65 phosphorylation. However, EPA could not affect IκB-α phosphorylation, nuclear translocation of p65, and DNA binding activity of NF-κB. EPA inhibited TNF-α-induced p65 phosphorylation through p38 and Akt inhibition and this inhibition was IKKα-dependent event. Taken together, we demonstrate that EPA inhibits TNF-α-induced MMP-9 expression through inhibition of p38 and Akt activation

  13. Rat embryonic fibroblasts improve reprogramming of human keratinocytes into induced pluripotent stem cells.

    Science.gov (United States)

    Linta, Leonhard; Stockmann, Marianne; Kleinhans, Karin N; Böckers, Anja; Storch, Alexander; Zaehres, Holm; Lin, Qiong; Barbi, Gotthold; Böckers, Tobias M; Kleger, Alexander; Liebau, Stefan

    2012-04-10

    Patient-specific human induced pluripotent stem (hiPS) cells not only provide a promising tool for cellular disease models in general, but also open up the opportunity to establish cell-type-specific systems for personalized medicine. One of the crucial prerequisites for these strategies, however, is a fast and efficient reprogramming strategy from easy accessible somatic cell populations. Keratinocytes from plucked human hair had been introduced as a superior cell source for reprogramming purposes compared with the widely used skin fibroblasts. The starting cell population is, however, limited and thereby further optimization in terms of time, efficiency, and quality is inevitable. Here we show that rat embryonic fibroblasts (REFs) should replace mouse embryonic fibroblasts as feeder cells in the reprogramming process. REFs enable a significantly more efficient reprogramming procedure as shown by colony number and total amount of SSEA4-positive cells. We successfully produced keratinocyte-derived hiPS (k-hiPS) cells from various donors. The arising k-hiPS cells display the hallmarks of pluripotency such as expression of stem cell markers and differentiation into all 3 germ layers. The increased reprogramming efficiency using REFs as a feeder layer occurred independent of the proliferation rate in the parental keratinocytes and acts, at least in part, in a non-cell autonomous way by secreting factors known to facilitate pluripotency such as Tgfb1, Inhba and Grem1. Hence, we provide an easy to use and highly efficient reprogramming system that could be very useful for a broad application to generate human iPS cells. © Mary Ann Liebert, Inc.

  14. Hyperthermia-induced micronucleus formation in a human keratinocyte cell line

    International Nuclear Information System (INIS)

    Hintzsche, Henning; Riese, Thorsten; Stopper, Helga

    2012-01-01

    Elevated temperature can cause biological effects in vitro and in vivo. Many studies on effects of hypo- and hyperthermia have been conducted, but only few studies systematically investigated the formation of genomic damage in the micronucleus test in human cells in vitro as a consequence of different temperatures. In the present study, HaCaT human keratinocytes were exposed to different temperatures from 37 °C to 42 °C for 24 h in a regular cell culture incubator. Micronucleus frequency as a marker of genomic damage was elevated in a temperature-dependent and statistically significant manner. Apoptosis occurred at temperatures of 39 °C or higher. Cell proliferation was unaffected up to 40 °C and decreased at 41 °C and 42 °C. Expression of the heat shock protein Hsp70 was elevated, particularly at temperatures of 40 °C and higher. These findings are in agreement with several in vivo studies and some in vitro studies looking at single, specific temperatures, but a systematically investigated temperature-dependent increase of genomic damage in human keratinocytes in vitro is demonstrated for the first time here.

  15. Integrin β4 Regulates Migratory Behavior of Keratinocytes by Determining Laminin-332 Organization*s

    Science.gov (United States)

    Sehgal, Bernd U.; DeBiase, Phillip J.; Matzno, Sumio; Chew, Teng-Leong; Claiborne, Jessica N.; Hopkinson, Susan B.; Russell, Alan; Marinkovich, M. Peter; Jones, Jonathan C. R.

    2010-01-01

    Whether α6β4 integrin regulates migration remains controversial. β4 integrin-deficient (JEB) keratinocytes display aberrant migration in that they move in circles, a behavior that mirrors the circular arrays of laminin (LM)-332 in their matrix. In contrast, wild-type keratinocytes and JEB keratinocytes, induced to express β4 integrin, assemble laminin-332 in linear tracks over which they migrate. Moreover, laminin-332-dependent migration of JEB keratinocytes along linear tracks is restored when cells are plated on wild-type keratinocyte matrix, whereas wild-type keratinocytes show rotation over circular arrays of laminn-332 in JEB keratinocyte matrix. The activities of Rac1 and the actin cytoskeleton-severing protein cofilin are low in JEB keratinocytes compared with wild-type cells but are rescued following expression of wild-type β4 integrin in JEB cells. Additionally, in wild-type keratinocytes Rac1 is complexed with α6β4 integrin. Moreover, Rac1 or cofilin inactivation induces wild-type keratinocytes to move in circles over rings of laminin-332 in their matrix. Together these data indicate that laminin-332 matrix organization is determined by the α6β4 integrin/actin cytoskeleton via Rac1/cofilin signaling. Furthermore, our results imply that the organizational state of laminin-332 is a key determinant of the motility behavior of keratinocytes, an essential element of skin wound healing and the successful invasion of epidermal-derived tumor cells. PMID:16973601

  16. Characterization of Fetal Keratinocytes, Showing Enhanced Stem Cell-Like Properties: A Potential Source of Cells for Skin Reconstruction

    Directory of Open Access Journals (Sweden)

    Kenneth K.B. Tan

    2014-08-01

    Full Text Available Epidermal stem cells have been in clinical application as a source of culture-generated grafts. Although applications for such cells are increasing due to aging populations and the greater incidence of diabetes, current keratinocyte grafting technology is limited by immunological barriers and the time needed for culture amplification. We studied the feasibility of using human fetal skin cells for allogeneic transplantation and showed that fetal keratinocytes have faster expansion times, longer telomeres, lower immunogenicity indicators, and greater clonogenicity with more stem cell indicators than adult keratinocytes. The fetal cells did not induce proliferation of T cells in coculture and were able to suppress the proliferation of stimulated T cells. Nevertheless, fetal keratinocytes could stratify normally in vitro. Experimental transplantation of fetal keratinocytes in vivo seeded on an engineered plasma scaffold yielded a well-stratified epidermal architecture and showed stable skin regeneration. These results support the possibility of using fetal skin cells for cell-based therapeutic grafting.

  17. UVA and UVB Irradiation Differentially Regulate microRNA Expression in Human Primary Keratinocytes

    Science.gov (United States)

    Kraemer, Anne; Chen, I-Peng; Henning, Stefan; Faust, Alexandra; Volkmer, Beate; Atkinson, Michael J.; Moertl, Simone; Greinert, Ruediger

    2013-01-01

    MicroRNA (miRNA)-mediated regulation of the cellular transcriptome is an important epigenetic mechanism for fine-tuning regulatory pathways. These include processes related to skin cancer development, progression and metastasis. However, little is known about the role of microRNA as an intermediary in the carcinogenic processes following exposure to UV-radiation. We now show that UV irradiation of human primary keratinocytes modulates the expression of several cellular miRNAs. A common set of miRNAs was influenced by exposure to both UVA and UVB. However, each wavelength band also activated a distinct subset of miRNAs. Common sets of UVA- and UVB-regulated miRNAs harbor the regulatory elements GLYCA-nTRE, GATA-1-undefined-site-13 or Hox-2.3-undefined-site-2 in their promoters. In silico analysis indicates that the differentially expressed miRNAs responding to UV have potential functions in the cellular pathways of cell growth and proliferation. Interestingly, the expression of miR-23b, which is a differentiation marker of human keratinocytes, is remarkably up-regulated after UVA irradiation. Studying the interaction between miR-23b and its putative skin-relevant targets using a Luciferase reporter assay revealed that RRAS2 (related RAS viral oncogene homolog 2), which is strongly expressed in highly aggressive malignant skin cancer, to be a direct target of miR-23b. This study demonstrates for the first time a differential miRNA response to UVA and UVB in human primary keratinocytes. This suggests that selective regulation of signaling pathways occurs in response to different UV energies. This may shed new light on miRNA-regulated carcinogenic processes involved in UV-induced skin carcinogenesis. PMID:24391759

  18. UVA and UVB irradiation differentially regulate microRNA expression in human primary keratinocytes.

    Directory of Open Access Journals (Sweden)

    Anne Kraemer

    Full Text Available MicroRNA (miRNA-mediated regulation of the cellular transcriptome is an important epigenetic mechanism for fine-tuning regulatory pathways. These include processes related to skin cancer development, progression and metastasis. However, little is known about the role of microRNA as an intermediary in the carcinogenic processes following exposure to UV-radiation. We now show that UV irradiation of human primary keratinocytes modulates the expression of several cellular miRNAs. A common set of miRNAs was influenced by exposure to both UVA and UVB. However, each wavelength band also activated a distinct subset of miRNAs. Common sets of UVA- and UVB-regulated miRNAs harbor the regulatory elements GLYCA-nTRE, GATA-1-undefined-site-13 or Hox-2.3-undefined-site-2 in their promoters. In silico analysis indicates that the differentially expressed miRNAs responding to UV have potential functions in the cellular pathways of cell growth and proliferation. Interestingly, the expression of miR-23b, which is a differentiation marker of human keratinocytes, is remarkably up-regulated after UVA irradiation. Studying the interaction between miR-23b and its putative skin-relevant targets using a Luciferase reporter assay revealed that RRAS2 (related RAS viral oncogene homolog 2, which is strongly expressed in highly aggressive malignant skin cancer, to be a direct target of miR-23b. This study demonstrates for the first time a differential miRNA response to UVA and UVB in human primary keratinocytes. This suggests that selective regulation of signaling pathways occurs in response to different UV energies. This may shed new light on miRNA-regulated carcinogenic processes involved in UV-induced skin carcinogenesis.

  19. A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Lu Ying

    2004-04-01

    Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the

  20. Oxidative stress drives CD8+ T-cell skin trafficking in patients with vitiligo through CXCL16 upregulation by activating the unfolded protein response in keratinocytes.

    Science.gov (United States)

    Li, Shuli; Zhu, Guannan; Yang, Yuqi; Jian, Zhe; Guo, Sen; Dai, Wei; Shi, Qiong; Ge, Rui; Ma, Jingjing; Liu, Ling; Li, Kai; Luan, Qi; Wang, Gang; Gao, Tianwen; Li, Chunying

    2017-07-01

    In patients with vitiligo, an increased reactive oxygen species (ROS) level has been proved to be a key player during disease initiation and progression in melanocytes. Nevertheless, little is known about the effects of ROS on other cells involved in the aberrant microenvironment, such as keratinocytes and the following immune events. CXCL16 is constitutively expressed in keratinocytes and was recently found to mediate homing of CD8 + T cells in human skin. We sought to explicate the effect of oxidative stress on human keratinocytes and its capacity to drive CD8 + T-cell trafficking through CXCL16 regulation. We first detected putative T-cell skin-homing chemokines and ROS in serum and lesions of patients with vitiligo. The production of candidate chemokines was detected by using quantitative real-time PCR and ELISA in keratinocytes exposed to H 2 O 2 . Furthermore, the involved mediators were analyzed by using quantitative real-time PCR, Western blotting, ELISA, and immunofluorescence. Next, we tested the chemotactic migration of CD8 + T cells from patients with vitiligo mediated by the CXCL16-CXCR6 pair using the transwell assay. CXCL16 expression increased and showed a positive correlation with oxidative stress levels in serum and lesions of patients with vitiligo. The H 2 O 2 -induced CXCL16 expression was due to the activation of 2 unfolded protein response pathways: kinase RNA (PKR)-like ER kinase-eukaryotic initiation factor 2α and inositol-requiring enzyme 1α-X-box binding protein 1. CXCL16 produced by stressed keratinocytes induced migration of CXCR6 + CD8 + T cells derived from patients with vitiligo. CXCR6 + CD8 + T-cell skin infiltration is accompanied by melanocyte loss in lesions of patients with vitiligo. Our study demonstrated that CXCL16-CXCR6 mediates CD8 + T-cell skin trafficking under oxidative stress in patients with vitiligo. The CXCL16 expression in human keratinocytes induced by ROS is, at least in part, caused by unfolded protein response

  1. Inhibition of inflammatory gene expression in keratinocytes using a composition containing carnitine, thioctic Acid and saw palmetto extract.

    Science.gov (United States)

    Chittur, Sridar; Parr, Brian; Marcovici, Geno

    2011-01-01

    Chronic inflammation of the hair follicle (HF) is considered a contributing factor in the pathogenesis of androgenetic alopecia (AGA). Previously, we clinically tested liposterolic extract of Serenoa repens (LSESr) and its glycoside, β-sitosterol, in subjects with AGA and showed a highly positive response to treatment. In this study, we sought to determine whether blockade of inflammation using a composition containing LSESr as well as two anti-inflammatory agents (carnitine and thioctic acid) could alter the expression of molecular markers of inflammation in a well-established in vitro system. Using a well-validated assay representative of HF keratinocytes, specifically, stimulation of cultured human keratinocyte cells in vitro, we measured changes in gene expression of a spectrum of well-known inflammatory markers. Lipopolysaccharide (LPS) provided an inflammatory stimulus. In particular, we found that the composition effectively suppressed LPS-activated gene expression of chemokines, including CCL17, CXCL6 and LTB(4) associated with pathways involved in inflammation and apoptosis. Our data support the hypothesis that the test compound exhibits anti-inflammatory characteristics in a well-established in vitro assay representing HF keratinocyte gene expression. These findings suggest that 5-alpha reductase inhibitors combined with blockade of inflammatory processes could represent a novel two-pronged approach in the treatment of AGA with improved efficacy over current modalities.

  2. Aldefluor protocol to sort keratinocytes stem cells from skin

    OpenAIRE

    Noronha, Samuel Marcos Ribeiro; Gragnani, Alfredo; Pereira, Thiago Antônio Calado; Correa, Silvana Aparecida Alves; Bonucci, Jessica; Ferreira, Lydia Masako

    2017-01-01

    Abstract Purpose: To investigate the use Aldefluor® and N, N - Dimethylaminobenzaldehyde (DEAB) to design a protocol to sort keratinocyte stem cells from cultured keratinocytes from burned patients. Methods: Activated Aldefluor® aliquots were prepared and maintained at temperature between 2 to 8°C, or stored at -20°C. Next, the cells were collected following the standard protocol of sample preparation. Results: Best results were obtained with Aldefluor® 1.5µl and DEAB 15 µl for 1 x 106 c...

  3. Dysregulated ΔNp63α inhibits expression of Ink4a/arf, blocks senescence, and promotes malignant conversion of keratinocytes.

    Directory of Open Access Journals (Sweden)

    Linan Ha

    Full Text Available p63 is critical for squamous epithelial development, and elevated levels of the ΔNp63α isoform are seen in squamous cell cancers of various organ sites. However, significant controversy exists regarding the role of p63 isoforms as oncoproteins or tumor suppressors. Here, lentiviruses were developed to drive long-term overexpression of ΔNp63α in primary keratinocytes. Elevated levels of ΔNp63α in vitro promote long-term survival and block both replicative and oncogene-induced senescence in primary keratinocytes, as evidenced by the expression of SA-β-gal and the presence of nuclear foci of heterochromatin protein 1γ. The contribution of ΔNp63α to cancer development was assessed using an in vivo grafting model of experimental skin tumorigenesis that allows distinction between benign and malignant tumors. Grafted lenti-ΔNp63α keratinocytes do not form tumors, whereas lenti-GFP/v-ras(Ha keratinocytes develop well-differentiated papillomas. Lenti-ΔNp63α/v-ras(Ha keratinocytes form undifferentiated carcinomas. The average volume of lenti-ΔNp63α/v-ras(Ha tumors was significantly higher than those in the lenti-GFP/v-ras(Ha group, consistent with increased BrdU incorporation detected by immunohistochemistry. The block in oncogene-induced senescence corresponds to sustained levels of E2F1 and phosphorylated AKT, and is associated with loss of induction of p16(ink4a/p19(arf. The relevance of p16(ink4a/p19(arf loss was demonstrated in grafting studies of p19(arf-null keratinocytes, which develop malignant carcinomas in the presence of v-ras(Ha similar to those arising in wildtype keratinocytes that express lenti-ΔNp63α and v-ras(Ha. Our findings establish that ΔNp63α has oncogenic activity and its overexpression in human squamous cell carcinomas contributes to the malignant phenotype, and implicate its ability to regulate p16(ink4a/p19(arf in the process.

  4. A Sensitive Sensor Cell Line for the Detection of Oxidative Stress Responses in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Ute Hofmann

    2014-06-01

    Full Text Available In the progress of allergic and irritant contact dermatitis, chemicals that cause the generation of reactive oxygen species trigger a heat shock response in keratinocytes. In this study, an optical sensor cell line based on cultured human keratinocytes (HaCaT cells expressing green fluorescent protein (GFP under the control of the stress-inducible HSP70B’ promoter were constructed. Exposure of HaCaT sensor cells to 25 µM cadmium, a model substance for oxidative stress induction, provoked a 1.7-fold increase in total glutathione and a ~300-fold induction of transcript level of the gene coding for heat shock protein HSP70B’. An extract of Arnica montana flowers resulted in a strong induction of the HSP70B’ gene and a pronounced decrease of total glutathione in keratinocytes. The HSP70B’ promoter-based sensor cells conveniently detected cadmium-induced stress using GFP fluorescence as read-out with a limit of detection of 6 µM cadmium. In addition the sensor cells responded to exposure of cells to A. montana extract with induction of GFP fluorescence. Thus, the HaCaT sensor cells provide a means for the automated detection of the compromised redox status of keratinocytes as an early indicator of the development of human skin disorders and could be applied for the prediction of skin irritation in more complex in vitro 3D human skin models and in the development of micro-total analysis systems (µTAS that may be utilized in dermatology, toxicology, pharmacology and drug screenings.

  5. Cell lineage mapping of taste bud cells and keratinocytes in the mouse tongue and soft palate.

    Science.gov (United States)

    Okubo, Tadashi; Clark, Cheryl; Hogan, Brigid L M

    2009-02-01

    The epithelium of the mouse tongue and soft palate consists of at least three distinct epithelial cell populations: basal cells, keratinized cells organized into filiform and fungiform papillae, and taste receptor cells present in tight clusters known as taste buds in the fungiform and circumvallate papillae and soft palate. All three cell types develop from the simple epithelium of the embryonic tongue and palate, and are continually replaced in the adult by cell turnover. Previous studies using pulse-chase tritiated thymidine labeling in the adult mouse provided evidence for a high rate of cell turnover in the keratinocytes (5-7 days) and taste buds (10 days). However, little is known about the localization and phenotype of the long-term stem or progenitor cells that give rise to the mature taste bud cells and surrounding keratinocytes in these gustatory tissues. Here, we make use of a tamoxifen-inducible K14-CreER transgene and the ROSA26 LacZ reporter allele to lineage trace the mature keratinocytes and taste bud cells of the early postnatal and adult mouse tongue and soft palate. Our results support the hypothesis that both the pore keratinocytes and receptor cells of the taste bud are derived from a common K14(+)K5(+)Trp63(+)Sox2(+) population of bipotential progenitor cells located outside the taste bud. The results are also compatible with models in which the keratinocytes of the filiform and fungiform papillae are derived from basal progenitor cells localized at the base of these structures.

  6. Keratinocyte-Derived Chemokines Orchestrate T-Cell Positioning in the Epidermis during Vitiligo and May Serve as Biomarkers of Disease.

    Science.gov (United States)

    Richmond, Jillian M; Bangari, Dinesh S; Essien, Kingsley I; Currimbhoy, Sharif D; Groom, Joanna R; Pandya, Amit G; Youd, Michele E; Luster, Andrew D; Harris, John E

    2017-02-01

    Vitiligo is an autoimmune disease of the skin that results in the destruction of melanocytes and the clinical appearance of white spots. Disease pathogenesis depends on IFN-γ and IFN-γ-induced chemokines to promote T-cell recruitment to the epidermis where melanocytes reside. The skin is a complex organ, with a variety of resident cell types. We sought to better define the microenvironment and distinct cellular contributions during autoimmunity in vitiligo, and we found that the epidermis is a chemokine-high niche in both a mouse model and human vitiligo. Analysis of chemokine expression in mouse skin showed that CXCL9 and CXCL10 expression strongly correlate with disease activity, whereas CXCL10 alone correlates with severity, supporting them as potential biomarkers for following disease progression. Further studies in both our mouse model and human patients showed that keratinocytes were the major chemokine producers throughout the course of disease, and functional studies using a conditional signal transducer and activator of transcription (STAT)-1 knockout mouse showed that IFN-γ signaling in keratinocytes was critical for disease progression and proper autoreactive T-cell homing to the epidermis. In contrast, epidermal immune cell populations including endogenous T cells, Langerhans cells, and γδ T cells were not required. These results have important clinical implications, because topical therapies that target IFN-γ signaling in keratinocytes could be safe and effective new treatments, and skin expression of these chemokines could be used to monitor disease activity and treatment responses. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Inhibition of Inflammatory Gene Expression in Keratinocytes Using a Composition Containing Carnitine, Thioctic Acid and Saw Palmetto Extract

    Directory of Open Access Journals (Sweden)

    Sridar Chittur

    2011-01-01

    Full Text Available Chronic inflammation of the hair follicle (HF is considered a contributing factor in the pathogenesis of androgenetic alopecia (AGA. Previously, we clinically tested liposterolic extract of Serenoa repens (LSESr and its glycoside, β-sitosterol, in subjects with AGA and showed a highly positive response to treatment. In this study, we sought to determine whether blockade of inflammation using a composition containing LSESr as well as two anti-inflammatory agents (carnitine and thioctic acid could alter the expression of molecular markers of inflammation in a well-established in vitro system. Using a well-validated assay representative of HF keratinocytes, specifically, stimulation of cultured human keratinocyte cells in vitro, we measured changes in gene expression of a spectrum of well-known inflammatory markers. Lipopolysaccharide (LPS provided an inflammatory stimulus. In particular, we found that the composition effectively suppressed LPS-activated gene expression of chemokines, including CCL17, CXCL6 and LTB(4 associated with pathways involved in inflammation and apoptosis. Our data support the hypothesis that the test compound exhibits anti-inflammatory characteristics in a well-established in vitro assay representing HF keratinocyte gene expression. These findings suggest that 5-alpha reductase inhibitors combined with blockade of inflammatory processes could represent a novel two-pronged approach in the treatment of AGA with improved efficacy over current modalities.

  8. Chemosensory Information Processing between Keratinocytes and Trigeminal Neurons

    Science.gov (United States)

    Sondersorg, Anna Christina; Busse, Daniela; Kyereme, Jessica; Rothermel, Markus; Neufang, Gitta; Gisselmann, Günter; Hatt, Hanns; Conrad, Heike

    2014-01-01

    Trigeminal fibers terminate within the facial mucosa and skin and transmit tactile, proprioceptive, chemical, and nociceptive sensations. Trigeminal sensations can arise from the direct stimulation of intraepithelial free nerve endings or indirectly through information transmission from adjacent cells at the peripheral innervation area. For mechanical and thermal cues, communication processes between skin cells and somatosensory neurons have already been suggested. High concentrations of most odors typically provoke trigeminal sensations in vivo but surprisingly fail to activate trigeminal neuron monocultures. This fact favors the hypothesis that epithelial cells may participate in chemodetection and subsequently transmit signals to neighboring trigeminal fibers. Keratinocytes, the major cell type of the epidermis, express various receptors that enable reactions to multiple environmental stimuli. Here, using a co-culture approach, we show for the first time that exposure to the odorant chemicals induces a chemical communication between human HaCaT keratinocytes and mouse trigeminal neurons. Moreover, a supernatant analysis of stimulated keratinocytes and subsequent blocking experiments with pyrodoxalphosphate-6-azophenyl-2′,4′-disulfonate revealed that ATP serves as the mediating transmitter molecule released from skin cells after odor stimulation. We show that the ATP release resulting from Javanol® stimulation of keratinocytes was mediated by pannexins. Consequently, keratinocytes act as chemosensors linking the environment and the trigeminal system via ATP signaling. PMID:24790106

  9. TLR3 mediates release of IL-1β and cell death in keratinocytes in a caspase-4 dependent manner.

    Science.gov (United States)

    Grimstad, Øystein; Husebye, Harald; Espevik, Terje

    2013-10-01

    Inflammation and timely cell death are important elements in host defence and healing processes. Keratinocytes express high levels of Toll-like receptor 3 (TLR3), and stimulation of the receptor with its ligand polyinosinic-polycytidylic acid (polyI:C) is a powerful signal for release of a variety of proinflammatory cytokines. Caspase-4 is required for maturation of pro-IL-1β through activation of caspase-1 in keratinocytes. TLR3 in keratinocytes was stimulated with polyI:C. Induction of messenger RNA of pro-IL-1β and inflammasomal components was measured using quantitative polymerase chain reaction methodology. Protein expression of IL-1β was analysed with ELISA and Western blot techniques. Activation of apoptotic caspases was measured with flow cytometry, and cytotoxicity was determined. TLR3 induced release of substantial amounts of pro-IL-1β in keratinocytes. NLRP3 or ASC dependent processing of IL-1β into its cleaved bioactive form was found to be minimal. The release of IL-1β was due to polyI:C induced cell death that occurred through a caspase-4 dependent manner. Caspase-1 did not seem to be involved in the polyI:C induced cytotoxicity despite that TLR3 stimulation induced activation of caspase-1. In addition, the apoptotic caspases -8, -9 and -3/7 were activated by polyI:C. TLR3 stimulation in keratinocytes induces a caspase-4 dependent release of pro-IL-1β, but further processing to active IL-1β is limited. Furthermore, TLR3 stimulation results in pyroptotic- and apoptotic cell death. Copyright © 2013 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  10. Postirradiation expression of lethal mutations in an immortalized human keratinocyte cell line

    International Nuclear Information System (INIS)

    O'Reilly, S.; Mothersill, C.; Seymour, C.B.

    1994-01-01

    The quantification of the extent of delayed cell death and the rate and pattern of its occurrence in relation to the cell division cycle is important in radiotherapy and also in radiation transformation studies related to protection and dose limits. Here the numbers of lethal mutations occurring over 45 population doublings (clonal expansion to about 10 13 cells per cell originally surviving irradiation) was measured in an HPV 16 immortalized human keratinocyte cell lines used for transformation studies. The results showed that when postirradiation (dose range 1-6 Gy) growth curves were constructed, the difference in slopes could be accounted for entirely by correcting for the non-clonogenic fraction in the cell count, excluding a longer cell generation time as an explanation. When the cell loss was examined over the entire growth period of 6 weeks (about 45 doublings of the cell population), it was found to be dose dependent for the first two passages, but then to become more independent of dose. The results allow a time/cell generation dependent factor to be derived for the cell line and used in survival curve equations where effects of radiation are being measured at times distant from the original exposure. (author)

  11. Gene expression signatures affected by ethanol and/or nicotine in normal human normal oral keratinocytes (NHOKs

    Directory of Open Access Journals (Sweden)

    Jeffrey J. Kim

    2014-12-01

    Full Text Available It has been reported that nicotine/alcohol alters epigenetic control and leads to abrogated DNA methylation and histone modifications, which could subsequently perturb transcriptional regulation critically important in cellular transformation. The aim of this study is to determine the molecular mechanisms of nicotine/alcohol-induced epigenetic alterations and their mechanistic roles in transcriptional regulation in human adult stem cells. We hypothesized that nicotine/alcohol induces deregulation of epigenetic machinery and leads to epigenetic alterations, which subsequently affect transcriptional regulation in oral epithelial stem cells. As an initiating step we have profiled transcriptomic alterations induced by the combinatory administration of EtOH and nicotine in primary normal human oral keratinocytes. Here we provide detailed experimental methods, analysis and information associated with our data deposited into Gene Expression Omnibus (GEO under GSE57634. Our data provide comprehensive transcriptomic map describing molecular changes induced by EtOH and nicotine on normal human oral keratinocytes.

  12. Keratinocytes express fibrillin and assemble microfibrils: implications for dermal matrix organization.

    Science.gov (United States)

    Haynes, S L; Shuttleworth, C A; Kielty, C M

    1997-07-01

    Fibrillin-containing microfibrils are key architectural structures of the upper dermis and integral components of the dermal elastic fibre network. Microfibril bundles intercalate into the dermal-epithelial junction and provide an elastic connection between the dermal elastic fibre network and the epidermis. Immunohistochemical studies have suggested that they are laid down both at the dermal-epithelial junction and in the deep dermis. While dermal fibroblasts are responsible for deposition of the elastin and microfibrillar components that comprise the elastic fibres of the deep dermis, the cellular origin of the microfibril bundles that extrude from the dermal-epithelial junction is not well defined. We have used fresh tissues, freshly isolated epidermis and primary human and porcine keratinocyte cultures to investigate the possibility that keratinocytes are responsible for deposition of these microfibrils. We have shown that keratinocytes in vivo and in vitro synthesize both fibrillin-1 and fibrillin-2, and assemble beaded microfibrils concurrently with expression of basement membrane collagen. These observations suggest that keratinocytes co-ordinate the secretion, deposition and assembly of these distinct structural elements of the dermal matrix, and have important implications for skin remodelling.

  13. Essential role of integrin-linked kinase in regulation of phagocytosis in keratinocytes.

    Science.gov (United States)

    Sayedyahossein, Samar; Nini, Lylia; Irvine, Timothy S; Dagnino, Lina

    2012-10-01

    Phagocytic melanosome uptake by epidermal keratinocytes is a central protective mechanism against damage induced by ultraviolet radiation. Phagocytosis requires formation of pseudopodia via actin cytoskeleton rearrangements. Integrin-linked kinase (ILK) is an important modulator of actin cytoskeletal dynamics. We have examined the role of ILK in regulation of phagocytosis, using epidermal keratinocytes isolated from mice with epidermis-restricted Ilk gene inactivation. ILK-deficient cells exhibited severely impaired capacity to engulf fluorescent microspheres in response to stimulation of the keratinocyte growth factor (KGF) receptor or the protease-activated receptor-2. KGF induced ERK phosphorylation in ILK-expressing and ILK-deficient cells, suggesting that ILK is not essential for KGF receptor signaling. In contrast, KGF promoted activation of Rac1 and formation of pseudopodia in ILK-expressing, but not in ILK-deficient cells. Rac1-deficient keratinocytes also showed substantially impaired phagocytic ability, underlining the importance of ILK-dependent Rac1 function for particle engulfment. Finally, cross-modulation of KGF receptors by integrins may be another important element, as integrin β1-deficient keratinocytes also fail to show significant phagocytosis in response to KGF. Thus, we have identified a novel signaling pathway essential for phagocytosis in keratinocytes, which involves ILK-dependent activation of Rac1 in response to KGF, resulting in the formation of pseudopodia and particle uptake.

  14. A novel DLX3-PKC integrated signaling network drives keratinocyte differentiation.

    Science.gov (United States)

    Palazzo, Elisabetta; Kellett, Meghan D; Cataisson, Christophe; Bible, Paul W; Bhattacharya, Shreya; Sun, Hong-Wei; Gormley, Anna C; Yuspa, Stuart H; Morasso, Maria I

    2017-04-01

    Epidermal homeostasis relies on a well-defined transcriptional control of keratinocyte proliferation and differentiation, which is critical to prevent skin diseases such as atopic dermatitis, psoriasis or cancer. We have recently shown that the homeobox transcription factor DLX3 and the tumor suppressor p53 co-regulate cell cycle-related signaling and that this mechanism is functionally involved in cutaneous squamous cell carcinoma development. Here we show that DLX3 expression and its downstream signaling depend on protein kinase C α (PKCα) activity in skin. We found that following 12-O-tetradecanoyl-phorbol-13-acetate (TPA) topical treatment, DLX3 expression is significantly upregulated in the epidermis and keratinocytes from mice overexpressing PKCα by transgenic targeting (K5-PKCα), resulting in cell cycle block and terminal differentiation. Epidermis lacking DLX3 (DLX3cKO), which is linked to the development of a DLX3-dependent epidermal hyperplasia with hyperkeratosis and dermal leukocyte recruitment, displays enhanced PKCα activation, suggesting a feedback regulation of DLX3 and PKCα. Of particular significance, transcriptional activation of epidermal barrier, antimicrobial peptide and cytokine genes is significantly increased in DLX3cKO skin and further increased by TPA-dependent PKC activation. Furthermore, when inhibiting PKC activity, we show that epidermal thickness, keratinocyte proliferation and inflammatory cell infiltration are reduced and the PKC-DLX3-dependent gene expression signature is normalized. Independently of PKC, DLX3 expression specifically modulates regulatory networks such as Wnt signaling, phosphatase activity and cell adhesion. Chromatin immunoprecipitation sequencing analysis of primary suprabasal keratinocytes showed binding of DLX3 to the proximal promoter regions of genes associated with cell cycle regulation, and of structural proteins and transcription factors involved in epidermal differentiation. These results indicate

  15. Evaluation of gene expression profile of keratinocytes in response to JP-8 jet fuel

    International Nuclear Information System (INIS)

    Espinoza, Luis A.; Li Peijun; Lee, Richard Y.; Wang Yue; Boulares, A. Hamid; Clarke, Robert; Smulson, Mark E.

    2004-01-01

    The skin is the principal barrier against any environmental insult. Therefore, there is a high risk for a large number of military and civilian personnel exposed to jet fuel JP-8 to suffer percutaneous absorption of this fuel. This paper reports the use of cDNA microarray to identify the gene expression profile in normal human epidermal keratinocytes exposed to JP-8 for 24-h and 7-day periods. The effects of JP-8 exposure on keratinocytes at these two different periods induced a set of genes with altered expression in response to this type of insult. Microarray data were visualized using a novel algorithm based on simple statistical analyses to reduce data dimensionality and identify subsets of discriminant genes. Predictive neural networks were built using a multiplayer perceptron to carry out a proper classification task in microarray data in the untreated versus JP-8-treated samples. The pattern of expressions in response to JP-8 provides evidences that detoxificant-related and cell growth regulator genes with the most variability in the level of expression may be useful genetic markers in adverse health effects of personnel exposed to JP-8. The approaches in our analysis provide a simple, safe, novel, and effective method that is reliable in identifying and analyzing gene expression in samples treated with JP-8 or over potential toxic agents. Gene expression data from these studies can be used to build accurate predictive models that separate different molecular profiles. The data establish the use and effectiveness of these approaches for future prospective studies

  16. Stanniocalcin-1 regulates re-epithelialization in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Bonnie H Y Yeung

    Full Text Available Stanniocalcin-1 (STC1, a glycoprotein hormone, is believed to be involved in various biological processes such as inflammation, oxidative responses and cell migration. Riding on these emerging evidences, we hypothesized that STC1 may participate in the re-epithelialization during wound healing. Re-epithelialization is a critical step that involves keratinocyte lamellipodia (e-lam formation, followed by cell migration. In this study, staurosporine (STS treatment induced human keratinocyte (HaCaT e-lam formation on fibronectin matrix and migration via the activation of focal adhesion kinase (FAK, the surge of intracellular calcium level [Ca²⁺]i and the inactivation of Akt. In accompanied with these migratory features, a time- and dose-dependent increase in STC1 expression was detected. STC1 gene expression was found not the downstream target of FAK-signaling as illustrated by FAK inhibition using PF573228. The reduction of [Ca²⁺]i by BAPTA/AM blocked the STS-mediated keratinocyte migration and STC1 gene expression. Alternatively the increase of [Ca²⁺]i by ionomycin exerted promotional effect on STS-induced STC1 gene expression. The inhibition of Akt by SH6 and GSK3β by lithium chloride (LiCl could respectively induce and inhibit the STS-mediated e-lam formation, cell migration and STC1 gene expression. The STS-mediated e-lam formation and cell migration were notably hindered or induced respectively by STC1 knockdown or overexpression. This notion was further supported by the scratched wound assay. Collectively the findings provide the first evidence that STC1 promotes re-epithelialization in wound healing.

  17. Stanniocalcin-1 regulates re-epithelialization in human keratinocytes.

    Science.gov (United States)

    Yeung, Bonnie H Y; Wong, Chris K C

    2011-01-01

    Stanniocalcin-1 (STC1), a glycoprotein hormone, is believed to be involved in various biological processes such as inflammation, oxidative responses and cell migration. Riding on these emerging evidences, we hypothesized that STC1 may participate in the re-epithelialization during wound healing. Re-epithelialization is a critical step that involves keratinocyte lamellipodia (e-lam) formation, followed by cell migration. In this study, staurosporine (STS) treatment induced human keratinocyte (HaCaT) e-lam formation on fibronectin matrix and migration via the activation of focal adhesion kinase (FAK), the surge of intracellular calcium level [Ca²⁺]i and the inactivation of Akt. In accompanied with these migratory features, a time- and dose-dependent increase in STC1 expression was detected. STC1 gene expression was found not the downstream target of FAK-signaling as illustrated by FAK inhibition using PF573228. The reduction of [Ca²⁺]i by BAPTA/AM blocked the STS-mediated keratinocyte migration and STC1 gene expression. Alternatively the increase of [Ca²⁺]i by ionomycin exerted promotional effect on STS-induced STC1 gene expression. The inhibition of Akt by SH6 and GSK3β by lithium chloride (LiCl) could respectively induce and inhibit the STS-mediated e-lam formation, cell migration and STC1 gene expression. The STS-mediated e-lam formation and cell migration were notably hindered or induced respectively by STC1 knockdown or overexpression. This notion was further supported by the scratched wound assay. Collectively the findings provide the first evidence that STC1 promotes re-epithelialization in wound healing.

  18. Expression of the helix-loop-helix protein inhibitor of DNA binding-1 (ID-1) is activated by all-trans retinoic acid in normal human keratinocytes

    International Nuclear Information System (INIS)

    Villano, C.M.; White, L.A.

    2006-01-01

    The ID (inhibitor of differentiation or DNA binding) helix-loop-helix proteins are important mediators of cellular differentiation and proliferation in a variety of cell types through regulation of gene expression. Overexpression of the ID proteins in normal human keratinocytes results in extension of culture lifespan, indicating that these proteins are important for epidermal differentiation. Our hypothesis is that the ID proteins are targets of the retinoic acid signaling pathway in keratinocytes. Retinoids, vitamin A analogues, are powerful regulators of cell growth and differentiation and are widely used in the prevention and treatment of a variety of cancers in humans. Furthermore, retinoic acid is necessary for the maintenance of epithelial differentiation and demonstrates an inhibitory action on skin carcinogenesis. We examined the effect of all-trans retinoic acid on expression of ID-1, -2, -3, and -4 in normal human keratinocytes and found that exposure of these cells to all-trans retinoic acid causes an increase in both ID-1 and ID-3 gene expression. Furthermore, our data show that this increase is mediated by increased transcription involving several cis-acting elements in the distal portion of the promoter, including a CREB-binding site, an Egr1 element, and an YY1 site. These data demonstrate that the ID proteins are direct targets of the retinoic acid signaling pathway. Given the importance of the ID proteins to epidermal differentiation, these results suggest that IDs may be mediating some of the effects of all-trans retinoic acid in normal human keratinocytes

  19. Gene expression studies on human keratinocytes transduced with human growth hormone gene for a possible utilization in gene therapy

    International Nuclear Information System (INIS)

    Mathor, Monica Beatriz.

    1994-01-01

    Taking advantage of the recent progress in the DNA-recombinant techniques and of the potentiality of normal human keratinocytes primary culture to reconstitute the epidermis, it was decided to genetically transform these keratinocytes to produce human growth hormone under controllable conditions that would be used in gene therapy at this hormone deficient patients. The first step to achieve this goal was to standardize infection of keratinocytes with retrovirus producer cells containing a construct which included the gene of bacterial b-galactosidase. The best result was obtained cultivating the keratinocytes for 3 days in a 2:1 mixture of retrovirus producer cells and 3T3-J2 fibroblasts irradiated with 60 Gy, and splitting these infected keratinocytes on 3T3-J2 fibroblasts feeder layer. Another preliminary experiment was to infect normal human keratinocytes with interleukin-6 gene (hIL-6) that, in pathologic conditions, could be reproduced by keratinocytes and secreted to the blood stream. Thus, we verify that infected keratinocytes secrete an average amount of 500 ng/10 6 cell/day of cytokin during the in vitro life time, that certify the stable character of the injection. These keratinocytes, when grafted in mice, secrete hIL-6 to the blood stream reaching levels of 40 pg/ml of serum. After these preliminary experiments, we construct a retroviral vector with the human growth hormone gene (h GH) driven by human metallothionein promoter (h PMT), designated DChPMTGH. Normal human keratinocytes were infected with DChPMTGH producer cells, following previously standardized protocol, obtaining infected keratinocytes secreting to the culture media 340 ng h GH/10 6 cell/day without promoter activation. This is the highest level of h GH secreted in human keratinocytes primary culture described in literature. The h GH value increases approximately 10 times after activation with 100 μM Zn +2 for 8-12 hours. (author). 158 refs., 42 figs., 6 tabs

  20. Enhanced constitutive invasion activity in human nontumorigenic keratinocytes exposed to a low level of barium for a long time.

    Science.gov (United States)

    Thang, Nguyen D; Yajima, Ichiro; Ohnuma, Shoko; Ohgami, Nobutaka; Kumasaka, Mayuko Y; Ichihara, Gaku; Kato, Masashi

    2015-02-01

    We have recently demonstrated that exposure to barium for a short time (≤4 days) and at a low level (5 µM = 687 µg/L) promotes invasion of human nontumorigenic HaCaT cells, which have characteristics similar to those of normal keratinocytes, suggesting that exposure to barium for a short time enhances malignant characteristics. Here we examined the effect of exposure to low level of barium for a long time, a condition mimicking the exposure to barium through well water, on malignant characteristics of HaCaT keratinocytes. Constitutive invasion activity, focal adhesion kinase (FAK) protein expression and activity, and matrix metalloproteinase 14 (MMP14) protein expression in primary cultured normal human epidermal keratinocytes, HaCaT keratinocytes, and HSC5 and A431 human squamous cell carcinoma cells were augmented following an increase in malignancy grade of the cells. Constitutive invasion activity, FAK phosphorylation, and MMP14 expression levels of HaCaT keratinocytes after treatment with 5 µM barium for 4 months were significantly higher than those of control untreated HaCaT keratinocytes. Taken together, our results suggest that exposure to a low level of barium for a long time enhances constitutive malignant characteristics of HaCaT keratinocytes via regulatory molecules (FAK and MMP14) for invasion. © 2013 Wiley Periodicals, Inc.

  1. A novel DLX3–PKC integrated signaling network drives keratinocyte differentiation

    Science.gov (United States)

    Palazzo, Elisabetta; Kellett, Meghan D; Cataisson, Christophe; Bible, Paul W; Bhattacharya, Shreya; Sun, Hong-wei; Gormley, Anna C; Yuspa, Stuart H; Morasso, Maria I

    2017-01-01

    Epidermal homeostasis relies on a well-defined transcriptional control of keratinocyte proliferation and differentiation, which is critical to prevent skin diseases such as atopic dermatitis, psoriasis or cancer. We have recently shown that the homeobox transcription factor DLX3 and the tumor suppressor p53 co-regulate cell cycle-related signaling and that this mechanism is functionally involved in cutaneous squamous cell carcinoma development. Here we show that DLX3 expression and its downstream signaling depend on protein kinase C α (PKCα) activity in skin. We found that following 12-O-tetradecanoyl-phorbol-13-acetate (TPA) topical treatment, DLX3 expression is significantly upregulated in the epidermis and keratinocytes from mice overexpressing PKCα by transgenic targeting (K5-PKCα), resulting in cell cycle block and terminal differentiation. Epidermis lacking DLX3 (DLX3cKO), which is linked to the development of a DLX3-dependent epidermal hyperplasia with hyperkeratosis and dermal leukocyte recruitment, displays enhanced PKCα activation, suggesting a feedback regulation of DLX3 and PKCα. Of particular significance, transcriptional activation of epidermal barrier, antimicrobial peptide and cytokine genes is significantly increased in DLX3cKO skin and further increased by TPA-dependent PKC activation. Furthermore, when inhibiting PKC activity, we show that epidermal thickness, keratinocyte proliferation and inflammatory cell infiltration are reduced and the PKC-DLX3-dependent gene expression signature is normalized. Independently of PKC, DLX3 expression specifically modulates regulatory networks such as Wnt signaling, phosphatase activity and cell adhesion. Chromatin immunoprecipitation sequencing analysis of primary suprabasal keratinocytes showed binding of DLX3 to the proximal promoter regions of genes associated with cell cycle regulation, and of structural proteins and transcription factors involved in epidermal differentiation. These results indicate

  2. Insulin binding properties of normal and transformed human epidermal cultured keratinocytes

    International Nuclear Information System (INIS)

    Verrando, P.; Ortonne, J.P.

    1985-01-01

    Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders

  3. Canine Distemper Virus Infects Canine Keratinocytes and Immune Cells by Using Overlapping and Distinct Regions Located on One Side of the Attachment Protein▿

    Science.gov (United States)

    Langedijk, Johannes P. M.; Janda, Jozef; Origgi, Francesco C.; Örvell, Claes; Vandevelde, Marc; Zurbriggen, Andreas; Plattet, Philippe

    2011-01-01

    The morbilliviruses measles virus (MeV) and canine distemper virus (CDV) both rely on two surface glycoproteins, the attachment (H) and fusion proteins, to promote fusion activity for viral cell entry. Growing evidence suggests that morbilliviruses infect multiple cell types by binding to distinct host cell surface receptors. Currently, the only known in vivo receptor used by morbilliviruses is CD150/SLAM, a molecule expressed in certain immune cells. Here we investigated the usage of multiple receptors by the highly virulent and demyelinating CDV strain A75/17. We based our study on the assumption that CDV-H may interact with receptors similar to those for MeV, and we conducted systematic alanine-scanning mutagenesis on CDV-H throughout one side of the β-propeller documented in MeV-H to contain multiple receptor-binding sites. Functional and biochemical assays performed with SLAM-expressing cells and primary canine epithelial keratinocytes identified 11 residues mutation of which selectively abrogated fusion in keratinocytes. Among these, four were identical to amino acids identified in MeV-H as residues contacting a putative receptor expressed in polarized epithelial cells. Strikingly, when mapped on a CDV-H structural model, all residues clustered in or around a recessed groove located on one side of CDV-H. In contrast, reported CDV-H mutants with SLAM-dependent fusion deficiencies were characterized by additional impairments to the promotion of fusion in keratinocytes. Furthermore, upon transfer of residues that selectively impaired fusion induction in keratinocytes into the CDV-H of the vaccine strain, fusion remained largely unaltered. Taken together, our results suggest that a restricted region on one side of CDV-H contains distinct and overlapping sites that control functional interaction with multiple receptors. PMID:21849439

  4. Chemical peeling by SA-PEG remodels photo-damaged skin: suppressing p53 expression and normalizing keratinocyte differentiation.

    Science.gov (United States)

    Dainichi, Teruki; Amano, Satoshi; Matsunaga, Yukiko; Iriyama, Shunsuke; Hirao, Tetsuji; Hariya, Takeshi; Hibino, Toshihiko; Katagiri, Chika; Takahashi, Motoji; Ueda, Setsuko; Furue, Masutaka

    2006-02-01

    Chemical peeling with salicylic acid in polyethylene glycol vehicle (SA-PEG), which specifically acts on the stratum corneum, suppresses the development of skin tumors in UVB-irradiated hairless mice. To elucidate the mechanism through which chemical peeling with SA-PEG suppresses skin tumor development, the effects of chemical peeling on photodamaged keratinocytes and cornified envelopes (CEs) were evaluated in vivo. Among UVB-irradiated hairless mice, the structural atypia and expression of p53 protein in keratinocytes induced by UVB irradiation were intensely suppressed in the SA-PEG-treated mice 28 days after the start of weekly SA-PEG treatments when compared to that in the control UVB-irradiated mice. Incomplete expression of filaggrin and loricrin in keratinocytes from the control mice was also improved in keratinocytes from the SA-PEG-treated mice. In photo-exposed human facial skin, immature CEs were replaced with mature CEs 4 weeks after treatment with SA-PEG. Restoration of photodamaged stratum corneum by treatment with SA-PEG, which may affect remodeling of the structural environment of the keratinocytes, involved the normalization of keratinocyte differentiation and suppression of skin tumor development. These results suggest that the stratum corneum plays a protective role against carcinogenesis, and provide a novel strategy for the prevention of photo-induced skin tumors.

  5. Ultraviolet radiation (UVR) induces cell-surface Ro/SSA antigen expression by human keratinocytes in vitro: a possible mechanism for the UVR induction of cutaneous lupus lesions

    International Nuclear Information System (INIS)

    Jones, S.K.

    1992-01-01

    Antinuclear antibodies are useful markers of connective tissue disease. In this study, UVB but not UVA induced the expression of Ro/SSA antigen on keratinocyte surfaces in vitro. This expression was also found with the extractable nuclear antigens RnP and Sm, but not with single or double-stranded DNA. The expression was prevented by blocking protein synthesis, suggesting that it was an active process. The results suggest that UVB exposure may result in the expression of Ro/SSA antigen on the surfaces of basal keratinocytes in vivo. This antigen could then bind circulating antibody leading to the cutaneous lesions in neonatal and subacute cutaneous lupus erythematosus. (Author)

  6. Delineating miRNA profile induced by chewing tobacco in oral keratinocytes

    Directory of Open Access Journals (Sweden)

    Mohd Younis Bhat

    2017-10-01

    Full Text Available The major established etiologic risk factor for oral cancer is tobacco (chewed, smoked and snuffed forms. Chewing form of tobacco is predominantly used in India making it the leading cause of oral cancer. Despite being one of the leading causes of oral cancer, the molecular alterations induced by chewing tobacco remains largely unclear. Carcinogenic effect of chewing tobacco is through chronic and not acute exposure. To understand the molecular alterations induced by chewing tobacco, we developed a cell line model where non-neoplastic oral keratinocytes were chronically exposed to chewing tobacco for a period of 6 months. This resulted in increased cellular proliferation and invasive ability of normal oral keratinocytes. Using this cellular model we studied the differential expression of miRNAs associated with chewing tobacco and the altered signaling pathways through which the aberrantly expressed miRNAs affect tumorigenesis. miRNA sequencing  was carried out using Illumina HiSeq 2500 platform  which resulted in the identification of 427 annotated miRNAs of which 10 were significantly dysregulated (≥ 4 fold; p-value ≤ 0.05 in tobacco exposed cells compared to untreated parental cells. To study the altered signaling in oral keratinocytes chronically exposed to chewing tobacco, we employed quantitative proteomics to characterize the dysregulated proteins. Integration of miRNA sequencing data with proteomic data resulted in identification of 36 proven protein targets which (≥1.5 fold; p-value ≤ 0.05 showed expression correlation with the 10 significantly dysregulated miRNAs. Pathway analysis of the dysregulated targets revealed enrichment of interferon signaling and mRNA processing related pathways in the chewing tobacco exposed cells. In addition, we also identified 6 novel miRNA in oral keratinocytes chronically exposed to chewing tobacco extract. Our study provides a framework to understand the oncogenic transformation induced by

  7. Keratin-6 driven ODC expression to hair follicle keratinocytes enhances stemness and tumorigenesis by negatively regulating Notch

    Energy Technology Data Exchange (ETDEWEB)

    Arumugam, Aadithya; Weng, Zhiping; Chaudhary, Sandeep C.; Afaq, Farrukh [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294-0019 (United States); Elmets, Craig A. [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294-0019 (United States); Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL 35294 (United States); Athar, Mohammad, E-mail: mathar@uab.edu [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294-0019 (United States); Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL 35294 (United States)

    2014-08-29

    Highlights: • Targeting ODC to hair follicle augments skin carcinogenesis and invasive SCCs. • Hair follicle ODC expands stem cell compartment carrying CD34{sup +}/K15{sup +}/p63{sup +} keratinocytes. • Negatively regulated Notch1 is associated with expansion of stem cell compartment. - Abstract: Over-expression of ornithine decarboxylase (ODC) is known to be involved in the epidermal carcinogenesis. However, the mechanism by which it enhances skin carcinogenesis remains undefined. Recently, role of stem cells localized in various epidermal compartments has been shown in the pathogenesis of skin cancer. To direct ODC expression in distinct epidermal compartments, we have developed keratin 6 (K6)-ODC/SKH-1 and keratin 14 (K14)-ODC/SKH-1 mice and employed them to investigate the role of ODC directed to these epidermal compartments on UVB-induced carcinogenesis. K6-driven ODC over-expression directed to outer root sheath (ORS) of hair follicle was more effective in augmenting tumorigenesis as compared to mice where K14-driven ODC expression was directed to inter-follicular epidermal keratinocytes. Chronically UVB-irradiated K6-ODC/SKH-1 developed 15 ± 2.5 tumors/mouse whereas K14-ODC/SKH-1 developed only 6.8 ± 1.5 tumors/mouse. K6-ODC/SKH-1 showed augmented UVB-induced proliferation and much higher pro-inflammatory responses than K14-ODC/SKH-1 mice. Tumors induced in K6-ODC/SKH-1 were rapidly growing, invasive and ulcerative squamous cell carcinoma (SCC) showing decreased expression of epidermal polarity marker E-cadherin and enhanced mesenchymal marker, fibronectin. Interestingly, the number of CD34/CK15/p63 positive stem-like cells was significantly higher in chronically UVB-irradiated K6-ODC/SKH-1 as compared to K14-ODC/SKH-1 mice. Reduced Notch1 expression was correlated with the expansion of stem cell compartment in these animals. However, other signaling pathways such as DNA damage response or mTOR signaling pathways were not significantly different in

  8. Keratin-6 driven ODC expression to hair follicle keratinocytes enhances stemness and tumorigenesis by negatively regulating Notch

    International Nuclear Information System (INIS)

    Arumugam, Aadithya; Weng, Zhiping; Chaudhary, Sandeep C.; Afaq, Farrukh; Elmets, Craig A.; Athar, Mohammad

    2014-01-01

    Highlights: • Targeting ODC to hair follicle augments skin carcinogenesis and invasive SCCs. • Hair follicle ODC expands stem cell compartment carrying CD34 + /K15 + /p63 + keratinocytes. • Negatively regulated Notch1 is associated with expansion of stem cell compartment. - Abstract: Over-expression of ornithine decarboxylase (ODC) is known to be involved in the epidermal carcinogenesis. However, the mechanism by which it enhances skin carcinogenesis remains undefined. Recently, role of stem cells localized in various epidermal compartments has been shown in the pathogenesis of skin cancer. To direct ODC expression in distinct epidermal compartments, we have developed keratin 6 (K6)-ODC/SKH-1 and keratin 14 (K14)-ODC/SKH-1 mice and employed them to investigate the role of ODC directed to these epidermal compartments on UVB-induced carcinogenesis. K6-driven ODC over-expression directed to outer root sheath (ORS) of hair follicle was more effective in augmenting tumorigenesis as compared to mice where K14-driven ODC expression was directed to inter-follicular epidermal keratinocytes. Chronically UVB-irradiated K6-ODC/SKH-1 developed 15 ± 2.5 tumors/mouse whereas K14-ODC/SKH-1 developed only 6.8 ± 1.5 tumors/mouse. K6-ODC/SKH-1 showed augmented UVB-induced proliferation and much higher pro-inflammatory responses than K14-ODC/SKH-1 mice. Tumors induced in K6-ODC/SKH-1 were rapidly growing, invasive and ulcerative squamous cell carcinoma (SCC) showing decreased expression of epidermal polarity marker E-cadherin and enhanced mesenchymal marker, fibronectin. Interestingly, the number of CD34/CK15/p63 positive stem-like cells was significantly higher in chronically UVB-irradiated K6-ODC/SKH-1 as compared to K14-ODC/SKH-1 mice. Reduced Notch1 expression was correlated with the expansion of stem cell compartment in these animals. However, other signaling pathways such as DNA damage response or mTOR signaling pathways were not significantly different in tumors induced

  9. GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states.

    Directory of Open Access Journals (Sweden)

    Rachel Herndon Klein

    2017-04-01

    Full Text Available Transcription factor binding, chromatin modifications and large scale chromatin re-organization underlie progressive, irreversible cell lineage commitments and differentiation. We know little, however, about chromatin changes as cells enter transient, reversible states such as migration. Here we demonstrate that when human progenitor keratinocytes either differentiate or migrate they form complements of typical enhancers and super-enhancers that are unique for each state. Unique super-enhancers for each cellular state link to gene expression that confers functions associated with the respective cell state. These super-enhancers are also enriched for skin disease sequence variants. GRHL3, a transcription factor that promotes both differentiation and migration, binds preferentially to super-enhancers in differentiating keratinocytes, while during migration, it binds preferentially to promoters along with REST, repressing the expression of migration inhibitors. Key epidermal differentiation transcription factor genes, including GRHL3, are located within super-enhancers, and many of these transcription factors in turn bind to and regulate super-enhancers. Furthermore, GRHL3 represses the formation of a number of progenitor and non-keratinocyte super-enhancers in differentiating keratinocytes. Hence, chromatin relocates GRHL3 binding and enhancers to regulate both the irreversible commitment of progenitor keratinocytes to differentiation and their reversible transition to migration.

  10. The Pseudomonas aeruginosa quorum sensing signal molecule N-(3-oxododecanoyl) homoserine lactone enhances keratinocyte migration and induces Mmp13 gene expression in vitro

    International Nuclear Information System (INIS)

    Paes, Camila; Nakagami, Gojiro; Minematsu, Takeo; Nagase, Takashi; Huang, Lijuan; Sari, Yunita; Sanada, Hiromi

    2012-01-01

    Highlights: ► An evidence of the positive effect of AHL on epithelialization process is provided. ► AHL enhances keratinocyte’s ability to migrate in an in vitro scratch wound model. ► AHL induces the expression of Mmp13. ► Topical application of AHL represents a possible strategy to treat chronic wounds. -- Abstract: Re-epithelialization is an essential step of wound healing involving three overlapping keratinocyte functions: migration, proliferation and differentiation. While quorum sensing (QS) is a cell density-dependent signaling system that enables bacteria to regulate the expression of certain genes, the QS molecule N-(3-oxododecanoyl) homoserine lactone (AHL) exerts effects also on mammalian cells in a process called inter-kingdom signaling. Recent studies have shown that AHL improves epithelialization in in vivo wound healing models but detailed understanding of the molecular and cellular mechanisms are needed. The present study focused on the AHL as a candidate reagent to improve wound healing through direct modulation of keratinocyte’s activity in the re-epithelialization process. Results indicated that AHL enhances the keratinocyte’s ability to migrate in an in vitro scratch wound healing model probably due to the high Mmp13 gene expression analysis after AHL treatment that was revealed by real-time RT-PCR. Inhibition of activator protein 1 (AP-1) signaling pathway completely prevented the migration of keratinocytes, and also resulted in a diminished Mmp13 gene expression, suggesting that AP-1 might be essential in the AHL-induced migration. Taken together, these results imply that AHL is a promising candidate molecule to improve re-epithelialization through the induction of migration of keratinocytes. Further investigation is needed to clarify the mechanism of action and molecular pathway of AHL on the keratinocyte migration process.

  11. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, Eric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Hamel, Rodolphe [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Neyret, Aymeric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Ekchariyawat, Peeraya [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Molès, Jean-Pierre [INSERM U1058, UM1, CHU Montpellier (France); Simmons, Graham [Blood Systems Research Institute, San Francisco, CA 94118 (United States); Chazal, Nathalie [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Desprès, Philippe [Unité Interactions Moléculaires Flavivirus-Hôtes, Institut Pasteur, Paris (France); and others

    2015-02-15

    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV.

  12. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    International Nuclear Information System (INIS)

    Bernard, Eric; Hamel, Rodolphe; Neyret, Aymeric; Ekchariyawat, Peeraya; Molès, Jean-Pierre; Simmons, Graham; Chazal, Nathalie; Desprès, Philippe

    2015-01-01

    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV

  13. Study of epithelial differentiation and protein expression of keratinocyte-mesenchyme stem cell co-cultivation on electrospun nylon/B. vulgaris extract composite scaffold

    Energy Technology Data Exchange (ETDEWEB)

    Hosseinzadeh, Simzar [School of Advanced Technologies in Medicine, Shahid Beheshti University of Medical Sciences, Tehran (Iran, Islamic Republic of); Soleimani, Masoud [Department of Hematology, Faculty of Medical Sciences, TarbiatModares University, Tehran (Iran, Islamic Republic of); Vossoughi, Manuchehr [Chemical and Petroleum Engineering Department, Sharif University of Technology, Tehran (Iran, Islamic Republic of); Ranjbarvan, Parviz [Department of Tissue Engineering, School of Advanced Medical Technologies, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Hamedi, Shokoh [Department of Persian Pharmacy, School of Persian and Complementary Medicine, Mashhad University of Medical Sciences, Mashhad (Iran, Islamic Republic of); Zamanlui, Soheila [Tissue Engineering and Regenerative Medicine Institute, Tehran Central Branch, Islamic Azad University, Tehran (Iran, Islamic Republic of); Mahmoudifard, Matin, E-mail: mahmodifard@mehr.sharif.edu [Institute for Nanoscience and Nanotechnology, Sharif University of Technology, Tehran (Iran, Islamic Republic of); Nanotechnology and Tissue Engineering Department, Stem Cell Technology Research Center, Tehran (Iran, Islamic Republic of)

    2017-06-01

    Employing of the composite electrospun scaffold containing herbal extract in conjugation with co-culturing of cells can open up new window to the design of efficient biomaterials for skin tissue regeneration. Here, we introduce the synergistic effect of composite electrospun nanofibrous scaffold of nylon66 loaded with Beta vulgaris (B. vulgaris) (extract of beet roots, a plants whose widely used in Iranian folk medicine as wound healing medicine) and co-culture of mesenchymal stem-cells (MSCs)-human keratinocyte (H-keratino) differentiation towards epithelial lineage. In vitro biocompatibility was examined through MTT assay and epithelial differentiation checked by real-time PCR and immunocytochemistry (ICC) assay after co-culturing of MSCs and H-keratino on proposed scaffold. Significant enhancement in cell proliferation was detected after cell culturing on the composite type of electrospun scaffold containing B. vulgaris. Moreover, after 14 days of co-culturing process, gene expression results revealed that both composite and non-composite nylon66 electrospun scaffold promote epithelial differentiation compared to mono-cell culturing of H-keratino in terms of several markers as Cytokeratin 10, Cytokeratin 14 and Involucrin and ICC of some dermal proteins like Cytokeratin 14 and Loricrin. To the best of our knowledge, findings of this study will introduce new way for the generation of novel biomaterials for the development of current skin tissue engineering. - Highlights: • New way for the generation of novel biomaterials for the development of current skin tissue engineering. • Fabrication of novel composite scaffold containing Beta vulgaris through electrospinning • Synergistic effect was found on epithelial differentiation through co-culture of keratinocyte and MSC on proposed composite NFM.

  14. Study of epithelial differentiation and protein expression of keratinocyte-mesenchyme stem cell co-cultivation on electrospun nylon/B. vulgaris extract composite scaffold

    International Nuclear Information System (INIS)

    Hosseinzadeh, Simzar; Soleimani, Masoud; Vossoughi, Manuchehr; Ranjbarvan, Parviz; Hamedi, Shokoh; Zamanlui, Soheila; Mahmoudifard, Matin

    2017-01-01

    Employing of the composite electrospun scaffold containing herbal extract in conjugation with co-culturing of cells can open up new window to the design of efficient biomaterials for skin tissue regeneration. Here, we introduce the synergistic effect of composite electrospun nanofibrous scaffold of nylon66 loaded with Beta vulgaris (B. vulgaris) (extract of beet roots, a plants whose widely used in Iranian folk medicine as wound healing medicine) and co-culture of mesenchymal stem-cells (MSCs)-human keratinocyte (H-keratino) differentiation towards epithelial lineage. In vitro biocompatibility was examined through MTT assay and epithelial differentiation checked by real-time PCR and immunocytochemistry (ICC) assay after co-culturing of MSCs and H-keratino on proposed scaffold. Significant enhancement in cell proliferation was detected after cell culturing on the composite type of electrospun scaffold containing B. vulgaris. Moreover, after 14 days of co-culturing process, gene expression results revealed that both composite and non-composite nylon66 electrospun scaffold promote epithelial differentiation compared to mono-cell culturing of H-keratino in terms of several markers as Cytokeratin 10, Cytokeratin 14 and Involucrin and ICC of some dermal proteins like Cytokeratin 14 and Loricrin. To the best of our knowledge, findings of this study will introduce new way for the generation of novel biomaterials for the development of current skin tissue engineering. - Highlights: • New way for the generation of novel biomaterials for the development of current skin tissue engineering. • Fabrication of novel composite scaffold containing Beta vulgaris through electrospinning • Synergistic effect was found on epithelial differentiation through co-culture of keratinocyte and MSC on proposed composite NFM

  15. The cytotoxic effect of neonatal lupus erythematosus and maternal sera on keratinocyte cultures is complement-dependent and can be augmented by ultraviolet irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Yu, H.-S.; Chang, C.-H.; Kang, J.-W. [Kaohsiung Medical College (Taiwan). Dept. of Dermatology; Chiang, L.-C. [Kaohsiung Medical College (Taiwan). Dept. of Microbiology and Immunology; Yu, C.-L. [National Yang-Ming University School of Medicine (Taiwan). Veterans General Hospital-Taipei

    1996-08-01

    To elucidate the role of autoantibodies and ultraviolet (UV) exposure in the pathogenesis of the skin lesions in neonatal lupus erythematosus (NLE), keratinocytes were cultured, as the target cells, from a patient with NLE and from a normal neonate. We demonstrated that the expression of nuclear/cytoplasma Ro/SSA and La/SSB molecules on to the surface of NLE keratinocytes occurred to a much greater extent than that on normal keratinocytes. A dose of 200 mJ/cm{sup 2} UVB irradiation on NLE keratinocytes induced a 2.5-3-fold increase in Ro/SSA and La/SSB expression compared to non-irradiated cells. Sera derived from both the NLE patient and from his mother exhibited a cytotoxic effect on NLE keratinocytes, but not on control cells, in the presence of complement. Furthermore, the cytotoxicity of the sera was enhanced in UVB-irradiated NLE keratinocytes, whereas it had no cytotoxic effects on UVB-irradiated control cells. This suggests that the abnormal expression of both Ro/SSA and La/SSB on the surface membrane of NLE keratinocytes induces the autoantibodies and complements to injure the cells. This complement-mediated cytotoxic effect can be augmented by UV irradiation, a concept not incompatible with the exacerbation of the skin eruption in sun-exposed skin sites. (author).

  16. The cytotoxic effect of neonatal lupus erythematosus and maternal sera on keratinocyte cultures is complement-dependent and can be augmented by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Yu, H.-S.; Chang, C.-H.; Kang, J.-W.; Chiang, L.-C.; Yu, C.-L.

    1996-01-01

    To elucidate the role of autoantibodies and ultraviolet (UV) exposure in the pathogenesis of the skin lesions in neonatal lupus erythematosus (NLE), keratinocytes were cultured, as the target cells, from a patient with NLE and from a normal neonate. We demonstrated that the expression of nuclear/cytoplasma Ro/SSA and La/SSB molecules on to the surface of NLE keratinocytes occurred to a much greater extent than that on normal keratinocytes. A dose of 200 mJ/cm 2 UVB irradiation on NLE keratinocytes induced a 2.5-3-fold increase in Ro/SSA and La/SSB expression compared to non-irradiated cells. Sera derived from both the NLE patient and from his mother exhibited a cytotoxic effect on NLE keratinocytes, but not on control cells, in the presence of complement. Furthermore, the cytotoxicity of the sera was enhanced in UVB-irradiated NLE keratinocytes, whereas it had no cytotoxic effects on UVB-irradiated control cells. This suggests that the abnormal expression of both Ro/SSA and La/SSB on the surface membrane of NLE keratinocytes induces the autoantibodies and complements to injure the cells. This complement-mediated cytotoxic effect can be augmented by UV irradiation, a concept not incompatible with the exacerbation of the skin eruption in sun-exposed skin sites. (author)

  17. Skin and hair follicle integrity is crucially dependent on beta 1 integrin expression on keratinocytes

    DEFF Research Database (Denmark)

    Brakebusch, C; Grose, R; Quondamatteo, F

    2000-01-01

    developed severe hair loss due to a reduced proliferation of hair matrix cells and severe hair follicle abnormalities. Eventually, the malformed hair follicles were removed by infiltrating macrophages. The epidermis of the back skin became hyperthickened, the basal keratinocytes showed reduced expression......, the integrity of the basement membrane surrounding the beta 1-deficient hair follicle was not affected. Finally, the dermis became fibrotic. These results demonstrate an important role of beta 1 integrins in hair follicle morphogenesis, in the processing of basement membrane components, in the maintenance...

  18. Up-regulation of intestinal epithelial cell derived IL-7 expression by keratinocyte growth factor through STAT1/IRF-1, IRF-2 pathway.

    Directory of Open Access Journals (Sweden)

    Yu-Jiao Cai

    Full Text Available BACKGROUND: Epithelial cells(EC-derived interleukin-7 (IL-7 plays a crucial role in control of development and homeostasis of neighboring intraepithelial lymphocytes (IEL, and keratinocyte growth factor (KGF exerts protective effects on intestinal epithelial cells and up-regulates EC-derived IL-7 expression through KGFR pathway. This study was to further investigate the molecular mechanism involved in the regulation of IL-7 expression by KGF in the intestine. METHODS: Intestinal epithelial cells (LoVo cells and adult C57BL/6J mice were treated with KGF. Epithelial cell proliferation was studied by flow cytometry for BrdU-incorporation and by immunohistochemistry for PCNA staining. Western blot was used to detect the changes of expression of P-Tyr-STAT1, STAT1, and IL-7 by inhibiting STAT1. Alterations of nuclear extracts and total proteins of IRF-1, IRF-2 and IL-7 following IRF-1 and IRF-2 RNA interference with KGF treatment were also measured with western blot. Moreover, IL-7 mRNA expressions were also detected by Real-time PCR and IL-7 protein level in culture supernatants was measured by enzyme linked immunosorbent assay(ELISA. RESULTS: KGF administration significantly increased LoVo cell proliferation and also increased intestinal wet weight, villus height, crypt depth and crypt cell proliferation in mice. KGF treatment led to increased levels of P-Tyr-STAT1, RAPA and AG490 both blocked P-Tyr-STAT1 and IL-7 expression in LoVo cells. IRF-1 and IRF-2 expression in vivo and in vitro were also up-regulated by KGF, and IL-7 expression was decreased after IRF-1 and IRF-2 expression was silenced by interfering RNA, respectively. CONCLUSION: KGF could up-regulate IL-7 expression through the STAT1/IRF-1, IRF-2 signaling pathway, which is a new insight in potential effects of KGF on the intestinal mucosal immune system.

  19. Expression of WNT genes in cervical cancer-derived cells: Implication of WNT7A in cell proliferation and migration

    International Nuclear Information System (INIS)

    Ramos-Solano, Moisés; Meza-Canales, Ivan D.; Torres-Reyes, Luis A.; Alvarez-Zavala, Monserrat

    2015-01-01

    According to the multifactorial model of cervical cancer (CC) causation, it is now recognized that other modifications, in addition to Human papillomavirus (HPV) infection, are necessary for the development of this neoplasia. Among these, it has been proposed that a dysregulation of the WNT pathway might favor malignant progression of HPV-immortalized keratinocytes. The aim of this study was to identify components of the WNT pathway differentially expressed in CC vs. non-tumorigenic, but immortalized human keratinocytes. Interestingly, WNT7A expression was found strongly downregulated in cell lines and biopsies derived from CC. Restoration of WNT7A in CC-derived cell lines using a lentiviral gene delivery system or after adding a recombinant human protein decreases cell proliferation. Likewise, WNT7A silencing in non-tumorigenic cells markedly accelerates proliferation. Decreased WNT7A expression was due to hypermethylation at particular CpG sites. To our knowledge, this is the first study reporting reduced WNT7A levels in CC-derived cells and that ectopic WNT7A restoration negatively affects cell proliferation and migration. - Highlights: • WNT7A is expressed in normal keratinocytes or cervical cells without lesion. • WNT7A is significantly reduced in cervical cancer-derived cells. • Restoration of WNT7A expression in HeLa decreases proliferation and cell migration. • Silencing of WNT7A in HaCaT induces an increased proliferation and migration rate. • Decreased WNT7A expression in this model is due to hypermethylation

  20. Expression of WNT genes in cervical cancer-derived cells: Implication of WNT7A in cell proliferation and migration

    Energy Technology Data Exchange (ETDEWEB)

    Ramos-Solano, Moisés, E-mail: mrsolano84@gmail.com [División de Inmunología, Centro de Investigación Biomédica de Occidente (CIBO)-Instituto Mexicano del Seguro Social (IMSS), Guadalajara, Jalisco (Mexico); Programa de Doctorado en Ciencias Biomédica, Centro Universitario de Ciencias de la Salud (CUCS), Universidad de Guadalajara, Guadalajara, Jalisco (Mexico); Meza-Canales, Ivan D., E-mail: imezacanales@ice.mpg.de [Department of Molecular Ecology, Max Planck Institute for Chemical Ecology, 07745 Jena (Germany); Torres-Reyes, Luis A., E-mail: torres_reyes_88@hotmail.com [División de Inmunología, Centro de Investigación Biomédica de Occidente (CIBO)-Instituto Mexicano del Seguro Social (IMSS), Guadalajara, Jalisco (Mexico); Programa de Doctorado en Ciencias Biomédica, Centro Universitario de Ciencias de la Salud (CUCS), Universidad de Guadalajara, Guadalajara, Jalisco (Mexico); Alvarez-Zavala, Monserrat, E-mail: monse_belan@hotmail.com [División de Inmunología, Centro de Investigación Biomédica de Occidente (CIBO)-Instituto Mexicano del Seguro Social (IMSS), Guadalajara, Jalisco (Mexico); Programa de Doctorado en Ciencias Biomédica, Centro Universitario de Ciencias de la Salud (CUCS), Universidad de Guadalajara, Guadalajara, Jalisco (Mexico); and others

    2015-07-01

    According to the multifactorial model of cervical cancer (CC) causation, it is now recognized that other modifications, in addition to Human papillomavirus (HPV) infection, are necessary for the development of this neoplasia. Among these, it has been proposed that a dysregulation of the WNT pathway might favor malignant progression of HPV-immortalized keratinocytes. The aim of this study was to identify components of the WNT pathway differentially expressed in CC vs. non-tumorigenic, but immortalized human keratinocytes. Interestingly, WNT7A expression was found strongly downregulated in cell lines and biopsies derived from CC. Restoration of WNT7A in CC-derived cell lines using a lentiviral gene delivery system or after adding a recombinant human protein decreases cell proliferation. Likewise, WNT7A silencing in non-tumorigenic cells markedly accelerates proliferation. Decreased WNT7A expression was due to hypermethylation at particular CpG sites. To our knowledge, this is the first study reporting reduced WNT7A levels in CC-derived cells and that ectopic WNT7A restoration negatively affects cell proliferation and migration. - Highlights: • WNT7A is expressed in normal keratinocytes or cervical cells without lesion. • WNT7A is significantly reduced in cervical cancer-derived cells. • Restoration of WNT7A expression in HeLa decreases proliferation and cell migration. • Silencing of WNT7A in HaCaT induces an increased proliferation and migration rate. • Decreased WNT7A expression in this model is due to hypermethylation.

  1. Response of Primary Human Bone Marrow Mesenchymal Stromal Cells and Dermal Keratinocytes to Thermal Printer Materials In Vitro.

    Science.gov (United States)

    Schmelzer, Eva; Over, Patrick; Gridelli, Bruno; Gerlach, Jörg C

    Advancement in thermal three-dimensional printing techniques has greatly increased the possible applications of various materials in medical applications and tissue engineering. Yet, potential toxic effects on primary human cells have been rarely investigated. Therefore, we compared four materials commonly used in thermal printing for bioengineering, namely thermally printed acrylonitrile butadiene styrene, MED610, polycarbonate, and polylactic acid, and investigated their effects on primary human adult skin epidermal keratinocytes and bone marrow mesenchymal stromal cells (BM-MSCs) in vitro. We investigated indirect effects on both cell types caused by potential liberation of soluble substances from the materials, and also analyzed BM-MSCs in direct contact with the materials. We found that even in culture without direct contact with the materials, the culture with MED610 (and to a lesser extent acrylonitrile butadiene styrene) significantly affected keratinocytes, reducing cell numbers and proliferation marker Ki67 expression, and increasing glucose consumption, lactate secretion, and expression of differentiation-associated genes. BM-MSCs had decreased metabolic activity, and exhibited increased cell death in direct culture on the materials. MED610 and acrylonitrile butadiene styrene induced the strongest expression of genes associated to differentiation and estrogen receptor activation. In conclusion, we found strong cell-type-specific effects of the materials, suggesting that materials for applications in regenerative medicine should be carefully selected not only based on their mechanical properties but also based on their cell-type-specific biological effects.

  2. Ultraviolet radiation can either suppress or induce expression of intercellular adhesion molecule 1 (ICAM-1) on the surface of cultured human keratinocytes

    International Nuclear Information System (INIS)

    Norris, D.A.; Lyons, M.B.; Middleton, M.H.; Yohn, J.J.; Kashihara-Sawami, M.

    1990-01-01

    Interactions of the ligand/receptor pair LFA-1(CD11a/CD18) and ICAM-1(CD54) initiate and control the cell-cell interactions of leukocytes and interactions of leukocytes with parenchymal cells in all phases of the immune response. Induction of the intercellular adhesion molecule 1 (ICAM-1) on the surface of epidermal keratinocytes has been proposed as an important regulator of contact-dependent aspects of cutaneous inflammation. Ultraviolet radiation (UVR) also modifies cutaneous inflammation, producing both up- and down-regulation of contact hypersensitivity. We have found that UVR has a biphasic effect on the induction of keratinocyte CD54. Using immunofluorescence and FACS techniques to quantitate cell-surface CD54 staining, we have shown that UVR significantly (p less than 0.01) inhibits keratinocyte CD54 induction by gamma interferon 24 h after irradiation. However, at 48, 72, and 96 h after UVR, CD54 expression is significantly induced to levels even greater than are induced by gamma interferon (20 U/ml). In addition, at 48, 72, or 96 h following UVR (30-100 mJ/cm2), the gamma-interferon-induced CD54 expression on human keratinocytes is also strongly (p less than 0.05 to p less than 0.001) enhanced. In this cell-culture system, gamma interferon and TNF-alpha are both strong CD54 inducers and are synergistic, but GM-CSF, TFG-beta, and IL-1 have no direct CD54-inducing effects. Thus the effects of UVR on CD54 induction are biphasic, producing inhibition at 24 h and induction at 48, 72, and 96 h. This effect on CD54 may contribute to the biphasic effects of UVR on delayed hypersensitivity in vivo. The early inhibition of ICAM-1 by UVR may also contribute to the therapeutic effects of UVR. We also speculate that the late induction of ICAM-1 by UVR might be an important step in the induction of photosensitive diseases such as lupus erythematosus

  3. The DP-1 transcription factor is required for keratinocyte growth and epidermal stratification.

    Science.gov (United States)

    Chang, Wing Y; Bryce, Dawn M; D'Souza, Sudhir J A; Dagnino, Lina

    2004-12-03

    The epidermis is a stratified epithelium constantly replenished through the ability of keratinocytes in its basal layer to proliferate and self-renew. The epidermis arises from a single-cell layer ectoderm during embryogenesis. Large proliferative capacity is central to ectodermal cell and basal keratinocyte function. DP-1, a heterodimeric partner of E2F transcription factors, is highly expressed in the ectoderm and all epidermal layers during embryogenesis. To investigate the role of DP-1 in epidermal morphogenesis, we inhibited DP-1 activity through exogenous expression of a dominant-negative mutant (dnDP-1). Expression of the dnDP-1 mutant interferes with binding of E2F/DP-1 heterodimers to DNA and inhibits DNA replication, as well as cyclin A mRNA and protein expression. Chromatin immunoprecipitation analysis demonstrated that the cyclin A promoter is predominantly bound in proliferating keratinocytes by complexes containing E2F-3 and E2F-4. Thus, the mechanisms of decreased expression of cyclin A in the presence of dnDP-1 seem to involve inactivation of DP-1 complexes containing E2F-3 and E2F-4. To assess the consequences on epidermal morphogenesis of inhibiting DP-1 activity, we expressed dnDP-1 in rat epithelial keratinocytes in organotypic culture and observed that DP-1 inhibition negatively affected stratification of these cells. Likewise, expression of dnDP-1 in embryonic ectoderm explants produced extensive disorganization of subsequently formed epidermal basal and suprabasal layers, interfering with normal epidermal formation. We conclude that DP-1 activity is required for normal epidermal morphogenesis and ectoderm-to-epidermis transition.

  4. Effects of UVB-induced oxidative stress on protein expression and specific protein oxidation in normal human epithelial keratinocytes: a proteomic approach

    Directory of Open Access Journals (Sweden)

    De Marco Federico

    2010-03-01

    Full Text Available Abstract Background The UVB component of solar ultraviolet irradiation is one of the major risk factors for the development of skin cancer in humans. UVB exposure elicits an increased generation of reactive oxygen species (ROS, which are responsible for oxidative damage to proteins, DNA, RNA and lipids. In order to examine the biological impact of UVB irradiation on skin cells, we used a parallel proteomics approach to analyze the protein expression profile and to identify oxidatively modified proteins in normal human epithelial keratinocytes. Results The expression levels of fifteen proteins - involved in maintaining the cytoskeleton integrity, removal of damaged proteins and heat shock response - were differentially regulated in UVB-exposed cells, indicating that an appropriate response is developed in order to counteract/neutralize the toxic effects of UVB-raised ROS. On the other side, the redox proteomics approach revealed that seven proteins - involved in cellular adhesion, cell-cell interaction and protein folding - were selectively oxidized. Conclusions Despite a wide and well orchestrated cellular response, a relevant oxidation of specific proteins concomitantly occurs in UVB-irradiated human epithelial Keratinocytes. These modified (i.e. likely dysfunctional proteins might result in cell homeostasis impairment and therefore eventually promote cellular degeneration, senescence or carcinogenesis.

  5. Effects of Human Mesenchymal Stem Cells Coculture on Calcium-Induced Differentiation of Normal Human Keratinocytes.

    Science.gov (United States)

    Sah, Shyam Kishor; Kim, Hae Young; Lee, Ji Hae; Lee, Seong-Wook; Kim, Hyung-Sik; Kim, Yeon-Soo; Kang, Kyung-Sun; Kim, Tae-Yoon

    2017-06-01

    The influence of mesenchymal stem cells (MSCs) on keratinocytes in altered microenvironments is poorly understood. Here, we cocultured umbilical cord blood-derived MSCs with normal human epidermal keratinocytes to evaluate their paracrine effect in the presence of high extracellular calcium (Ca 2+ ) concentration. High Ca 2+ environment to keratinocytes can disrupt normal skin barrier function due to abnormal/premature differentiation of keratinocytes. Surprisingly, we found that MSCs suppress both proliferation and differentiation of keratinocytes under a high Ca 2+ environment in transforming growth factors β1 (TGFβ1)-dependent manner. Furthermore, we determined that MSCs can regulate the mitogen-activated protein kinases, phosphatidylinositol 3-kinase/protein kinase B, and protein kinase C pathways in Ca 2+ -induced differentiated keratinocytes. Knockdown of TGFβ1 from MSCs results in decreased suppression of differentiation with significantly increased proliferation of keratinocytes compared with control MSCs. MSCs-derived TGFβ1 further induced growth inhibition of keratinocyte in high extracellular Ca 2+ environment as analyzed by a decrease in DNA synthesis, accumulation of phosphorylated retinoblastoma protein, cdc2, and increased mRNA level of p21, and independent of TGFβ1/SMAD pathway. Taken together, we found that MSCs-derived TGFβ1 is a critical regulator of keratinocyte function, and involves multiple proximal signaling cascades. Stem Cells 2017;35:1592-1602. © 2017 AlphaMed Press.

  6. The caspase-1 inhibitor CARD18 is specifically expressed during late differentiation of keratinocytes and its expression is lost in lichen planus.

    Science.gov (United States)

    Qin, Haihong; Jin, Jiang; Fischer, Heinz; Mildner, Michael; Gschwandtner, Maria; Mlitz, Veronika; Eckhart, Leopold; Tschachler, Erwin

    2017-08-01

    CARD18 contains a caspase recruitment domain (CARD) via which it binds to caspase-1 and thereby inhibits caspase-1-mediated activation of the pro-inflammatory cytokine interleukin (IL)-1β. To determine the expression profile and the role of CARD18 during differentiation of keratinocytes and to compare the expression of CARD18 in normal skin and in inflammatory skin diseases. Human keratinocytes were induced to differentiate in monolayer and in 3D skin equivalent cultures. In some experiments, CARD18-specific siRNAs were used to knock down expression of CARD18. CARD18 mRNA levels were determined by quantitative real-time PCR, and CARD18 protein was detected by Western blot and immunofluorescence analyses. In situ expression was analyzed in skin biopsies obtained from healthy donors and patients with psoriasis and lichen planus. CARD18 mRNA was expressed in the epidermis at more than 100-fold higher levels than in any other human tissue. Within the epidermis, CARD18 was specifically expressed in the granular layer. In vitro CARD18 was strongly upregulated at both mRNA and protein levels in keratinocytes undergoing terminal differentiation. In skin equivalent cultures the expression of CARD18 was efficiently suppressed by siRNAs without impairing stratum corneum formation. Epidermal expression of CARD18 was increased after ultraviolet (UV)B irradiation of skin explants. In skin biopsies of patients with psoriasis no consistent regulation of CARD18 expression was observed, however, in lesional epidermis of patients with lichen planus, CARD18 expression was either greatly diminished or entirely absent whereas in non-lesional areas expression was comparable to normal skin. Our results identify CARD18 as a differentiation-associated keratinocyte protein that is altered in abundance by UV stress. Its downregulation in lichen planus indicates a potential role in inflammatory reactions of the epidermis in this disease. Copyright © 2017 Japanese Society for Investigative

  7. Cox2 and β-Catenin/T-cell Factor Signaling Intestinalize Human Esophageal Keratinocytes When Cultured under Organotypic Conditions

    Directory of Open Access Journals (Sweden)

    Jianping Kong

    2011-09-01

    Full Text Available The incidence of esophageal adenocarcinoma (EAC is rising in the United States. An important risk factor for EAC is the presence of Barrett esophagus (BE. BE is the replacement of normal squamous esophageal epithelium with a specialized columnar epithelium in response to chronic acid and bile reflux. However, the emergence of BE from squamous keratinocytes has not yet been demonstrated. Our research has focused on this. Wnt and cyclooxygenase 2 (Cox2 are two pathways whose activation has been associated with BE and progression to EAC, but their role has not been tested experimentally. To explore their contribution, we engineered a human esophageal keratinocyte cell line to express either a dominant-active Wnt effector CatCLef or a Cox2 complementary DNA. In a two-dimensional culture environment, Cox2 expression increases cell proliferation and migration, but neither transgene induces known BE markers. In contrast, when these cells were placed into three-dimensional organotypic culture conditions, we observed more profound effects. CatCLef-expressing cells were more proliferative, developed a thicker epithelium, and upregulated Notch signaling and several BE markers including NHE2. Cox2 expression also increased cell proliferation and induced a thicker epithelium. More importantly, we observed cysts form within the epithelium, filled with intestinal mucins including Muc5B and Muc17. This suggests that Cox2 expression in a three-dimensional culture environment induces a lineage of mucin-secreting cells and supports an important causal role for Cox2 in BE pathogenesis. We conclude that in vitro modeling of BE pathogenesis can be improved by enhancing Wnt signaling and Cox2 activity and using three-dimensional organotypic culture conditions.

  8. In vivo relative quantitative proteomics reveals HMGB1 as a downstream mediator of oestrogen-stimulated keratinocyte migration.

    Science.gov (United States)

    Shin, Jung U; Noh, Ji Yeon; Lee, Ju Hee; Lee, Won Jai; Yoo, Jong Shin; Kim, Jin Young; Kim, Hyeran; Jung, Inhee; Jin, Shan; Lee, Kwang Hoon

    2015-06-01

    It is known that oestrogen influences skin wound healing by modulating the inflammatory response, cytokine expression and extracellular matrix deposition; accelerating re-epithelialization; and stimulating angiogenesis. To identify novel proteins associated with effects of oestrogen on keratinocyte, stable isotope labelling by amino acids in cell culture (SILAC)-based mass spectrometry was performed. Using SILAC, quantification of 1085 proteins was achieved. Among these proteins, 60 proteins were upregulated and 32 proteins were downregulated. Among significantly upregulated proteins, high-mobility group protein B1 (HMGB1) has been further evaluated for its role in the effect of oestrogen on keratinocytes. HMGB1 expression was strongly induced in oestrogen-treated keratinocytes in dose- and time-dependent manner. Further, HMGB1 was able to significantly accelerate the rate of HaCaT cell migration. To determine whether HMGB1 is involved in E2-induced HaCaT cell migration, cells were transfected with HMGB1 siRNA. Knockdown of HMGB1 blocked oestrogen-induced keratinocyte migration. Collectively, these experiments demonstrate that HMGB1 is a novel downstream mediator of oestrogen-stimulated keratinocyte migration. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. cDNA microarray analysis of human keratinocytes cells of patients submitted to chemoradiotherapy and oral photobiomodulation therapy: pilot study.

    Science.gov (United States)

    Antunes, Heliton S; Wajnberg, Gabriel; Pinho, Marcos B; Jorge, Natasha Andressa Nogueira; de Moraes, Joyce Luana Melo; Stefanoff, Claudio Gustavo; Herchenhorn, Daniel; Araújo, Carlos M M; Viégas, Celia Maria Pais; Rampini, Mariana P; Dias, Fernando L; de Araujo-Souza, Patricia Savio; Passetti, Fabio; Ferreira, Carlos G

    2018-01-01

    Oral mucositis is an acute toxicity that occurs in patients submitted to chemoradiotherapy to treat head and neck squamous cell carcinoma. In this study, we evaluated differences in gene expression in the keratinocytes of the oral mucosa of patients treated with photobiomodulation therapy and tried to associate the molecular mechanisms with clinical findings. From June 2009 to December 2010, 27 patients were included in a randomized double-blind pilot study. Buccal smears from 13 patients were obtained at days 1 and 10 of chemoradiotherapy, and overall gene expression of samples from both dates were analyzed by complementary DNA (cDNA) microarray. In addition, samples from other 14 patients were also collected at D1 and D10 of chemoradiotherapy for subsequent validation of cDNA microarray findings by qPCR. The expression array analysis identified 105 upregulated and 60 downregulated genes in our post-treatment samples when compared with controls. Among the upregulated genes with the highest fold change, it was interesting to observe the presence of genes related to keratinocyte differentiation. Among downregulated genes were observed genes related to cytotoxicity and immune response. The results indicate that genes known to be induced during differentiation of human epidermal keratinocytes were upregulated while genes associated with cytotoxicity and immune response were downregulated in the laser group. These results support previous clinical findings indicating that the lower incidence of oral mucositis associated with photobiomodulation therapy might be correlated to the activation of genes involved in keratinocyte differentiation.

  10. Astragaloside IV Downregulates β-Catenin in Rat Keratinocytes to Counter LiCl-Induced Inhibition of Proliferation and Migration

    Directory of Open Access Journals (Sweden)

    Fu-Lun Li

    2012-01-01

    Full Text Available Re-epithelialization is a crucial step towards wound healing. The traditional Chinese medicine, Astragalus membranaceus (Fisch Bge, has been used for hundreds of years for many kinds of ulcerated wounds. Recent research has identified the active compound in this drug as astragaloside IV (AS-IV, but the underlying molecular mechanisms of its therapeutic action on keratinocytes remain poorly understood. In this study, we used an in vitro model of ulcer-like wound processes, lithium chloride (LiCl-induced cultured mouse keratinocytes, to investigate the effects of AS-IV treatment. The effects on cell proliferation were evaluated by the MTS/PMS colorimetric assay, effects on cell migration were determined by a wound-healing scratch experiment, effects on the cell cycle were analyzed by flow cytometry, and effects on protein expression were analyzed by immunoblotting and immunofluorescence. LiCl strongly inhibited cell proliferation and migration, up-regulated β-catenin expression, and down-regulated proliferating cell nuclear antigen (PCNA expression. AS-IV treatment attenuat the inhibition of proliferation and migration, significantly reducing the enhanced β-catenin expression, and recovering PCNA and β-tubulin expression. Thus, AS-IV mediates mouse keratinocyte proliferation and migration via regulation of the Wnt signaling pathway. Down-regulating β-catenin to increase keratinocyte migration and proliferation is one mechanism by which AS-IV can promote ulcerated wound healing.

  11. The radiosensitivity of human keratinocytes: influence of activated c-H-ras oncogene expression and tumorigenicity

    International Nuclear Information System (INIS)

    Mendonca, M.S.; Redpath, J.L.; Stanbridge, E.J.

    1991-01-01

    The authors investigated γ-ray sensitivity of several activated c-H-ras (EJ) containing clones established after transfection of the spontaneously immortalized non-tumorigenic human keratinocyte cell line HaCaT. The clones were grouped according to tumorigenic potential after subcutaneous injection into nude mice, and fell into three classes: Class I clones A-4 and I-6 are non-tumorigenic and express very low levels of c-H-ras mRNA and no mutated ras protein (p 21 ); Class II clones I-5 and I-7 grow to large (benign) epidermal cysts, express intermediate to high c-H-ras mRNA and variable levels of mutated ras p 21 protein with clone I-5 expressing little and clone I-7 expressing high levels of p 21 ; Class III clones II-3 and II-4 grow to solid squamous cell carcinomas, express high c-H-ras mRNA and high level of mutated p 21 ras protein similar to clone I-7. Comparison of single-hit multitarget or linear-quadratic survival curve parameters, and survival at 2Gy (S 2 ) indicate no general correlation with either activated c-H-ras expression level or tumorigenic potential, and increased radioresistance. (author)

  12. Comparative study of human-induced pluripotent stem cells derived from bone marrow cells, hair keratinocytes, and skin fibroblasts.

    Science.gov (United States)

    Streckfuss-Bömeke, Katrin; Wolf, Frieder; Azizian, Azadeh; Stauske, Michael; Tiburcy, Malte; Wagner, Stefan; Hübscher, Daniela; Dressel, Ralf; Chen, Simin; Jende, Jörg; Wulf, Gerald; Lorenz, Verena; Schön, Michael P; Maier, Lars S; Zimmermann, Wolfram H; Hasenfuss, Gerd; Guan, Kaomei

    2013-09-01

    Induced pluripotent stem cells (iPSCs) provide a unique opportunity for the generation of patient-specific cells for use in disease modelling, drug screening, and regenerative medicine. The aim of this study was to compare human-induced pluripotent stem cells (hiPSCs) derived from different somatic cell sources regarding their generation efficiency and cardiac differentiation potential, and functionalities of cardiomyocytes. We generated hiPSCs from hair keratinocytes, bone marrow mesenchymal stem cells (MSCs), and skin fibroblasts by using two different virus systems. We show that MSCs and fibroblasts are more easily reprogrammed than keratinocytes. This corresponds to higher methylation levels of minimal promoter regions of the OCT4 and NANOG genes in keratinocytes than in MSCs and fibroblasts. The success rate and reprogramming efficiency was significantly higher by using the STEMCCA system than the OSNL system. All analysed hiPSCs are pluripotent and show phenotypical characteristics similar to human embryonic stem cells. We studied the cardiac differentiation efficiency of generated hiPSC lines (n = 24) and found that MSC-derived hiPSCs exhibited a significantly higher efficiency to spontaneously differentiate into beating cardiomyocytes when compared with keratinocyte-, and fibroblast-derived hiPSCs. There was no significant difference in the functionalities of the cardiomyocytes derived from hiPSCs with different origins, showing the presence of pacemaker-, atrial-, ventricular- and Purkinje-like cardiomyocytes, and exhibiting rhythmic Ca2+ transients and Ca2+ sparks in hiPSC-derived cardiomyocytes. Furthermore, spontaneously and synchronously beating and force-developing engineered heart tissues were generated. Human-induced pluripotent stem cells can be reprogrammed from all three somatic cell types, but with different efficiency. All analysed iPSCs can differentiate into cardiomyocytes, and the functionalities of cardiomyocytes derived from different cell

  13. Gene Expression Response of Trichophyton rubrum during Coculture on Keratinocytes Exposed to Antifungal Agents

    Directory of Open Access Journals (Sweden)

    Tatiana Takahasi Komoto

    2015-01-01

    Full Text Available Trichophyton rubrum is the most common causative agent of dermatomycoses worldwide, causing infection in the stratum corneum, nails, and hair. Despite the high prevalence of these infections, little is known about the molecular mechanisms involved in the fungal-host interaction, particularly during antifungal treatment. The aim of this work was to evaluate the gene expression of T. rubrum cocultured with keratinocytes and treated with the flavonoid trans-chalcone and the glycoalkaloid α-solanine. Both substances showed a marked antifungal activity against T. rubrum strain CBS (MIC = 1.15 and 17.8 µg/mL, resp.. Cytotoxicity assay against HaCaT cells produced IC50 values of 44.18 to trans-chalcone and 61.60 µM to α-solanine. The interaction of keratinocytes with T. rubrum conidia upregulated the expression of genes involved in the glyoxylate cycle, ergosterol synthesis, and genes encoding proteases but downregulated the ABC transporter TruMDR2 gene. However, both antifungals downregulated the ERG1 and ERG11, metalloprotease 4, serine proteinase, and TruMDR2 genes. Furthermore, the trans-chalcone downregulated the genes involved in the glyoxylate pathway, isocitrate lyase, and citrate synthase. Considering the urgent need for more efficient and safer antifungals, these results contribute to a better understanding of fungal-host interactions and to the discovery of new antifungal targets.

  14. Transmembrane collagen XVII modulates integrin dependent keratinocyte migration via PI3K/Rac1 signaling.

    Directory of Open Access Journals (Sweden)

    Stefanie Löffek

    Full Text Available The hemidesmosomal transmembrane component collagen XVII (ColXVII plays an important role in the anchorage of the epidermis to the underlying basement membrane. However, this adhesion protein seems to be also involved in the regulation of keratinocyte migration, since its expression in these cells is strongly elevated during reepithelialization of acute wounds and in the invasive front of squamous cell carcinoma, while its absence in ColXVII-deficient keratinocytes leads to altered cell motility. Using a genetic model of murine Col17a1⁻/⁻ keratinocytes we elucidated ColXVII mediated signaling pathways in cell adhesion and migration. Col17a1⁻/⁻ keratinocytes exhibited increased spreading on laminin 332 and accelerated, but less directed cell motility. These effects were accompanied by increased expression of the integrin subunits β4 and β1. The migratory phenotype, as evidenced by formation of multiple unstable lamellipodia, was associated with enhanced phosphoinositide 3-kinase (PI3K activity. Dissection of the signaling pathway uncovered enhanced phosphorylation of the β4 integrin subunit and the focal adhesion kinase (FAK as activators of PI3K. This resulted in elevated Rac1 activity as a downstream consequence. These results provide mechanistic evidence that ColXVII coordinates keratinocyte adhesion and directed motility by interfering integrin dependent PI3K activation and by stabilizing lamellipodia at the leading edge of reepithelializing wounds and in invasive squamous cell carcinoma.

  15. Induction of PDGF-B in TCA-treated epidermal keratinocytes.

    Science.gov (United States)

    Yonei, Nozomi; Kanazawa, Nobuo; Ohtani, Toshio; Furukawa, Fukumi; Yamamoto, Yuki

    2007-11-01

    Trichloroacetic acid (TCA) is one of the most widely used peeling agents, and induces full necrosis of the whole epidermis, followed by reconstitution of the epidermis and the matrix of the papillary dermis. The cytotoxic effects of TCA, such as suppressing proliferation of keratinocytes and fibroblasts and protein synthesis by fibroblasts, have already been reported. However, the entire biological mechanism responsible for TCA peeling has yet to be determined. Hypothetical activation effects of TCA treatment on epidermal cells to induce production of growth factors and cytokines are examined, and are compared with its cytotoxic effects in terms of time course and applied TCA concentrations. After various periods of incubation with TCA, viability of Pam212 murine keratinocytes was investigated with MTT assay and dye exclusion assay, and production of growth factors and cytokines with reverse transcription-polymerase chain reaction (RT-PCR). Changes in platelet-derived growth factor (PDGF)-B mRNA expression and protein production in the human skin specimens after TCA application were then examined by RT-PCR and immunohistochemistry, respectively. Incubation with TCA showed cytotoxicity and induced death of Pam212 cells, depending on the incubation period and the TCA concentration. In addition, expressions of PDGF-B, tumor growth factor (TGF)-alpha, TGF- beta1 and vascular endothelial growth factor, which are the growth factors reportedly secreted from keratinocytes during wound healing, were all detected in Pam212 cells after short-term treatment with TCA. Expressions of inflammatory cytokines such as interleukin (IL)-1 and IL-10 were also induced. In TCA-treated NIH-3T3 fibroblasts, in contrast, observed was upregulation of only keratinocyte growth factor, which is reportedly secreted from fibroblasts, as well as the similar cytotoxic effect. In human skin, PDGF-B mRNA expression became significantly upregulated after TCA application, and then immediately

  16. Punicalagin and (-)-Epigallocatechin-3-Gallate Rescue Cell Viability and Attenuate Inflammatory Responses of Human Epidermal Keratinocytes Exposed to Airborne Particulate Matter PM10.

    Science.gov (United States)

    Seok, Jin Kyung; Lee, Jeong-Won; Kim, Young Mi; Boo, Yong Chool

    2018-01-01

    Airborne particulate matter with a diameter of < 10 µm (PM10) causes oxidative damage, inflammation, and premature skin aging. In this study, we evaluated whether polyphenolic antioxidants attenuate the inflammatory responses of PM10-exposed keratinocytes. Primary human epidermal keratinocytes were exposed in vitro to PM10 in the absence or presence of punicalagin and (-)-epigallocatechin-3-gallate (EGCG), which are the major polyphenolic antioxidants found in pomegranate and green tea, respectively. Assays were performed to determine cell viability, production of reactive oxygen species (ROS), and expression of NADPH oxidases (NOX), proinflammatory cytokines, and matrix metalloproteinase (MMP)-1. PM10 decreased cell viability and increased ROS production in a dose-dependent manner. It also increased the expression levels of NOX-1, NOX-2, tumor necrosis factor-α (TNF-α), interleukin (IL)-1β, IL-6, IL-8, and MMP-1. Punicalagin was not cytotoxic up to 300 μM, and (-)-EGCG was cytotoxic above 30 μM, respectively. Further, punicalagin (3-30 μM) and EGCG (3-10 μM) rescued the viability of PM10-exposed cells. They also attenuated ROS production and the expression of NOX-1, NOX-2, TNF-α, IL-1β, IL-6, IL-8, and MMP-1 stimulated by PM10. This study demonstrates that polyphenolic antioxidants, such as punicalagin and (-)-EGCG, rescue keratinocyte viability and attenuate the inflammatory responses of these cells due to airborne particles. © 2018 S. Karger AG, Basel.

  17. Cdc42 is crucial for the maturation of primordial cell junctions in keratinocytes independent of Rac1

    DEFF Research Database (Denmark)

    Du, Dan; Pedersen, Esben; Wang, Zhipeng

    2008-01-01

    Cell-cell contacts are crucial for the integrity of all tissues. Contrasting reports have been published about the role of Cdc42 in epithelial cell-cell contacts in vitro. In keratinocytes, it was suggested that Rac1 and not Cdc42 is crucial for the formation of mature epithelial junctions, based...... on dominant negative inhibition experiments. Deletion of the Cdc42 gene in keratinocytes in vivo slowly impaired the maintenance of cell-cell contacts by an increased degradation of beta-catenin. Whether Cdc42 is required for the formation of mature junctions was not tested. We show now that Cdc42-deficient...... immortalized and primary keratinocytes form only punctate primordial cell contacts in vitro, which cannot mature into belt-like junctions. This defect was independent of enhanced degradation of beta-catenin, but correlated to an impaired activation and localization of aPKCzeta in the Cdc42-null keratinocytes...

  18. Oral keratinocyte stem/progenitor cells: specific markers, molecular signaling pathways and potential uses.

    Science.gov (United States)

    Calenic, Bogdan; Greabu, Maria; Caruntu, Constantin; Tanase, Cristiana; Battino, Maurizio

    2015-10-01

    Oral keratinocyte stem cells reside in the basal layers of the oral epithelium, representing a minor population of cells with a great potential to self-renew and proliferate over the course of their lifetime. As a result of the potential uses of oral keratinocyte stem cells in regenerative medicine and the key roles they play in tissue homeostasis, inflammatory conditions, wound healing and tumor initiation and progression, intense scientific efforts are currently being undertaken to identify, separate and reprogram these cells. Although currently there is no specific marker that can characterize and isolate oral keratinocyte stem cells, several suggestions have been made. Thus, different stem/progenitor-cell subpopulations have been categorized based on combinations of positive and/or negative membrane-surface markers, which include integrins, clusters of differentiation and cytokeratins. Important advances have also been made in understanding the molecular pathways that govern processes such as self-renewal, differentiation, proliferation, wound healing and programmed cell death. A thorough understanding of stem-cell biology and the molecular players that govern cellular fate is paramount in the quest for using stem-cell-derived therapies in the treatment of various oral pathologies. The current review focuses on recent advances in understanding the molecular signaling pathways coordinating the behavior of these cells and in identifying suitable markers used for their isolation and characterization. Special emphasis will also be placed on the roles played by oral keratinocyte stem and progenitor cells in normal and diseased oral tissues and on their potential uses in the fields of general medicine and dentistry. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Increased keratinocyte proliferation initiated through downregulation of desmoplakin by RNA interference

    International Nuclear Information System (INIS)

    Wan Hong; South, Andrew P.; Hart, Ian R.

    2007-01-01

    The intercellular adhesive junction desmosomes are essential for the maintenance of tissue structure and integrity in skin. Desmoplakin (Dp) is a major obligate plaque protein which plays a fundamental role in anchoring intermediate filaments to desmosomal cadherins. Evidence from hereditary human disease caused by mutations in the gene encoding Dp, e.g. Dp haploinsufficiency, suggests that alterations in Dp expression result not only in the disruption of tissue structure and integrity but also could evoke changes in keratinocyte proliferation. We have used transient RNA interference (RNAi) to downregulate Dp specifically in HaCaT keratinocytes. We showed that this Dp downregulation also caused reduced expression of several other desmosomal proteins. Increased cell proliferation and enhanced G 1 -to-S-phase entry in the cell cycle, as monitored by colonial cellular density and BrdU incorporation, were seen in Dp RNAi-treated cells. These proliferative changes were associated with elevated phospho-ERK1/2 and phospho-Akt levels. Furthermore, this increase in phospho-ERK/1/2 and phospho-Akt levels was sustained in Dp RNAi-treated cells at confluence whereas in control cells there was a significant reduction in phosphorylation of ERK1/2. This study indicates that Dp may participate in the regulation of keratinocyte cell proliferation by, in part at least, regulating cell cycle progression

  20. Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

    Science.gov (United States)

    Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

    2013-02-01

    Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

  1. Cell cycle pathway dysregulation in human keratinocytes during chronic exposure to low arsenite.

    Science.gov (United States)

    Al-Eryani, Laila; Waigel, Sabine; Jala, Venkatakrishna; Jenkins, Samantha F; States, J Christopher

    2017-09-15

    Arsenic is naturally prevalent in the earth's crust and widely distributed in air and water. Chronic low arsenic exposure is associated with several cancers in vivo, including skin cancer, and with transformation in vitro of cell lines including immortalized human keratinocytes (HaCaT). Arsenic also is associated with cell cycle dysregulation at different exposure levels in multiple cell lines. In this work, we analyzed gene expression in HaCaT cells to gain an understanding of gene expression changes contributing to transformation at an early time point. HaCaT cells were exposed to 0 or 100nM NaAsO 2 for 7weeks. Total RNA was purified and analyzed by microarray hybridization. Differential expression with fold change≥|1.5| and p-value≤0.05 was determined using Partek Genomic Suite™ and pathway and network analyses using MetaCore™ software (FDR≤0.05). Cell cycle analysis was performed using flow cytometry. 644 mRNAs were differentially expressed. Cell cycle/cell cycle regulation pathways predominated in the list of dysregulated pathways. Genes involved in replication origin licensing were enriched in the network. Cell cycle assay analysis showed an increase in G2/M compartment in arsenite-exposed cells. Arsenite exposure induced differential gene expression indicating dysregulation of cell cycle control, which was confirmed by cell cycle analysis. The results suggest that cell cycle dysregulation is an early event in transformation manifested in cells unable to transit G2/M efficiently. Further study at later time points will reveal additional changes in gene expression related to transformation processes. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Ecklonia cava Extract and Dieckol Attenuate Cellular Lipid Peroxidation in Keratinocytes Exposed to PM10.

    Science.gov (United States)

    Lee, Jeong-Won; Seok, Jin Kyung; Boo, Yong Chool

    2018-01-01

    Airborne particulate matter can cause oxidative stress, inflammation, and premature skin aging. Marine plants such as Ecklonia cava Kjellman contain high amounts of polyphenolic antioxidants. The purpose of this study was to examine the antioxidative effects of E. cava extract in cultured keratinocytes exposed to airborne particulate matter with a diameter of <10  μ m (PM10). After the exposure of cultured HaCaT keratinocytes to PM10 in the absence and presence of E. cava extract and its constituents, cell viability and cellular lipid peroxidation were assessed. The effects of eckol and dieckol on cellular lipid peroxidation and cytokine expression were examined in human epidermal keratinocytes exposed to PM10. The total phenolic content of E. cava extract was the highest among the 50 marine plant extracts examined. The exposure of HaCaT cells to PM10 decreased cell viability and increased lipid peroxidation. The PM10-induced cellular lipid peroxidation was attenuated by E. cava extract and its ethyl acetate fraction. Dieckol more effectively attenuated cellular lipid peroxidation than eckol in both HaCaT cells and human epidermal keratinocytes. Dieckol and eckol attenuated the expression of inflammatory cytokines such as tumor necrosis factor- (TNF-) α , interleukin- (IL-) 1 β , IL-6, and IL-8 in human epidermal keratinocytes stimulated with PM10. This study suggested that the polyphenolic constituents of E. cava , such as dieckol, attenuated the oxidative and inflammatory reactions in skin cells exposed to airborne particulate matter.

  3. Osteo-/odontogenic differentiation of induced mesenchymal stem cells generated through epithelial-mesenchyme transition of cultured human keratinocytes.

    Science.gov (United States)

    Yi, Jin-Kyu; Mehrazarin, Shebli; Oh, Ju-Eun; Bhalla, Anu; Oo, Jenessa; Chen, Wei; Lee, Min; Kim, Reuben H; Shin, Ki-Hyuk; Park, No-Hee; Kang, Mo K

    2014-11-01

    Revascularization of necrotic pulp has been successful in the resolution of periradicular inflammation; yet, several case studies suggest the need for cell-based therapies using mesenchymal stem cells (MSCs) as an alternative for de novo pulp regeneration. Because the availability of MSCs may be limited, especially in an aged population, the current study reports an alternative approach in generating MSCs from epidermal keratinocytes through a process called epithelial-mesenchymal transition (EMT). We induced EMT in primary normal human epidermal keratinocytes (NHEKs) by transient transfection of small interfering RNA targeting the p63 gene. The resulting cells were assayed for their mesenchymal marker expression, proliferation capacities as a monolayer and in a 3-dimensional collagen scaffold, and differentiation capacities. Transient transfection of p63 small-interfering RNA successfully abolished the expression of endogenous p63 in NHEKs and induced the expression of mesenchymal markers (eg, vimentin and fibronectin), whereas epithelial markers (eg, E-cadherin and involucrin) were lost. The NHEKs exhibiting the EMT phenotype acquired extended replicative potential and an increased telomere length compared with the control cells. Similar to the established MSCs, the NHEKs with p63 knockdown showed attachment onto the 3-dimensional collagen scaffold and underwent progressive proliferation and differentiation. Upon differentiation, these EMT cells expressed alkaline phosphatase activity, osteocalcin, and osteonectin and readily formed mineralized nodules detected by alizarin S red staining, showing osteo-/odontogenic differentiation. The induction of EMT in primary NHEKs by means of transient p63 knockdown allows the generation of induced MSCs from autologous sources. These cells may be used for tissues engineering purposes, including that of dental pulp. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  4. Large-scale analysis of protein expression changes in human keratinocytes immortalized by human papilloma virus type 16 E6 and E7 oncogenes

    Directory of Open Access Journals (Sweden)

    Arnouk Hilal

    2009-08-01

    Full Text Available Abstract Background Infection with high-risk type human papilloma viruses (HPVs is associated with cervical carcinomas and with a subset of head and neck squamous cell carcinomas. Viral E6 and E7 oncogenes cooperate to achieve cell immortalization by a mechanism that is not yet fully understood. Here, human keratinocytes were immortalized by long-term expression of HPV type 16 E6 or E7 oncoproteins, or both. Proteomic profiling was used to compare expression levels for 741 discrete protein features. Results Six replicate measurements were performed for each group using two-dimensional difference gel electrophoresis (2D-DIGE. The median within-group coefficient of variation was 19–21%. Significance of between-group differences was tested based on Significance Analysis of Microarray and fold change. Expression of 170 (23% of the protein features changed significantly in immortalized cells compared to primary keratinocytes. Most of these changes were qualitatively similar in cells immortalized by E6, E7, or E6/7 expression, indicating convergence on a common phenotype, but fifteen proteins (~2% were outliers in this regulatory pattern. Ten demonstrated opposite regulation in E6- and E7-expressing cells, including the cell cycle regulator p16INK4a; the carbohydrate binding protein Galectin-7; two differentially migrating forms of the intermediate filament protein Cytokeratin-7; HSPA1A (Hsp70-1; and five unidentified proteins. Five others had a pattern of expression that suggested cooperativity between the co-expressed oncoproteins. Two of these were identified as forms of the small heat shock protein HSPB1 (Hsp27. Conclusion This large-scale analysis provides a framework for understanding the cooperation between E6 and E7 oncoproteins in HPV-driven carcinogenesis.

  5. Platelets Regulate the Migration of Keratinocytes via Podoplanin/CLEC-2 Signaling during Cutaneous Wound Healing in Mice.

    Science.gov (United States)

    Asai, Jun; Hirakawa, Satoshi; Sakabe, Jun-ichi; Kishida, Tsunao; Wada, Makoto; Nakamura, Naomi; Takenaka, Hideya; Mazda, Osam; Urano, Tetsumei; Suzuki-Inoue, Katsue; Tokura, Yoshiki; Katoh, Norito

    2016-01-01

    Podoplanin is an endogenous ligand for C-type lectin-like receptor 2 (CLEC-2), which is expressed on platelets. Recent evidence indicates that this specific marker of lymphatic endothelial cells is also expressed by keratinocytes at the edge of wounds. However, whether podoplanin or platelets play a role in keratinocyte activity during wound healing remains unknown. We evaluated the effect of podoplanin expression levels on keratinocyte motility using cultured primary normal human epidermal keratinocytes (NHEKs). Down-regulation of podoplanin in NHEKs via transfection with podoplanin siRNA inhibited their migration, indicating that podoplanin plays a mandatory role in this process. In addition, down-regulation of podoplanin was correlated with up-regulation of E-cadherin, suggesting that podoplanin-mediated stimulation of keratinocyte migration is associated with a loss of E-cadherin. Both the addition of platelets and treatment with CLEC-2 inhibited the migration of NHEKs. The down-regulation of RhoA activity and the up-regulation of E-cadherin in keratinocytes were also induced by CLEC-2. In conclusion, these results suggest that podoplanin/CLEC-2 signaling regulates keratinocyte migration via modulating E-cadherin expression through RhoA signaling. Altering the regulation of keratinocyte migration by podoplanin might be a novel therapeutic approach to improve wound healing. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  6. Marked stimulation of growth and motility of human keratinocytes by hepatocyte growth factor

    International Nuclear Information System (INIS)

    Matsumoto, K.; Hashimoto, K.; Yoshikawa, K.; Nakamura, T.

    1991-01-01

    Effect of hepatocyte growth factor (HGF) on normal human epidermal keratinocytes cultured under conditions of low Ca2+ (0.1 mM, growth-promoting condition) and physiological Ca2+ (1.8 mM, differentiation-promoting condition) was investigated. In low Ca2+, HGF markedly enhanced the migration of keratinocytes while it suppressed cell growth and DNA synthesis in a dose-dependent manner. In contrast, HGF enhanced the migration, cell growth, and DNA synthesis of keratinocytes cultured under conditions of physiological Ca2+. The maximal stimulation of DNA synthesis (2.4-fold stimulation) in physiological Ca2+ was seen at 2.5-5 ng/ml HGF and the stimulatory effect of HGF was suppressed by transforming growth factor-beta 1. Analysis of the HGF receptor using 125I-HGF as a ligand showed that human keratinocytes expressed a single class of specific, saturable receptor for HGF in both low and physiological Ca2+ conditions, exhibiting a Kd = 17.3 pM and approximately 690 binding sites/cell under physiological Ca2+. Thus, HGF is a potent factor which enhances growth and migration of normal human keratinocytes under conditions of physiological Ca2+. HGF may play an important role in epidermal tissue repair as it enhances both the migration and growth of keratinocytes

  7. Tofacitinib Represses the Janus Kinase-Signal Transducer and Activators of Transcription Signalling Pathway in Keratinocytes.

    Science.gov (United States)

    Srivastava, Ankit; Ståhle, Mona; Pivarcsi, Andor; Sonkoly, Enikö

    2018-05-08

    Tofacitinib is a Janus kinase (JAK) inhibitor, which has shown efficacy in treating psoriasis. The mode of action of tofacitinib is not completely understood but it has been thought to be mediated by the inhibition of CD4+ T-cell activation. Here, we investigated whether the molecular targets of tofacitinib are expressed in keratinocytes, and whether tofacitinib can modulate the activity of the JAK/Signal Transducer and Activators of Transcription (STAT)-pathway in keratinocytes. Transcriptomic profiling of human keratinocytes treated with IL-22 in combination with tofacitinib revealed that tofacitinib could prevent the majority of IL-22-mediated gene expression changes. Pathway analysis of tofacitinib-regulated genes in keratinocytes revealed enrichment of genes involved in the JAK/STAT signalling pathway. Quantitative real-time-PCR confirmed the upregulation of S100A7 and downregulation of EGR1 expression by IL-22, which was prevented by tofacitinib pre-treatment. These results indicate a direct effect of tofacinitib on keratinocytes, which can have relevance for systemic as well as for topical treatment of psoriasis with tofacitinib.

  8. Increased ICAM-1 Expression in Transformed Human Oral Epithelial Cells: Molecular Mechanism and Functional Role in Peripheral Blood Mononuclear Cell Adhesion and Lymphokine-Activated-Killer Cell Cytotoxicity

    Science.gov (United States)

    Huang, George T.-J.; Zhang, Xinli; Park, No-Hee

    2012-01-01

    The intercellular adhesion molecule-1 (ICAM-1, CD54) serves as a counter-receptor for the β2-integrins, LFA-1 and Mac-1, which are expressed on leukocytes. Although expression of ICAM-1 on tumor cells has a role in tumor progression and development, information on ICAM-1 expression and its role in oral cancer has not been established. Normal human oral keratinocytes (NHOK), human papilloma virus (HPV)-immortalized human oral keratinocyte lines (HOK-16B, HOK-18A, and HOK-18C), and six human oral neoplastic cell lines (HOK-16B-BaP-T1, SCC-4, SCC-9, HEp-2, Tu-177 and 1483) were used to study ICAM-1 expression and its functional role in vitro. Our results demonstrated that NHOK express negligible levels of ICAM-1, whereas immortalized human oral keratinocytes and cancer cells express significantly higher levels of ICAM-1, except for HOK-16B-BaP-T1 and HEp-2. Altered mRNA half-lives did not fully account for the increased accumulation of ICAM-1 mRNA. Adhesion of peripheral blood mononuclear cells (PBMC) to epithelial cells correlated with cell surface ICAM-1 expression levels. This adhesion was inhibited by antibodies specific for either ICAM-1 or LFA-1/Mac-1, suggesting a role for these molecules in adhesion. In contrast, lymphokine-activated-killer (LAK) cell cytotoxic killing of epithelial cells did not correlate with ICAM-1 levels or with adhesion. Nonetheless, within each cell line, blocking of ICAM-1 or LFA-1/Mac-1 reduced LAK cells killing, suggesting that ICAM-1 is involved in mediating this killing. PMID:10938387

  9. Effect of Wnt3a on Keratinocytes Utilizing in Vitro and Bioinformatics Analysis

    Directory of Open Access Journals (Sweden)

    Ju-Suk Nam

    2014-03-01

    Full Text Available Wingless-type (Wnt signaling proteins participate in various cell developmental processes. A suppressive role of Wnt5a on keratinocyte growth has already been observed. However, the role of other Wnt proteins in proliferation and differentiation of keratinocytes remains unknown. Here, we investigated the effects of the Wnt ligand, Wnt3a, on proliferation and differentiation of keratinocytes. Keratinocytes from normal human skin were cultured and treated with recombinant Wnt3a alone or in combination with the inflammatory cytokine, tumor necrosis factor α (TNFα. Furthermore, using bioinformatics, we analyzed the biochemical parameters, molecular evolution, and protein–protein interaction network for the Wnt family. Application of recombinant Wnt3a showed an anti-proliferative effect on keratinocytes in a dose-dependent manner. After treatment with TNFα, Wnt3a still demonstrated an anti-proliferative effect on human keratinocytes. Exogenous treatment of Wnt3a was unable to alter mRNA expression of differentiation markers of keratinocytes, whereas an altered expression was observed in TNFα-stimulated keratinocytes. In silico phylogenetic, biochemical, and protein–protein interaction analysis showed several close relationships among the family members of the Wnt family. Moreover, a close phylogenetic and biochemical similarity was observed between Wnt3a and Wnt5a. Finally, we proposed a hypothetical mechanism to illustrate how the Wnt3a protein may inhibit the process of proliferation in keratinocytes, which would be useful for future researchers.

  10. Toll like receptors gene expression of human keratinocytes cultured of severe burn injury.

    Science.gov (United States)

    Cornick, Sarita Mac; Noronha, Silvana Aparecida Alves Corrêa de; Noronha, Samuel Marcos Ribeiro de; Cezillo, Marcus V B; Ferreira, Lydia Masako; Gragnani, Alfredo

    2014-01-01

    To evaluate the expression profile of genes related to Toll Like Receptors (TLR) pathways of human Primary Epidermal keratinocytes of patients with severe burns. After obtaining viable fragments of skin with and without burning, culture hKEP was initiated by the enzymatic method using Dispase (Sigma-Aldrich). These cells were treated with Trizol(r) (Life Technologies) for extraction of total RNA. This was quantified and analyzed for purity for obtaining cDNA for the analysis of gene expression using specific TLR pathways PCR Arrays plates (SA Biosciences). After the analysis of gene expression we found that 21% of these genes were differentially expressed, of which 100% were repressed or hyporegulated. Among these, the following genes (fold decrease): HSPA1A (-58), HRAS (-36), MAP2K3 (-23), TOLLIP (-23), RELA (-18), FOS (-16), and TLR1 (-6.0). This study contributes to the understanding of the molecular mechanisms related to TLR pathways and underlying wound infection caused by the burn. Furthermore, it may provide new strategies to restore normal expression of these genes and thereby change the healing process and improve clinical outcome.

  11. Concentration-dependent effect of platelet-rich plasma on keratinocyte and fibroblast wound healing.

    Science.gov (United States)

    Xian, Law Jia; Chowdhury, Shiplu Roy; Bin Saim, Aminuddin; Idrus, Ruszymah Bt Hj

    2015-03-01

    Platelet-rich plasma (PRP) has been found to contain a high concentration of growth factors that are present during the process of healing. Studies conducted found that application of PRP accelerates wound healing. In this study, we characterized the skin cell suspension harvested using the co-isolation technique and evaluated the effects of PRP (10% and 20%, v/v) on co-cultured keratinocytes and fibroblasts in terms of wound healing. Human keratinocytes and fibroblasts were harvested via co-isolation technique and separated via differential trypsinization. These cells were then indirectly co-cultured in medium supplemented with 10% or 20% PRP for 3 days without medium change for analysis of wound-healing potential. The wound-healing potential of keratinocytes and fibroblasts was evaluated in terms of growth property, migratory property, extracellular matrix gene expression and soluble factor secretion. The co-isolation technique yielded a skin cell population dominated by fibroblasts and keratinocytes, with a small amount of melanocytes. Comparison between the 10% and 20% PRP cultures showed that the 10% PRP culture exhibited higher keratinocyte apparent specific growth rate, and secretion of hepatocyte growth factor, monocyte chemoattractant protein-1, epithelial-derived neutrophil-activating protein 78 and vascular endothelial growth factor A, whereas the 20% PRP culture has significantly higher collagen type 1 and collagen type 3 expressions and produced more granulocyte-macrophage colony-stimulating factor. PRP concentration modulates keratinocyte and fibroblast wound healing potential, whereby the 10% PRP promotes wound remodeling, whereas the 20% PRP enhances inflammation and collagen deposition. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  12. Toxicity of silver nanoparticles in monocytes and keratinocytes

    DEFF Research Database (Denmark)

    Orłowski, Piotr; Krzyzowska, Malgorzata; Winnicka, Anna

    2012-01-01

    Silver nanoparticles are of interest to be used as antimicrobial agents in wound dressings and coatings in medical devices, but potential adverse effects have been reported in the literature. The possible local inflammatory response to silver nanoparticles and the role of cell death in determining...... these effects are largely unknown. Effects of the mixture of silver nanoparticles of different sizes were compared in in vitro assays for cytotoxicity, caspase-1 and caspase-9 activity and bax expression. In all tested concentrations, silver nanoparticles were more toxic for RAW 264.7 monocytes than for 291.03C...... keratinocytes and induced significant caspase-1 activity and necrotic cell death. In keratinocytes, more significantly than in macrophages, silver nanoparticles led to increase of caspase-9 activity and apoptosis. These results indicate that effects of silver nanoparticles depend on the type of exposed cells...

  13. Galectin-7 overexpression is associated with the apoptotic process in UVB-induced sunburn keratinocytes

    Science.gov (United States)

    Bernerd, Francoise; Sarasin, Alain; Magnaldo, Thierry

    1999-01-01

    Galectin-7 is a β-galactoside binding protein specifically expressed in stratified epithelia and notably in epidermis, but barely detectable in epidermal tumors and absent from squamous carcinoma cell lines. Galectin-7 gene is an early transcriptional target of the tumor suppressor protein P53 [Polyak, K., Xia, Y., Zweier, J., Kinzler, K. & Vogelstein, B. (1997) Nature (London) 389, 300–305]. Because p53 transcriptional activity is increased by genotoxic stresses we have examined the possible effects of ultraviolet radiations (UVB) on galectin-7 expression in epidermal keratinocytes. The amounts of galectin-7 mRNA and protein are increased rapidly after UVB irradiation of epidermal keratinocytes. The increase of galectin-7 is parallel to P53 stabilization. UVB irradiation of skin reconstructed in vitro and of human skin ex vivo demonstrates that galectin-7 overexpression is associated with sunburn/apoptotic keratinocytes. Transfection of a galectin-7 expression vector results in a significant increase in terminal deoxynucleotidyltransferase-mediated UTP end labeling-positive keratinocytes. The present findings demonstrate a keratinocyte-specific protein involved in the UV-induced apoptosis, an essential process in the maintenance of epidermal homeostasis. PMID:10500176

  14. MiR-217 is down-regulated in psoriasis and promotes keratinocyte differentiation via targeting GRHL2

    International Nuclear Information System (INIS)

    Zhu, Haigang; Hou, Liyue; Liu, Jingjing; Li, Zhiming

    2016-01-01

    MiR-217 is a well-known tumor suppressor, and its down-regulation has been shown in a wide range of solid and leukaemic cancers. However, the biological role of miR-217 in psoriasis pathogenesis, especially in keratinocyte hyperproliferation and differentiation, is not clearly understood. In this study, we found the expression of miR-217 was markedly down-regulated in psoriasis keratinocytes of psoriatic patients. In addition, overexpression of miR-217 inhibited the proliferation and promoted the differentiation of primary human keratinocytes. On the contrary, inhibition of endogenous miR-217 increased cell proliferation and delayed differentiation. Furthermore, Grainyhead-like 2 (GRHL2) was identified as a direct target of miR-217 by luciferase reporter assay. The expression of miR-217 and GRHL2 was inversely correlated in both transfected keratinocytes and in psoriasis lesional skin. Moreover, knocking down GRHL2 expression by siRNA enhanced keratinocyte differentiation. Taken together, our results demonstrate a role for miR-217 in the regulation of keratinocyte differentiation, partially through the regulation of GRHL2. - Highlights: • miR-217 is down-regulated in psoriasis skin lesions. • miR-217 inhibits the proliferation and promotes differentiation of keratinocytes. • GRHL2 is a novel target of miR-217 in keratinocytes. • GRHL2 is up-regulated and inversely correlated with miR-217 in psoriasis skin lesions.

  15. MiR-217 is down-regulated in psoriasis and promotes keratinocyte differentiation via targeting GRHL2

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Haigang; Hou, Liyue; Liu, Jingjing; Li, Zhiming, E-mail: lizm_1001@sina.com

    2016-02-26

    MiR-217 is a well-known tumor suppressor, and its down-regulation has been shown in a wide range of solid and leukaemic cancers. However, the biological role of miR-217 in psoriasis pathogenesis, especially in keratinocyte hyperproliferation and differentiation, is not clearly understood. In this study, we found the expression of miR-217 was markedly down-regulated in psoriasis keratinocytes of psoriatic patients. In addition, overexpression of miR-217 inhibited the proliferation and promoted the differentiation of primary human keratinocytes. On the contrary, inhibition of endogenous miR-217 increased cell proliferation and delayed differentiation. Furthermore, Grainyhead-like 2 (GRHL2) was identified as a direct target of miR-217 by luciferase reporter assay. The expression of miR-217 and GRHL2 was inversely correlated in both transfected keratinocytes and in psoriasis lesional skin. Moreover, knocking down GRHL2 expression by siRNA enhanced keratinocyte differentiation. Taken together, our results demonstrate a role for miR-217 in the regulation of keratinocyte differentiation, partially through the regulation of GRHL2. - Highlights: • miR-217 is down-regulated in psoriasis skin lesions. • miR-217 inhibits the proliferation and promotes differentiation of keratinocytes. • GRHL2 is a novel target of miR-217 in keratinocytes. • GRHL2 is up-regulated and inversely correlated with miR-217 in psoriasis skin lesions.

  16. Protective effect of 3,4-dihydroxybenzoic acid isolated from Cladophora wrightiana Harvey against ultraviolet B radiation-induced cell damage in human HaCaT keratinocytes.

    Science.gov (United States)

    Cha, Ji Won; Piao, Mei Jing; Kim, Ki Cheon; Zheng, Jian; Yao, Cheng Wen; Hyun, Chang Lim; Kang, Hee Kyoung; Yoo, Eun Sook; Koh, Young Sang; Lee, Nam Ho; Ko, Mi Hee; Hyun, Jin Won

    2014-03-01

    The aim of the present study was to elucidate the protective properties of 3,4-dihydroxybenzoic acid (DBA) isolated from Cladophora wrightiana Harvey (a green alga) against ultraviolet B (UVB)-induced damage to human HaCaT keratinocytes. DBA exhibited scavenging actions against the 1,1-diphenyl-2-picrylhydrazyl radical, the superoxide anion, and the hydroxyl radical. Furthermore, DBA decreased the levels of intracellular reactive oxygen species generated by hydrogen peroxide or UVB treatment of the cells. DBA also decreased the UVB-augmented levels of phospho-histone H2A.X and the extent of comet tail formation, which are both indications of DNA damage. In addition, the compound safeguarded keratinocytes from UVB-induced injury by reversing the production of apoptotic bodies, overturning the disruption of mitochondrial membrane potential, increasing the expression of the anti-apoptotic protein, B-cell lymphoma 2, and decreasing the expression of the pro-apoptotic proteins, Bcl-2-associated X and cleaved caspase-3. Taken together, these results demonstrate that DBA isolated from a green alga protects human keratinocytes against UVB-induced oxidative stress and apoptosis.

  17. Leptin regulates the pro-inflammatory response in human epidermal keratinocytes.

    Science.gov (United States)

    Lee, Moonyoung; Lee, Eunyoung; Jin, Sun Hee; Ahn, Sungjin; Kim, Sae On; Kim, Jungmin; Choi, Dalwoong; Lim, Kyung-Min; Lee, Seung-Taek; Noh, Minsoo

    2018-05-01

    The role of leptin in cutaneous wound healing process has been suggested in genetically obese mouse studies. However, the molecular and cellular effects of leptin on human epidermal keratinocytes are still unclear. In this study, the whole-genome-scale microarray analysis was performed to elucidate the effect of leptin on epidermal keratinocyte functions. In the leptin-treated normal human keratinocytes (NHKs), we identified the 151 upregulated and 53 downregulated differentially expressed genes (DEGs). The gene ontology (GO) enrichment analysis with the leptin-induced DEGs suggests that leptin regulates NHKs to promote pro-inflammatory responses, extracellular matrix organization, and angiogenesis. Among the DEGs, the protein expression of IL-8, MMP-1, fibronectin, and S100A7, which play roles in which is important in the regulation of cutaneous inflammation, was confirmed in the leptin-treated NHKs. The upregulation of the leptin-induced proteins is mainly regulated by the STAT3 signaling pathway in NHKs. Among the downregulated DEGs, the protein expression of nucleosome assembly-associated centromere protein A (CENPA) and CENPM was confirmed in the leptin-treated NHKs. However, the expression of CENPA and CENPM was not coupled with those of other chromosome passenger complex like Aurora A kinase, INCENP, and survivin. In cell growth kinetics analysis, leptin had no significant effect on the cell growth curves of NHKs in the normal growth factor-enriched condition. Therefore, leptin-dependent downregulation of CENPA and CENPM in NHKs may not be directly associated with mitotic regulation during inflammation.

  18. The Effects of Antifungal Azoles on Inflammatory Cytokine Production in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    K Zomorodian

    2008-04-01

    Full Text Available ABSTRACT: Introduction & Objective: Azoles drugs are being used successfully in treatment of fungal infections. Recently, immunosuppressive effects of some of these agents have been reported. Keratinocytes, as the major cells of the skin, have an important role in innate immunity against pathogenic agents. Considering the scanty of information about the effects of azoles on immune responces, this study was conducted to assess the expression and secretion of inflammatory cytokines in keratinocytes following treatment with azole drugs. Materials & Methods: This is an exprimental study conducted in in molecular biology division in Tehran University of Medical Sciences and Immunodermatology Department in Vienna Medical University. Primery keratinocytes were cultured and treated with different concentrations of fluconazole, itraconazole, ketoconazole and griseofulvin. Secreted IL1, IL6 and TNF-α by keratinocytes in culture supernatant were measured by quantitative enzyme immunoassay technique. Moreover, expression of the genes encoding IL1 and IL8 was evaluated by Real Time-PCR. Results: Treatment of keratinocytes with different concentrations of fluconazole and low concentration of ketoconazole resulted in decrease in IL1 secretion, but Itraconazole and griseofulvin did not show such an effect at the same concentrations. In addition, none of the examined drugs had an effect on secretion level of IL6 and TNF-α. Quantitative analysis of IL1 and IL8 encoding genes revealed that transcription on these genes might be suppressed following treatment with fluconazole or ketoconazole. Conclusion: Fluconazole and ketoconazole might modulate the expression and secretion of IL1 and IL8 and affect the direction of immune responses induced by keratinocytes

  19. Differential Activation of Human Keratinocytes by Leishmania Species Causing Localized or Disseminated Disease.

    Science.gov (United States)

    Scorza, Breanna M; Wacker, Mark A; Messingham, Kelly; Kim, Peter; Klingelhutz, Aloysius; Fairley, Janet; Wilson, Mary E

    2017-10-01

    All Leishmania species parasites are introduced into mammalian skin through a sand fly bite, but different species cause distinct clinical outcomes. Mouse studies suggest that early responses are critical determinants of subsequent adaptive immunity in leishmaniasis, yet few studies address the role of keratinocytes, the most abundant cell in the epidermis. We hypothesized that Leishmania infection causes keratinocytes to produce immunomodulatory factors that influence the outcome of infection. Incubation of primary or immortalized human keratinocytes with Leishmania infantum or Leishmania major, which cause visceral or cutaneous leishmaniasis, respectively, elicited dramatically different responses. Keratinocytes incubated with L. infantum significantly increased expression of proinflammatory genes for IL-6, IL-8, tumor necrosis factor, and IL-1B, whereas keratinocytes exposed to several L. major isolates did not. Furthermore, keratinocyte-monocyte co-incubation studies across a 4 µM semipermeable membrane suggested that L. infantum-exposed keratinocytes release soluble factors that enhance monocyte control of intracellular L. infantum replication (P Leishmania species that may affect the course of disease. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Rho kinase inhibitor Y-27632 promotes the differentiation of human bone marrow mesenchymal stem cells into keratinocyte-like cells in xeno-free conditioned medium.

    Science.gov (United States)

    Li, Zhenzhen; Han, Shichao; Wang, Xingqin; Han, Fu; Zhu, Xiongxiang; Zheng, Zhao; Wang, Hongtao; Zhou, Qin; Wang, Yunchuan; Su, Linlin; Shi, Jihong; Tang, Chaowu; Hu, Dahai

    2015-03-11

    Bone marrow mesenchymal stem cells (BMSCs), which have the ability to self-renew and to differentiate into multiple cell types, have recently become a novel strategy for cell-based therapies. The differentiation of BMSCs into keratinocytes may be beneficial for patients with burns, disease, or trauma. However, the currently available cells are exposed to animal materials during their cultivation and induction. These xeno-contaminations severely limit their clinical outcomes. Previous studies have shown that the Rho kinase (ROCK) inhibitor Y-27632 can promote induction efficiency and regulate the self-renewal and differentiation of stem cells. In the present study, we attempted to establish a xeno-free system for the differentiation of BMSCs into keratinocytes and to investigate whether Y-27632 can facilitate this differentiation. BMSCs isolated from patients were cultured by using a xeno-free system and characterised by using flow cytometric analysis and adipogenic and osteogenic differentiation assays. Human primary keratinocytes were also isolated from patients. Then, the morphology, population doubling time, and β-galactosidase staining level of these cells were evaluated in the presence or absence of Y-27632 to determine the effects of Y-27632 on the state of the keratinocytes. Keratinocyte-like cells (KLCs) were detected at different time points by immunocytofluorescence analysis. Moreover, the efficiency of BMSC differentiation under different conditions was measured by quantitative real-time-polymerase chain reaction (RT-PCR) and Western blot analyses. The ROCK inhibitor Y-27632 promoted the proliferation and lifespan of human primary keratinocytes. In addition, we showed that keratinocyte-specific markers could be detected in BMSCs cultured in a xeno-free system using keratinocyte-conditioned medium (KCM) independent of the presence of Y-27632. However, the efficiency of the differentiation of BMSCs into KLCs was significantly higher in the presence of Y

  1. Innate and adaptive immunity gene expression of human keratinocytes cultured of severe burn injury.

    Science.gov (United States)

    Noronha, Silvana Aparecida Alves Corrêa de; Noronha, Samuel Marcos Ribeiro de; Lanziani, Larissa Elias; Ferreira, Lydia Masako; Gragnani, Alfredo

    2014-01-01

    Evaluate the expression profile of genes related to Innate and Adaptive Immune System (IAIS) of human Primary Epidermal keratinocytes (hPEKP) of patients with severe burns. After obtaining viable fragments of skin with and without burning, culture hKEP was initiated by the enzymatic method using Dispase (Sigma-Aldrich). These cells were treated with Trizol(r) (Life Technologies) for extraction of total RNA. This was quantified and analyzed for purity for obtaining cDNA for the analysis of gene expression using specific IAIS PCR Arrays plates (SA Biosciences). After the analysis of gene expression we found that 63% of these genes were differentially expressed, of which 77% were repressed and 23% were hyper-regulated. Among these, the following genes (fold increase or decrease): IL8 (41), IL6 (32), TNF (-92), HLA-E (-86), LYS (-74), CCR6 (- 73), CD86 (-41) and HLA-A (-35). This study contributes to the understanding of the molecular mechanisms underlying wound infection caused by the burn. Furthermore, it may provide new strategies to restore normal expression of these genes and thereby change the healing process and improve clinical outcome.

  2. Staphylococcus aureus keratinocyte invasion is mediated by integrin-linked kinase and Rac1.

    Science.gov (United States)

    Sayedyahossein, Samar; Xu, Stacey X; Rudkouskaya, Alena; McGavin, Martin J; McCormick, John K; Dagnino, Lina

    2015-02-01

    Staphylococcus aureus is a major component of the skin microbiota and causes a large number of serious infections. S. aureus first interacts with epidermal keratinocytes to breach the epidermal barrier through mechanisms not fully understood. By use of primary keratinocytes from mice with epidermis-restricted Ilk gene inactivation and control integrin-linked kinase (ILK)-expressing littermates, we investigated the role of ILK in epidermal S. aureus invasion. Heat-killed, but not live, bacteria were internalized to Rab5- and Rab7-positive phagosomes, and incubation with keratinocyte growth factor increased their uptake 2.5-fold. ILK-deficient mouse keratinocytes internalized bacteria 2- to 4-fold less efficiently than normal cells. The reduced invasion by live S. aureus of ILK-deficient cells was restored in the presence of exogenous, constitutively active Rac1. Thus, Rac1 functions downstream from ILK during invasion. Further, invasion by S. aureus of Rac1-deficient cells was 2.5-fold lower than in normal cells. Paradoxically, staphylococcal cutaneous penetration of mouse skin explants with ILK-deficient epidermis was 35-fold higher than that of normal skin, indicating defects in epidermal barrier function in the absence of ILK. Thus, we identified an ILK-Rac1 pathway essential for bacterial invasion of keratinocytes, and established ILK as a key contributor to prevent invasive staphylococcal cutaneous infection. © FASEB.

  3. Tissue-specific regulation of CXCL9/10/11 chemokines in keratinocytes: Implications for oral inflammatory disease.

    Directory of Open Access Journals (Sweden)

    Alison Marshall

    Full Text Available The IFN-γ-inducible chemokines CXCL9, CXCL10, and CXCL11 play a key role in many inflammatory conditions, particularly those mediated by T cells. Therefore, the production of these chemokines in peripheral tissues could be instrumental in the pathophysiology of tissue-specific immunological diseases such as oral lichen planus (OLP. In the present study, we assessed the production of keratinocyte-derived CXCL9/10/11 under basal and inflammatory conditions and investigated whether these chemokines were involved in the pathogenesis of OLP. We used semi-quantitative PCR, ELISA, chemotaxis assays, and fluorescence-activated cell sorting (FACS to assess the expression and functional role of CXCL9/10/11 in oral keratinocytes (three strains of normal human oral keratinocytes (NHOK, and the H357 oral cancer cell line in the presence or absence of IFN-γ. CXCL9/10/11 were also assessed in tissues from normal patients and those with oral lichen planus (OLP. The time course study in oral keratinocytes treated with IFN-γ showed that expression of CXCL9/10/11 chemokines was significantly enhanced by IFN-γ in a time-dependent manner. In particular, CXCL10, a prominent chemokine that was overexpressed by IFN-γ-stimulated NHOK, was able to effectively recruit CD4 lymphocytes, mainly CD4+CD45RA- cells. Significantly higher levels of CXCL9/10/11 were found in tissues from patients with OLP compared to normal oral mucosa. Taken together, the results demonstrate that normal oral keratinocytes produce chemotactic molecules that mediate T cell recruitment. This study furthers understanding of chemokine production in oral keratinocytes and their role in the pathophysiology of oral mucosa, with particular relevance to OLP.

  4. Dermal-epidermal membrane systems by using human keratinocytes and mesenchymal stem cells isolated from dermis

    Energy Technology Data Exchange (ETDEWEB)

    Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)

    2017-02-01

    Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.

  5. SOCS3 inhibits the pathological effects of IL-22 in non-melanoma skin tumor-derived keratinocytes.

    Science.gov (United States)

    Madonna, Stefania; Scarponi, Claudia; Morelli, Martina; Sestito, Rosanna; Scognamiglio, Pasqualina Liana; Marasco, Daniela; Albanesi, Cristina

    2017-04-11

    Basal cell carcinomas (BCC) and squamous-cell carcinomas (SCC) are common malignancies in humans, caused by neoplastic transformation of keratinocytes of the basal or suprabasal layers of epidermis, respectively. Tumor-infiltrating lymphocytes (TILs) are frequently found in BCC and SCC, and functionally promote epithelial carcinogenesis. TILs secreting IL-22, in particular, participate to BCC and SCC growth by inducing keratinocyte proliferation and migration, as well as the expression of inflammatory, anti-apoptotic and pro-angiogenic genes.In this study, we identified SOCS3 as a valid candidate to be manipulated for suppressing tumorigenic functions in BCC and SCC. We found that SOCS3 and SOCS1 expression was reduced in vivo, in tumor lesions of BCC and SCC, as compared to other skin inflammatory conditions such as psoriasis, despite the high number of IL-22-secreting TILs. Moreover, IL-22 was not able to induce in vitro the transcriptional expression of SOCS3 in BCC-or SCC-derived keratinocytes, contrarily to healthy cells. Aimed at rescuing SOCS3 activity in these tumor contexts, a SOCS3-derived peptide, named KIR-ESS, was synthesized, and its ability in suppressing IL-22-induced responses was evaluated in healthy and transformed keratinocytes. We found that KIR-ESS peptide efficiently suppressed the IL-22 molecular signaling in keratinocytes, by acting on STAT3 and Erk1/2 cascade, as well as on the expression of STAT3-dependent downstream genes. Interestingly, after treatment with peptide, both healthy and transformed keratinocytes could no longer aberrantly proliferate and migrate in response to IL-22. Finally, treatment of athymic nude mice bearing SCC xenografts with KIR-ESS peptide concomitantly reduced tumor growth and activated STAT3 levels. As a whole, these data provides the rationale for the use in BCC and SCC skin tumors of SOCS3 mimetics, being able to inhibit the deleterious effects of IL-22 in these contexts.

  6. Human atopic dermatitis skin-derived T cells can induce a reaction in mouse keratinocytes in vivo

    DEFF Research Database (Denmark)

    Martel, Britta C; Blom, Lars; Dyring-Andersen, Beatrice

    2015-01-01

    . In comparison, blood -derived in vitro differentiated Th2 cells only induced a weak response in a few of the mice. Thus, we conclude that human AD skin-derived T cells can induce a reaction in mouse skin through induction of a proliferative response in the mouse keratinocytes. This article is protected......In atopic dermatitis (AD), the inflammatory response between skin infiltrating T cells and keratinocytes is fundamental to the development of chronic lesional eczema. The aim of this study was to investigate whether skin-derived T cells from AD patients could induce an inflammatory response in mice...... through keratinocyte activation and consequently cause development of eczematous lesions. Punch biopsies of lesional skin from AD patients were used to establish skin-derived T cell cultures and which were transferred into NOD.Cg-Prkd(scid) Il2rg(tm1Sug) /JicTac (NOG) mice. We found that subcutaneous...

  7. Platelet-released growth factors inhibit proliferation of primary keratinocytes in vitro.

    Science.gov (United States)

    Bayer, Andreas; Tohidnezhad, Mersedeh; Berndt, Rouven; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Jahr, Holger; Cremer, Jochen; Rademacher, Franziska; Simanski, Maren; Gläser, Regine; Harder, Jürgen

    2018-01-01

    Autologous thrombocyte concentrate lysates as platelet-released growth factors (PRGF) or Vivostat Platelet Rich Fibrin (PRF ® ) represent important tools in modern wound therapy, especially in the treatment of chronic, hard-to-heal or infected wounds. Nevertheless, underlying cellular and molecular mechanisms of the beneficial clinical effects of a local wound therapy with autologous thrombocyte concentrate lysates are poorly understood. Recently, we have demonstrated that PRGF induces antimicrobial peptides in primary keratinocytes and accelerates keratinocytes' differentiation. In the present study we analyzed the influence of PRGF on primary human keratinocytes' proliferation. Using the molecular proliferation marker Ki-67 we observed a concentration- and time dependent inhibition of Ki-67 gene expression in PRGF treated primary keratinocytes. These effects were independent from the EGFR- and the IL-6-R pathway. Inhibition of primary keratinocytes' proliferation by PRGF treatment was confirmed in colorimetric cell proliferation assays. Together, these data indicate that the clinically observed positive effects of autologous thrombocytes concentrates in the treatment of chronic, hard-to-heal wounds are not based on an increased keratinocytes proliferation. Copyright © 2017 Elsevier GmbH. All rights reserved.

  8. UVA Irradiation of Dysplastic Keratinocytes: Oxidative Damage versus Antioxidant Defense

    Science.gov (United States)

    Nechifor, Marina T.; Niculiţe, Cristina M.; Urs, Andreea O.; Regalia, Teodor; Mocanu, Mihaela; Popescu, Alexandra; Manda, Gina; Dinu, Diana; Leabu, Mircea

    2012-01-01

    UVA affects epidermal cell physiology in a complex manner, but the harmful effects have been studied mainly in terms of DNA damage, mutagenesis and carcinogenesis. We investigated UVA effects on membrane integrity and antioxidant defense of dysplastic keratinocytes after one and two hours of irradiation, both immediately after exposure, and 24 h post-irradiation. To determine the UVA oxidative stress on cell membrane, lipid peroxidation was correlated with changes in fatty acid levels. Membrane permeability and integrity were assessed by propidium iodide staining and lactate dehydrogenase release. The effects on keratinocyte antioxidant protection were investigated in terms of catalase activity and expression. Lipid peroxidation increased in an exposure time-dependent manner. UVA exposure decreased the level of polyunsaturated fatty acids, which gradually returned to its initial value. Lactate dehydrogenase release showed a dramatic loss in membrane integrity after 2 h minimum of exposure. The cell ability to restore membrane permeability was noted at 24 h post-irradiation (for one hour exposure). Catalase activity decreased in an exposure time-dependent manner. UVA-irradiated dysplastic keratinocytes developed mechanisms leading to cell protection and survival, following a non-lethal exposure. The surviving cells gained an increased resistance to apoptosis, suggesting that their pre-malignant status harbors an abnormal ability to control their fate. PMID:23222638

  9. Keratinocyte Motility Is Affected by UVA Radiation—A Comparison between Normal and Dysplastic Cells

    Directory of Open Access Journals (Sweden)

    Cristina M. Niculiţe

    2018-06-01

    Full Text Available UVA radiation induces multiple and complex changes in the skin, affecting epidermal cell behavior. This study reports the effects of UVA exposure on normal (HaCaT and dysplastic (DOK keratinocytes. The adherence, spreading and proliferation were investigated by time-lapse measurement of cell layer impedance on different matrix proteins. Prior to UVA exposure, the time required for adherence and spreading did not differ significantly for HaCaT and DOK cells, while spreading areas were larger for HaCaT cells. Under UVA exposure, HaCaT and DOK cells behavior differed in terms of movement and proliferation. The cells’ ability to cover the denuded surface and individual cell trajectories were recorded by time-lapse videomicroscopy, during wound healing experiments. Dysplastic keratinocytes showed more sensitivity to UVA, exhibiting transient deficiencies in directionality of movement and a delay in re-coating the denuded area. The actin cytoskeleton displayed a cortical organization immediately after irradiation, in both cell lines, similar to mock-irradiated cells. Post-irradiation, DOK cells displayed a better organization of stress fibers, persistent filopodia, and new, stronger focal contacts. In conclusion, after UVA exposure HaCaT and DOK cells showed a different behavior in terms of adherence, spreading, motility, proliferation, and actin cytoskeleton dynamics, with the dyplastic keratinocytes being more sensitive.

  10. Subcellular localisation of BAG-1 and its regulation of vitamin D receptor-mediated transactivation and involucrin expression in oral keratinocytes: Implications for oral carcinogenesis

    International Nuclear Information System (INIS)

    Lee, San San; Crabb, Simon J.; Janghra, Nari; Carlberg, Carsten; Williams, Ann C.; Cutress, Ramsey I.; Packham, Graham; Hague, Angela

    2007-01-01

    In oral cancers, cytoplasmic BAG-1 overexpression is a marker of poor prognosis. BAG-1 regulates cellular growth, differentiation and survival through interactions with diverse proteins, including the vitamin D receptor (VDR), a key regulator of keratinocyte growth and differentiation. BAG-1 is expressed ubiquitously in human cells as three major isoforms of 50 kDa (BAG-1L), 46 kDa (BAG-1M) and 36 kDa (BAG-1S) from a single mRNA. In oral keratinocytes BAG-1L, but not BAG-1M and BAG-1S, enhanced VDR transactivation in response to 1α,25-dihydroxyvitamin D 3. BAG-1L was nucleoplasmic and nucleolar, whereas BAG-1S and BAG-1M were cytoplasmic and nucleoplasmic in localisation. Having identified the nucleolar localisation sequence in BAG-1L, we showed that mutation of this sequence did not prevent BAG-1L from potentiating VDR activity. BAG-1L also potentiated transactivation of known vitamin-D-responsive gene promoters, osteocalcin and 24-hydroxylase, and enhanced VDR-dependent transcription and protein expression of the keratinocyte differentiation marker, involucrin. These results demonstrate endogenous gene regulation by BAG-1L by potentiating nuclear hormone receptor function and suggest a role for BAG-1L in 24-hydroxylase regulation of vitamin D metabolism and the cellular response of oral keratinocytes to 1α,25-dihydroxyvitamin D 3 . By contrast to the cytoplasmic BAG-1 isoforms, BAG-1L may act to suppress tumorigenesis

  11. Hepatocyte and keratinocyte growth factors and their receptors in human lung emphysema

    Directory of Open Access Journals (Sweden)

    Marchal Joëlle

    2005-10-01

    Full Text Available Abstract Background Hepatocyte and keratinocyte growth factors are key growth factors in the process of alveolar repair. We hypothesized that excessive alveolar destruction observed in lung emphysema involves impaired expression of hepatocyte and keratinocyte growth factors or their respective receptors, c-met and keratinocyte growth factor receptor. The aim of our study was to compare the expression of hepatocyte and keratinocyte growth factors and their receptors in lung samples from 3 groups of patients: emphysema; smokers without emphysema and non-smokers without emphysema. Methods Hepatocyte and keratinocyte growth factor proteins were analysed by immunoassay and western blot; mRNA expression was measured by real time quantitative polymerase chain reaction. Results Hepatocyte and keratinocyte growth factors, c-met and keratinocyte growth factor receptor mRNA levels were similar in emphysema and non-emphysema patients. Hepatocyte growth factor mRNA correlated negatively with FEV1 and the FEV1/FVC ratio both in emphysema patients and in smokers with or without emphysema. Hepatocyte and keratinocyte growth factor protein concentrations were similar in all patients' groups. Conclusion The expression of hepatocyte and keratinocyte growth factors and their receptors is preserved in patients with lung emphysema as compared to patients without emphysema. Hepatocyte growth factor mRNA correlates with the severity of airflow obstruction in smokers.

  12. Anti-Inflammatory Effect of Melittin on Porphyromonas Gingivalis LPS-Stimulated Human Keratinocytes.

    Science.gov (United States)

    Kim, Woon-Hae; An, Hyun-Jin; Kim, Jung-Yeon; Gwon, Mi-Gyeong; Gu, Hyemin; Jeon, Minji; Kim, Min-Kyung; Han, Sang-Mi; Park, Kwan-Kyu

    2018-02-05

    Periodontitis is a chronic inflammatory disease that contributes to the destruction of the gingiva. Porphyromonas gingivalis ( P. gingivalis ) can cause periodontitis via its pathogenic lipopolysaccharides (LPS). Melittin, a major component of bee venom, is known to have anti-inflammatory and antibacterial effects. However, the role of melittin in the inflammatory response has not been elucidated in periodontitis-like human keratinocytes. Therefore, we investigated the anti-inflammatory effects of melittin on a P. gingivalis LPS (PgLPS)-treated HaCaT human keratinocyte cell line. The cytotoxicity of melittin was measured using a human keratinocyte cell line, HaCaT, and a Cell Counting Kit-8. The effect of melittin on PgLPS-induced inflammation was determined with Western blot, real-time quantitative PCT, and immunofluorescence. PgLPS increased the expression of toll-like receptor (TLR) 4 and proinflammatory cytokines, such as tumor necrosis factor-α (TNF-α), interleukin (IL)-6, IL-8, and interferon-γ (IFN-γ). Moreover, PgLPS induced activation of the nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), extracellular signal-regulated kinase (ERK), and protein kinase B/Akt. Melittin also inhibited the expression of proinflammatory cytokines by suppressing the activation of the NF-κB signaling pathway, ERK, and Akt. Melittin attenuates the PgLPS-induced inflammatory response and could therefore be applied in the treatment of periodontitis for anti-inflammatory effects.

  13. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Yu-Ping Hsiao

    2015-01-01

    Full Text Available Malic acid (MA has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT. The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs. Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR was significantly decreased whereas extracellular acidification rate (ECAR was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  14. Effects of 25-hydroxyvitamin D3 on cathelicidin production and antibacterial function of human oral keratinocytes.

    Science.gov (United States)

    Wang, Qi; Zhang, Wu; Li, Hao; Aprecio, Raydolf; Wu, Wan; Lin, Yiqiao; Li, Yiming

    2013-01-01

    Vitamin D and its metabolites have been recognized as key determinants in innate immune modulation. In this study, we investigated the regulation of antibacterial functions of oral keratinocyte cells by 25-hydroxyvitamin D3 (25VD3). OKF6/TERT2 cells, an immortalized human oral keratinocyte cell line, were transfected with or without 24-hydroxylase small interfering RNA (siRNA) and incubated with different amounts of 25VD3. These epithelial cells expressed high levels of inactivating 24-hydroxylase (CYP24A1) and relatively low levels of activating 1α-hydroxylase (CYP27B1) in the presence of 25VD3. 25VD3 influenced the expression of vitamin D-driven genes and cathelicidin in a dose-related manner. SiRNA specific to 24-hydroxylase augmented the cathelicidin production and subseqently influenced the antibacterial activity on multispecies of oral pathogens. These observations suggest that 25VD3 is capable of stimulating cathelicidin production and modulating antibacterial function upon CYP24A1 knochdown in oral epithelial cells, and indicate novel mechanisms that 25VD3 may enhance antibacterial ability in oral keratinocytes. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. In vitro induction of matrix metalloproteinase-2 and matrix metalloproteinase-9 expression in keratinocytes by boron and manganese.

    Science.gov (United States)

    Chebassier, Nathalie; El Houssein, Ouijja; Viegas, Isabelle; Dréno, Brigitte

    2004-08-01

    Matrix metalloproteinase (MMP)-2 and MMP-9 are involved in keratinocyte migration and granulation tissue remodeling during wound healing. Thermal water cures are sometimes proposed as complementary treatment for accelerating healing of wounds resulting from burns and/or surgery, but their mechanisms of action remain unknown. Some thermal waters are rich in trace elements such as boron and manganese. Interestingly, clinical studies have shown the beneficial effects of trace elements such as boron and manganese for human wound healing. To try to specify the role of trace elements in cutaneous healing, the present study investigated the effects of these trace elements on the production of MMP-2 and MMP-9 by normal human keratinocytes cultured in vitro. Immunohistochemistry and Western blot showed that intracellular MMP-9 expression in keratinocytes was induced when incubated for 6 h with boron at 10 micro g/ml or manganese at 0.2 micro g/ml. Moreover, gelatin zymography on keratinocyte supernatants showed an increase of gelatinase secretion after 24 h of incubation of keratinocytes with boron or manganese, regardless of concentration. Gelatinase secretion was not associated with keratinocyte proliferation induced by trace elements. Thus, our results suggest that boron and manganese could play a role in the clinical efficiency of thermal water on wound healing.

  16. Modulation of LXR-α and the effector genes by Ascorbic acid and Statins in psoriatic keratinocytes.

    Science.gov (United States)

    Soodgupta, Deepti; Kaul, Deepak; Kanwar, A J; Parsad, Davinder

    2014-12-01

    Recent studies have revealed critical roles that nuclear receptors like LXR-α (Liver X Receptor- alpha) plays as a class of post-transcriptional gene regulator in skin development and diseases. Keeping in view the fact that LXR-α plays crucial role in keratinocyte proliferation and differentiation, it becomes imperative to dissect the pathways and role of LXR-α genomics in the pathogenesis of psoriasis with ultimate aim to explore novel preventive/therapeutic strategies as treatment options. To explore the effects of agonists and activators of LXR-α on its own gene expression and the putative targets in psoriatic keratinocytes. Identification of promoter sequences for (vitamin D receptor) VDR and Catalase were done using in silico analysis followed by β-galactosidase (β-gal) reporter plasmid assay in keratinocytes from clinically heathy subjects. Determination of relative levels of LXR-α,VDR and catalase in control versus treated cells upon activation of LXR-α with Atorvastatin + 22R hydroxycholestrol and Ascorbic acid + 22R hydroxycholestrol was done by PCR and Cell Proliferation Assay. The cells transfected with the reporter plasmid element for VDR and catalase showed more than 5 and 4 fold increase respectively in the β-gal activity compared to the control. An increase of 55% in LXR-α gene expression at RNA level was observed in Atorvastatin + 22-R hydroxycholestrol compared to 24% in Ascorbic acid + 22-ROH cholesterol. The expression of the VDR and Catalase was significantly increased in both treated keratinocytes compared to its normal counterpart.

  17. Serial cultivation of human scalp hair follicle keratinocytes.

    Science.gov (United States)

    Weterings, P J; Roelofs, H M; Vermorken, A J; Bloemendal, H

    1983-01-01

    A method is described for the serial cultivation of adult human hair follicle keratinocytes. Plucked scalp hair follicles, placed on bovine eye lens capsules as a growth substrate, give rise to quickly expanding colonies within a few days. After trypsinization, the cells are replated with irradiated 3T3 cells as 'feeders'. Using this combination of techniques the keratinocytes can be subcultured up to four times. In this way about 10(7) keratinocytes can be generated from one single hair follicle. Moreover, the technique enables cryogenic storage of the cells, allowing for instance, convenient transportation. Subcultured hair follicle keratinocytes can be plated on glass coverslips. This allows immunofluorescence studies. The keratin cytoskeletons visualized using an antiserum against human keratin.

  18. Establishment of primary keratinocyte culture from horse tissue biopsates

    Directory of Open Access Journals (Sweden)

    Jernej OGOREVC

    2015-12-01

    Full Text Available Primary cell lines established from skin tissue can be used in immunological, proteomic and genomic studies as in vitro skin models. The goal of our study was to establish a primary keratinocyte cell culture from tissue biopsates of two horses. The primary keratinocyte cell culture was obtained by mechanical and enzymatic dissociation and with explant culture method. The result was a heterogeneous primary culture comprised of keratinocytes and fibroblasts. To distinguish epithelial and mesenchymal cells immunofluorescent characterisation was performed, using antibodies against cytokeratin 14 and vimentin. We successfully at attained a primary cell line of keratinocytes, which could potentially be used to study equine skin diseases, as an animal model for human diseases, and for cosmetic and therapeutic product testing.

  19. Alteration of skin wound healing in keratinocyte-specific mediator complex subunit 1 null mice.

    Science.gov (United States)

    Noguchi, Fumihito; Nakajima, Takeshi; Inui, Shigeki; Reddy, Janardan K; Itami, Satoshi

    2014-01-01

    MED1 (Mediator complex subunit 1) is a co-activator of various transcription factors that function in multiple transcriptional pathways. We have already established keratinocyte-specific MED1 null mice (Med1(epi-/-)) that develop epidermal hyperplasia. Herein, to investigate the function(s) of MED1 in skin wound healing, full-thickness skin wounds were generated in Med1(epi-/-) and age-matched wild-type mice and the healing process was analyzed. Macroscopic wound closure and the re-epithelialization rate were accelerated in 8-week-old Med1(epi-/-) mice compared with age-matched wild-type mice. Increased lengths of migrating epithelial tongues and numbers of Ki67-positive cells at the wounded epidermis were observed in 8-week-old Med1(epi-/-) mice, whereas wound contraction and the area of α-SMA-positive myofibroblasts in the granulation tissue were unaffected. Migration was enhanced in Med1(epi-/-) keratinocytes compared with wild-type keratinocytes in vitro. Immunoblotting revealed that the expression of follistatin was significantly decreased in Med1(epi-/-) keratinocytes. Moreover, the mitogen-activated protein kinase pathway was enhanced before and after treatment of Med1(epi-/-) keratinocytes with activin A in vitro. Cell-cycle analysis showed an increased ratio of S phase cells after activin A treatment of Med1(epi-/-) keratinocytes compared with wild-type keratinocytes. These findings indicate that the activin-follistatin system is involved in this acceleration of skin wound healing in 8-week-old Med1(epi-/-) mice. On the other hand, skin wound healing in 6-month-old Med1(epi-/-) mice was significantly delayed with decreased numbers of Ki67-positive cells at the wounded epidermis as well as BrdU-positive label retaining cells in hair follicles compared with age-matched wild-type mice. These results agree with our previous observation that hair follicle bulge stem cells are reduced in older Med1(epi-/-) mice, indicating a decreased contribution of hair

  20. Alteration of skin wound healing in keratinocyte-specific mediator complex subunit 1 null mice.

    Directory of Open Access Journals (Sweden)

    Fumihito Noguchi

    Full Text Available MED1 (Mediator complex subunit 1 is a co-activator of various transcription factors that function in multiple transcriptional pathways. We have already established keratinocyte-specific MED1 null mice (Med1(epi-/- that develop epidermal hyperplasia. Herein, to investigate the function(s of MED1 in skin wound healing, full-thickness skin wounds were generated in Med1(epi-/- and age-matched wild-type mice and the healing process was analyzed. Macroscopic wound closure and the re-epithelialization rate were accelerated in 8-week-old Med1(epi-/- mice compared with age-matched wild-type mice. Increased lengths of migrating epithelial tongues and numbers of Ki67-positive cells at the wounded epidermis were observed in 8-week-old Med1(epi-/- mice, whereas wound contraction and the area of α-SMA-positive myofibroblasts in the granulation tissue were unaffected. Migration was enhanced in Med1(epi-/- keratinocytes compared with wild-type keratinocytes in vitro. Immunoblotting revealed that the expression of follistatin was significantly decreased in Med1(epi-/- keratinocytes. Moreover, the mitogen-activated protein kinase pathway was enhanced before and after treatment of Med1(epi-/- keratinocytes with activin A in vitro. Cell-cycle analysis showed an increased ratio of S phase cells after activin A treatment of Med1(epi-/- keratinocytes compared with wild-type keratinocytes. These findings indicate that the activin-follistatin system is involved in this acceleration of skin wound healing in 8-week-old Med1(epi-/- mice. On the other hand, skin wound healing in 6-month-old Med1(epi-/- mice was significantly delayed with decreased numbers of Ki67-positive cells at the wounded epidermis as well as BrdU-positive label retaining cells in hair follicles compared with age-matched wild-type mice. These results agree with our previous observation that hair follicle bulge stem cells are reduced in older Med1(epi-/- mice, indicating a decreased contribution of hair

  1. Gene expression analysis of skin grafts and cultured keratinocytes using synthetic RNA normalization reveals insights into differentiation and growth control.

    Science.gov (United States)

    Katayama, Shintaro; Skoog, Tiina; Jouhilahti, Eeva-Mari; Siitonen, H Annika; Nuutila, Kristo; Tervaniemi, Mari H; Vuola, Jyrki; Johnsson, Anna; Lönnerberg, Peter; Linnarsson, Sten; Elomaa, Outi; Kankuri, Esko; Kere, Juha

    2015-06-25

    Keratinocytes (KCs) are the most frequent cells in the epidermis, and they are often isolated and cultured in vitro to study the molecular biology of the skin. Cultured primary cells and various immortalized cells have been frequently used as skin models but their comparability to intact skin has been questioned. Moreover, when analyzing KC transcriptomes, fluctuation of polyA+ RNA content during the KCs' lifecycle has been omitted. We performed STRT RNA sequencing on 10 ng samples of total RNA from three different sample types: i) epidermal tissue (split-thickness skin grafts), ii) cultured primary KCs, and iii) HaCaT cell line. We observed significant variation in cellular polyA+ RNA content between tissue and cell culture samples of KCs. The use of synthetic RNAs and SAMstrt in normalization enabled comparison of gene expression levels in the highly heterogenous samples and facilitated discovery of differences between the tissue samples and cultured cells. The transcriptome analysis sensitively revealed genes involved in KC differentiation in skin grafts and cell cycle regulation related genes in cultured KCs and emphasized the fluctuation of transcription factors and non-coding RNAs associated to sample types. The epidermal keratinocytes derived from tissue and cell culture samples showed highly different polyA+ RNA contents. The use of SAMstrt and synthetic RNA based normalization allowed the comparison between tissue and cell culture samples and thus proved to be valuable tools for RNA-seq analysis with translational approach. Transciptomics revealed clear difference both between tissue and cell culture samples and between primary KCs and immortalized HaCaT cells.

  2. Expression of heparanase in basal cell carcinoma and squamous cell carcinoma.

    Science.gov (United States)

    Pinhal, Maria Aparecida Silva; Almeida, Maria Carolina Leal; Costa, Alessandra Scorse; Theodoro, Thérèse Rachell; Serrano, Rodrigo Lorenzetti; Machado, Carlos D'Apparecida Santos

    2016-01-01

    Heparanase is an enzyme that cleaves heparan sulfate chains. Oligosaccharides generated by heparanase induce tumor progression. Basal cell carcinoma and squamous cell carcinoma comprise types of nonmelanoma skin cancer. Evaluate the glycosaminoglycans profile and expression of heparanase in two human cell lines established in culture, immortalized skin keratinocyte (HaCaT) and squamous cell carcinoma (A431) and also investigate the expression of heparanase in basal cell carcinoma, squamous cell carcinoma and eyelid skin of individuals not affected by the disease (control). Glycosaminoglycans were quantified by electrophoresis and indirect ELISA method. The heparanase expression was analyzed by quantitative RT-PCR (qRTPCR). The A431 strain showed significant increase in the sulfated glycosaminoglycans, increased heparanase expression and decreased hyaluronic acid, comparing to the HaCaT lineage. The mRNA expression of heparanase was significantly higher in Basal cell carcinoma and squamous cell carcinoma compared with control skin samples. It was also observed increased heparanase expression in squamous cell carcinoma compared to the Basal cell carcinoma. The glycosaminoglycans profile, as well as heparanase expression are different between HaCaT and A431 cell lines. The increased expression of heparanase in Basal cell carcinoma and squamous cell carcinoma suggests that this enzyme could be a marker for the diagnosis of such types of non-melanoma cancers, and may be useful as a target molecule for future alternative treatment.

  3. Steroid synthesis by primary human keratinocytes; implications for skin disease

    Energy Technology Data Exchange (ETDEWEB)

    Hannen, Rosalind F., E-mail: r.f.hannen@qmul.ac.uk [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Michael, Anthony E. [Centre for Developmental and Endocrine Signalling, Academic Section of Obstetrics and Gynaecology, Division of Clinical Developmental Sciences, 3rd Floor, Lanesborough Wing, St. George' s, University of London, Cranmer Terrace, Tooting, London SW17 0RE (United Kingdom); Jaulim, Adil [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Bhogal, Ranjit [Life Science, Unilever R and D Colworth House, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Burrin, Jacky M. [Centre for Endocrinology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London EC1M 6BQ (United Kingdom); Philpott, Michael P. [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom)

    2011-01-07

    Research highlights: {yields} Primary keratinocytes express the steroid enzymes required for cortisol synthesis. {yields} Normal primary human keratinocytes can synthesise cortisol. {yields} Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. {yields} StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3{beta}HSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7-{sup 3}H]-pregnenolone through each steroid intermediate to [7-{sup 3}H]-cortisol in cultured PHK. Trilostane (a 3{beta}HSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data

  4. Steroid synthesis by primary human keratinocytes; implications for skin disease

    International Nuclear Information System (INIS)

    Hannen, Rosalind F.; Michael, Anthony E.; Jaulim, Adil; Bhogal, Ranjit; Burrin, Jacky M.; Philpott, Michael P.

    2011-01-01

    Research highlights: → Primary keratinocytes express the steroid enzymes required for cortisol synthesis. → Normal primary human keratinocytes can synthesise cortisol. → Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. → StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3βHSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7- 3 H]-pregnenolone through each steroid intermediate to [7- 3 H]-cortisol in cultured PHK. Trilostane (a 3βHSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data show that PHK are capable of extra

  5. Vitamin D receptor-mediated control of Soggy, Wise, and Hairless gene expression in keratinocytes.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Estess, Rudolf C; Kaneko, Ichiro; Whitfield, G Kerr; Jurutka, Peter W; Haussler, Mark R

    2014-02-01

    The vitamin D receptor (VDR), but not its hormonal ligand, 1,25-dihydroxyvitamin D3 (1,25D), is required for the progression of the mammalian hair cycle. We studied three genes relevant to hair cycle signaling, DKKL1 (Soggy), SOSTDC1 (Wise), and HR (Hairless), to determine whether their expression is regulated by VDR and/or its 1,25D ligand. DKKL1 mRNA was repressed 49-72% by 1,25D in primary human and CCD-1106 KERTr keratinocytes; a functional vitamin D responsive element (VDRE) was identified at -9590 bp in murine Soggy. Similarly, SOSTDC1 mRNA was repressed 41-59% by 1,25D in KERTr and primary human keratinocytes; a functional VDRE was located at -6215 bp in human Wise. In contrast, HR mRNA was upregulated 1.56- to 2.77-fold by 1,25D in primary human and KERTr keratinocytes; a VDRE (TGGTGAgtgAGGACA) consisting of an imperfect direct repeat separated by three nucleotides (DR3) was identified at -7269 bp in the human Hairless gene that mediated dramatic induction, even in the absence of 1,25D ligand. In parallel, a DR4 thyroid hormone responsive element, TGGTGAggccAGGACA, was identified at +1304 bp in the human HR gene that conferred tri-iodothyronine (T3)-independent transcriptional activation. Because the thyroid hormone receptor controls HR expression in the CNS, whereas VDR functions in concert with the HR corepressor specifically in skin, a model is proposed wherein unliganded VDR upregulates the expression of HR, the gene product of which acts as a downstream comodulator to feedback-repress DKKL1 and SOSTDC1, resulting in integration of bone morphogenic protein and Wnt signaling to drive the mammalian hair cycle and/or influencing epidermal function.

  6. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    Science.gov (United States)

    Tohidnezhad, Mersedeh; Lammel, Justus; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Jahr, Holger; Cremer, Jochen; Rademacher, Franziska; Gläser, Regine; Harder, Jürgen

    2017-01-01

    Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs) or their clinically related formulations (e.g., Vivostat PRF®) came recently into the physicians' focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10) and late (transglutaminase-1 and involucrin) differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR-) dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo. PMID:28808357

  7. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    Directory of Open Access Journals (Sweden)

    Andreas Bayer

    2017-01-01

    Full Text Available Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs or their clinically related formulations (e.g., Vivostat PRF® came recently into the physicians’ focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10 and late (transglutaminase-1 and involucrin differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR- dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo.

  8. Differentiation of human scalp hair follicle keratinocytes in culture.

    Science.gov (United States)

    Weterings, P J; Verhagen, H; Wirtz, P; Vermorken, A J

    1984-01-01

    The morphology of human scalp hair follicle keratinocytes, cultured on the bovine eye lens capsule, is studied by light and electron microscopy. The hair follicle keratinocytes in the stratified cultures are characterized by the presence of numerous tonofilaments, desmosomes and lysosomes and by the presence of glycogen accumulations. The cells in the upper layers develop a cornified envelope. Moreover, an incomplete basal lamina is found between the capsule and the basal cells. However, some features of epidermal keratinocytes in vivo, such as keratohyalin granules and stratum corneum formation, are absent. Analysis of the polypeptides by sodium dodecylsulfate polyacrylamide gel electrophoresis also reveals differences between the cultured hair follicle cells and epidermis, whilst the patterns of cultured cells and hair follicle sheaths are similar. The morphological and protein biosynthetic aspects of terminal differentiation of the keratinocytes in vitro are correlated. These results are discussed in the light of the findings with cultured epidermal keratinocytes, reported in the literature.

  9. Treatment of burn injuries with keratinocyte cultures

    International Nuclear Information System (INIS)

    Syring, C.; Maenig, H.J.; Von Versen, R.; Bruck, J.

    1999-01-01

    The German Institute for Cell and Tissue Replacement (DIZG) provides burned patients with skin and amnion for a temporary wound closure. Severely burned patients (>60% BSA for adults, >40% BSA for children) were supplied with autologous and allogenic grafts from cultured keratinocytes. The keratinocyte culture is done under GMP-conditions using the method of Rheinwald and Green. The 3T3 fibroblasts were irradiated with 60 Gy and used as feeder cells to produce keratinocyte sheets within 3 weeks. In this time up to 6.000 cm are available. The sheets were harvested by detachment with dispase (1,2 U/ml), fixed to gauze and transported to the hospital. The DIZG has a 3 years experience in the treatment of burns with keratinocyte sheets. The sheets were transplanted to patients in different hospitals, the total transplanted area is about 30.000 cm. This paper describes the experiences with ten severely burned patients treated with keratinocyte sheet

  10. Mechanosensory and ATP Release Deficits following Keratin14-Cre-Mediated TRPA1 Deletion Despite Absence of TRPA1 in Murine Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Katherine J Zappia

    Full Text Available Keratinocytes are the first cells that come into direct contact with external tactile stimuli; however, their role in touch transduction in vivo is not clear. The ion channel Transient Receptor Potential Ankyrin 1 (TRPA1 is essential for some mechanically-gated currents in sensory neurons, amplifies mechanical responses after inflammation, and has been reported to be expressed in human and mouse skin. Other reports have not detected Trpa1 mRNA transcripts in human or mouse epidermis. Therefore, we set out to determine whether selective deletion of Trpa1 from keratinocytes would impact mechanosensation. We generated K14Cre-Trpa1fl/fl mice lacking TRPA1 in K14-expressing cells, including keratinocytes. Surprisingly, Trpa1 transcripts were very poorly detected in epidermis of these mice or in controls, and detection was minimal enough to preclude observation of Trpa1 mRNA knockdown in the K14Cre-Trpa1fl/fl mice. Unexpectedly, these K14Cre-Trpa1fl/fl mice nonetheless exhibited a pronounced deficit in mechanosensitivity at the behavioral and primary afferent levels, and decreased mechanically-evoked ATP release from skin. Overall, while these data suggest that the intended targeted deletion of Trpa1 from keratin 14-expressing cells of the epidermis induces functional deficits in mechanotransduction and ATP release, these deficits are in fact likely due to factors other than reduction of Trpa1 expression in adult mouse keratinocytes because they express very little, if any, Trpa1.

  11. Early Gene Expression in Wounded Human Keratinocytes Revealed by DNA Microarray Analysis

    Directory of Open Access Journals (Sweden)

    Pascal Barbry

    2006-04-01

    Full Text Available Wound healing involves several steps: spreading of the cells, migration and proliferation. We have profiled gene expression during the early events of wound healing in normal human keratinocytes with a home-made DNA microarray containing about 1000 relevant human probes. An original wounding machine was used, that allows the wounding of up to 40% of the surface of a confluent monolayer of cultured cells grown on a Petri dish (compared with 5% with a classical ‘scratch’ method. The two aims of the present study were: (a to validate a limited number of genes by comparing the expression levels obtained with this technique with those found in the literature; (b to combine the use of the wounding machine with DNA microarray analysis for large-scale detection of the molecular events triggered during the early stages of the wound-healing process. The time-courses of RNA expression observed at 0.5, 1.5, 3, 6 and 15 h after wounding for genes such as c-Fos, c-Jun, Egr1, the plasminogen activator PLAU (uPA and the signal transducer and transcription activator STAT3, were consistent with previously published data. This suggests that our methodologies are able to perform quantitative measurement of gene expression. Transcripts encoding two zinc finger proteins, ZFP36 and ZNF161, and the tumour necrosis factor α-induced protein TNFAIP3, were also overexpressed after wounding. The role of the p38 mitogen-activated protein kinase (p38MAPK in wound healing was shown after the inhibition of p38 by SB203580, but our results also suggest the existence of surrogate activating pathways.

  12. RIP2: A novel player in the regulation of keratinocyte proliferation and cutaneous wound repair?

    International Nuclear Information System (INIS)

    Adams, Stephanie; Valchanova, Ralitsa S.; Munz, Barbara

    2010-01-01

    We could recently demonstrate an important role of receptor interacting protein 4 (RIP4) in the regulation of keratinocyte differentiation. Now, we analyzed a potential role of the RIP4 homolog RIP2 in keratinocytes. Specifically, we demonstrate here that rip2 expression is induced by scratch-wounding and after the induction of differentiation in these cells. Furthermore, serum growth factors and cytokines can induce rip2, with TNF-α-dependent induction being dependent on p38 MAPK. In addition, we demonstrate that scratch-induced upregulation of rip2 expression is completely blocked by the steroid dexamethasone. Since we also show that RIP2 is an important player in the regulation of keratinocyte proliferation, these data suggest that inhibition of rip2 upregulation after wounding might contribute to the reduced and delayed wound re-epithelialization phenotype seen in glucocorticoid-treated patients.

  13. Evidence for Alteration of EZH2, BMI1, and KDM6A and Epigenetic Reprogramming in Human Papillomavirus Type 16 E6/E7-Expressing Keratinocytes

    OpenAIRE

    Hyland, Paula L.; McDade, Simon S.; McCloskey, Rachel; Dickson, Glenda J.; Arthur, Ken; McCance, Dennis J.; Patel, Daksha

    2011-01-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2...

  14. Scleroderma keratinocytes promote fibroblast activation independent of transforming growth factor beta.

    Science.gov (United States)

    McCoy, Sara S; Reed, Tamra J; Berthier, Celine C; Tsou, Pei-Suen; Liu, Jianhua; Gudjonsson, Johann E; Khanna, Dinesh; Kahlenberg, J Michelle

    2017-11-01

    SSc is a devastating disease that results in fibrosis of the skin and other organs. Fibroblasts are a key driver of the fibrotic process through deposition of extracellular matrix. The mechanisms by which fibroblasts are induced to become pro-fibrotic remain unclear. Thus, we examined the ability of SSc keratinocytes to promote fibroblast activation and the source of this effect. Keratinocytes were isolated from skin biopsies of 9 lcSSc, 10 dcSSc and 13 control patients. Conditioned media was saved from the cultures. Normal fresh primary fibroblasts were exposed to healthy control and SSc keratinocyte conditioned media in the presence or absence of neutralizing antibodies for TGF-β. Gene expression was assessed by microarrays and real-time PCR. Immunocytochemistry was performed for α-smooth muscle actin (α-SMA), collagen type 1 (COL1A1) and CCL5 expression. SSc keratinocyte conditioned media promoted fibroblast activation, characterized by increased α-SMA and COL1A1 mRNA and protein expression. This effect was independent of TGF-β. Microarray analysis identified upregulation of nuclear factor κB (NF-κB) and downregulation of peroxisome proliferator-activated receptor γ (PPAR-γ) pathways in both SSc subtypes. Scleroderma keratinocytes exhibited increased expression of NF-κB-regulated cytokines and chemokines and lesional skin staining confirmed upregulation of CCL5 in basal keratinocytes. Scleroderma keratinocytes promote the activation of fibroblasts in a TGF-β-independent manner and demonstrate an imbalance in NF-κB1 and PPAR-γ expression leading to increased cytokine and CCL5 production. Further study of keratinocyte mediators of fibrosis, including CCL5, may provide novel targets for skin fibrosis therapy. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  15. SORBS2 and TLR3 induce premature senescence in primary human fibroblasts and keratinocytes

    International Nuclear Information System (INIS)

    Liesenfeld, Melanie; Mosig, Sandy; Funke, Harald; Jansen, Lars; Runnebaum, Ingo B; Dürst, Matthias; Backsch, Claudia

    2013-01-01

    Genetic aberrations are required for the progression of HPV-induced cervical precancers. A prerequisite for clonal expansion of cancer cells is unlimited proliferative capacity. In a cell culture model for cervical carcinogenesis loss of genes located on chromosome 4q35→qter and chromosome 10p14-p15 were found to be associated with escape from senescence. Moreover, by LOH and I-FISH analyses a higher frequency of allele loss of these regions was also observed in cervical carcinomas as compared to CIN3. The aim of this study was to identify candidate senescence-related genes located on chromosome 4q35→qter and chromosome 10p14-p15 which may contribute to clonal expansion at the transition of CIN3 to cancer. Microarray expression analyses were used to identify candidate genes down-regulated in cervical carcinomas as compared to CIN3. In order to relate these genes with the process of senescence their respective cDNAs were overexpressed in HPV16-immortalized keratinocytes as well as in primary human fibroblasts and keratinocytes using lentivirus mediated gene transduction. Overall fifteen genes located on chromosome 4q35→qter and chromosome 10p14-p15 were identified. Ten of these genes could be validated in biopsies by RT-PCR. Of interest is the novel finding that SORBS2 and TLR3 can induce senescence in primary human fibroblasts and keratinocytes but not in HPV-immortalized cell lines. Intriguingly, the endogenous expression of both genes increases during finite passaging of primary keratinocytes in vitro. The relevance of the genes SORBS2 and TLR3 in the process of cellular senescence warrants further investigation. In ongoing experiments we are investigating whether this increase in gene expression is also characteristic of replicative senescence

  16. Cdc42 expression in keratinocytes is required for the maintenance of the basement membrane in skin

    DEFF Research Database (Denmark)

    Wu, Xunwei; Quondamatteo, Fabio; Brakebusch, Cord

    2006-01-01

    , structure and number of hemidesomosomes were not significantly changed in the Cdc42 mutant skin compared with the control mice and no blister formation was observed in mutant skin. These data indicate that Cdc42 in keratinocytes is important for maintenance of the basement membrane of skin....... process, which requires directed secretion, deposition and organization of basement membrane components at the basal side of epithelial cells. In the current study, we analyzed the maintenance of skin basement membrane in mice with a keratinocyte-restricted deletion of the Cdc42 gene. In the absence...

  17. Alteration of keratinocyte differentiation and senescence by the tumor promoter dioxin

    International Nuclear Information System (INIS)

    Ray, Soma S.; Swanson, Hollie I.

    2003-01-01

    Exposure to the environmental contaminant dioxin, elicits a variety of responses, which includes tumor promotion, embryotoxicity/teratogenesis, and carcinogenesis in both animals and humans. Many of the effects of dioxin are mediated by the aryl hydrocarbon receptor (AHR), a ligand-activated bHLH (basic helix-loop-helix)/PAS transcription factor. We initiated this study to determine whether dioxin's tumor-promoting activities may lie in its ability to alter proliferation, differentiation, and/or senescence using normal human epidermal keratinocytes (HEKs). Here, we report that dioxin appears to accelerate differentiation as measured by flow cytometry and by increased expression of the differentiation markers involucrin and filaggrin. In addition, dioxin appears to increase proliferation as indicated by an increase in NADH/NADPH production and changes in cell cycle. Finally, dioxin decreases SA (senescence associated) β-galactosidase staining, an indicator of senescence, in the differentiating keratinocytes. These changes were accompanied by decreases in the expression levels of key cell cycle regulatory proteins p53, p16 INK4a , and p14 ARF . Our findings support the idea that dioxin may exert its tumor-promoting actions, in part, by downregulating the expression levels of key tumor suppressor proteins, which may impair the cell's ability to maintain its appropriate cellular status

  18. The expression of proinflammatory genes in epidermal keratinocytes is regulated by hydration status.

    Science.gov (United States)

    Xu, Wei; Jia, Shengxian; Xie, Ping; Zhong, Aimei; Galiano, Robert D; Mustoe, Thomas A; Hong, Seok J

    2014-04-01

    Mucosal wounds heal more rapidly, exhibit less inflammation, and are associated with minimal scarring when compared with equivalent cutaneous wounds. We previously demonstrated that cutaneous epithelium exhibits an exaggerated response to injury compared with mucosal epithelium. We hypothesized that treatment of injured skin with a semiocclusive dressing preserves the hydration of the skin and results in a wound healing phenotype that more closely resembles that of mucosa. Here we explored whether changes in hydration status alter epidermal gene expression patterns in rabbit partial-thickness incisional wounds. Using microarray studies on injured epidermis, we showed that global gene expression patterns in highly occluded versus non-occluded wounds are distinct. Many genes including IL-1β, IL-8, TNF-α (tumor necrosis factor-α), and COX-2 (cyclooxygenase 2) are upregulated in non-occluded wounds compared with highly occluded wounds. In addition, decreased levels of hydration resulted in an increased expression of proinflammatory genes in human ex vivo skin culture (HESC) and stratified keratinocytes. Hierarchical analysis of genes using RNA interference showed that both TNF-α and IL-1β regulate the expression of IL-8 through independent pathways in response to reduced hydration. Furthermore, both gene knockdown and pharmacological inhibition studies showed that COX-2 mediates the TNF-α/IL-8 pathway by increasing the production of prostaglandin E2 (PGE2). IL-8 in turn controls the production of matrix metalloproteinase-9 in keratinocytes. Our data show that hydration status directly affects the expression of inflammatory signaling in the epidermis. The identification of genes involved in the epithelial hydration pathway provides an opportunity to develop strategies to reduce scarring and optimize wound healing.

  19. RAC1 in keratinocytes regulates crosstalk to immune cells by Arp2/3-dependent control of STAT1

    DEFF Research Database (Denmark)

    Pedersen, Esben Ditlev Kølle; Wang, Zhipeng; Stanley, Alanna

    2012-01-01

    Crosstalk between keratinocytes and immune cells is crucial for the immunological barrier function of the skin, and aberrant crosstalk contributes to inflammatory skin diseases. Using mice with a keratinocyte-restricted deletion of the RAC1 gene we found that RAC1 in keratinocytes plays...... hypersensitive to inflammatory stimuli both in vitro and in vivo, suggesting a major role for RAC1 in regulating the crosstalk between the epidermis and the immune system....

  20. TIG3 - AN IMPORTANT REGULATOR OF KERATINOCYTE PROLIFERATION AND SURVIVAL

    OpenAIRE

    Scharadin, Tiffany M.; Eckert, Richard L.

    2014-01-01

    Tazarotene induced gene 3 (TIG3) is a tumor suppressor protein. In normal human epidermis, TIG3 is present in the differentiated, suprabasal layers and regulates terminal differentiation. TIG3 level is reduced in hyperproliferative diseases, including psoriasis and skin cancer, suggesting that loss of TIG3 is associated with enhanced cell proliferation. Moreover, transient expression of TIG3 leads to terminal differentiation in normal keratinocytes and apoptosis in skin cancer cells. In both ...

  1. Comparison of epidermal keratinocytes and dermal fibroblasts as potential target cells for somatic gene therapy of phenylketonuria

    DEFF Research Database (Denmark)

    Christensen, Rikke; Güttler, Flemming; Jensen, Thomas G

    2002-01-01

    gene therapy. We have previously shown that overexpression of PAH and GTP-CH in primary human keratinocytes leads to high levels of phenylalanine clearance without BH(4) supplementation [Gene Ther. 7 (2000) 1971]. Here, we investigate the capacity of fibroblasts, another cell type from the skin......, to metabolize phenylalanine. After retroviral gene transfer of PAH and GTP-CH both normal and PKU patient fibroblasts were able to metabolize phenylalanine, however, in lower amounts compared to genetically modified keratinocytes. Further comparative analyses between keratinocytes and fibroblasts revealed...

  2. α6 Integrin and CD44 enrich for a primary keratinocyte population that displays resistance to UV-induced apoptosis.

    Directory of Open Access Journals (Sweden)

    Helen Wray

    Full Text Available Epidermal human keratinocytes are exposed to a wide range of environmental genotoxic insults, including the UV component of solar radiation. Epidermal homeostasis in response to cellular or tissue damage is maintained by a population of keratinocyte stem cells (KSC that reside in the basal layer of the epithelium. Using cell sorting based on cell-surface markers, we have identified a novel α6 integrin(high+/CD44(+ sub-population of basal keratinocytes. These α6 integrin(high+/CD44(+ keratinocytes have both high proliferative potential, form colonies in culture that have characteristics of holoclones and have a unique pattern of resistance to apoptosis induced by UVB radiation or by agents that induce single- or double strand DNA breaks. Resistance to UVB induced apoptosis in the α6 integrin(high+/CD44(+ cells involved increased expression of TAp63 and was overcome by PI-3 kinase inhibition. In marked contrast, the α6 integrin(high+/CD44(+ cells were sensitive to apoptosis induced by the cross-linking agent cisplatin, and imatinib inhibition of c-Abl blocked the ability of cisplatin to kill α6 integrin(high+/CD44(+ cells. Our findings reveal a population of basal keratinocytes with long-term proliferative properties that display specific patterns of apoptotic resistance that is dependent upon the genotoxic stimulus, and provide insights into how these cells can be targeted with chemotherapeutic agents.

  3. Effect of Nanodiamond and Nanoplatinum Liquid, DPV576, on Human Primary Keratinocytes.

    Science.gov (United States)

    Ghoneum, Mamdooh H; Katano, Hideki; Agrawal, Sudhanshu; Ganguly, Sreerupa; Agrawal, Anshu

    2017-01-01

    Nanofabrics are now being used in a wide range of products that come into direct contact with skin, including carpet, clothing, and medical fabrics. In the current study, we examined the effect of a dispersed aqueous mixture of nanodiamond (ND) and nanoplatinum (NP) (DPV576) on human primary keratinocytes with respect to transient receptor potential vanilloid (TRPV) channel expression, secretion of cytokines and production of nerve growth factor (NGF). Keratinocytes were treated with DPV576 at concentrations of 1:10 and 1:100 dilutions for 24 hours in vitro, and their activation of was determined by production of cytokines TNF-α, IL-1β, and prostaglandin (PGE2), and by production of NGF. Inhibitor experiments were carried out by incubating keratinocytes with the TRPV4-selective antagonist HC-067047. TRPV receptor expression (TRPV1, TRPV3 and TRPV4) on keratinocytes as well as changes in Ca2+ potential were examined by flow cytometry. DPV576 treatment of keratinocytes resulted in the following effects: (1) stimulation of keratinocytes as indicated by the significant secretion of cytokines IL-1β, TNF-α, and PGE2, an effect noted only at higher concentration (1:10); (2) significant decrease in the expression of TRPV4 on keratinocytes with a spike in the calcium flux, but no change in the expression of TRPV1 and TRPV3; (3) induction of cytokine secretion independent of TRPV4, as the addition of TRPV4 inhibitor had no significant effect on the cytokine production from keratinocytes; (4) induction of NGF secretion by keratinocytes. These results demonstrate that DPV576 activates keratinocytes via multiple signaling pathways which may reduce stress associated with inflammation, pain, and circadian rhythms. ND/NP-coated fabrics that target the modulation of local inflammation, pain, and circadian rhythms could potentially be of benefit to humans.

  4. Kinetics of growth and differentiation of cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Albers, K.M.

    1985-01-01

    A study was made of the interrelationship between replication and differentiation in cultures of human epidermal keratinocytes. Measures of both parameters were made using newly developed methods to quantify the rate at which keratinocytes replicate and the rate at which they withdraw from the cell cycle. Keratinocyte replication was measured by determining the cell doubling time, labeling index, and cell cycle duration. Cell cycle length was measured using a double label assay that determines the length of time between two successive phases of DNA synthesis. The first DNA synthesis phase was marked by labeling keratinocytes with 14 C-thymidine. At the next round of DNA synthesis, cells were labeled with bromodeoxyuridine, a heavy analog of thymidine. The cell cycle length is given by the time required for the 14 C-labeled DNA to become double labeled. To measure keratinocyte differentiation, the rate at which cells withdraw from the cell cycle was determined. To measure withdrawal, the percentage of cells labeled by a pulse of 14 C-thymidine that failed to undergo a second cycle of DNA synthesis, as measured by bromodeoxyuridine incorporation, was determined. Cells which failed to undergo a second cycle of synthesis were considered to have differentiated and withdrawn from the cell cycle

  5. Intermittent pressure decreases human keratinocyte proliferation in vitro.

    Science.gov (United States)

    Nasca, Maria R; Shih, Alan T; West, Dennis P; Martinez, Wanda M; Micali, Giuseppe; Landsman, Adam S

    2007-01-01

    The aim of this study was to investigate the correlation between pressure changes and keratinocyte proliferation by determining whether keratinocytes exposed to altered mechanical pressures would proliferate at different rates compared to control cells not subjected to pressure changes. Tissue culture flasks of human keratinocytes plated at an approximate density of 15,000 cells/cm(2) undergoing an intermittent cyclic pressure of 362 mm Hg at a frequency of 2.28 or 5.16 cycles/min (0.038 or 0.086 Hz) for 8 h were compared to control flasks grown at ambient room pressure. An in-line pressure transducer was used to monitor and adjust pressure within the cell chambers, using a solenoid valve. A thymidine incorporation assay assessed the amount of cell proliferation in each set of experiments. Differences in proliferation between keratinocytes subjected to cyclic pressure changes and control cells were found to be statistically significant (p < 0.05) in 4 out of 5 proliferation assays. Also, a higher frequency of pressure changes consistently generated a reduced proliferation rate compared to that seen in cells exposed to a lower frequency of pressure changes. These data indicate that keratinocytes undergoing intermittent pressure changes exhibit decreased proliferation rates compared to controls. Furthermore, an increased frequency rate seems to have a greater effect on proliferation than low-frequency rate pressure changes, suggesting that the stress caused by frequently changed pressure may play a greater role in reducing keratinocyte proliferation than the actual magnitude of load applied to the cells. Our results support the current treatment protocol of reducing speed and duration of walking on the site of the wound to promote healing of foot ulcers. (c) 2007 S. Karger AG, Basel.

  6. The Effect of Calcipotriol on the Expression of Human β Defensin-2 and LL-37 in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Beom Joon Kim

    2009-01-01

    Full Text Available Background. Vitamin D has been reported to regulate innate immunity by controlling the expression of antimicrobial peptides (AMPs. Objective. We investigated the effect of calcipotriol on the expression of AMPs in human cultured keratinocytes. Methods. Keratinocytes were treated with lipopolysaccharide (LPS, TNF-α, Calcipotriol and irradiated with UVB, cultured, and harvested. To assess the expression of human beta defensin-2 and LL-37 in the control group, not exposed to any stimulants, the experimental group was treated with LPS, TNF-α, or UVB, and another group was treated again with calcipotriol; reverse transcriptase-polymerase chain reaction, Western blotting, and immunohistochemical staining were performed. Results. In the experimental group treated with LPS, UVB irradiation, and TNF-α, the expression of β-defensin and LL-37 was increased more than in the control group and then decreased in the experimental group treated with calcipotriol. Conclusions. Calcipotriol suppressed HBD-2 and LL-37, which were stimulated by UVB, LPS, and TNF-α.

  7. ATF3 activates Stat3 phosphorylation through inhibition of p53 expression in skin cancer cells.

    Science.gov (United States)

    Hao, Zhen-Feng; Ao, Jun-Hong; Zhang, Jie; Su, You-Ming; Yang, Rong-Ya

    2013-01-01

    ATF3, a member of the ATF/CREB family of transcription factors, has been found to be selectively induced by calcineurin/NFAT inhibition and to enhance keratinocyte tumor formation, although the precise role of ATF3 in human skin cancer and possible mechanisms remain unknown. In this study, clinical analysis of 30 skin cancer patients and 30 normal donors revealed that ATF3 was accumulated in skin cancer tissues. Functional assays demonstrated that ATF3 significantly promoted skin cancer cell proliferation. Mechanically, ATF3 activated Stat3 phosphorylation in skin cancer cell through regulation of p53 expression. Moreover, the promotion effect of ATF3 on skin cancer cell proliferation was dependent on the p53-Stat3 signaling cascade. Together, the results indicate that ATF3 might promote skin cancer cell proliferation and enhance skin keratinocyte tumor development through inhibiting p53 expression and then activating Stat3 phosphorylation.

  8. Thalidomide increases human keratinocyte migration and proliferation.

    Science.gov (United States)

    Nasca, M R; O'Toole, E A; Palicharla, P; West, D P; Woodley, D T

    1999-11-01

    Thalidomide is reported to have therapeutic utility in the treatment of pyoderma gangrenosum, Behçet's disease, aphthous ulcers, and skin wounds. We investigated the effect of thalidomide on human keratinocyte proliferation and migration, two early and critical events in the re-epithelialization of skin wounds. Thalidomide at concentrations less than 1 microM did not affect keratinocyte viability. Using a thymidine incorporation assay, we found that thalidomide, at therapeutic concentrations, induced more than a 2. 5-fold increase in the proliferative potential of the cells. Keratinocyte migration was assessed by two independent motility assays: a colloidal gold assay and an in vitro scratch assay. At optimal concentrations, thalidomide increased keratinocyte migration on a collagen matrix more than 2-fold in the colloidal gold assay and more than 3-fold in the scratch assay over control. Although pro-migratory, thalidomide did not alter the level of metalloproteinase-9 secreted into culture medium. Thalidomide did, however, induce a 2-4-fold increase in keratinocyte-derived interleukin-8, a pro-migratory cellular autocrine factor. Human keratinocyte migration and proliferation are essential for re-epithelialization of skin wounds. Interleukin-8 increases human keratinocyte migration and proliferation and is chemotactic for keratinocytes. Therefore, thalidomide may modulate keratinocyte proliferation and motility by a chemokine-dependent pathway.

  9. Clinicopathological correlation of keratinocyte growth factor and matrix metalloproteinase-9 expression in human gastric cancer.

    Science.gov (United States)

    Zhang, Qing; Wang, Ping; Shao, Ming; Chen, Shi-Wen; Xu, Zhi-Feng; Xu, Feng; Yang, Zhong-Yin; Liu, Bing-Ya; Gu, Qin-Long; Zhang, Wen-Jian; Li, Yong

    2015-01-01

    Keratinocyte growth factor (KGF) is reported to be implicated in the growth of some cancer cells. Matrix metalloproteinase 9 (MMP-9) is thought to enhance the tumor invasion and metastasis ability. This study was aimed at analyzing the relationship between KGF and MMP-9 expression and patients' clinicopathological characteristics to clarify the clinical significance of the expression of KGF and MMP-9 in gastric cancer. Tissue samples from 161 patients with primary gastric cancer were investigated using immunohistochemistry. The relationship between KGF and/or MMP-9 expression and clinicopathological characteristics was analyzed. KGF expression and MMP-9 expression in gastric cancer tissue were observed in 62 cases (38.5%) and 97 cases (60.2%), respectively. MMP-9 was significantly associated with depth of invasion, lymph node metastasis and TNM stage. The prognosis of MMP-9-positive patients was significantly poorer than that of MMP-9-negative patients (p = 0.009). KGF expression was positively correlated with MMP-9 expression in gastric cancer, and the prognosis of patients with both KGF- and MMP-9-positive tumors was significantly worse than that of patients with negative tumors for either factor (p = 0.045). Expression of MMP-9 was revealed to be an independent prognostic factor (p = 0.026). Coexpression of KGF and MMP-9 in gastric cancer could be a useful prognostic factor, and MMP-9 might also serve as a novel target for both prognostic prediction and therapeutics.

  10. The ultrastructural surface morphology of oral cancer cells and keratinocytes after exposure to chitosan

    Science.gov (United States)

    Fatimah; Sarsito, A. S.; Wimardhani, Y. S.

    2017-08-01

    Low-molecular-weight chitosan (LMWC) has the same selective cytotoxic effects on oral cancer cells as cisplatin. The cell deaths caused by the anticancer characteristics of chitosan show that apoptosis is not the death pathway of the primary cells involved. The interactions between LMWC and the cells need to be explored. The objective of this study was to compare the ultrastructural morphology of oral Squamous Cell Carcinoma (SCC Ca)-922 and noncancer keratinocyte HaCaT cell lines after exposure to LMWC and cisplatin. The cells were treated with LMWC and cisplatin, and their ultrastructural morphology was analyzed using scanning electron micrographs. Features of early apoptosis, seen as the loss of microvilli, were detected in the LMWC-exposed Ca9-22 cells, and there was a material surrounding the cells. In contrast, the LMWC-exposed HaCaT cells showed no changes related to apoptosis. The results were the opposite when cisplatin was used. This study confirms that there are differences in the ultrastructural surface morphology of LMWC-exposed and cisplatin-exposed oral cancer cells and keratinocytes that could be correlated with their biological activity.

  11. Lopinavir up-regulates expression of the antiviral protein ribonuclease L in human papillomavirus-positive cervical carcinoma cells.

    Science.gov (United States)

    Batman, Gavin; Oliver, Anthony W; Zehbe, Ingeborg; Richard, Christina; Hampson, Lynne; Hampson, Ian N

    2011-01-01

    We have previously shown that the HIV protease inhibitor lopinavir has selective toxicity against human papillomavirus (HPV)-positive cervical carcinoma cells via an unknown mechanism. SiHa cervical carcinoma cells were stably transfected with the proteasome sensor vector pZsProSensor-1 to confirm lopinavir inhibits the proteasome in these cells. The Panorama Xpress profiler 725 antibody array was then used to analyse specific changes in protein expression in lopinavir-treated versus control untreated SiHa cells followed by PCR and western blotting. Colorimetric growth assays of lopinavir-treated E6/E7 immortalised versus control human keratinocytes were performed. Targeted small interfering RNA gene silencing followed by growth assay comparison of lopinavir-treated/untreated SiHa cells was also used. Lopinavir induced an increase in the fluorescence of pZsProSensor-1 transfected SiHa cells, indicative of proteasomal inhibition. Ribonuclease L (RNASEL) protein was shown to be up-regulated in lopinavir-treated SiHa cells, which was confirmed by PCR and western blot. Targeted silencing of RNASEL reduced the sensitivity of SiHa cells to lopinavir. Selective toxicity against E6/E7 immortalised keratinocytes versus control cells was also seen with lopinavir and was associated with up-regulated RNASEL expression. These data are consistent with the toxicity of lopinavir against HPV-positive cervical carcinoma cells being related to its ability to block viral proteasome activation and induce an up-regulation of the antiviral protein RNASEL. This is supported by the drug's selective toxicity and up-regulation of RNASEL in E6/E7 immortalised keratinocytes combined with the increased resistance to lopinavir observed in SiHa cells following silencing of RNASEL gene expression.

  12. Impaired hair follicle morphogenesis and polarized keratinocyte movement upon conditional inactivation of integrin-linked kinase in the epidermis.

    Science.gov (United States)

    Nakrieko, Kerry-Ann; Welch, Ian; Dupuis, Holly; Bryce, Dawn; Pajak, Agnieszka; St Arnaud, René; Dedhar, Shoukat; D'Souza, Sudhir J A; Dagnino, Lina

    2008-04-01

    Integrin-linked kinase (ILK) is key for cell survival, migration, and adhesion, but little is known about its role in epidermal development and homeostasis in vivo. We generated mice with conditional inactivation of the Ilk gene in squamous epithelia. These mice die perinatally and exhibit skin blistering and severe defects in hair follicle morphogenesis, including greatly reduced follicle numbers, failure to progress beyond very early developmental stages, and pronounced defects in follicular keratinocyte proliferation. ILK-deficient epidermis shows abnormalities in adhesion to the basement membrane and in differentiation. ILK-deficient cultured keratinocytes fail to attach and spread efficiently and exhibit multiple abnormalities in actin cytoskeletal organization. Ilk gene inactivation in cultured keratinocytes causes impaired ability to form stable lamellipodia, to directionally migrate, and to polarize. These defects are accompanied by abnormal distribution of active Cdc42 to cell protrusions, as well as reduced activation of Rac1 upon induction of cell migration in scraped keratinocyte monolayers. Significantly, alterations in cell spreading and forward movement in single cells can be rescued by expression of constitutively active Rac1 or RhoG. Our studies underscore a central and distinct role for ILK in hair follicle development and in polarized cell movements, two key aspects of epithelial morphogenesis and function.

  13. Lysophosphatidic acid induces expression of genes in human oral keratinocytes involved in wound healing.

    Science.gov (United States)

    Thorlakson, Hong Huynh; Engen, Stian Andre; Schreurs, Olav; Schenck, Karl; Blix, Inger Johanne Schytte

    2017-08-01

    Epithelial cells participate in wound healing by covering wounds, but also as important mediators of wound healing processes. Topical application of the phospholipid growth factor lysophosphatidic acid (LPA) accelerates dermal wound healing and we hypothesized that LPA can play a role in human oral wound healing through its effects on human oral keratinocytes (HOK). HOK were isolated from gingival biopsies and exposed to LPA. The LPA receptor profile, signal transduction pathways, gene expression and secretion of selected cytokines were analyzed. HOK expressed the receptors LPA 1 , LPA 5 and LPA 6 and LPA activated the ERK1/2, JNK and p38 intracellular pathways, substantiated by secretion of IL-6 and IL-8. The early (2h) and intermediate (6h) gene expression profiles of HOK after LPA treatment showed a wide array of regulated genes. The majority of the strongest upregulated genes were related to chemotaxis and inflammation, and became downregulated after 6h. At 6h, genes coding for factors involved in extracellular matrix remodeling and re-epithelialization became highly expressed. IL-36γ, not earlier known to be regulated by LPA, was strongly transcribed and translated but not secreted. After stimulation with LPA, HOK responded by regulating factors and genes that are essential in wound healing processes. As LPA is found in saliva and is released by activated cells after wounding, our results indicate that LPA has a favorable physiological role in oral wound healing. This may further point towards a beneficial role for application of LPA on oral surgical or chronic wounds. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. PCB153 reduces telomerase activity and telomere length in immortalized human skin keratinocytes (HaCaT) but not in human foreskin keratinocytes (NFK)

    International Nuclear Information System (INIS)

    Senthilkumar, P.K.; Robertson, L.W.; Ludewig, G.

    2012-01-01

    Polychlorinated biphenyls (PCBs), ubiquitous environmental pollutants, are characterized by long term-persistence in the environment, bioaccumulation, and biomagnification in the food chain. Exposure to PCBs may cause various diseases, affecting many cellular processes. Deregulation of the telomerase and the telomere complex leads to several biological disorders. We investigated the hypothesis that PCB153 modulates telomerase activity, telomeres and reactive oxygen species resulting in the deregulation of cell growth. Exponentially growing immortal human skin keratinocytes (HaCaT) and normal human foreskin keratinocytes (NFK) were incubated with PCB153 for 48 and 24 days, respectively, and telomerase activity, telomere length, superoxide level, cell growth, and cell cycle distribution were determined. In HaCaT cells exposure to PCB153 significantly reduced telomerase activity, telomere length, cell growth and increased intracellular superoxide levels from day 6 to day 48, suggesting that superoxide may be one of the factors regulating telomerase activity, telomere length and cell growth compared to untreated control cells. Results with NFK cells showed no shortening of telomere length but reduced cell growth and increased superoxide levels in PCB153-treated cells compared to untreated controls. As expected, basal levels of telomerase activity were almost undetectable, which made a quantitative comparison of treated and control groups impossible. The significant down regulation of telomerase activity and reduction of telomere length by PCB153 in HaCaT cells suggest that any cell type with significant telomerase activity, like stem cells, may be at risk of premature telomere shortening with potential adverse health effects for the affected organism. -- Highlights: ► Human immortal (HaCaT) and primary (NFK) keratinocytes were exposed to PCB153. ► PCB153 significantly reduced telomerase activity and telomere length in HaCaT. ► No effect on telomere length and

  15. Antioxidant Opuntia ficus-indica Extract Activates AHR-NRF2 Signaling and Upregulates Filaggrin and Loricrin Expression in Human Keratinocytes.

    Science.gov (United States)

    Nakahara, Takeshi; Mitoma, Chikage; Hashimoto-Hachiya, Akiko; Takahara, Masakazu; Tsuji, Gaku; Uchi, Hiroshi; Yan, Xianghong; Hachisuka, Junichi; Chiba, Takahito; Esaki, Hitokazu; Kido-Nakahara, Makiko; Furue, Masutaka

    2015-10-01

    Opuntia ficus-indica (OFI) is a cactus species widely used as an anti-inflammatory, antilipidemic, and hypoglycemic agent. It has been shown that OFI extract (OFIE) inhibits oxidative stress in animal models of diabetes and hepatic disease; however, its antioxidant mechanism remains largely unknown. In this study, we demonstrated that OFIE exhibited potent antioxidant activity through the activation of nuclear factor erythroid 2-related factor 2 (NRF2) and the downstream antioxidant enzyme quinone oxidoreductase 1 (NQO1), which inhibited the generation of reactive oxygen species in keratinocytes challenged with tumor necrosis factor α or benzo[α]pyrene. The antioxidant capacity of OFIE was canceled in NRF2 knockdown keratinocytes. OFIE exerted this NRF2-NQO1 upregulation through activation of the aryl hydrocarbon receptor (AHR). Moreover, the ligation of AHR by OFIE upregulated the expression of epidermal barrier proteins: filaggrin and loricrin. OFIE also prevented TH2 cytokine-mediated downregulation of filaggrin and loricrin expression in an AHR-dependent manner because it was canceled in AHR knockdown keratinocytes. Antioxidant OFIE is a potent activator of AHR-NRF2-NQO1 signaling and may be beneficial in treating barrier-disrupted skin disorders.

  16. Ultraviolet radiation induction of ornithine decarboxylase in rat keratinocytes

    International Nuclear Information System (INIS)

    Rosen, C.F.; Gajic, D.; Drucker, D.J.

    1990-01-01

    UV radiation plays an important role in the induction of cutaneous malignancy, including basal cell and squamous cell carcinomas and malignant melanoma. In addition to its effects on DNA damage and repair mechanisms, UV radiation has been shown to modulate the expression of specific genes, altering the levels of their mRNAs and the synthesis of their corresponding proteins. In order to gain further information about the molecular effects of UV radiation, we have studied the regulation of ornithine decarboxylase (ODC) gene expression in response to UVB radiation. ODC is the rate-limiting enzyme in polyamine biosynthesis, is involved in growth and differentiation, and has been implicated in carcinogenesis. Keratinocytes grown in culture were either sham-irradiated or exposed to increasing doses of UVB (1-5 mJ/cm2). Northern blot analysis of keratinocyte RNA under basal conditions demonstrated the presence of two ODC mRNA transcripts. Increasing exposure to UVB resulted in a dose-dependent increase in the levels of both ODC mRNA transcripts. The induction of ODC gene expression following UVB was noted 2 h after UVB exposure, and ODC mRNA levels continued to increase up to 24 h after UVB exposure. The UVB-induced increase in ODC gene expression was not serum dependent, despite the ability of serum alone to induce ODC gene expression. The mRNA transcripts for actin and hexosaminidase A were not induced after UVB exposure. These studies show that the UVB-induced increase in ODC activity is due, at least in part, to an increase in ODC gene expression and they provide a useful model for the analysis of the molecular effects of UVB radiation

  17. Ultraviolet radiation induction of ornithine decarboxylase in rat keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Rosen, C.F.; Gajic, D.; Drucker, D.J. (Women' s College Hospital, Toronto, Ontario (Canada))

    1990-05-01

    UV radiation plays an important role in the induction of cutaneous malignancy, including basal cell and squamous cell carcinomas and malignant melanoma. In addition to its effects on DNA damage and repair mechanisms, UV radiation has been shown to modulate the expression of specific genes, altering the levels of their mRNAs and the synthesis of their corresponding proteins. In order to gain further information about the molecular effects of UV radiation, we have studied the regulation of ornithine decarboxylase (ODC) gene expression in response to UVB radiation. ODC is the rate-limiting enzyme in polyamine biosynthesis, is involved in growth and differentiation, and has been implicated in carcinogenesis. Keratinocytes grown in culture were either sham-irradiated or exposed to increasing doses of UVB (1-5 mJ/cm2). Northern blot analysis of keratinocyte RNA under basal conditions demonstrated the presence of two ODC mRNA transcripts. Increasing exposure to UVB resulted in a dose-dependent increase in the levels of both ODC mRNA transcripts. The induction of ODC gene expression following UVB was noted 2 h after UVB exposure, and ODC mRNA levels continued to increase up to 24 h after UVB exposure. The UVB-induced increase in ODC gene expression was not serum dependent, despite the ability of serum alone to induce ODC gene expression. The mRNA transcripts for actin and hexosaminidase A were not induced after UVB exposure. These studies show that the UVB-induced increase in ODC activity is due, at least in part, to an increase in ODC gene expression and they provide a useful model for the analysis of the molecular effects of UVB radiation.

  18. Piperine attenuates UV-R induced cell damage in human keratinocytes via NF-kB, Bax/Bcl-2 pathway: An application for photoprotection.

    Science.gov (United States)

    Verma, Ankit; Kushwaha, Hari N; Srivastava, Ajeet K; Srivastava, Saumya; Jamal, Naseem; Srivastava, Kriti; Ray, Ratan Singh

    2017-07-01

    Chronic ultraviolet radiation (UV-R) exposure causes skin disorders like erythema, edema, hyperpigmentation, photoaging and photocarcinogenesis. Recent research trends of researchers have focused more attention on the identification and use of photo stable natural agents with photoprotective properties. Piperine (PIP), as a plant alkaloid, is an important constituent present in black pepper (Piper nigrum), used widely in ayurvedic and other traditional medicines and has broad pharmacological properties. The study was planned to photoprotective efficacy of PIP in human keratinocyte (HaCaT) cell line. We have assessed the UV-R induced activation of transcription factor NF-κB in coordination with cell death modulators (Bax/Bcl-2 and p21). The LC-MS/MS analysis revealed that PIP was photostable under UV-A/UV-B exposure. PIP (10μg/ml) attenuates the UV-R (A and B) induced phototoxicity of keratinocyte cell line through the restoration of cell viability, inhibition of ROS, and malondialdehyde generation. Further, PIP inhibited UV-R mediated DNA damage, prevented micronuclei formation, and reduced sub-G1 phase in cell cycle, which supported against photogenotoxicity. This study revealed that PIP pretreatment strongly suppressed UV-R induced photodamages. Molecular docking studies suggest that PIP binds at the active site of NF-κB, and thus, preventing its translocation to nucleus. In addition, transcriptional and translational analysis advocate the increased expression of NF-κB and concomitant decrease in IkB-α expression under UV-R exposed cells, favouring the apoptosis via Bax/Bcl-2 and p21 pathways. However, PIP induced expression of IkB-α suppress the NF-κB activity which resulted in suppression of apoptotic marker genes and proteins that involved in photoprotection. Therefore, we suggest the applicability of photostable PIP as photoprotective agent for human use. Copyright © 2017. Published by Elsevier B.V.

  19. Molecular cloning and expression of a novel keratinocyte protein (psoriasis-associated fatty acid-binding protein [PA-FABP]) that is highly up-regulated in psoriatic skin and that shares similarity to fatty acid-binding proteins

    DEFF Research Database (Denmark)

    Madsen, Peder; Rasmussen, H H; Leffers, H

    1992-01-01

    termed PA-FABP (psoriasis-associated fatty acid-binding protein). The deduced sequence predicted a protein with molecular weight of 15,164 daltons and a calculated pI of 6.96, values that are close to those recorded in the keratinocyte 2D gel protein database. The protein comigrated with PA-FABP...... as determined by 2D gel analysis of [35S]-methionine-labeled proteins expressed by transformed human amnion (AMA) cells transfected with clone 1592 using the vaccinia virus expression system and reacted with a rabbit polyclonal antibody raised against 2D gel purified PA-FABP. Structural analysis of the amino...... acid sequence revealed 48%, 52%, and 56% identity to known low-molecular-weight fatty acid-binding proteins belonging to the FABP family. Northern blot analysis showed that PA-FABP mRNA is indeed highly up-regulated in psoriatic keratinocytes. The transcript is present in human cell lines of epithelial...

  20. The E5 protein of human papillomavirus type 16 perturbs MHC class II antigen maturation in human foreskin keratinocytes treated with interferon-γ

    International Nuclear Information System (INIS)

    Zhang Benyue; Li Ping; Wang Exing; Brahmi, Zacharie; Dunn, Kenneth W.; Blum, Janice S.; Roman, Ann

    2003-01-01

    Major histocompatibility complex (MHC) class II antigens are expressed on human foreskin keratinocytes (HFKs) following exposure to interferon gamma. The expression of MHC class II proteins on the cell surface may allow keratinocytes to function as antigen-presenting cells and induce a subsequent immune response to virus infection. Invariant chain (Ii) is a chaperone protein which plays an important role in the maturation of MHC class II molecules. The sequential degradation of Ii within acidic endocytic compartments is a key process required for the successful loading of antigenic peptide onto MHC class II molecules. Since human papillomavirus (HPV) 16 E5 can inhibit the acidification of late endosomes in HFKs, the E5 protein may be able to affect proper peptide loading onto the MHC class II molecule. To test this hypothesis, HFKs were infected with either control virus or a recombinant virus expressing HPV16 E5 and the infected cells were subsequently treated with interferon-γ. ELISAs revealed a decrease of MHC class II expression on the surface of E5-expressing cells compared with control virus-infected cells after interferon treatment. Western blot analysis showed that, in cells treated with interferon gamma, E5 could prevent the breakdown of Ii and block the formation of peptide-loaded, SDS-stable mature MHC class II dimers, correlating with diminished surface MHC class II expression. These data suggest that HPV16 E5 may be able to decrease immune recognition of infected keratinocytes via disruption of MHC class II protein function

  1. MicroRNA-17-92 cluster promotes the proliferation and the chemokine production of keratinocytes: implication for the pathogenesis of psoriasis.

    Science.gov (United States)

    Zhang, Weigang; Yi, Xiuli; An, Yawen; Guo, Sen; Li, Shuli; Song, Pu; Chang, Yuqian; Zhang, Shaolong; Gao, Tianwen; Wang, Gang; Li, Chunying

    2018-05-11

    Keratinocytes are the main epidermal cell type that constitutes the skin barrier against environmental damages, which emphasizes the balance between the growth and the death of keratinocytes in maintaining skin homeostasis. Aberrant proliferation of keratinocytes and the secretion of inflammatory factors from keratinocytes are related to the formation of chronic inflammatory skin diseases like psoriasis. MicroRNA-17-92 (miRNA-17-92 or miR-17-92) is a miRNA cluster that regulates cell growth and immunity, but the role of miR-17-92 cluster in keratinocytes and its relation to skin diseases have not been well investigated. In the present study, we initially found that miR-17-92 cluster promoted the proliferation and the cell-cycle progression of keratinocytes via suppressing cyclin-dependent kinase inhibitor 2B (CDKN2B). Furthermore, miR-17-92 cluster facilitated the secretion of C-X-C motif chemokine ligand 9 (CXCL9) and C-X-C motif chemokine ligand 10 (CXCL10) from keratinocytes by inhibiting suppressor of cytokine signaling 1 (SOCS1), which enhanced the chemotaxis for T lymphocytes formed by keratinocytes. In addition, we detected increased expression of miR-17-92 cluster in psoriatic lesions and the level of lesional miR-17-92 cluster was positively correlated with the disease severity in psoriasis patients. At last, miR-17-92 cluster was increased in keratinocytes by cytokines through the activation of signal transducers and activators of transcription 1 (STAT1) signaling pathway. Our findings demonstrate that cytokine-induced overexpression of miR-17-92 cluster can promote the proliferation and the immune function of keratinocytes, and thus may contribute to the development of inflammatory skin diseases like psoriasis, which implicates miR-17-92 cluster as a potential therapeutic target for psoriasis and other skin diseases with similar inflammatory pathogenesis.

  2. Re-appraisal of keratinocytes' role in vitiligo pathogenesis

    Directory of Open Access Journals (Sweden)

    Ola Ahmed Bakry

    2018-01-01

    Full Text Available Background: Vitiligo is a common pigmentary disorder. Studies on its pathogenesis extensively investigated melanocytes' abnormalities and few studies searched for keratinocytes' role in disease development. Liver X receptor-α (LXR-α is a member of nuclear hormone receptors that acts as a transcription factor. Its target genes are the main regulators of melanocyte functions. Aim: The aim of this study is to investigate keratinocytes' role in vitiligo pathogenesis through immunohistochemical expression of LXR-α in lesional, perilesional, and distant nonlesional vitiligo skin. Materials and Methods: This case–control study was carried out on 44 participants. These included 24 patients with vitiligo and 20 age- and sex-matched normal individuals as a control group. Biopsies, from cases, were taken from lesional, perilesional, and distant nonlesional areas. Evaluation was done using immunohistochemical technique. Results: Keratinocyte LXR-α expression was upregulated in the lesional and perilesional skin (follicular and interfollicular epidermis compared with control skin (P<0.001 for all. There was significant association between higher histoscore (H-score in lesional epidermis (P<0.001 and in hair follicle (P=0.001 and the presence of angiogenesis. There was significant association between higher H-score in lesional epidermis and suprabasal vacuolization (P=0.02. No significant association was found between H-score or expression percentage and clinical data of selected cases. Conclusion: LXR-α upregulation is associated with keratinocyte damage in vitiligo lesional skin that leads to decreased keratinocyte-derived mediators and growth factors supporting the growth and/or melanization of surrounding melanocytes. Therefore, melanocyte function and survival are affected.

  3. Cloning, expression, and chromosome mapping of human galectin-7

    DEFF Research Database (Denmark)

    Madsen, Peder; Rasmussen, H H; Flint, T

    1995-01-01

    The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. Here we report the cloning and expression of a novel member of this family (galectin-7) that correspond to IEF (isoelectric focusing) 17 (12,700 Da; pI, 7.6) in the human...... keratinocyte protein data base, and that is strikingly down-regulated in SV40 transformed keratinocytes (K14). The cDNA was cloned from a lambda gt11 cDNA expression library using degenerated oligodeoxyribonucleotides back-translated from an IEF 17 peptide sequence. The protein encoded by the galectin-7 clone......14 keratinocytes imply a role in cell-cell and/or cell-matrix interactions necessary for normal growth control. The galectin-7 gene was mapped to chromosome 19. Udgivelsesdato: 1995-Mar-17...

  4. Deletion of the N-terminus of IKKγ induces apoptosis in keratinocytes and impairs the AKT/PTEN signaling pathway

    International Nuclear Information System (INIS)

    Leis, Hugo; Sanchis, Ana; Perez, Paloma

    2007-01-01

    The regulatory subunit IKKγ/NEMO is crucial for skin development and function and although devoid of kinase activity, loss of IKKγ function completely abolishes the activation of NF-κB by all pro-inflammatory cytokines. To inhibit the IκB kinase (IKK) complex in keratinocytes, we have used a dominant negative approach by generating stable transfectants of an N-terminal deletion of IKKγ (IKKγ-DN97) that uncouples formation of the IKK complex. Expression of this mutant in PB keratinocytes (PB-IKKγ-DN97) delayed growth kinetics, caused morphological changes and dramatically augmented apoptosis even in the absence of pro-apoptotic stimuli, as determined by cell morphology, TUNEL and caspase-3 cleavage. Moreover, in PB-IKKγ-DN97 cells, TNF-α and IL-1 treatment failed to induce degradation of IκBα, phosphorylation of p65 on Ser 536 and nuclear translocation which, consequently, reduced κB-binding activity. In PB-IKKγ-DN97 cells, accumulation of IκBα correlated with a downregulation of AKT activity and an increase of PTEN protein levels whereas pro-apoptotic p53 target genes Bax and Puma were upregulated. These effects were most likely mediated through IKK since coexpression of the wild-type form of IKKγ in keratinocytes partially reversed apoptosis and reduced PTEN expression. Thus, our data suggest a negative cross-talk mechanism involving PTEN and NF-κB, critical for the anti-apoptotic role of NF-κB in keratinocytes

  5. Mesenchymal stem cell-conditioned medium accelerates skin wound healing: An in vitro study of fibroblast and keratinocyte scratch assays

    International Nuclear Information System (INIS)

    Walter, M.N.M.; Wright, K.T.; Fuller, H.R.; MacNeil, S.; Johnson, W.E.B.

    2010-01-01

    We have used in vitro scratch assays to examine the relative contribution of dermal fibroblasts and keratinocytes in the wound repair process and to test the influence of mesenchymal stem cell (MSC) secreted factors on both skin cell types. Scratch assays were established using single cell and co-cultures of L929 fibroblasts and HaCaT keratinocytes, with wound closure monitored via time-lapse microscopy. Both in serum supplemented and serum free conditions, wound closure was faster in L929 fibroblast than HaCaT keratinocyte scratch assays, and in co-culture the L929 fibroblasts lead the way in closing the scratches. MSC-CM generated under serum free conditions significantly enhanced the wound closure rate of both skin cell types separately and in co-culture, whereas conditioned medium from L929 or HaCaT cultures had no significant effect. This enhancement of wound closure in the presence of MSC-CM was due to accelerated cell migration rather than increased cell proliferation. A number of wound healing mediators were identified in MSC-CM, including TGF-β1, the chemokines IL-6, IL-8, MCP-1 and RANTES, and collagen type I, fibronectin, SPARC and IGFBP-7. This study suggests that the trophic activity of MSC may play a role in skin wound closure by affecting both dermal fibroblast and keratinocyte migration, along with a contribution to the formation of extracellular matrix.

  6. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

    International Nuclear Information System (INIS)

    Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

    2014-01-01

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

  7. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Sun Hee [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of); Choi, Dalwoong [Department of Public Health Science, Korea University, Seoul 136-701 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2014-10-15

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

  8. Inhibitors of cysteine cathepsin and calpain do not prevent ultraviolet-B-induced apoptosis in human keratinocytes and HeLa cells

    DEFF Research Database (Denmark)

    Bang, Bo; Baadsgaard, Ole; Skov, Lone

    2004-01-01

    been demonstrated to play a role in the execution of programmed cell death induced by other stimuli, e.g. TNF-alpha. The purpose of the present study was therefore to investigate whether inhibitors of cysteine cathepsins and calpains could prevent UVB-induced apoptosis in HeLa cells and keratinocytes....... This was done by investigating the effect of the irreversible cysteine protease inhibitor zFA-fmk, the cathepsin B inhibitor CA-074-Me and the calpain inhibitor ALLN on the viability of UVB-irradiated human keratinocytes and HeLa cells. At concentrations of 10 microM and above zVAD-fmk conferred partial dose......-dependent protection against UVB-induced apoptosis in HeLa cells and keratinocytes. Moreover, caspase-3 activity was completely blocked at zVAD-fmk concentrations of 1 microM in HeLa cells. This indicates that caspase-independent mechanisms could be involved in UVB-induced apoptosis. However, the protease inhibitors z...

  9. Gelatin for purification and proliferation of primary keratinocyte culture for use in chronic wounds and burns.

    Science.gov (United States)

    Rahsaz, Marjan; Geramizadeh, Bita; Kaviani, Maryam; Marzban, Saeed

    2015-04-01

    Human epidermal keratinocytes are currently established as a treatment for burns and wounds and have laboratory applications. Keratinocyte culture contamination by unwanted cells and inhibition of cell proliferation are barriers in primary keratinocyte culture. According to the recent literature, these cells are hard to culture. The present study was conducted to evaluate the efficacy of gelatin-coated surfaces in keratinocyte cultures. After enzymatic isolation of keratinocytes from normal epidermis by trypsin, the cells were cultured on gelatin-coated flasks in serum-free medium. Another group of cells were cultured as a control group without gelatin coating. We showed positive effects of surface coating with gelatin on the primary culture of keratinocytes. Culture of these cells on a gelatincoated surface showed better proliferation with suitable morphology. By using gelatin, adhesion of these cells to the surface was more efficient and without contamination by small round cells. Successful primary culture of keratinocytes on a gelatin-coated surface may provide better yield and optimal number of cells for research and clinical applications.

  10. Amniotic Membrane Modifies the Genetic Program Induced by TGFß, Stimulating Keratinocyte Proliferation and Migration in Chronic Wounds.

    Directory of Open Access Journals (Sweden)

    Antonia Alcaraz

    Full Text Available Post-traumatic large-surface or deep wounds often cannot progress to reepithelialisation because they become irresponsive in the inflammatory stage, so intervention is necessary to provide the final sealing epidermis. Previously we have shown that Amniotic Membrane (AM induced a robust epithelialisation in deep traumatic wounds.To better understand this phenomenon, we used keratinocytes to investigate the effect of AM on chronic wounds. Using keratinocytes, we saw that AM treatment is able to exert an attenuating effect upon Smad2 and Smad3 TGFß-induced phosphorylation while triggering the activation of several MAPK signalling pathways, including ERK and JNK1, 2. This also has a consequence for TGFß-induced regulation on cell cycle control key players CDK1A (p21 and CDK2B (p15. The study of a wider set of TGFß regulated genes showed that the effect of AM was not wide but very concrete for some genes. TGFß exerted a powerful cell cycle arrest; the presence of AM however prevented TGFß-induced cell cycle arrest. Moreover, AM induced a powerful cell migration response that correlates well with the expression of c-Jun protein at the border of the healing assay. Consistently, the treatment with AM of human chronic wounds induced a robust expression of c-Jun at the wound border.The effect of AM on the modulation of TGFß responses in keratinocytes that favours proliferation together with AM-induced keratinocyte migration is the perfect match that allows chronic wounds to move on from their non-healing state and progress into epithelialization. Our results may explain why the application of AM on chronic wounds is able to promote epithelialisation.

  11. Photodynamic toxicity of hematoporphyrin derivatives to human keratinocytes in culture.

    Science.gov (United States)

    Kappus, H; Reinhold, C; Artuc, M

    Human keratinocytes in culture were able to take up hematoporphyrin derivatives (HPDs) used during photodynamic chemotherapy of tumors. In the absence of light, HPDs showed no cytotoxic effects to keratinocytes. However, after irradiation with visible light, HPDs induced immediate cytotoxicity as measured by the neutral red uptake assay. On the other hand, cell attachment as measured by protein estimation was not affected. When the cells treated with HPDs and irradiated with light were cultured for a further 72 h, they partially lost their ability to attach to the collagen surface. Most of the cells remaining attached after 72 h were no longer viable following treatment with HPDs and light. All parameters measured depended on the intracellular concentration of HPDs used (7-50 ng/10(5) cells) and the time of irradiation (0-30 min). These results suggest that human keratinocytes are a good model to study cytotoxic effects of photodynamically active drugs. Further, keratinocytes were unable to recover after damage caused by HPDs and light.

  12. The peanut lectin-binding glycoproteins of human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Morrison, A.I.; Keeble, S.; Watt, F.M.

    1988-01-01

    The peanut lectin (PNA) is known to bind more strongly to keratinocytes that are undergoing terminal differentiation than to proliferating keratinocytes. In order to investigate the significance of this change in cell-surface carbohydrate authors have identified the PNA-binding glycoproteins of cultured human keratinocytes and antibodies against them. Two heavily glycosylated bands of 110 and 250 kDa were resolved by PAGE of [ 14 C]galactose- or [ 14 C]mannose- and [ 14 C]glucosamine-labeled cell extracts eluted with galactose from PNA affinity columns. The higher molecular weight band was also detected on PNA blots of unlabeled cell extracts transferred to nitrocellulose. Both bands were sensitive to pronase digestion, but only the 250-kDa band was digested with trypsin. A rabbit antiserum that we prepared (anti-PNA-gp) immunoprecipitated both bands from cell extracts. In contrast to PNA, anti-PNA-gp bound equally to proliferating and terminally differentiating cells, indicating that some epitope(s) of the PNA-binding glycoproteins is present on the cell surface prior to terminal differentiation. When keratinocytes grown as a monolayer in low-calcium medium were switched to medium containing 2 mM calcium ions in order to induce desmosome formation and stratification, there was a dramatic redistribution of the PNA-binding glycoproteins, which became concentrated at the boundaries between cells. This may suggest a role for the glycoproteins in cell-cell interactions during stratification

  13. Integrin-linked kinase and ELMO2 modulate recycling endosomes in keratinocytes.

    Science.gov (United States)

    Ho, Ernest; Ivanova, Iordanka A; Dagnino, Lina

    2016-12-01

    The formation of tight cell-cell junctions is essential in the epidermis for its barrier properties. In this tissue, keratinocytes follow a differentiation program tightly associated with their movement from the innermost basal to the outer suprabasal layers, and with changes in their cell-cell adhesion profile. Intercellular adhesion in keratinocytes is mediated through cell-cell contacts, including E-cadherin-based adherens junctions. Although the mechanisms that mediate E-cadherin delivery to the plasma membrane have been widely studied in simple epithelia, this process is less well understood in the stratified epidermis. In this study, we have investigated the role of Engulfment and Cell Motility 2 (ELMO2) and integrin-linked kinase (ILK) in the positioning of E-cadherin-containing recycling endosomes during establishment of cell-cell contacts in differentiating keratinocytes. We now show that induction of keratinocyte differentiation by Ca 2+ is accompanied by localization of ELMO2 and ILK to Rab4- and Rab11a-containing recycling endosomes. The positioning of long-loop Rab11a-positive endosomes at areas adjacent to cell-cell contacts is disrupted in ELMO2- or ILK-deficient keratinocytes, and is associated with impaired localization of E-cadherin to cell borders. Our studies show a previously unrecognized role for ELMO2 and ILK in modulation of endosomal positioning, which may play key roles in epidermal sheet maintenance and permeability barrier function. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Development of a keratinocyte-based screening model for antipsoriatic drugs using green fluorescent protein under the control of an endogenous promoter.

    Science.gov (United States)

    Pol, Arno; van Ruissen, Fred; Schalkwijk, Joost

    2002-08-01

    Inflamed epidermis (psoriasis, wound healing, ultraviolet-irradiated skin) harbors keratinocytes that are hyperproliferative and display an abnormal differentiation program. A distinct feature of this so-called regenerative maturation pathway is the expression of proteins such as the cytokeratins CK6, CK16, and CK17 and the antiinflammatory protein SKALP/elafin. These proteins are absent in normal skin but highly induced in lesional psoriatic skin. Expression of these genes can be used as a surrogate marker for psoriasis in drug-screening procedures of large compound libraries. The aim of this study was to develop a keratinocyte cell line that contained a reporter gene under the control of a psoriasis-associated endogenous promoter and demonstrate its use in an assay suitable for screening. We generated a stably transfected keratinocyte cell line that expresses enhanced green fluorescent protein (EGFP), under the control of a 0.8-kb fragment derived from the promoter of the SKALP/elafin gene, which confers high levels of tissue-specific expression at the mRNA level. Induction of the SKALP promoter by tumor necrosis factor-alpha resulted in increased expression levels of the secreted SKALP-EGFP fusion protein as assessed by direct readout of fluorescence and fluorescence polarization in 96-well cell culture plates. The fold stimulation of the reporter gene was comparable to that of the endogenous SKALP gene as assessed by enzyme-linked immunosorbent assay. Although the dynamic range of the screening system is limited, the small standard deviation yields a Z factor of 0.49. This indicates that the assay is suitable as a high-throughput screen, and provides proof of the concept that a secreted EGFP fusion protein under the control of a physiologically relevant endogenous promoter can be used as a fluorescence-based high-throughput screen for differentiation-modifying or antiinflammatory compounds that act via the keratinocyte.

  15. Tumor necrosis factor beta and ultraviolet radiation are potent regulators of human keratinocyte ICAM-1 expression

    International Nuclear Information System (INIS)

    Krutmann, J.; Koeck, A.S.; Schauer, E.; Parlow, F.; Moeller, A.K.; Kapp, A.; Foerster, E.S.; Schoepf, E.L.; Luger, T.A.

    1990-01-01

    Intercellular adhesion molecule-1 (ICAM-1) functions as a ligand of leukocyte function-associated antigen-1 (LFA-1), as well as a receptor for human picorna virus, and its regulation thus affects various immunologic and inflammatory reactions. The weak, constitutive ICAM-1 expression on human keratinocytes (KC) can be up-regulated by cytokines such as interferon-gamma (IFN gamma) and tumor necrosis factor alpha (TNF alpha). In order to further examine the regulation of KC ICAM-1 expression, normal human KC or epidermoid carcinoma cells (KB) were incubated with different cytokines and/or exposed to ultraviolet (UV) radiation. Subsequently, ICAM-1 expression was monitored cytofluorometrically using a monoclonal anti-ICAM-1 antibody. Stimulation of cells with recombinant human (rh) interleukin (IL) 1 alpha, rhIL-4, rhIL-5, rhIL-6, rh granulocyte/macrophage colony-stimulating factor (GM-CSF), rh interferon alpha (rhIFN alpha), and rh transforming growth factor beta (TGF beta) did not increase ICAM-1 surface expression. In contrast, rhTNF beta significantly up-regulated ICAM-1 expression in a time- and dose-dependent manner. Moreover, the combination of rhTNF beta with rhIFN gamma increased the percentage of ICAM-1-positive KC synergistically. This stimulatory effect of rhTNF beta was further confirmed by the demonstration that rhTNF beta was capable of markedly enhancing ICAM-1 mRNA expression in KC. Finally, exposure of KC in vitro to sublethal doses of UV radiation (0-100 J/m2) prior to cytokine (rhIFN tau, rhTNF alpha, rhTNF beta) stimulation inhibited ICAM-1 up-regulation in a dose-dependent fashion. These studies identify TNF beta and UV light as potent regulators of KC ICAM-1 expression, which may influence both attachment and detachment of leukocytes and possibly viruses to KC

  16. Abnormalities in the basement membrane structure promote basal keratinocytes in the epidermis of hypertrophic scars to adopt a proliferative phenotype.

    Science.gov (United States)

    Yang, Shaowei; Sun, Yexiao; Geng, Zhijun; Ma, Kui; Sun, Xiaoyan; Fu, Xiaobing

    2016-05-01

    The majority of studies on scar formation have mainly focused on the dermis and little is known of the involvement of the epidermis. Previous research has demonstrated that the scar tissue-derived keratinocytes are different from normal cells at both the genetic and cell biological levels; however, the mechanisms responsible for the fundamental abnormalities in keratinocytes during scar development remain elusive. For this purpose, in this study, we used normal, wound edge and hypertrophic scar tissue to examine the morphological changes which occur during epidermal regeneration as part of the wound healing process and found that the histological structure of hypertrophic scar tissues differed from that of normal skin, with a significant increase in epidermal thickness. Notably, staining of the basement membrane (BM) appeared to be absent in the scar tissues. Moreover, immunofluorescence staining for cytokeratin (CK)10, CK14, CK5, CK19 and integrin-β1 indicated the differential expression of cell markers in the epidermal keratinocytes among the normal, wound edge and hypertrophic scar tissues, which corresponded with the altered BM structures. By using a panel of proteins associated with BM components, we validated our hypothesis that the BM plays a significant role in regulating the cell fate decision of epidermal keratinocytes during skin wound healing. Alterations in the structure of the BM promote basal keratinocytes to adopt a proliferative phenotype both in vivo and in vitro.

  17. Cortactin involvement in the keratinocyte growth factor and fibroblast growth factor 10 promotion of migration and cortical actin assembly in human keratinocytes

    International Nuclear Information System (INIS)

    Ceccarelli, Simona; Cardinali, Giorgia; Aspite, Nicaela; Picardo, Mauro; Marchese, Cinzia; Torrisi, Maria Rosaria; Mancini, Patrizia

    2007-01-01

    Keratinocyte growth factor (KGF/FGF7) and fibroblast growth factor 10 (FGF10/KGF2) regulate keratinocyte proliferation and differentiation by binding to the tyrosine kinase KGF receptor (KGFR). KGF induces keratinocyte motility and cytoskeletal rearrangement, whereas a direct role of FGF10 on keratinocyte migration is not clearly established. Here we analyzed the motogenic activity of FGF10 and KGF on human keratinocytes. Migration assays and immunofluorescence of actin cytoskeleton revealed that FGF10 is less efficient than KGF in promoting migration and exerts a delayed effect in inducing lamellipodia and ruffles formation. Both growth factors promoted phosphorylation and subsequent membrane translocation of cortactin, an F-actin binding protein involved in cell migration; however, FGF10-induced cortactin phosphorylation was reduced, more transient and delayed with respect to that promoted by KGF. Cortactin phosphorylation induced by both growth factors was Src-dependent, while its membrane translocation and cell migration were blocked by either Src and PI3K inhibitors, suggesting that both pathways are involved in KGF- and FGF10-dependent motility. Furthermore, siRNA-mediated downregulation of cortactin inhibited KGF- and FGF10-induced migration. These results indicate that cortactin is involved in keratinocyte migration promoted by both KGF and FGF10

  18. Chimeric Human Skin Substitute Tissue: A Novel Treatment Option for the Delivery of Autologous Keratinocytes.

    Science.gov (United States)

    Rasmussen, Cathy A; Allen-Hoffmann, B Lynn

    2012-04-01

    For patients suffering from catastrophic burns, few treatment options are available. Chimeric coculture of patient-derived autologous cells with a "carrier" cell source of allogeneic keratinocytes has been proposed as a means to address the complex clinical problem of severe skin loss. Currently, autologous keratinocytes are harvested, cultured, and expanded to form graftable epidermal sheets. However, epidermal sheets are thin, are extremely fragile, and do not possess barrier function, which only develops as skin stratifies and matures. Grafting is typically delayed for up to 4 weeks to propagate a sufficient quantity of the patient's cells for application to wound sites. Fully stratified chimeric bioengineered skin substitutes could not only provide immediate wound coverage and restore barrier function, but would simultaneously deliver autologous keratinocytes to wounds. The ideal allogeneic cell source for this application would be an abundant supply of clinically evaluated, nontumorigenic, pathogen-free, human keratinocytes. To evaluate this potential cell-based therapy, mixed populations of a green fluorescent protein-labeled neonatal human keratinocyte cell line (NIKS) and unlabeled primary keratinocytes were used to model the allogeneic and autologous components of chimeric monolayer and organotypic cultures. Relatively few autologous keratinocytes may be required to produce fully stratified chimeric skin substitute tissue substantially composed of autologous keratinocyte-derived regions. The need for few autologous cells interspersed within an allogeneic "carrier" cell population may decrease cell expansion time, reducing the time to patient application. This study provides proof of concept for utilizing NIKS keratinocytes as the allogeneic carrier for the generation of bioengineered chimeric skin substitute tissues capable of providing immediate wound coverage while simultaneously supplying autologous human cells for tissue regeneration.

  19. Selenoproteins are essential for proper keratinocyte function and skin development.

    Directory of Open Access Journals (Sweden)

    Aniruddha Sengupta

    2010-08-01

    Full Text Available Dietary selenium is known to protect skin against UV-induced damage and cancer and its topical application improves skin surface parameters in humans, while selenium deficiency compromises protective antioxidant enzymes in skin. Furthermore, skin and hair abnormalities in humans and rodents may be caused by selenium deficiency, which are overcome by dietary selenium supplementation. Most important biological functions of selenium are attributed to selenoproteins, proteins containing selenium in the form of the amino acid, selenocysteine (Sec. Sec insertion into proteins depends on Sec tRNA; thus, knocking out the Sec tRNA gene (Trsp ablates selenoprotein expression. We generated mice with targeted removal of selenoproteins in keratin 14 (K14 expressing cells and their differentiated descendents. The knockout progeny had a runt phenotype, developed skin abnormalities and experienced premature death. Lack of selenoproteins in epidermal cells led to the development of hyperplastic epidermis and aberrant hair follicle morphogenesis, accompanied by progressive alopecia after birth. Further analyses revealed that selenoproteins are essential antioxidants in skin and unveiled their role in keratinocyte growth and viability. This study links severe selenoprotein deficiency to abnormalities in skin and hair and provides genetic evidence for the role of these proteins in keratinocyte function and cutaneous development.

  20. Keratinocyte proliferation, differentiation, and apoptosis-Differential mechanisms of regulation by curcumin, EGCG and apigenin

    International Nuclear Information System (INIS)

    Balasubramanian, Sivaprakasam; Eckert, Richard L.

    2007-01-01

    We have proposed that it is important to examine the impact of chemopreventive agents on the function of normal human epidermal keratinocytes since these cells comprise the barrier that protects the body from a range of environmental insults. In this context, it is widely appreciated that cancer may be retarded by consumption or topical application of naturally occurring food-derived chemopreventive agents. Our studies show that (-)-epigallocatechin-3-gallate (EGCG), a green tea-derived polyphenol, acts to enhance the differentiation of normal human keratinocytes as evidenced by its ability to increase involucrin (hINV), transglutaminase type 1 (TG1) and caspase-14 gene expression. EGCG also stimulates keratinocyte morphological differentiation. These actions of EGCG are mediated via activation of a nPKC, Ras, MEKK1, MEK3, p38δ-ERK1/2 signaling cascade which leads to increased activator protein 1 (AP1) and CAATT enhancer binding protein (C/EBP) transcription factor expression, increased binding of these factors to DNA, and increased gene transcription. In contrast, apigenin, a dietary flavonoid derived from plants and vegetables, and curcumin, an agent derived from turmeric, inhibit differentiation by suppressing MAPK signal transduction and reducing API transcription factor level. Curcumin also acts to enhance apoptosis, although EGCG and apigenin do not stimulate apoptosis. In addition, all of these agents inhibit keratinocyte proliferation. These findings indicate that each of these diet-derived chemopreventive agents has a profound impact on normal human keratinocyte function and that they operate via distinct and sometimes opposing mechanisms. However, all are expected to act as chemopreventive agents

  1. Ultra-violet B (UVB)-induced skin cell death occurs through a cyclophilin D intrinsic signaling pathway

    International Nuclear Information System (INIS)

    Ji, Chao; Yang, Bo; Yang, Zhi; Tu, Ying; Yang, Yan-li; He, Li; Bi, Zhi-Gang

    2012-01-01

    Highlights: ► UVB radiated skin keratinocytes show cyclophilin D (Cyp-D) upregulation. ► NAC inhibits UVB induced Cyp-D expression, while H 2 O 2 facilitates it. ► Cyp-D-deficient cells are significantly less susceptible to UVB induced cell death. ► Over-expression of Cyp-D causes spontaneous keratinocytes cell death. -- Abstract: UVB-induced skin cell damage involves the opening of mitochondrial permeability transition pore (mPTP), which leads to both apoptotic and necrotic cell death. Cyclophilin D (Cyp-D) translocation to the inner membrane of mitochondrion acts as a key component to open the mPTP. Our Western-Blot results in primary cultured human skin keratinocytes and in HaCaT cell line demonstrated that UVB radiation and hydrogen peroxide (H 2 O 2 ) induced Cyp-D expression, which was inhibited by anti-oxidant N-acetyl cysteine (NAC). We created a stable Cyp-D deficiency skin keratinocytes by expressing Cyp-D-shRNA through lentiviral infection. Cyp-D-deficient cells were significantly less susceptible than their counterparts to UVB- or H 2 O 2 -induced cell death. Further, cyclosporine A (Cs-A), a Cyp-D inhibitor, inhibited UVB- or H 2 O 2 -induced keratinocytes cell death. Reversely, over-expression of Cyp-D in primary keratinocytes caused spontaneous keratinocytes cell death. These results suggest Cyp-D’s critical role in UVB/oxidative stress-induced skin cell death.

  2. Photon-induced cell migration and integrin expression promoted by DNA integration of HPV16 genome

    International Nuclear Information System (INIS)

    Rieken, Stefan; Simon, Florian; Habermehl, Daniel; Dittmar, Jan Oliver; Combs, Stephanie E.; Weber, Klaus; Debus, Juergen; Lindel, Katja

    2014-01-01

    Persistent human papilloma virus 16 (HPV16) infections are a major cause of cervical cancer. The integration of the viral DNA into the host genome causes E2 gene disruption which prevents apoptosis and increases host cell motility. In cervical cancer patients, survival is limited by local infiltration and systemic dissemination. Surgical control rates are poor in cases of parametrial infiltration. In these patients, radiotherapy (RT) is administered to enhance local control. However, photon irradiation itself has been reported to increase cell motility. In cases of E2-disrupted cervical cancers, this phenomenon would impose an additional risk of enhanced tumor cell motility. Here, we analyze mechanisms underlying photon-increased migration in keratinocytes with differential E2 gene status. Isogenic W12 (intact E2 gene status) and S12 (disrupted E2 gene status) keratinocytes were analyzed in fibronectin-based and serum-stimulated migration experiments following single photon doses of 0, 2, and 10 Gy. Quantitative FACS analyses of integrin expression were performed. Migration and adhesion are increased in E2 gene-disrupted keratinocytes. E2 gene disruption promotes attractability by serum components, therefore, effectuating the risk of local infiltration and systemic dissemination. In S12 cells, migration is further increased by photon RT which leads to enhanced expression of fibronectin receptor integrins. HPV16-associated E2 gene disruption is a main predictor of treatment-refractory cancer virulence. E2 gene disruption promotes cell motility. Following photon RT, E2-disrupted tumors bear the risk of integrin-related infiltration and dissemination. (orig.) [de

  3. The Antimicrobial Peptide Human Beta-Defensin-3 Is Induced by Platelet-Released Growth Factors in Primary Keratinocytes

    Directory of Open Access Journals (Sweden)

    Andreas Bayer

    2017-01-01

    Full Text Available Platelet-released growth factors (PRGF and its related clinically used formulations (e.g., Vivostat Platelet-Rich Fibrin (PRF® contain a variety of chemokines, cytokines, and growth factors and are therefore used to support healing of chronic, hard-to-heal, or infected wounds. Human beta-defensin-3 (hBD-3 is an antimicrobial peptide inducibly expressed in human keratinocytes especially upon wounding. The potent antimicrobial activity of hBD-3 together with its wound closure-promoting activities suggests that hBD-3 may play a crucial role in wound healing. Therefore, we analyzed the influence of PRGF on hBD-3 expression in human primary keratinocytes in vitro. In addition, we investigated the influence of Vivostat PRF on hBD-3 expression in artificially generated human skin wounds in vivo. PRGF treatment of primary keratinocytes induced a significant, concentration- and time-dependent increase in hBD-3 gene expression which was partially mediated by the epidermal growth factor receptor (EGFR. In line with these cell culture data, in vivo experiments revealed an enhanced hBD-3 expression in experimentally produced human wounds after the treatment with Vivostat PRF. Thus, the induction of hBD-3 may contribute to the beneficial effects of thrombocyte concentrate lysates in the treatment of chronic or infected wounds.

  4. The Antimicrobial Peptide Human Beta-Defensin-3 Is Induced by Platelet-Released Growth Factors in Primary Keratinocytes

    Science.gov (United States)

    Lammel, Justus; Tohidnezhad, Mersedeh; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Cremer, Jochen; Jahr, Holger; Rademacher, Franziska; Gläser, Regine; Harder, Jürgen

    2017-01-01

    Platelet-released growth factors (PRGF) and its related clinically used formulations (e.g., Vivostat Platelet-Rich Fibrin (PRF®)) contain a variety of chemokines, cytokines, and growth factors and are therefore used to support healing of chronic, hard-to-heal, or infected wounds. Human beta-defensin-3 (hBD-3) is an antimicrobial peptide inducibly expressed in human keratinocytes especially upon wounding. The potent antimicrobial activity of hBD-3 together with its wound closure-promoting activities suggests that hBD-3 may play a crucial role in wound healing. Therefore, we analyzed the influence of PRGF on hBD-3 expression in human primary keratinocytes in vitro. In addition, we investigated the influence of Vivostat PRF on hBD-3 expression in artificially generated human skin wounds in vivo. PRGF treatment of primary keratinocytes induced a significant, concentration- and time-dependent increase in hBD-3 gene expression which was partially mediated by the epidermal growth factor receptor (EGFR). In line with these cell culture data, in vivo experiments revealed an enhanced hBD-3 expression in experimentally produced human wounds after the treatment with Vivostat PRF. Thus, the induction of hBD-3 may contribute to the beneficial effects of thrombocyte concentrate lysates in the treatment of chronic or infected wounds. PMID:28811680

  5. The control of epidermal stem cells (holoclones) in the treatment of massive full-thickness burns with autologous keratinocytes cultured on fibrin.

    Science.gov (United States)

    Pellegrini, G; Ranno, R; Stracuzzi, G; Bondanza, S; Guerra, L; Zambruno, G; Micali, G; De Luca, M

    1999-09-27

    Cell therapy is an emerging therapeutic strategy aimed at replacing or repairing severely damaged tissues with cultured cells. Epidermal regeneration obtained with autologous cultured keratinocytes (cultured autografts) can be life-saving for patients suffering from massive full-thickness burns. However, the widespread use of cultured autografts has been hampered by poor clinical results that have been consistently reported by different burn units, even when cells were applied on properly prepared wound beds. This might arise from the depletion of epidermal stem cells (holoclones) in culture. Depletion of holoclones can occur because of (i) incorrect culture conditions, (ii) environmental damage of the exposed basal layer of cultured grafts, or (iii) use of new substrates or culture technologies not pretested for holoclone preservation. The aim of this study was to show that, if new keratinocyte culture technologies and/or "delivery systems" are proposed, a careful evaluation of epidermal stem cell preservation is essential for the clinical performance of this life-saving technology. Fibrin was chosen as a potential substrate for keratinocyte cultivation. Stem cells were monitored by clonal analysis using the culture system originally described by Rheinwald and Green as a reference. Massive full-thickness burns were treated with the composite allodermis/cultured autograft technique. We show that: (i) the relative percentage of holoclones, meroclones, and paraclones is maintained when keratinocytes are cultivated on fibrin, proving that fibrin does not induce clonal conversion and consequent loss of epidermal stem cells; (ii) the clonogenic ability, growth rate, and long-term proliferative potential are not affected by the new culture system; (iii) when fibrin-cultured autografts bearing stem cells are applied on massive full-thickness burns, the "take" of keratinocytes is high, reproducible, and permanent; and (iv) fibrin allows a significant reduction of the cost

  6. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. During development intense Sox2 expression marks not only Prox1-expressing taste bud cell but also perigemmal cell lineages.

    Science.gov (United States)

    Nakayama, Ayumi; Miura, Hirohito; Ooki, Makoto; Harada, Shuitsu

    2015-03-01

    Sox2 is proposed to regulate the differentiation of bipotential progenitor cells into taste bud cells. However, detailed expression of Sox2 remains unclear. In this report, Sox2 expression during taste bud development in the fungiform (FF), circumvallate (CV) and soft palate (SP) areas is examined together with Prox1. First, we immunohistochemically checked Prox1 expression in adults and found that almost all taste bud cells are Prox1-positive. During FF development, intense Sox2 expression was restricted to taste bud primordia expressing Prox1 at E12.5. However, at E14.5, Sox2 was intensely expressed outside the developing taste buds resolving to perigemmal Sox2 expression in adults. In the SP, at E14.5, taste bud primordia emerged as Prox1-expressing cell clusters. However, intense Sox2 expression was not restricted to taste bud primordia but was detected widely in the epithelium. During development, Sox2 expression outside developing taste buds was generally down-regulated but was retained in the perigemmal region similarly to that in the FF. In the CV, the initial stage of taste bud development remained unclear because of the lack of taste bud primordia comparable to that in the FF and SP. Here, we show that Prox1-expressing cells appear in the apical epithelium at E12.5, in the inner trench wall at E17.5 and in the outer trench wall at E18.5. Sox2 was again not restricted to developing taste bud cells expressing Prox1 during CV development. The expression patterns support that Sox2 does not serve as a cell fate selector between taste bud cells and surrounding keratinocytes but rather may contribute to them both.

  8. AMPK regulation of the growth of cultured human keratinocytes

    International Nuclear Information System (INIS)

    Saha, Asish K.; Persons, Kelly; Safer, Joshua D.; Luo Zhijun; Holick, Michael F.; Ruderman, Neil B.

    2006-01-01

    AMP kinase (AMPK) is a fuel sensing enzyme that responds to cellular energy depletion by increasing processes that generate ATP and inhibiting others that require ATP but are not acutely necessary for survival. In the present study, we examined the relationship between AMPK activation and the growth (proliferation) of cultured human keratinocytes and assessed whether the inhibition of keratinocyte growth by vitamin D involves AMPK activation. In addition, we explored whether the inhibition of keratinocyte proliferation as they approach confluence could be AMPK-related. Keratinocytes were incubated for 12 h with the AMPK activator, 5-aminoimidazole-4-carboxamide-1-β-D-ribofuranoside (AICAR). At concentrations of 10 -4 and 10 -3 M, AICAR inhibited keratinocyte growth by 50% and 95%, respectively, based on measurements of thymidine incorporation into DNA. It also increased AMPK and acetyl CoA carboxylase phosphorylation (P-AMPK and P-ACC) and decreased the concentration of malonyl CoA confirming that AMPK activation had occurred. Incubation with the thiazolidinedione, troglitazone (10 -6 M) caused similar alterations in P-AMPK, P-ACC, and cell growth. In contrast, the well known inhibition of keratinocyte growth by 1,25-dihydroxyvitamin D 3 (10 -7 and 10 -6 M) was not associated with changes in P-AMPK or P-ACC. Like most cells, the growth of keratinocytes diminished as they approached confluence. Thus, it was of note that we found a progressive increase in P-AMPK (1.5- to 2-fold, p 3 is AMPK-independent

  9. Six1 overexpression at early stages of HPV16-mediated transformation of human keratinocytes promotes differentiation resistance and EMT

    International Nuclear Information System (INIS)

    Xu, Hanwen; Pirisi, Lucia; Creek, Kim E.

    2015-01-01

    Previous studies in our laboratory discovered that SIX1 mRNA expression increased during in vitro progression of HPV16-immortalized human keratinocytes (HKc/HPV16) toward a differentiation-resistant (HKc/DR) phenotype. In this study, we explored the role of Six1 at early stages of HPV16-mediated transformation by overexpressing Six1 in HKc/HPV16. We found that Six1 overexpression in HKc/HPV16 increased cell proliferation and promoted cell migration and invasion by inducing epithelial–mesenchymal transition (EMT). Moreover, the overexpression of Six1 in HKc/HPV16 resulted in resistance to serum and calcium-induced differentiation, which is the hallmark of the HKc/DR phenotype. Activation of MAPK in HKc/HPV16 overexpressing Six1 is linked to resistance to calcium-induced differentiation. In conclusion, this study determined that Six1 overexpression resulted in differentiation resistance and promoted EMT at early stages of HPV16-mediated transformation of human keratinocytes. - Highlights: • Six1 expression increases during HPV16-mediated transformation. • Six1 overexpression causes differentiation resistance in HPV16-immortalized cells. • Six1 overexpression in HPV16-immortalized keratinocytes activates MAPK. • Activation of MAPK promotes EMT and differentiation resistance. • Six1 overexpression reduces Smad-dependent TGF-β signaling

  10. Proliferation of Keratinocytes Induced by Adipose-Derived Stem Cells on a Chitosan Scaffold and Its Role in Wound Healing, a Review

    Directory of Open Access Journals (Sweden)

    Sankaralakshmi Gomathysankar

    2014-09-01

    Full Text Available In the field of tissue engineering and reconstruction, the development of efficient biomaterial is in high demand to achieve uncomplicated wound healing. Chronic wounds and excessive scarring are the major complications of tissue repair and, as this inadequate healing continues to increase, novel therapies and treatments for dysfunctional skin repair and reconstruction are important. This paper reviews the various aspects of the complications related to wound healing and focuses on chitosan because of its unique function in accelerating wound healing. The proliferation of keratinocytes is essential for wound closure, and adipose-derived stem cells play a significant role in wound healing. Thus, chitosan in combination with keratinocytes and adipose-derived stem cells may act as a vehicle for delivering cells, which would increase the proliferation of keratinocytes and help complete recovery from injuries.

  11. Ultra-violet B (UVB)-induced skin cell death occurs through a cyclophilin D intrinsic signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Ji, Chao [Department of Dermatology, The First Affiliated Hospital of Nanjing Medical University, Nanjing 210024, Jiangsu (China); Yang, Bo [Department of Dermatology, Huashan Hospital, Fudan University, Shanghai 200040 (China); Yang, Zhi; Tu, Ying [Department of Dermatology, The First Affiliated Hospital of Kunming Medical University, Yunnan Provincial Institute of Dermatology, Kunming 650032, Yunnan (China); Yang, Yan-li [Department of Otorhinolaryngology, The First Affiliated Hospital of Nanjing Medical University, Nanjing 210024, Jiangsu (China); He, Li, E-mail: heli2662@yahoo.com.cn [Department of Otorhinolaryngology, The First Affiliated Hospital of Nanjing Medical University, Nanjing 210024, Jiangsu (China); Bi, Zhi-Gang, E-mail: eltonbibenqhospital@yahoo.com.cn [Department of Dermatology, BenQ Medical Center, Nanjing Medical University, Nanjing 210019, Jiangsu (China)

    2012-09-07

    Highlights: Black-Right-Pointing-Pointer UVB radiated skin keratinocytes show cyclophilin D (Cyp-D) upregulation. Black-Right-Pointing-Pointer NAC inhibits UVB induced Cyp-D expression, while H{sub 2}O{sub 2} facilitates it. Black-Right-Pointing-Pointer Cyp-D-deficient cells are significantly less susceptible to UVB induced cell death. Black-Right-Pointing-Pointer Over-expression of Cyp-D causes spontaneous keratinocytes cell death. -- Abstract: UVB-induced skin cell damage involves the opening of mitochondrial permeability transition pore (mPTP), which leads to both apoptotic and necrotic cell death. Cyclophilin D (Cyp-D) translocation to the inner membrane of mitochondrion acts as a key component to open the mPTP. Our Western-Blot results in primary cultured human skin keratinocytes and in HaCaT cell line demonstrated that UVB radiation and hydrogen peroxide (H{sub 2}O{sub 2}) induced Cyp-D expression, which was inhibited by anti-oxidant N-acetyl cysteine (NAC). We created a stable Cyp-D deficiency skin keratinocytes by expressing Cyp-D-shRNA through lentiviral infection. Cyp-D-deficient cells were significantly less susceptible than their counterparts to UVB- or H{sub 2}O{sub 2}-induced cell death. Further, cyclosporine A (Cs-A), a Cyp-D inhibitor, inhibited UVB- or H{sub 2}O{sub 2}-induced keratinocytes cell death. Reversely, over-expression of Cyp-D in primary keratinocytes caused spontaneous keratinocytes cell death. These results suggest Cyp-D's critical role in UVB/oxidative stress-induced skin cell death.

  12. Response of human epidermal keratinocytes to UV light

    International Nuclear Information System (INIS)

    Kartasova, A.A.

    1987-01-01

    This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

  13. Adherence of human oral keratinocytes and gingival fibroblasts to nano-structured titanium surfaces.

    Science.gov (United States)

    Dorkhan, Marjan; Yücel-Lindberg, Tülay; Hall, Jan; Svensäter, Gunnel; Davies, Julia R

    2014-06-21

    A key element for long-term success of dental implants is integration of the implant surface with the surrounding host tissues. Modification of titanium implant surfaces can enhance osteoblast activity but their effects on soft-tissue cells are unclear. Adherence of human keratinocytes and gingival fibroblasts to control commercially pure titanium (CpTi) and two surfaces prepared by anodic oxidation was therefore investigated. Since implant abutments are exposed to a bacteria-rich environment in vivo, the effect of oral bacteria on keratinocyte adhesion was also evaluated. The surfaces were characterized using scanning electron microscopy (SEM). The number of adhered cells and binding strength, as well as vitality of fibroblasts and keratinocytes were evaluated using confocal scanning laser microscopy after staining with Live/Dead Baclight. To evaluate the effect of bacteria on adherence and vitality, keratinocytes were co-cultured with a four-species streptococcal consortium. SEM analysis showed the two anodically oxidized surfaces to be nano-structured with differing degrees of pore-density. Over 24 hours, both fibroblasts and keratinocytes adhered well to the nano-structured surfaces, although to a somewhat lesser degree than to CpTi (range 42-89% of the levels on CpTi). The strength of keratinocyte adhesion was greater than that of the fibroblasts but no differences in adhesion strength could be observed between the two nano-structured surfaces and the CpTi. The consortium of commensal streptococci markedly reduced keratinocyte adherence on all the surfaces as well as compromising membrane integrity of the adhered cells. Both the vitality and level of adherence of soft-tissue cells to the nano-structured surfaces was similar to that on CpTi. Co-culture with streptococci reduced the number of keratinocytes on all the surfaces to approximately the same level and caused cell damage, suggesting that commensal bacteria could affect adherence of soft-tissue cells to

  14. Saponins from Tribulus terrestris L. protect human keratinocytes from UVB-induced damage.

    Science.gov (United States)

    Sisto, Margherita; Lisi, Sabrina; D'Amore, Massimo; De Lucro, Raffaella; Carati, Davide; Castellana, Donatello; La Pesa, Velia; Zuccarello, Vincenzo; Lofrumento, Dario D

    2012-12-05

    Chronic exposure to solar UVB radiation damages skin, increasing the risk to develop cancer. Hence the identification of compounds with a photoprotective efficacy is essential. This study examined the role of saponins derived from Tribulus terrestris L. (TT) on the modulation of apoptosis in normal human keratinocytes (NHEK) exposed to physiological doses of UVB and to evaluate their antitumoral properties. In NHEK, TT saponins attenuate UVB-induced programmed cell death through inhibition of intrinsic apoptotic pathway. In squamous cell carcinomas (SCC) TT saponins do not make the malignant keratinocytes more resistant to UVB and determine an enhanced apoptotic response. The photoprotective effect of TT saponins is tightly correlated to the enhancement of NER genes expression and the block of UVB-mediated NF-κB activation. Collectively, our study shows experimental evidence that TT has a preventive efficacy against UVB-induced carcinogenesis and the molecular knowledge on the mechanisms through which TT saponins regulate cell death suggests great potential for TT to be developed into a new medicine for cancer patients. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Inhibition of inflammatory and proliferative responses of human keratinocytes exposed to the sesquiterpene lactones dehydrocostuslactone and costunolide.

    Directory of Open Access Journals (Sweden)

    Claudia Scarponi

    Full Text Available The imbalance of the intracellular redox state and, in particular, of the glutathione (GSH/GSH disulfide couple homeostasis, is involved in the pathogenesis of a number of diseases. In many skin diseases, including psoriasis, oxidative stress plays an important role, as demonstrated by the observation that treatments leading to increase of the local levels of oxidant species ameliorate the disease. Recently, dehydrocostuslactone (DCE and costunolide (CS, two terpenes naturally occurring in many plants, have been found to exert various anti-inflammatory and pro-apoptotic effects on different human cell types. These compounds decrease the level of the intracellular GSH by direct interaction with it, and, therefore, can alter cellular redox state. DCE and CS can trigger S-glutathionylation of various substrates, including the transcription factor STAT3 and JAK1/2 proteins. In the present study, we investigated on the potential role of DCE and CS in regulating inflammatory and proliferative responses of human keratinocytes to cytokines. We demonstrated that DCE and CS decreased intracellular GSH levels in human keratinocytes, as well as inhibited STAT3 and STAT1 phosphorylation and activation triggered by IL-22 or IFN-γ, respectively. Consequently, DCE and CS decreased the IL-22- and IFN-γ-induced expression of inflammatory and regulatory genes in keratinocytes, including CCL2, CXCL10, ICAM-1 and SOCS3. DCE and CS also inhibited proliferation and cell-cycle progression-related gene expression, as well as they promoted cell cycle arrest and apoptosis. In parallel, DCE and CS activated the anti-inflammatory EGFR and ERK1/2 molecules in keratinocytes, and, thus, wound healing in an in vitro injury model. In light of our findings, we can hypothesize that the employment of DCE and CS in psoriasis could efficiently counteract the pro-inflammatory effects of IFN-γ and IL-22 on keratinocytes, revert the apoptosis-resistant phenotype, as well as inhibit

  16. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    International Nuclear Information System (INIS)

    Shimabukuro, Junji; Yamaoka, Ayako; Murata, Ken-ichi; Kotani, Eiji; Hirano, Tomoko; Nakajima, Yumiko; Matsumoto, Goichi; Mori, Hajime

    2014-01-01

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals

  17. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    Energy Technology Data Exchange (ETDEWEB)

    Shimabukuro, Junji; Yamaoka, Ayako; Murata, Ken-ichi [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Kotani, Eiji [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan); Hirano, Tomoko [Venture Laboratory, Kyoto Institute of Technology, Kyoto (Japan); Nakajima, Yumiko [Functional Genomics Group, COMB, Tropical Biosphere Research Center, University of the Ryukyus, Okinawa (Japan); Matsumoto, Goichi [Division of Oral Surgery, Yokohama Clinical Education Center of Kanagawa Dental University, Yokohama (Japan); Mori, Hajime, E-mail: hmori@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan)

    2014-09-01

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals.

  18. Culture technique of rabbit primary epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Marini M

    2012-10-01

    Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.

  19. Neurohumoral mechanisms of keratinocytes regulation in diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Ekaterina Viktorovna Artemova

    2016-12-01

    Full Text Available The extent of damage to the nervous, vascular and microcirculatory systems in diabetic patients determine the regulation of physiological events that lead to the formation of chronic wounds, reduction of patient quality of life and increase of the financial value of medical care. Successful physiological repair is impossible without the successive phases of inflammation, proliferation and wound healing. Keratinocytes are the major cellular barrier components of the epidermis. These cells play an important role in physiological repair, as suggested by recent research, with many cells able to secrete steroid hormones de novo. Damage to the integrity of the skin leads to keratinocyte activation, triggering a cascade of reactions that contribute to changes in epidermal cell phenotype and lead to their proliferation and migration, analogous to changes in cellular adhesion and configuration of the cytoskeleton. An open question remains as to how the keratinocyte cell cycle, which is altered under conditions of hyperglycemia, and neurotransmitter metabolism during different stages of physiological repair are regulated. Understanding these processes will provide a scientific basis for the development of new targets for pharmacotherapies.

  20. Crucial role of vinexin for keratinocyte migration in vitro and epidermal wound healing in vivo

    International Nuclear Information System (INIS)

    Kioka, Noriyuki; Ito, Takuya; Yamashita, Hiroshi; Uekawa, Natsuko; Umemoto, Tsutomu; Motoyoshi, Soh; Imai, Hiroshi; Takahashi, Kenzo; Watanabe, Hideto; Yamada, Masayasu; Ueda, Kazumitsu

    2010-01-01

    In the process of tissue injury and repair, epithelial cells rapidly migrate and form epithelial sheets. Vinexin is a cytoplasmic molecule of the integrin-containing cell adhesion complex localized at focal contacts in vitro. Here, we investigated the roles of vinexin in keratinocyte migration in vitro and wound healing in vivo. Vinexin knockdown using siRNA delayed migration of both HaCaT human keratinocytes and A431 epidermoid carcinoma cells in scratch assay but did not affect cell proliferation. Induction of cell migration by scratching the confluent monolayer culture of these cells activated both EGFR and ERK, and their inhibitors AG1478 and U0126 substantially suppressed scratch-induced keratinocyte migration. Vinexin knockdown in these cells inhibited the scratch-induced activation of EGFR, but not that of ERK, suggesting that vinexin promotes cell migration via activation of EGFR. We further generated vinexin (-/-) mice and isolated their keratinocytes. They similarly showed slow migration in scratch assay. Furthermore, vinexin (-/-) mice exhibited a delay in cutaneous wound healing in both the back skin and tail without affecting the proliferation of keratinocytes. Together, these results strongly suggest a crucial role of vinexin in keratinocyte migration in vitro and cutaneous wound healing in vivo.

  1. Death penalty for keratinocytes: apoptosis versus cornification.

    Science.gov (United States)

    Lippens, S; Denecker, G; Ovaere, P; Vandenabeele, P; Declercq, W

    2005-11-01

    Homeostasis implies a balance between cell growth and cell death. This balance is essential for the development and maintenance of multicellular organisms. Homeostasis is controlled by several mechanisms including apoptosis, a process by which cells condemned to death are completely eliminated. However, in some cases, total destruction and removal of dead cells is not desirable, as when they fulfil a specific function such as formation of the skin barrier provided by corneocytes, also known as terminally differentiated keratinocytes. In this case, programmed cell death results in accumulation of functional cell corpses. Previously, this process has been associated with apoptotic cell death. In this overview, we discuss differences and similarities in the molecular regulation of epidermal programmed cell death and apoptosis. We conclude that despite earlier confusion, apoptosis and cornification occur through distinct molecular pathways, and that possibly antiapoptotic mechanisms are implicated in the terminal differentiation of keratinocytes.

  2. Chitosan modified poly(lactic-co-glycolic acid nanoparticles interaction with normal, precancerous keratinocytes and dental pulp cells

    Directory of Open Access Journals (Sweden)

    Maria Justina Roxana Virlan

    2017-03-01

    Conclusion: Chitosan-coated PLGAChi NPs proved to be able to cross the cellular membrane of oral keratinocytes, in 2D as well as in 3D cultures. The polymeric NPs used in the present study seem not to be suitable for applications that require NPs uptake by DPCs, as no evidence of uptake in these cells was found in this study. The finding that PLGAChi NPs showed significant internalization by human keratinocytes indicate that they could be used for drug delivery purposes to oral mucosa.

  3. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  4. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    International Nuclear Information System (INIS)

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-01-01

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes

  5. Binding of antibodies to the extractable nuclear antigens SS-A/Ro and SS-B/La is induced on the surface of human keratinocytes by ultraviolet light (UVL): Implications for the pathogenesis of photosensitive cutaneous lupus

    International Nuclear Information System (INIS)

    Furukawa, F.; Kashihara-Sawami, M.; Lyons, M.B.; Norris, D.A.

    1990-01-01

    Autoantibodies to the non-histone nucleoprotein antigens SS-A/Ro, SS-B/La, and RNP are highly associated with photosensitive cutaneous lupus erythematosus (LE). In order to better understand the potential mechanisms of ultraviolet (UV) light on photosensitivity in patients with cutaneous LE, we designed immunopathologic in vitro and in vivo experiments to evaluate the effects of UV on the binding of such autoantibodies to the surface of human keratinocytes, one major target of immunologic damage in photosensitive LE. Short-term 2% paraformaldehyde fixation of suspensions of cultured human keratinocytes previously incubated with monospecific antiserum probes enabled the detection of ENA expression on the cell surface by flow-cytometry analysis. UVB light (280-320 nm) induced the binding of monospecific antibody probes for SS-A/Ro and SS-B/La on keratinocytes in a dose-dependent pattern with maximal induction observed at the dose of 200 mJ/cm2 UVB. Binding of SS-A/Ro, SS-B/La, and RNP antibody was augmented strongly, but binding of anti-Sm was very weak. In contrast, UVA (320-400 nm) light had no effect on the induction of binding of these antibody probes. Identical results were seen by standard immunofluorescence techniques. Hydroxyurea-treated keratinocytes showed similar induction of those antigens by UVB irradiation, which suggested that ENA expression on cultured keratinocytes by UVB were cell-cycle independent. Tunicamycin, an inhibitor of glycosylation of proteins, reduced UVB light effect on the SS-A/Ro and SS-B/La antigen's expression. These in vitro FACS analyses revealed that ENA augmentation on the keratinocyte cell surface was dose dependent, UVB dependent, glycosylation dependent, and cell-cycle independent. In vivo ENA augmentation on the keratinocyte surface was examined in suction blister epidermal roofs

  6. Transactivation of involucrin, a marker of differentiation in keratinocytes, by lens epithelium-derived growth factor (LEDGF).

    Science.gov (United States)

    Kubo, E; Fatma, N; Sharma, P; Shinohara, T; Chylack, L T; Akagi, Y; Singh, D P

    2002-07-26

    Human involucrin (hINV), first appears in the cytosol of keratinocytes and ultimately cross-linked to membrane proteins via transglutaminase and forms a protective barrier as an insoluble envelope beneath the plasma membrane. Although the function and evolution of involucrin is known, the regulation of its gene expression is not well understood. An analysis of the hINV gene sequence, upstream of the transcription start site (-534 to +1 nt) revealed the presence of potential sites for binding of lens epithelium-derived growth factor (LEDGF); stress response element (STRE; A/TGGGGA/T) and heat shock element (HSE; nGAAn). We reported earlier that LEDGF activates stress-associated genes by binding to these elements and elevates cellular resistance to various stresses. Here, gel-shift and super-shift assays confirm the binding of LEDGF to the DNA fragments containing HSEs and STREs that are present in the involucrin gene promoter. Furthermore, hINV promoter linked to CAT reporter gene, cotransfected in human corneal simian virus 40-transformed keratinocytes (HCK), was transactivated by LEDGF significantly. In contrast, the activity of hINV promoter bearing mutations at the WT1 (containing HSE and STRE), WT2 (containing STRE) and WT3 (containing STRE) binding sites was diminished. In addition, in HCK cell over-expressing LEDGF, the levels of hINV mRNA and hINV protein are increased by four to five-fold. LEDGF is inducible to oxidants. Cells treated with 12-O-tetradecanoyl-phorbol-13-acetate (TPA), known to stimulate production of H(2)O(2), showed higher levels of LEDGF mRNA. Furthermore, our immunohistochemical studies revealed that hINV protein is found in the cytoplasm of HCK cells over-expressing LEDGF, but not detectable in the normal HCK cells or HCK cells transfected with vector. This regulation appears to be physiologically important, as over-expression of HCK with LEDGF increases the expression of the endogenous hINV gene and may provide new insight to understand

  7. Expression of major histocompatibility complex class II and costimulatory molecules in oral carcinomas in vitro.

    Science.gov (United States)

    Villarroel-Dorrego, Mariana; Speight, Paul M; Barrett, A William

    2005-01-01

    Recognition in the 1980 s that keratinocytes can express class II molecules of the Major Histocompatibility Complex (MHC) first raised the possibility that these cells might have an immunological function, and may even act as antigen presenting cells (APC). For effective T lymphocyte activation, APC require, in addition to MHC II, appropriate costimulatory signals. The aim of this study was to determine the expression of MHC class II and the co-stimulatory molecules CD40, CD80 and CD86 in keratinocytes derived from healthy oral mucosa and oral carcinomas. Using flow cytometry, it was confirmed that oral keratinocytes, switch on, expression of MHC class II molecules after stimulation with IFNgamma in vitro. All keratinocyte lines expressed CD40 constitutively; by contrast, CD80 and CD86 were universally absent. Loss of CD80 and CD86 may be one means whereby tumours escape immunological surveillance.

  8. Sonoporation delivery of monoclonal antibodies against human papillomavirus 16 E6 restores p53 expression in transformed cervical keratinocytes.

    Directory of Open Access Journals (Sweden)

    Melissa Togtema

    Full Text Available High-risk types of human papillomavirus (HPV, such as HPV16, have been found in nearly all cases of cervical cancer. Therapies targeted at blocking the HPV16 E6 protein and its deleterious effects on the tumour suppressor pathways of the cell can reverse the malignant phenotype of affected keratinocytes while sparing uninfected cells. Through a strong interdisciplinary collaboration between engineering and biology, a novel, non-invasive intracellular delivery method for the HPV16 E6 antibody, F127-6G6, was developed. The method employs high intensity focused ultrasound (HIFU in combination with microbubbles, in a process known as sonoporation. In this proof of principle study, it was first demonstrated that sonoporation antibody delivery into the HPV16 positive cervical carcinoma derived cell lines CaSki and SiHa was possible, using chemical transfection as a baseline for comparison. Delivery of the E6 antibody using sonoporation significantly restored p53 expression in these cells, indicating the antibody is able to enter the cells and remains active. This delivery method is targeted, non-cytotoxic, and non-invasive, making it more easily translatable for in vivo experiments than other transfection methods.

  9. Evidence for alteration of EZH2, BMI1, and KDM6A and epigenetic reprogramming in human papillomavirus type 16 E6/E7-expressing keratinocytes.

    Science.gov (United States)

    Hyland, Paula L; McDade, Simon S; McCloskey, Rachel; Dickson, Glenda J; Arthur, Ken; McCance, Dennis J; Patel, Daksha

    2011-11-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future.

  10. Mesenchymal stem cells ameliorate impaired wound healing through enhancing keratinocyte functions in diabetic foot ulcerations on the plantar skin of rats.

    Science.gov (United States)

    Kato, Jiro; Kamiya, Hideki; Himeno, Tatsuhito; Shibata, Taiga; Kondo, Masaki; Okawa, Tetsuji; Fujiya, Atsushi; Fukami, Ayako; Uenishi, Eita; Seino, Yusuke; Tsunekawa, Shin; Hamada, Yoji; Naruse, Keiko; Oiso, Yutaka; Nakamura, Jiro

    2014-01-01

    Although the initial healing stage involves a re-epithelialization in humans, diabetic foot ulceration (DFU) has been investigated using rodent models with wounds on the thigh skin, in which a wound contraction is initiated. In this study, we established a rodent model of DFU on the plantar skin and evaluated the therapeutic efficacy of bone-marrow-derived mesenchymal stem cells (BM-MSCs) in this model. The wounds made on the hind paws or thighs of streptozotocin induced diabetic or control rats were treated with BM-MSCs. Expression levels of phosphorylated focal adhesion kinase (pFAK), matrix metaroprotease (MMP)-2, EGF, and IGF-1, were evaluated in human keratinocytes, which were cultured in conditioned media of BM-MSCs (MSC-CM) with high glucose levels. Re-epithelialization initiated the healing process on the plantar, but not on the thigh, skin. The therapy utilizing BM-MSCs ameliorated the delayed healing in diabetic rats. In the keratinocytes cultured with MSC-CM, the decreased pFAK levels in the high glucose condition were restored, and the MMP2, EGF, and IGF-1 levels increased. Our study established a novel rat DFU model. The impaired healing process in diabetic rats was ameliorated by transplantation of BM-MSCs. This amelioration might be accounted for by the modification of keratinocyte functions. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Transcription factors and stress response gene alterations in human keratinocytes following Solar Simulated Ultra Violet Radiation.

    Science.gov (United States)

    Marais, Thomas L Des; Kluz, Thomas; Xu, Dazhong; Zhang, Xiaoru; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong

    2017-10-19

    Ultraviolet radiation (UVR) from sunlight is the major effector for skin aging and carcinogenesis. However, genes and pathways altered by solar-simulated UVR (ssUVR), a mixture of UVA and UVB, are not well characterized. Here we report global changes in gene expression as well as associated pathways and upstream transcription factors in human keratinocytes exposed to ssUVR. Human HaCaT keratinocytes were exposed to either a single dose or 5 repetitive doses of ssUVR. Comprehensive analyses of gene expression profiles as well as functional annotation were performed at 24 hours post irradiation. Our results revealed that ssUVR modulated genes with diverse cellular functions changed in a dose-dependent manner. Gene expression in cells exposed to a single dose of ssUVR differed significantly from those that underwent repetitive exposures. While single ssUVR caused a significant inhibition in genes involved in cell cycle progression, especially G2/M checkpoint and mitotic regulation, repetitive ssUVR led to extensive changes in genes related to cell signaling and metabolism. We have also identified a panel of ssUVR target genes that exhibited persistent changes in gene expression even at 1 week after irradiation. These results revealed a complex network of transcriptional regulators and pathways that orchestrate the cellular response to ssUVR.

  12. Rapid adhesion and proliferation of keratinocytes on the gold colloid/chitosan film scaffold

    International Nuclear Information System (INIS)

    Zhang Yi; He Hong; Gao Wenjuan; Lu Shuangyun; Liu Yang; Gu Haiying

    2009-01-01

    The gold colloid/chitosan film scaffold, which could enhance the attached ratio and accelerate proliferation of newborn mice keratinocytes, was fabricated by nanotechnology and self-assembly technology. This nanometer scaffold was characterized by atomic force microscopy (AFM) and scanning electron microscopy (SEM). The keratinocytes were cultured and observed on three different extracellular matrices (ECM): gold colloid/chitosan film scaffold, chitosan film and cell culture plastic (control groups). 6 h, 12 h, 24 h after inoculation, the cell attached ratios were calculated respectively. In comparison to control groups, this scaffold could significantly (P < 0.01) increase the attached ratio of keratinocytes and promote their growth. Meanwhile, there were not any fusiform fibroblasts growing on this scaffold. The rapidly proliferating keratinocytes were indentified and characterized by immunohistochemistry and transmissive electron microscope (TEM), which showed the cells maintain their biological activity well. The results indicated that gold colloid/chitosan film scaffold was nontoxic to keratinocytes, and was a good candidate for wound dressing in skin tissue engineering.

  13. Human keratinocyte sensitivity towards inflammatory cytokines varies with culture time

    Directory of Open Access Journals (Sweden)

    G. Elliott

    1992-01-01

    Full Text Available Proliferating keratinocyte cultures have been reported to synthesize higher concentrations of prostaglandin (PG E than confluent ones. As interleukin-1 (IL-1 stimulates keratinocyte PGE synthesis we investigated whether the degree of confluency of the keratinocyte culture modified the response of the cells to IL-1. It was found that IL-1α (100 U/ml stimulated PGE2 synthesis by proliferating (7 days in culture but not differentiating (14 days in culture keratinocytes. Similar effects were observed using tumour necrosis factor-α. Both arachidonic acid (AA and the calcium ionophore A23187 stimulated PGE2 synthesis by 7 and 14 day cultures although the increase was greatest when 7 day cultures were used. Our data indicate that there is a specific down-regulation of the mechanism(s by which some inflammatory cytokines stimulate keratinocyte eicosanoid synthesis as cultured keratinocytes begin to differentiate.

  14. Arsenic exposure disrupts epigenetic regulation of SIRT1 in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Herbert, Katharine J. [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia); Holloway, Adele [Menzies Research Institute Tasmania, University of Tasmania, Hobart, TAS 7000 (Australia); Cook, Anthony L. [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia); Chin, Suyin P. [Menzies Research Institute Tasmania, University of Tasmania, Hobart, TAS 7000 (Australia); Snow, Elizabeth T., E-mail: elizabeth.snow@utas.edu.au [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia)

    2014-11-15

    Arsenic is an environmental toxin which increases skin cancer risk for exposed populations worldwide; however the underlying biomolecular mechanism for arsenic-induced carcinogenesis is complex and poorly defined. Recent investigations show that histone deacetylase and DNA methyltransferase activity is impaired, and epigenetic patterns of gene regulation are consistently altered in cancers associated with arsenic exposure. Expression of the histone deacetylase SIRT1 is altered in solid tumours and haematological malignancies; however its role in arsenic-induced pathology is unknown. In this study we investigated the effect of arsenic on epigenetic regulation of SIRT1 and its targeting microRNA, miR-34a in primary human keratinocytes. Acetylation of histone H4 at lysine 16 (H4K16) increased in keratinocytes exposed to 0.5 μM arsenite [As(III)]; and this was associated with chromatin remodelling at the miR-34a promoter. Moreover, although SIRT1 protein initially increased in these As(III)-exposed cells, after 24 days expression was not significantly different from untreated controls. Extended exposure to low-dose As(III) (0.5 μM; > 5 weeks) compromised the pattern of CpG methylation at SIRT1 and miR-34a gene promoters, and this was associated with altered expression for both genes. We have found that arsenic alters epigenetic regulation of SIRT1 expression via structural reorganisation of chromatin at the miR-34a gene promoter in the initial 24 h of exposure; and over time, through shifts in miR-34a and SIRT1 gene methylation. Taken together, this investigation demonstrates that arsenic produces cumulative disruptions to epigenetic regulation of miR-34a expression, and this is associated with impaired coordination of SIRT1 functional activity. - Highlights: • Submicromolar arsenic concentrations disrupt SIRT1 activity and expression in human keratinocytes. • Arsenic-induced chromatin remodelling at the miR-34a gene promoter is associated with hyperacetylation

  15. Arsenic exposure disrupts epigenetic regulation of SIRT1 in human keratinocytes

    International Nuclear Information System (INIS)

    Herbert, Katharine J.; Holloway, Adele; Cook, Anthony L.; Chin, Suyin P.; Snow, Elizabeth T.

    2014-01-01

    Arsenic is an environmental toxin which increases skin cancer risk for exposed populations worldwide; however the underlying biomolecular mechanism for arsenic-induced carcinogenesis is complex and poorly defined. Recent investigations show that histone deacetylase and DNA methyltransferase activity is impaired, and epigenetic patterns of gene regulation are consistently altered in cancers associated with arsenic exposure. Expression of the histone deacetylase SIRT1 is altered in solid tumours and haematological malignancies; however its role in arsenic-induced pathology is unknown. In this study we investigated the effect of arsenic on epigenetic regulation of SIRT1 and its targeting microRNA, miR-34a in primary human keratinocytes. Acetylation of histone H4 at lysine 16 (H4K16) increased in keratinocytes exposed to 0.5 μM arsenite [As(III)]; and this was associated with chromatin remodelling at the miR-34a promoter. Moreover, although SIRT1 protein initially increased in these As(III)-exposed cells, after 24 days expression was not significantly different from untreated controls. Extended exposure to low-dose As(III) (0.5 μM; > 5 weeks) compromised the pattern of CpG methylation at SIRT1 and miR-34a gene promoters, and this was associated with altered expression for both genes. We have found that arsenic alters epigenetic regulation of SIRT1 expression via structural reorganisation of chromatin at the miR-34a gene promoter in the initial 24 h of exposure; and over time, through shifts in miR-34a and SIRT1 gene methylation. Taken together, this investigation demonstrates that arsenic produces cumulative disruptions to epigenetic regulation of miR-34a expression, and this is associated with impaired coordination of SIRT1 functional activity. - Highlights: • Submicromolar arsenic concentrations disrupt SIRT1 activity and expression in human keratinocytes. • Arsenic-induced chromatin remodelling at the miR-34a gene promoter is associated with hyperacetylation

  16. The involvement of Gab1 and PI 3-kinase in β1 integrin signaling in keratinocytes

    International Nuclear Information System (INIS)

    Kuwano, Yoshihiro; Fujimoto, Manabu; Watanabe, Rei; Ishiura, Nobuko; Nakashima, Hiroko; Komine, Mayumi; Hamazaki, Tatsuo S.; Tamaki, Kunihiko; Okochi, Hitoshi

    2007-01-01

    The control of the stem cell compartment in epidermis is closely linked to the regulation of keratinocyte proliferation and differentiation. β1 integrins are expressed 2-fold higher by stem cells than transit-amplifying cells. Signaling from these β1 integrins is critical for the regulation of the epidermal stem cell compartment. To clarify the functional relevance of this differential expression of β1 integrins, we established HaCaT cells with high β1integrin expression by repeated flow cytometric sorting of this population from the parental cell line. In these obtained cells expressing β1 integrins by 5-fold, MAPK activation was markedly increased. Regarding the upstream of MAPK, Gab1 phosphorylation was also higher with high β1 integrin expression, while Shc phosphorylation was not altered. In addition, enhanced phosphatidylinositol 3-kinase activation was also observed. These observations suggest that Gab1 and phosphatidylinositol 3-kinase play pivotal roles in the β1 integrin-mediated regulation of the epidermal stem cell compartment

  17. Cryopreservation of dermal fibroblasts and keratinocytes in hydroxyethyl starch-based cryoprotectants.

    Science.gov (United States)

    Naaldijk, Yahaira; Johnson, Adiv A; Friedrich-Stöckigt, Annett; Stolzing, Alexandra

    2016-12-01

    Preservation of human skin fibroblasts and keratinocytes is essential for the creation of skin tissue banks. For successful cryopreservation of cells, selection of an appropriate cryoprotectant agent (CPA) is imperative. The aim of this study was to identify CPAs that minimize toxic effects and allow for the preservation of human fibroblasts and keratinocytes in suspension and in monolayers. We cryopreserved human fibroblasts and keratinocytes with different CPAs and compared them to fresh, unfrozen cells. Cells were frozen in the presence and absence of hydroxyethyl starch (HES) or dimethyl sulfoxide (DMSO), the latter of which is a commonly used CPA known to exert toxic effects on cells. Cell numbers were counted immediately post-thaw as well as three days after thawing. Cellular structures were analyzed and counted by labeling nuclei, mitochondria, and actin filaments. We found that successful cryopreservation of suspended or adherent keratinocytes can be accomplished with a 10% HES or a 5% HES, 5% DMSO solution. Cell viability of fibroblasts cryopreserved in suspension was maintained with 10% HES or 5% HES, 5% DMSO solutions. Adherent, cryopreserved fibroblasts were successfully maintained with a 5% HES, 5% DMSO solution. We conclude that skin tissue cells can be effectively cryopreserved by substituting all or a portion of DMSO with HES. Given that DMSO is the most commonly used CPA and is believed to be more toxic than HES, these findings are of clinical significance for tissue-based replacement therapies. Therapies that require the use of keratinocyte and fibroblast cells, such as those aimed at treating skin wounds or skin burns, may be optimized by substituting a portion or all of DMSO with HES during cryopreservation protocols.

  18. Epithelium Expressing the E7 Oncoprotein of HPV16 Attracts Immune-Modulatory Dendritic Cells to the Skin and Suppresses Their Antigen-Processing Capacity.

    Directory of Open Access Journals (Sweden)

    Janin Chandra

    Full Text Available Antigen presenting cells (APCs in skin can promote either antigen-specific effector functions or antigen tolerance, and thus determine clearance or persistence of cutaneous viral infections. Human papillomavirus (HPV infections can persist in squamous epithelium in immunocompetent individuals, and some persisting HPV infections, particularly with HPV16, promote malignant epithelial transformation. Here, we investigate whether local expression of the HPV16 protein most associated with malignant transformation, HPV16-E7, affects the phenotype and function of APC subsets in the skin. We demonstrate an expanded population of Langerhans cells in HPV16-E7 transgenic skin with distinct cell surface markers which express immune-modulatory enzymes and cytokines not expressed by cells from non transgenic skin. Furthermore, HPV16-E7 transgene expression in keratinocytes attracts new APC subsets to the epidermis. In vivo migration and transport of antigen to the draining lymph node by these APCs is markedly enhanced in HPV16-E7 expressing skin, whereas antigen-processing, as measured by proteolytic cleavage of DQ-OVA and activation of T cells in vivo by APCs, is significantly impaired. These data suggest that local expression of HPV16-E7 in keratinocytes can contribute to persisting infection with this oncogenic virus, by altering the phenotype and function of local APCs.

  19. Ultra-violet B (UVB)-induced skin cell death occurs through a cyclophilin D intrinsic signaling pathway.

    Science.gov (United States)

    Ji, Chao; Yang, Bo; Yang, Zhi; Tu, Ying; Yang, Yan-li; He, Li; Bi, Zhi-Gang

    2012-09-07

    UVB-induced skin cell damage involves the opening of mitochondrial permeability transition pore (mPTP), which leads to both apoptotic and necrotic cell death. Cyclophilin D (Cyp-D) translocation to the inner membrane of mitochondrion acts as a key component to open the mPTP. Our Western-Blot results in primary cultured human skin keratinocytes and in HaCaT cell line demonstrated that UVB radiation and hydrogen peroxide (H(2)O(2)) induced Cyp-D expression, which was inhibited by anti-oxidant N-acetyl cysteine (NAC). We created a stable Cyp-D deficiency skin keratinocytes by expressing Cyp-D-shRNA through lentiviral infection. Cyp-D-deficient cells were significantly less susceptible than their counterparts to UVB- or H(2)O(2)-induced cell death. Further, cyclosporine A (Cs-A), a Cyp-D inhibitor, inhibited UVB- or H(2)O(2)-induced keratinocytes cell death. Reversely, over-expression of Cyp-D in primary keratinocytes caused spontaneous keratinocytes cell death. These results suggest Cyp-D's critical role in UVB/oxidative stress-induced skin cell death. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Lactobacillus rhamnosus GG Lysate Increases Re-Epithelialization of Keratinocyte Scratch Assays by Promoting Migration.

    Science.gov (United States)

    Mohammedsaeed, Walaa; Cruickshank, Sheena; McBain, Andrew J; O'Neill, Catherine A

    2015-11-05

    A limited number of studies have investigated the potential of probiotics to promote wound healing in the digestive tract. The aim of the current investigation was to determine whether probiotic bacteria or their extracts could be beneficial in cutaneous wound healing. A keratinocyte monolayer scratch assay was used to assess re-epithelialization; which comprises keratinocyte proliferation and migration. Primary human keratinocyte monolayers were scratched then exposed to lysates of Lactobacillus (L) rhamnosus GG, L. reuteri, L. plantarum or L. fermentum. Re-epithelialization of treated monolayers was compared to that of untreated controls. Lysates of L. rhamnosus GG and L. reuteri significantly increased the rate of re-epithelialization, with L. rhamnosus GG being the most efficacious. L. reuteri increased keratinocyte proliferation while L. rhamnosus GG lysate significantly increased proliferation and migration. Microarray analysis of L. rhamnosus GG treated scratches showed increased expression of multiple genes including the chemokine CXCL2 and its receptor CXCR2. These are involved in normal wound healing where they stimulate keratinocyte proliferation and/or migration. Increased protein expression of both CXCL2 and CXCR2 were confirmed by ELISA and immunoblotting. These data demonstrate that L. rhamnosus GG lysate accelerates re-epithelialization of keratinocyte scratch assays, potentially via chemokine receptor pairs that induce keratinocyte migration.

  1. Keratinocytes from APP/APLP2-deficient mice are impaired in proliferation, adhesion and migration in vitro

    International Nuclear Information System (INIS)

    Siemes, Christina; Quast, Thomas; Kummer, Christiane; Wehner, Sven; Kirfel, Gregor; Mueller, Ulrike; Herzog, Volker

    2006-01-01

    Growing evidence shows that the soluble N-terminal form (sAPPα) of the amyloid precursor protein (APP) represents an epidermal growth factor fostering keratinocyte proliferation, migration and adhesion. APP is a member of a protein family including the two mammalian amyloid precursor-like proteins APLP1 and APLP2. In the mammalian epidermis, only APP and APLP2 are expressed. APP and APLP2-deficient mice die shortly after birth but do not display a specific epidermal phenotype. In this report, we investigated the epidermis of APP and/or APLP2 knockout mice. Basal keratinocytes showed reduced proliferation in vivo by about 40%. Likewise, isolated keratinocytes exhibited reduced proliferation rates in vitro, which could be completely rescued by either exogenously added recombinant sAPPα, or by co-culture with dermal fibroblasts derived from APP knockout mice. Moreover, APP-knockout keratinocytes revealed reduced migration velocity resulting from severely compromised cell substrate adhesion. Keratinocytes from double knockout mice died within the first week of culture, indicating essential functions of APP-family members for survival in vitro. Our data indicate that sAPPα has to be considered as an essential epidermal growth factor which, however, in vivo can be functionally compensated to a certain extent by other growth factors, e.g., factors released from dermal fibroblasts

  2. Effect of Gloriosa superba and Catharanthus roseus Extracts on IFN-γ-Induced Keratin 17 Expression in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Nattaporn Pattarachotanant

    2014-01-01

    Full Text Available Gloriosa superba and Catharanthus roseus are useful in traditional medicine for treatment of various skin diseases and cancer. However, their molecular effect on psoriasis has not been investigated. In this study, the effect of ethanol extracts derived from G. superba leaves and C. roseus stems on the expression of psoriatic marker, keratin 17 (K17, was investigated in human keratinocytes using biochemical and molecular experimental approaches. Both extracts could reduce the expression of K17 in a dose-dependent manner through JAK/STAT pathway as demonstrated by an observation of reduced phosphorylation of STAT3 (p-STAT3. The inhibitory activity of G. superba extract was more potent than that of C. roseus. The Pearson's correlation between K17 and cell viability was shown positive. Taken together, the extracts of G. superba and C. roseus may be developed as alternative therapies for psoriasis.

  3. Expression and Functional Studies on the Noncoding RNA, PRINS

    Directory of Open Access Journals (Sweden)

    Márta Széll

    2012-12-01

    Full Text Available PRINS, a noncoding RNA identified earlier by our research group, contributes to psoriasis susceptibility and cellular stress response. We have now studied the cellular and histological distribution of PRINS by using in situ hybridization and demonstrated variable expressions in different human tissues and a consistent staining pattern in epidermal keratinocytes and in vitro cultured keratinocytes. To identify the cellular function(s of PRINS, we searched for a direct interacting partner(s of this stress-induced molecule. In HaCaT and NHEK cell lysates, the protein proved to be nucleophosmin (NPM protein as a potential physical interactor with PRINS. Immunohistochemical experiments revealed an elevated expression of NPM in the dividing cells of the basal layers of psoriatic involved skin samples as compared with healthy and psoriatic uninvolved samples. Others have previously shown that NPM is a ubiquitously expressed nucleolar phosphoprotein which shuttles to the nucleoplasm after UV-B irradiation in fibroblasts and cancer cells. We detected a similar translocation of NPM in UV-B-irradiated cultured keratinocytes. The gene-specific silencing of PRINS resulted in the retention of NPM in the nucleolus of UV-B-irradiated keratinocytes; suggesting that PRINS may play a role in the NPM-mediated cellular stress response in the skin.

  4. Strain-dependent augmentation of tight-junction barrier function in human primary epidermal keratinocytes by Lactobacillus and Bifidobacterium lysates.

    Science.gov (United States)

    Sultana, Reshma; McBain, Andrew J; O'Neill, Catherine A

    2013-08-01

    In this study, we investigated whether probiotic lysates can modify the tight-junction function of human primary keratinocytes. The keratinocytes were grown on cell culture inserts and treated with lysates from Bifidobacterium longum, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus fermentum, or Lactobacillus rhamnosus GG. With the exception of L. fermentum (which decreased cell viability), all strains markedly enhanced tight-junction barrier function within 24 h, as assessed by measurements of transepithelial electrical resistance (TEER). However, B. longum and L. rhamnosus GG were the most efficacious, producing dose-dependent increases in resistance that were maintained for 4 days. These increases in TEER correlated with elevated expression of tight-junction protein components. Neutralization of Toll-like receptor 2 abolished both the increase in TEER and expression of tight-junction proteins induced by B. longum, but not L. rhamnosus GG. These data suggest that some bacterial strains increase tight-junction function via modulation of protein components but the different pathways involved may vary depending on the bacterial strain.

  5. A chemically defined culture medium containing Rho kinase inhibitor Y-27632 for the fabrication of stratified squamous epithelial cell grafts

    International Nuclear Information System (INIS)

    Aslanova, Afag; Takagi, Ryo; Yamato, Masayuki; Okano, Teruo; Yamamoto, Masakazu

    2015-01-01

    With the development of a culture method for stratified squamous epithelial cells, tissue-engineered epithelial cell sheets have been successfully applied as clinical cell grafts. However, the implementation of these cell sheets without the use of any animal-derived materials is highly desirable. In this study, Rho-associated protein kinase inhibitor Y-27632 was used to develop a chemically defined culture medium for the fabrication of stratified epithelial cell grafts consisting of human epidermal and oral keratinocytes, and the proliferation activity, cell morphology, and gene expressions of the keratinocytes were analyzed. The results of a colorimetric assay indicated that Y-27632 significantly promoted the proliferation of the keratinocytes in culture media both with and without fetal bovine serum (FBS), although there were no indications of Y-27632 efficacy on cell morphology and stratification of the keratinocytes in culture medium without any animal-derived materials. The results of quantitative RT-PCR revealed that gene expressions correlated with cell adhesion, cell–cell junction, proliferation markers, and stem/progenitor markers in cultured keratinocytes were not strongly affected by the addition of Y-27632 to the culture medium. Moreover, gene expressions of differentiation markers in stratified keratinocytes cultured in medium without FBS were nearly identical to those of keratinocytes co-cultured with 3T3 feeder cells. Interestingly, the expressions of differentiation markers in cultured stratified keratinocytes were suppressed by FBS, whereas they were reconstructed by either co-culture of a 3T3 feeder layer or addition of Y-27632 into the culture medium containing FBS. These findings indicate that Y-27632 is a useful supplement for the development of a chemically defined culture medium for fabrication of stratified epithelial cell grafts for clinical applications for the purpose of developing the culture medium with a lower risk of pathogen

  6. A chemically defined culture medium containing Rho kinase inhibitor Y-27632 for the fabrication of stratified squamous epithelial cell grafts

    Energy Technology Data Exchange (ETDEWEB)

    Aslanova, Afag [Department of Surgery, Institute of Gastroenterology, Tokyo Women' s Medical University, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666 (Japan); Institute of Advanced Biomedical Engineering and Science, Tokyo Women' s Medical University, TWIns, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666 (Japan); Takagi, Ryo; Yamato, Masayuki; Okano, Teruo [Institute of Advanced Biomedical Engineering and Science, Tokyo Women' s Medical University, TWIns, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666 (Japan); Yamamoto, Masakazu, E-mail: yamamoto.ige@twmu.ac.jp [Department of Surgery, Institute of Gastroenterology, Tokyo Women' s Medical University, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666 (Japan)

    2015-05-01

    With the development of a culture method for stratified squamous epithelial cells, tissue-engineered epithelial cell sheets have been successfully applied as clinical cell grafts. However, the implementation of these cell sheets without the use of any animal-derived materials is highly desirable. In this study, Rho-associated protein kinase inhibitor Y-27632 was used to develop a chemically defined culture medium for the fabrication of stratified epithelial cell grafts consisting of human epidermal and oral keratinocytes, and the proliferation activity, cell morphology, and gene expressions of the keratinocytes were analyzed. The results of a colorimetric assay indicated that Y-27632 significantly promoted the proliferation of the keratinocytes in culture media both with and without fetal bovine serum (FBS), although there were no indications of Y-27632 efficacy on cell morphology and stratification of the keratinocytes in culture medium without any animal-derived materials. The results of quantitative RT-PCR revealed that gene expressions correlated with cell adhesion, cell–cell junction, proliferation markers, and stem/progenitor markers in cultured keratinocytes were not strongly affected by the addition of Y-27632 to the culture medium. Moreover, gene expressions of differentiation markers in stratified keratinocytes cultured in medium without FBS were nearly identical to those of keratinocytes co-cultured with 3T3 feeder cells. Interestingly, the expressions of differentiation markers in cultured stratified keratinocytes were suppressed by FBS, whereas they were reconstructed by either co-culture of a 3T3 feeder layer or addition of Y-27632 into the culture medium containing FBS. These findings indicate that Y-27632 is a useful supplement for the development of a chemically defined culture medium for fabrication of stratified epithelial cell grafts for clinical applications for the purpose of developing the culture medium with a lower risk of pathogen

  7. Evidence for Alteration of EZH2, BMI1, and KDM6A and Epigenetic Reprogramming in Human Papillomavirus Type 16 E6/E7-Expressing Keratinocytes

    Science.gov (United States)

    Hyland, Paula L.; McDade, Simon S.; McCloskey, Rachel; Dickson, Glenda J.; Arthur, Ken; McCance, Dennis J.; Patel, Daksha

    2011-01-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future. PMID:21865393

  8. [Cultivated keratinocytes on micro-carriers: in vitro studies of a new carrier system].

    Science.gov (United States)

    Hecht, J; Hoefter, E A; Hecht, J; Haraida, S; Nerlich, A; Hartinger, A; Mühlbauer, W; Dimoudis, N

    1997-03-01

    Epidermal grafts from confluently cultivated keratinocytes have been used since the early eighties for the treatment of severe burns, where the shortage of donor sites for split-thickness skin grafts did not allow for adequate wound coverage. The difficult handling of these grafts as well as the advanced differentiation of their epithelial cells into a multilayer sheet poses a problem for their clinical application. The aim of the study was to characterize cultivated keratinocytes, as well as to observe their migration and proliferation from the MC onto a surface. Keratinocytes were isolated from human foreskin and cultivated in serum-free and serum-containing medium according to a modified method by Rheinwald and Green. Collagen-coated Dextran beads were used as MC. The MC were colonized with keratinocytes using the Spinner culture technique. After seeding the colonized MC into culture flasks, their migration and proliferation was monitored regularly through immunohistochemical studies and measurement of the metabolic cell activity. Immunohistological staining proved that the cells isolated from human foreskin represent keratinocytes of the basal type. Keratinocytes, cultivated with serum-containing and serum free medium, both adhered to the surface of the MC, then migrated onto the surface of the flasks and proliferated to form a multilayer of epithelial cells. In the long-term, a flexible epithelial graft consisting of poorly differentiated keratinocytes should be available, which is simple to produce and easy to handle. This would be an alternative method for treating wounds, where the conventional multilayer epithelial graft (ET) is insufficient.

  9. A flexible thermoresponsive cell culture substrate for direct transfer of keratinocyte cell sheets.

    Science.gov (United States)

    Praveen, Wulligundam; Madathil, Bernadette K; Sajin Raj, R S; Kumary, T V; Anil Kumar, P R

    2017-10-25

    Most cell sheet engineering systems require a support or carrier to handle the harvested cell sheets. In this study, polyethylene terephthalate-based overhead projection transparency sheets (OHPS) were subjected to surface hydrolysis by alkali treatment to increase pliability and hydrophilicity and enable poly(N-isopropylacrylamide-co-glycidylmethacrylate) copolymer (NGMA) coating to impart thermoresponsiveness. NGMA was applied on the modified OHPS by the technique of spin coating using an indigenously designed spin coater. The spin coating had the advantage of using low volumes of the polymer and a reduced coating time. The surface chemistry and thermoresponsive coating was analyzed by Fourier transform infrared spectroscopy and water contact angle. Human keratinocyte cells were cultured on the spin coated surface and scaffold-free cell sheets were successfully harvested by simple variation of temperature. These cell sheets were found to be viable, exhibited epithelial characteristic and cell-cell contact as confirmed by positive immunostaining for ZO-1. The integrity and morphology of the cell sheet was confirmed by stereomicroscopy and E-SEM. These results highlight the potential of the NGMA spin coated modified OHPS to serve as a thermoresponsive culture surface-cum-flexible transfer tool.

  10. CD44 antibody stimulates adhesion of peripheral blood T cells to keratinocytes through the leukocyte function-associated antigen-1/intercellular adhesion molecule-1 pathway

    NARCIS (Netherlands)

    Bruynzeel, I.; Koopman, G.; van der Raaij, L. M.; Pals, S. T.; Willemze, R.

    1993-01-01

    Close contact between T lymphocytes and keratinocytes is an important feature of many inflammatory skin diseases. In vitro studies showed that stimulation of keratinocytes with interferon-gamma or tumor necrosis factor-alpha and of T cells with phorbol esters results in a leukocyte

  11. PAX2 regulates ADAM10 expression and mediates anchorage-independent cell growth of melanoma cells.

    Directory of Open Access Journals (Sweden)

    Sophia Boyoung Lee

    Full Text Available PAX transcription factors play an important role during development and carcinogenesis. In this study, we investigated PAX2 protein levels in melanocytes and melanoma cells by Western Blot and immunofluorescence analysis and characterized the role of PAX2 in the pathogenesis of melanoma. In vitro we found weak PAX2 protein expression in keratinocytes and melanocytes. Compared to melanocytes increased PAX2 protein levels were detectable in melanoma cell lines. Interestingly, in tissue sections of melanoma patients nuclear PAX2 expression strongly correlated with nuclear atypia and the degree of prominent nucleoli, indicating an association of PAX2 with a more atypical cellular phenotype. In addition, with chromatin immunoprecipitation assay, PAX2 overexpression and PAX2 siRNA we present compelling evidence that PAX2 can regulate ADAM10 expression, a metalloproteinase known to play important roles in melanoma metastasis. In human tissue samples we found co-expression of PAX2 and ADAM10 in melanocytes of benign nevi and in melanoma cells of patients with malignant melanoma. Importantly, the downregulation of PAX2 by specific siRNA inhibited the anchorage independent cell growth and decreased the migratory and invasive capacity of melanoma cells. Furthermore, the downregulation of PAX2 abrogated the chemoresistance of melanoma cells against cisplatin, indicating that PAX2 expression mediates cell survival and plays important roles during melanoma progression.

  12. TCDD induces dermal accumulation of keratinocyte-derived matrix metalloproteinase-10 in an organotypic model of human skin

    Energy Technology Data Exchange (ETDEWEB)

    De Abrew, K. Nadira [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Thomas-Virnig, Christina L.; Rasmussen, Cathy A. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Bolterstein, Elyse A. [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Schlosser, Sandy J. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Allen-Hoffmann, B. Lynn, E-mail: blallenh@wisc.edu [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States)

    2014-05-01

    The epidermis of skin is the first line of defense against the environment. A three dimensional model of human skin was used to investigate tissue-specific phenotypes induced by the environmental contaminant, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Continuous treatment of organotypic cultures of human keratinocytes with TCDD resulted in intracellular spaces between keratinocytes of the basal and immediately suprabasal layers as well as thinning of the basement membrane, in addition to the previously reported hyperkeratinization. These tissue remodeling events were preceded temporally by changes in expression of the extracellular matrix degrading enzyme, matrix metalloproteinase-10 (MMP-10). In organotypic cultures MMP-10 mRNA and protein were highly induced following TCDD treatment. Q-PCR and immunoblot results from TCDD-treated monolayer cultures, as well as indirect immunofluorescence and immunoblot analysis of TCDD-treated organotypic cultures, showed that MMP-10 was specifically contributed by the epidermal keratinocytes but not the dermal fibroblasts. Keratinocyte-derived MMP-10 protein accumulated over time in the dermal compartment of organotypic cultures. TCDD-induced epidermal phenotypes in organotypic cultures were attenuated by the keratinocyte-specific expression of tissue inhibitor of metalloproteinase-1, a known inhibitor of MMP-10. These studies suggest that MMP-10 and possibly other MMP-10-activated MMPs are responsible for the phenotypes exhibited in the basement membrane, the basal keratinocyte layer, and the cornified layer of TCDD-treated organotypic cultures. Our studies reveal a novel mechanism by which the epithelial–stromal microenvironment is altered in a tissue-specific manner thereby inducing structural and functional pathology in the interfollicular epidermis of human skin. - Highlights: • TCDD causes hyperkeratosis and basement membrane changes in a model of human skin. • TCDD induces MMP-10 expression in organotypic cultures

  13. PER, a Circadian Clock Component, Mediates the Suppression of MMP-1 Expression in HaCaT Keratinocytes by cAMP.

    Science.gov (United States)

    Yeom, Miji; Lee, HansongI; Shin, Seoungwoo; Park, Deokhoon; Jung, Eunsun

    2018-03-23

    Skin circadian clock system responds to daily changes, thereby regulating skin functions. Exposure of the skin to UV irradiation induces the expression of matrix metalloproteinase-1 (MMP-1) and causes DNA damage. It has been reported both DNA repair and DNA replication are regulated by the circadian clock in mouse skin. However, the molecular link between circadian clock and MMP-1 has little been investigated. We found PERIOD protein, a morning clock component, represses the expression of MMP-1 in human keratinocytes by using a PER-knockdown strategy. Treatment with siPer3 alleviated the suppression of MMP-1 expression induced by forskolin. Results revealed PER3 suppresses the expression of MMP-1 via cAMP signaling pathway. Additionally, we screened for an activator of PER that could repress the expression of MMP-1 using HaCaT cell line containing PER promoter-luciferase reporter gene. Results showed Lespedeza capitate extract (LCE) increased PER promoter activity. LCE inhibited the expression of MMP-1 and its effect of LCE was abolished in knockdown of PER2 or PER3, demonstrating LCE can repress the expression of MMP-1 through PER. Since circadian clock component PER can regulate MMP-1 expression, it might be a new molecular mechanism to develop therapeutics to alleviate skin aging and skin cancer.

  14. PER, a Circadian Clock Component, Mediates the Suppression of MMP-1 Expression in HaCaT Keratinocytes by cAMP

    Directory of Open Access Journals (Sweden)

    Miji Yeom

    2018-03-01

    Full Text Available Skin circadian clock system responds to daily changes, thereby regulating skin functions. Exposure of the skin to UV irradiation induces the expression of matrix metalloproteinase-1 (MMP-1 and causes DNA damage. It has been reported both DNA repair and DNA replication are regulated by the circadian clock in mouse skin. However, the molecular link between circadian clock and MMP-1 has little been investigated. We found PERIOD protein, a morning clock component, represses the expression of MMP-1 in human keratinocytes by using a PER-knockdown strategy. Treatment with siPer3 alleviated the suppression of MMP-1 expression induced by forskolin. Results revealed PER3 suppresses the expression of MMP-1 via cAMP signaling pathway. Additionally, we screened for an activator of PER that could repress the expression of MMP-1 using HaCaT cell line containing PER promoter-luciferase reporter gene. Results showed Lespedeza capitate extract (LCE increased PER promoter activity. LCE inhibited the expression of MMP-1 and its effect of LCE was abolished in knockdown of PER2 or PER3, demonstrating LCE can repress the expression of MMP-1 through PER. Since circadian clock component PER can regulate MMP-1 expression, it might be a new molecular mechanism to develop therapeutics to alleviate skin aging and skin cancer.

  15. IKKα regulates human keratinocyte migration through surveillance of the redox environment.

    Science.gov (United States)

    Lisse, Thomas S; Rieger, Sandra

    2017-03-01

    Although the functions of H 2 O 2 in epidermal wound repair are conserved throughout evolution, the underlying signaling mechanisms are largely unknown. In this study we used human keratinocytes (HEK001) to investigate H 2 O 2 -dependent wound repair mechanisms. Scratch wounding led to H 2 O 2 production in two or three cell layers at the wound margin within ∼30 min and subsequent cysteine modification of proteins via sulfenylation. Intriguingly, exogenous H 2 O 2 treatment resulted in preferential sulfenylation of keratinocytes that adopted a migratory phenotype and detached from neighboring cells, suggesting that one of the primary functions of H 2 O 2 is to stimulate signaling factors involved in cell migration. Based on previous findings that revealed epidermal growth factor receptor (EGFR) involvement in H 2 O 2 -dependent cell migration, we analyzed oxidation of a candidate upstream target, the inhibitor of κB kinase α (IKKα; encoded by CHUK ), as a mechanism of action. We show that IKKα is sulfenylated at a conserved cysteine residue in the kinase domain, which correlates with de-repression of EGF promoter activity and increased EGF expression. Thus, this indicates that IKKα promotes migration through dynamic interactions with the EGF promoter depending on the redox state within cells. © 2017. Published by The Company of Biologists Ltd.

  16. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P

    2010-02-01

    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  17. Differential responses of cells from human skin keratinocyte and bovine mammary epithelium to attack by pore-forming Staphylococcus aureus alpha-toxin.

    Science.gov (United States)

    Suriyaphol, Gunnaporn; Sarikaputi, Meena; Suriyaphol, Prapat

    2009-11-01

    Human skin keratinocytes HaCat attacked by Staphylococcus aureus alpha-toxin showed a transient drop of cellular ATP levels whereas in toxin-perforated bovine mammary epithelial cells (BMEC), the ATP levels dropped more slowly. Morphologically, during the ATP level depletion, HaCat cell developed a spacious intracellular vacuole together with the transient influx of trypan blue. WST-1 signal, which tested the function of mitochondrial enzyme in viable cells, also decreased concomitantly. On the other hand, BMEC excluded trypan blue and vacuolation was not observed throughout the experiment. We conclude that mammary epithelial cells resist the toxin better than keratinocytes. This is the first report showing that alpha-toxin enhances transient membrane permeability to large molecules, temporary vacuole formation and the transient defect of mitochondrial enzyme in viable cells without cell lysis.

  18. Epithelial cells derived from human embryonic stem cells display p16INK4A senescence, hypermotility, and differentiation properties shared by many P63+ somatic cell types

    DEFF Research Database (Denmark)

    Dabelsteen, Sally; Hercule, Paula; Barron, Patricia

    2009-01-01

    hESderK cells and keratinocytes a substantially extended lifespan. When exposed to transforming growth factor beta or to an incompletely processed form of Laminin-332, three lifespan-extended or immortalized hESderK lines that we studied became directionally hypermotile, a wound healing and invasion......(+)/K14(+) urothelial and tracheobronchial epithelial cells. Primary and immortalized lines of these cell types had growth requirements and hypermotility responses similar to keratinocytes and bmi1 expression facilitated their immortalization by engineering to express the catalytic subunit of telomerase...

  19. Attachment and growth of human keratinocytes in a serum-free environment.

    Science.gov (United States)

    Gilchrest, B A; Calhoun, J K; Maciag, T

    1982-08-01

    Using a serum-free system, we have investigated the influence of human fibronectin (HFN) and selected growth factors (GF) on the attachment and growth of normal human keratinocytes in vitro. Single-cell suspensions of keratinocytes from near-confluent primary plates, plated on 5-10 microgram/cm2 HFN, showed approximately 30-40% attachment after 2-24 hours of incubation at 37 degrees C, compared with 4-6% attachment on uncoated platic plates. Percentage of attached cells was independent of seed density, tissue donor age, in vitro culture age, or medium composition, while subsequent cellular proliferation was strongly dependent on these factors. Keratinocytes grown on an adequate HFN matrix in a previously described hormone-supplemented medium (Maciag et al., 1981a) achieved four to eight population doubling over 7-12 days at densities greater than or equal to 104 cell/cm2. Removal of most GF individually from the medium had little or no effect on growth, while removal of epidermal growth factor (EGF) alone reduced growth by 30-35% and removal of bovine brain extract (BE) alone reduced growth by approximately 90%. Conversely, EGF alone in basal medium supported approximately 10% control growth, BE alone supported 30-40% control growth, and the combination of EGF and BE approximately 70%. In addition to its major effect on proliferation in this system, BE was necessary to preserve normal keratinocyte morphology and protein production. These findings expand earlier observations that HFN facilitates keratinocyte attachment in vitro and that a brain-derived extract can exert a major positive influence on cultured keratinocytes.

  20. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors.

    Science.gov (United States)

    Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

    2014-10-15

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Differential effects of the extracellular microenvironment on human embryonic stem cell differentiation into keratinocytes and their subsequent replicative life span.

    Science.gov (United States)

    Movahednia, Mohammad Mehdi; Kidwai, Fahad Karim; Zou, Yu; Tong, Huei Jinn; Liu, Xiaochen; Islam, Intekhab; Toh, Wei Seong; Raghunath, Michael; Cao, Tong

    2015-04-01

    Culture microenvironment plays a critical role in the propagation and differentiation of human embryonic stem cells (hESCs) and their differentiated progenies. Although high efficiency of hESC differentiation to keratinocytes (hESC-Kert) has been achieved, little is known regarding the effects of early culture microenvironment and pertinent extracellular matrix (ECM) interactions during epidermal commitment on subsequent proliferative capacity of hESC-Kert. The aim of this study is to evaluate the effects of the different ECM microenvironments during hESC differentiation on subsequent replicative life span of hESC-Kert. In doing so, H1-hESCs were differentiated to keratinocytes (H1-Kert) in two differentiation systems. The first system employed autologous fibroblast feeder support, in which keratinocytes (H1-Kert(ACC)) were derived by coculture of hESCs with hESC-derived fibroblasts (H1-ebFs). The second system employed a novel decellularized matrix from H1-ebFs to create a dermoepidermal junction-like (DEJ) matrix. H1-Kert(AFF) were derived by differentiation of hESCs on the feeder-free system employing the DEJ matrix. Our study indicated that the feeder-free system with the use of DEJ matrix was more efficient in differentiation of hESCs toward epidermal progenitors. However, the feeder-free system was not sufficient to support the subsequent replicative capacity of differentiated keratinocytes. Of note, H1-Kert(AFF) showed limited replicative capacity with reduced telomere length and early cellular senescence. We further showed that the lack of cell-cell interactions during epidermal commitment led to heightened production of TGF-β1 by hESC-Kert during extended culture, which in turn was responsible for resulting in the limited replicative life span with cellular senescence of hESC-Kert derived under the feeder-free culture system. This study highlights for the first time the importance of the culture microenvironment and cell-ECM interactions during

  2. Asymmetric migration of human keratinocytes under mechanical stretch and cocultured fibroblasts in a wound repair model.

    Directory of Open Access Journals (Sweden)

    Dongyuan Lü

    Full Text Available Keratinocyte migration during re-epithelization is crucial in wound healing under biochemical and biomechanical microenvironment. However, little is known about the underlying mechanisms whereby mechanical tension and cocultured fibroblasts or keratinocytes modulate the migration of keratinocytes or fibroblasts. Here we applied a tensile device together with a modified transwell assay to determine the lateral and transmembrane migration dynamics of human HaCaT keratinocytes or HF fibroblasts. A novel pattern of asymmetric migration was observed for keratinocytes when they were cocultured with non-contact fibroblasts, i.e., the accumulative distance of HaCaT cells was significantly higher when moving away from HF cells or migrating from down to up cross the membrane than that when moving close to HF cells or when migrating from up to down, whereas HF migration was symmetric. This asymmetric migration was mainly regulated by EGF derived from fibroblasts, but not transforming growth factor α or β1 production. Mechanical stretch subjected to fibroblasts fostered keratinocyte asymmetric migration by increasing EGF secretion, while no role of mechanical stretch was found for EGF secretion by keratinocytes. These results provided a new insight into understanding the regulating mechanisms of two- or three-dimensional migration of keratinocytes or fibroblasts along or across dermis and epidermis under biomechanical microenvironment.

  3. Flow cytometry of human primary epidermal and follicular keratinocytes.

    Science.gov (United States)

    Gragnani, Alfredo; Ipolito, Michelle Zampieri; Sobral, Christiane S; Brunialti, Milena Karina Coló; Salomão, Reinaldo; Ferreira, Lydia Masako

    2008-02-19

    The aim of this study was to characterize using flow cytometry cultured human primary keratinocytes isolated from the epidermis and hair follicles by different methods. Human keratinocytes derived from discarded fragments of total skin and scalp hair follicles from patients who underwent plastic surgery in the Plastic Surgery Division at UNIFESP were used. The epidermal keratinocytes were isolated by using 3 different methods: the standard method, upon exposure to trypsin for 30 minutes; the second, by treatment with dispase for 18 hours and with trypsin for 10 minutes; and the third, by treatment with dispase for 18 hours and with trypsin for 30 minutes. Follicular keratinocytes were isolated using the standard method. On comparing the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with dispase for 18 hours and with trypsin for 30 minutes, it was observed that the first group presented the largest number of viable cells, the smallest number of cells in late apoptosis and necrosis with statistical significance, and no difference in apoptosis. When we compared the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with trypsin, the first group presented the largest number of viable cells, the smallest number of cells in apoptosis with statistical significance, and no difference in late apoptosis and necrosis. When we compared the results of the group treated with dispase for 18 hours and with trypsin for 10 minutes with the results for follical isolation, there was a statistical difference in apoptosis and viable cells. The isolation method of treatment with dispase for 18 hours and with trypsin for 10 minutes produced the largest number of viable cells and the smallest number of cells in apoptosis/necrosis.

  4. Proteomic profiling of human keratinocytes undergoing UVB-induced alternative differentiation reveals TRIpartite Motif Protein 29 as a survival factor.

    Directory of Open Access Journals (Sweden)

    Véronique Bertrand-Vallery

    Full Text Available BACKGROUND: Repeated exposures to UVB of human keratinocytes lacking functional p16(INK-4a and able to differentiate induce an alternative state of differentiation rather than stress-induced premature senescence. METHODOLOGY/PRINCIPAL FINDINGS: A 2D-DIGE proteomic profiling of this alternative state of differentiation was performed herein at various times after the exposures to UVB. Sixty-nine differentially abundant protein species were identified by mass spectrometry, many of which are involved in keratinocyte differentiation and survival. Among these protein species was TRIpartite Motif Protein 29 (TRIM29. Increased abundance of TRIM29 following UVB exposures was validated by Western blot using specific antibody and was also further analysed by immunochemistry and by RT-PCR. TRIM29 was found very abundant in keratinocytes and reconstructed epidermis. Knocking down the expression of TRIM29 by short-hairpin RNA interference decreased the viability of keratinocytes after UVB exposure. The abundance of involucrin mRNA, a marker of late differentiation, increased concomitantly. In TRIM29-knocked down reconstructed epidermis, the presence of picnotic cells revealed cell injury. Increased abundance of TRIM29 was also observed upon exposure to DNA damaging agents and PKC activation. The UVB-induced increase of TRIM29 abundance was dependent on a PKC signaling pathway, likely PKCdelta. CONCLUSIONS/SIGNIFICANCE: These findings suggest that TRIM29 allows keratinocytes to enter a protective alternative differentiation process rather than die massively after stress.

  5. Activation of human gingival epithelial cells by cell-surface components of black-pigmented bacteria: augmentation of production of interleukin-8, granulocyte colony-stimulating factor and granulocyte-macrophage colony-stimulating factor and expression of intercellular adhesion molecule 1.

    Science.gov (United States)

    Sugiyama, A; Uehara, A; Iki, K; Matsushita, K; Nakamura, R; Ogawa, T; Sugawara, S; Takada, H

    2002-01-01

    Black-pigmented anaerobic bacteria, such as Porphyromonas gingivalis and Prevotella intermedia, are amongst the predominant bacteria in periodontal pockets and have been implicated in periodontal diseases. To elucidate the roles of gingival keratinocytes, which are the first cells encountered by oral bacteria in periodontal diseases, human gingival keratinocytes in primary culture were stimulated with cell-surface components of P gingivalis and Pr. intermedia. A glycoprotein fraction from Pr. intermedia (PGP) clearly augmented the release of interleukin-8, granulocyte colony-stimulating factor and granulocyte-macrophage colony-stimulating factor, as determined by enzyme-linked immunosorbent assay. This PGP also induced expression of intercellular adhesion molecule-1 (ICAM-1), as determined by flow cytometry. The augmentation of mRNA expression for these molecules was also confirmed by reverse transcription PCR. In contrast, lipopolysaccharide (LPS) from Pr. intermedia and Escherichia coli was completely inactive in these assays. LPS fraction and purified fimbriae from P gingivalis exhibited weak activities. Cytokine production and ICAM-1 expression by gingival keratinocytes might cause accumulation and activation of neutrophils in the epithelium and, therefore, may be involved in the initiation and development of inflammation in periodontal tissues.

  6. Smad4 disruption accelerates keratinocyte reepithelialization in murine cutaneous wound repair.

    Science.gov (United States)

    Yang, Leilei; Li, Wenlong; Wang, Shaoxia; Wang, Lijuan; Li, Yang; Yang, Xiao; Peng, Ruiyun

    2012-10-01

    Keratinocyte reepithelialization is a rate-limiting event in cutaneous wound repair, which involves the migration and proliferation of keratinocytes to cover the denuded dermal surface. Transforming growth factor-β1 (TGF-β1) has the ability to induce epithelial cell migration while inhibiting proliferation, and controversial results have been generated regarding the effect of TGF-β signaling on reepithelialization. In this study, full-thickness skin wounds were made in keratinocyte-specific Smad4 knockout and the control mice. The wound closure, reepithelialization, keratinocyte proliferation, myofibroblast numbers and collagen deposition of were assessed. The results showed that the proliferation of keratinocytes increased, which accelerated the reepithelialization, and led to faster wound repair in the epidermis of Smad4 mutant mice. Upregulation of keratin 17, 14-3-3 sigma and phosphorylated AKT in the hyperproliferative epidermis may be correlated with the accelerated reepithelialization. We conclude that Smad4 plays an inhibitory role in the keratinocyte-mediated reepithelialization of wound healing.

  7. Ski protein levels increase during in vitro progression of HPV16-immortalized human keratinocytes and in cervical cancer

    International Nuclear Information System (INIS)

    Chen, Yi; Pirisi, Lucia; Creek, Kim E.

    2013-01-01

    We compared the levels of the Ski oncoprotein, an inhibitor of transforming growth factor-beta (TGF-β) signaling, in normal human keratinocytes (HKc), HPV16 immortalized HKc (HKc/HPV16), and differentiation resistant HKc/HPV16 (HKc/DR) in the absence and presence of TGF-β. Steady-state Ski protein levels increased in HKc/HPV16 and even further in HKc/DR, compared to HKc. TGF-β treatment of HKc, HKc/HPV16, and HKc/DR dramatically decreased Ski. TGF-β-induced Ski degradation was delayed in HKc/DR. Ski and phospho-Ski protein levels are cell cycle dependent with maximal Ski expression and localization to centrosomes and mitotic spindles during G2/M. ShRNA knock down of Ski in HKc/DR inhibited cell proliferation. More intense nuclear and cytoplasmic Ski staining and altered Ski localization were found in cervical cancer samples compared to adjacent normal tissue in a cervical cancer tissue array. Overall, these studies demonstrate altered Ski protein levels, degradation and localization in HPV16-transformed human keratinocytes and in cervical cancer. - Highlights: • Ski oncoprotein levels increase during progression of HPV16-transformed cells. • Ski and phospho-Ski protein levels are cell cycle dependent. • Ski knock-down in HPV16-transformed keratinocytes inhibited cell proliferation. • Cervical cancer samples overexpress Ski

  8. Expression of C4.4A in an in Vitro Human Tissue-Engineered Skin Model

    DEFF Research Database (Denmark)

    Jacobsen, Benedikte; Larouche, Danielle; Rochette-Drouin, Olivier

    2017-01-01

    , the biological function of C4.4A remains unknown. To enable further studies, we evaluated the expression of C4.4A in monolayer cultures of normal human keratinocytes and in tissue-engineered skin substitutes (TESs) produced by the self-assembly approach, which allow the formation of a fully differentiated...... epidermis tissue. Results showed that, in monolayer, C4.4A was highly expressed in the centre of keratinocyte colonies at cell-cell contacts areas, while some cells located at the periphery presented little C4.4A expression. In TES, emergence of C4.4A expression coincided with the formation of the stratum...

  9. No evidence for induction of key components of the Notch signaling pathway (Notch-1, Jagged-1) by treatment with UV-B, 1,25(OH)(2)D(3), and/or epigenetic drugs (TSA, 5-Aza) in human keratinocytes in vitro.

    Science.gov (United States)

    Reichrath, Sandra; Reichrath, Jörg

    2012-01-01

    Notch signaling is of high importance for growth and survival of various cell types. We now analyzed the protein expression of two key components of the Notch signaling pathway (Notch-1, Jagged-1) in spontaneously immortalized (HaCaT) and in malignant (SCL-1) human keratinocytes, using western analysis. We found that Notch-1 and its corresponding ligand Jagged-1 are expressed in both cell lines, with no marked change following UV-B treatment. Moreover, treatment of both cell lines before or after UV-B irradiation with 1,25-dihydroxyvitamin D(3), the biologically active form of vitamin D, and/or epigenetic modulating drugs (TSA; 5-Aza) did not result in a marked modulation of the protein expression of Notch-1 or Jagged-1. Under the experimental conditions of this study, treatment with 1,25(OH)(2)D(3) protected human keratinocytes in part against the antiproliferative effects of UV-B-radiation. In conclusion, our findings do not point at a differential expression of these two key components of Notch signaling in non-malignant as compared to malignant human keratinocytes, indicating that alterations in their expression are not of importance for the photocarcinogenesis of human squamous cell carcinomas. Moreover, our findings do not support the hypothesis that modulation of Notch signaling may be involved in the photoprotective effect of 1,25-dihydroxyvitamin D(3), that we and others reported previously. Additionally, we demonstrate that epigenetic modulating drugs (TSA, 5-Aza) do not markedly modulate the expression Notch-1 or Jagged-1 in UV-B-treated human keratinocytes in vitro.

  10. Biochemical mechanisms of skin radiation burns inhibition and healing by the volumetric autotransplantation of fibroblasts and of keratinocytes with fibroblasts composition

    Directory of Open Access Journals (Sweden)

    L. V. Altukhova

    2015-09-01

    Full Text Available Mechanisms of influence of volumetric autotransplantation of fibroblasts and of the mixture of fibroblasts and keratinocytes on the development of the local 3rd degree X-ray burn and the radiation skin ulcer in guinea pigs were investigated. We used deepadministration into the irradiation zone on its perimeter of 6 doses, which contained (150–160×103 fibroblasts and (130–140×103 keratinocytes in 100 µl. It is shown that this autotransplantation carried out 1 hour after the irradiation, and then every 24 hours, reduces the area of burn on the 35th day, compared to the control by 63%. Radiation ulcer appears on the 10th day after irradiation and is completely healed on the 25th day. With the same regimen of administration of only fibroblasts containing (200–210×103 cells in 100 µl, these parameters of treatment were equal to 31% on 4th and 35th day, respectively. It is shown that as a result of radiation in the area of burn the level of gene expression of collagen types I and III, elastin, fibronectin, vinculin, decorin, hyaluronansynthases 1, 2, 3, matrix metalloproteinases 1, 2, 3, 7, 9 and hyaluronidase is reduced. Besides, in the burn area the level of gene expression of transforming growth factor α, fibroblast growth factors 1, 2, 8 and anti-inflammatory cytokines – interleukin 10 and transforming growth factor-β1 – is reduced, while the level of gene expression of proinflammatory cytokine (interleykin1β increases. Both types of autotransplantation cause the growth of the expression level of all the structural genes and regulatory proteins of biopolymers and decrease in the expression level of interleukin 1β, which leads to activation of tissue regeneration and healing of the burn wound. Reasonsfor the higher efficiency of autotransplantation using the mixture of fibroblasts and keratinocytes compared to autotransplantation by fibroblasts only are both the larger total number of live cells regularly replacing dead cells in

  11. Skin equivalent tissue-engineered construct: co-cultured fibroblasts/ keratinocytes on 3D matrices of sericin hope cocoons.

    Directory of Open Access Journals (Sweden)

    Sunita Nayak

    Full Text Available The development of effective and alternative tissue-engineered skin replacements to autografts, allografts and xenografts has became a clinical requirement due to the problems related to source of donor tissue and the perceived risk of disease transmission. In the present study 3D tissue engineered construct of sericin is developed using co-culture of keratinocytes on the upper surface of the fabricated matrices and with fibroblasts on lower surface. Sericin is obtained from "Sericin Hope" silkworm of Bombyx mori mutant and is extracted from cocoons by autoclave. Porous sericin matrices are prepared by freeze dried method using genipin as crosslinker. The matrices are characterized biochemically and biophysically. The cell proliferation and viability of co-cultured fibroblasts and keratinocytes on matrices for at least 28 days are observed by live/dead assay, Alamar blue assay, and by dual fluorescent staining. The growth of the fibroblasts and keratinocytes in co-culture is correlated with the expression level of TGF-β, b-FGF and IL-8 in the cultured supernatants by enzyme-linked immunosorbent assay. The histological analysis further demonstrates a multi-layered stratified epidermal layer of uninhibited keratinocytes in co-cultured constructs. Presence of involucrin, collagen IV and the fibroblast surface protein in immuno-histochemical stained sections of co-cultured matrices indicates the significance of paracrine signaling between keratinocytes and fibroblasts in the expression of extracellular matrix protein for dermal repair. No significant amount of pro inflammatory cytokines (TNF-α, IL-1β and nitric oxide production are evidenced when macrophages grown on the sericin matrices. The results all together depict the potentiality of sericin 3D matrices as skin equivalent tissue engineered construct in wound repair.

  12. Effects of 12-O-tetradecanoyl-phorbol-13-acetate [corrected] and sodium lauryl sulfate on the production and expression of cytokines and proto-oncogenes in photoaged and intrinsically aged human keratinocytes.

    Science.gov (United States)

    Suh, D H; Youn, J I; Eun, H C

    2001-11-01

    Skin aging may be divided into photoaging and intrinsic aging. The purpose of this study was to investigate the effects of 12-O-tetradecanoyl-phorbol-13-acetate and sodium lauryl sulfate on the production and expression of cytokines and proto-oncogenes in photoaged and intrinsically aged skin, compared with young skin. Keratinocytes were taken from newborns, young adults in their twenties, and from the forearm and thigh of volunteers in their fifties and seventies. Interleukin-1alpha and -6, and interleukin-1 receptor antagonist, c-fos and c-myc were measured after cultured keratinocytes had been treated with 12-O-tetradecanoyl-phorbol-13-acetate and sodium lauryl sulfate. There has been no report concerning the dependence of cytokine production by sodium lauryl sulfate upon photoaging and intrinsic aging. This study also involves the first investigation of the effects of aging on c-myc expression by 12-O-tetradecanoyl-phorbol-13-acetate treatment. Cytokine production decreased markedly with age. These results suggest the progressive decline of cellular function with age. The ratio of cytokine production in the irritant-treated group compared with that in the control group showed a different pattern in photoaging and intrinsic aging. With the significant difference between photoaging and intrinsic aging, T/C ratio decreased in interleukin-1alpha and interleukin-1 receptor antagonist upon aging, whereas it increased in interleukin-6. S/C ratio was uniquely elevated on photoaged skin in the 50 y age group. It is suggested that photoaged skin shows an exaggerated reaction to surfactant. Compared with the control, c-fos expression in 12-O-tetradecanoyl-phorbol-13-acetate-treated keratinocytes decreased with age in the thigh, but increased in the photoaged skin of forearm. The increased c-fos expression in 12-O-tetradecanoyl-phorbol-13-acetate-treated keratinocytes could be relevant for the predisposition of photoaged keratinocytes to malignant transformation.

  13. Inhibition of Connexin 26/43 and Extracellular-Regulated Kinase Protein Plays a Critical Role in Melatonin Facilitated Gap Junctional Intercellular Communication in Hydrogen Peroxide-Treated HaCaT Keratinocyte Cells

    Directory of Open Access Journals (Sweden)

    Hyo-Jung Lee

    2012-01-01

    Full Text Available Though melatonin was known to regulate gap junctional intercellular communication (GJIC in chick astrocytes and mouse hepatocytes, the underlying mechanism by melatonin was not elucidated in hydrogen peroxide- (H2O2- treated HaCaT keratinocyte cells until now. In the current study, though melatonin at 2 mM and hydrogen peroxide (H2O2 at 300 μM showed weak cytotoxicity in HaCaT keratinocyte cells, melatonin significantly suppressed the formation of reactive oxygen species (ROS in H2O2-treated HaCaT cells compared to untreated controls. Also, the scrape-loading dye-transfer assay revealed that melatonin enhances the intercellular communication by introducing Lucifer Yellow into H2O2-treated cells. Furthermore, melatonin significantly enhanced the expression of connexin 26 (Cx26 and connexin 43 (Cx43 at mRNA and protein levels, but not that of connexin 30 (Cx30 in H2O2-treated HaCaT cells. Of note, melatonin attenuated the phosphorylation of extracellular signal-regulated protein kinases (ERKs more than p38 MAPK or JNK in H2O2-treated HaCaT cells. Conversely, ERK inhibitor PD98059 promoted the intercellular communication in H2O2-treated HaCaT cells. Furthermore, combined treatment of melatonin (200 μM and vitamin C (10 μg/mL significantly reduced ROS production in H2O2-treated HaCaT cells. Overall, these findings support the scientific evidences that melatonin facilitates gap junctional intercellular communication in H2O2-treated HaCaT keratinocyte cells via inhibition of connexin 26/43 and ERK as a potent chemopreventive agent.

  14. Epidermal cell-shape regulation and subpopulation kinetics during butyrate-induced terminal maturation of normal and SV40-transformed human keratinocytes: epithelial models of differentiation therapy.

    Science.gov (United States)

    Staiano-Coico, L; Steinberg, M; Higgins, P J

    1990-10-15

    Recent data indicate that malignant human epidermal cells may be appropriate targets for sodium butyrate (NaB)-mediated differentiation therapy. The response of pre- and post-crisis populations of SV40-transformed human keratinocytes (SVKs) to this differentiation-inducing agent was assessed, therefore, within the framework of NaB-directed normal human keratinocyte (NHK) maturation. NaB augmented cornified envelope (CE) production in NHK and pre-crisis SVK cultures; the time-course and efficiency of induced maturation were similar in the 2 cell systems. In NHKs, the percentage of amplifying ("B" substate) cells decreased with time in NaB correlating with increases in both "C" stage keratinocytes and CEs. The latter formed over one or 2 layers of nucleated basal-like cells. Inductions were accompanied by immediate cell cycle blocks (in both the G1 and G2/M phases), reorganization within the actin cytoskeleton, and transient early increases in cellular actin content. Increased NHK and pre-crisis SVK cytoskeletal-associated actin reached a maximum approximately 48 hr after NaB addition and preceded development of CEs. The CE precursors, thus, probably reside in the "B" substate. Post-crisis SVKs, in contrast, were refractive to NaB-induced terminal maturation or cell-cycle perturbation, failed to initiate actin filament rearrangements, and retained a basal cell-like phenotype. Stable transformation of human SVKs in post-crisis phase, therefore, appears to be associated with loss of maturation "competence" within the "B" keratinocyte subpopulation.

  15. Expression and purification of recombinant truncated human keratinocyte growth factor-1

    International Nuclear Information System (INIS)

    Deng Lin; Ma Jisheng; Liu Xiaoju; Wang Xiaojie; Li Xiaokun; Gong Shouliang; Wang Huiyan; Tian Haishan

    2010-01-01

    Objective: To construct the genetic engineering bacteria highly expressing 23 amino acids human keratinocyte growth factor-1 (rhKGF1 dest23 ) missing N terminal, and provide experimental data for development of new drug for treatment of oral mucositis after radiotherapy and chemotherapy. Methods: PCR was used to synthese 23 amino acids rhKGF1 dest23 missing N terminal and sumo gene fragments, and construct four kinds of recombinant prokaryotic expression vectors: pET22b-rhKGF1 dest23 , pET22b-sumo-rhKGF1 dest23 , pET3c-rhKGF1 dest23 and pET3c-sumo-rhKGF1 dest23 , then they were transformed into prokaryotic expression host bacteria: Rosetta (DE3) plysS, BL21 (DE3), BL21 (DE3) Star plysS, origima(DE3) and BL21AI, the best expression combination of plasmid and host strain of rhKGF1 dest23 protein was screened and purified by CM ion-exchange and heparin affinity chromatography and identified with Western blotting. Results: pET22b-rhKGF1 dest23 plasmid and the BL21AI host bacteria was the best combination of expression, after induced by IPTG and arabinose, the majority of recombinant protein was expressed in soluble form, accounting for about 12% of the total bacterial proteins. Its purity reached to more than 95% of the protein after two steps chromatography, then conformed with Western blotting. Conclusion: Human genetic engineering bacteria of KGF1 dest23 is successfully constructed and induced by IPTG and arabinose, then after CM weak cation exchange and heparin affinity chromatography, the purified rhKGF1 dest23 protein is obtained. (authors)

  16. Adenovirus vector expressing keratinocyte growth factor using CAG promoter impairs pulmonary function of mice with elastase-induced emphysema.

    Science.gov (United States)

    Oki, Hiroshi; Yazawa, Takuya; Baba, Yasuko; Kanegae, Yumi; Sato, Hanako; Sakamoto, Seiko; Goto, Takahisa; Saito, Izumu; Kurahashi, Kiyoyasu

    2017-07-01

    Pulmonary emphysema impairs quality of life and increases mortality. It has previously been shown that administration of adenovirus vector expressing murine keratinocyte growth factor (KGF) before elastase instillation prevents pulmonary emphysema in mice. We therefore hypothesized that therapeutic administration of KGF would restore damage to lungs caused by elastase instillation and thus improve pulmonary function in an animal model. KGF expressing adenovirus vector, which prevented bleomycin-induced pulmonary fibrosis in a previous study, was constructed. Adenovirus vector (1.0 × 10 9 plaque-forming units) was administered intratracheally one week after administration of elastase into mouse lungs. One week after administration of KGF-vector, exercise tolerance testing and blood gas analysis were performed, after which the lungs were removed under deep anesthesia. KGF-positive pneumocytes were more numerous, surfactant protein secretion in the airspace greater and mean linear intercept of lungs shorter in animals that had received KGF than in control animals. Unexpectedly, however, arterial blood oxygenation was worse in the KGF group and maximum running speed, an indicator of exercise capacity, had not improved after KGF in mice with elastase-induced emphysema, indicating that KGF-expressing adenovirus vector impaired pulmonary function in these mice. Notably, vector lacking KGF-expression unit did not induce such impairment, implying that the KGF expression unit itself may cause the damage to alveolar cells. Possible involvement of the CAG promoter used for KGF expression in impairing pulmonary function is discussed. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

  17. Cyr61/CCN1 induces CCL20 production by keratinocyte via activating p38 and JNK/AP-1 pathway in psoriasis.

    Science.gov (United States)

    Li, Huidan; Li, Haichuan; Huo, Rongfen; Wu, Pinru; Shen, Zhengyu; Xu, Hui; Shen, Baihua; Li, Ningli

    2017-10-01

    Psoriasis is a common chronic skin disease characterized by epidermal hyperplasia and inflammation. Cysteine-rich angiogenic inducer 61 (Cyr61/CCN1) has recently been implicated in psoriasis pathogenesis by promoting keratinocyte activation. However, the mechanisms by which CCN1 enhances cutaneous inflammation are not fully understood. In this study, we investigated the role of CCN1 on the expression of CCL20 in human keratinocyte. By double-label immunofluorescence staining, we first identified that the expression of CCN1 colocalized well with CCL20 production in the epidermis of psoriasis skin lesion. Furthermore, in vivo, blocking or knockdown CCN1 expression ameliorated skin inflammation and reduced the expression of CCL20 in both imiquimod and IL-23-induced psoriasis-like mouse models, which indicated that CCN1 might be involved in the regulation of CCL20 production in psoriasis. Next, in vitro, we stimulated primary normal human epidermal keratinocyte (NHEK) with exogenous protein CCN1 and found that CCN1 directly upregulated CCL20 production independent of TNF-α, IL-22 and IL-17 pathway. Lastly, the signaling pathway study showed that CCN1 enhanced the binding of AP-1 to the CCL20 promoter via crosstalk with p38 and JNK. Our study demonstrates that CCN1 stimulates CCL20 production in vitro and in vivo, and thus supports the notion that overexpressed CCN1 in hyperproliferating keratinocyte is functionally involved in the recruitment of inflammatory cells to skin lesions affected by psoriasis. Copyright © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.

  18. Expression and analysis of exogenous proteins in epidermal cells.

    Science.gov (United States)

    Dagnino, Lina; Ho, Ernest; Chang, Wing Y

    2010-01-01

    In this chapter we review protocols for transient transfection of primary keratinocytes. The ability to transfect primary epidermal cells regardless of their differentiation status allows the biochemical and molecular characterization of multiple proteins. We review methods to analyze exogenous protein abundance in transfected keratinocytes by immunoblot and immunoprecipitation. We also present protocols to determine the subcellular distribution of these proteins by indirect immunofluorescence microscopy approaches.

  19. The extracellular adherence protein (Eap) of Staphylococcus aureus acts as a proliferation and migration repressing factor that alters the cell morphology of keratinocytes.

    Science.gov (United States)

    Eisenbeis, Janina; Peisker, Henrik; Backes, Christian S; Bur, Stephanie; Hölters, Sebastian; Thewes, Nicolas; Greiner, Markus; Junker, Christian; Schwarz, Eva C; Hoth, Markus; Junker, Kerstin; Preissner, Klaus T; Jacobs, Karin; Herrmann, Mathias; Bischoff, Markus

    2017-02-01

    Staphyloccocus aureus is a major human pathogen and a common cause for superficial and deep seated wound infections. The pathogen is equipped with a large arsenal of virulence factors, which facilitate attachment to various eukaryotic cell structures and modulate the host immune response. One of these factors is the extracellular adherence protein Eap, a member of the "secretable expanded repertoire adhesive molecules" (SERAM) protein family that possesses adhesive and immune modulatory properties. The secreted protein was previously shown to impair wound healing by interfering with host defense and neovascularization. However, its impact on keratinocyte proliferation and migration, two major steps in the re-epithelialization process of wounds, is not known. Here, we report that Eap affects the proliferation and migration capacities of keratinocytes by altering their morphology and adhesive properties. In particular, treatment of non-confluent HaCaT cell cultures with Eap resulted in cell morphology changes as well as a significant reduction in cell proliferation and migration. Eap-treated HaCaT cells changed their appearance from an oblong via a trapezoid to an astral-like shape, accompanied by decreases in cell volume and cell stiffness, and exhibited significantly increased cell adhesion. Eap had a similar influence on endothelial and cancer cells, indicative for a general effect of Eap on eukaryotic cell morphology and functions. Specifically, Eap was found to interfere with growth factor-stimulated activation of the mitogen-activated protein kinase (MAPK) pathway that is known to be responsible for cell shape modulation, induction of proliferation and migration of epithelial cells. Western blot analyses revealed that Eap blocked the phosphorylation of extracellular signal-regulated kinase 1 and 2 (Erk1/2) in keratinocyte growth factor (KGF)-stimulated HaCaT cells. Together, these data add another antagonistic mechanism of Eap in wound healing, whereby the

  20. Immunohistochemical detection of cytochrome P450 isoenzymes in cultured human epidermal cells.

    Science.gov (United States)

    Van Pelt, F N; Meierink, Y J; Blaauboer, B J; Weterings, P J

    1990-12-01

    We used specific monoclonal antibodies (MAb) to human cytochrome P450 isoenzymes to determine the presence of these proteins in human epidermal cells. Two MAb (P450-5 and P450-8) recognize major forms of hepatic cytochrome P450 involved in biotransformation of xenobiotics. A third MAb, to cytochrome P450-9, is not fully characterized. The proteins were determined by the indirect immunoperoxidase technique after fixation with methanol and acetone. Biopsy materials for cultured keratinocytes, i.e., foreskin and hair follicles, contained the two major forms of cytochrome P450. In cultured keratinocytes derived from hair follicles the proteins were undetectable, whereas the keratinocytes derived from foreskin continued to express the two major forms of hepatic cytochrome P450. Cultured human fibroblasts and a human keratinocyte cell line (SVK14) showed staining similar to that of the foreskin keratinocytes. Cytochrome P450-9 was detectable only in human hepatocytes. The results indicate that, under the culture conditions applied, cultured human foreskin cells and the cell line SVK14 continue to express specific cytochrome P450 isoenzymes in culture, in contrast to hair follicle keratinocytes.

  1. Additive Effects of Millimeter Waves and 2-Deoxyglucose Co-Exposure on the Human Keratinocyte Transcriptome.

    Science.gov (United States)

    Soubere Mahamoud, Yonis; Aite, Meziane; Martin, Catherine; Zhadobov, Maxim; Sauleau, Ronan; Le Dréan, Yves; Habauzit, Denis

    2016-01-01

    Millimeter Waves (MMW) will be used in the next-generation of high-speed wireless technologies, especially in future Ultra-Broadband small cells in 5G cellular networks. Therefore, their biocompatibilities must be evaluated prior to their massive deployment. Using a microarray-based approach, we analyzed modifications to the whole genome of a human keratinocyte model that was exposed at 60.4 GHz-MMW at an incident power density (IPD) of 20 mW/cm2 for 3 hours in athermic conditions. No keratinocyte transcriptome modifications were observed. We tested the effects of MMWs on cell metabolism by co-treating MMW-exposed cells with a glycolysis inhibitor, 2-deoxyglucose (2dG, 20 mM for 3 hours), and whole genome expression was evaluated along with the ATP content. We found that the 2dG treatment decreased the cellular ATP content and induced a high modification in the transcriptome (632 coding genes). The affected genes were associated with transcriptional repression, cellular communication and endoplasmic reticulum homeostasis. The MMW/2dG co-treatment did not alter the keratinocyte ATP content, but it did slightly alter the transcriptome, which reflected the capacity of MMW to interfere with the bioenergetic stress response. The RT-PCR-based validation confirmed 6 MMW-sensitive genes (SOCS3, SPRY2, TRIB1, FAM46A, CSRNP1 and PPP1R15A) during the 2dG treatment. These 6 genes encoded transcription factors or inhibitors of cytokine pathways, which raised questions regarding the potential impact of long-term or chronic MMW exposure on metabolically stressed cells.

  2. Protective Effect of the Ethyl Acetate Fraction of Sargassum muticum against Ultraviolet B–Irradiated Damage in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Jin Won Hyun

    2011-11-01

    Full Text Available The aim of this study was to investigate the cytoprotective properties of the ethyl acetate fraction of Sargassum muticum (SME against ultraviolet B (UVB-induced cell damage in human keratinocytes (HaCaT cells. SME exhibited scavenging activity toward the 1,1-diphenyl-2-picrylhydrazyl radicals and hydrogen peroxide (H2O2 and UVB-induced intracellular reactive oxygen species (ROS. SME also scavenged the hydroxyl radicals generated by the Fenton reaction (FeSO4 + H2O2, which was detected using electron spin resonance spectrometry. In addition, SME decreased the level of lipid peroxidation that was increased by UVB radiation, and restored the level of protein expression and the activities of antioxidant enzymes that were decreased by UVB radiation. Furthermore, SME reduced UVB-induced apoptosis as shown by decreased DNA fragmentation and numbers of apoptotic bodies. These results suggest that SME protects human keratinocytes against UVB-induced oxidative stress by enhancing antioxidant activity in cells, thereby inhibiting apoptosis.

  3. Cytoskeleton and pericellular matrix organization of pure adult human keratinocytes cultured from suction-blister roof epidermis.

    Science.gov (United States)

    Kariniemi, A L; Lehto, V P; Vartio, T; Virtanen, I

    1982-12-01

    Pure adult human keratinocyte cultures were raised from suction-blister roof epidermis and cultured in MCDB-151 medium. In primary culture the epidermal cells rapidly adhered, spread and began to proliferate on collagen-coated growth substrata but not on uncoated plastic or glass substrata. A fibrillar keratin-specific fluorescence, showing a typical cell-cell arrangement, was seen in all cells in indirect immunofluorescence microscopy, whereas only some cells also showed vimentin-specific staining. A fine fibrillar fibronectin-specific surface staining was seen at the margin of attaching cells and in marginal cells of spreading cell islands, whereas no fluorescence could be seen in epidermal cells, with antibodies against type IV collagen or laminin. Interestingly, the marginal cells also showed intracellular fibronectin. The synthesis of fibronectin in epidermal cell cultures could also be revealed by metabolic labelling experiments with [35S]methionine. In contrast to primary cultures, subcultivated keratinocytes also adhered to uncoated plastic and glass substrata. After subcultivation, keratin and surface fibronectin distribution remained unaltered but after some subcultivations, most of the cells also showed fibrillar vimentin and expressed fibronectin intracellularly. The results show that the suction-blister method provides an easy way to obtain pure epidermal cell cultures without contaminating mesenchymal cells. Our results also suggest a direct role for fibronectin but not for collagen type IV or laminin in adhesion and spreading of epidermal cells in vitro.

  4. ER signaling is activated to protect human HaCaT keratinocytes from ER stress induced by environmental doses of UVB

    International Nuclear Information System (INIS)

    Mera, Kentaro; Kawahara, Ko-ichi; Tada, Ko-ichi; Kawai, Kazuhiro; Hashiguchi, Teruto; Maruyama, Ikuro; Kanekura, Takuro

    2010-01-01

    Proteins are folded properly in the endoplasmic reticulum (ER). Various stress such as hypoxia, ischemia and starvation interfere with the ER function, causing ER stress, which is defined by the accumulation of unfolded protein (UP) in the ER. ER stress is prevented by the UP response (UPR) and ER-associated degradation (ERAD). These signaling pathways are activated by three major ER molecules, ATF6, IRE-1 and PERK. Using HaCaT cells, we investigated ER signaling in human keratinocytes irradiated by environmental doses of ultraviolet B (UVB). The expression of Ero1-Lα, an upstream signaling molecule of ER stress, decreased at 1-4 h after 10 mJ/cm 2 irradiation, indicating that the environmental dose of UVB-induced ER stress in HaCaT cells, without growth retardation. Furthermore, expression of intact ATF6 was decreased and it was translocated to the nuclei. The expression of XBP-1, a downstream molecule of IRE-1, which is an ER chaperone whose expression is regulated by XBP-1, and UP ubiquitination were induced by 10 mJ/cm 2 UVB at 4 h. PERK, which regulates apoptosis, was not phosphorylated. Our results demonstrate that UVB irradiation generates UP in HaCaT cells and that the UPR and ERAD systems are activated to protect cells from UVB-induced ER stress. This is the first report to show ER signaling in UVB-irradiated keratinocytes.

  5. Fisetin inhibits TNF-α-induced inflammatory action and hydrogen peroxide-induced oxidative damage in human keratinocyte HaCaT cells through PI3K/AKT/Nrf-2-mediated heme oxygenase-1 expression.

    Science.gov (United States)

    Seo, Seung-Hee; Jeong, Gil-Saeng

    2015-12-01

    Oxidative skin damage and skin inflammation play key roles in the pathogenesis of skin-related diseases. Fisetin is a naturally occurring flavonoid abundantly found in several vegetables and fruits. Fisetin has been shown to exert various positive biological effects, such as anti-cancer, anti-proliferative, neuroprotective and anti-oxidative effects. In this study, we investigate the skin protective effects and anti-inflammatory properties of fisetin in hydrogen peroxide- and TNF-α-challenged human keratinocyte HaCaT cells. When HaCaT cells were treated with non-cytotoxic concentrations of fisetin (1-20μM), heme oxygenase (HO)-1 mRNA and protein expression increased in a dose-dependent manner. Furthermore, fisetin dose-dependently increased cell viability and reduced ROS production in hydrogen peroxide-treated HaCaT cells. Fisetin also inhibited the production of NO, PGE2 IL-1β, IL-6, expression of iNOS and COX-2, and activation of NF-κB in HaCaT cells treated with TNF-α. Fisetin induced Nrf2 translocation to the nuclei. HO-1 siRNA transient transfection reversed the effects of fisetin on cytoprotection, ROS reduction, NO, PGE2, IL-1β, IL-6, and TNF-α production, and NF-κB DNA-binding activity. Moreover, fisetin increased Akt phosphorylation and a PI3K pathway inhibitor (LY294002) abolished fisetin-induced cytoprotection and NO inhibition. Taken together, these results provide evidence for a beneficial role of fisetin in skin therapy. Copyright © 2015. Published by Elsevier B.V.

  6. Gene expression studies on human keratinocytes transduced with human growth hormone gene for a possible utilization in gene therapy; Estudos da expressao genica mediante utilizacao de queratinocitos humanos normais transduzidos com o gene do hormonio de crscimento humano. Possivel utilizacao em terapia genica

    Energy Technology Data Exchange (ETDEWEB)

    Mathor, Monica Beatriz

    1994-12-31

    Taking advantage of the recent progress in the DNA-recombinant techniques and of the potentiality of normal human keratinocytes primary culture to reconstitute the epidermis, it was decided to genetically transform these keratinocytes to produce human growth hormone under controllable conditions that would be used in gene therapy at this hormone deficient patients. The first step to achieve this goal was to standardize infection of keratinocytes with retrovirus producer cells containing a construct which included the gene of bacterial b-galactosidase. The best result was obtained cultivating the keratinocytes for 3 days in a 2:1 mixture of retrovirus producer cells and 3T3-J2 fibroblasts irradiated with 60 Gy, and splitting these infected keratinocytes on 3T3-J2 fibroblasts feeder layer. Another preliminary experiment was to infect normal human keratinocytes with interleukin-6 gene (hIL-6) that, in pathologic conditions, could be reproduced by keratinocytes and secreted to the blood stream. Thus, we verify that infected keratinocytes secrete an average amount of 500 ng/10{sup 6} cell/day of cytokin during the in vitro life time, that certify the stable character of the injection. These keratinocytes, when grafted in mice, secrete hIL-6 to the blood stream reaching levels of 40 pg/ml of serum. After these preliminary experiments, we construct a retroviral vector with the human growth hormone gene (h GH) driven by human metallothionein promoter (h PMT), designated DChPMTGH. Normal human keratinocytes were infected with DChPMTGH producer cells, following previously standardized protocol, obtaining infected keratinocytes secreting to the culture media 340 ng h GH/10{sup 6} cell/day without promoter activation. This is the highest level of h GH secreted in human keratinocytes primary culture described in literature. The h GH value increases approximately 10 times after activation with 100 {mu}M Zn{sup +2} for 8-12 hours. (author). 158 refs., 42 figs., 6 tabs.

  7. Influence of extracellular matrix proteins on human keratinocyte attachment, proliferation and transfer to a dermal wound model.

    Science.gov (United States)

    Dawson, R A; Goberdhan, N J; Freedlander, E; MacNeil, S

    1996-03-01

    The aim of this study was to investigate whether prior culture of cells on ECM proteins might positively influence the performance of keratinocytes when cells are transferred to a dermal in vitro wound bed model. Keratinocytes were cultured using a method for producing cultured epithelial autografts for severely burned patients (essentially using Green's medium, a mitogen-rich medium containing fetal calf serum, cholera toxin, EGF, insulin, transferrin and triiodothyronine). Cells were cultured either on irradiated 3T3 fibroblasts (as in the standard Rheinwald and Green technique) or, alternatively, on collagen I, collagen IV, matrigel, RGD, vitronectin or fibronectin. Under these conditions matrigel, collagen I and IV enhanced initial attachment, RGD, vitronectin, fibronectin and irradiated 3T3 fibroblasts did not. Proliferation of cells was positively influenced by matrigel, collagen I and IV and irradiated 3T3 fibroblasts; of these, however, only matrigel and 3T3 fibroblasts had sustained significant effects on keratinocyte proliferation over 4 days. Cells on fibronectin showed significantly reduced proliferation. An acellular non-viable dermis was then used to mimic the homograft allodermis onto which cultured epithelial autograft sheets are grafted clinically and cells cultured on the various ECM proteins for 96 h were transferred to this in vitro wound model. None of the substrates enhanced keratinocyte performance on this model. It was concluded that under these conditions some ECM proteins can significantly affect keratinocyte attachment and, to a lesser extent, proliferation but that the culture of keratinocytes on these ECM proteins does not appear to confer any lasting benefit to the attachment of these keratinocytes to an in vitro wound-bed model.

  8. Non-thermal Plasma Activates Human Keratinocytes by Stimulation of Antioxidant and Phase II Pathways

    Science.gov (United States)

    Schmidt, Anke; Dietrich, Stephan; Steuer, Anna; Weltmann, Klaus-Dieter; von Woedtke, Thomas; Masur, Kai; Wende, Kristian

    2015-01-01

    Non-thermal atmospheric pressure plasma provides a novel therapeutic opportunity to control redox-based processes, e.g. wound healing, cancer, and inflammatory diseases. By spatial and time-resolved delivery of reactive oxygen and nitrogen species, it allows stimulation or inhibition of cellular processes in biological systems. Our data show that both gene and protein expression is highly affected by non-thermal plasma. Nuclear factor erythroid-related factor 2 (NRF2) and phase II enzyme pathway components were found to act as key controllers orchestrating the cellular response in keratinocytes. Additionally, glutathione metabolism, which is a marker for NRF2-related signaling events, was affected. Among the most robustly increased genes and proteins, heme oxygenase 1, NADPH-quinone oxidoreductase 1, and growth factors were found. The roles of NRF2 targets, investigated by siRNA silencing, revealed that NRF2 acts as an important switch for sensing oxidative stress events. Moreover, the influence of non-thermal plasma on the NRF2 pathway prepares cells against exogenic noxae and increases their resilience against oxidative species. Via paracrine mechanisms, distant cells benefit from cell-cell communication. The finding that non-thermal plasma triggers hormesis-like processes in keratinocytes facilitates the understanding of plasma-tissue interaction and its clinical application. PMID:25589789

  9. Mannosides as crucial part of bioactive supports for cultivation of human epidermal keratinocytes without feeder cells

    Czech Academy of Sciences Publication Activity Database

    Labský, Jiří; Dvořánková, B.; Smetana, Karel; Holíková, Z.; Brož, L.; Gabius, H.J.

    2003-01-01

    Roč. 24, č. 5 (2003), s. 863-872 ISSN 0142-9612 R&D Projects: GA ČR GA203/00/1310; GA MŠk LN00A065; GA MZd ND6340 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy * keratinocyte * mannose Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.903, year: 2003

  10. Extracellular calcium alters the effects of retinoic acid on DNA synthesis in cultured murine keratinocytes

    International Nuclear Information System (INIS)

    Tong, P.; Mayes, D.; Wheeler, L.

    1986-01-01

    The rate of proliferation of epidermal keratinocytes was manipulated by growing the cells in medium containing high or low concentrations of calcium. Keratinocytes cultured in high extracellular Ca ++ (1.4 mM and 2.8 mM) proliferated twice as fast as those grown in low Ca ++ medium (0.09 mM) as measured by incorporation of [ 3 H] thymidine into DNA. Exposure of high calcium keratinocytes to all-trans retinoic acid for 4 days caused a dose-related inhibition of DNA synthesis with an IC 50 of about 10 μM. In contrast, incubating low calcium keratinocytes with all-trans retinoic acid caused a dose-related stimulation of DNA synthesis with maximum increase of 278% over control at 10 μM. This increase was accompanied by increases in culture confluency with maximum increase of 109% in cell number of control at 10 μM. These results are of importance since they suggest Ca ++ may influence the effect of retinoids on keratinocytes

  11. The incidence and multiplicity rates of keratinocyte cancers in Australia.

    Science.gov (United States)

    Pandeya, Nirmala; Olsen, Catherine M; Whiteman, David C

    2017-10-16

    To assess the incidence and multiplicity of keratinocyte cancers (basal cell carcinoma [BCC] and squamous cell carcinoma [SCC]) excised in Australia, and to examine variations by age, sex, state, and prior skin cancer history. Analysis of individual-level Medicare data for keratinocyte cancer treatments (identified by eight specific MBS item codes) during 2011-2014. Histological data from the QSkin prospective cohort study were analysed to estimate BCC and SCC incidence. A 10% systematic random sample of all people registered with Medicare during 1997-2014. People aged at least 20 years in 2011 who made at least one claim for any MBS medical service during 2011-2014 (1 704 193 individuals). Age-standardised incidence rates (ASRs) and standardised incidence ratios (SIRs). The person-based incidence of keratinocyte cancer excisions in Australia was 1531 per 100 000 person-years; incidence increased with age, and was higher for men than women (SIR, 1.43; 95% CI, 1.42-1.45). Lesion-based incidence was 3154 per 100 000 person-years. The estimated ASRs for BCC and SCC were 770 per 100 000 and 270 per 100 000 person-years respectively. During 2011-2014, 3.9% of Australians had one keratinocyte cancer excised, 2.7% had more than one excised; 74% of skin cancers were excised from patients who had two or more lesions removed. Multiplicity was strongly correlated with age; most male patients over 70 were treated for multiple lesions. Keratinocyte cancer incidence was eight times as high among people with a prior history of excisions as among those without. The incidence and multiplicity of keratinocyte cancer in Australia are very high, causing a large disease burden that has not previously been quantified.

  12. Human T-Lymphotropic virus (HTLV type I in vivo integration in oral keratinocytes

    Directory of Open Access Journals (Sweden)

    Martha C Domínguez

    2011-03-01

    Full Text Available Although the infection of HTLV-1 to cell components of the mouth have been previously reported, there was not until this report, a detailed study to show the characteristics of such infection. From 14 Tropical Spastic Paraparesis/ HTLV-1-Associated Myelopathy (HAM/TSP patients and 11 asymptomatic carrier individuals (AC coming from HTLV-1 endemic areas of southwest Pacific of Colombia, infected oral mucosa cells were primary cultured during five days. These cell cultures were immunophenotyped by dual color fluorescence cell assortment using different lymphocyte CD markers and also were immunohistochemically processed using a polyclonal anti-keratin antibody. Five days old primary cultures were characterized as oral keratinocytes, whose phenotype was CD3- /CD4-/CD8-/CD19-/CD14-/CD45-/A575-keratin+. From DNA extracted of primary cultures LTR, pol, env and tax HTLV-1 proviral DNA regions were differentially amplified by PCR showing proviral integration. Using poly A+ RNA obtained of these primary cultures, we amplify by RT-PCR cDNA of tax and pol in 57.14% (8/14 HAM/TSP patients and 27.28% (3/11 AC. Tax and pol poly A+ RNA were expressed only in those sIgA positive subjects. Our results showed that proviral integration and viral gene expression in oral keratinocytes are associated with a HTLV-1 specific local mucosal immune response only in those HTLV-1 infected individuals with detectable levels of sIgA in their oral fluids. Altogether the results gave strong evidence that oral mucosa infection would be parte of the systemic spreading of HTLV-1 infection.

  13. Micronucleus formation in cultured human keratinocytes: Involvement of intercellular bioactivation.

    Science.gov (United States)

    van Pelt, F N; Haring, R M; Weterings, P J

    1991-01-01

    Micronucleus formation in cultured human keratinocytes was studied after exposure to benzo[a]pyrene, cyclophosphamide and 12-O-tetradecanoylphorbol-13-acetate without the addition of an exogenous metabolizing system. The first two agents need bioactivation by specific isoenzymes of cytochrome P-450 to form genotoxic intermediates. Benzo[a]pyrene induced the micronucleus formation in both uninduced and Aroclor 1254-pretreated cultures. Clastogenic effects of cyclophosphamide were observed only in Aroclor 1254-pretreated cells. The tumour promotor 12-O-tetradecanoylphorbol-13-acetate did not affect the frequency of micronuclei in human keratinocytes. The data indicate that cultured human keratinocytes can be used to study the tissue-specific response to genotoxic agents as well as interindividual variation in biotransformation capacity.

  14. Additive Effects of Millimeter Waves and 2-Deoxyglucose Co-Exposure on the Human Keratinocyte Transcriptome.

    Directory of Open Access Journals (Sweden)

    Yonis Soubere Mahamoud

    Full Text Available Millimeter Waves (MMW will be used in the next-generation of high-speed wireless technologies, especially in future Ultra-Broadband small cells in 5G cellular networks. Therefore, their biocompatibilities must be evaluated prior to their massive deployment. Using a microarray-based approach, we analyzed modifications to the whole genome of a human keratinocyte model that was exposed at 60.4 GHz-MMW at an incident power density (IPD of 20 mW/cm2 for 3 hours in athermic conditions. No keratinocyte transcriptome modifications were observed. We tested the effects of MMWs on cell metabolism by co-treating MMW-exposed cells with a glycolysis inhibitor, 2-deoxyglucose (2dG, 20 mM for 3 hours, and whole genome expression was evaluated along with the ATP content. We found that the 2dG treatment decreased the cellular ATP content and induced a high modification in the transcriptome (632 coding genes. The affected genes were associated with transcriptional repression, cellular communication and endoplasmic reticulum homeostasis. The MMW/2dG co-treatment did not alter the keratinocyte ATP content, but it did slightly alter the transcriptome, which reflected the capacity of MMW to interfere with the bioenergetic stress response. The RT-PCR-based validation confirmed 6 MMW-sensitive genes (SOCS3, SPRY2, TRIB1, FAM46A, CSRNP1 and PPP1R15A during the 2dG treatment. These 6 genes encoded transcription factors or inhibitors of cytokine pathways, which raised questions regarding the potential impact of long-term or chronic MMW exposure on metabolically stressed cells.

  15. Resveratrol-Sensitized UVA Induced Apoptosis in Human Keratinocytes through Mitochondrial Oxidative Stress and Pore Opening

    Science.gov (United States)

    Boyer, Jean Z; Jandova, Jana; Janda, Jaroslav; Vleugels, Frank R; Elliott, David; Sligh, James E

    2012-01-01

    Resveratrol (3, 5, 4′-trihydroxy- trans- stilbene), a polyphenol compound, is derived from natural products such as the skin of red grapes, blueberries and cranberries. Resveratrol not only exhibits antioxidant, cardioprotection, and anti-aging properties, but can also inhibit cancer cell growth and induce apoptosis. It has been shown that resveratrol inhibits the activation of Nf-kB and subsequently down regulates the expression of Nf-kB regulated genes such as interleukin-2 and Bcl-2, leading to cell cycle arrest and increased apoptosis in multiple myeloma cells. In the skin, resveratrol has been reported to sensitize keratinocytes to UVA induced apoptosis. However, the effect of resveratrol on opening of the mitochondrial permeability transition pore has not been previously examined. Our data show that UVA (14J/cm2) along with resveratrol causes massive oxidative stress in mitochondria. As a consequence of oxidative stress, the mitochondrial membrane potential decreases which results in opening of the mitochondrial pores ultimately leading to apoptosis in human keratinocytes. These results may have clinical implications for development of future chemotherapeutic treatment for tumors of the skin. PMID:22673012

  16. Enhanced secretion of TIMP-1 by human hypertrophic scar keratinocytes could contribute to fibrosis.

    Science.gov (United States)

    Simon, Franck; Bergeron, Daniele; Larochelle, Sébastien; Lopez-Vallé, Carlos A; Genest, Hervé; Armour, Alexis; Moulin, Véronique J

    2012-05-01

    Hypertrophic scars are a pathological process characterized by an excessive deposition of extracellular matrix components. Using a tissue-engineered reconstructed human skin (RHS) method, we previously reported that pathological keratinocytes induce formation of a fibrotic dermal matrix. We further investigated keratinocyte action using conditioned media. Results showed that conditioned media induce a similar action on dermal thickness similar to when an epidermis is present. Using a two-dimensional electrophoresis technique, we then compared conditioned media from normal or hypertrophic scar keratinocytes and determined that TIMP-1 was increased in conditioned media from hypertrophic scar keratinocytes. This differential profile was confirmed using ELISA, assaying TIMP-1 presence on media from monolayer cultured keratinocytes and from RHS. The dermal matrix of these RHS was recreated using mesenchymal cells from three different origins (skin, wound and hypertrophic scar). The effect of increased TIMP-1 levels on dermal fibrosis was also validated independently from the mesenchymal cell origin. Immunodetection of TIMP-1 showed that this protein was increased in the epidermis of hypertrophic scar biopsies. The findings of this study represent an important advance in understanding the role of keratinocytes as a direct potent modulator for matrix degradation and scar tissue remodeling, possibly through inactivation of MMPs. Copyright © 2011 Elsevier Ltd and ISBI. All rights reserved.

  17. Eradication of damaged keratinocytes in cutaneous lichen planus forms demonstrated by evaluation of epidermal and follicular expression of CK15, indices of apoptosis and regulatory protein S100.

    Science.gov (United States)

    Upeniece, Ilze; Groma, Valerie; Skuja, Sandra; Cauce, Vinita

    The study of cytoskeleton arrangement and its contribution to survival of cell-to-cell contacts appears to be essential for understanding of numerous cellular and tissue processes. Applying CK15, S100 labeling and TUNEL reaction to cutaneous lichen planus subtypes, we found CK15 expression in the outer and inner root sheath of hair follicles, the basal epidermal layer, and eccrine glands. Its follicular expression was decreased in nearby inflammatory infiltrates. The CK15 immunopositivity was mostly described as weak (92.3%) for lichen planus but equally subdivided into weak, moderate and strong in lichen planopilaris (2 = 32.514; df = 4; p lichen planopilaris involving the scalp: 81.2 ±10.7; 87.8 ±10.7 and 88.0 ±10.5 for the basal, spinous and upper epidermal layers, respectively. S100 positive epidermal and follicular cells did not differ in the lesions demonstrated in the study groups; still immunoreactivity was more pronounced in the scalp region of lichen planopilaris. Damage of cell-to-cell contacts was confirmed by electron microscopy. Apart from immunocyte-mediated keratinocyte death, cytoskeleton-based injury and loss of cell-to-cell and matrix contacts may be of great importance, leading to eradication of degrading cells and thus contributing to the pathogenesis of lichen planus.

  18. Resveratrol prevents oxidative stress-induced senescence and proliferative dysfunction by activating the AMPK-FOXO3 cascade in cultured primary human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Yasuo Ido

    Full Text Available The aging process is perceived as resulting from a combination of intrinsic factors such as changes in intracellular signaling and extrinsic factors, most notably environmental stressors. In skin, the relationship between intrinsic changes and keratinocyte function is not clearly understood. Previously, we found that increasing the activity of AMP-activated protein kinase (AMPK suppressed senescence in hydrogen peroxide (H2O2-treated human primary keratinocytes, a model of oxidative stress-induced cellular aging. Using this model in the present study, we observed that resveratrol, an agent that increases the activities of both AMPK and sirtuins, ameliorated two age-associated phenotypes: cellular senescence and proliferative dysfunction. In addition, we found that treatment of keratinocytes with Ex527, a specific inhibitor of sirtuin 1 (SIRT1, attenuated the ability of resveratrol to suppress senescence. In keeping with the latter observation, we noted that compared to non-senescent keratinocytes, senescent cells lacked SIRT1. In addition to these effects on H2O2-induced senescence, resveratrol also prevented the H2O2-induced decrease in proliferation (as indicated by 3H-thymidine incorporation in the presence of insulin. This effect was abrogated by inhibition of AMPK but not SIRT1. Compared to endothelium, we found that human keratinocytes expressed relatively high levels of Forkhead box O3 (FOXO3, a downstream target of both AMPK and SIRT1. Treatment of keratinocytes with resveratrol transactivated FOXO3 and increased the expression of its target genes including catalase. Resveratrol's effects on both senescence and proliferation disappeared when FOXO3 was knocked down. Finally, we performed an exploratory study which showed that skin from humans over 50 years old had lower AMPK activity than skin from individuals under age 20. Collectively, these findings suggest that the effects of resveratrol on keratinocyte senescence and proliferation

  19. Activation of endogenous opioid gene expression in human keratinocytes and fibroblasts by pulsed radiofrequency energy fields

    Directory of Open Access Journals (Sweden)

    Moffett J

    2012-09-01

    Full Text Available John Moffett,1 Linley M Fray,1 Nicole J Kubat21Life Science Department, 2Independent Consultant, Regenesis Biomedical Inc, Scottsdale, AZ, USABackground: Pulsed radiofrequency energy (PRFE fields are being used increasingly for the treatment of pain arising from dermal trauma. However, despite their increased use, little is known about the biological and molecular mechanism(s responsible for PRFE-mediated analgesia. In general, current therapeutics used for analgesia target either endogenous factors involved in inflammation, or act on endogenous opioid pathways.Methods and Results: Using cultured human dermal fibroblasts (HDF and human epidermal keratinocytes (HEK, we investigated the effect of PRFE treatment on factors, which are involved in modulating peripheral analgesia in vivo. We found that PRFE treatment did not inhibit cyclooxygenase enzyme activity, but instead had a positive effect on levels of endogenous opioid precursor mRNA (proenkephalin, pro-opiomelanocortin, prodynorphin and corresponding opioid peptide. In HEK cells, increases in opioid mRNA were dependent, at least in part, on endothelin-1. In HDF cells, additional pathways also appear to be involved. PRFE treatment was also followed by changes in endogenous expression of several cytokines, including increased levels of interleukin-10 mRNA and decreased levels of interleukin-1β mRNA in both cell types.Conclusion: These findings provide a new insight into the molecular mechanism underlying PRFE-mediated analgesia reported in the clinical setting.Keywords: peripheral analgesia, endogenous opioids, endothelin-1, endothelin receptor A, endothelin receptor B, pulsed radiofrequency energy field, cyclooxygenase

  20. Disruption of Spectrin-Like Cytoskeleton in Differentiating Keratinocytes by PKCδ Activation Is Associated with Phosphorylated Adducin

    Science.gov (United States)

    Zhao, Kong-Nan; Masci, Paul P.; Lavin, Martin F.

    2011-01-01

    Spectrin is a central component of the cytoskeletal protein network in a variety of erythroid and non-erythroid cells. In keratinocytes, this protein has been shown to be pericytoplasmic and plasma membrane associated, but its characteristics and function have not been established in these cells. Here we demonstrate that spectrin increases dramatically in amount and is assembled into the cytoskeleton during differentiation in mouse and human keratinocytes. The spectrin-like cytoskeleton was predominantly organized in the granular and cornified layers of the epidermis and disrupted by actin filament inhibitors, but not by anti-mitotic drugs. When the cytoskeleton was disrupted PKCδ was activated by phosphorylation on Thr505. Specific inhibition of PKCδ(Thr505) activation with rottlerin prevented disruption of the spectrin-like cytoskeleton and the associated morphological changes that accompany differentiation. Rottlerin also inhibited specific phosphorylation of the PKCδ substrate adducin, a cytoskeletal protein. Furthermore, knock-down of endogenous adducin affected not only expression of adducin, but also spectrin and PKCδ, and severely disrupted organization of the spectrin-like cytoskeleton and cytoskeletal distribution of both adducin and PKCδ. These results demonstrate that organization of a spectrin-like cytoskeleton is associated with keratinocytes differentiation, and disruption of this cytoskeleton is mediated by either PKCδ(Thr505) phosphorylation associated with phosphorylated adducin or due to reduction of endogenous adducin, which normally connects and stabilizes the spectrin-actin complex. PMID:22163289

  1. Effects of bee venom against Propionibacterium acnes-induced inflammation in human keratinocytes and monocytes.

    Science.gov (United States)

    Kim, Jung-Yeon; Lee, Woo-Ram; Kim, Kyung-Hyun; An, Hyun-Jin; Chang, Young-Chae; Han, Sang-Mi; Park, Yoon-Yub; Pak, Sok Cheon; Park, Kwan-Kyu

    2015-06-01

    Propionibacterium acnes (P. acnes) cause inflammatory acne and play an important role in the pathogenesis of acne by inducing inflammatory mediators. P. acnes contributes to the inflammatory responses of acne by activating inflammatory cells, keratinocytes and sebocytes to secrete pro-inflammatory cytokines such as tumor necrosis factor-α (TNF-α), interleukin (IL)-1β and IL-8. Bee venom has traditionally been used in the treatment of certain immune-related diseases. However, there has not yet been a robust trial to prove the therapeutic effect of bee venom in skin inflammation. The aim of the present study was to investigate anti-inflammatory properties of bee venom in skin inflammation induced by P. acnes using keratinocytes (HaCaT) and monocytes (THP-1). P. acnes is known to stimulate the production of pro-inflammatory cytokines such as IL-1, IL-8, IL-12 and TNF-α. In the present study, the production of interferon-γ (IFN-γ), IL-1β, IL-8 and TNF-α was increased by P. acnes treatment in HaCaT and THP-1 cells. By contrast, bee venom effectively inhibited the secretion of IFN-γ, IL-1β, IL-8 and TNF-α. Furthermore, P. acnes treatment activated the expression of IL-8 and toll-like receptor 2 (TLR2) in HaCaT cells. However, bee venom inhibited the expression of IL-8 and TLR2 in heat-killed P. acnes. Based on these results, it is concluded that bee venom has an effective anti-inflammatory activity against P. acnes in HaCaT and THP-1 cells. Therefore, we suggest that bee venom is an alternative treatment to antibiotic therapy of acne.

  2. Lactobacillus rhamnosus GG Inhibits the Toxic Effects of Staphylococcus aureus on Epidermal Keratinocytes

    Science.gov (United States)

    Mohammedsaeed, Walaa; McBain, Andrew J.; Cruickshank, Sheena M.

    2014-01-01

    Few studies have evaluated the potential benefits of the topical application of probiotic bacteria or material derived from them. We have investigated whether a probiotic bacterium, Lactobacillus rhamnosus GG, can inhibit Staphylococcus aureus infection of human primary keratinocytes in culture. When primary human keratinocytes were exposed to S. aureus, only 25% of the keratinocytes remained viable following 24 h of incubation. However, in the presence of 108 CFU/ml of live L. rhamnosus GG, the viability of the infected keratinocytes increased to 57% (P = 0.01). L. rhamnosus GG lysates and spent culture fluid also provided significant protection to keratinocytes, with 65% (P = 0.006) and 57% (P = 0.01) of cells, respectively, being viable following 24 h of incubation. Keratinocyte survival was significantly enhanced regardless of whether the probiotic was applied in the viable form or as cell lysates 2 h before or simultaneously with (P = 0.005) or 12 h after (P = 0.01) S. aureus infection. However, spent culture fluid was protective only if added before or simultaneously with S. aureus. With respect to mechanism, both L. rhamnosus GG lysate and spent culture fluid apparently inhibited adherence of S. aureus to keratinocytes by competitive exclusion, but only viable bacteria or the lysate could displace S. aureus (P = 0.04 and 0.01, respectively). Furthermore, growth of S. aureus was inhibited by either live bacteria or lysate but not spent culture fluid. Together, these data suggest at least two separate activities involved in the protective effects of L. rhamnosus GG against S. aureus, growth inhibition and reduction of bacterial adhesion. PMID:25015889

  3. Characterization of A Three-Dimensional Organotypic Co-Culture Skin Model for Epidermal Differentiation of Rat Adipose-Derived Stem Cells.

    Science.gov (United States)

    Ghanavati, Zeinab; Orazizadeh, Mahmoud; Bayati, Vahid; Abbaspour, Mohammad Reza; Khorsandi, Layasadat; Mansouri, Esrafil; Neisi, Niloofar

    2016-01-01

    The organotypic co-culture is a well-known technique to examine cellular interactions and their roles in stem cell proliferation and differentiation. This study aims to evaluate the effects of dermal fibroblasts (DFs) on epidermal differentiation of adipose-derived stem cells (ASCs) using a three-dimensional (3D) organotypic co- culture technique. In this experimental research study, rat DFs and ASCs were isolated and cultured separately on electrospun polycaprolactone (PCL) matrices. The PCL matrices seeded by ASCs were superimposed on to the matrices seeded by DFs in order to create a 3D organotypic co-culture. In the control groups, PCL matrices seeded by ASCs were placed on matrices devoid of DFs. After 10 days, we assessed the expressions of keratinocyte-related genes by real-time reverse transcriptase-polymerase chain reaction (RT-PCR) and expression of pan-cytokeratin protein by immunofluorescence in the differentiated keratinocyte-like cells from co- culture and control groups. Keratinocyte-like cell morphologies were also observed by scanning electron microscopy (SEM). The early, intermediate, and terminal differentiation keratinocyte markers-Cytokeratin14, Filaggrin, and Involucrin significantly expressed in the co-culture groups com- pared to the control ones (P<0.05). We observed pan-cytokeratin in keratinocyte-like cells of both groups by immunofluorescence. SEM observation of the co-culture groups showed that the differentiated keratinocyte-like cells developed a polygonal cobblestone shape, considered characteristic of keratinocytes. The 3D organotypic co-culture bilayered construct that consisted of DFs and ASCs was an effective technique for epidermal differentiation of ASCs. This co-culture might be useful for epidermal differentiation of stem cells for future applications in skin regeneration.

  4. 11β-Hydroxysteroid dehydrogenase 1 contributes to the pro-inflammatory response of keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Itoi, Saori; Terao, Mika, E-mail: mterao@derma.med.osaka-u.ac.jp; Murota, Hiroyuki; Katayama, Ichiro

    2013-10-18

    Highlights: •We investigate the role of 11β-HSD1 in skin inflammation. •Various stimuli increase expression of 11β-HSD1 in keratinocytes. •11β-HSD1 knockdown by siRNA decreases cortisol levels in media. •11β-HSD1 knockdown abrogates the response to pro-inflammatory cytokines. •Low-dose versus high-dose cortisol has opposing effects on keratinocyte inflammation. -- Abstract: The endogenous glucocorticoid, cortisol, is released from the adrenal gland in response to various stress stimuli. Extra-adrenal cortisol production has recently been reported to occur in various tissues. Skin is known to synthesize cortisol through a de novo pathway and through an activating enzyme. The enzyme that catalyzes the intracellular conversion of hormonally-inactive cortisone into active cortisol is 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1). We recently reported that 11β-HSD1 is expressed in normal human epidermal keratinocytes (NHEKs) and negatively regulates proliferation of NHEKs. In this study, we investigated the role of 11β-HSD1 in skin inflammation. Expression of 11β-HSD1 was induced by UV-B irradiation and in response to the pro-inflammatory cytokines, IL-1β and TNFα. Increased cortisol concentrations in culture media also increased in response to these stimuli. To investigate the function of increased 11β-HSD1 in response to pro-inflammatory cytokines, we knocked down 11β-HSD1 by transfecting siRNA. Production of IL-6 and IL-8 in response to IL-1β or TNFα stimulation was attenuated in NHEKs transfected with si11β-HSD1 compared with control cells. In addition, IL-1β-induced IL-6 production was enhanced in cultures containing 1 × 10{sup −13} M cortisol, whereas 1 × 10{sup −5} M cortisol attenuated production of IL-6. Thus, cortisol showed immunostimulatory and immunosuppressive activities depending on its concentration. Our results indicate that 11β-HSD1 expression is increased by various stimuli. Thus, regulation of cytosolic cortisol

  5. 11β-Hydroxysteroid dehydrogenase 1 contributes to the pro-inflammatory response of keratinocytes

    International Nuclear Information System (INIS)

    Itoi, Saori; Terao, Mika; Murota, Hiroyuki; Katayama, Ichiro

    2013-01-01

    Highlights: •We investigate the role of 11β-HSD1 in skin inflammation. •Various stimuli increase expression of 11β-HSD1 in keratinocytes. •11β-HSD1 knockdown by siRNA decreases cortisol levels in media. •11β-HSD1 knockdown abrogates the response to pro-inflammatory cytokines. •Low-dose versus high-dose cortisol has opposing effects on keratinocyte inflammation. -- Abstract: The endogenous glucocorticoid, cortisol, is released from the adrenal gland in response to various stress stimuli. Extra-adrenal cortisol production has recently been reported to occur in various tissues. Skin is known to synthesize cortisol through a de novo pathway and through an activating enzyme. The enzyme that catalyzes the intracellular conversion of hormonally-inactive cortisone into active cortisol is 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1). We recently reported that 11β-HSD1 is expressed in normal human epidermal keratinocytes (NHEKs) and negatively regulates proliferation of NHEKs. In this study, we investigated the role of 11β-HSD1 in skin inflammation. Expression of 11β-HSD1 was induced by UV-B irradiation and in response to the pro-inflammatory cytokines, IL-1β and TNFα. Increased cortisol concentrations in culture media also increased in response to these stimuli. To investigate the function of increased 11β-HSD1 in response to pro-inflammatory cytokines, we knocked down 11β-HSD1 by transfecting siRNA. Production of IL-6 and IL-8 in response to IL-1β or TNFα stimulation was attenuated in NHEKs transfected with si11β-HSD1 compared with control cells. In addition, IL-1β-induced IL-6 production was enhanced in cultures containing 1 × 10 −13 M cortisol, whereas 1 × 10 −5 M cortisol attenuated production of IL-6. Thus, cortisol showed immunostimulatory and immunosuppressive activities depending on its concentration. Our results indicate that 11β-HSD1 expression is increased by various stimuli. Thus, regulation of cytosolic cortisol concentrations

  6. Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion.

    Directory of Open Access Journals (Sweden)

    Aleksandra Piwko-Czuchra

    Full Text Available BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in their absence, while in vitro data have shown a fundamental role for these adhesion receptors in stem/progenitor cell expansion and differentiation. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate this discrepancy we generated hypomorphic mice expressing reduced beta1 integrin levels on keratinocytes that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis.

  7. Protective effect of indole-3-pyruvate against ultraviolet b-induced damage to cultured HaCaT keratinocytes and the skin of hairless mice.

    Directory of Open Access Journals (Sweden)

    Reiji Aoki

    Full Text Available Previous investigations demonstrated that pyruvate protects human keratinocytes against cell damage stemming from exposure to ultraviolet B (UVB radiation. This study endeavoured to elucidate the protective capacity of aromatic pyruvates (e.g., phenylpyruvate (PPyr, 4-hydroxyphenylpyruvate (HPPyr, and indole-3-pyruvate (IPyr against UVB-induced injury to skin cells, both in vitro and in vivo. Cultured human HaCaT keratinocytes were irradiated with UVB light (60 mJ/cm2 and maintained with or without test compounds (1-25 mM.In addition, the dorsal skin of hairless mice (HR-1 was treated with test compounds (10 μmol and exposed to UVB light (1 J/cm2 twice [corrected]. The ability of the test compounds to ameliorate UVB-induced cytotoxicity and inflammation was then assessed. Aromatic pyruvates reduced cytotoxicity in UVB-irradiated HaCaT keratinocytes, and also diminished the expression of interleukin 1β (IL-1β and interleukin 6 (IL-6. IPyr was more efficacious than either PPyr or HPPyr. Furthermore, only IPyr inhibited cyclooxygenase-2 (Cox-2 expression at both the mRNA and the protein level in UVB-treated keratinocytes. Topical application of IPyr to the dorsal skin of hairless mice reduced the severity of UVB-induced skin lesions, the augmentation of dermal thickness, and transepithelial water loss. Overproduction of IL-1β and IL-6 in response to UVB radiation was also suppressed in vivo by the topical administration of IPyr. These data strongly suggest that IPyr might find utility as a UVB-blocking reagent in therapeutic strategies to lessen UVB-induced inflammatory skin damage.

  8. Angiopoietin-related growth factor (AGF) supports adhesion, spreading, and migration of keratinocytes, fibroblasts, and endothelial cells through interaction with RGD-binding integrins

    International Nuclear Information System (INIS)

    Zhang Yueqing; Hu Xiaobo; Tian Ruiyang; Wei Wangui; Hu Wei; Chen Xia; Han Wei; Chen Huayou; Gong Yi

    2006-01-01

    Angiopoietin-related growth factor (AGF) is a newly identified member of angiopoietin-related proteins (ARPs)/angiopoietin-like proteins (Angptls). AGF has been considered as a novel growth factor in accelerating cutaneous wound healing, as it is capable of stimulating keratinocytes proliferation as well as angiogenesis. But in our paper, we demonstrate that AGF stimulates keratinocytes proliferation only at high protein concentration, however, it can potently promote adhesion, spreading, and migration of keratinocytes, fibroblasts, and endothelial cells. Furthermore, we confirm that the adhesion and migration cellular events are mediated by RGD-binding integrins, most possibly the α v -containing integrins, by in vitro inhibition assays using synthetic competitive peptides. Our results strongly suggest that AGF is an integrin ligand as well as a mitogenic growth factor and theoretically participates in cutaneous wound healing in a more complex mechanism

  9. UVB induces IL-12 transcription in human keratinocytes in vivo and in vitro

    International Nuclear Information System (INIS)

    Enk, C.D.; Blauvet, A.; Katz, S.I.; Mahanty, S.

    1996-01-01

    Human epidermal cells produce a wide range of cytokines, including those characteristic of Th2-like responses such as interleukin (IL)-4 and IL-10. As well, keratinocytes have recently been shown to produce Th1-like cytokines such as IL-12. Exposure to UVB has profound effects on the skin and systemic immune system, which is in part mediated by secretion of tumor necrosis factor (TNF)-α by epidermal cells. Because IL-12 induces production of TNF-α by certain cells of the immune system, we sought to determine whether UVB is an inducer of IL-12 gene expression in epidermal cells. Human epidermal cells were exposed to UVB radiation in vivo, isolated by suction blister technique and trypsinization and transcription of the IL-12 p35 and p40 chains was examined by RT-PCR. (Author)

  10. The porcine skin associated T-cell homing chemokine CCL27: molecular cloning and mRNA expression in piglets infected experimentally with Staphylococcus hyicus

    DEFF Research Database (Denmark)

    Johnsen, C. K.; Jensen, Annette Nygaard; Ahrens, P.

    2003-01-01

    CCL27 (also named CTACK, ALP, ILC and ESkine) is a CC chemokine primarily expressed by keratinocytes of the skin. The cognate receptor of CCL27 named CCR10 (GPR-2), is also expressed in skin-derived cells, and in addition by a subset of peripheral blood T-cells and in a variety of other tissues....... In this paper, we report the cloning of porcine CCL27 cDNA and investigation of CCL27 mRNA expression in Staphylococcus hyicus infected piglets. At the protein level, 77 and 74% homology was found to human and mouse CCL27 sequences, respectively. The results of the expression analyses show that CCL27 m...

  11. Fibroblast and keratinocyte gene expression following exposure to the extracts of holy basil plant (Ocimum tenuiflorum, malabar nut plant (Justicia adhatoda, and emblic myrobalan plant (Phyllanthus emblica

    Directory of Open Access Journals (Sweden)

    Takao Someya

    2018-04-01

    Full Text Available This data article provides gene expression profiles, determined by using real-time PCR, of fibroblasts and keratinocytes treated with 0.01% and 0.001% extracts of holy basil plant (Ocimum tenuiflorum, sri lankan local name “maduruthala”, 0.1% and 0.01% extracts of malabar nut plant (Justicia adhatoda, sri lankan local name “adayhoda” and 0.003% and 0.001% extracts of emblic myrobalan plant (Phyllanthus emblica, sri lankan local name “nelli”, harvested in Sri Lanka. For fibroblasts, the dataset includes expression profiles for genes encoding hyaluronan synthase 1 (HAS1, hyaluronan synthase 2 (HAS2, hyaluronidase-1 (HYAL1, hyaluronidase-2 (HYAL2, versican, aggrecan, CD44, collagen, type I, alpha 1 (COL1A1, collagen, type III, alpha 1 (COL3A1, collagen, type VII, alpha 1 (COL7A1, matrix metalloproteinase 1 (MMP1, acid ceramidase, basic fibroblast growth factor (bFGF, fibroblast growth factor-7 (FGF7, vascular endothelial growth factor (VEGF, interleukin-1 alpha (IL-1α, cyclooxygenase-2 (cox2, transforming growth factor beta (TGF-β, and aquaporin 3 (AQP3. For keratinocytes, the expression profiles are for genes encoding HAS1, HAS2, HYAL1, HYAL2, versican, CD44, IL-1α, cox2, TGF-β, AQP3, Laminin5, collagen, type XVII, alpha 1 (COL17A1, integrin alpha-6 (ITGA6, ceramide synthase 3 (CERS3, elongation of very long chain fatty acids protein 1 (ELOVL1, elongation of very long chain fatty acids protein 4 (ELOVL4, filaggrin (FLG, transglutaminase 1 (TGM1, and keratin 1 (KRT1. The expression profiles are provided as bar graphs. Keywords: Real-time PCR, Gene expression profile, Fibroblast, Keratinocyte, Holy basil extract, Ocimum tenuiflorum, Maduruthala, Malabar nut plant extract, Justicia adhatoda, Adayhoda, Emblic myrobalan extract, Phyllanthus emblica, Nelli

  12. Dissecting the calcium-induced differentiation of human primary keratinocytes stem cells by integrative and structural network analyses.

    Directory of Open Access Journals (Sweden)

    Kiana Toufighi

    2015-05-01

    Full Text Available The molecular details underlying the time-dependent assembly of protein complexes in cellular networks, such as those that occur during differentiation, are largely unexplored. Focusing on the calcium-induced differentiation of primary human keratinocytes as a model system for a major cellular reorganization process, we look at the expression of genes whose products are involved in manually-annotated protein complexes. Clustering analyses revealed only moderate co-expression of functionally related proteins during differentiation. However, when we looked at protein complexes, we found that the majority (55% are composed of non-dynamic and dynamic gene products ('di-chromatic', 19% are non-dynamic, and 26% only dynamic. Considering three-dimensional protein structures to predict steric interactions, we found that proteins encoded by dynamic genes frequently interact with a common non-dynamic protein in a mutually exclusive fashion. This suggests that during differentiation, complex assemblies may also change through variation in the abundance of proteins that compete for binding to common proteins as found in some cases for paralogous proteins. Considering the example of the TNF-α/NFκB signaling complex, we suggest that the same core complex can guide signals into diverse context-specific outputs by addition of time specific expressed subunits, while keeping other cellular functions constant. Thus, our analysis provides evidence that complex assembly with stable core components and competition could contribute to cell differentiation.

  13. Differential regulation of iron chelator-induced IL-8 synthesis via MAP kinase and NF-κB in immortalized and malignant oral keratinocytes

    International Nuclear Information System (INIS)

    Lee, Hwa-Jeong; Lee, Jun; Lee, Sun-Kyung; Lee, Suk-Keun; Kim, Eun-Cheol

    2007-01-01

    Interleukin-8 (IL-8) is a cytokine that plays an important role in tumor progression in a variety of cancer types; however, its regulation is not well understood in oral cancer cells. In the present study, we examined the expression and mechanism of IL-8 in which it is involved by treating immortalized (IHOK) and malignant human oral keratinocytes (HN12) cells with deferoxamine (DFO). IL-8 production was measured by an enzyme-linked immunoabsorbent assay and reverse transcriptase-polymerase chain reaction (RT-PCR) analysis. Electrophoretic mobility shift assays was used to determine NF-κB binding activity. Phosphorylation and degradation of the I-κB were analyized by Western blot. IHOK cells incubated with DFO showed increased expression of IL-8 mRNA, as well as higher release of the IL-8 protein. The up-regulation of DFO-induced IL-8 expression was higher in IHOK cells than in HN12 cells and was concentration-dependent. DFO acted additively with IL-1β to strongly up-regulate IL-8 in IHOK cells but not in HN12 cells. Accordingly, selective p38 and ERK1/2 inhibitors for both kinases abolished DFO-induced IL-8 expression in both IHOK and HN12 cells. Furthermore, DFO induced the degradation and phosphorylation of IκB, and activation of NF-κB. The IL-8 inducing effects of DFO were mediated by a nitric oxide donor (S-nitrosoglutathione), and by pyrrolidine dithiocarbamate, an inhibitor of NF-κB, as well as by wortmannin, which inhibits the phosphatidylinositol 3-kinase-dependent activation of NAD(P)H oxidase. This results demonstrate that DFO-induced IL-8 acts via multiple signaling pathways in immortalized and malignant oral keratinocytes, and that the control of IL-8 may be an important target for immunotheraphy against human oral premalignant lesions

  14. Studies on acute toxic effects to keratinocytes induced by hematoporphyrin derivatives and laser light.

    Science.gov (United States)

    Artuc, M; Ramshad, M; Kappus, H

    1989-01-01

    Human epidermal keratinocytes were grown in culture and the uptake of hematoporphyrin derivatives (HPDs) used in photodynamic therapy was estimated. Keratinocytes loaded with HPDs were irradiated with laser light of 632 nm generated by a helium-neon laser and cell toxicity was determined by the trypan blue exclusion test and the measurement of enzyme release. With increasing intracellular concentration of HPDs and with increasing intensity of the laser light, an increasing number of cells took up trypan blue and released the cytosolic enzyme lactate dehydrogenase and the lysosomal enzyme acid phosphatase after 1 h incubation of the irradiated cells at 37 degrees C. Cytotoxicity was less pronounced when the irradiated cells were incubated at 0 degree C indicating the involvement of enzyme reactions in cell death. No lipid peroxidation as measured by malondialdehyde and ethane formation was detectable. Our results suggest that during photodynamic therapy with HPDs and laser light epidermal keratinocytes may be seriously damaged. The data indicate that not lipid peroxidation but rather the activation of lysosomal enzymes is responsible for the cytotoxicity observed.

  15. Platelet-rich plasma (PRP) and adipose-derived mesenchymal stem cells: stimulatory effects on proliferation and migration of fibroblasts and keratinocytes in vitro.

    Science.gov (United States)

    Stessuk, Talita; Puzzi, Maria Beatriz; Chaim, Elinton Adami; Alves, Paulo César Martins; de Paula, Erich Vinicius; Forte, Andresa; Izumizawa, Juliana Massae; Oliveira, Carolina Caliári; Frei, Fernando; Ribeiro-Paes, João Tadeu

    2016-09-01

    The clinical use of tissue engineering associated with cell therapy is considered a new alternative therapy for the repair of chronic lesions with potential application in different medical areas, mostly in orthopedic and dermatological diseases. Platelet-rich plasma (PRP) is a rich source of growth factors and cytokines important for wound healing. Adipose-derived mesenchymal stem cells (ADSCs) have shown potential to accelerate the resolution of ulcers, to stimulate cell proliferation, and to benefit the quality of skin repair. This study aims to determine the effect of PRP and conditioned medium (CM) from ADSC on fibroblast and keratinocyte proliferation in vitro. Migration and proliferation assays were performed to evaluate the growth of fibroblasts and keratinocytes in the presence of PRP, CM, and CM + PRP. Significant proliferative stimulation was observed after 48 h of culture (p PRP, 100 % CM, and 25 % PRP + 25 % CM, if compared with control. Keratinocyte proliferation was stimulated after 48 h in cultures with 25, 50, and 100 % CM, and growth was compared with controls. The migration assay detected a significant migratory stimulus in fibroblasts cultured with 10 % PRP + 10 % CM after 48 h. These in vitro results suggest that PRP and ADSC have therapeutic potential for healing and re-epithelialization of chronic wounds in vivo.

  16. Citric acid induces cell-cycle arrest and apoptosis of human immortalized keratinocyte cell line (HaCaT) via caspase- and mitochondrial-dependent signaling pathways.

    Science.gov (United States)

    Ying, Tsung-Ho; Chen, Chia-Wei; Hsiao, Yu-Ping; Hung, Sung-Jen; Chung, Jing-Gung; Yang, Jen-Hung

    2013-10-01

    Citric acid is an alpha-hydroxyacid (AHA) widely used in cosmetic dermatology and skincare products. However, there is concern regarding its safety for the skin. In this study, we investigated the cytotoxic effects of citric acid on the human keratinocyte cell line HaCaT. HaCaT cells were treated with citric acid at 2.5-12.5 mM for different time periods. Cell-cycle arrest and apoptosis were investigated by 4,6-diamidino-2-phenylindole dihydrochloride (DAPI) staining, flow cytometry, western blot and confocal microscopy. Citric acid not only inhibited proliferation of HaCaT cells in a dose-dependent manner, but also induced apoptosis and cell cycle-arrest at the G2/M phase (before 24 h) and S phase (after 24 h). Citric acid increased the level of Bcl-2-associated X protein (BAX) and reduced the levels of B-cell lymphoma-2 (BCL-2), B-cell lymphoma-extra large (BCL-XL) and activated caspase-9 and caspase-3, which subsequently induced apoptosis via caspase-dependent and caspase-independent pathways. Citric acid also activated death receptors and increased the levels of caspase-8, activated BH3 interacting-domain death agonist (BID) protein, Apoptosis-inducing factor (AIF), and Endonuclease G (EndoG). Therefore, citric acid induces apoptosis through the mitochondrial pathway in the human keratinocyte cell line HaCaT. The study results suggest that citric acid is cytotoxic to HaCaT cells via induction of apoptosis and cell-cycle arrest in vitro.

  17. Ultraviolet radiation induces changes in membrane metabolism of human keratinocytes in culture

    International Nuclear Information System (INIS)

    De Leo, V.A.; Horlick, H.; Hanson, D.; Eisinger, M.; Harber, L.C.

    1984-01-01

    Human keratinocytes in culture were prelabeled with [ 3 H]arachidonic acid (AA) and then exposed to ultraviolet B radiation. Irradiated cells released labeled AA metabolites into media in a dose-dependent manner when compared to sham-irradiated cells. The response began immediately and continued for 24 h. Extracts from media were examined by high-performance liquid chromatography for identification of specific AA metabolites. Irradiated cells were stimulated to produce prostaglandin-like material (PGE2 and PGF2 alpha). These findings support the concept that the cell membrane of keratinocytes participates directly or indirectly in initiating the sunburn response. It is also felt that the metabolites formed following injury to the membrane are an integral component in the mediation of that response

  18. Effect of Absolute From Hibiscus syriacus L. Flower on Wound Healing in Keratinocytes

    Science.gov (United States)

    Yoon, Seok Won; Lee, Kang Pa; Kim, Do-Yoon; Hwang, Dae Il; Won, Kyung-Jong; Lee, Dae Won; Lee, Hwan Myung

    2017-01-01

    Background: Proliferation and migration of keratinocytes are essential for the repair of cutaneous wounds. Hibiscus syriacus L. has been used in Asian medicine; however, research on keratinocytes is inadequate. Objective: To establish the dermatological properties of absolute from Hibiscus syriacus L. flower (HSF) and to provide fundamental research for alternative medicine. Materials and Methods: We identified the composition of HSF absolute using gas chromatography-mass spectrometry analysis. We also examined the effect of HSF absolute in HaCaT cells using the XTT assay, Boyden chamber assay, sprout-out growth assay, and western blotting. We conducted an in-vivo wound healing assay in rat tail-skin. Results: Ten major active compounds were identified from HSF absolute. As determined by the XTT assay, Boyden chamber assay, and sprout-out growth assay results, HSF absolute exhibited similar effects as that of epidermal growth factor on the proliferation and migration patterns of keratinocytes (HaCaT cells), which were significantly increased after HSF absolute treatment. The expression levels of the phosphorylated signaling proteins relevant to proliferation, including extracellular signal-regulated kinase 1/2 (Erk 1/2) and Akt, were also determined by western blot analysis. Conclusion: These results of our in-vitro and ex-vivo studies indicate that HSF absolute induced cell growth and migration of HaCaT cells by phosphorylating both Erk 1/2 and Akt. Moreover, we confirmed the wound-healing effect of HSF on injury of the rat tail-skin. Therefore, our results suggest that HSF absolute is promising for use in cosmetics and alternative medicine. SUMMARY Hisbiscus syriacus L. flower absolute increases HaCaT cell migration and proliferation.Hisbiscus syriacus L. flower absolute regulates phosphorylation of ERK 1/2 and Akt in HaCaT cell.Treatment with Hisbiscus syriacus L. flower induced sprout outgrowth.The wound in the tail-skin of rat was reduced by Hisbiscus syriacus

  19. The epithelial-mesenchymal transition induced by keratinocyte growth conditions is overcome by E6 and E7 from HPV16, but not HPV8 and HPV38: Characterization of global transcription profiles

    International Nuclear Information System (INIS)

    Azzimonti, Barbara; Dell'Oste, Valentina; Borgogna, Cinzia; Mondini, Michele; Gugliesi, Francesca; De Andrea, Marco; Chiorino, Giovanna; Scatolini, Maria; Ghimenti, Chiara; Landolfo, Santo; Gariglio, Marisa

    2009-01-01

    The aim of this study was to evaluate the growth properties of primary human keratinocytes expressing E6 and E7 proteins, which are from either the β- or α-genotypes, under different culture conditions. We demonstrated that keratinocytes expressing E6 and E7, from both HPV8 and 38, irreversibly underwent the epithelial-mesenchymal transition (EMT) when grown on plastic with FAD medium (F12/DMEM/5%FBS). Expression of E6/E7 from HPV16 was capable of fully overcoming the FAD-induced EMT. Immortalization was only observed in HPV16-transduced cell lines, while the more proliferating phenotype of both KerHPV8 and 38 was mainly related to FAD-induced EMT. Microarray analysis of exponentially growing cells identified 146 cellular genes that were differentially regulated in HPV16 compared to HPV8- and 38-transduced cells. A large accumulation of transcripts associated with epidermal development and differentiation was observed in HPV16-transduced cells, whereas transcripts of genes involved in the extracellular matrix, multicellular organismal processes, and inflammatory response were affected in HPV8 and 38-transduced cells.

  20. Age-related changes in expression and function of Toll-like receptors in human skin

    Science.gov (United States)

    Iram, Nousheen; Mildner, Michael; Prior, Marion; Petzelbauer, Peter; Fiala, Christian; Hacker, Stefan; Schöppl, Alice; Tschachler, Erwin; Elbe-Bürger, Adelheid

    2012-01-01

    Toll-like receptors (TLRs) initiate innate immune responses and direct subsequent adaptive immunity. They play a major role in cutaneous host defense against micro-organisms and in the pathophysiology of several inflammatory skin diseases. To understand the role of TLRs in the acquisition of immunological competence, we conducted a comprehensive study to evaluate TLR expression and function in the developing human skin before and after birth and compared it with adults. We found that prenatal skin already expresses the same spectrum of TLRs as adult skin. Strikingly, many TLRs were significantly higher expressed in prenatal (TLRs 1-5) and infant and child (TLRs 1 and 3) skin than in adult skin. Surprisingly, neither dendritic cell precursors in prenatal skin nor epidermal Langerhans cells and dermal dendritic cells in adult skin expressed TLRs 3 and 6, whereas the staining pattern and intensity of both TLRs in fetal basal keratinocytes was almost comparable to those of adults. Stimulation of primary human keratinocytes from fetal, neonatal and adult donors with selected TLR agonists revealed that the synthetic TLR3 ligand poly (I:C) specifically, mimicking viral double-stranded RNA, induced a significantly enhanced secretion of CXCL8/IL8, CXCL10/IP-10 and TNFα in fetal and neonatal keratinocytes compared with adult keratinocytes. This study demonstrates quantitative age-specific modifications in TLR expression and innate skin immune reactivity in response to TLR activation. Thus, antiviral innate immunity already in prenatal skin may contribute to protect the developing human body from viral infections in utero in a scenario where the adaptive immune system is not yet fully functional. PMID:23034637

  1. Serially cultured keratinocytes from human scalp hair follicles: a tool for cytogenetic studies.

    Science.gov (United States)

    Weterings, P J; Roelofs, H M; Jansen, B A; Vermorken, A J

    1983-01-01

    Keratinocytes originating from adult human hair follicles, the most convenient biopsy tissue, can be serially cultured using a combination of two techniques. Primary cultures are established using plucked scalp hair follicles and the bovine eye lens capsule as a growth substrate. Subsequently, cells from these cultures are serially cultivated in the presence of irradiated 3T3 cells as feeders. By this combination of techniques many keratinocytes can be generated from one single hair follicle. These cultures, appropriately treated with colchicine, can provide an adequate number of metaphases suitable for chromosome studies.

  2. CRISPR-assisted receptor deletion reveals distinct roles for ERBB2 and ERBB3 in skin keratinocytes.

    Science.gov (United States)

    Dahlhoff, Maik; Gaborit, Nadège; Bultmann, Sebastian; Leonhardt, Heinrich; Yarden, Yosef; Schneider, Marlon R

    2017-10-01

    While the epidermal growth factor receptor (EGFR) is an established regulator of skin development and homeostasis, the functions of the related tyrosine kinase receptors ERBB2 and ERBB3 in this tissue have only recently been examined. Previously reported, skin-specific deletion of each of these receptors in mice resulted in similar defects in keratinocyte proliferation and migration, resulting in impaired wound healing and tumorigenesis. Because both ERBB2 and ERBB3 are targets for treating an array of cancer types, it is important to examine the consequences of receptor inhibition in human keratinocytes. Here, we employed the CRISPR/Cas9 technology to generate HaCaT cells (an established human keratinocyte cell line) lacking ERBB2 or ERBB3. HaCaT clones lacking ERBB2 or ERBB3 showed comparable reductions in cell proliferation as assessed by BrdU staining. Apoptosis, in contrast, was reduced in ERBB3-deficient HaCaT cells only. Assessment of cell migration using a wound healing (scratch) assay showed that the closure of the wound gaps was completed by 48 h in mock and in ERBB3 knockout clones. In contrast, this process was considerably delayed in ERBB2 knockout clones, and a complete closure of the gap in the latter cells did not occur before 72 h. In conclusion, both ERBB2 and ERBB3 are essential for normal proliferation of skin keratinocytes, but in contrast to ERBB3, ERBB2 is essential for migration of human keratinocytes. These observations might bear significance to patient adverse effects of therapeutic agents targeting ERBB2 and ERBB3. © 2017 Federation of European Biochemical Societies.

  3. Immunohistochemical expression of perforin in lichen planus lesions.

    Science.gov (United States)

    Gaber, Mohamed Abdelwahed; Maraee, Alaa Hassan; Alsheraky, Dalia Rifaat; Azeem, Marwa Hussain Abdel

    2014-12-01

    Lichen planus (LP) is a chronic inflammatory papulosquamous skin disease characterized by epidermal basal cell damage and a particular band-like infiltrate predominantly of T cells in the upper dermis. It is characterized by the formation of colloid bodies representing apoptotic keratinocytes. The apoptotic process mediated by CD8+ cytotoxic T lymphocytes and natural killer cells mainly involves two distinct pathways: the perforin/granzyme pathway and the Fas/FasL pathway. So far, little is known regarding the role of perforin-mediated apoptosis in LP. Is to study the expression and distribution of perforin in the epidermis and dermis of lesional LP skin. Skin biopsy specimens from lesional skin of 31 patients with LP and 10 healthy persons were analyzed by immunohistochemistry. Significant accumulation of perforin + cells was found in both epidermis and dermis of LP lesions compared with healthy skin. Perforin expression was significantly upregulated in the epidermis of LP lesions. Accumulation of perforin + cells in the epidermis of LP lesions suggest a potential role of perforin in the apoptosis of basal keratinocytes.

  4. Radical Scavenging Activity-Based and AP-1-Targeted Anti-Inflammatory Effects of Lutein in Macrophage-Like and Skin Keratinocytic Cells

    Directory of Open Access Journals (Sweden)

    Jueun Oh

    2013-01-01

    Full Text Available Lutein is a naturally occurring carotenoid with antioxidative, antitumorigenic, antiangiogenic, photoprotective, hepatoprotective, and neuroprotective properties. Although the anti-inflammatory effects of lutein have previously been described, the mechanism of its anti-inflammatory action has not been fully elucidated. Therefore, in the present study, we aimed to investigate the regulatory activity of lutein in the inflammatory responses of skin-derived keratinocytes or macrophages and to elucidate the mechanism of its inhibitory action. Lutein significantly reduced several skin inflammatory responses, including increased expression of interleukin-(IL- 6 from LPS-treated macrophages, upregulation of cyclooxygenase-(COX- 2 from interferon-γ/tumor necrosis-factor-(TNF- α-treated HaCaT cells, and the enhancement of matrix-metallopeptidase-(MMP- 9 level in UV-irradiated keratinocytes. By evaluating the intracellular signaling pathway and the nuclear transcription factor levels, we determined that lutein inhibited the activation of redox-sensitive AP-1 pathway by suppressing the activation of p38 and c-Jun-N-terminal kinase (JNK. Evaluation of the radical and ROS scavenging activities further revealed that lutein was able to act as a strong anti-oxidant. Taken together, our findings strongly suggest that lutein-mediated AP-1 suppression and anti-inflammatory activity are the result of its strong antioxidative and p38/JNK inhibitory activities. These findings can be applied for the preparation of anti-inflammatory and cosmetic remedies for inflammatory diseases of the skin.

  5. The Herbal Bitter Drug Gentiana lutea Modulates Lipid Synthesis in Human Keratinocytes In Vitro and In Vivo.

    Science.gov (United States)

    Wölfle, Ute; Haarhaus, Birgit; Seiwerth, Jasmin; Cawelius, Anja; Schwabe, Kay; Quirin, Karl-Werner; Schempp, Christoph M

    2017-08-22

    Gentiana lutea is a herbal bitter drug that is used to enhance gastrointestinal motility and secretion. Recently we have shown that amarogentin, a characteristic bitter compound of Gentiana lutea extract (GE), binds to the bitter taste receptors TAS2R1 and TAS2R38 in human keratinocytes, and stimulates the synthesis of epidermal barrier proteins. Here, we wondered if GE also modulates lipid synthesis in human keratinocytes. To address this issue, human primary keratinocytes were incubated for 6 days with GE. Nile Red labeling revealed that GE significantly increased lipid synthesis in keratinocytes. Similarly, gas chromatography with flame ionization detector indicated that GE increases the amount of triglycerides in keratinocytes. GE induced the expression of epidermal ceramide synthase 3, but not sphingomyelinase. Lipid synthesis, as well as ceramide synthase 3 expression, could be specifically blocked by inhibitors of the p38 MAPK and PPARγ signaling pathway. To assess if GE also modulates lipid synthesis in vivo, we performed a proof of concept half side comparison on the volar forearms of 33 volunteers. In comparison to placebo, GE significantly increased the lipid content of the treated skin areas, as measured with a sebumeter. Thus, GE enhances lipid synthesis in human keratinocytes that is essential for building an intact epidermal barrier. Therefore, GE might be used to improve skin disorders with an impaired epidermal barrier, e.g., very dry skin and atopic eczema.

  6. IFN-β antiproliferative effect and miRNA regulation in Human Papilloma Virus E6- and E7-transformed keratinocytes.

    Science.gov (United States)

    Chiantore, Maria Vincenza; Mangino, Giorgio; Iuliano, Marco; Zangrillo, Maria Simona; De Lillis, Ilaria; Vaccari, Gabriele; Accardi, Rosita; Tommasino, Massimo; Fiorucci, Gianna; Romeo, Giovanna

    2017-01-01

    Human Papilloma Viruses (HPVs) are the causative agents of cervical cancer although other types of cancers are associated with HPV infection. Type I Interferons can interfere with HPV E6- and/or E7-dependent transformation and can affect microRNA (miRNA) expression. Cancer cells show a specific pattern of miRNA expression and HPVs are able to modulate miRNAs expressed in infected cells. Keratinocytes transduced with E6 and E7 from mucosal HPV-16 or cutaneous HPV-38 (K16 and K38) were studied to analyze the involvement of HPV oncoproteins in the anti-proliferative activity of IFN-β. In view of our previous data showing senescence induction by the cytokine in K38 cells, we observe that IFN-β treatment leads to p53-indipendent apoptosis in K16 cells whereas induces senescence in K16 cells if E6 is silenced and p53 expression is restored. The levels of selected miRNAs, deregulated in K16 and K38 cells, can be modulated by IFN-β when E6 and E7 proteins of HPV-16, but not HPV-38, are expressed. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. γ-Tocotrienol prevents 5-FU-induced reactive oxygen species production in human oral keratinocytes through the stabilization of 5-FU-induced activation of Nrf2.

    Science.gov (United States)

    Takano, Hideyuki; Momota, Yukihiro; Kani, Kouichi; Aota, Keiko; Yamamura, Yoshiko; Yamanoi, Tomoko; Azuma, Masayuki

    2015-04-01

    Chemotherapy-induced oral mucositis is a common adverse event in patients with oral squamous cell carcinoma, and is initiated through a variety of mechanisms, including the generation of reactive oxygen species (ROS). In this study, we examined the preventive effect of γ-tocotrienol on the 5-FU-induced ROS production in human oral keratinocytes (RT7). We treated RT7 cells with 5-FU and γ-tocotrienol at concentrations of 10 µg/ml and 10 nM, respectively. When cells were treated with 5-FU alone, significant growth inhibition was observed as compared to untreated cells. This inhibition was, in part, due to the ROS gene-rated by 5-FU treatment, because N-acetyl cysteine (NAC), a ROS scavenger, significantly ameliorated the growth of RT7 cells. γ-tocotrienol showed no cytotoxic effect on the growth of RT7 cells. Simultaneous treatment of cells with these agents resulted in the significant recovery of cell growth, owing to the suppression of ROS generation by γ-tocotrienol. Whereas 5-FU stimulated the expression of NF-E2-related factor 2 (Nrf2) protein in the nucleus up to 12 h after treatment of RT7 cells, γ-tocotrienol had no obvious effect on the expression of nuclear Nrf2 protein. Of note, the combined treatment with both agents stabilized the 5-FU-induced nuclear Nrf2 protein expression until 24 h after treatment. In addition, expression of Nrf2-dependent antioxidant genes, such as heme oxygenase-1 (HO-1) and quinone oxidoreductase-1 (NQO-1), was significantly augmented by treatment of cells with both agents. These findings suggest that γ-tocotrienol could prevent 5-FU-induced ROS generation by stabilizing Nrf2 activation, thereby leading to ROS detoxification and cell survival in human oral keratinocytes.

  8. Human lactoferrin stimulates skin keratinocyte function and wound re-epithelialization.

    Science.gov (United States)

    Tang, L; Wu, J J; Ma, Q; Cui, T; Andreopoulos, F M; Gil, J; Valdes, J; Davis, S C; Li, J

    2010-07-01

    Human lactoferrin (hLF), a member of the transferrin family, is known for its antimicrobial and anti-inflammatory effects. Recent studies on various nonskin cell lines indicate that hLF may have a stimulatory effect on cell proliferation. To study the potential role of hLF in wound re-epithelialization. The effects of hLF on cell growth, migration, attachment and survival were assessed, with a rice-derived recombinant hLF (holo-rhLF), using proliferation analysis, scratch migration assay, calcein-AM/propidium iodide staining and terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) method, respectively. The mechanisms of hLF on cell proliferation and migration were explored using specific pathway inhibitors. The involvement of lactoferrin receptor low-density lipoprotein receptor-related protein 1 (LRP1) was examined with RNA interference technique. An in vivo swine second-degree burn wound model was also used to assess wound re-epithelialization. Studies revealed that holo-rhLF significantly stimulated keratinocyte proliferation which could be blocked by mitogen-activated protein kinase (MAPK) kinase 1 inhibitor. Holo-rhLF also showed strong promoting effects on keratinocyte migration, which could be blocked by either inhibition of the MAPK, Src and Rho/ROCK pathways, or downregulation of the LRP1 receptor. With cells under starving or 12-O-tetradecanoylphorbol-13-acetate exposure, the addition of holo-rhLF was found greatly to increase cell viability and inhibit cell apoptosis. Additionally, holo-rhLF significantly increased the rate of wound re-epithelialization in swine second-degree burn wounds. Our studies demonstrate the direct effects of holo-rhLF on wound re-epithelialization including the enhancement of keratinocyte proliferation and migration as well as the protection of cells from apoptosis. The data strongly indicate its potential therapeutic applications in wound healing.

  9. Nuclear DNA damage-triggered NLRP3 inflammasome activation promotes UVB-induced inflammatory responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Hasegawa, Tatsuya, E-mail: tatsuya.hasegawa@to.shiseido.co.jp; Nakashima, Masaya; Suzuki, Yoshiharu

    2016-08-26

    Ultraviolet (UV) radiation in sunlight can result in DNA damage and an inflammatory reaction of the skin commonly known as sunburn, which in turn can lead to cutaneous tissue disorders. However, little has been known about how UV-induced DNA damage mediates the release of inflammatory mediators from keratinocytes. Here, we show that UVB radiation intensity-dependently increases NLRP3 gene expression and IL-1β production in human keratinocytes. Knockdown of NLRP3 with siRNA suppresses UVB-induced production of not only IL-1β, but also other inflammatory mediators, including IL-1α, IL-6, TNF-α, and PGE{sub 2}. In addition, inhibition of DNA damage repair by knockdown of XPA, which is a major component of the nucleotide excision repair system, causes accumulation of cyclobutane pyrimidine dimer (CPD) and activation of NLRP3 inflammasome. In vivo immunofluorescence analysis confirmed that NLRP3 expression is also elevated in UV-irradiated human epidermis. Overall, our findings indicate that UVB-induced DNA damage initiates NLRP3 inflammasome activation, leading to release of various inflammatory mediators from human keratinocytes. - Highlights: • UVB radiation induces NLRP3 inflammasome activation in human keratinocytes. • NLRP3 knockdown suppresses production of UVB-induced inflammatory mediators. • UVB-induced DNA damage triggers NLRP3 inflammasome activation. • NLRP3 expression in human epidermis is elevated in response to UV radiation.

  10. Nuclear DNA damage-triggered NLRP3 inflammasome activation promotes UVB-induced inflammatory responses in human keratinocytes

    International Nuclear Information System (INIS)

    Hasegawa, Tatsuya; Nakashima, Masaya; Suzuki, Yoshiharu

    2016-01-01

    Ultraviolet (UV) radiation in sunlight can result in DNA damage and an inflammatory reaction of the skin commonly known as sunburn, which in turn can lead to cutaneous tissue disorders. However, little has been known about how UV-induced DNA damage mediates the release of inflammatory mediators from keratinocytes. Here, we show that UVB radiation intensity-dependently increases NLRP3 gene expression and IL-1β production in human keratinocytes. Knockdown of NLRP3 with siRNA suppresses UVB-induced production of not only IL-1β, but also other inflammatory mediators, including IL-1α, IL-6, TNF-α, and PGE_2. In addition, inhibition of DNA damage repair by knockdown of XPA, which is a major component of the nucleotide excision repair system, causes accumulation of cyclobutane pyrimidine dimer (CPD) and activation of NLRP3 inflammasome. In vivo immunofluorescence analysis confirmed that NLRP3 expression is also elevated in UV-irradiated human epidermis. Overall, our findings indicate that UVB-induced DNA damage initiates NLRP3 inflammasome activation, leading to release of various inflammatory mediators from human keratinocytes. - Highlights: • UVB radiation induces NLRP3 inflammasome activation in human keratinocytes. • NLRP3 knockdown suppresses production of UVB-induced inflammatory mediators. • UVB-induced DNA damage triggers NLRP3 inflammasome activation. • NLRP3 expression in human epidermis is elevated in response to UV radiation.

  11. Protection against 2-chloroethyl ethyl sulfide (CEES) - induced cytotoxicity in human keratinocytes by an inducer of the glutathione detoxification pathway

    International Nuclear Information System (INIS)

    Abel, Erika L.; Bubel, Jennifer D.; Simper, Melissa S.; Powell, Leslie; McClellan, S. Alex; Andreeff, Michael; MacLeod, Michael C.; DiGiovanni, John

    2011-01-01

    Sulfur mustard (SM or mustard gas) was first used as a chemical warfare agent almost 100 years ago. Due to its toxic effects on the eyes, lungs, and skin, and the relative ease with which it may be synthesized, mustard gas remains a potential chemical threat to the present day. SM exposed skin develops fluid filled bullae resulting from potent cytotoxicity of cells lining the basement membrane of the epidermis. Currently, there are no antidotes for SM exposure; therefore, chemopreventive measures for first responders following an SM attack are needed. Glutathione (GSH) is known to have a protective effect against SM toxicity, and detoxification of SM is believed to occur, in part, via GSH conjugation. Therefore, we screened 6 potential chemopreventive agents for ability to induce GSH synthesis and protect cultured human keratinocytes against the SM analog, 2-chloroethyl ethyl sulfide (CEES). Using NCTC2544 human keratinocytes, we found that both sulforaphane and methyl-2-cyano-3,12-dioxooleana-1,9-dien-28-oate (CDDO-Me) stimulated nuclear localization of Nrf2 and induced expression of the GSH synthesis gene, GCLM. Additionally, we found that treatment with CDDO-Me elevated reduced GSH content of NCTC2544 cells and preserved their viability by ∼ 3-fold following exposure to CEES. Our data also suggested that CDDO-Me may act additively with 2,6-dithiopurine (DTP), a nucleophilic scavenging agent, to increase the viability of keratinocytes exposed to CEES. These results suggest that CDDO-Me is a promising chemopreventive agent for SM toxicity in the skin. - Highlights: → CDDO-Me treatment increased intracellular GSH in human keratinocytes. → CDDO-Me increased cell viability following exposure to the half-mustard, CEES. → The cytoprotective effect of CDDO-Me was likely due to scavenging with endogenous GSH.

  12. Expression of Ulex europaeus agglutinin I lectin-binding sites in squamous cell carcinomas and their absence in basal cell carcinomas. Indicator of tumor type and differentiation.

    Science.gov (United States)

    Heng, M C; Fallon-Friedlander, S; Bennett, R

    1992-06-01

    Lectins bind tightly to carbohydrate moieties on cell surfaces. Alterations in lectin binding have been reported to accompany epidermal cell differentiation, marking alterations in membrane sugars during this process. The presence of UEA I (Ulex europaeus agglutinin I) L-fucose-specific lectin-binding sites has been used as a marker for terminally differentiated (committed) keratinocytes. In this article, we report the presence of UEA-I-binding sites on squamous keratinocytes of well-differentiated squamous cell carcinomas, with patchy loss of UEA I positivity on poorly differentiated cells of squamous cell carcinomas, suggesting a possible use for this technique in the rapid assessment of less differentiated areas within the squamous cell tumor. The absence of UEA-I-binding sites on basal cell carcinomas may be related to an inability of cells comprising this tumor to convert the L-D-pyranosyl moiety on basal cells to the L-fucose moiety, resulting in an inability of basal cell carcinoma cell to undergo terminal differentiation into a committed keratinocyte.

  13. Exposure to Carbon Nanotube Material: Assessment of Nanotube Cytotoxicity Using Human Keratinocyte Cells

    Science.gov (United States)

    Shvedova, Anna A.; Castranova, Vincent; Kisin, Elena R.; Schwegler-Berry, Diane; Murray, Ashley R.; Gandelsman, Vadim Z.; Maynard, Andrew; Baron, Paul

    2003-01-01

    Carbon nanotubes are new members of carbon allotropes similar to fullerenes and graphite. Because of their unique electrical, mechanical, and thermal properties, carbon nanotubes are important for novel applications in the electronics, aerospace, and computer industries. Exposure to graphite and carbon materials has been associated with increased incidence of skin diseases, such as carbon fiber dermatitis, hyperkeratosis, and naevi. We investigated adverse effects of single-wall carbon nanotubes (SWCNT) using a cell culture of immortalized human epidermal keratinocytes (HaCaT). After 18 h of exposure of HaCaT to SWCNT, oxidative stress and cellular toxicity were indicated by formation of free radicals, accumulation of peroxidative products, antioxidant depletion, and loss of cell viability. Exposure to SWCNT also resulted in ultrastructural and morphological changes in cultured skin cells. These data indicate that dermal exposure to unrefined SWCNT may lead to dermal toxicity due to accelerated oxidative stress in the skin of exposed workers.

  14. 3-Amino-1,2,4-triazole Limits the Oxidative Damage in UVA-Irradiated Dysplastic Keratinocytes

    Directory of Open Access Journals (Sweden)

    Marina Tamara Nechifor

    2017-01-01

    Full Text Available Reactive oxygen species (ROS generated by UVA irradiation affect the keratinocyte cell membrane, DNA, and proteins and may cause serious injury to the skin. Treating human dysplastic keratinocytes (DOK with 3-amino-1,2,4-triazole (AMT, a common catalase inhibitor, induced a compensatory mechanism for the hydrogen peroxide detoxification, which included a rise in glutathione peroxidase and glutathione reductase activities. Here, we examined a possible role of AMT in protecting a human DOK cell line against UVA-induced damage. In DOK cells exposed to UVA irradiation, we observed a substantial decrease in antioxidant enzymatic activities, such as catalase, glutathione peroxidase, glutathione reductase, and glutathione-S-transferase and an increase in lipid peroxidation and protein oxidation levels. Treating DOK cells with AMT prior to UVA exposure enhanced the activities of glutathione peroxidase, glutathione reductase, and glutathione-S-transferase, relative to nontreated cells. The enhanced antioxidant activities were correlated with decreased protein oxidation levels. Based on these results, we suggest that AMT may protect dysplastic keratinocytes against the harmful effects of UVA radiation.

  15. Psidium guajava extract inhibits thymus and activation-regulated chemokine (TARC/CCL17) production in human keratinocytes by inducing heme oxygenase-1 and blocking NF-κB and STAT1 activation.

    Science.gov (United States)

    Han, Eun Hee; Hwang, Yong Pil; Choi, Jae Ho; Yang, Ji Hye; Seo, Jong Kwon; Chung, Young Chul; Jeong, Hye Gwang

    2011-09-01

    Psidium guajava (P. guajava) is a food and medicinal plant with antioxidant, anti-inflammatory, and anti-allergic activities that support its traditional uses. The aim of this study was to determine the effects of P. guajava ethyl acetate extract (PGEA) on atopic dermatitis and to investigate the possible mechanisms by which PGEA inhibits cytokine-induced Th2 chemokine expression in HaCaT human keratinocyte cells. We found that PGEA suppressed the IFN-γ/TNF-α-co-induced production of thymus and activation-regulated chemokine (TARC) protein and mRNA in HaCaT cells. Additionally, PGEA inhibited the TNF-α/IFN-γ-co-induced activation of NF-κB and STAT1 and increased the expression of heme oxygenase-1 (HO-1) protein and mRNA. HO-1 inhibitor enhanced the suppressive effects of PGEA on TNF-α/IFN-γ-co-induced TARC production and gene expression. Collectively, these data demonstrate that PGEA inhibits chemokine expression in keratinocytes by inducing HO-1 expression and it suggests a possible therapeutic application in atopic dermatitis and other inflammatory skin diseases. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Survivin Modulates Squamous Cell Carcinoma-Derived Stem-Like Cell Proliferation, Viability and Tumor Formation in Vivo

    Directory of Open Access Journals (Sweden)

    Roberta Lotti

    2016-01-01

    Full Text Available Squamous Cell Carcinoma-derived Stem-like Cells (SCC-SC originate from alterations in keratinocyte stem cells (KSC gene expression and sustain tumor development, invasion and recurrence. Since survivin, a KSC marker, is highly expressed in SCC-SC, we evaluate its role in SCC-SC cell growth and SCC models. Survivin silencing by siRNA decreases clonal growth of SCC keratinocytes and viability of total, rapidly adhering (RAD and non-RAD (NRAD cells from primary SCC. Similarly, survivin silencing reduces the expression of stem cell markers (OCT4, NOTCH1, CD133, β1-integrin, while it increases the level of differentiation markers (K10, involucrin. Moreover, survivin silencing improves the malignant phenotype of SCC 3D-reconstruct, as demonstrated by reduced epidermal thickness, lower Ki-67 positive cell number, and decreased expression of MMP9 and psoriasin. Furthermore, survivin depletion by siRNA in RasG12V-IκBα-derived tumors leads to smaller tumor formation characterized by lower mitotic index and reduced expression of the tumor-associated marker HIF1α, VEGF and CD51. Therefore, our results indicate survivin as a key gene in regulating SCC cancer stem cell formation and cSCC development.

  17. Blockage of JNK pathway enhances arsenic trioxide-induced apoptosis in human keratinocytes

    International Nuclear Information System (INIS)

    Huang, H.-S.; Liu, Z.-M.; Hong, D.-Y.

    2010-01-01

    Arsenic is well known as a carcinogen predisposing humans to some severe diseases and also as an effective medicine for treating acute promyelocytic leukemia, syphilis, and psoriasis. Multiple active mechanisms, including cell cycle arrest and apoptosis, have been proposed in therapy; however, the opposing effects of arsenic remain controversial. Our previous study found that arsenic trioxide (ATO)-induced activation of p21 WAF1/CIP1 (p21) led to A431 cell death through the antagonistic effects of the signaling of ERK1/2 and JNK1. In the current study, the inhibitory effects of JNK1 on ATO-induced p21 expression were explored. Over-expression of JNK1 in A431 cells could inhibit p21 expression, which was associated with HDAC1 and TGIF. Using the GST pull-down assay and fluorescence resonance energy transfer analysis, N-terminal domain (amino acids 1-108) of TGIF, critical to its binding with c-Jun, was found. Using reporter assays, requirement of the C-terminal domain (amino acids 138-272) of TGIF to suppress ATO-induced p21 expression was observed. Thus, the domains of TGIF that carried out its inhibitory effects on p21 were identified. Finally, treatment with JNK inhibitor SP600125 could enhance ATO-induced apoptosis of HaCaT keratinocytes by using flow cytometry.

  18. Humanized Mouse Model of Skin Inflammation Is Characterized by Disturbed Keratinocyte Differentiation and Influx of IL-17A Producing T Cells

    Science.gov (United States)

    de Oliveira, Vivian L.; Keijsers, Romy R. M. C.; van de Kerkhof, Peter C. M.; Seyger, Marieke M. B.; Fasse, Esther; Svensson, Lars; Latta, Markus; Norsgaard, Hanne; Labuda, Tord; Hupkens, Pieter; van Erp, Piet E. J.; Joosten, Irma; Koenen, Hans J. P. M.

    2012-01-01

    Humanized mouse models offer a challenging possibility to study human cell function in vivo. In the huPBL-SCID-huSkin allograft model human skin is transplanted onto immunodeficient mice and allowed to heal. Thereafter allogeneic human peripheral blood mononuclear cells are infused intra peritoneally to induce T cell mediated inflammation and microvessel destruction of the human skin. This model has great potential for in vivo study of human immune cells in (skin) inflammatory processes and for preclinical screening of systemically administered immunomodulating agents. Here we studied the inflammatory skin response of human keratinocytes and human T cells and the concomitant systemic human T cell response. As new findings in the inflamed human skin of the huPBL-SCID-huSkin model we here identified: 1. Parameters of dermal pathology that enable precise quantification of the local skin inflammatory response exemplified by acanthosis, increased expression of human β-defensin-2, Elafin, K16, Ki67 and reduced expression of K10 by microscopy and immunohistochemistry. 2. Induction of human cytokines and chemokines using quantitative real-time PCR. 3. Influx of inflammation associated IL-17A-producing human CD4+ and CD8+ T cells as well as immunoregulatory CD4+Foxp3+ cells using immunohistochemistry and -fluorescence, suggesting that active immune regulation is taking place locally in the inflamed skin. 4. Systemic responses that revealed activated and proliferating human CD4+ and CD8+ T cells that acquired homing marker expression of CD62L and CLA. Finally, we demonstrated the value of the newly identified parameters by showing significant changes upon systemic treatment with the T cell inhibitory agents cyclosporine-A and rapamycin. In summary, here we equipped the huPBL-SCID-huSkin humanized mouse model with relevant tools not only to quantify the inflammatory dermal response, but also to monitor the peripheral immune status. This combined approach will gain our

  19. Single Low-Dose Radiation Induced Regulation of Keratinocyte Differentiation in Calcium-Induced HaCaT Cells

    OpenAIRE

    Hahn, Hyung Jin; Youn, Hae Jeong; Cha, Hwa Jun; Kim, Karam; An, Sungkwan; Ahn, Kyu Joong

    2016-01-01

    Background We are continually exposed to low-dose radiation (LDR) in the range 0.1 Gy from natural sources, medical devices, nuclear energy plants, and other industrial sources of ionizing radiation. There are three models for the biological mechanism of LDR: the linear no-threshold model, the hormetic model, and the threshold model. Objective We used keratinocytes as a model system to investigate the molecular genetic effects of LDR on epidermal cell differentiation. Methods To identify kera...

  20. The comparison of two methods to obtain human oral keratinocytes in primary culture

    International Nuclear Information System (INIS)

    Klingbeil, Maria Fatima Guarizo

    2006-01-01

    The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)

  1. Keratinocyte secretion of cyclophilin B via the constitutive pathway is regulated through its cyclosporin-binding site.

    Science.gov (United States)

    Fearon, Paula; Lonsdale-Eccles, Ann A; Ross, O Kehinde; Todd, Carole; Sinha, Aparna; Allain, Fabrice; Reynolds, Nick J

    2011-05-01

    Cyclophilin B (CypB) is an endoplasmic reticulum (ER)-resident member of the cyclophilin family of proteins that bind cyclosporin A (CsA). We report that as in other cell types, CypB trafficked from the ER and was secreted by keratinocytes into the media in response to CsA. Concentrations as low as 1 pM of CsA induced secretion of CypB. Using brefeldin A, we showed that CypB is secreted from keratinocytes via the constitutive secretory pathway. We defined that substitution of tryptophan residue 128 in the CsA-binding site of CypB with alanine resulted in dissociation of CypB(W128A)-green fluorescent protein (GFP) from the ER. Photobleaching studies revealed a significant reduction in the diffusible mobility of CypB(W128A)-GFP compared with CypB(WT)-GFP, consistent with redistribution of CypB(W128A)-GFP into secretory vesicles disconnected from the ER/Golgi network. Furthermore, CsA significantly decreased the mobility of CypB(WT)-GFP but not CypB(W128A)-GFP. These studies demonstrate that therapeutically relevant concentrations of CsA regulate secretion of CypB by keratinocytes, and that a key residue within the CsA-binding site of CypB controls retention of CypB within the ER and regulates entry into the secretory pathway. As keratinocytes express CypB receptors (CD147) and CypB exhibits chemotactic properties, these data have implications for the therapeutic effects of CsA in inflammatory skin disease.

  2. Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion

    DEFF Research Database (Denmark)

    Piwko-Czuchra, Aleksandra; Koegel, Heidi; Meyer, Hannelore

    2009-01-01

    BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in thei...... of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis....... that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon...... was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations...

  3. 5-fluorouracil Toxicity Mechanism Determination in Human Keratinocytes: in vitro Study on HaCaT

    Directory of Open Access Journals (Sweden)

    Jan Hartinger

    2018-01-01

    Full Text Available 5-fluorouracil (5-FU and capecitabine therapy is often accompanied by palmar-plantar erythrodysesthesia (PPE which is manifestation of 5-FU toxicity in keratinocytes. The main mechanisms of 5-FU action are thymidylate synthase (TS inhibition which can be abrogated by thymidine and strengthened by calciumfolinate (CF and incorporation of fluorouridinetriphosphate into RNA which can be abrogated by uridine. For proper PPE treatment 5-FU mechanism of action in keratinocytes needs to be elucidated. We used the 5-FU toxicity modulators uridine, thymidine and CF to discover the mechanism of 5-FU action in human keratinocyte cell line HaCaT. To measure the cellular viability, we used MTT test and RTCA test. CF did not augment 5-FU toxicity and 5-FU toxicity was weakened by uridine. Therefore, the primary mechanism of 5-FU toxicity in keratinocytes is 5-FU incorporation into RNA. The uridine protective effect cannot fully develop in the presence of CF. Thymidine addition to 5-FU and uridine treated cells not only prevents the toxicity-augmenting CF effect but it also prolongs the 5-FU treated cells survival in comparison to uridine only. Therefore, it can be assumed that in the presence of uridine the 5-FU toxicity mechanism is switched from RNA incorporation to TS inhibition. Although particular 5-FU toxicity mechanisms were previously described in various cell types, this is the first time when various combinations of pyrimidine nucleosides and CF were used for 5-FU toxicity mechanism elucidation in human keratinocytes. We suggest that for PPE treatment ointment containing uridine and thymidine should be further clinically tested.

  4. Air-Stimulated ATP Release from Keratinocytes Occurs through Connexin Hemichannels

    Science.gov (United States)

    Barr, Travis P.; Albrecht, Phillip J.; Hou, Quanzhi; Mongin, Alexander A.; Strichartz, Gary R.; Rice, Frank L.

    2013-01-01

    Cutaneous ATP release plays an important role in both epidermal stratification and chronic pain, but little is known about ATP release mechanisms in keratinocytes that comprise the epidermis. In this study, we analyzed ATP release from cultured human neonatal keratinocytes briefly exposed to air, a process previously demonstrated to trigger ATP release from these cells. We show that exposing keratinocytes to air by removing media for 15 seconds causes a robust, long-lasting ATP release. This air-stimulated ATP release was increased in calcium differentiated cultures which showed a corresponding increase in connexin 43 mRNA, a major component of keratinocyte hemichannels. The known connexin hemichannel inhibitors 1-octanol and carbenoxolone both significantly reduced air-stimulated ATP release, as did two drugs traditionally used as ABC transporter inhibitors (glibenclamide and verapamil). These same 4 inhibitors also prevented an increase in the uptake of a connexin permeable dye induced by air exposure, confirming that connexin hemichannels are open during air-stimulated ATP release. In contrast, activity of the MDR1 ABC transporter was reduced by air exposure and the drugs that inhibited air-stimulated ATP release had differential effects on this transporter. These results indicate that air exposure elicits non-vesicular release of ATP from keratinocytes through connexin hemichannels and that drugs used to target connexin hemichannels and ABC transporters may cross-inhibit. Connexins represent a novel, peripheral target for the treatment of chronic pain and dermatological disease. PMID:23457608

  5. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    Energy Technology Data Exchange (ETDEWEB)

    Yamakoshi, Takako [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Makino, Teruhiko, E-mail: tmakino@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Ur Rehman, Mati; Yoshihisa, Yoko [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Sugimori, Michiya [Department of Integrative Neuroscience, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Shimizu, Tadamichi, E-mail: shimizut@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan)

    2013-03-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes.

  6. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    International Nuclear Information System (INIS)

    Yamakoshi, Takako; Makino, Teruhiko; Ur Rehman, Mati; Yoshihisa, Yoko; Sugimori, Michiya; Shimizu, Tadamichi

    2013-01-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes

  7. HPV16 E6 regulates annexin 1 (ANXA1) protein expression in cervical carcinoma cell lines

    International Nuclear Information System (INIS)

    Calmon, Marilia Freitas; Sichero, Laura; Boccardo, Enrique; Villa, Luisa Lina; Rahal, Paula

    2016-01-01

    Annexin 1 (ANXA1) is a substrate for E6AP mediated ubiquitylation. It has been hypothesized that HPV 16 E6 protein redirects E6AP away from ANXA1, increasing its stability and possibly contributing to viral pathogenesis. We analyzed ANXA1 expression in HPV-positive and negative cervical carcinoma-derived cells, in cells expressing HPV-16 oncogenes and in cells transduced with shRNA targeting E6AP. We observed that ANXA1 protein expression increased in HPV-16-positive tumor cells, in keratinocytes expressing HPV-16 E6wt (wild-type) or E6/E7 and C33 cells expressing HPV-16 E6wt. ANXA1 protein expression decreased in cells transfected with E6 Dicer-substrate RNAs (DsiRNA) and C33 cells cotransduced with HPV-16 E6wt and E6AP shRNA. Moreover, colony number and proliferation rate decreased in HPV16-positive cells transduced with ANXA1 shRNA. We observed that in cells infected with HPV16, the E6 binds to E6AP to degrade p53 and upregulate ANXA1. We suggest that ANXA1 may play a role in HPV-mediated carcinogenesis. - Highlights: • ANXA1 upregulation requires the presence of E6 and E6AP and is dependent on E6 integrity. • E6 binds to E6AP to degrade p53 and upregulate ANXA1 in cells infected with HPV16. • ANXA1 plays a role in cell proliferation in HPV-positive cervical cells.

  8. HPV16 E6 regulates annexin 1 (ANXA1) protein expression in cervical carcinoma cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Calmon, Marilia Freitas [Department of Biology, Institute of Bioscience, Language and Exact Science, São Paulo State University, São Jose do Rio Preto (Brazil); Sichero, Laura [Molecular Biology Laboratory, Centre for Translational Research in Oncology, Instituto do Câncer do Estado de São Paulo (ICESP), São Paulo (Brazil); Boccardo, Enrique [Department of Microbiology, Institute of Biomedical Sciences, University of São Paulo., São Paulo (Brazil); Villa, Luisa Lina [Department of Radiology and Oncology, Faculdade de Medicina, Universidade de São Paulo, São Paulo (Brazil); Rahal, Paula, E-mail: rahalp@yahoo.com.br [Department of Biology, Institute of Bioscience, Language and Exact Science, São Paulo State University, São Jose do Rio Preto (Brazil)

    2016-09-15

    Annexin 1 (ANXA1) is a substrate for E6AP mediated ubiquitylation. It has been hypothesized that HPV 16 E6 protein redirects E6AP away from ANXA1, increasing its stability and possibly contributing to viral pathogenesis. We analyzed ANXA1 expression in HPV-positive and negative cervical carcinoma-derived cells, in cells expressing HPV-16 oncogenes and in cells transduced with shRNA targeting E6AP. We observed that ANXA1 protein expression increased in HPV-16-positive tumor cells, in keratinocytes expressing HPV-16 E6wt (wild-type) or E6/E7 and C33 cells expressing HPV-16 E6wt. ANXA1 protein expression decreased in cells transfected with E6 Dicer-substrate RNAs (DsiRNA) and C33 cells cotransduced with HPV-16 E6wt and E6AP shRNA. Moreover, colony number and proliferation rate decreased in HPV16-positive cells transduced with ANXA1 shRNA. We observed that in cells infected with HPV16, the E6 binds to E6AP to degrade p53 and upregulate ANXA1. We suggest that ANXA1 may play a role in HPV-mediated carcinogenesis. - Highlights: • ANXA1 upregulation requires the presence of E6 and E6AP and is dependent on E6 integrity. • E6 binds to E6AP to degrade p53 and upregulate ANXA1 in cells infected with HPV16. • ANXA1 plays a role in cell proliferation in HPV-positive cervical cells.

  9. Comparative transcriptomic profiling of hydrogen peroxide signaling networks in zebrafish and human keratinocytes: Implications toward conservation, migration and wound healing.

    Science.gov (United States)

    Lisse, Thomas S; King, Benjamin L; Rieger, Sandra

    2016-02-05

    Skin wounds need to be repaired rapidly after injury to restore proper skin barrier function. Hydrogen peroxide (H2O2) is a conserved signaling factor that has been shown to promote a variety of skin wound repair processes, including immune cell migration, angiogenesis and sensory axon repair. Despite growing research on H2O2 functions in wound repair, the downstream signaling pathways activated by this reactive oxygen species in the context of injury remain largely unknown. The goal of this study was to provide a comprehensive analysis of gene expression changes in the epidermis upon exposure to H2O2 concentrations known to promote wound repair. Comparative transcriptome analysis using RNA-seq data from larval zebrafish and previously reported microarray data from a human epidermal keratinocyte line shows that H2O2 activates conserved cell migration, adhesion, cytoprotective and anti-apoptotic programs in both zebrafish and human keratinocytes. Further assessment of expression characteristics and signaling pathways revealed the activation of three major H2O2-dependent pathways, EGF, FOXO1, and IKKα. This study expands on our current understanding of the clinical potential of low-level H2O2 for the promotion of epidermal wound repair and provides potential candidates in the treatment of wound healing deficits.

  10. Micronucleus formation in cultured human keratinocytes following exposure to mitomycin C and cyclophosphamide.

    Science.gov (United States)

    van Pelt, F N; Haring, R M; Overkamp, M J; Weterings, P J

    1991-02-01

    A method is described to investigate the induction of micronuclei in cultured human keratinocytes after short-term exposure to known clastogenic agents. The cytokinesis-block method was applied to facilitate the scoring of micronucleated cells. Mitomycin C, a direct-acting compound, caused a 5-20-fold increase in micronuclei over the controls at the highest concentration tested (1 microgram/ml). Cyclophosphamide, an agent requiring metabolic activation, did not induce the formation of micronuclei in cultured keratinocytes. However, after pretreatment of the keratinocyte cultures with Aroclor 1254 for 72 h, exposure to cyclophosphamide resulted in a 3-fold increase in micronucleus frequency over the controls. No cytogenetic effect of Aroclor 1254 was observed in control experiments.

  11. A comparative in vitro study of the viability of human keratinocytes grown on irradiated human amnion membrane and fibrin glue scaffolds

    International Nuclear Information System (INIS)

    Dorai, A.A.; Lim, C.K.; Azman, W.S.; Halim, A.S.

    2008-01-01

    Full text: The dried irradiated human amnion membrane has been used as a biological dressing for various clinical conditions. Being another biological membrane its potential as a scaffold to grow human keratinocytes is not known yet. To compare the growth patterns and cell viability of keratinocytes using fibrin glue and air dried amnion membrane as a scaffold. Keratinocytes were obtained from skin samples of six patients undergoing elective surgery. Fibrin glue (Tisseel, Baxter ) was diluted and used to coat the wells. Human dried amnion membrane was obtained and placed into the 24 well plates. Keratinocytes were seeded into the fibrin and amnion scaffold. Cell viability assay (MTT) was performed after 24, 48 and 72 hours. Finally the measurements were done by the Enzyme-Linked Immunosorbent Assay (ELISA) reader at 570 nm. Six patients consented for the study. The cells growing on the amnion scaffold showed a decreasing trend (20.67%, 17.94% and 16.78% respectively for 24, 48 and 72 hours). The cells growing on the fibrin scaffold showed a steady increase in number at 24, 48 and 72 hours (73.03%, 74.12% and 79.66%). The percentage of growth of normal human keratinocytes were significantly greater in the fibrin scaffold group (Mann - Whitney p = 0.002) for 24, 48 and 72 hours. The air dried irradiated human amnion membrane can be used as a scaffold to grow keratinocytes but however the growth pattern does not sustain with time. Fibrin glue supports the growth of human keratinocytes and shows an increasing pattern of growth with time. (Author)

  12. Expression of drebrin, an actin binding protein, in basal cell carcinoma, trichoblastoma and trichoepithelioma.

    Science.gov (United States)

    Mizutani, Yoko; Iwamoto, Ikuko; Kanoh, Hiroyuki; Seishima, Mariko; Nagata, Koh-ichi

    2014-06-01

    Drebrin, an F-actin binding protein, is known to play important roles in cell migration, synaptogenesis and neural plasticity. Although drebrin was long thought to be specific for neuronal cells, its expression has recently been reported in non-neuronal cells. As for skin-derived cells, drebrin was shown to be enriched at adhering junctions (AJs) in cultured primary keratinocytes and also be highly expressed in basal cell carcinoma (BCC) cells. Since BCC and two types of benign neoplasm, trichoblastoma and trichoepithelioma, are considered to derive from the same origin, follicular germinative cells, it is sometimes difficult to morphologically distinguish BCC from trichoblastoma and trichoepithelioma. In this study, we performed immunohistochemical staining of drebrin in BCC, trichoblastoma and trichoepithelioma, to examine whether drebrin could serve as a biomarker for BCC diagnosis. In western blotting, drebrin was detected highly and moderately in the lysates from a squamous cell carcinoma cell line, DJM-1, and normal human epidermis, respectively. In immunofluorescence analyses, drebrin was colocalized with markers of AJs and tight junctions in DJM-1 cells and detected at cell-cell junction areas of human normal epidermis tissue. We then examined the distribution patterns of drebrin in BCC, trichoblastoma and trichoepithelioma. In BCC tissues, intense and homogeneous drebrin expression was observed mainly at tumor cell-cell boundaries. In contrast, drebrin was stained only weakly and non-homogeneously in trichoblastoma and trichoepthelioma tissue samples. For differential diagnosis of BCC, drebrin may be a novel and useful marker.

  13. Influence of ion implantation on the adhesion and grow of human keratinocytes

    International Nuclear Information System (INIS)

    Walachova, K.; Svorcik, V.; Dvorakova, B.; Vogtova, D.

    1999-01-01

    Interaction of keratinocytes with polymer modified by ion implantation was studied with the possibility of cultivate these cells for regeneration of dermal cover, for example, heavy burned persons. The modification on polyethylene (PE) with 100 μm thickness was processed by implantation the Ar + ions with the energy 63 keV and Xe + ions with the energy 156 keV. Some characteristics of superficial modified layers and influence of ion implantation on the adhesion and proliferation of keratinocytes were studied

  14. In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland

    Science.gov (United States)

    Slominski, Andrzej T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.

    2014-01-01

    We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-hydroxylation of products. Studies with purified human CYP11A1 confirmed the ability of this enzyme to convert vitamin D2 to 20(OH)D2 and 17,20(OH)2D2. In placentas and Caco-2 cells, production of 20(OH)D2 was higher than 25(OH)D2 while in human keratinocytes the production of 20(OH)D2 and 25(OH)D2 were comparable. HaCaT keratinocytes showed high accumulation of 1,20(OH)2D2 relative to 20(OH)D2 indicating substantial CYP27B1 activity. This is the first in vivo evidence for a novel pathway of vitamin D2 metabolism initiated by CYP11A1 and modified by CYP27B1, with the product profile showing tissue- and cell-type specificity. PMID:24382416

  15. Fluctuating levels of reprogramming factor expression in cultured ...

    African Journals Online (AJOL)

    Although human undifferentiated keratinocytes (HUKs) can be reprogrammed to become induced pluripotent stem cells (iPSCs) with high efficiency and rapid kinetics by transducing reprogramming factors (RFs), the endogenous expression of reprogramming factors in cultured HUKs is not clear at different stages. In this ...

  16. Changes in dermal matrix in the absence of Rac1 in keratinocytes

    DEFF Research Database (Denmark)

    Stanley, Alanna; Pedersen, Esben Ditlev Kølle; Brakebusch, Cord

    2016-01-01

    Keratinocytes, in response to irritants, secrete pro-inflammatory mediators which recruit and activate immune and mesenchymal cells, including fibroblasts, to repair the skin. Fibroblasts respond by synthesising collagen and promoting the crosslinking extracellular matrix (ECM). We recently showed....... As inflammation is intimately linked with fibrotic disease in the skin, this raised the question as to whether this deletion may also affect the deposition and arrangement of the dermal ECM. This study assessed the effects of Rac1 deletion in keratinocytes and of the heightened inflammatory status by induction...... that this increase in the diameter of collagen fibrils due to inflammation may serve as pre-fibrotic marker enabling earlier determination of fibrosis and earlier treatment. This study has revealed previously unknown effects on the ECM due to the deletion of Rac1 in keratinocytes....

  17. Dysregulation of suppressor of cytokine signaling 3 in keratinocytes causes skin inflammation mediated by interleukin-20 receptor-related cytokines.

    Directory of Open Access Journals (Sweden)

    Ayako Uto-Konomi

    Full Text Available Homeostatic regulation of epidermal keratinocytes is controlled by the local cytokine milieu. However, a role for suppressor of cytokine signaling (SOCS, a negative feedback regulator of cytokine networks, in skin homeostasis remains unclear. Keratinocyte specific deletion of Socs3 (Socs3 cKO caused severe skin inflammation with hyper-production of IgE, epidermal hyperplasia, and S100A8/9 expression, although Socs1 deletion caused no inflammation. The inflamed skin showed constitutive STAT3 activation and up-regulation of IL-6 and IL-20 receptor (IL-20R related cytokines, IL-19, IL-20 and IL-24. Disease development was rescued by deletion of the Il6 gene, but not by the deletion of Il23, Il4r, or Rag1 genes. The expression of IL-6 in Socs3 cKO keratinocytes increased expression of IL-20R-related cytokines that further facilitated STAT3 hyperactivation, epidermal hyperplasia and neutrophilia. These results demonstrate that skin homeostasis is strictly regulated by the IL-6-STAT3-SOCS3 axis. Moreover, the SOCS3-mediated negative feedback loop in keratinocytes has a critical mechanistic role in the prevention of skin inflammation caused by hyperactivation of STAT3.

  18. Characterization of Ninjurin and TSC22 induction after X-irradiation of normal human skin cells

    International Nuclear Information System (INIS)

    Koike, Manabu; Ninomiya, Yasuharu; Koike, Aki

    2008-01-01

    The skin is an external organ that is most frequently exposed to radiation. It is important to elucidate the influence of radiation exposure on the skin at the molecular level. To identify radiation-responsive genes in human skin cells, we used microarray technology to examine the effects of irradiation on 641 genes in normal human epidermal keratinocytes at 4 h and 8 h postirradiation with a cytotoxic dose of X-ray (10 Gy). We found that 18 genes were upregulated and 35 genes were downregulated in keratinocytes at 4 h and/or 8 h postirradiation. Ninjurin, whose function remains unknown in keratinocytes, was induced most strongly by X-irradiation. Several known apoptosis-related genes, such as TSC22, were also upregulated. We characterized Ninjurin and TSC22 induction after X-irradiation of normal human skin cells. The induction of the expression of Ninjurin and TSC22 mRNA in keratinocytes following high-dose X-irradiation was confirmed by northern blot analysis. In dermal fibroblasts, Ninjurin, but not TSC22, was induced after X-ray irradiation. The dependence of both gene expression on the status of an apoptosis regulator, p53, was found. In addition, the expression of both mRNA was induced upon treatment with an apoptosis inducer, etoposide. On the other hand, TSC22, but not Ninjurin, was induced and accumulated in keratinocytes upon treatment with an apoptosis inducer, anisomycin. However, in transient expression assay, EYFP-TSC22, as well as EYFP-Ninjurin or EYFP alone, did not induce apoptosis in keratinocytes in contrast to EYFP-GADD45. Taken together, these findings have important implications on the understanding of the mechanism underlying the complex response of skin cells following X-irradiation. (author)

  19. Pseudomonas-derived ceramidase induces production of inflammatory mediators from human keratinocytes via sphingosine-1-phosphate.

    Directory of Open Access Journals (Sweden)

    Ami Oizumi

    Full Text Available Ceramide is important for water retention and permeability barrier functions in the stratum corneum, and plays a key role in the pathogenesis of atopic dermatitis (AD. A Pseudomonas aeruginosa-derived neutral ceramidase (PaCDase isolated from a patient with AD was shown to effectively degrade ceramide in the presence of Staphylococcus aureus-derived lipids or neutral detergents. However, the effect of ceramide metabolites on the functions of differentiating keratinocytes is poorly understood. We found that the ceramide metabolite sphingosine-1-phosphate (S1P stimulated the production of inflammatory mediators such as TNF-α and IL-8 from three-dimensionally cultured human primary keratinocytes (termed "3D keratinocytes", which form a stratum corneum. PaCDase alone did not affect TNF-α gene expression in 3D keratinocytes. In the presence of the detergent Triton X-100, which damages stratum corneum structure, PaCDase, but not heat-inactivated PaCDase or PaCDase-inactive mutant, induced the production of TNF-α, endothelin-1, and IL-8, indicating that this production was dependent on ceramidase activity. Among various ceramide metabolites, sphingosine and S1P enhanced the gene expression of TNF-α, endothelin-1, and IL-8. The PaCDase-enhanced expression of these genes was inhibited by a sphingosine kinase inhibitor and by an S1P receptor antagonist VPC 23019. The TNF-α-binding antibody infliximab suppressed the PaCDase-induced upregulation of IL-8, but not TNF-α, mRNA. PaCDase induced NF-κB p65 phosphorylation. The NF-κB inhibitor curcumin significantly inhibited PaCDase-induced expression of IL-8 and endothelin-1. VPC 23019 and infliximab inhibited PaCDase-induced NF-κB p65 phosphorylation and reduction in the protein level of the NF-κB inhibitor IκBα. Collectively, these findings suggest that (i 3D keratinocytes produce S1P from sphingosine, which is produced through the hydrolysis of ceramide by PaCDase, (ii S1P induces the production

  20. Gene expression based evidence of innate immune response activation in the epithelium with oral lichen planus

    Science.gov (United States)

    Adami, Guy R.; Yeung, Alexander C.F.; Stucki, Grant; Kolokythas, Antonia; Sroussi, Herve Y.; Cabay, Robert J.; Kuzin, Igor; Schwartz, Joel L.

    2014-01-01

    Objective Oral lichen planus (OLP) is a disease of the oral mucosa of unknown cause producing lesions with an intense band-like inflammatory infiltrate of T cells to the subepithelium and keratinocyte cell death. We performed gene expression analysis of the oral epithelium of lesions in subjects with OLP and its sister disease, oral lichenoid reaction (OLR), in order to better understand the role of the keratinocytes in these diseases. Design Fourteen patients with OLP or OLR were included in the study, along with a control group of 23 subjects with a variety of oral diseases and a normal group of 17 subjects with no clinically visible mucosal abnormalities. Various proteins have been associated with OLP, based on detection of secreted proteins or changes in RNA levels in tissue samples consisting of epithelium, stroma, and immune cells. The mRNA level of twelve of these genes expressed in the epithelium was tested in the three groups. Results Four genes showed increased expression in the epithelium of OLP patients: CD14, CXCL1, IL8, and TLR1, and at least two of these proteins, TLR1 and CXCL1, were expressed at substantial levels in oral keratinocytes. Conclusions Because of the large accumulation of T cells in lesions of OLP it has long been thought to be an adaptive immunity malfunction. We provide evidence that there is increased expression of innate immune genes in the epithelium with this illness, suggesting a role for this process in the disease and a possible target for treatment. PMID:24581860

  1. Integrin-Linked Kinase Is Indispensable for Keratinocyte Differentiation and Epidermal Barrier Function.

    Science.gov (United States)

    Sayedyahossein, Samar; Rudkouskaya, Alena; Leclerc, Valerie; Dagnino, Lina

    2016-02-01

    A functional permeability barrier is essential to prevent the passage of water and electrolytes, macromolecules, and pathogens through the epidermis. This is accomplished in terminally differentiated keratinocytes through formation of a cornified envelope and the assembly of tight intercellular junctions. Integrin-linked kinase (ILK) is a scaffold protein essential for hair follicle morphogenesis and epidermal attachment to the basement membrane. However, the biological functions of ILK in differentiated keratinocytes remain poorly understood. Furthermore, whether ILK is implicated in keratinocyte differentiation and intercellular junction formation has remained an unresolved issue. Here we describe a pivotal role for ILK in keratinocyte differentiation responses to increased extracellular Ca(2+), regulation of adherens and tight junction assembly, and the formation of an outside-in permeability barrier toward macromolecules. In the absence of ILK, the calcium sensing receptor, E-cadherin, and ZO-1 fail to translocate to the cell membrane, through mechanisms that involve abnormalities in microtubules and in RhoA activation. In situ, ILK-deficient epidermis exhibits reduced tight junction formation and increased outside-in permeability to a dextran tracer, indicating reduced barrier properties toward macromolecules. Therefore, ILK is an essential component of keratinocyte differentiation programs that contribute to epidermal integrity and the establishment of its barrier properties. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Modulation of mitochondrial activity in HaCaT keratinocytes by the cell penetrating peptide Z-Gly-RGD(DPhe)-mitoparan.

    Science.gov (United States)

    Richardson, Adam; Muir, Lewis; Mousdell, Sasha; Sexton, Darren; Jones, Sarah; Howl, John; Ross, Kehinde

    2018-01-30

    Biologically active cell penetrating peptides (CPPs) are an emerging class of therapeutic agent. The wasp venom peptide mastoparan is an established CPP that modulates mitochondrial activity and triggers caspase-dependent apoptosis in cancer cells, as does the mastoparan analogue mitoparan (mitP). Mitochondrial depolarisation and activation of the caspase cascade also underpins the action of dithranol, a topical agent for treatment of psoriasis. The effects of a potent mitP analogue on mitochondrial activity were therefore examined to assess its potential as a novel approach for targeting mitochondria for the treatment of psoriasis. In HaCaT keratinocytes treated with the mitP analogue Z-Gly-RGD(DPhe)-mitP for 24 h, a dose-dependent loss of mitochondrial activity was observed using the methyl-thiazolyl-tetrazolium (MTT) assay. At 10 μmol L -1 , MTT activity was less than 30% that observed in untreated cells. Staining with the cationic dye JC-1 suggested that Z-Gly-RGD(DPhe)-mitP also dissipated the mitochondrial membrane potential, with a threefold increase in mitochondrial depolarisation levels. However, caspase activity appeared to be reduced by 24 h exposure to Z-Gly-RGD(DPhe)-mitP treatment. Furthermore, Z-Gly-RGD(DPhe)-mitP treatment had little effect on overall cell viability. Our findings suggest Z-Gly-RGD(DPhe)-mitP promotes the loss of mitochondrial activity but does not appear to evoke apoptosis in HaCaT keratinocytes.

  3. Differentiation-Dependent KLF4 Expression Promotes Lytic Epstein-Barr Virus Infection in Epithelial Cells.

    Directory of Open Access Journals (Sweden)

    Dhananjay M Nawandar

    2015-10-01

    Full Text Available Epstein-Barr virus (EBV is a human herpesvirus associated with B-cell and epithelial cell malignancies. EBV lytically infects normal differentiated oral epithelial cells, where it causes a tongue lesion known as oral hairy leukoplakia (OHL in immunosuppressed patients. However, the cellular mechanism(s that enable EBV to establish exclusively lytic infection in normal differentiated oral epithelial cells are not currently understood. Here we show that a cellular transcription factor known to promote epithelial cell differentiation, KLF4, induces differentiation-dependent lytic EBV infection by binding to and activating the two EBV immediate-early gene (BZLF1 and BRLF1 promoters. We demonstrate that latently EBV-infected, telomerase-immortalized normal oral keratinocyte (NOKs cells undergo lytic viral reactivation confined to the more differentiated cell layers in organotypic raft culture. Furthermore, we show that endogenous KLF4 expression is required for efficient lytic viral reactivation in response to phorbol ester and sodium butyrate treatment in several different EBV-infected epithelial cell lines, and that the combination of KLF4 and another differentiation-dependent cellular transcription factor, BLIMP1, is highly synergistic for inducing lytic EBV infection. We confirm that both KLF4 and BLIMP1 are expressed in differentiated, but not undifferentiated, epithelial cells in normal tongue tissue, and show that KLF4 and BLIMP1 are both expressed in a patient-derived OHL lesion. In contrast, KLF4 protein is not detectably expressed in B cells, where EBV normally enters latent infection, although KLF4 over-expression is sufficient to induce lytic EBV reactivation in Burkitt lymphoma cells. Thus, KLF4, together with BLIMP1, plays a critical role in mediating lytic EBV reactivation in epithelial cells.

  4. Fibroblast growth factor 2 and DNA repair involvement in the keratinocyte stem cells response to ionizing radiation

    International Nuclear Information System (INIS)

    Harfouche, L'Emira Ghida

    2010-02-01

    Keratinocyte stem cells (KSCs) from the human inter follicular epidermis are regarded as the major target to radiation during radiotherapy. We found herein that KSCs are more resistant to ionizing radiation than their direct progeny, and presented more rapid DNA damage repair kinetics than the progenitors. Furthermore, we provided evidence describing the effect of fibroblast growth factor 2 (FGF2) signaling on the ability of KSCs and progenitors to repair damaged DNA. Despite our knowledge of the fact, that FGF is an anti-apoptotic factor in multiple cell types, the direct link between DNA repair and FGF2 signaling has rarely been shown. Existence of such link is an important issue with implications not only to stem cell field but also to cancer therapy. (author)

  5. UVB-induced nuclear translocation of TC-PTP by AKT/14-3-3σ axis inhibits keratinocyte survival and proliferation.

    Science.gov (United States)

    Kim, Mihwa; Morales, Liza D; Baek, Minwoo; Slaga, Thomas J; DiGiovanni, John; Kim, Dae Joon

    2017-10-31

    Understanding protein subcellular localization is important to determining the functional role of specific proteins. T-cell protein tyrosine phosphatase (TC-PTP) contains bipartite nuclear localization signals (NLSI and NLSII) in its C-terminus. We previously have demonstrated that the nuclear form of TC-PTP (TC45) is mainly localized to the cytoplasm in keratinocytes and it is translocated to the nucleus following UVB irradiation. Here, we report that TC45 is translocated by an AKT/14-3-3σ-mediated mechanism in response to UVB exposure, resulting in increased apoptosis and decreased keratinocyte proliferation. We demonstrate that UVB irradiation increased phosphorylation of AKT and induced nuclear translocation of 14-3-3σ and TC45. However, inhibition of AKT blocked nuclear translocation of TC45 and 14-3-3σ. Site-directed mutagenesis of 14-3-3σ binding sites within TC45 showed that a substitution at Threonine 179 (TC45/T179A) effectively blocked UVB-induced nuclear translocation of ectopic TC45 due to the disruption of the direct binding between TC45 and 14-3-3σ. Overexpression of TC45/T179A in keratinocytes resulted in a decrease of UVB-induced apoptosis which corresponded to an increase in nuclear phosphorylated STAT3, and cell proliferation was higher in TC45/T179A-overexpressing keratinocytes compared to control keratinocytes following UVB irradiation. Furthermore, deletion of TC45 NLSII blocked its UVB-induced nuclear translocation, indicating that both T179 and NLSII are required. Taken together, our findings suggest that AKT and 14-3-3σ cooperatively regulate TC45 nuclear translocation in a critical step of an early protective mechanism against UVB exposure that signals the deactivation of STAT3 in order to promote keratinocyte cell death and inhibit keratinocyte proliferation.

  6. In vitro human keratinocyte migration rates are associated with SNPs in the KRT1 interval.

    Directory of Open Access Journals (Sweden)

    Heng Tao

    Full Text Available Efforts to develop effective therapeutic treatments for promoting fast wound healing after injury to the epidermis are hindered by a lack of understanding of the factors involved. Re-epithelialization is an essential step of wound healing involving the migration of epidermal keratinocytes over the wound site. Here, we examine genetic variants in the keratin-1 (KRT1 locus for association with migration rates of human epidermal keratinocytes (HEK isolated from different individuals. Although the role of intermediate filament genes, including KRT1, in wound activated keratinocytes is well established, this is the first study to examine if genetic variants in humans contribute to differences in the migration rates of these cells. Using an in vitro scratch wound assay we observe quantifiable variation in HEK migration rates in two independent sets of samples; 24 samples in the first set and 17 samples in the second set. We analyze genetic variants in the KRT1 interval and identify SNPs significantly associated with HEK migration rates in both samples sets. Additionally, we show in the first set of samples that the average migration rate of HEK cells homozygous for one common haplotype pattern in the KRT1 interval is significantly faster than that of HEK cells homozygous for a second common haplotype pattern. Our study demonstrates that genetic variants in the KRT1 interval contribute to quantifiable differences in the migration rates of keratinocytes isolated from different individuals. Furthermore we show that in vitro cell assays can successfully be used to deconstruct complex traits into simple biological model systems for genetic association studies.

  7. Areca nut extract up-regulates prostaglandin production, cyclooxygenase-2 mRNA and protein expression of human oral keratinocytes.

    Science.gov (United States)

    Jeng, J H; Ho, Y S; Chan, C P; Wang, Y J; Hahn, L J; Lei, D; Hsu, C C; Chang, M C

    2000-07-01

    There are about 600 million betel quid (BQ) chewers in the world. BQ chewing is associated with increased incidence of oral cancer and submucous fibrosis. In this study, areca nut (AN) extract (200-800 microg/ml) induced the prostaglandin E(2) (PGE(2)) production by 1. 4-3.4-fold and 6-keto-PGF(1 alpha) production by 1.1-1.7-fold of gingival keratinocytes (GK), respectively, following 24 h of exposure. Exposure of GK to AN extract (>400 microg/ml) led to cell retraction and intracellular vacuoles formation. At concentrations of 800 and 1200 microg/ml, AN extract induced cell death at 21-24 and 32-52% as detected by MTT assay and cellular lactate dehydrogenase release, respectively. Interestingly, AN-induced morphological changes of GK are reversible. GK can still proliferate following exposure to AN extract. Cytotoxicity of AN extract cannot be inhibited by indomethacin (1 microM) and aspirin (50 microM), indicating that prostaglandin (PG) production is not the major factor responsible for AN cytotoxicity. PGE(2) exhibited little effect on the growth of GK at concentrations ranging from 100-1000 pg/ml. Stimulating GK production of PGs by AN extract could be due to induction of cyclooxygenase-2 (COX-2) mRNA expression and protein production. These results suggest that AN ingredients are critical in the pathogenesis of oral submucous fibrosis and oral cancer via their stimulatory effects on the PGs, COX-2 production and associated tissue inflammatory responses. AN cytotoxicity to GK is not directly mediated by COX-2 stimulation and PG production.

  8. Factors affecting ultraviolet-A photon emission from β-irradiated human keratinocyte cells.

    Science.gov (United States)

    Le, M; Mothersill, C E; Seymour, C B; Ahmad, S B; Armstrong, A; Rainbow, A J; McNeill, F E

    2015-08-21

    The luminescence intensity of 340±5 nm photons emitted from HaCaT (human keratinocyte) cells was investigated using a single-photon-counting system during cellular exposure to (90)Y β-particles. Multiple factors were assessed to determine their influence upon the quantity and pattern of photon emission from β-irradiated cells. Exposure of 1 x 10(4) cells/5 mL to 703 μCi resulted in maximum UVA photoemission at 44.8 x 10(3)±2.5 x 10(3) counts per second (cps) from live HaCaT cells (background: 1-5 cps); a 16-fold increase above cell-free controls. Significant biophoton emission was achieved only upon stimulation and was also dependent upon presence of cells. UVA luminescence was measured for (90)Y activities 14 to 703 μCi where a positive relationship between photoemission and (90)Y activity was observed. Irradiation of live HaCaT cells plated at various densities produced a distinct pattern of emission whereby luminescence increased up to a maximum at 1 x 10(4) cells/5 mL and thereafter decreased. However, this result was not observed in the dead cell population. Both live and dead HaCaT cells were irradiated and were found to demonstrate different rates of photon emission at low β activities (⩽400 μCi). Dead cells exhibited greater photon emission rates than live cells which may be attributable to metabolic processes taking place to modulate the photoemissive effect. The results indicate that photon emission from HaCaT cells is perturbed by external stimulation, is dependent upon the activity of radiation delivered, the density of irradiated cells, and cell viability. It is postulated that biophoton emission may be modulated by a biological or metabolic process.

  9. Effect of 1,24R-dihydroxyvitamin D3 on the growth of human keratinocytes.

    LENUS (Irish Health Repository)

    Matsumoto, K

    1990-02-01

    The effect of 1,24R-dihydroxyvitamin D3 (1,24R(OH)2D3), a synthetic analogue of a biologically active form of vitamin D3 (1,25-dihydroxyvitamin D3, 1,25(OH)2D3), on the growth of human keratinocytes cultured in serum-free medium was investigated. The growth of cultured normal human keratinocytes was inhibited by 65% by 10(-8)M 1,24R(OH)2D3 and by 90% by 10(-7)M 1,24(OH)2D3. It inhibited cell growth almost completely at 10(-6)M. The DNA synthesis of keratinocytes was also inhibited with 1,24R(OH)2D3 by 27% at 10(-8)M, 59% at 10(-7)M, and 92% at 10(-6)M. The inhibition of cell growth and DNA synthesis were more remarkable by 1,24R(OH)2D3 than by 1,25(OH)2D3. 1,24R(OH)2D3 also inhibited the growth of keratinocytes derived from patients with psoriasis vulgaris; the growth inhibitory effect was again more remarkable with 1,24R(OH)2D3 than with 1,25(OH)2D3. The viability and protein synthesis of keratinocytes were not affected by 1,24R(OH)2D3, suggesting that the growth inhibitory effect is due to its biological activity, not to cytotoxicity. The binding of [3H]-labeled 1,25(OH)2D3 to its receptor in the cytosolic fraction of cultured keratinocytes was competitively substituted by unlabeled 1,24R(OH)2D3 as well as 1,25(OH)2D3, suggesting that 1,24R(OH)2D3 binds to the 1,25(OH)2D3 receptor. It was found that the affinity of 1,24R(OH)2D3 for the receptor was slightly higher than that of 1,25(OH)2D3. These results demonstrate that 1,24R(OH)2D3 functions as a potent growth inhibitor in vitro in human keratinocytes from both normal and psoriatic epidermis, and it possesses a higher affinity for the 1,25(OH)2D3 receptor in cultured human keratinocytes. The difference in affinity of 1,24R(OH)2D3 for the 1,25(OH)2D3 receptor correlates with its greater inhibition of keratinocyte growth than 1,25(OH)2D3. 1,24R(OH)2D3 may be useful in the treatment of psoriasis.

  10. CDH1 regulates E2F1 degradation in response to differentiation signals in keratinocytes.

    Science.gov (United States)

    Singh, Randeep K; Dagnino, Lina

    2017-01-17

    The E2F1 transcription factor plays key roles in skin homeostasis. In the epidermis, E2F1 expression is essential for normal proliferation of undifferentiated keratinocytes, regeneration after injury and DNA repair following UV radiation-induced photodamage. Abnormal E2F1 expression promotes nonmelanoma skin carcinoma. In addition, E2F1 must be downregulated for proper keratinocyte differentiation, but the relevant mechanisms involved remain poorly understood. We show that differentiation signals induce a series of post-translational modifications in E2F1 that are jointly required for its downregulation. Analysis of the structural determinants that govern these processes revealed a central role for S403 and T433. In particular, substitution of these two amino acid residues with non-phosphorylatable alanine (E2F1 ST/A) interferes with E2F1 nuclear export, K11- and K48-linked polyubiquitylation and degradation in differentiated keratinocytes. In contrast, replacement of S403 and T433 with phosphomimetic aspartic acid to generate a pseudophosphorylated E2F1 mutant protein (E2F1 ST/D) generates a protein that is regulated in a manner indistinguishable from that of wild type E2F1. Cdh1 is an activating cofactor that interacts with the anaphase-promoting complex/cyclosome (APC/C) ubiquitin E3 ligase, promoting proteasomal degradation of various substrates. We found that Cdh1 associates with E2F1 in keratinocytes. Inhibition or RNAi-mediated silencing of Cdh1 prevents E2F1 degradation in response to differentiation signals. Our results reveal novel regulatory mechanisms that jointly modulate post-translational modifications and downregulation of E2F1, which are necessary for proper epidermal keratinocyte differentiation.

  11. Exploratory Study on the Stability Characteristics of Commercial Human Keratinocytes

    Science.gov (United States)

    1990-04-01

    Invest. Dermatol. 75:176- 182; 1980. 16. Hayflick , L. The limited in vitro lifetime of huiran diploid strains. Exp. Cell Res. 37:614-636; 1965. 17...culture keratinocytes were considered by some investigators to have limited proliferative potential, so they used third and fourth passage commercial

  12. The role of alpha3beta1 integrin in determining the supramolecular organization of laminin-5 in the extracellular matrix of keratinocytes.

    Science.gov (United States)

    deHart, Gregory W; Healy, Kevin E; Jones, Jonathan C R

    2003-02-01

    Analyses of mice with targeted deletions in the genes for alpha3 and beta1 integrin suggest that the alpha3beta1 integrin heterodimer likely determines the organization of the extracellular matrix within the basement membrane of skin. Here we tested this hypothesis using keratinocytes derived from alpha3 integrin-null mice. We have compared the organizational state of laminin-5, a ligand of alpha3beta1 integrin, in the matrix of wild-type keratinocytes with that of laminin-5 in the matrix of alpha3 integrin-null cells. Laminin-5 distributes diffusely in arc structures in the matrix of wild-type mouse keratinocytes, whereas laminin-5 is organized into linear, spike-like arrays by the alpha3 integrin-null cells. The fact that alpha3 integrin-null cells are deficient in their ability to assemble a proper laminin-5 matrix is also shown by their failure to remodel laminin-5 when plated onto surfaces coated with purified laminin-5 protein. In sharp contrast, wild-type keratinocytes organize exogenously added laminin-5 into discrete ring-like organizations. These findings led us next to assess whether differences in laminin-5 organization in the matrix of the wild-type and alpha3 integrin-null cells impact cell behavior. Our results indicate that alpha3 integrin-null cells are more motile than their wild-type counterparts and leave extensive trails of laminin-5 over the surface on which they move. Moreover, HEK 293 cells migrate significantly more on the laminin-5-rich matrix derived from the alpha3 integrin-null cells than on the wild-type keratinocyte laminin-5 matrix. In addition, alpha3 integrin-null cells show low strength of adhesion to surfaces coated with purified laminin-5 compared to wild-type cells although both the wild type and the alpha3 integrin-null keratinocytes adhere equally strongly to laminin-5 that has been organized into arrays by other epithelial cells. These data suggest: (1) that alpha3beta1 integrin plays an important role in determining the

  13. Protective effect of different antioxidant agents in UVB-irradiated keratinocytes

    Directory of Open Access Journals (Sweden)

    Sara Salucci

    2017-09-01

    Full Text Available Skin cells can respond to UVB-induced damage either by tolerating it, or restoring it through antioxidant activation and DNA repair mechanisms or, ultimately, undergoing programmed cell death, when damage is massive. Nutritional factors, in particular, food antioxidants, have attracted much interest because of their potential use in new preventive, protective, and therapeutic strategies for chronic degenerative diseases, including skin inflammation and cancer. Some polyphenols, present in virgin olive oil, well tolerated by organism after oral administration, show a variety of pharmacological and clinical benefits such as anti-oxidant, anti-cancer, anti-inflammatory, and neuro-protective activities. Here, the protective effects of antioxidant compounds against UV-induced apoptosis have been described in HaCat cell line. Human keratinocytes were pre-treated with antioxidants before UVB exposure and their effects have been evaluated by means of ultrastructural analyses. After UVB radiation, a known cell death trigger, typical apoptotic features, absent in control condition and in antioxidant alone-treated cells, appear. An evident numerical decrease of ultrastructural apoptotic patterns and TUNEL positive nuclei can be observed when natural antioxidants were supplied before cell death induction. These data have been confirmed by molecular investigation of caspase activity. In conclusion, this paper highlights antioxidant compound ability to prevent apoptotic cell death in human keratinocytes exposed to UVB, suggesting, for these molecules, a potential role in preventing skin damage. 

  14. Keratinocytes propagated in serum-free, feeder-free culture conditions fail to form stratified epidermis in a reconstituted skin model.

    Directory of Open Access Journals (Sweden)

    Rebecca Lamb

    Full Text Available Primary human epidermal stem cells isolated from skin tissues and subsequently expanded in tissue culture are used for human therapeutic use to reconstitute skin on patients and to generate artificial skin in culture for academic and commercial research. Classically, epidermal cells, known as keratinocytes, required fibroblast feeder support and serum-containing media for serial propagation. In alignment with global efforts to remove potential animal contaminants, many serum-free, feeder-free culture methods have been developed that support derivation and growth of these cells in 2-dimensional culture. Here we show that keratinocytes grown continually in serum-free and feeder-free conditions were unable to form into a stratified, mature epidermis in a skin equivalent model. This is not due to loss of cell potential as keratinocytes propagated in serum-free, feeder-free conditions retain their ability to form stratified epidermis when re-introduced to classic serum-containing media. Extracellular calcium supplementation failed to improve epidermis development. In contrast, the addition of serum to commercial, growth media developed for serum-free expansion of keratinocytes facilitated 3-dimensional stratification in our skin equivalent model. Moreover, the addition of heat-inactivated serum improved the epidermis structure and thickness, suggesting that serum contains factors that both aid and inhibit stratification.

  15. A modified fluorimetric host cell reactivation assay to determine the repair capacity of primary keratinocytes, melanocytes and fibroblasts

    Directory of Open Access Journals (Sweden)

    Gebhard Daniel

    2010-06-01

    Full Text Available Abstract Background The Host Cell Reactivation Assay (HCRA is widely used to identify circumstances and substances affecting the repair capacity of cells, however, it is restricted by the transfection procedure used and the sensitivity of the detection method. Primary skin cells are particularly difficult to transfect, and therefore sensitive methods are needed to detect any variations due to the cell-type or inter-individual differences or changes induced by diverse substances. A sensitive and repeatable method to detect the repair capacity of skin cells would be useful in two different aspects: On the one hand, to identify substances influencing the repair capacity in a positive manner (these substances could be promising ingredients for cosmetic products and on the other hand, to exclude the negative effects of substances on the repair capacity (this could serve as one step further towards replacing or at least reducing animal testing. Results In this paper, we present a rapid and sensitive assay to determine the repair capacity of primary keratinocytes, melanocytes and fibroblasts based on two wave-length Green Fluorescent Protein (GFP and DsRed reporter technology in order to test different substances and their potential to influence the DNA repair capacity. For the detection of plasmid restoration, we used FACS technology, which, in comparison to luminometer technology, is highly sensitive and allows single cell based analysis. The usefulness of this assay and studying the repair capacity is demonstrated by the evidence that DNA repair is repressed by Cyclosporin A in fibroblasts. Conclusions The methodology described in this paper determines the DNA repair capacity in different types of human skin cells. The described transfection protocol is suitable for the transfection of melanocytes, keratinocytes and fibroblasts, reaching efficacies suitable for the detection of the restored plasmids by FACS technology. Therefore the repair capacity

  16. Comparison of the miRNA profiles in HPV-positive and HPV-negative tonsillar tumors and a model system of human keratinocyte clones

    International Nuclear Information System (INIS)

    Vojtechova, Zuzana; Sabol, Ivan; Salakova, Martina; Smahelova, Jana; Zavadil, Jiri; Turek, Lubomir; Grega, Marek; Klozar, Jan; Prochazka, Bohumir; Tachezy, Ruth

    2016-01-01

    Better insights into the molecular changes involved in virus-associated and -independent head and neck cancer may advance our knowledge of HNC carcinogenesis and identify critical disease biomarkers. Here we aimed to characterize the expression profiles in a matched set of well-characterized HPV-dependent and HPV-independent tonsillar tumors and equivalent immortalized keratinocyte clones to define potential and clinically relevant biomarkers of HNC of different etiology. Fresh frozen tonsillar cancer tissues were analyzed together with non-malignant tonsillar tissues and compared with cervical tumors and normal cervical tissues. Furthermore, relative miRNAs abundance levels of primary and immortalized human keratinocyte clones were evaluated. The global quantitation of miRNA gene abundance was performed using a TaqMan Low Density Array system. The confirmation of differentially expressed miRNAs was performed on a set of formalin-fixed paraffin-embedded tumor samples enriched for the tumor cell fraction by macrodissection. We defined 46 upregulated and 31 downregulated miRNAs characteristic for the HPV-positive tonsillar tumors and 42 upregulated miRNAs and 42 downregulated miRNAs characteristic for HPV-independent tumors. In comparison with the expression profiles in cervical tumors, we defined miR-141-3p, miR-15b-5p, miR-200a-3p, miR-302c-3p, and miR-9-5p as specific for HPV induced malignancies. MiR-335-5p, miR-579-3p, and miR-126-5p were shared by the expression profiles of HPV-positive tonsillar tumors and of the HPV immortalized keratinocyte clones, whereas miR-328-3p, miR-34c-3p, and miR-885-5p were shared by the miRNA profiles of HPV-negative tonsillar tumors and the HPV-negative keratinocytes. We identified the miRNAs characteristic for HPV-induced tumors and tonsillar tumors of different etiology, and the results were compared with those of the model system. Our report presents the basis for further investigations leading to the identification of

  17. Methotrexate treatment provokes apoptosis of proliferating keratinocyte in psoriasis patients.

    Science.gov (United States)

    Elango, Tamilselvi; Thirupathi, Anand; Subramanian, Swapna; Ethiraj, Purushoth; Dayalan, Haripriya; Gnanaraj, Pushpa

    2017-08-01

    Psoriasis is a chronic inflammatory skin disease characterized by hyper proliferation of keratinocytes. Recent data show that the epidermis thickening in psoriasis may be related to imbalance of homeostasis caused by abnormal apoptotic process. Maintenance of keratinocyte apoptotic process is very important in psoriasis. Methotrexate (MTX) has been used for many years to restore the normal skin in psoriasis condition. However, the exact mechanism of MTX in psoriasis condition is poorly understood. The aim of this study was to examine the role of MTX on keratinocyte apoptosis pathway in psoriasis patients. A total of 58 psoriasis vulgaris patients were recruited for this study. Nonlesional skin biopsies served as control. Skin biopsies of psoriatic patients were collected and analyzed for cytosolic, mitochondria and total cytochrome c by ELISA. Expression of caspase-9, NFκBp65, pAkt1 by western blot, real-time PCR and immunohistochemical analysis of c-FLIP protein was analyzed in nonlesional and lesional skin biopsies before (day 0) and after (at the end of 6 and 12 weeks) MTX treatment. After MTX treatment, a significant increase in cytochrome c was observed when compared with before MTX treatment in psoriasis patients (p psoriasis by controlling the acanthosis.

  18. Molecular cloning and expression of a novel keratinocyte protein (psoriasis-associated fatty acid-binding protein [PA-FABP]) that is highly up-regulated in psoriatic skin and that shares similarity to fatty acid-binding proteins

    DEFF Research Database (Denmark)

    Madsen, Peder; Rasmussen, H H; Leffers, H

    1992-01-01

    termed PA-FABP (psoriasis-associated fatty acid-binding protein). The deduced sequence predicted a protein with molecular weight of 15,164 daltons and a calculated pI of 6.96, values that are close to those recorded in the keratinocyte 2D gel protein database. The protein comigrated with PA......-FABP as determined by 2D gel analysis of [35S]-methionine-labeled proteins expressed by transformed human amnion (AMA) cells transfected with clone 1592 using the vaccinia virus expression system and reacted with a rabbit polyclonal antibody raised against 2D gel purified PA-FABP. Structural analysis of the amino...... with epidermal growth factor (EGF), pituitary extract, and 10% fetal calf serum] revealed a strong up-regulation of PA-FABP, psoriasin, calgranulins A and B, and a few other proteins that are highly expressed in psoriatic skin. The levels of these proteins exceeded by far those observed in non-cultured normal...

  19. Cancer-associated fibroblasts regulate keratinocyte cell-cell adhesion via TGF-β-dependent pathways in genotype-specific oral cancer.

    Science.gov (United States)

    Cirillo, N; Hassona, Y; Celentano, A; Lim, K P; Manchella, S; Parkinson, E K; Prime, S S

    2017-01-01

    The interrelationship between malignant epithelium and the underlying stroma is of fundamental importance in tumour development and progression. In the present study, we used cancer-associated fibroblasts (CAFs) derived from genetically unstable oral squamous cell carcinomas (GU-OSCC), tumours that are characterized by the loss of genes such as TP53 and p16 INK4A and with extensive loss of heterozygosity, together with CAFs from their more genetically stable (GS) counterparts that have wild-type TP53 and p16 INK4A and minimal loss of heterozygosity (GS-OSCC). Using a systems biology approach to interpret the genome-wide transcriptional profile of the CAFs, we show that transforming growth factor-β (TGF-β) family members not only had biological relevance in silico but also distinguished GU-OSCC-derived CAFs from GS-OSCC CAFs and fibroblasts from normal oral mucosa. In view of the close association between TGF-β family members, we examined the expression of TGF-β1 and TGF-β2 in the different fibroblast subtypes and showed increased levels of active TGF-β1 and TGF-β2 in CAFs from GU-OSCC. CAFs from GU-OSCC, but not GS-OSCC or normal fibroblasts, induced epithelial-mesenchymal transition and down-regulated a broad spectrum of cell adhesion molecules resulting in epithelial dis-cohesion and invasion of target keratinocytes in vitro in a TGF-β-dependent manner. The results demonstrate that the TGF-β family of cytokines secreted by CAFs derived from genotype-specific oral cancer (GU-OSCC) promote, at least in part, the malignant phenotype by weakening intercellular epithelial adhesion. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Expression of basal cell marker revealed by RAM11 antibody during epithelial regeneration in rabbits.

    Directory of Open Access Journals (Sweden)

    Tadeusz Cichocki

    2010-06-01

    Full Text Available RAM11 is a mouse monoclonal anti-rabbit macrophage antibody recognizing connective tissue and vascular macrophages. Our previous report showed that RAM11 reacted with basal cells of stratified squamous epithelia of rabbit skin, oral mucosa and esophagus. The aim of the present study was to follow the appearance of RAM11 immunoreactivity in basal cells of regenerating oral epithelium in rabbits. No RAM11 immunostaining was observed in the regenerating epithelium examined on days 1 and 3 of wound healing. A weak immunofluorescence first appeared on day 7 in single basal cells and 32% of RAM11- positive basal cells were observed on day 14. These findings indicate that expression of the antigen recognized by RAM11 antibody is a transient event in the differentiation of oral keratinocytes which not always occurs during epithelial repair, although it is a constant feature of epithelial turnover in mature epithelium. Therefore this antigen can be regarded as basal cell marker only in mature stratified squamous epithelia.

  1. Upregulation of adhesion complex proteins and fibronectin by human keratinocytes treated with an aqueous extract from the leaves of Chromolaena odorata (Eupolin).

    Science.gov (United States)

    Phan, T T; Allen, J; Hughes, M A; Cherry, G; Wojnarowska, F

    2000-01-01

    The fresh leaves and extract of the plant Chromolaena odorata are a traditional herbal treatment in developing countries for burns, soft tissue wounds and skin infections. We have previously shown that the extract had an effect on the growth and proliferation of keratinocytes and fibroblasts in culture. This study has demonstrated that Eupolin extract increased expression of several components of the adhesion complex and fibronectin by human keratinocytes. Using indirect immunofluorescence we found increased expression (dose-dependent) of laminin 5, laminin 1, collagen IV, and fibronectin. The expression of the b1 and b4 integrins was upregulated by the extract at low concentrations (0.1 and 1 microg/ml), but the expression was decreased at higher doses of Eupolin (10 microg-150 microg/ml). A number of clinical studies carried out by Vietnamese and international medical investigators have demonstrated the efficacy of this extract on the wound healing process. In this study we have shown that Eupolin stimulated the expression of many proteins of the adhesion complex and fibronectin by human keratinocytes. The adhesion complex proteins are essential to stabilise epithelium and this effect could contribute to the clinical efficacy of Eupolin in healing.

  2. The E7 protein of the cottontail rabbit papillomavirus immortalizes normal rabbit keratinocytes and reduces pRb levels, while E6 cooperates in immortalization but neither degrades p53 nor binds E6AP

    International Nuclear Information System (INIS)

    Ganzenmueller, Tina; Matthaei, Markus; Muench, Peter; Scheible, Michael; Iftner, Angelika; Hiller, Thomas; Leiprecht, Natalie; Probst, Sonja; Stubenrauch, Frank; Iftner, Thomas

    2008-01-01

    Human papillomaviruses (HPVs) cause cervical cancer and are associated with the development of non-melanoma skin cancer. A suitable animal model for papillomavirus-associated skin carcinogenesis is the infection of domestic rabbits with the cottontail rabbit papillomavirus (CRPV). As the immortalizing activity of CRPV genes in the natural target cells remains unknown, we investigated the properties of CRPV E6 and E7 in rabbit keratinocytes (RK) and their influence on the cell cycle. Interestingly, CRPV E7 immortalized RK after a cellular crisis but showed no such activity in human keratinocytes. Co-expressed CRPV E6 prevented cellular crisis. The HPV16 or CRPV E7 protein reduced rabbit pRb levels thereby causing rabbit p19 ARF induction and accumulation of p53 without affecting cellular proliferation. Both CRPV E6 proteins failed to degrade rabbit p53 in vitro or to bind E6AP; however, p53 was still inducible by mitomycin C. In summary, CRPV E7 immortalizes rabbit keratinocytes in a species-specific manner and E6 contributes to immortalization without directly affecting p53

  3. Aqueous extract from Vitis vinifera tendrils is able to enrich keratinocyte antioxidant defences.

    Science.gov (United States)

    Fraternale, Daniele; De Bellis, Roberta; Calcabrini, Cinzia; Potenza, Lucia; Cucchiarini, Luigi; Mancini, Umberto; Dachà, Marina; Ricci, Donata

    2011-09-01

    An aqueous extract of V. vinifera L. tendrils was evaluated for its ability to enrich the antioxidant capacity of cultured cells. The long-time antioxidant capability of the extract was measured by in vitro chemical methods, and its influence on reduced glutathione levels and plasma membrane oxido reductase activity was determined in cultured human keratinocytes (NCTC 2544). Keratinocytes are cells normally exposed to oxidative stress, and for this reason adequately equipped with antioxidant defences. However, it has long been suggested that exogenous antioxidants may play an important role in minimizing the adverse effects of oxidative stress on skin.We demonstrated that V. vinifera tendril aqueous extract was able to increase, in a time- and dose-dependent manner, the reduced glutathione concentration and activity of trans plasma membrane oxido reductase as an indirect evaluation of the intracellular redox status of the cells demonstrating a relevant antioxidant activity of this phytocomplex.

  4. Development of Transgenic Cloned Pig Models of Skin Inflammation by DNA Transposon-Directed Ectopic Expression of Human β1 and α2 Integrin

    Science.gov (United States)

    Staunstrup, Nicklas Heine; Madsen, Johannes; Primo, Maria Nascimento; Li, Juan; Liu, Ying; Kragh, Peter M.; Li, Rong; Schmidt, Mette; Purup, Stig; Dagnæs-Hansen, Frederik; Svensson, Lars; Petersen, Thomas K.; Callesen, Henrik; Bolund, Lars; Mikkelsen, Jacob Giehm

    2012-01-01

    Integrins constitute a superfamily of transmembrane signaling receptors that play pivotal roles in cutaneous homeostasis by modulating cell growth and differentiation as well as inflammatory responses in the skin. Subrabasal expression of integrins α2 and/or β1 entails hyperproliferation and aberrant differentiation of keratinocytes and leads to dermal and epidermal influx of activated T-cells. The anatomical and physiological similarities between porcine and human skin make the pig a suitable model for human skin diseases. In efforts to generate a porcine model of cutaneous inflammation, we employed the Sleeping Beauty DNA transposon system for production of transgenic cloned Göttingen minipigs expressing human β1 or α2 integrin under the control of a promoter specific for subrabasal keratinocytes. Using pools of transgenic donor fibroblasts, cloning by somatic cell nuclear transfer was utilized to produce reconstructed embryos that were subsequently transferred to surrogate sows. The resulting pigs were all transgenic and harbored from one to six transgene integrants. Molecular analyses on skin biopsies and cultured keratinocytes showed ectopic expression of the human integrins and localization within the keratinocyte plasma membrane. Markers of perturbed skin homeostasis, including activation of the MAPK pathway, increased expression of the pro-inflammatory cytokine IL-1α, and enhanced expression of the transcription factor c-Fos, were identified in keratinocytes from β1 and α2 integrin-transgenic minipigs, suggesting the induction of a chronic inflammatory phenotype in the skin. Notably, cellular dysregulation obtained by overexpression of either β1 or α2 integrin occurred through different cellular signaling pathways. Our findings mark the creation of the first cloned pig models with molecular markers of skin inflammation. Despite the absence of an overt psoriatic phenotype, these animals may possess increased susceptibility to severe skin damage

  5. The impact of extracellular syntaxin4 on HaCaT keratinocyte behavior

    International Nuclear Information System (INIS)

    Kadono, Nanako; Miyazaki, Takafumi; Okugawa, Yoji; Nakajima, Kiichiro; Hirai, Yohei

    2012-01-01

    Highlights: ► A subpopulation of syntaxin4 localizes extracellularly in the keratinocytes. ► Epimorphin and syntaxin4 confer the resistance to the oxidative stress. ► Epimorphin suppresses and syntaxin4 accelerates the CCE formation. ► The antagonistic peptide to syntaxin4 blocks the syntaxin4-dependent CCE formation. -- Abstract: Syntaxin4 belongs to t-SNARE protein family and functions as a vesicular fusion mediator in the plasma membrane in a wide variety of cell types. This protein resembles another family member, epimorphin, a subpopulation of which has been shown to be secreted extracellularly in order to exert signaling functions. Here, we demonstrate the secretion of syntaxin4 via a non-classical pathway and its extracellular functions by using the functionally normal keratinocyte HaCaT. Extracellularly presented syntaxin4 appeared to elicit many cell responses similar to epimorphin with an important exception: it clearly facilitated keratinocyte cornification. The circularized peptide ST4n1 was synthesized from the putative functional core of syntaxin4 (a.a. 103–108), which is equivalent to the previously generated antagonist of epimorphin, and neutralized this contradictory effect. Intriguingly, an epimorphin mutant (EP4M) in which the functional core was replaced by that of syntaxin4 behaved like epimorphin, which was again antagonized by ST4n1. Electrophoresis-based analyses demonstrated the distinct structure of syntaxin4 compared to epimorphin or EP4M. These results revealed, for the first time, the extracellular role of syntaxin4 and shed light on the division of the extracellular effects exerted by epimorphin and syntaxin4 on keratinocyte cornification.

  6. Growth of various cell types in the presence of lactic and glycolic acids: the adverse effect of glycolic acid released from PLAGA copolymer on keratinocyte proliferation.

    Science.gov (United States)

    Garric, Xavier; Molès, Jean-Pierre; Garreau, Henri; Braud, Christian; Guilhou, Jean-Jacques; Vert, Michel

    2002-01-01

    Poly(alpha-hydroxy-acid)s derived from lactic acid (LA) and glycolic acid (GA) are bioresorbable polymers that are currently used in human surgery and in pharmacology to make temporary therapeutic devices. Nowadays, increasing attention is paid to these polymers in the field of tissue engineering. However, the literature shows that a large number of factors can affect many of their properties and the responses of biological systems. As part of our investigation of the biocompatibility of degradable aliphatic polyesters, the effects of LA and GA on the proliferation of various cells under in vitro cell culture conditions were studied. The release of LA and GA from films made of a copolymer synthesized by the zinc lactate method and composed of 37.5% L-lactyl, 37.5% D-lactyl, and 25% glycolyl repeating units was first investigated over a period of 30 days under abiotic conditions in a cell culture medium in order to identify a range of acid concentrations consistent with releases to be expected in real cell cultures. Four cell lines, namely 3T3-J2, C3H10(1/2), A431, and HaCat, and three primary cell cultures, namely rat endothelial cells, rat smooth muscle cells, and human dermal fibroblasts, were then allowed to grow in the presence of LA and GA at various concentrations taken within the selected 10-1000 mg/cm3 range. Little or no effect was observed on the proliferation of all cells except human keratinocytes, whose growth was dramatically inhibited by GA at concentrations as low as 10 mg/cm3. The inhibiting effect of GA was confirmed by considering the growth of keratinocytes on films made of the same copolymer, in comparison with poly(DL-lactic acid) and polystyrene taken as references. This work shows that GA-releasing degradable matrices are not adapted to the culture of keratinocytes with the aim of making skin grafts.

  7. Synthesis and biological activity of M6-P and M6-P analogs on fibroblast and keratinocyte proliferation.

    Science.gov (United States)

    Clavel, Caroline; Barragan-Montero, Véronique; Garric, Xavier; Molès, Jean-Pierre; Montero, Jean-Louis

    2005-09-01

    A new synthetic route to obtain the carboxylate analog of mannose 6-phosphate (M6-P) is presented. The effects of the M6-P, the carboxylate and two other analogs (the phosphonate and the alpha,beta ethylenic carboxylate) on the proliferation of human keratinocytes and dermal fibroblasts as well as on the proliferation of a murine fibroblast cell line, 3T3-J2 are tested. We observed that M6-P is a potent inhibitor of proliferation of both fibroblasts and keratinocytes. Among its analogs, the phosphonate showed a similar effect on human dermal fibroblasts but not on keratinocytes.

  8. Tumor necrosis factor related apoptosis inducing ligand triggers apoptosis in dividing but not in differentiating human epidermal keratinocytes

    NARCIS (Netherlands)

    Jansen, Bastiaan J. H.; van Ruissen, Fred; Cerneus, Stefanie; Cloin, Wendy; Bergers, Mieke; van Erp, Piet E. J.; Schalkwijk, Joost

    2003-01-01

    Using serial analysis of gene expression we have previously identified the expression of several pro-apoptotic and anti-apoptotic genes in cultured human primary epidermal keratinocytes, including tumor necrosis factor related apoptosis inducing ligand (TRAIL). TRAIL is a potent inducer of apoptosis

  9. Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

    Science.gov (United States)

    Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

  10. Effect of in vitro and in vivo UV irradiation on the production of ETAF activity by human and murine keratinocytes

    International Nuclear Information System (INIS)

    Ansel, J.C.; Luger, T.A.; Green, I.

    1983-01-01

    Cultured epidermal cells and keratinocytes produce a potent hormone-like factor called epidermal cell-derived thymocyte-activating factor (ETAF). ETAF appears to be similar if not identical to a monocyte-derived lymphokine, known as interleukin 1 (IL-1). These two cytokines are able to amplify a diverse number of proliferative and inflammatory processes. Several recent investigations have suggested that UV-induced immunosuppression may be due in part to the inhibition of IL-1/ETAF production by monocytes and keratinocytes, respectively. We therefore decided to directly study the effects of various doses of in vitro and in vivo UV radiation (UVR) on the production of ETAF by normal murine epidermal cells and a murine (Pam 212) and a human (SCC) keratinocyte cell line. Our results surprisingly demonstrated an increase in both the extracellular and the intracellular ETAF activity of the murine epidermal, Pam 212, and SCC after sublethal amounts of in vitro UVR. Likewise, increased ETAF activity of murine epidermal cells was detected after sublethal doses of in vivo UVR. The UV-induced ETAF activity was cycloheximide-sensitive, suggesting that de novo synthesis of ETAF rather than cell membrane leakage was responsible for the increased ETAF activity. The fact that UV irradiation can increase ETAF activity by keratinocytes could have important local and systemic consequences for the host and may provide an efficient, contaminant-free method for generating ETAF activity for further biochemical and immunologic studies

  11. A crucial role of beta 1 integrins for keratinocyte migration in vitro and during cutaneous wound repair

    DEFF Research Database (Denmark)

    Grose, Richard; Hutter, Caroline; Bloch, Wilhelm

    2002-01-01

    of beta 1 integrins in keratinocytes caused a severe defect in wound healing. beta 1-null keratinocytes showed impaired migration and were more densely packed in the hyperproliferative epithelium. Surprisingly, their proliferation rate was not reduced in early wounds and even increased in late wounds....... The failure in re-epithelialisation resulted in a prolonged inflammatory response, leading to dramatic alterations in the expression of important wound-regulated genes. Ultimately, beta 1-deficient epidermis did cover the wound bed, but the epithelial architecture was abnormal. These findings demonstrate...

  12. Lycopene Protects Keratinocytes Against UVB Radiation-Induced Carcinogenesis via Negative Regulation of FOXO3a Through the mTORC2/AKT Signaling Pathway.

    Science.gov (United States)

    Chen, Ping; Xu, Shina; Qu, Jinlong

    2018-01-01

    Lycopene, one of the most potent anti-oxidants, has been reported to exhibit potent anti-proliferative properties in a wide range of cancer cells through modulation of the cell cycle and apoptosis. Forkhead box O3 (FOXO3a) plays a pivotal role in modulating the expression of genes involved in cell death. Herein, we investigated the role of FOXO3a signaling in the anti-cancer effects of lycopene. Results showed that lycopene pretreatment attenuated UVB-induced cell hyper-proliferation and promoted apoptosis, accompanied by decreased cyclin-dependent kinase 2 (CDK2) and CDK4 complex in both human keratinocytes and SKH-1 hairless mice. FOXO3a is phosphorylated in response to UVB irradiation and sequestered in the cytoplasm, while lycopene pretreatment rescued this sensitization. Gene ablation of FOXO3a attenuated lycopene-induced decrease in cell hyper-proliferation, CDK2, and CDK4 complex, indicating a critical role of FOXO3a in the lycopene-induced anti-proliferative effect of keratinocytes during UVB irradiation. Transfection with FOXO3a siRNA inhibited the lycopene-induced increase in cell apoptosis, BAX and cleaved PARP expression. Moreover, loss of AKT induced further accelerated lycopene-induced FOXO3a dephosphorylation, while loss of mechanistic target of rapamycin complex 2 (mTORC2) by transfection with RICTOR siRNA induced levels of AKT phosphorylation comparable to those obtained with lycopene. In contrast, overexpression of AKT or mTORC2 decreased the effects of lycopene on the expression of FOXO3a as well as AKT phosphorylation, suggesting that lycopene depends on the negative modulation of mTORC2/AKT signaling. Taken together, our findings demonstrate that the mTORC2/AKT/FOXO3a axis plays a critical role in the anti-proliferative and pro-apoptotic effects of lycopene in UVB-induced photocarcinogenesis. J. Cell. Biochem. 119: 366-377, 2018. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  13. The Hsp90 inhibitor 17-AAG represses calcium-induced cytokeratin 1 and 10 expression in HaCaT keratinocytes.

    Science.gov (United States)

    Miyoshi, Sadanori; Yamazaki, Shota; Uchiumi, Asato; Katagata, Yohtaro

    2012-01-01

    Hsp90 is essential for maintaining the activity of numerous signaling factors, and plays a key role in cellular signal transduction networks. 17-Allylamino-17-demethoxygeldanamycin (17-AAG) is an ansamycin antibiotic that binds to Hsp90 and inhibits its function. HaCaT human keratinocytes were used to investigate the cellular and molecular functions of Hsp90 in keratinocyte differentiation. Inhibition of Hsp90 by 17-AAG leads to downregulation of the differentiation markers cytokeratin 1 and cytokeratin 10 at the protein and mRNA levels.

  14. Differential Regulation of Gene Expression of Alveolar Epithelial Cell Markers in Human Lung Adenocarcinoma-Derived A549 Clones

    Directory of Open Access Journals (Sweden)

    Hiroshi Kondo

    2015-01-01

    Full Text Available Stem cell therapy appears to be promising for restoring damaged or irreparable lung tissue. However, establishing a simple and reproducible protocol for preparing lung progenitor populations is difficult because the molecular basis for alveolar epithelial cell differentiation is not fully understood. We investigated an in vitro system to analyze the regulatory mechanisms of alveolus-specific gene expression using a human alveolar epithelial type II (ATII cell line, A549. After cloning A549 subpopulations, each clone was classified into five groups according to cell morphology and marker gene expression. Two clones (B7 and H12 were further analyzed. Under serum-free culture conditions, surfactant protein C (SPC, an ATII marker, was upregulated in both H12 and B7. Aquaporin 5 (AQP5, an ATI marker, was upregulated in H12 and significantly induced in B7. When the RAS/MAPK pathway was inhibited, SPC and thyroid transcription factor-1 (TTF-1 expression levels were enhanced. After treatment with dexamethasone (DEX, 8-bromoadenosine 3′5′-cyclic monophosphate (8-Br-cAMP, 3-isobutyl-1-methylxanthine (IBMX, and keratinocyte growth factor (KGF, surfactant protein B and TTF-1 expression levels were enhanced. We found that A549-derived clones have plasticity in gene expression of alveolar epithelial differentiation markers and could be useful in studying ATII maintenance and differentiation.

  15. Observations on the expression of human papillomavirus major capsid protein in HeLa cells.

    Science.gov (United States)

    Xiao, Chang-Yi; Fu, Bing-Bing; Li, Zhi-Ying; Mushtaq, Gohar; Kamal, Mohammad Amjad; Li, Jia-Hua; Tang, Gui-Cheng; Xiao, Shuo-Shuang

    2015-01-01

    The goal of this study was to identify the nature of the inclusion bodies that have been found in HeLa cells (cervical cancer immortal cell line) by electron microscope and to determine whether the major capsid protein (L1) of human papillomavirus (HPV) can be expressed in HPV-positive uterine cervix cancer cells. HPV L1 protein expression in HeLa cells was detected with anti-HPV L1 multivalent mice monoclonal antibody and rabbit polyclonal anti-HPV L1 antibody by ELISA, light microscope immunohistochemistry, electron microscope immunocytochemistry and Western blotting assays. Reverse transcriptional PCR (RT-PCR) was performed to detect the transcription of L1 mRNA in HeLa cells. The immortalized human keratinocyte HeCat was used as the negative control. HPV L1 proteins reacted positively in the lysate of HeLa cells by ELISA assays. HRP labeled light microscope immunohistochemistry assay showed that there was a strong HPV L1 positive reaction in HeLa cells. Under the electron microscope, irregular shaped inclusion bodies, assembled by many small and uniform granules, had been observed in the cytoplasm of some HeLa cells. These granules could be labeled by the colloidal gold carried by HPV L1 antibody. The Western blotting assay showed that there was a L1 reaction strap at 80-85 kDa in the HeLa cell lysates, hence demonstrating the existence of HPV18 L1 in HeLa cells. RT-PCR assay showed that the L1 mRNA was transcribed in HeLa cells. The inclusion bodies found in the cytoplasm of HeLa cells are composed of HPV18 L1 protein. Since HeLa cell line is a type of cervical cancer cells, this implies that HeLa cells have the ability to express HPV L1 proteins.

  16. Use of a collagen-elastin matrix as transport carrier system to transfer proliferating epidermal cells to human dermis in vitro.

    Science.gov (United States)

    Waaijman, Taco; Breetveld, Melanie; Ulrich, Magda; Middelkoop, Esther; Scheper, Rik J; Gibbs, Susan

    2010-01-01

    This in vitro study describes a novel cell culture, transport, and transfer protocol that may be highly suitable for delivering cultured proliferating keratinocytes and melanocytes to large open skin wounds (e.g., burns). We have taken into account previous limitations identified using other keratinocyte transfer techniques, such as regulatory issues, stability of keratinocytes during transport (single cell suspensions undergo terminal differentiation), ease of handling during application, and the degree of epidermal blistering resulting after transplantation (both related to transplanting keratinocyte sheets). Large numbers of proliferating epidermal cells (EC) (keratinocytes and melanocytes) were generated within 10-14 days and seeded onto a three-dimensional matrix composed of elastin and collagen types I, III, and V (Matriderm®), which enabled easy and stable transport of the EC for up to 24 h under ambient conditions. All culture conditions were in accordance with the regulations set by the Dutch Central Committee on Research Involving Human Subjects (CCMO). As an in vitro model system for clinical in vivo transfer, the EC were then transferred from Matriderm onto human acellular dermis during a period of 3 days. After transfer the EC maintained the ability to regenerate into a fully differentiated epidermis containing melanocytes on the human dermis. Proliferating keratinocytes were located in the basal layer and keratin-10 expression was located in differentiating suprabasal layers similar to that found in human epidermis. No blistering was observed (separation of the epidermis from the basement membrane). Keratin-6 expression was strongly upregulated in the regenerating epidermis similar to normal wound healing. In summary, we show that EC-Matriderm contains viable, metabolically active keratinocytes and melanocytes cultured in a manner that permits easy transportation and contains epidermal cells with the potential to form a pigmented reconstructed

  17. The effect of 'allergenic' and 'nonallergenic' antibiotics on dog keratinocyte viability in vitro.

    Science.gov (United States)

    Voie, Katrine L; Lucas, Benjamin E; Schaeffer, David; Kim, Dewey; Campbell, Karen L; Lavergne, Sidonie N

    2013-10-01

    Immune-mediated adverse drug reactions (drug hypersensitivity) are relatively common in veterinary medicine, but their pathogenesis is not well understood. For an unknown reason, delayed drug hypersensitivity often targets the skin. Antibiotics, especially β-lactams and sulfonamides, are commonly associated with these adverse events. The 'danger theory' hypothesizes that 'danger' signals, such as drug-induced cell death, might be part of the pathogenesis of drug hypersensitivity reactions. The goal of this study was to determine whether antibiotics that are commonly associated with cutaneous drug hypersensitivity (allergenic) decrease canine keratinocyte viability in vitro more than antibiotics that rarely cause such reactions (nonallergenic). Immortalized canine keratinocytes (CPEK cells) were exposed to a therapeutic range of drug concentrations of four 'allergenic' antibiotics (two β-lactams, i.e. amoxicillin and cefalexin, and two sulfonamides, i.e. sulfamethoxazole and sulfadimethoxine) or two 'nonallergenic' antibiotics (enrofloxacin and amikacin) over 48 h (2, 4, 8, 24 and 48 h). The reactive nitroso metabolite of sulfamethoxazole was also tested. Cefalexin (2 mmol/L) significantly decreased cell viability after 48 h (28 ± 7%; P = 0.035). The nitroso metabolite of sulfamethoxazole (100 μmol/L) decreased cell viability after 2 h (21 ± 7%; P = 0.049), but cell numbers were increased after 8 h (22 ± 6%; P = 0.018). In addition, enrofloxacin (500 μmol/L) also significantly decreased cell viability by 37% (±6%; P = 0.0035) at 24 h and by 70% (±8%; P good predictor of the 'allergenic' potential of an antibiotic. Further work is required to investigate other drug-induced 'danger' signals in dog keratinocytes exposed to 'allergenic' antibiotics in vitro. © 2013 ESVD and ACVD.

  18. Human papillomavirus type 59 immortalized keratinocytes express late viral proteins and infectious virus after calcium stimulation

    International Nuclear Information System (INIS)

    Lehr, Elizabeth E.; Qadadri, Brahim; Brown, Calla R.; Brown, Darron R.

    2003-01-01

    Human papillomavirus type 59 (HPV 59) is an oncogenic type related to HPV 18. HPV 59 was recently propagated in the athymic mouse xenograft system. A continuous keratinocyte cell line infected with HPV 59 was created from a foreskin xenograft grown in an athymic mouse. Cells were cultured beyond passage 50. The cells were highly pleomorphic, containing numerous abnormally shaped nuclei and mitotic figures. HPV 59 sequences were detected in the cells by DNA in situ hybridization in a diffuse nuclear distribution. Southern blots were consistent with an episomal state of HPV 59 DNA at approximately 50 copies per cell. Analysis of the cells using a PCR/reverse blot strip assay, which amplifies a portion of the L1 open reading frame, was strongly positive. Differentiation of cells in monolayers was induced by growth in F medium containing 2 mM calcium chloride for 10 days. Cells were harvested as a single tissue-like sheet, and histologic analysis revealed a four-to-six cell-thick layer. Transcripts encoding involucrin, a cornified envelope protein, and the E1-circumflexE4 and E1-circumflexE4-circumflexL1 viral transcripts were detected after several days of growth in F medium containing 2 mM calcium chloride. The E1-circumflexE4 and L1 proteins were detected by immunohistochemical analysis, and virus particles were seen in electron micrographs in a subset of differentiated cells. An extract of differentiated cells was prepared by vigorous sonication and was used to infect foreskin fragments. These fragments were implanted into athymic mice. HPV 59 was detected in the foreskin xenografts removed 4 months later by DNA in situ hybridization and PCR/reverse blot assay. Thus, the complete viral growth cycle, including production on infectious virus, was demonstrated in the HPV 59 immortalized cells grown in a simple culture system

  19. The effect of cold stress on UVB injury in mouse skin and cultured keratinocytes

    International Nuclear Information System (INIS)

    Ota, Toshiaki; Hanada, Katsumi; Hashimoto, Isao

    1996-01-01

    The effect of cold stress on skin damage caused by UVB irradiation was investigated both in vivo and in vitro. Ear skin of mice that had been exposed to cold stress at 0 o C for 20 min and at 5 o C for 24 h was exposed to UVB radiation. Sunburn cell production was less in mice exposed to the lower temperature. In addition, the effect of cold stress on the survival rate of UVB-irradiated rat keratinocytes was examined in a cytoxicity test, with the results showing that keratinocytes exposed to cold stress of 0 o C had a higher survival rate than control cells. To pursue a promising clue for explaining the result, we examined metallothionein (MT) production in rat keratinocytes that had been exposed to cold stress at 0 o C. Microfluorometric quantification showed a positive correlation between the time course and the intensity of immunofluorescence for MT, indicating that the molecule is inducible by exposure to cold stress in our experimental system. These results suggest that epidermal cells that have been exposed to cold stress maintain a higher resistance to UV radiation than nonexposed controls in vivo and in vitro, and that MT with radical-scavenging activity might contribute, at least in part, to photoprotection against UVB-induced oxidative damage in mammalian skin. (Author)

  20. The effect of cold stress on UVB injury in mouse skin and cultured keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Ota, Toshiaki; Hanada, Katsumi; Hashimoto, Isao [Hirosaki Univ., Aomori (Japan). School of Medicine

    1996-12-01

    The effect of cold stress on skin damage caused by UVB irradiation was investigated both in vivo and in vitro. Ear skin of mice that had been exposed to cold stress at 0{sup o}C for 20 min and at 5{sup o}C for 24 h was exposed to UVB radiation. Sunburn cell production was less in mice exposed to the lower temperature. In addition, the effect of cold stress on the survival rate of UVB-irradiated rat keratinocytes was examined in a cytoxicity test, with the results showing that keratinocytes exposed to cold stress of 0{sup o}C had a higher survival rate than control cells. To pursue a promising clue for explaining the result, we examined metallothionein (MT) production in rat keratinocytes that had been exposed to cold stress at 0{sup o}C. Microfluorometric quantification showed a positive correlation between the time course and the intensity of immunofluorescence for MT, indicating that the molecule is inducible by exposure to cold stress in our experimental system. These results suggest that epidermal cells that have been exposed to cold stress maintain a higher resistance to UV radiation than nonexposed controls in vivo and in vitro, and that MT with radical-scavenging activity might contribute, at least in part, to photoprotection against UVB-induced oxidative damage in mammalian skin. (Author).

  1. The effect of Candida albicans on the expression levels of toll-like receptor 2 and interleukin-8 in HaCaT cells under High- and Low-glucose conditions

    Directory of Open Access Journals (Sweden)

    Di Wang

    2018-01-01

    Full Text Available Background: The diabetics are prone to skin infections, especially with Candida albicans. It is important to elucidate the different antifungal abilities of patients with hyperglycemia and healthy controls for the treatment of this condition. The toll-like receptor 2 (TLR2 and interleukin (IL-8 secreted by keratinocytes counteract C. albicans. Aim: This study aims to explore the differential expression of toll-like receptor 2 (TLR2 and interleukin (IL-8 secretion by keratinocytes between controls and diabetic patients when challenged with C. albicans. Materials and Methods: HaCaT cells were cultured in high-glucose (HG Dulbecco's modified Eagle's medium (DMEM and low-glucose (LG DMEM. Then, they were exposed to C. albicans hyphae for 24 h. The expression levels of TLR2 and IL-8 were determined at different periods in both the HG and LG groups. Real-time polymerase chain reaction analysis, western blotting, and enzyme-linked immunosorbent assays were performed in this study. The morphological changes of HaCaT cells under two different glucose concentrations were also observed. Results: We found that the expression levels of both TLR2 and IL-8 increased and then decreased in the two groups. Notably, the IL-8 levels in the LG group were higher than those in the HG group at each time point (P<0.05, and the TLR2 levels in the LG group were higher than those in the HG group at the beginning of the experiment and after 24 h of treatment with C. albicans (P<0.05. In each group, the levels of IL-8 and TLR2 at the secretion peak were significantly different from those in the initial and the last period of observation (P<0.05. The cellular morphology of HaCaT cells treated with different concentrations of glucose was also similar. However, with prolonged coculture time, cell death increased. Conclusion: These observations showed that TLR2 and IL-8 act on the keratinocytes interacting with C. albicans, and HG status might affect the function of HaCaT cells

  2. Interaction of urokinase A chain with the receptor of human keratinocytes stimulates release of urokinase-like plasminogen activator

    Energy Technology Data Exchange (ETDEWEB)

    Fibbi, G.; Magnelli, L.; Pucci, M.; Del Rosso, M. (Florence Univ. (Italy))

    1990-03-01

    On the basis of a fibrinolytic assay with {sup 125}I-fibrin, zymography, and immunoprobing with anti-human urokinase antibody, the authors have observed that the in vitro established NCTC human keratinocyte cell line releases into the culture medium a 54,000-Da plasminogen activator which is indistinguishable from human urokinase. Only the early release following the washing of keratinocyte monolayers is accounted for by secretion of preformed enzyme, while late secretory events require the de novo synthesis of urokinase. The released enzyme can interact by autocriny with its own receptor present on keratinocytes. The addition to the keratinocyte culture medium of the urokinase A chain can stimulate a concentration-dependent urokinase oversecretion, which is not paralleled by oversecretion of plasminogen activator inhibitor-1. Since stimulation of urokinase production can be obtained by an A chain concentration which was previously shown to be efficient in inducing keratinocyte mobilization in an in vitro migration model system, they hypothesize that this mechanism may be important in vivo during the process of wound repair.

  3. Development of a co-culture of keratinocytes and immune cells for in vitro investigation of cutaneous sulfur mustard toxicity.

    Science.gov (United States)

    Balszuweit, Frank; Menacher, Georg; Bloemeke, Brunhilde; Schmidt, Annette; Worek, Franz; Thiermann, Horst; Steinritz, Dirk

    2014-11-05

    Sulfur mustard (SM) is a chemical warfare agent causing skin blistering, ulceration and delayed wound healing. Inflammation and extrinsic apoptosis are known to have an important role in SM-induced cytotoxicity. As immune cells are involved in those processes, they may significantly modulate SM toxicity, but the extent of those effects is unknown. We adapted a co-culture model of immortalized keratinocytes (HaCaT) and immune cells (THP-1) and exposed this model to SM. Changes in necrosis, apoptosis and inflammation, depending on SM challenge, absence or presence and number of THP-1 cells were investigated. THP-1 were co-cultured for 24h prior to SM exposure in order to model SM effects on immune cells continuously present in the skin. Our results indicate that the presence of THP-1 strongly increased necrosis, apoptosis and inflammation. This effect was already significant when the ratio of THP-1 and HaCaT cells was similar to the ratio of Langerhans immune cells and keratinocytes in vivo. Any further increases in the number of THP-1 had only slight additional effects on SM-induced cytotoxicity. In order to assess the effects of immune cells migrating into skin areas damaged by SM, we added non-exposed THP-1 to SM-exposed HaCaT. Those THP-1 had only slight effects on SM-induced cytotoxicity. Notably, in HaCaT exposed to 300μM SM, necrosis and inflammation were slightly reduced by adding intact THP-1. This effect was dependent on the number of immune cells, steadily increasing with the number of unexposed THP-1 added. In summary, we have demonstrated that (a) the presented co-culture is a robust model to assess SM toxicity and can be used to test the efficacy of potential antidotes in vitro; (b) immune cells, damaged by SM strongly amplified cytotoxicity, (c) in contrast, unexposed THP-1 (simulating migration of immune cells into affected areas after exposure in vivo) had no pronounced adverse, but exhibited some protective effects. Thus, protecting immune cells

  4. Stem cell recovering effect of copper-free GHK in skin.

    Science.gov (United States)

    Choi, Hye-Ryung; Kang, Youn-A; Ryoo, Sun-Jong; Shin, Jung-Won; Na, Jung-Im; Huh, Chang-Hun; Park, Kyoung-Chan

    2012-11-01

    The peptide Gly-His-Lys (GHK) is a naturally occurring copper(II)-chelating motifs in human serum and cerebrospinal fluid. In industry, GHK (with or without copper) is used to make hair and skin care products. Copper-GHK plays a physiological role in the process of wound healing and tissue repair by stimulating collagen synthesis in fibroblasts. We also reported that copper-GHK promotes the survival of basal stem cells in the skin. However, the effects of copper-free GHK (GHK) have not been investigated well. In this study, the effects of GHK were studied using cultured normal human keratinocytes and skin equivalent (SE) models. In monolayer cultured keratinocytes, GHK increased the proliferation of keratinocytes. When GHK was added during the culture of SE models, the basal cells became more cuboidal than control model. In addition, there was linear and intense staining of α6 and β1 integrin along the basement membrane. The number of p63 and proliferating cell nuclear antigen positive cells was also significantly increased in GHK-treated SEs than in control SEs. Western blot and slide culture experiment showed that GHK increased the expression of integrin by keratinocytes. All these results showed that GHK increased the stemness and proliferative potential of epidermal basal cells, which is associated with increased expression of integrin. In conclusion, copper-free GHK showed similar effects with copper-GHK. Thus, it can be said that copper-free GHK can be used in industry to obtain the effects of copper-GHK in vivo. Further study is necessary to explore the relationship between copper-free GHK and copper-GHK. Copyright © 2012 European Peptide Society and John Wiley & Sons, Ltd.

  5. Modulation of basal cell fate during productive and transforming HPV-16 infection is mediated by progressive E6-driven depletion of Notch.

    Science.gov (United States)

    Kranjec, Christian; Holleywood, Christina; Libert, Diane; Griffin, Heather; Mahmood, Radma; Isaacson, Erin; Doorbar, John

    2017-08-01

    In stratified epithelia such as the epidermis, homeostasis is maintained by the proliferation of cells in the lower epithelial layers and the concomitant loss of differentiated cells from the epithelial surface. These differentiating keratinocytes progressively stratify and form a self-regenerating multi-layered barrier that protects the underlying dermis. In such tissue, the continual loss and replacement of differentiated cells also limits the accumulation of oncogenic mutations within the tissue. Inactivating mutations in key driver genes, such as TP53 and NOTCH1, reduce the proportion of differentiating cells allowing for the long-term persistence of expanding mutant clones in the tissue. Here we show that through the expression of E6, HPV-16 prevents the early fate commitment of human keratinocytes towards differentiation and confers a strong growth advantage to human keratinocytes. When E6 is expressed either alone or with E7, it promotes keratinocyte proliferation at high cell densities, through the combined inactivation of p53 and Notch1. In organotypic raft culture, the activity of E6 is restricted to the basal layer of the epithelium and is enhanced during the progression from productive to abortive or transforming HPV-16 infection. Consistent with this, the expression of p53 and cleaved Notch1 becomes progressively more disrupted, and is associated with increased basal cell density and reduced commitment to differentiation. The expression of cleaved Notch1 is similarly disrupted also in HPV-16-positive cervical lesions, depending on neoplastic grade. When taken together, these data depict an important role of high-risk E6 in promoting the persistence of infected keratinocytes in the basal and parabasal layers through the inactivation of gene products that are commonly mutated in non-HPV-associated neoplastic squamous epithelia. © 2017 The Authors. The Journal of Pathology published by John Wiley & Sons Ltd on behalf of Pathological Society of Great

  6. The effect of keratinocytes on the biomechanical characteristics and pore microstructure of tissue engineered skin using deep dermal fibroblasts.

    Science.gov (United States)

    Varkey, Mathew; Ding, Jie; Tredget, Edward E

    2014-12-01

    Fibrosis affects most organs, it results in replacement of normal parenchymal tissue with collagen-rich extracellular matrix, which compromises tissue architecture and ultimately causes loss of function of the affected organ. Biochemical pathways that contribute to fibrosis have been extensively studied, but the role of biomechanical signaling in fibrosis is not clearly understood. In this study, we assessed the effect keratinocytes have on the biomechanical characteristics and pore microstructure of tissue engineered skin made with superficial or deep dermal fibroblasts in order to determine any biomaterial-mediated anti-fibrotic influences on tissue engineered skin. Tissue engineered skin with deep dermal fibroblasts and keratinocytes were found to be less stiff and contracted and had reduced number of myofibroblasts and lower expression of matrix crosslinking factors compared to matrices with deep fibroblasts alone. However, there were no such differences between tissue engineered skin with superficial fibroblasts and keratinocytes and matrices with superficial fibroblasts alone. Also, tissue engineered skin with deep fibroblasts and keratinocytes had smaller pores compared to those with superficial fibroblasts and keratinocytes; pore size of tissue engineered skin with deep fibroblasts and keratinocytes were not different from those matrices with deep fibroblasts alone. A better understanding of biomechanical characteristics and pore microstructure of tissue engineered skin may prove beneficial in promoting normal wound healing over pathologic healing. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Scanning Ion Conductance Microscopy of Live Keratinocytes

    International Nuclear Information System (INIS)

    Hegde, V; Mason, A; Saliev, T; Smith, F J D; McLean, W H I; Campbell, P A

    2012-01-01

    Scanning ion conductance microscopy (SICM) is perhaps the least well known technique from the scanning probe microscopy (SPM) family of instruments. As with its more familiar counterpart, atomic force microscopy (AFM), the technique provides high-resolution topographic imaging, with the caveat that target structures must be immersed in a conducting solution so that a controllable ion current may be utilised as the basis for feedback. In operation, this non-contact characteristic of SICM makes it ideal for the study of delicate structures, such as live cells. Moreover, the intrinsic architecture of the instrument, incorporating as it does, a scanned micropipette, lends itself to combination approaches with complementary techniques such as patch-clamp electrophysiology: SICM therefore boasts the capability for both structural and functional imaging. For the present observations, an ICnano S system (Ionscope Ltd., Melbourn, UK) operating in 'hopping mode' was used, with the objective of assessing the instrument's utility for imaging live keratinocytes under physiological buffers. In scans employing cultured HaCaT cells (spontaneously immortalised, human keratinocytes), we compared the qualitative differences of live cells imaged with SICM and AFM, and also with their respective counterparts after chemical fixation in 4% paraformaldehyde. Characteristic surface microvilli were particularly prominent in live cell imaging by SICM. Moreover, time lapse SICM imaging on live cells revealed that changes in the pattern of microvilli could be tracked over time. By comparison, AFM imaging on live cells, even at very low contact forces (< nN), could not routinely image microvilli: rather, an apparently convolved image of the underlying cytoskeleton was instead prevalent. We note that the present incarnation of the commercial instrument falls some way behind the market leading SPMs in terms of technical prowess and scanning speed, however, the intrinsic non-obtrusive nature of

  8. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

    Science.gov (United States)

    Laporta, Robert F.; Taichman, Lorne B.

    1982-06-01

    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  9. Enhancement of keratinocyte performance in the production of tissue-engineered skin using a low-calcium medium.

    Science.gov (United States)

    Hernon, Catherine A; Harrison, Caroline A; Thornton, Daniel J A; MacNeil, Sheila

    2007-01-01

    The success of laboratory-expanded autologous keratinocytes for the treatment of severe burn injuries is often compromised by their lack of dermal remnants and failure to establish a secure dermo-epidermal junction on the wound bed. We have developed a tissue-engineered skin substitute for in vivo use, based on a sterilized donor human dermis seeded with autologous keratinocytes and fibroblasts. However, culture rates are currently too slow for clinical use in acute burns. Our aim in this study was to increase the rate of production of tissue-engineered skin. Two approaches were explored: one using a commercial low-calcium media and the other supplementing well-established media for keratinocyte culture with the calcium-chelating agent ethylene glutamine tetra-acetic acid (EGTA). Using commercial low-calcium media for both the initial cell culture and subsequent culture of tissue-engineered skin did not produce tissue suitable for clinical use. However, it was possible to enhance the initial proliferation of keratinocytes and to increase their horizontal migration in tissue-engineered skin by supplementing established culture medium with 0.04 mM EGTA without sacrificing epidermal attachment and differentiation. Enhancement of keratinocyte migration with EGTA was also maximal in the absence of fibroblasts or basement membrane.

  10. The key role of miR-21-regulated SOD2 in the medium-mediated bystander responses in human fibroblasts induced by α-irradiated keratinocytes

    International Nuclear Information System (INIS)

    Tian, Wenqian; Yin, Xiaoming; Wang, Longxiao; Wang, Jingdong; Zhu, Wei; Cao, Jianping; Yang, Hongying

    2015-01-01

    Highlights: • After co-culture with α-irradiated HaCaT cells, WS1 cells displayed oxidative stress and DNA damage. • Increased miR-21 expression in bystander cells was critical to the occurrence of RIBEs. • SOD2 of bystander cells played an important role in bystander responses. • miR-21 mediated bystander effects through its regulation on SOD2. - Abstract: Radiation-induced bystander effect (RIBE) is well accepted in the radiation research field by now, but the underlying molecular mechanisms for better understanding this phenomenon caused by intercellular communication and intracellular signal transduction are still incomplete. Although our previous study has demonstrated an important role of miR-21 of unirradiated bystander cells in RIBEs, the direct evidence for the hypothesis that RIBE is epigenetically regulated is still limited and how miR-21 mediates RIBEs is unknown. Reactive oxygen species (ROS) have been demonstrated to be involved in RIBEs, however, the roles of anti-oxidative stress system of cells in RIBEs are unclear. Using transwell insert co-culture system, we investigated medium-mediated bystander responses in WS1 human fibroblasts after co-culture with HaCaT keratinocytes traversed by α-particles. Results showed that the ROS levels in unirradiated bystander WS1 cells were significantly elevated after 30 min of co-culture, and 53BP1 foci, a surrogate marker of DNA damage, were obviously induced after 3 h of co-culture. This indicates the occurrence of oxidative stress and DNA damage in bystander WS1 cells after co-culture with irradiated keratinocytes. Furthermore, the expression of miR-21 was increased in bystander WS1 cells, downregulation of miR-21 eliminated the bystander responses, overexpression of miR-21 alone could induce bystander-like oxidative stress and DNA damage in WS1 cells. These data indicate an important mediating role of miR-21 in RIBEs. In addition, MnSOD or SOD2 in WS1 cells was involved in the bystander effects

  11. The key role of miR-21-regulated SOD2 in the medium-mediated bystander responses in human fibroblasts induced by α-irradiated keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Tian, Wenqian; Yin, Xiaoming; Wang, Longxiao; Wang, Jingdong; Zhu, Wei; Cao, Jianping [School of Radiation Medicine and Protection, Medical College of Soochow University/Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, 199 Renai Road, Suzhou Industrial Park, Suzhou, Jiangsu Province 215123 (China); Yang, Hongying, E-mail: yanghongying@suda.edu.cn [School of Radiation Medicine and Protection, Medical College of Soochow University/Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, 199 Renai Road, Suzhou Industrial Park, Suzhou, Jiangsu Province 215123 (China); Institute of Radiotherapy & Oncology, Soochow University (China)

    2015-10-15

    Highlights: • After co-culture with α-irradiated HaCaT cells, WS1 cells displayed oxidative stress and DNA damage. • Increased miR-21 expression in bystander cells was critical to the occurrence of RIBEs. • SOD2 of bystander cells played an important role in bystander responses. • miR-21 mediated bystander effects through its regulation on SOD2. - Abstract: Radiation-induced bystander effect (RIBE) is well accepted in the radiation research field by now, but the underlying molecular mechanisms for better understanding this phenomenon caused by intercellular communication and intracellular signal transduction are still incomplete. Although our previous study has demonstrated an important role of miR-21 of unirradiated bystander cells in RIBEs, the direct evidence for the hypothesis that RIBE is epigenetically regulated is still limited and how miR-21 mediates RIBEs is unknown. Reactive oxygen species (ROS) have been demonstrated to be involved in RIBEs, however, the roles of anti-oxidative stress system of cells in RIBEs are unclear. Using transwell insert co-culture system, we investigated medium-mediated bystander responses in WS1 human fibroblasts after co-culture with HaCaT keratinocytes traversed by α-particles. Results showed that the ROS levels in unirradiated bystander WS1 cells were significantly elevated after 30 min of co-culture, and 53BP1 foci, a surrogate marker of DNA damage, were obviously induced after 3 h of co-culture. This indicates the occurrence of oxidative stress and DNA damage in bystander WS1 cells after co-culture with irradiated keratinocytes. Furthermore, the expression of miR-21 was increased in bystander WS1 cells, downregulation of miR-21 eliminated the bystander responses, overexpression of miR-21 alone could induce bystander-like oxidative stress and DNA damage in WS1 cells. These data indicate an important mediating role of miR-21 in RIBEs. In addition, MnSOD or SOD2 in WS1 cells was involved in the bystander effects

  12. In Vitro Growth of Human Keratinocytes and Oral Cancer Cells into Microtissues: An Aerosol-Based Microencapsulation Technique

    Directory of Open Access Journals (Sweden)

    Wai Yean Leong

    2017-05-01

    Full Text Available Cells encapsulation is a micro-technology widely applied in cell and tissue research, tissue transplantation, and regenerative medicine. In this paper, we proposed a growth of microtissue model for the human keratinocytes (HaCaT cell line and an oral squamous cell carcinoma (OSCC cell line (ORL-48 based on a simple aerosol microencapsulation technique. At an extrusion rate of 20 μL/min and air flow rate of 0.3 L/min programmed in the aerosol system, HaCaT and ORL-48 cells in alginate microcapsules were encapsulated in microcapsules with a diameter ranging from 200 to 300 μm. Both cell lines were successfully grown into microtissues in the microcapsules of alginate within 16 days of culture. The microtissues were characterized by using a live/dead cell viability assay, field emission-scanning electron microscopy (FE-SEM, fluorescence staining, and cell re-plating experiments. The microtissues of both cell types were viable after being extracted from the alginate membrane using alginate lyase. However, the microtissues of HaCaT and ORL-48 demonstrated differences in both nucleus size and morphology. The microtissues with re-associated cells in spheroids are potentially useful as a cell model for pharmacological studies.

  13. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-01-01

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways. PMID:28277539

  14. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis.

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-03-09

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways.

  15. Hepatic leukemia factor promotes resistance to cell death: Implications for therapeutics and chronotherapy

    International Nuclear Information System (INIS)

    Waters, Katrina M.; Sontag, Ryan L.; Weber, Thomas J.

    2013-01-01

    Physiological variation related to circadian rhythms and aberrant gene expression patterns are believed to modulate therapeutic efficacy, but the precise molecular determinants remain unclear. Here we examine the regulation of cell death by hepatic leukemia factor (HLF), which is an output regulator of circadian rhythms and is aberrantly expressed in human cancers, using an ectopic expression strategy in JB6 mouse epidermal cells and human keratinocytes. Ectopic HLF expression inhibited cell death in both JB6 cells and human keratinocytes, as induced by serum-starvation, tumor necrosis factor alpha and ionizing radiation. Microarray analysis indicates that HLF regulates a complex multi-gene transcriptional program encompassing upregulation of anti-apoptotic genes, downregulation of pro-apoptotic genes, and many additional changes that are consistent with an anti-death program. Collectively, our results demonstrate that ectopic expression of HLF, an established transcription factor that cycles with circadian rhythms, can recapitulate many features associated with circadian-dependent physiological variation. - Highlights: ► Circadian-dependent physiological variation impacts therapeutic efficacy. ► Hepatic leukemia factor inhibits cell death and is a candidate circadian factor. ► Hepatic leukemia factor anti-death program is conserved in murine and human cells. ► Transcriptomics indicates the anti-death program results from a systems response

  16. Hepatic leukemia factor promotes resistance to cell death: Implications for therapeutics and chronotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Waters, Katrina M. [Computational Biology and Bioinformatics, Pacific Northwest National Laboratory, Richland, WA 99354 (United States); Sontag, Ryan L. [Systems Toxicology Groups, Pacific Northwest National Laboratory, Richland, WA 99354 (United States); Weber, Thomas J., E-mail: Thomas.Weber@pnl.gov [Systems Toxicology Groups, Pacific Northwest National Laboratory, Richland, WA 99354 (United States)

    2013-04-15

    Physiological variation related to circadian rhythms and aberrant gene expression patterns are believed to modulate therapeutic efficacy, but the precise molecular determinants remain unclear. Here we examine the regulation of cell death by hepatic leukemia factor (HLF), which is an output regulator of circadian rhythms and is aberrantly expressed in human cancers, using an ectopic expression strategy in JB6 mouse epidermal cells and human keratinocytes. Ectopic HLF expression inhibited cell death in both JB6 cells and human keratinocytes, as induced by serum-starvation, tumor necrosis factor alpha and ionizing radiation. Microarray analysis indicates that HLF regulates a complex multi-gene transcriptional program encompassing upregulation of anti-apoptotic genes, downregulation of pro-apoptotic genes, and many additional changes that are consistent with an anti-death program. Collectively, our results demonstrate that ectopic expression of HLF, an established transcription factor that cycles with circadian rhythms, can recapitulate many features associated with circadian-dependent physiological variation. - Highlights: ► Circadian-dependent physiological variation impacts therapeutic efficacy. ► Hepatic leukemia factor inhibits cell death and is a candidate circadian factor. ► Hepatic leukemia factor anti-death program is conserved in murine and human cells. ► Transcriptomics indicates the anti-death program results from a systems response.

  17. The effect of anthocyanins from red wine and blackberry on the integrity of a keratinocyte model using ECIS.

    Science.gov (United States)

    Évora, Ana; de Freitas, Victor; Mateus, Nuno; Fernandes, Iva

    2017-11-15

    There is a growing market demand for the incorporation of plant-derived ingredients into new products for the cosmetic industry. Anthocyanins are polyphenols arising from plant secondary metabolism that have been shown to possess many bioactive properties such as free radical scavenging, antimicrobial, and chemopreventive activities. In this work, the biological activities of red wine and blackberry anthocyanins were assessed by developing a new keratinocyte barrier model using the HaCat cell line and a microelectrode-based biosensor device, referred to as Electric Cell-Substrate Impedance Sensing (ECIS). Cells were seeded at the optimal cellular density of 1.6 × 10 6 cells per mL and the half-time was calculated to be 3.55 ± 0.67 hours. The compounds' cytotoxicity was assessed and anthocyanin pigments showed no cytotoxicity towards keratinocyte cells. Wound healing assays were also performed using ECIS and it was observed that the tested pigments enhanced the healing rate of keratinocyte cells by reducing the healing time more than 50%. Cyanidin-3-glucoside presented the best results recovering 50% of the injured area in 1.48(±0.15) hours, followed by the blackberry anthocyanins (2.01 ± 0.18 hours), malvidin-3-glucoside (2.03 ± 0.09 hours) and red wine anthocyanins (2.36 ± 0.76 hours). All presented significant differences from the control 4.91(±1.11) hours.

  18. Keratinocyte Growth Factor Causes Cystic Dilation of the Mammary Glands of Mice: Interactions of Keratinocyte Growth Factor, Estrogen, and Progesterone In Vivo

    OpenAIRE

    Yi, Eunhee S.; Bedoya, Adriana A.; Lee, Hyesun; Kim, Seokhyun; Housley, Regina M.; Aukerman, Sharon L.; Tarpley, John E.; Starnes, Charles; Yin, Songmei; Pierce, Glenn F.; Ulich, Thomas R.

    1994-01-01

    Keratinocyte growth factor (KGF) is a paracrine mediator of epithelial cell proliferation that has been reported to induce marked proliferation of mammary epithelium in rats. In this study, systemic administration of KGF into naive and oophorectomized mice causes mammary gland proliferation, as evidenced histologically by the appearance of cysts lined by a single layer of epithelium and by hyperplastic epithelium. Whole mount preparations of the mammary glands reveal that the histologically n...

  19. Progression from productive infection to integration and oncogenic transformation in human papillomavirus type 59-immortalized foreskin keratinocytes.

    Science.gov (United States)

    Spartz, Helena; Lehr, Elizabeth; Zhang, Benyue; Roman, Ann; Brown, Darron R

    2005-05-25

    Studies of changes in the virus and host cell upon progression from human papillomavirus (HPV) episomal infection to integration are critical to understanding HPV-related malignant transformation. However, there exist only a few in vitro models of both productive HPV infection and neoplastic progression on the same host background. We recently described a unique foreskin keratinocyte cell line (ERIN 59) that contains HPV 59 (a close relative of HPV 18). Early passages of ERIN 59 cells (passages 9-13) contained approximately 50 copies of episomes/cell, were feeder cell-dependent, and could be induced to differentiate and produce infectious virus in a simple culture system. We now report that late passage cells (passages greater than 50) were morphologically different from early passage cells, were feeder cell independent, and did not differentiate or produce virus. These late passage cells contained HPV in an integrated form. An integration-derived oncogene transcript was expressed in late passage cells. The E2 open reading frame was interrupted in this transcript at nucleotide 3351. Despite a lower viral genome copy number in late passage ERIN 59 cells, expression of E6/E7 oncogene transcripts was similar to early passage cells. We conclude that ERIN 59 cells are a valuable cell line representing a model of progression from HPV 59 episomal infection and virus production to HPV 59 integration and associated oncogenic transformation on the same host background.

  20. Interferon-β induces cellular senescence in cutaneous human papilloma virus-transformed human keratinocytes by affecting p53 transactivating activity.

    Directory of Open Access Journals (Sweden)

    Maria V Chiantore

    Full Text Available Interferon (IFN-β inhibits cell proliferation and affects cell cycle in keratinocytes transformed by both mucosal high risk Human Papilloma Virus (HPV and cutaneous HPV E6 and E7 proteins. In particular, upon longer IFN-β treatments, cutaneous HPV38 expressing cells undergo senescence. IFN-β appears to induce senescence by upregulating the expression of the tumor suppressor PML, a well known IFN-induced gene. Indeed, experiments in gene silencing via specific siRNAs have shown that PML is essential in the execution of the senescence programme and that both p53 and p21 pathways are involved. IFN-β treatment leads to a modulation of p53 phosphorylation and acetylation status and a reduction in the expression of the p53 dominant negative ΔNp73. These effects allow the recovery of p53 transactivating activity of target genes involved in the control of cell proliferation. Taken together, these studies suggest that signaling through the IFN pathway might play an important role in cellular senescence. This additional understanding of IFN antitumor action and mechanisms influencing tumor responsiveness or resistance appears useful in aiding further promising development of biomolecular strategies in the IFN therapy of cancer.

  1. A Patient with Multiple Keratinocytic Cancers (MKC): Uncommon Presentation in a Bulgarian Patient.

    Science.gov (United States)

    Tchernev, Georgi; Philipov, Stanislav; Chokoeva, Anastasiya Atanasova; Wollina, Uwe; Lotti, Torello; Lozev, Ilia; Yungareva, Irina; Maximov, Georgi Konstantinov

    2018-01-25

    Keratinocyte skin cancers, including basal cell carcinoma (BCC) and squamous cell carcinoma (SCC), are the most common cancer occurring in people with fair skin, worldwide. Despite all known triggers, several suggested contributors are still investigated. We will focus our attention on the personal history of previous cancers and radiation exposure as occupational risk factors, as in the presented case. We report a patient, with multiple BCCs, and subsequent occurrence of a SCC on photo-exposed area of the face, as we want to emphasize the importance of strict following up of these patients, regarding the risk for developing new tumors in short periods of time, no matter if the triggering exposure factor is known from the history, or not. Although keratinocytes tumours are associated with the low mortality rate, we focus the attention on the fact, that the history of non-melanoma skin cancer is associated with increased mortality.

  2. Experimental model of cultured keratinocytes Modelo experimental de cultura de queratinócitos

    Directory of Open Access Journals (Sweden)

    Alfredo Gragnani

    2003-01-01

    Full Text Available The bioengineering research is essential in the development of ideal combination of biomaterials and cultured cells to produce the permanent wound coverage. The experimental model of cultured keratinocytes presents all steps of the culture, since the isolation of the keratinocytes, preparation of the human acellular dermis, preparation of the composite skin graft and their elevation to the air-liquid interface. The research in cultured keratinocytes model advances in two main ways: 1. optimization of the methods in vitro to the skin cells culture and proliferation and 2. developing biomaterials that present similar skin properties.A pesquisa em bioengenharia é primordial no desenvolvimento da combinação ideal de biomateriais e células cultivadas para produzir a cobertura definitiva das lesões. O modelo experimental da cultura de queratinócitos apresenta toda as etapas do cultivo, desde o isolamento dos queratinócitos, preparação da derme acelular humana, do enxerto composto e da sua elevação à interface ar-líquido. A pesquisa em modelo de cultura de queratinócitos desenvolve-se em duas vias principais: 1. otimização dos métodos in vitro para cultivo e proliferação de células da pele e 2. desenvolvimento de biomateriais que mimetizem as propriedades da pele.

  3. Protective Effect of Diphlorethohydroxycarmalol against Ultraviolet B Radiation-Induced DNA Damage by Inducing the Nucleotide Excision Repair System in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Mei Jing Piao

    2015-09-01

    Full Text Available We investigated the protective properties of diphlorethohydroxycarmalol (DPHC, a phlorotannin, against ultraviolet B (UVB radiation-induced cyclobutane pyrimidine dimers (CPDs in HaCaT human keratinocytes. The nucleotide excision repair (NER system is the pathway by which cells identify and repair bulky, helix-distorting DNA lesions such as ultraviolet (UV radiation-induced CPDs and 6-4 photoproducts. CPDs levels were elevated in UVB-exposed cells; however, this increase was reduced by DPHC. Expression levels of xeroderma pigmentosum complementation group C (XPC and excision repair cross-complementing 1 (ERCC1, which are essential components of the NER pathway, were induced in DPHC-treated cells. Expression of XPC and ERCC1 were reduced following UVB exposure, whereas DPHC treatment partially restored the levels of both proteins. DPHC also increased expression of transcription factor specificity protein 1 (SP1 and sirtuin 1, an up-regulator of XPC, in UVB-exposed cells. DPHC restored binding of the SP1 to the XPC promoter, which is reduced in UVB-exposed cells. These results indicate that DPHC can protect cells against UVB-induced DNA damage by inducing the NER system.

  4. Arecoline decreases interleukin-6 production and induces apoptosis and cell cycle arrest in human basal cell carcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Li-Wen [Department of Medical Laboratory Science and Biotechnology, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Hsieh, Bau-Shan; Cheng, Hsiao-Ling [Department of Biochemistry, Faculty of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Hu, Yu-Chen [Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Chang, Wen-Tsan [Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Division of Hepatobiliarypancreatic Surgery, Department of Surgery, Kaohsiung Medical University Hospital, Kaohsiung 80708, Taiwan (China); Chang, Kee-Lung, E-mail: Chang.KeeLung@msa.hinet.net [Department of Biochemistry, Faculty of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China)

    2012-01-15

    Arecoline, the most abundant areca alkaloid, has been reported to decrease interleukin-6 (IL-6) levels in epithelial cancer cells. Since IL-6 overexpression contributes to the tumorigenic potency of basal cell carcinoma (BCC), this study was designed to investigate whether arecoline altered IL-6 expression and its downstream regulation of apoptosis and the cell cycle in cultured BCC-1/KMC cells. BCC-1/KMC cells and a human keratinocyte cell line, HaCaT, were treated with arecoline at concentrations ranging from 10 to 100 μg/ml, then IL-6 production and expression of apoptosis- and cell cycle progress-related factors were examined. After 24 h exposure, arecoline inhibited BCC-1/KMC cell growth and decreased IL-6 production in terms of mRNA expression and protein secretion, but had no effect on HaCaT cells. Analysis of DNA fragmentation and chromatin condensation showed that arecoline induced apoptosis of BCC-1/KMC cells in a dose-dependent manner, activated caspase-3, and decreased expression of the anti-apoptotic protein Bcl-2. In addition, arecoline induced progressive and sustained accumulation of BCC-1/KMC cells in G2/M phase as a result of reducing checkpoint Cdc2 activity by decreasing Cdc25C phosphatase levels and increasing p53 levels. Furthermore, subcutaneous injection of arecoline led to decreased BCC-1/KMC tumor growth in BALB/c mice by inducing apoptosis. This study demonstrates that arecoline has potential for preventing BCC tumorigenesis by reducing levels of the tumor cell survival factor IL-6, increasing levels of the tumor suppressor factor p53, and eliciting cell cycle arrest, followed by apoptosis. Highlights: ► Arecoline has potential to prevent against basal cell carcinoma tumorigenesis. ► It has more effectiveness on BCC as compared with a human keratinocyte cell line. ► Mechanisms involved including reducing tumor cells’ survival factor IL-6, ► Decreasing Cdc25C phosphatase, enhancing tumor suppressor factor p53, ► Eliciting G2/M

  5. Low-level laser irradiation promotes the proliferation and maturation of keratinocytes during epithelial wound repair

    Science.gov (United States)

    Sperandio, Felipe F.; Simões, Alyne; Corrêa, Luciana; Aranha, Ana Cecília C.; Giudice, Fernanda S.; Hamblin, Michael R.; Sousa, Suzana C.O.M.

    2015-01-01

    Low-level laser therapy (LLLT) has been extensively employed to improve epithelial wound healing, though the exact response of epithelium maturation and stratification after LLLT is unknown. Thus, this study aimed to assess the in vitro growth and differentiation of keratinocytes (KCs) and in vivo wound healing response when treated with LLLT. Human KCs (HaCaT cells) showed an enhanced proliferation with all the employed laser energy densities (3, 6 and 12 J/cm2, 660nm, 100mW), together with an increased expression of Cyclin D1. Moreover, the immunoexpression of proteins related to epithelial proliferation and maturation (p63, CK10, CK14) all indicated a faster maturation of the migrating KCs in the LLLT-treated wounds. In that way, an improved epithelial healing was promoted by LLLT with the employed parameters; this improvement was confirmed by changes in the expression of several proteins related to epithelial proliferation and maturation. PMID:25411997

  6. Heavy metal-induced cytotoxicity to cultured human epidermal keratinocytes and effects of antioxidants.

    Science.gov (United States)

    Kappus, H; Reinhold, C

    1994-04-01

    Human epidermal keratinocytes which have been cultured were treated with the heavy metal ions of cadmium, mercury, copper and zinc. Cytotoxicity was measured either by protein estimation or by using the neutral red assay. Antioxidants were added in order to find out whether heavy metal-induced cytotoxicity is related to oxidative stress. All metals used showed considerable cytotoxic effects within 24 h in moderate concentrations. None of the antioxidants vitamin E (alpha-tocopherol), pyrogallol, propyl gallate, BHT or ebselen showed any protective or preventive effect. This indicates that oxidative stress may not be involved in the cytotoxicity induced by heavy metals in human epidermal keratinocytes. The cells used are, however, a valuable tool to study mechanisms of cytotoxicity.

  7. Sustained phenotypic reversion of junctional epidermolysis bullosa dog keratinocytes: Establishment of an immunocompetent animal model for cutaneous gene therapy

    International Nuclear Information System (INIS)

    Spirito, Flavia; Capt, Annabelle; Rio, Marcela Del; Larcher, Fernando; Guaguere, Eric; Danos, Olivier; Meneguzzi, Guerrino

    2006-01-01

    Gene transfer represents the unique therapeutic issue for a number of inherited skin disorders including junctional epidermolysis bullosa (JEB), an untreatable genodermatose caused by mutations in the adhesion ligand laminin 5 (α3β3γ2) that is secreted in the extracellular matrix by the epidermal basal keratinocytes. Because gene therapy protocols require validation in animal models, we have phenotypically reverted by oncoretroviral transfer of the curative gene the keratinocytes isolated from dogs with a spontaneous form of JEB associated with a genetic mutation in the α3 chain of laminin 5. We show that the transduced dog JEB keratinocytes: (1) display a sustained secretion of laminin 5 in the extracellular matrix; (2) recover the adhesion, proliferation, and clonogenic capacity of wild-type keratinocytes; (3) generate fully differentiated stratified epithelia that after grafting on immunocompromised mice produce phenotypically normal skin and sustain permanent expression of the transgene. We validate an animal model that appears particularly suitable to demonstrate feasibility, efficacy, and safety of genetic therapeutic strategies for cutaneous disorders before undertaking human clinical trials

  8. Human papillomavirus 16 E5 induces bi-nucleated cell formation by cell-cell fusion

    International Nuclear Information System (INIS)

    Hu Lulin; Plafker, Kendra; Vorozhko, Valeriya; Zuna, Rosemary E.; Hanigan, Marie H.; Gorbsky, Gary J.; Plafker, Scott M.; Angeletti, Peter C.; Ceresa, Brian P.

    2009-01-01

    Human papillomaviruses (HPV) 16 is a DNA virus encoding three oncogenes - E5, E6, and E7. The E6 and E7 proteins have well-established roles as inhibitors of tumor suppression, but the contribution of E5 to malignant transformation is controversial. Using spontaneously immortalized human keratinocytes (HaCaT cells), we demonstrate that expression of HPV16 E5 is necessary and sufficient for the formation of bi-nucleated cells, a common characteristic of precancerous cervical lesions. Expression of E5 from non-carcinogenic HPV6b does not produce bi-nucleate cells. Video microscopy and biochemical analyses reveal that bi-nucleates arise through cell-cell fusion. Although most E5-induced bi-nucleates fail to propagate, co-expression of HPV16 E6/E7 enhances the proliferation of these cells. Expression of HPV16 E6/E7 also increases bi-nucleated cell colony formation. These findings identify a new role for HPV16 E5 and support a model in which complementary roles of the HPV16 oncogenes lead to the induction of carcinogenesis

  9. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  10. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    International Nuclear Information System (INIS)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-01-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  11. Cervical cancer cell lines expressing NKG2D-ligands are able to down-modulate the NKG2D receptor on NKL cells with functional implications

    Directory of Open Access Journals (Sweden)

    Jimenez-Perez Miriam I

    2012-02-01

    Full Text Available Abstract Background Cervical cancer represents the third most commonly diagnosed cancer and the fourth leading cause of cancer-related deaths in women worldwide. Natural killer (NK cells play an important role in the defense against viruses, intracellular bacteria and tumors. NKG2D, an activating receptor on NK cells, recognizes MHC class I chain-related molecules, such as MICA/B and members of the ULBP/RAET1 family. Tumor-derived soluble NKG2D-ligands have been shown to down-modulate the expression of NKG2D on NK cells. In addition to the down-modulation induced by soluble NKG2D-ligands, it has recently been described that persistent cell-cell contact can also down-modulate NKG2D expression. The goal of this study was to determine whether the NKG2D receptor is down-modulated by cell-cell contact with cervical cancer cells and whether this down-modulation might be associated with changes in NK cell activity. Results We demonstrate that NKG2D expressed on NKL cells is down-modulated by direct cell contact with cervical cancer cell lines HeLa, SiHa, and C33A, but not with non-tumorigenic keratinocytes (HaCaT. Moreover, this down-modulation had functional implications. We found expression of NKG2D-ligands in all cervical cancer cell lines, but the patterns of ligand distribution were different in each cell line. Cervical cancer cell lines co-cultured with NKL cells or fresh NK cells induced a marked diminution of NKG2D expression on NKL cells. Additionally, the cytotoxic activity of NKL cells against K562 targets was compromised after co-culture with HeLa and SiHa cells, while co-culture with C33A increased the cytotoxic activity of the NKL cells. Conclusions Our results suggest that differential expression of NKG2D-ligands in cervical cancer cell lines might be associated with the down-modulation of NKG2D, as well as with changes in the cytotoxic activity of NKL cells after cell-cell contact with the tumor cells.

  12. Oral fibroblasts produce more HGF and KGF than skin fibroblasts in response to co-culture with keratinocytes

    DEFF Research Database (Denmark)

    Grøn, Birgitte; Stoltze, Kaj; Andersson, Anders

    2002-01-01

    The production of hepatocyte growth factor (HGF) and keratinocyte growth factor (KGF) in subepithelial fibroblasts from buccal mucosa, periodontal ligament, and skin was determined after co-culture with keratinocytes. The purpose was to detect differences between the fibroblast subpopulations...... days by ELISA. When cultured on polystyrene, the constitutive level of KGF and HGF in periodontal fibroblasts was higher than the level in buccal and skin fibroblasts. In the presence of keratinocytes, all three types of fibroblasts in general increased their HGF and KGF production 2-3 times. When...... cells were maintained in collagen, the level of HGF and KGF was decreased mainly in skin cultures. However, in oral fibroblasts, induction after stimulation was at a similar level in collagen compared to on polystyrene. Skin fibroblasts maintained in collagen produced almost no HGF whether...

  13. Human keratinocytes are a source for tumor necrosis factor alpha: Evidence for synthesis and release upon stimulation with endotoxin or ultraviolet light

    International Nuclear Information System (INIS)

    Koeck, A.S.; Schwarz, T.; Kirnbauer, R.; Urbanski, A.; Perry, P.; Ansel, J.C.; Luger, T.A.

    1990-01-01

    Tumor necrosis factor alpha (TNF-alpha), in addition to being cytotoxic for certain tumor cells, has turned out as a multifunctional cytokine that is involved in the regulation of immunity and inflammation. Since human keratinocytes have been demonstrated to be a potent source of various cytokines, it was investigated whether epidermal cells synthesize and release TNF-alpha. Supernatants derived from normal human keratinocytes (HNK) and human epidermoid carcinoma cell lines (KB, A431) were tested both in a TNF-alpha-specific ELISA and a bioassay. In supernatants of untreated epidermal cells, no or minimal TNF-alpha activity was found, while after stimulation with lipopolysaccharide (LPS) or ultraviolet (UV) light, significant amounts were detected. Western blot analysis using an antibody directed against human TNF-alpha revealed a molecular mass of 17 kD for keratinocyte-derived TNF-alpha. These biological and biochemical data were also confirmed by Northern blot analysis revealing mRNA specific for TNF-alpha in LPS- or ultraviolet B (UVB)-treated HNK and KB cells. In addition, increased TNF-alpha levels were detected in the serum obtained from human volunteers 12 and 24 h after a single total body UVB exposure, which caused a severe sunburn reaction. These findings indicate that keratinocytes upon stimulation are able to synthesize and release TNF-alpha, which may gain access to the circulation. Thus, TNF-alpha in concert with other epidermal cell-derived cytokines may mediate local and systemic inflammatory reactions during host defense against injurious events caused by microbial agents or UV irradiation

  14. A Patient with Multiple Keratinocytic Cancers (MKC: Uncommon Presentation in a Bulgarian Patient

    Directory of Open Access Journals (Sweden)

    Georgi Tchernev

    2018-01-01

    Full Text Available Keratinocyte skin cancers, including basal cell carcinoma (BCC and squamous cell carcinoma (SCC, are the most common cancer occurring in people with fair skin, worldwide. Despite all known triggers, several suggested contributors are still investigated. We will focus our attention on the personal history of previous cancers and radiation exposure as occupational risk factors, as in the presented case. We report a patient, with multiple BCCs, and subsequent occurrence of a SCC on photo-exposed area of the face, as we want to emphasize the importance of strict following up of these patients, regarding the risk for developing new tumors in short periods of time, no matter if the triggering exposure factor is known from the history, or not.  Although keratinocytes tumours are associated with the low mortality rate, we focus the attention on the fact, that the history of non-melanoma skin cancer is associated with increased mortality.

  15. Interleukin-1α Induction in Human Keratinocytes (HaCaT: An In Vitro Model for Chemoprevention in Skin

    Directory of Open Access Journals (Sweden)

    T. Magcwebeba

    2012-01-01

    Full Text Available Long-term exposure to UV irradiation and toxic chemicals is associated with chronic inflammation that contributes to skin cancer development with interleukin-1 alpha (IL-1α, constitutively produced by keratinocytes, playing a pivotal role in skin inflammation. The aim of this study was to investigate the modulation of IL-1α production in the HaCaT keratinocyte cell line. Phorbol 12-myristate 13-acetate failed to induce IL-1α in HaCaT cells, and this might be associated with the specific deficiency known to affect downstream signalling of the MEK/ERK pathway in these cells. The calcium ionophore, ionomycin, slightly enhanced the production of intracellular (icIL-1α, but this resulted in a necrotic release at higher concentrations. UV-B exposure significantly increased the production of icIL-1α in a dose-dependent manner with a maximal induction exhibited at 24 h with minimal necrotic and apoptotic effects. Validation of the HaCaT cell model indicated that the nonsteroidal anti-inflammatory drug (NSAID, ibuprofen, and the glucocorticoid, dexamethasone, inhibited icIL-1α production, and this was associated with a slight inhibition of cell viability. The UV-B-induced keratinocyte cell model provides an in vitro system that could, apart from phorbol ester-like compounds, be utilised as a screening assay in identifying skin irritants and/or therapeutic topical agents via the modulation of IL-1α production.

  16. Differentiation of human keratinocytes: changes in lipid synthesis, plasma membrane lipid composition, and 125I-EGF binding upon administration of 25-hydroxycholesterol and mevinolin

    International Nuclear Information System (INIS)

    Ponec, M.; Kempenaar, J.; Weerheim, A.; Boonstra, J.

    1987-01-01

    We have studied the relationship between differentiation capacity, plasma membrane composition, and epidermal growth factor (EGF) receptor expression of normal keratinocytes in vitro. The plasma membrane composition of the cells was modulated experimentally by cholesterol depletion, using specific inhibitors of cholesterol synthesis, such as 25-hydroxycholesterol and mevinolin. Exposure of the cells towards these inhibitors resulted in a drastic decrease of cholesterol biosynthesis, as determined from 14 C-acetate incorporation into the various lipid fractions. This effect on cholesterol biosynthesis was reflected by changes in plasma membrane composition, as determined by lipid analysis of isolated plasma membrane fractions, these resulting in a decreased cholesterol-phospholipid ratio. The experimental modulation of plasma membrane composition by 25-hydroxycholesterol or mevinolin were accompanied by a decreased cornified envelope formation and by high expression of EGF binding sites. These phenomena were more pronounced in cells induced to differentiate by exposure of cells grown under low Ca2+ to normal Ca2+ concentrations, as compared to cells grown persistently under low Ca2+ concentrations. These results suggest a close correlation between plasma membrane composition, differentiation capacity, and EGF receptor expression

  17. Melanosomes are transferred from melanocytes to keratinocytes through the processes of packaging, release, uptake, and dispersion.

    Science.gov (United States)

    Ando, Hideya; Niki, Yoko; Ito, Masaaki; Akiyama, Kaoru; Matsui, Mary S; Yarosh, Daniel B; Ichihashi, Masamitsu

    2012-04-01

    Recent studies have described the role of shedding vesicles as physiological conveyers of intracellular components between neighboring cells. Here we report that melanosomes are one example of shedding vesicle cargo, but are processed by a previously unreported mechanism. Pigment globules were observed to be connected to the filopodia of melanocyte dendrites, which have previously been shown to be conduits for melanosomes. Pigment globules containing multiple melanosomes were released from various areas of the dendrites of normal human melanocytes derived from darkly pigmented skin. The globules were then captured by the microvilli of normal human keratinocytes, also derived from darkly pigmented skin, which incorporated them in a protease-activated receptor-2 (PAR-2)-dependent manner. After the pigment globules were ingested by the keratinocytes, the membrane that surrounded each melanosome cluster was gradually degraded, and the individual melanosomes then spread into the cytosol and were distributed primarily in the perinuclear area of each keratinocyte. These results suggest a melanosome transfer pathway wherein melanosomes are transferred from melanocytes to keratinocytes via the shedding vesicle system. This packaging system generates pigment globules containing multiple melanosomes in a unique manner.

  18. Chitosan-shelled oxygen-loaded nanodroplets abrogate hypoxia dysregulation of human keratinocyte gelatinases and inhibitors: New insights for chronic wound healing

    Energy Technology Data Exchange (ETDEWEB)

    Khadjavi, Amina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Magnetto, Chiara [Istituto Nazionale di Ricerca Metrologica (INRIM), Torino (Italy); Panariti, Alice [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Argenziano, Monica [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Gulino, Giulia Rossana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Rivolta, Ilaria [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Cavalli, Roberta [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Giribaldi, Giuliana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Guiot, Caterina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Prato, Mauro, E-mail: mauro.prato@unito.it [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Dipartimento di Scienze della Sanità Pubblica e Pediatriche, Università di Torino, Torino (Italy)

    2015-08-01

    Background: : In chronic wounds, efficient epithelial tissue repair is hampered by hypoxia, and balances between the molecules involved in matrix turn-over such as matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) are seriously impaired. Intriguingly, new oxygenating nanocarriers such as 2H,3H-decafluoropentane-based oxygen-loaded nanodroplets (OLNs) might effectively target chronic wounds. Objective: : To investigate hypoxia and chitosan-shelled OLN effects on MMP/TIMP production by human keratinocytes. Methods: : HaCaT cells were treated for 24 h with 10% v/v OLNs both in normoxia or hypoxia. Cytotoxicity and cell viability were measured through biochemical assays; cellular uptake by confocal microscopy; and MMP and TIMP production by enzyme-linked immunosorbent assay or gelatin zymography. Results: : Normoxic HaCaT cells constitutively released MMP-2, MMP-9, TIMP-1 and TIMP-2. Hypoxia strongly impaired MMP/TIMP balances by reducing MMP-2, MMP-9, and TIMP-2, without affecting TIMP-1 release. After cellular uptake by keratinocytes, nontoxic OLNs abrogated all hypoxia effects on MMP/TIMP secretion, restoring physiological balances. OLN abilities were specifically dependent on time-sustained oxygen diffusion from OLN core. Conclusion: : Chitosan-shelled OLNs effectively counteract hypoxia-dependent dysregulation of MMP/TIMP balances in human keratinocytes. Therefore, topical administration of exogenous oxygen, properly encapsulated in nanodroplet formulations, might be a promising adjuvant approach to promote healing processes in hypoxic wounds. - Highlights: • Hypoxia impairs MMP9/TIMP1 and MMP2/TIMP2 balances in HaCaT human keratinocytes. • Chitosan-shelled oxygen-loaded nanodroplets (OLNs) are internalised by HaCaT cells. • OLNs are not toxic to HaCaT cells. • OLNs effectively counteract hypoxia effects on MMP/TIMP balances in HaCaT cells. • OLNs appear as promising and cost-effective therapeutic tools for hypoxic

  19. Chitosan-shelled oxygen-loaded nanodroplets abrogate hypoxia dysregulation of human keratinocyte gelatinases and inhibitors: New insights for chronic wound healing

    International Nuclear Information System (INIS)

    Khadjavi, Amina; Magnetto, Chiara; Panariti, Alice; Argenziano, Monica; Gulino, Giulia Rossana; Rivolta, Ilaria; Cavalli, Roberta; Giribaldi, Giuliana; Guiot, Caterina; Prato, Mauro

    2015-01-01

    Background: : In chronic wounds, efficient epithelial tissue repair is hampered by hypoxia, and balances between the molecules involved in matrix turn-over such as matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) are seriously impaired. Intriguingly, new oxygenating nanocarriers such as 2H,3H-decafluoropentane-based oxygen-loaded nanodroplets (OLNs) might effectively target chronic wounds. Objective: : To investigate hypoxia and chitosan-shelled OLN effects on MMP/TIMP production by human keratinocytes. Methods: : HaCaT cells were treated for 24 h with 10% v/v OLNs both in normoxia or hypoxia. Cytotoxicity and cell viability were measured through biochemical assays; cellular uptake by confocal microscopy; and MMP and TIMP production by enzyme-linked immunosorbent assay or gelatin zymography. Results: : Normoxic HaCaT cells constitutively released MMP-2, MMP-9, TIMP-1 and TIMP-2. Hypoxia strongly impaired MMP/TIMP balances by reducing MMP-2, MMP-9, and TIMP-2, without affecting TIMP-1 release. After cellular uptake by keratinocytes, nontoxic OLNs abrogated all hypoxia effects on MMP/TIMP secretion, restoring physiological balances. OLN abilities were specifically dependent on time-sustained oxygen diffusion from OLN core. Conclusion: : Chitosan-shelled OLNs effectively counteract hypoxia-dependent dysregulation of MMP/TIMP balances in human keratinocytes. Therefore, topical administration of exogenous oxygen, properly encapsulated in nanodroplet formulations, might be a promising adjuvant approach to promote healing processes in hypoxic wounds. - Highlights: • Hypoxia impairs MMP9/TIMP1 and MMP2/TIMP2 balances in HaCaT human keratinocytes. • Chitosan-shelled oxygen-loaded nanodroplets (OLNs) are internalised by HaCaT cells. • OLNs are not toxic to HaCaT cells. • OLNs effectively counteract hypoxia effects on MMP/TIMP balances in HaCaT cells. • OLNs appear as promising and cost-effective therapeutic tools for hypoxic

  20. GATA3 is a master regulator of the transcriptional response to low-dose ionizing radiation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Bonin, F.; Molina, M.; Berthier-Vergnes, O.; Lamartine, J. [Universite de Lyon, Lyon, F-69003 (France); Universite Lyon 1, Lyon, F-69003 (France); CNRS, UMR5534, Centre de Genetique Moleculaire et Cellulaire, Villeurbanne, F-69622 (France); Malet, C.; Ginestet, C. [Centre Leon Berard, Service de Radiotherapie, Lyon F-69008 (France); Martin, M.T. [Laboratoire de Genomique et Radiobiologie de la Keratinopoiese, CEA, IRCM, Evry F-91000 (France)

    2009-07-01

    Background: The general population is constantly exposed to low levels of radiation through natural, occupational or medical irradiation. Even if the biological effects of low-level radiation have been intensely debated and investigated, the molecular mechanisms underlying the cellular response to low doses remain largely unknown. Results: The present study investigated the role of GATA3 protein in the control of the cellular and molecular response of human keratinocytes exposed to a 1 cGy dose of X-rays. Chromatin immunoprecipitation showed GATA3 to be able to bind the promoter of 4 genes responding to a 1 cGy exposure. To go further into the role of GATA3 after ionizing radiation exposure, we studied the cellular and molecular consequences of radiation in GATA3 knock-down cells. Knockdown was obtained by lentiviral-mediated expression of an shRNA targeting the GATA3 transcript in differentiated keratinocytes. First, radiosensitivity was assessed: the toxicity, in terms of immediate survival (with XTT test), associated with 1 cGy radiation was found to be increased in GATA3 knock-down cells. The impact of GATA3 knock-down on the transcriptome of X-ray irradiated cells was also investigated, using oligonucleotide micro-arrays to assess changes between 3 h and 72 h post-irradiation in normal vs GATA3 knock-down backgrounds; transcriptome response was found to be completely altered in GATA3 knock-down cells, with a strong induction/repression peak 48 h after irradiation. Functional annotation revealed enrichment in genes known to be involved in chaperone activity, TGF{beta} signalling and stress response. Conclusion: Taken together, these data indicate that GATA3 is an important regulator of the cellular and molecular response of epidermal cells to very low doses of radiation. (authors)

  1. GATA3 is a master regulator of the transcriptional response to low-dose ionizing radiation in human keratinocytes

    International Nuclear Information System (INIS)

    Bonin, F.; Molina, M.; Berthier-Vergnes, O.; Lamartine, J.; Malet, C.; Ginestet, C.; Martin, M.T.

    2009-01-01

    Background: The general population is constantly exposed to low levels of radiation through natural, occupational or medical irradiation. Even if the biological effects of low-level radiation have been intensely debated and investigated, the molecular mechanisms underlying the cellular response to low doses remain largely unknown. Results: The present study investigated the role of GATA3 protein in the control of the cellular and molecular response of human keratinocytes exposed to a 1 cGy dose of X-rays. Chromatin immunoprecipitation showed GATA3 to be able to bind the promoter of 4 genes responding to a 1 cGy exposure. To go further into the role of GATA3 after ionizing radiation exposure, we studied the cellular and molecular consequences of radiation in GATA3 knock-down cells. Knockdown was obtained by lentiviral-mediated expression of an shRNA targeting the GATA3 transcript in differentiated keratinocytes. First, radiosensitivity was assessed: the toxicity, in terms of immediate survival (with XTT test), associated with 1 cGy radiation was found to be increased in GATA3 knock-down cells. The impact of GATA3 knock-down on the transcriptome of X-ray irradiated cells was also investigated, using oligonucleotide micro-arrays to assess changes between 3 h and 72 h post-irradiation in normal vs GATA3 knock-down backgrounds; transcriptome response was found to be completely altered in GATA3 knock-down cells, with a strong induction/repression peak 48 h after irradiation. Functional annotation revealed enrichment in genes known to be involved in chaperone activity, TGFβ signalling and stress response. Conclusion: Taken together, these data indicate that GATA3 is an important regulator of the cellular and molecular response of epidermal cells to very low doses of radiation. (authors)

  2. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor.

    Science.gov (United States)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Possible role of epidermal keratinocytes in the construction of acupuncture meridians.

    Science.gov (United States)

    Denda, Mitsuhiro; Tsutsumi, Moe

    2014-04-01

    Acupuncture meridians consist of a network of acupuncture points on the skin, stimulation of which is well established to have a variety of physiological effects. We have previously demonstrated that epidermal keratinocytes contain multiple sensory systems for temperature, mechanical stimuli, electric potentials and other stimuli. These sensory systems generate changes in the calcium-ion concentration in the epidermis, so epidermal keratinocytes can generate spatially-localized electro-physiological patterns in the skin. We have previously demonstrated signaling between epidermal keratinocytes and peripheral nerve systems. Therefore, stimuli sensed by epidermal keratinocytes might be transferred to the unmyelinated nerve fibers that are known to exist in the epidermis and, thence, to the spinal cord and brain. We propose that epidermal keratinocytes form an information-gathering network in the skin and that this network plays a key role in whole-body homeostasis in response to the changing environment. We also hypothesize that this network corresponds to the acupuncture meridians. As supporting examples, we present some striking calcium propagation patterns observed in cultured human keratinocytes after adenosine-triphosphate (ATP) stimulation. These results support the ideas that keratinocytes can generate spatially-restricted signaling patterns after environmental stimulation and that the cultures might be in-vitro models of meridians as an information-gathering network in skin. Copyright © 2014. Published by Elsevier B.V.

  4. Low-dose dose-response for reduced cell viability after exposure of human keratinocyte (HEK001 cells to arsenite

    Directory of Open Access Journals (Sweden)

    Kenneth T. Bogen

    Full Text Available The in vitro arsenite (AsIII cytotoxicity dose-response (DR of human keratinocytes (HEK001 was examined at greater statistical resolution than ever previously reported using the MTT assay to determine cell viability. Fifty-four 96-well plates were treated with AsIII concentrations of 0.25, 0.5, 1, 2, 3, 4, 5, 7, 10, 15, 20, 25, or 30 μM. Because of unexpected variation in viability response patterns, a two-stage DR analysis was used in which data on plate-specific viability (%, estimated as 100% times the ratio of measured viability in exposed to unexposed cells, were fit initially to a generalized lognormal response function positing that HEK001 cells studied consisted of: a proportion P of relatively highly sensitive (HS cells, a proportion Po of relatively resistant cells, and a remaining (1–P–Po fraction of typical-sensitivity (TS cells exhibiting the intermediate level of AsIII sensitivity characteristic of most cells in each assay. The estimated fractions P and Po were used to adjust data from all 54 plates (and from the 28 plates yielding the best fits to reflect the condition that P = Po = 0 to provide detailed DR analysis specifically for TS cells. Four DR models fit to the combined adjusted data were each very predictive (R2 > 0.97 overall but were inconsistent with at least one of the data set examined (p  0.30 and exceeded 100% significance (p ≤ 10−6. A low-dose hormetic model provided the best fit to the combined adjusted data for TS cells (R2 = 0.995. Marked variability in estimates of P (the proportion of apparent HS cells was unexpected, not readily explained, and warrants further study using additional cell lines and assay methods, and in vivo. Keywords: Arsenic, Arsenate, Cell culture, Cell death, Cytotoxicity, HEK001 cells

  5. Release by ultraviolet B (u.v.B) radiation of nitric oxide (NO) from human keratinocytes: a potential role for nitric oxide in erythema production

    International Nuclear Information System (INIS)

    Deliconstantinos, G.; Villiotou, V.; Stravrides, J.C.

    1995-01-01

    The mechanism of human sunburn is poorly understood but its characteristic features include the development of erythema. In this study we attempted to determine whether human keratinocytes possess a nitric oxide (NO) synthase (NOS), if this enzyme could be activated to release NO following exposure to ultraviolet B (u.v.B) and to define whether this photo-induced response could be involved in the pathogenesis of sunburn erythema. The present results indicate that u.v.B radiation acts as a potent stimulator of NOS in keratinocytes. NO is lipophilic and may diffuse out of the keratinocytes, activating sGC in endothelial cells and neighbouring smooth muscle cells. This may be a major part of the integrated response of the skin leading to vasodilatation and erythema. (author)

  6. Human Adipose Mesenchymal Cells Inhibit Melanocyte Differentiation and the Pigmentation of Human Skin via Increased Expression of TGF-β1.

    Science.gov (United States)

    Klar, Agnes S; Biedermann, Thomas; Michalak, Katarzyna; Michalczyk, Teresa; Meuli-Simmen, Claudia; Scherberich, Arnaud; Meuli, Martin; Reichmann, Ernst

    2017-12-01

    There is accumulating evidence that interactions between epidermal melanocytes and stromal cells play an important role in the regulation of skin pigmentation. In this study we established a pigmented dermo-epidermal skin model, melDESS, of human origin to investigate the effects of distinct stromal cells on melanogenesis. melDESS is a complex, clinically relevant skin equivalent composed of an epidermis containing both melanocytes and keratinocytes. Its dermal compartment consists either of adipose tissue-derived stromal cells, dermal fibroblasts (Fbs), or a mixture of both cell types. These skin substitutes were transplanted for 5 weeks on the backs of immuno-incompetent rats and analyzed. Gene expression and Western blot analyses showed a significantly higher expression of transforming growth factor-β1 by adipose tissue-derived stromal cells compared with dermal Fbs. In addition, we showed that melanocytes responded to the increased levels of transforming growth factor-β1 by down-regulating the expression of key melanogenic enzymes such as tyrosinase. This caused decreased melanin synthesis and, consequently, greatly reduced pigmentation of melDESS. The conclusions are of utmost clinical relevance, namely that adipose tissue-derived stromal cells derived from the hypodermis fail to appropriately interact with epidermal melanocytes, thus preventing the sustainable restoration of the patient's native skin color in bioengineered skin grafts. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Cobalt toxicity: Chemical and radiological combined effects on HaCaT keratinocyte cell line

    International Nuclear Information System (INIS)

    Sandre, C.; Moulin, C.; Bresson, C.; Gault, N.; Poncy, J. L.; Lefaix, J. L.

    2010-01-01

    Cobalt (Co) is an essential trace element well known as a constituent of vitamin B 12 , but different compounds of Co are also described as highly toxic and/or radio-toxic for individuals or the environment. In nuclear power plants, 58 Co and 60 Co are radioactive isotopes of cobalt present as activation products of stable Co and Ni used in alloys. Skin exposure is a current occupational risk in the hard metal and nuclear industries. As biochemical and molecular cobalt-induced toxicological mechanisms are not fully identified, we investigated cobalt toxicity in a model human keratinocyte cell line, HaCaT. In this study, we propose a model to determine the in vitro chemical impact on cell viability of a soluble form of cobalt (CoCl 2 ) with or without gamma-ray doses to mimic contamination by 60 Co, to elucidate the mechanisms of cobalt intracellular chemical and radiological toxicity. Intracellular cobalt concentration was determined after HaCaT cell contamination and chemical toxicity was evaluated in terms of cellular viability and clonogenic survival. We investigated damage to DNA in HaCaT cells by combined treatment with chemical cobalt and a moderate gamma-ray dose. Additive effects of cobalt and irradiation were demonstrated. The underlying mechanism of cobalt toxicity is not clearly established, but our results seem to indicate that the toxicity of Co(II) and of irradiation arises from production of reactive oxygen species. (authors)

  8. Cobalt toxicity: Chemical and radiological combined effects on HaCaT keratinocyte cell line

    Energy Technology Data Exchange (ETDEWEB)

    Gault, N. [CEA Fontenay aux Roses, DSV/IRCM/SCSR/LRTS, 92265 Fontenay aux Rose (France); Sandre, C.; Moulin, B.; Bresson, C. [CEA, DEN, SECR, Laboratoire de Speciation des Radionucleides et des Molecules, F-91191 Gif-sur-Yvette (France); Poncy, J.L. [CEA Bruyeres Le Chatel, DSV/IRCM/SREIT/LRT, 91680 Bruyeres Le Chatel (France); Lefaix, J.L. [CEA Caen, DSV/IRCM/SRO/LARIA, 14070 Caen (France)

    2010-07-01

    Cobalt (Co) is an essential trace element well known as a constituent of vitamin B12, but different compounds of Co are also described as highly toxic and/or radio-toxic for individuals or the environment. In nuclear power plants, {sup 58}Co and {sup 60}Co are radioactive isotopes of cobalt present as activation products of stable Co and Ni used in alloys. Skin exposure is a current occupational risk in the hard metal and nuclear industries. As biochemical and molecular cobalt-induced toxicological mechanisms are not fully identified, we investigated cobalt toxicity in a model human keratinocyte cell line, HaCaT. In this study, we propose a model to determine the in vitro chemical impact on cell viability of a soluble form of cobalt (CoCl{sub 2}) with or without {gamma}-ray doses to mimic contamination by {sup 60}Co, to elucidate the mechanisms of cobalt intracellular chemical and radiological toxicity. Intracellular cobalt concentration was determined after HaCaT cell contamination and chemical toxicity was evaluated in terms of cellular viability and clonogenic survival. We investigated damage to DNA in HaCaT cells by combined treatment with chemical cobalt and a moderate {gamma}-ray dose. Additive effects of cobalt and irradiation were demonstrated. The underlying mechanism of cobalt toxicity is not clearly established, but our results seem to indicate that the toxicity of Co(II) and of irradiation arises from production of reactive oxygen species. (authors)

  9. Cobalt toxicity: Chemical and radiological combined effects on HaCaT keratinocyte cell line

    Energy Technology Data Exchange (ETDEWEB)

    Sandre, C.; Moulin, C.; Bresson, C. [CEA Saclay, DEN, SECR, Lab Speciat Radionucleides and Mol, F-91191 Gif Sur Yvette (France); Gault, N. [CEA Fontenay Roses, DSV IRCM SCSR LRTS, F-92265 Fontenay Aux Roses (France); Poncy, J. L. [CEA Bruyeres Le Chatel, DSV IRCM SREIT LRT, F-91680 Bruyeres Le Chatel (France); Lefaix, J. L. [CEA Caen, DSV IRCM SRO LARIA, F-14070 Caen (France)

    2010-07-01

    Cobalt (Co) is an essential trace element well known as a constituent of vitamin B{sub 12}, but different compounds of Co are also described as highly toxic and/or radio-toxic for individuals or the environment. In nuclear power plants, {sup 58}Co and {sup 60}Co are radioactive isotopes of cobalt present as activation products of stable Co and Ni used in alloys. Skin exposure is a current occupational risk in the hard metal and nuclear industries. As biochemical and molecular cobalt-induced toxicological mechanisms are not fully identified, we investigated cobalt toxicity in a model human keratinocyte cell line, HaCaT. In this study, we propose a model to determine the in vitro chemical impact on cell viability of a soluble form of cobalt (CoCl{sub 2}) with or without gamma-ray doses to mimic contamination by {sup 60}Co, to elucidate the mechanisms of cobalt intracellular chemical and radiological toxicity. Intracellular cobalt concentration was determined after HaCaT cell contamination and chemical toxicity was evaluated in terms of cellular viability and clonogenic survival. We investigated damage to DNA in HaCaT cells by combined treatment with chemical cobalt and a moderate gamma-ray dose. Additive effects of cobalt and irradiation were demonstrated. The underlying mechanism of cobalt toxicity is not clearly established, but our results seem to indicate that the toxicity of Co(II) and of irradiation arises from production of reactive oxygen species. (authors)

  10. Constitutive and inducible expression of SKALP/elafin provides anti-elastase defense in human epithelia.

    Science.gov (United States)

    Pfundt, R; van Ruissen, F; van Vlijmen-Willems, I M; Alkemade, H A; Zeeuwen, P L; Jap, P H; Dijkman, H; Fransen, J; Croes, H; van Erp, P E; Schalkwijk, J

    1996-01-01

    Skin-derived antileukoproteinase (SKALP), also known as elafin, is a serine proteinase inhibitor first discovered in keratinocytes from hyperproliferative human epidermis. In addition to the proteinase inhibiting domain which is directed against polymorphonuclear leukocyte (PMN) derived enzymes such as elastase and proteinase 3, SKALP contains multiple transglutaminase (TGase) substrate domains which enable crosslinking to extracellular and cell envelope proteins. Here we show that SKALP is constitutively expressed in several epithelia that are continuously subjected to inflammatory stimuli, such as the oral cavity and the vagina where it co-localizes with type 1 TGase. All epithelia from sterile body cavities are negative for SKALP. In general, stratified squamous epithelia are positive, whereas pseudostratified epithelia, simple/glandular epithelia and normal epidermis are negative. SKALP was found in fetal tissues of the oral cavity from 17 wk gestation onwards where it continued to be expressed up to adult life. Remarkably, in fetal epidermis SKALP was found from week 28 onwards, but was downregulated to undetectable levels in neonatal skin within three months, suggesting a role during pregnancy in feto-maternal interactions or in the early maturation phase of the epidermis. Immunoelectron microscopy revealed the presence of SKALP in secretory vesicles including the lamellar granules. In culture models for epidermal keratinocytes we found that expression of the endogenous SKALP gene provided protection against cell detachment caused by purified elastase or activated PMNs. Addition of exogenous recombinant SKALP fully protected the keratinocytes against PMN-dependent detachment whereas superoxide dismutase and catalase were only marginally effective. These findings strongly suggest that the constitutive expression of SKALP in squamous epithelia, and the inducible expression in epidermis participate in the control of epithelial integrity, by inhibiting PMN

  11. Skin Barrier Development Depends on CGI-58 Protein Expression during Late-Stage Keratinocyte Differentiation

    Science.gov (United States)

    Grond, Susanne; Radner, Franz P.W.; Eichmann, Thomas O.; Kolb, Dagmar; Grabner, Gernot F.; Wolinski, Heimo; Gruber, Robert; Hofer, Peter; Heier, Christoph; Schauer, Silvia; Rülicke, Thomas; Hoefler, Gerald; Schmuth, Matthias; Elias, Peter M.; Lass, Achim; Zechner, Rudolf; Haemmerle, Guenter

    2017-01-01

    Adipose triglyceride lipase (ATGL) and its coactivator comparative gene identification-58 (CGI-58) are limiting in cellular triglyceride catabolism. Although ATGL deficiency is compatible with normal skin development, mice globally lacking CGI-58 die postnatally and exhibit a severe epidermal permeability barrier defect, which may originate from epidermal and/or peripheral changes in lipid and energy metabolism. Here, we show that epidermis-specific disruption of CGI-58 is sufficient to provoke a defect in the formation of a functional corneocyte lipid envelope linked to impaired ω-O-acylceramide synthesis. As a result, epidermis-specific CGI-58-deficient mice show severe skin dysfunction, arguing for a tissue autonomous cause of disease development. Defective skin permeability barrier formation in global CGI-58-deficient mice could be reversed via transgenic restoration of CGI-58 expression in differentiated but not basal keratinocytes suggesting that CGI-58 is essential for lipid metabolism in suprabasal epidermal layers. The compatibility of ATGL deficiency with normal epidermal function indicated that CGI-58 may stimulate an epidermal triglyceride lipase beyond ATGL required for the adequate provision of fatty acids as a substrate for ω-O-acylceramide synthesis. Pharmacological inhibition of ATGL enzyme activity similarly reduced triglyceride-hydrolytic activities in wild-type and CGI-58 overexpressing epidermis implicating that CGI-58 participates in ω-O-acylceramide biogenesis independent of its role as a coactivator of epidermal triglyceride catabolism. PMID:27725204

  12. The key role of miR-21-regulated SOD2 in the medium-mediated bystander responses in human fibroblasts induced by α-irradiated keratinocytes.

    Science.gov (United States)

    Tian, Wenqian; Yin, Xiaoming; Wang, Longxiao; Wang, Jingdong; Zhu, Wei; Cao, Jianping; Yang, Hongying

    2015-10-01

    Radiation-induced bystander effect (RIBE) is well accepted in the radiation research field by now, but the underlying molecular mechanisms for better understanding this phenomenon caused by intercellular communication and intracellular signal transduction are still incomplete. Although our previous study has demonstrated an important role of miR-21 of unirradiated bystander cells in RIBEs, the direct evidence for the hypothesis that RIBE is epigenetically regulated is still limited and how miR-21 mediates RIBEs is unknown. Reactive oxygen species (ROS) have been demonstrated to be involved in RIBEs, however, the roles of anti-oxidative stress system of cells in RIBEs are unclear. Using transwell insert co-culture system, we investigated medium-mediated bystander responses in WS1 human fibroblasts after co-culture with HaCaT keratinocytes traversed by α-particles. Results showed that the ROS levels in unirradiated bystander WS1 cells were significantly elevated after 30min of co-culture, and 53BP1 foci, a surrogate marker of DNA damage, were obviously induced after 3h of co-culture. This indicates the occurrence of oxidative stress and DNA damage in bystander WS1 cells after co-culture with irradiated keratinocytes. Furthermore, the expression of miR-21 was increased in bystander WS1 cells, downregulation of miR-21 eliminated the bystander responses, overexpression of miR-21 alone could induce bystander-like oxidative stress and DNA damage in WS1 cells. These data indicate an important mediating role of miR-21 in RIBEs. In addition, MnSOD or SOD2 in WS1 cells was involved in the bystander effects, overexpression of SOD2 abolished the bystander oxidative stress and DNA damage, indicating that SOD2 was critical to the induction of RIBEs. Moreover, we found that miR-21 regulated SOD2, suggesting that miR-21 might mediate bystander responses through its regulation on SOD2. In conclusion, this study revealed a profound role of miR-21-regulated SOD2 of unirradiated WS1

  13. Multiple biological effects of inhibitors of arachidonic acid metabolism on human keratinocytes

    Czech Academy of Sciences Publication Activity Database

    Pacherník, Jiří; Hampl, Aleš; Souček, Karel; Kovaříková, Martina; Andrysík, Zdeněk; Hofmanová, Jiřina; Kozubík, Alois

    2002-01-01

    Roč. 293, č. 12 (2002), s. 626-633 ISSN 0340-3696 R&D Projects: GA ČR GA524/99/0694; GA AV ČR IBS5004009; GA ČR GA524/98/0190 Institutional research plan: CEZ:AV0Z5004920 Keywords : lipoxygenase * keratinocytes * cell cycle Subject RIV: BO - Biophysics Impact factor: 1.452, year: 2002

  14. Advances in reprogramming somatic cells to induced pluripotent stem cells.

    Science.gov (United States)

    Patel, Minal; Yang, Shuying

    2010-09-01

    Traditionally, nuclear reprogramming of cells has been performed by transferring somatic cell nuclei into oocytes, by combining somatic and pluripotent cells together through cell fusion and through genetic integration of factors through somatic cell chromatin. All of these techniques changes gene expression which further leads to a change in cell fate. Here we discuss recent advances in generating induced pluripotent stem cells, different reprogramming methods and clinical applications of iPS cells. Viral vectors have been used to transfer transcription factors (Oct4, Sox2, c-myc, Klf4, and nanog) to induce reprogramming of mouse fibroblasts, neural stem cells, neural progenitor cells, keratinocytes, B lymphocytes and meningeal membrane cells towards pluripotency. Human fibroblasts, neural cells, blood and keratinocytes have also been reprogrammed towards pluripotency. In this review we have discussed the use of viral vectors for reprogramming both animal and human stem cells. Currently, many studies are also involved in finding alternatives to using viral vectors carrying transcription factors for reprogramming cells. These include using plasmid transfection, piggyback transposon system and piggyback transposon system combined with a non viral vector system. Applications of these techniques have been discussed in detail including its advantages and disadvantages. Finally, current clinical applications of induced pluripotent stem cells and its limitations have also been reviewed. Thus, this review is a summary of current research advances in reprogramming cells into induced pluripotent stem cells.

  15. N-Acetylglutaminoyl-S-farnesyl-L-cysteine (SIG-1191): an anti-inflammatory molecule that increases the expression of the aquaglyceroporin, aquaporin-3, in human keratinocytes.

    Science.gov (United States)

    Fernández, José R; Webb, Corey; Rouzard, Karl; Voronkov, Michael; Huber, Kristen L; Stock, Jeffry B; Stock, Maxwell; Gordon, Joel S; Perez, Eduardo

    2017-03-01

    Isoprenylcysteine (IPC) small molecules were discovered as signal transduction modulating compounds ~25 years ago. More recently, IPC molecules have demonstrated antioxidant and anti-inflammatory properties in a variety of dermal cells as well as antimicrobial activity, representing a novel class of compounds to ameliorate skin conditions and disease. Here, we demonstrate a new IPC compound, N-acetylglutaminoyl-S-farnesyl-L-cysteine (SIG-1191), which inhibits UVB-induced inflammation blocking pro-inflammatory cytokine interleukin-6 (IL-6) and tumor necrosis factor alpha (TNF-α) production. To investigate further the previously reported hydrating potential of IPC compounds, SIG-1191 was tested for its ability to modulate aquaporin expression. Specifically, aquaporin 3 (AQP3) the most abundant aquaporin found in skin has been reported to play a key role in skin hydration, elasticity and barrier repair. Results show here for the first time that SIG-1191 increases AQP3 expression in both cultured normal human epidermal keratinocytes as well as when applied topically in a three-dimensional (3D) reconstructed human skin equivalent. Additionally, SIG-1191 dose dependently increased AQP3 protein levels, as determined by specific antibody staining, in the epidermis of the 3D skin equivalents. To begin to elucidate which signaling pathways SIG-1191 may be modulating to increase AQP3 levels, we used several pharmacological pathway inhibitors and determined that AQP3 expression is mediated by the Mitogen-activated protein kinase/Extracellular signal-regulated kinase kinase (MEK) pathway. Altogether, these data suggest SIG-1191 represents a new IPC derivative with anti-inflammatory activity that may also promote increased skin hydration based on its ability to increase AQP3 levels.

  16. Basal Cell Carcinoma in Gorlin's Patients: a Matter of Fibroblasts-Led Protumoral Microenvironment?

    Science.gov (United States)

    Gache, Yannick; Brellier, Florence; Rouanet, Sophie; Al-Qaraghuli, Sahar; Goncalves-Maia, Maria; Burty-Valin, Elodie; Barnay, Stéphanie; Scarzello, Sabine; Ruat, Martial; Sevenet, Nicolas; Avril, Marie-Françoise; Magnaldo, Thierry

    2015-01-01

    Basal cell carcinoma (BCC) is the commonest tumor in human. About 70% sporadic BCCs bear somatic mutations in the PATCHED1 tumor suppressor gene which encodes the receptor for the Sonic Hedgehog morphogen (SHH). PATCHED1 germinal mutations are associated with the dominant Nevoid Basal Cell Carcinoma Syndrome (NBCCS), a major hallmark of which is a high susceptibility to BCCs. Although the vast majority of sporadic BCCs arises exclusively in sun exposed skin areas, 40 to 50% BCCs from NBCCS patients develop in non photo-exposed skin. Since overwhelming evidences indicate that microenvironment may both be modified by- and influence the- epithelial tumor, we hypothesized that NBCCS fibroblasts could contribute to BCCs in NBCCS patients, notably those developing in non photo-exposed skin areas. The functional impact of NBCCS fibroblasts was then assessed in organotypic skin cultures with control keratinocytes. Onset of epidermal differentiation was delayed in the presence of primary NBCCS fibroblasts. Unexpectedly, keratinocyte proliferation was severely reduced and showed high levels of nuclear P53 in both organotypic skin cultures and in fibroblast-led conditioning experiments. However, in spite of increased levels of senescence associated β-galactosidase activity in keratinocytes cultured in the presence of medium conditioned by NBCCS fibroblasts, we failed to observe activation of P16 and P21 and then of bona fide features of senescence. Constitutive extinction of P53 in WT keratinocytes resulted in an invasive phenotype in the presence of NBCCS fibroblasts. Finally, we found that expression of SHH was limited to fibroblasts but was dependent on the presence of keratinocytes. Inhibition of SHH binding resulted in improved epidermal morphogenesis. Altogether, these data suggest that the repertoire of diffusible factors (including SHH) expressed by primary NBCCS fibroblasts generate a stress affecting keratinocytes behavior and epidermal homeostasis. Our findings

  17. Cytotoxic effects of denture adhesives on primary human oral keratinocytes, fibroblasts and permanent L929 cell lines.

    Science.gov (United States)

    Chen, Fengying; Wu, Tianfu; Cheng, Xiangrong

    2014-03-01

    To date, there have been very little data on the cytotoxic responses of different cell lines to denture adhesives. To determine the cytotoxicity of three denture adhesives on primary human oral keratinocytes (HOKs), fibroblasts (HOFs) and permanent mouse fibroblasts cell lines (L929). Three commercial denture adhesives (two creams and one powder) were prepared for indirect contact using the agar diffusion test, as well as extracts in MTT assay. The results of the MTT assay were statistically analysed by one-way anova and Tukey's test (p adhesives showed mild to moderate cytotoxicity to primary HOKs (p  0.05) in both assays. For primary HOFs cultures, slight cytotoxicity was observed for one of the products from the agar diffusion test and undiluted eluates of all tested adhesives with MTT assay (p adhesives are toxic to the primary HOKs and HOFs cultures, whereas non-toxic to L929 cells. The results suggest that primary human oral mucosal cells may provide more valuable information in toxicity screening of denture adhesives. © 2012 John Wiley & Sons A/S and The Gerodontology Association. Published by John Wiley & Sons Ltd.

  18. Valproic acid induces cutaneous wound healing in vivo and enhances keratinocyte motility.

    Directory of Open Access Journals (Sweden)

    Soung-Hoon Lee

    Full Text Available BACKGROUND: Cutaneous wound healing is a complex process involving several signaling pathways such as the Wnt and extracellular signal-regulated kinase (ERK signaling pathways. Valproic acid (VPA is a commonly used antiepileptic drug that acts on these signaling pathways; however, the effect of VPA on cutaneous wound healing is unknown. METHODS AND FINDINGS: We created full-thickness wounds on the backs of C3H mice and then applied VPA. After 7 d, we observed marked healing and reduced wound size in VPA-treated mice. In the neo-epidermis of the wounds, β-catenin and markers for keratinocyte terminal differentiation were increased after VPA treatment. In addition, α-smooth muscle actin (α-SMA, collagen I and collagen III in the wounds were significantly increased. VPA induced proliferation and suppressed apoptosis of cells in the wounds, as determined by Ki67 and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL staining analyses, respectively. In vitro, VPA enhanced the motility of HaCaT keratinocytes by activating Wnt/β-catenin, ERK and phosphatidylinositol 3-kinase (PI3-kinase/Akt signaling pathways. CONCLUSIONS: VPA enhances cutaneous wound healing in a murine model and induces migration of HaCaT keratinocytes.

  19. Expression of human olfactory receptor 10J5 in heart aorta, coronary artery, and endothelial cells and its functional role in angiogenesis.

    Science.gov (United States)

    Kim, Sung-Hee; Yoon, Yeo Cho; Lee, Ae Sin; Kang, NaNa; Koo, JaeHyung; Rhyu, Mee-Ra; Park, Jae-Ho

    2015-05-01

    ORs are ectopically expressed in non-chemosensory tissues including muscle, kidney, and keratinocytes; however, their physiological roles are largely unknown. We found that human olfactory receptor 10J5 (OR10J5) is expressed in the human aorta, coronary artery, and umbilical vein endothelial cells (HUVEC). Lyral induces Ca(2+) and phosphorylation of AKT in HUVEC. A knockdown study showed the inhibition of the lyral-induced Ca(2+) and the phosphorylation AKT and implied that these processes are mediated by OR10J5. In addition, lyral enhanced migration of HUVEC, which were also inhibited by RNAi in a migration assay. In addition, matrigel plug assay showed that lyral enhanced angiogenesis in vivo. Together these data demonstrate the physiological role of OR10J5 in angiogenesis and represent roles of ORs in HUVEC cells. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Generation of organotypic raft cultures from primary human keratinocytes.

    Science.gov (United States)

    Anacker, Daniel; Moody, Cary

    2012-02-22

    The development of organotypic epithelial raft cultures has provided researchers with an efficient in vitro system that faithfully recapitulates epithelial differentiation. There are many uses for this system. For instance, the ability to grow three-dimensional organotypic raft cultures of keratinocytes has been an important milestone in the study of human papillomavirus (HPV)(1). The life cycle of HPV is tightly linked to the differentiation of squamous epithelium(2). Organotypic epithelial raft cultures as demonstrated here reproduce the entire papillomavirus life cycle, including virus production(3,4,5). In addition, these raft cultures exhibit dysplastic lesions similar to those observed upon in vivo infection with HPV. Hence this system can also be used to study epithelial cell cancers, as well as the effect of drugs on epithelial cell differentiation in general. Originally developed by Asselineau and Prunieras(6) and modified by Kopan et al.(7), the organotypic epithelial raft culture system has matured into a general, relatively easy culture model, which involves the growth of cells on collagen plugs maintained at an air-liquid interface (Figure 1A). Over the course of 10-14 days, the cells stratify and differentiate, forming a full thickness epithelium that produces differentiation-specific cytokeratins. Harvested rafts can be examined histologically, as well as by standard molecular and biochemical techniques. In this article, we describe a method for the generation of raft cultures from primary human keratinocytes. The same technique can be used with established epithelial cell lines, and can easily be adapted for use with epithelial tissue from normal or diseased biopsies(8). Many viruses target either the cutaneous or mucosal epithelium as part of their replicative life cycle. Over the past several years, the feasibility of using organotypic raft cultures as a method of studying virus-host cell interactions has been shown for several herpesviruses, as

  1. Semaphorin4D Drives CD8+ T-Cell Lesional Trafficking in Oral Lichen Planus via CXCL9/CXCL10 Upregulations in Oral Keratinocytes.

    Science.gov (United States)

    Ke, Yao; Dang, Erle; Shen, Shengxian; Zhang, Tongmei; Qiao, Hongjiang; Chang, Yuqian; Liu, Qing; Wang, Gang

    2017-11-01

    Chemokine-mediated CD8 + T-cell recruitment is an essential but not well-established event for the persistence of oral lichen planus (OLP). Semaphorin 4D (Sema4D)/CD100 is implicated in immune dysfunction, chemokine modulation, and cell migration, which are critical aspects for OLP progression, but its implication in OLP pathogenesis has not been determined. In this study, we sought to explicate the effect of Sema4D on human oral keratinocytes and its capacity to drive CD8 + T-cell lesional trafficking via chemokine modulation. We found that upregulations of sSema4D in OLP tissues and blood were positively correlated with disease severity and activity. In vitro observation revealed that Sema4D induced C-X-C motif chemokine ligand 9/C-X-C motif chemokine ligand 10 production by binding to plexin-B1 via protein kinase B-NF-κB cascade in human oral keratinocytes, which elicited OLP CD8 + T-cell migration. We also confirmed using clinical samples that elevated C-X-C motif chemokine ligand 9/C-X-C motif chemokine ligand 10 levels were positively correlated with sSema4D levels in OLP lesions and serum. Notably, we determined matrix metalloproteinase-9 as a new proteolytic enzyme for the cleavage of sSema4D from the T-cell surface, which may contribute to the high levels of sSema4D in OLP lesions and serum. Our findings conclusively revealed an amplification feedback loop involving T cells, chemokines, and Sema4D-dependent signal that promotes OLP progression. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Serial Analysis of Gene Expression: Applications in Human Studies

    Directory of Open Access Journals (Sweden)

    Tuteja Renu

    2004-01-01

    Full Text Available Serial analysis of gene expression (SAGE is a powerful tool, which provides quantitative and comprehensive expression profile of genes in a given cell population. It works by isolating short fragments of genetic information from the expressed genes that are present in the cell being studied. These short sequences, called SAGE tags, are linked together for efficient sequencing. The frequency of each SAGE tag in the cloned multimers directly reflects the transcript abundance. Therefore, SAGE results in an accurate picture of gene expression at both the qualitative and the quantitative levels. It does not require a hybridization probe for each transcript and allows new genes to be discovered. This technique has been applied widely in human studies and various SAGE tags/SAGE libraries have been generated from different cells/tissues such as dendritic cells, lung fibroblast cells, oocytes, thyroid tissue, B-cell lymphoma, cultured keratinocytes, muscles, brain tissues, sciatic nerve, cultured Schwann cells, cord blood-derived mast cells, retina, macula, retinal pigment epithelial cells, skin cells, and so forth. In this review we present the updated information on the applications of SAGE technology mainly to human studies.

  3. Implanted hair follicle stem cells form Schwann cells that support repair of severed peripheral nerves.

    Science.gov (United States)

    Amoh, Yasuyuki; Li, Lingna; Campillo, Raul; Kawahara, Katsumasa; Katsuoka, Kensei; Penman, Sheldon; Hoffman, Robert M

    2005-12-06

    The hair follicle bulge area is an abundant, easily accessible source of actively growing, pluripotent adult stem cells. Nestin, a protein marker for neural stem cells, also is expressed in follicle stem cells and their immediate, differentiated progeny. The fluorescent protein GFP, whose expression is driven by the nestin regulatory element in transgenic mice, served to mark the follicle cell fate. The pluripotent nestin-driven GFP stem cells are positive for the stem cell marker CD34 but negative for keratinocyte marker keratin 15, suggesting their relatively undifferentiated state. These cells can differentiate into neurons, glia, keratinocytes, smooth muscle cells, and melanocytes in vitro. In vivo studies show the nestin-driven GFP hair follicle stem cells can differentiate into blood vessels and neural tissue after transplantation to the subcutis of nude mice. Equivalent hair follicle stem cells derived from transgenic mice with beta-actin-driven GFP implanted into the gap region of a severed sciatic nerve greatly enhance the rate of nerve regeneration and the restoration of nerve function. The follicle cells transdifferentiate largely into Schwann cells, which are known to support neuron regrowth. Function of the rejoined sciatic nerve was measured by contraction of the gastrocnemius muscle upon electrical stimulation. After severing the tibial nerve and subsequent transplantation of hair follicle stem cells, walking print length and intermediate toe spread significantly recovered, indicating that the transplanted mice recovered the ability to walk normally. These results suggest that hair follicle stem cells provide an important, accessible, autologous source of adult stem cells for regenerative medicine.

  4. Ectopic Cdx2 expression in murine esophagus models an intermediate stage in the emergence of Barrett's esophagus.

    Directory of Open Access Journals (Sweden)

    Jianping Kong

    2011-04-01

    Full Text Available Barrett's esophagus (BE is an intestinal metaplasia that occurs in the setting of chronic acid and bile reflux and is associated with a risk for adenocarcinoma. Expression of intestine-specific transcription factors in the esophagus likely contributes to metaplasia development. Our objective was to explore the effects of an intestine-specific transcription factor when expressed in the mouse esophageal epithelium. Transgenic mice were derived in which the transcription factor Cdx2 is expressed in squamous epithelium using the murine Keratin-14 gene promoter. Effects of the transgene upon cell proliferation and differentiation, gene expression, and barrier integrity were explored. K14-Cdx2 mice express the Cdx2 transgene in esophageal squamous tissues. Cdx2 expression was associated with reduced basal epithelial cell proliferation and altered cell morphology. Ultrastructurally two changes were noted. Cdx2 expression was associated with dilated space between the basal cells and diminished cell-cell adhesion caused by reduced Desmocollin-3 mRNA and protein expression. This compromised epithelial barrier function, as the measured trans-epithelial electrical resistance (TEER of the K14-Cdx2 epithelium was significantly reduced compared to controls (1189 Ohm*cm(2 ±343.5 to 508 Ohm*cm(2±92.48, p = 0.0532. Secondly, basal cells with features of a transitional cell type, intermediate between keratinocytes and columnar Barrett's epithelial cells, were observed. These cells had reduced keratin bundles and increased endoplasmic reticulum levels, suggesting the adoption of secretory-cell features. Moreover, at the ultrastructural level they resembled "Distinctive" cells associated with multilayered epithelium. Treatment of the K14-Cdx2 mice with 5'-Azacytidine elicited expression of BE-associated genes including Cdx1, Krt18, and Slc26a3/Dra, suggesting the phenotype could be advanced under certain conditions. We conclude that ectopic Cdx2 expression in

  5. Photon-induced cell migration and integrin expression promoted by DNA integration of HPV16 genome

    Energy Technology Data Exchange (ETDEWEB)

    Rieken, Stefan; Simon, Florian; Habermehl, Daniel; Dittmar, Jan Oliver; Combs, Stephanie E.; Weber, Klaus; Debus, Juergen; Lindel, Katja [University Hospital of Heidelberg, Department of Radiation Therapy and Radiation Oncology, Heidelberg (Germany)

    2014-10-15

    Persistent human papilloma virus 16 (HPV16) infections are a major cause of cervical cancer. The integration of the viral DNA into the host genome causes E2 gene disruption which prevents apoptosis and increases host cell motility. In cervical cancer patients, survival is limited by local infiltration and systemic dissemination. Surgical control rates are poor in cases of parametrial infiltration. In these patients, radiotherapy (RT) is administered to enhance local control. However, photon irradiation itself has been reported to increase cell motility. In cases of E2-disrupted cervical cancers, this phenomenon would impose an additional risk of enhanced tumor cell motility. Here, we analyze mechanisms underlying photon-increased migration in keratinocytes with differential E2 gene status. Isogenic W12 (intact E2 gene status) and S12 (disrupted E2 gene status) keratinocytes were analyzed in fibronectin-based and serum-stimulated migration experiments following single photon doses of 0, 2, and 10 Gy. Quantitative FACS analyses of integrin expression were performed. Migration and adhesion are increased in E2 gene-disrupted keratinocytes. E2 gene disruption promotes attractability by serum components, therefore, effectuating the risk of local infiltration and systemic dissemination. In S12 cells, migration is further increased by photon RT which leads to enhanced expression of fibronectin receptor integrins. HPV16-associated E2 gene disruption is a main predictor of treatment-refractory cancer virulence. E2 gene disruption promotes cell motility. Following photon RT, E2-disrupted tumors bear the risk of integrin-related infiltration and dissemination. (orig.) [German] Persistierende Infektionen mit humanen Papillomaviren 16 (HPV16) sind ein Hauptausloeser des Zervixkarzinoms. Die Integration der viralen DNS in das Wirtszellgenom fuehrt zum Integritaetsverlust des E2-Gens, wodurch in der Wirtszelle Apoptose verhindert und Motilitaet gesteigert werden. In

  6. Distinct interferon-gamma and interleukin-9 expression in cutaneous and oral lichen planus.

    Science.gov (United States)

    Weber, B; Schlapbach, C; Stuck, M; Simon, H-U; Borradori, L; Beltraminelli, H; Simon, D

    2017-05-01

    Cutaneous (CLP) and oral lichen planus (OLP) as the main subtypes of lichen planus (LP) present with different clinical manifestation and disease course, although their histopathologic features such as the band-like lymphocyte infiltrate and keratinocyte apoptosis are similar. So far, the underlying cellular and molecular mechanisms remain poorly understood. The aim of this study was to characterize and compare the in situ cellular infiltrates, cytokine expression profiles and apoptosis markers in CLP and OLP. Using immunofluorescence staining and laser scanning microscopy, we evaluated the cellular infiltrate (CD1a, CD3, CD4, CD8, CD21, CD57, CD123), cytokine expression (interleukin (IL)-1, IL-6, IL-9, IL-10, IL-17, IL-22, IL-23, tumour necrosis factor-α, transforming growth factor-β, interferon (IFN)-γ), and apoptosis markers (Fas, Fas ligand, cleaved caspase-3, TUNEL) of 21 anonymized biopsy specimens of LP (11 CLP, 10 OLP). Among infiltrating cells mainly T cells and natural killer (NK) cells as well as plasmacytoid dendritic cells (DC) were observed. A predominance of CD8+ T cells was noted in OLP. In both CLP and OLP, T helper (Th)1, Th9, Th17, and Th22-type cytokines were expressed. The expression of IL-9, IFN-γ and IL-22 was higher in CLP compared to that of OLP (P = 0.0165; P = 0.0016; P = 0.052 respectively). Expression of Fas and Fas ligand as well as cleaved caspase-3-positive cells was observed in the epithelium of all LP samples. The cell and cytokine patterns of CLP and OLP were partially distinct and generally resembled those reported for autoimmune diseases. The presence of CD8+ and NK cells as well as Fas/Fas ligand expression suggested that various pathways involved in keratinocyte apoptosis are relevant for LP. These results might help to establish targeted therapies for LP. © 2016 European Academy of Dermatology and Venereology.

  7. Vanillin protects human keratinocyte stem cells against ultraviolet B irradiation.

    Science.gov (United States)

    Lee, Jienny; Cho, Jae Youl; Lee, Sang Yeol; Lee, Kyung-Woo; Lee, Jongsung; Song, Jae-Young

    2014-01-01

    Ultraviolet-B (UVB) irradiation is one of major factors which induce cellular damages in the epidermis. We investigated protective effects and mechanisms of vanillin, a main constituent of vanilla beans, against UVB-induced cellular damages in keratinocyte stem cells (KSC). Here, vanillin significantly attenuated UVB irradiation-induced cytotoxicity. The vanillin effects were also demonstrated by the results of the senescence-associated β-galactosidase and alkaline comet assays. In addition, vanillin induced production of pro-inflammatory cytokines. Attempts to elucidate a possible mechanism underlying the vanillin-mediated effects revealed that vanillin significantly reduced UVB-induced phosphorylation of ataxia telangiectasia mutated (ATM), serine threonine kinase checkpoint kinase 2 (Chk2), tumor suppressor protein 53 (p53), p38/mitogen-activated protein kinase (p38), c-Jun N-terminal kinase/stress-activated protein kinase (JNK), S6 ribosomal protein (S6RP), and histone 2A family member X (H2A.X). UVB-induced activation of p53 luciferase reporter was also significantly inhibited by vanillin. In addition, while ATM inhibitor had no effect on the vanillin effects, mouse double minute 2 homolog (MDM2) inhibitor significantly attenuated suppressive effects of vanillin on UVB-induced activation of p53 reporter in KSC. Taken together, these findings suggest that vanillin protects KSC from UVB irradiation and its effects may occur through the suppression of downstream step of MDM2 in UVB irradiation-induced p53 activation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. IL-22/STAT3-Induced Increases in SLURP1 Expression within Psoriatic Lesions Exerts Antimicrobial Effects against Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Yasuhiro Moriwaki

    Full Text Available SLURP1 is the causal gene for Mal de Meleda (MDM, an autosomal recessive skin disorder characterized by diffuse palmoplantar keratoderma and transgressive keratosis. Moreover, although SLURP1 likely serves as an important proliferation/differentiation factor in keratinocytes, the possible relation between SLURP1 and other skin diseases, such as psoriasis and atopic dermatitis, has not been studied, and the pathophysiological control of SLURP1 expression in keratinocytes is largely unknown.Our aim was to examine the involvement of SLURP1 in the pathophysiology of psoriasis using an imiquimod (IMQ-induced psoriasis model mice and normal human epidermal keratinocytes (NHEKs.SLURP1 expression was up-regulated in the skin of IMQ-induced psoriasis model mice. In NHEKs stimulated with the inflammatory cytokines IL-17, IL-22 and TNF-α, which are reportedly expressed in psoriatic lesions, SLURP1 mRNA expression was significantly up-regulated by IL-22 but not the other two cytokines. The stimulatory effect of IL-22 was completely suppressed in NHEKs treated with a STAT3 inhibitor or transfected with siRNA targeting STAT3. Because IL-22 induces production of antimicrobial proteins in epithelial cells, the antibacterial activity of SLURP1 was assessed against Staphylococcus aureus (S. aureus, which is known to be associated with disease severity in psoriasis. SLURP1 significantly suppressed the growth of S. aureus.These results indicate SLURP1 participates in pathophysiology of psoriasis by regulating keratinocyte proliferation and differentiation, and by suppressing the growth of S. aureus.

  9. Assessment of radiation induced cytogenetic damage in human keratinocytes by comet assay

    International Nuclear Information System (INIS)

    Joseph, Praveen; Sanjeev Ganesh; Narayana, Y.; Puthali, Abhay; Bhat, N.N.

    2010-01-01

    In the present study the effect of gamma radiation on normal human keratinocytes (HaCaT) cells has been analyzed using alkaline comet assay and a comparative study over the sensitivity of different comet parameters such as tail length (TL), olive tail moment (OTM) and percentage tail DNA (TDNA) has also been made. Human keratinocytes (HaCaT) cells were grown in Dulbecco's modified essential medium (DMEM) (10% FCS) at 37 °C in a humidified atmosphere containing 5% CO 2 . Cultured cells were harvested with 0.025 % trypsin EDTA. The sample (2 X 10 cells/ml) was exposed to gamma radiation of different dose using a 60 Co gamma source at dose rate of 2 Gy min -1 and the dosimetry has been carried out using Fricke and FBX dosimeters. After irradiation, to quantify the DNA damage the comet assay (single cell gel electrophoresis) was carried out under alkaline conditions, by the methods outlined by Singh et al. The quantification of the DNA strand breaks in each cells were performed using CASP software. The DNA damage quantification can be accomplished by measuring those comet parameters which exhibit a linear dependence on the amount of DNA damage. In the present study, comet parameters such as OTM, TL and TDNA were recorded and the variation of these parameters and their correlation coefficients for different doses of gamma radiation is plotted. The OTM value is normalized with control value and control for TL and TDNA is adjusted to zero to avoid initial variations in different experiments

  10. Ultraviolet B, melanin and mitochondrial DNA: Photo-damage in human epidermal keratinocytes and melanocytes modulated by alpha-melanocyte-stimulating hormone [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Markus Böhm

    2016-05-01

    Full Text Available Alpha-melanocyte-stimulating hormone (alpha-MSH increases melanogenesis and protects from UV-induced DNA damage. However, its effect on mitochondrial DNA (mtDNA damage is unknown. We have addressed this issue in a pilot study using human epidermal keratinocytes and melanocytes incubated with alpha-MSH and irradiated with UVB. Real-time touchdown PCR was used to quantify total and deleted mtDNA. The deletion detected encompassed the common deletion but was more sensitive to detection. There were 4.4 times more mtDNA copies in keratinocytes than in melanocytes. Irradiation alone did not affect copy numbers. Alpha-MSH slightly increased copy numbers in both cell types in the absence of UVB and caused a similar small decrease in copy number with dose in both cell types. Deleted copies were nearly twice as frequent in keratinocytes as in melanocytes. Alpha-MSH reduced the frequency of deleted copies by half in keratinocytes but not in melanocytes. UVB dose dependently led to an increase in the deleted copy number in alpha-MSH-treated melanocytes. UVB irradiation had little effect on deleted copy number in alpha-MSH-treated keratinocytes. In summary, alpha-MSH enhances mtDNA damage in melanocytes presumably by increased melanogenesis, while α-MSH is protective in keratinocytes, the more so in the absence of irradiation.

  11. Oral epithelial cells are susceptible to cell-free and cell-associated HIV-1 infection in vitro

    International Nuclear Information System (INIS)

    Moore, Jennifer S.; Rahemtulla, Firoz; Kent, Leigh W.; Hall, Stacy D.; Ikizler, Mine R.; Wright, Peter F.; Nguyen, Huan H.; Jackson, Susan

    2003-01-01

    Epithelial cells lining the oral cavity are exposed to HIV-1 through breast-feeding and oral-genital contact. Genital secretions and breast milk of HIV-1-infected subjects contain both cell-free and cell-associated virus. To determine if oral epithelial cells can be infected with HIV-1 we exposed gingival keratinocytes and adenoid epithelial cells to cell-free virus and HIV-1-infected peripheral blood mononuclear cells and monocytes. Using primary isolates we determined that gingival keratinocytes are susceptible to HIV-1 infection via cell-free CD4-independent infection only. R5 but not X4 viral strains were capable of infecting the keratinocytes. Further, infected cells were able to release infectious virus. In addition, primary epithelial cells isolated from adenoids were also susceptible to infection; both cell-free and cell-associated virus infected these cells. These data have potential implications in the transmission of HIV-1 in the oral cavity

  12. How Does Chronic Cigarette Smoke Exposure Affect Human Skin? A Global Proteomics Study in Primary Human Keratinocytes.

    Science.gov (United States)

    Rajagopalan, Pavithra; Nanjappa, Vishalakshi; Raja, Remya; Jain, Ankit P; Mangalaparthi, Kiran K; Sathe, Gajanan J; Babu, Niraj; Patel, Krishna; Cavusoglu, Nükhet; Soeur, Jeremie; Pandey, Akhilesh; Roy, Nita; Breton, Lionel; Chatterjee, Aditi; Misra, Namita; Gowda, Harsha

    2016-11-01

    Cigarette smoking has been associated with multiple negative effects on human skin. Long-term physiological effects of cigarette smoke are through chronic and not acute exposure. Molecular alterations due to chronic exposure to cigarette smoke remain unclear. Primary human skin keratinocytes chronically exposed to cigarette smoke condensate (CSC) showed a decreased wound-healing capacity with an increased expression of NRF2 and MMP9. Using quantitative proteomics, we identified 4728 proteins, of which 105 proteins were overexpressed (≥2-fold) and 41 proteins were downregulated (≤2-fold) in primary skin keratinocytes chronically exposed to CSC. We observed an alteration in the expression of several proteins involved in maintenance of epithelial barrier integrity, including keratin 80 (5.3 fold, p value 2.5 × 10 -7 ), cystatin A (3.6-fold, p value 3.2 × 10 -3 ), and periplakin (2.4-fold, p value 1.2 × 10 -8 ). Increased expression of proteins associated with skin hydration, including caspase 14 (2.2-fold, p value 4.7 × 10 -2 ) and filaggrin (3.6-fold, p value 5.4 × 10 -7 ), was also observed. In addition, we report differential expression of several proteins, including adipogenesis regulatory factor (2.5-fold, p value 1.3 × 10 -3 ) and histone H1.0 (2.5-fold, p value 6.3 × 10 -3 ) that have not been reported earlier. Bioinformatics analyses demonstrated that proteins differentially expressed in response to CSC are largely related to oxidative stress, maintenance of skin integrity, and anti-inflammatory responses. Importantly, treatment with vitamin E, a widely used antioxidant, could partially rescue adverse effects of CSC exposure in primary skin keratinocytes. The utility of antioxidant-based new dermatological formulations in delaying or preventing skin aging and oxidative damages caused by chronic cigarette smoke exposure warrants further clinical investigations and multi-omics research.

  13. Chromium III histidinate exposure modulates antioxidant gene expression in HaCaT human keratinocytes exposed to oxidative stress

    Science.gov (United States)

    While the toxicity of hexavalent chromium is well established, trivalent Cr (Cr(III)) is an essential nutrient involved in insulin and glucose homeostasis. Recently, antioxidant effects of chromium (III) histidinate (Cr(III)His) were reported in HaCaT human keratinocytes exposed to oxidative stress...

  14. Effects of Wannachawee Recipe with Antipsoriatic Activity on Suppressing Inflammatory Cytokine Production in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Mingkwan Na Takuathung

    2017-01-01

    Full Text Available Psoriasis is a chronic inflammatory and immune-mediated skin disease. The pathogenesis involves T cells activation via the IL-23/Th17 axis. Conventional treatments of psoriasis have adverse events influencing patients’ adherence. Wannachawee Recipe (WCR has been effectively used as Thai folk remedy for psoriasis patients; however, preclinical evidence defining how WCR works is still lacking. This study defined mechanisms for its antiproliferation and anti-inflammatory effects in HaCaT cells. The cytotoxicity and antiproliferation results from SRB and CCK-8 assays showed that WCR inhibited the growth and viability of HaCaT cells in a concentration-dependent manner. The distribution of cell cycle phases determined by flow cytometry showed that WCR did not interrupt cell cycle progression. Interestingly, RT-qPCR revealed that WCR significantly decreased the mRNA expression of IL-1β, IL-6, IL-8, IL-17A, IL-22, IL-23, and TNF-α but induced IL-10 expression in TNF-α- and IFN-γ-induced HaCaT cells. At the protein level determined by ELISA, WCR significantly reduced the secretion of IL-17A, IL-22, and IL-23. The WCR at low concentrations was proved to possess anti-inflammatory effect without cytotoxicity and it did not interfere with cell cycle of keratinocytes. This is the first study to provide convincing evidence that WCR is a potential candidate for development of effective psoriasis therapies.

  15. Cobalt Oxide Nanoparticles: Behavior towards Intact and Impaired Human Skin and Keratinocytes Toxicity

    Directory of Open Access Journals (Sweden)

    Marcella Mauro

    2015-07-01

    Full Text Available Skin absorption and toxicity on keratinocytes of cobalt oxide nanoparticles (Co3O4NPs have been investigated. Co3O4NPs are commonly used in industrial products and biomedicine. There is evidence that these nanoparticles can cause membrane damage and genotoxicity in vitro, but no data are available on their skin absorption and cytotoxicity on keratinocytes. Two independent 24 h in vitro experiments were performed using Franz diffusion cells, using intact (experiment 1 and needle-abraded human skin (experiment 2. Co3O4NPs at a concentration of 1000 mg/L in physiological solution were used as donor phase. Cobalt content was evaluated by Inductively Coupled–Mass Spectroscopy. Co permeation through the skin was demonstrated after 24 h only when damaged skin protocol was used (57 ± 38 ng·cm−2, while no significant differences were shown between blank cells (0.92 ± 0.03 ng cm−2 and those with intact skin (1.08 ± 0.20 ng·cm−2. To further investigate Co3O4NPs toxicity, human-derived HaCaT keratinocytes were exposed to Co3O4NPs and cytotoxicity evaluated by MTT, Alamarblue® and propidium iodide (PI uptake assays. The results indicate that a long exposure time (i.e., seven days was necessary to induce a concentration-dependent cell viability reduction (EC50 values: 1.3 × 10−4 M, 95% CL = 0.8–1.9 × 10−4 M, MTT essay; 3.7 × 10−5 M, 95% CI = 2.2–6.1 × 10−5 M, AlamarBlue® assay that seems to be associated to necrotic events (EC50 value: 1.3 × 10−4 M, 95% CL = 0.9–1.9 × 10−4 M, PI assay. This study demonstrated that Co3O4NPs can penetrate only damaged skin and is cytotoxic for HaCat cells after long term exposure.

  16. Dek overexpression in murine epithelia increases overt esophageal squamous cell carcinoma incidence

    Science.gov (United States)

    Cimperman, Katherine A.; Haas, Sarah R.; Guasch, Geraldine; Waclaw, Ronald R.; Komurov, Kakajan; Lane, Adam; Wikenheiser-Brokamp, Kathryn A.

    2018-01-01

    Esophageal cancer occurs as either squamous cell carcinoma (ESCC) or adenocarcinoma. ESCCs comprise almost 90% of cases worldwide, and recur with a less than 15% five-year survival rate despite available treatments. The identification of new ESCC drivers and therapeutic targets is critical for improving outcomes. Here we report that expression of the human DEK oncogene is strongly upregulated in esophageal SCC based on data in the cancer genome atlas (TCGA). DEK is a chromatin-associated protein with important roles in several nuclear processes including gene transcription, epigenetics, and DNA repair. Our previous data have utilized a murine knockout model to demonstrate that Dek expression is required for oral and esophageal SCC growth. Also, DEK overexpression in human keratinocytes, the cell of origin for SCC, was sufficient to cause hyperplasia in 3D organotypic raft cultures that mimic human skin, thus linking high DEK expression in keratinocytes to oncogenic phenotypes. However, the role of DEK over-expression in ESCC development remains unknown in human cells or genetic mouse models. To define the consequences of Dek overexpression in vivo, we generated and validated a tetracycline responsive Dek transgenic mouse model referred to as Bi-L-Dek. Dek overexpression was induced in the basal keratinocytes of stratified squamous epithelium by crossing Bi-L-Dek mice to keratin 5 tetracycline transactivator (K5-tTA) mice. Conditional transgene expression was validated in the resulting Bi-L-Dek_K5-tTA mice and was suppressed with doxycycline treatment in the tetracycline-off system. The mice were subjected to an established HNSCC and esophageal carcinogenesis protocol using the chemical carcinogen 4-nitroquinoline 1-oxide (4NQO). Dek overexpression stimulated gross esophageal tumor development, when compared to doxycycline treated control mice. Furthermore, high Dek expression caused a trend toward esophageal hyperplasia in 4NQO treated mice. Taken together, these

  17. Solar Simulated Ultraviolet Radiation Induces Global Histone Hypoacetylation in Human Keratinocytes.

    Science.gov (United States)

    Zhang, Xiaoru; Kluz, Thomas; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong

    2016-01-01

    Ultraviolet radiation (UVR) from sunlight is the primary effector of skin DNA damage. Chromatin remodeling and histone post-translational modification (PTM) are critical factors in repairing DNA damage and maintaining genomic integrity, however, the dynamic changes of histone marks in response to solar UVR are not well characterized. Here we report global changes in histone PTMs induced by solar simulated UVR (ssUVR). A decrease in lysine acetylation of histones H3 and H4, particularly at positions of H3 lysine 9, lysine 56, H4 lysine 5, and lysine 16, was found in human keratinocytes exposed to ssUVR. These acetylation changes were highly associated with ssUVR in a dose-dependent and time-specific manner. Interestingly, H4K16ac, a mark that is crucial for higher order chromatin structure, exhibited a persistent reduction by ssUVR that was transmitted through multiple cell divisions. In addition, the enzymatic activities of histone acetyltransferases were significantly reduced in irradiated cells, which may account for decreased global acetylation. Moreover, depletion of histone deacetylase SIRT1 in keratinocytes rescued ssUVR-induced H4K16 hypoacetylation. These results indicate that ssUVR affects both HDAC and HAT activities, leading to reduced histone acetylation.

  18. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  19. Interferon-gamma up-regulates a unique set of proteins in human keratinocytes. Molecular cloning and expression of the cDNA encoding the RGD-sequence-containing protein IGUP I-5111

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder

    1993-01-01

    AMP (Bt2cAMP), dibutyryl cGMP (Bt2cGMP)] and compounds known to affect keratinocytes [4 beta-phorbol 12-myristate 13-acetate (PMA), retinoic acid, Ca2+, dexamethasone, lipopolysaccharides, foetal calf serum]. Protein IGUP I-5111 was selected for further studies as its level is affected by simian-virus-40......, which migrated with the AMA variant of keratinocyte protein IEF SSP 5111, is novel although it exhibits weak similarity to cytoskeletal proteins. IGUP I-5111 contains the RGD sequence found in many extracellular glycoprotein ligands of the integrin receptor family and it is found at least partially...... in the culture supernatant. Considering the presence of IFN-gamma in psoriatic plaques as well as its putative involvement in the pathophysiology of the disease it was of interest to determine whether the set of proteins was upregulated in these cells. Two-dimensional gel analysis of the protein phenotype of non-cultured...

  20. Germacrane sesquiterpenes isolated from the rhizome of Curcuma xanthorrhiza Roxb. inhibit UVB-induced upregulation of MMP-1, -2, and -3 expression in human keratinocytes.

    Science.gov (United States)

    Park, Ji-Hae; Mohamed, Mohamed Antar Aziz; Jung, Ye-Jin; Shrestha, Sabina; Lee, Tae Hoon; Lee, Chang-Ho; Han, Daeseok; Kim, Jiyoung; Baek, Nam-In

    2015-10-01

    Four sesquiterpenes were isolated from the rhizome of Curcuma xanthorrhiza Roxb.: furanodiene (1), germacrone (2), furanodienone (3), and 13-hydroxygermacrone (4). Importantly, this was the first time compounds 1 and 4 were isolated from this plant. The chemical structures of these compounds were determined using 1D- and 2D-nuclear magnetic resonance, infrared spectroscopy, and electron ionization mass spectrometry analyses. Among the isolated compounds, compounds 2 and 4 inhibited UVB-induced upregulation of the mRNA and protein expression levels of MMP-1, MMP-2, and MMP-3 in human keratinocytes (HaCaT). Moreover, this upregulation occurred in a dose-dependent manner over the range of 1-10 μM for each compound.