Retrospective study of canine nasal tumor treated with hypofractionated radiotherapy
International Nuclear Information System (INIS)
Maruo, Takuya; Shida, Takuo; Fukuyama, Yasuhiro; Hosaka, Soshi; Noda, Masashi; Ito, Tetsuro; Sugiyama, Hiroki; Ishikawa, Takeshi; Madarame, Hiroo
2011-01-01
The object of this study was to evaluate hypofractionated multiportal field and two-portion (rostral and caudal portions divided by the eyelid) radiation therapy for canine nasal tumors. Sixty-three dogs underwent multiportal hypofractionated radiation therapy. The radiation field was divided into rostral and caudal portions by the eyelid. Treatments were performed four times for 57 dogs. The median irradiation dose/fraction was 8 Gy (range, 5-10 Gy); the median total dose was 32 Gy (10-40 Gy). Improvement of clinical symptoms was achieved in 53 (84.1%) of 63 cases. Median survival time was 197 days (range, 2-1,080 days). Median survival times with and without destruction of the cribriform plate before radiotherapy were 163 and 219 days, respectively. There was no significant difference between them. No other factors were related to survival according to a univariate analysis. All radiation side effects, except one, were grade I according to the VRTOG classification. It was not necessary to treat any dogs for skin side effects. One dog (1.6%) developed an oronasal fistula 1 year after completion of radiation therapy. This radiation protocol may be useful in reducing radiation side effects in dogs with cribriform plate destruction. (author)
CT findings of malignant nasal cavity tumors
International Nuclear Information System (INIS)
Ku, Young Mi; Chun, Kyung Ah; Choi, Kyu Ho; Yu, Won Jong; Kim, Young Joo; Kim, Sung Hoon; Park, Seog Hee; Shinn, Kyung Sub
1997-01-01
To evaluate the CT findings of malignant nasal cavity tumors. Retrospective analysis was performed on 20 patients with pathologically-proven malignant nasal cavity tumors. Using CT, we analysed their location, extent of bone destruction and of involvement of adjacent structures, and enhancing pattern. A total of 20 cases included nine squamous cell carcinomas, three olfactory neuroblastomas, three lymphomas, two polymorphic reticulosis, one adenoid cystic carcinoma, one undifferentiated carcinoma and one metastasis from renal cell carcinoma. All cases except one adenoid cystic carcinoma and one squamous cell carcinoma revealed bone destruction or erosion. Aggressive bone destruction and irregular enhancement were seen in eight cases of squamous cell carcinoma, seven cases of which showed involvement of the adjacent paranasal sinuses, nasopharynx, and orbit. Olfactory neuroblastomas were centered in the superior nasal cavity and the adjacent ethmoid sinus, and erosion or destruction of the cribriform plate had occurred. Lymphomas showed bilateral involvement, with uniform contrast enhancement. Polymorphic reticuloses showed perforation or erosion of the nasal septum, with bilateral involvement of the nasal cavity. The location, presence of bone destruction, involvement of adjacent structures, and enhancement pattern of tumor on CT can be helpful for the differential diagnosis of malignant nasal cavity tumors
Inflammatory Myofibroblastic Tumor of the Nasal Septum
Directory of Open Access Journals (Sweden)
Yuri Okumura
2013-01-01
Full Text Available We report an extremely rare case of inflammatory myofibroblastic tumor of the posterior edge of the nasal septum. An 11-year-old boy presented with frequent epistaxis and nasal obstruction persisting for one year. Based on the clinical presentation and imaging studies, juvenile angiofibroma was suspected, but angiography suggested the possibility of another type of tumor. Transnasal endoscopic surgery found that the tumor protruded into the nasopharynx from the posterior end of the nasal septum. Histological examination identified spindle cells with immunoreaction for vimentin, smooth muscle actin, and anaplastic lymphoma kinase (ALK, but not for desmin and cytokeratin. This is a report of inflammatory myofibroblastic tumor mimicking juvenile angiofibroma. This case suggests that angiography is helpful in the differential diagnosis of epipharyngeal tumor in adolescence.
Methods for Diagnosing Some Malignant Neoplasms of the Canine Nasal Mucosa
Directory of Open Access Journals (Sweden)
Emilia Florica Balint
2016-11-01
Full Text Available Abstract The aim of this study is to highlight the easiest method of investigation (nasal lavage or rhinoscopy depending on the animal condition. 18 dogs were investigated, which presented at the Faculty of Veterinary Medicine Bucharest, with respiratory distress due to obstruction of the nasal cavities. The sampling for cytological diagnosis was done using the two techniques, the nasal lavage and rhinoscopy. It is most useful to try the lavage first, because it is less invasive, and only then, if case of poor cellularity after centrifugation, or in case of a inflammatory process with unfavourable post-treatment evolution, endoscopy will be used. Cytomorphological diagnosis using, after rhinoscopy or nasal lavage, have evidentiated the following forms of nasal cancer: 10 cases out of 18 were epithelial neoplasms of the olfactory mucosa; 6 cases out of 18 were nerve tumors (malignant melanoma, estesiocarcinoma; 2 cases out of 18 were mesenchymal tumors (osteosarcoma, fibrosarcoma. The nasal lavage is a good sampling method but has the disadvantage of sometimes encountering an acute or chronic inflammatory process that can shield the tumor process.
International Nuclear Information System (INIS)
Bradshaw, Tyler J.; Bowen, Stephen R.; Deveau, Michael A.; Kubicek, Lyndsay; White, Pamela; Bentzen, Søren M.; Chappell, Richard J.; Forrest, Lisa J.; Jeraj, Robert
2015-01-01
Purpose: Imaging biomarkers of resistance to radiation therapy can inform and guide treatment management. Most studies have so far focused on assessing a single imaging biomarker. The goal of this study was to explore a number of different molecular imaging biomarkers as surrogates of resistance to radiation therapy. Methods and Materials: Twenty-two canine patients with spontaneous sinonasal tumors were treated with accelerated hypofractionated radiation therapy, receiving either 10 fractions of 4.2 Gy each or 10 fractions of 5.0 Gy each to the gross tumor volume. Patients underwent fluorodeoxyglucose (FDG)-, fluorothymidine (FLT)-, and Cu(II)-diacetyl-bis(N4-methylthiosemicarbazone) (Cu-ATSM)-labeled positron emission tomography/computed tomography (PET/CT) imaging before therapy and FLT and Cu-ATSM PET/CT imaging during therapy. In addition to conventional maximum and mean standardized uptake values (SUV max ; SUV mean ) measurements, imaging metrics providing response and spatiotemporal information were extracted for each patient. Progression-free survival was assessed according to response evaluation criteria in solid tumor. The prognostic value of each imaging biomarker was evaluated using univariable Cox proportional hazards regression. Multivariable analysis was also performed but was restricted to 2 predictor variables due to the limited number of patients. The best bivariable model was selected according to pseudo-R 2 . Results: The following variables were significantly associated with poor clinical outcome following radiation therapy according to univariable analysis: tumor volume (P=.011), midtreatment FLT SUV mean (P=.018), and midtreatment FLT SUV max (P=.006). Large decreases in FLT SUV mean from pretreatment to midtreatment were associated with worse clinical outcome (P=.013). In the bivariable model, the best 2-variable combination for predicting poor outcome was high midtreatment FLT SUV max (P=.022) in combination with large FLT response from
Energy Technology Data Exchange (ETDEWEB)
Bradshaw, Tyler J. [Department of Medical Physics, School of Medicine and Public Health, University of Wisconsin-Madison, Madison, Wisconsin (United States); Bowen, Stephen R. [Departments of Radiation Oncology and Radiology, University of Washington, Seattle, Washington (United States); Deveau, Michael A. [Department of Small Animal Clinical Sciences, Texas A& M University, College Station, Texas (United States); Kubicek, Lyndsay [Angell Animal Medical Center, Boston, Massachusetts (United States); White, Pamela [Department of Surgical Sciences, School of Veterinary Medicine, University of Wisconsin-Madison, Madison, Wisconsin (United States); Bentzen, Søren M. [Division of Biostatistics and Bioinformatics, University of Maryland Greenebaum Cancer Center, and Department of Epidemiology and Public Health, University of Maryland School of Medicine, Baltimore, Maryland (United States); Chappell, Richard J. [Department of Biostatistics and Medical Informatics, School of Medicine and Public Health, University of Wisconsin-Madison, Madison, Wisconsin (United States); Forrest, Lisa J. [Department of Surgical Sciences, School of Veterinary Medicine, University of Wisconsin-Madison, Madison, Wisconsin (United States); Jeraj, Robert, E-mail: rjeraj@wisc.edu [Department of Medical Physics, School of Medicine and Public Health, University of Wisconsin-Madison, Madison, Wisconsin (United States); Department of Human Oncology, School of Medicine and Public Health, University of Wisconsin-Madison, Madison, Wisconsin (United States)
2015-03-15
Purpose: Imaging biomarkers of resistance to radiation therapy can inform and guide treatment management. Most studies have so far focused on assessing a single imaging biomarker. The goal of this study was to explore a number of different molecular imaging biomarkers as surrogates of resistance to radiation therapy. Methods and Materials: Twenty-two canine patients with spontaneous sinonasal tumors were treated with accelerated hypofractionated radiation therapy, receiving either 10 fractions of 4.2 Gy each or 10 fractions of 5.0 Gy each to the gross tumor volume. Patients underwent fluorodeoxyglucose (FDG)-, fluorothymidine (FLT)-, and Cu(II)-diacetyl-bis(N4-methylthiosemicarbazone) (Cu-ATSM)-labeled positron emission tomography/computed tomography (PET/CT) imaging before therapy and FLT and Cu-ATSM PET/CT imaging during therapy. In addition to conventional maximum and mean standardized uptake values (SUV{sub max}; SUV{sub mean}) measurements, imaging metrics providing response and spatiotemporal information were extracted for each patient. Progression-free survival was assessed according to response evaluation criteria in solid tumor. The prognostic value of each imaging biomarker was evaluated using univariable Cox proportional hazards regression. Multivariable analysis was also performed but was restricted to 2 predictor variables due to the limited number of patients. The best bivariable model was selected according to pseudo-R{sup 2}. Results: The following variables were significantly associated with poor clinical outcome following radiation therapy according to univariable analysis: tumor volume (P=.011), midtreatment FLT SUV{sub mean} (P=.018), and midtreatment FLT SUV{sub max} (P=.006). Large decreases in FLT SUV{sub mean} from pretreatment to midtreatment were associated with worse clinical outcome (P=.013). In the bivariable model, the best 2-variable combination for predicting poor outcome was high midtreatment FLT SUV{sub max} (P=.022) in
Directory of Open Access Journals (Sweden)
Julio César Gálvez Chávez
2009-09-01
Full Text Available INTRODUCCIÓN. La recidiva tumoral es una de las complicaciones más temidas de la evolución oncológica, y además de ensombrecer el pronóstico de vida, causa la pérdida de muchas reconstrucciones y agota las posibilidades quirúrgicas restauradoras. Este estudio tuvo el objetivo de determinar la frecuencia de recidivas, la repercusión sobre la reconstrucción y la evolución médica posterior de pacientes operados de tumoraciones nasales malignas. MÉTODOS. Se realizó un estudio descriptivo retrospectivo, con 20 pacientes operados de tumoraciones nasales malignas, con reconstrucción inmediata con colgajo frontal. Los pacientes procedían del Instituto Nacional de Oncología y Radiobiología (INOR, donde fueron atendidos entre el año 2002 y el 2007. RESULTADOS. Hubo recidivas en 5 pacientes (25 % de la muestra y el 80 % de estas eran un carcinoma epidermoide. Todos los pacientes con recidiva perdieron los tejidos reconstruidos y recibieron tratamiento con radioterapia. Solo se pudo reconstruir nuevamente el defecto de uno de los pacientes; dos de los restantes fallecieron y dos continuaban vivos, sin recurrencia del tumor pero sin posibilidades de reconstrucción. CONCLUSIONES. Teniendo en cuenta la frecuencia de recidivas de los carcinomas epidermoides nasales y de su repercusión, cuando no se cuenta con la técnica histográfica de Mhos, se sugiere posponer la reconstrucción nasal hasta tanto no se realice la confirmación histológica de la exéresis completa del tumor.INTRODUCTION: Tumor relapse is one of the more fearsome complications of the oncologic course and also to obscure the life prognosis, causing the loss of many reconstructions and of exhausting the repairing surgical possibilities. The aim of this study was to determine the relapse frequency, the repercussion on the repair and the subsequent medical course of patients operated on malign nasal tumors. METHODS: We made a retrospective and descriptive study in 20 patients
A Rare Tumor of Nasal Cavity: Glomangiopericytoma
Directory of Open Access Journals (Sweden)
Aysegul Verim
2014-01-01
Full Text Available Glomangiopericytoma is a rare vascular neoplasm characterized by a pattern of prominent perivascular growth. A 72-year-old woman was admitted to our clinic complaining of nasal obstruction, frequent epistaxis, and facial pain. A reddish tumor filling the left nasal cavity was observed on endoscopy and treated with endoscopic excision. Microscopically, closely packed cells interspersed with numerous thin-walled, branching staghorn vessels were seen. Glomangiopericytoma is categorized as a borderline low malignancy tumor by WHO classification. Long-term follow-up with systemic examination is necessary due to high risk of recurrence.
Squamous cell carcinoma of the canine nasal cavity and frontal sinus: eight cases
International Nuclear Information System (INIS)
Rogers, K.S.; Walker, M.A.; Helman, R.G.
1996-01-01
Squamous cell carcinoma of the canine nasal cavity and frontal sinus was diagnosed in eight cases between May 1988 and April 1994. The most common presenting complaints were nasal discharge, including epistaxis; sneezing; and facial deformity or exophthalmos. Metastasis was not identified in any case, but bone lysis and invasion into tissues outside the nasal cavity were noted in five cases. Computed tomograms were performed in five cases and were more useful than radiographs in determining the extent of neoplastic involvement. Euthanasia was performed within one week of diagnosis in three cases at the owner's request; one case died at home within one month; and the remaining four cases were euthanized within eight months due to progressive clinical signs. The mean survival time in these eight cases was three months, with a range of zero weeks to eight months
Tumor microvessel density–associated mast cells in canine nodal lymphoma
Mann, Elizabeth; Whittington, Lisa
2014-01-01
Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4) was significantly higher (p < 0.05) than that in the control (0.83 ± 0.3) and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009). Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended. PMID:26770752
Tumor microvessel density–associated mast cells in canine nodal lymphoma
Directory of Open Access Journals (Sweden)
Moges Woldemeskel
2014-11-01
Full Text Available Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4 was significantly higher (p < 0.05 than that in the control (0.83 ± 0.3 and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009. Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended.
Tumor relapse present in oncologic nasal repair
International Nuclear Information System (INIS)
Galvez Chavez, Julio Cesar; Sanchez Wals, Lenia; Monzon Fernandez, Abel Nicolas; Morales Tirado, Roxana
2009-01-01
Tumor relapse is one of the more fearsome complications of the oncologic course and also to obscure the life prognosis, causing the loss of many reconstructions and of exhausting the repairing surgical possibilities. The aim of this study was to determine the relapse frequency, the repercussion on the repair and the subsequent medical course of patients operated on malign nasal tumors
Vulnerability of cultured canine lung tumor cells to NK cell-mediated cytolysis
International Nuclear Information System (INIS)
Haley, P.J.; Kohr, J.M.; Kelly, G.; Muggenburg, B.A.; Guilmette, B.A.
1988-01-01
Five cell lines, designated as canine lung epithelial cell (CLEP), derived from radiation induced canine lung tumors and canine thyroid adeno-carcinoma (CTAC) cells were compared for their susceptibility to NK cell-mediated cytolysis using peripheral blood lymphocytes from normal, healthy Beagle dogs as effector cells. Effector cells and chromium 51 radiolabeled target cells were incubated for 16 h at ratios of 12.5:1, 25:1, 50:1, and 100:1. Increasing cytolysis was observed for all cell lines as the effector-to-target-cell ratios increased from 12.5:1 to 100:1. The percent cytotoxicity was significantly less for all lung tumor cell lines as compared to CTAC at the 100:1 ratio. One lung tumor cell line, CLEP-9, had 85% of the lytic vulnerability of the CTAC cell line and significantly greater susceptibility to NK cell-mediated lysis than all of the other lung tumor cell lines. Susceptibility to NK cell cytolysis did not correlate with in vivo malignant behavior of the original tumor. These data suggest that cultured canine lung tumor cells are susceptible to NK cell cytolytic activity in vitro and that at least one of these cell lines (CLEP-9) is a candidate for substitution of the standard canine NK cell target, CTAC, in NK cell assays. The use of lung tumor cells in NK cell assays may provide greater insight into the control of lung tumors by immune mechanisms. (author)
Altered oxidative stress and carbohydrate metabolism in canine mammary tumors
Directory of Open Access Journals (Sweden)
K. Jayasri
2016-12-01
Full Text Available Aim: Mammary tumors are the most prevalent type of neoplasms in canines. Even though cancer induced metabolic alterations are well established, the clinical data describing the metabolic profiles of animal tumors is not available. Hence, our present investigation was carried out with the aim of studying changes in carbohydrate metabolism along with the level of oxidative stress in canine mammary tumors. Materials and Methods: Fresh mammary tumor tissues along with the adjacent healthy tissues were collected from the college surgical ward. The levels of thiobarbituric acid reactive substances (TBARS, glutathione, protein, hexose, hexokinase, glucose-6-phosphatase, fructose-1, 6-bisphosphatase, and glucose-6-phosphate dehydrogenase (G6PD were analyzed in all the tissues. The results were analyzed statistically. Results: More than two-fold increase in TBARS and three-fold increase in glutathione levels were observed in neoplastic tissues. Hexokinase activity and hexose concentration (175% was found to be increased, whereas glucose-6-phosphatase (33%, fructose-1, 6-bisphosphatase (42%, and G6PD (5 fold activities were reduced in tumor mass compared to control. Conclusion: Finally, it was revealed that lipid peroxidation was increased with differentially altered carbohydrate metabolism in canine mammary tumors.
Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment
Energy Technology Data Exchange (ETDEWEB)
Kim, Jong-Hyuk, E-mail: jhkim@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Robinson, Sally [Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Sharkey, Leslie C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); O' Brien, Timothy D. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Department of Veterinary Population Medicine, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Dickerson, Erin B. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Modiano, Jaime F., E-mail: modiano@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States)
2014-04-15
Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated
Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment
International Nuclear Information System (INIS)
Kim, Jong-Hyuk; Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C.; Robinson, Sally; Sharkey, Leslie C.; O'Brien, Timothy D.; Dickerson, Erin B.; Modiano, Jaime F.
2014-01-01
Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated
Nasal and oral masses in a dog.
Levy, Esther; Mylonakis, Mathios E; Saridomichelakis, Manolis N; Polizopoulou, Zoe S; Psychogios, Vassilios; Koutinas, Alexander F
2006-03-01
A 5-year-old, intact male, stray dog was presented in poor body condition, with pallor, muzzle deformity, multiple oozing fistulas with grass awns, bilateral sanguinopurulent nasal discharge and a fleshy friable mass occupying part of the hard palate. A friable mass occupying both nasal cavities was found on rhinoscopy. The dog had moderate nonregenerative normochromic-microcytic anemia, thrombocytopenia, hyperglobulinemia, and hypoalbuminemia. Cytologic preparations of the nasal and oral masses contained a neoplastic population of round cells with intracytoplasmic and extracellular vacuoles. Leishmania amastigotes also were observed, in the cytoplasm of macrophages and, occasionally, within neoplastic cells. A diagnosis of transmissible venereal tumor and concurrent leishmaniosis was made. Treatment with vincristine and allopurinol resulted in complete resolution of clinical signs and disappearance of the masses. The presence of amastigotes in neoplastic TVT cells may suggest an alternative mode of transmission of canine leishmaniosis where these diseases co-exist.
Expression of monocarboxylate transporter 1 in oral and ocular canine melanocytic tumors.
Shimoyama, Y; Akihara, Y; Kirat, D; Iwano, H; Hirayama, K; Kagawa, Y; Ohmachi, T; Matsuda, K; Okamoto, M; Kadosawa, T; Yokota, H; Taniyama, H
2007-07-01
Solid tumors are composed of a heterogeneous population of cells surviving in various concentrations of oxygen. In a hypoxic environment, tumor cells generally up-regulate glycolysis and, therefore, generate more lactate that must be expelled from the cell through proton transporters to prevent intracellular acidosis. Monocarboxylate transporter 1 (MCT1) is a major proton transporter in mammalian cells that transports monocarboxylates, such as lactate and pyruvate, together with a proton across the plasma membrane. Melanocytic neoplasia occurs frequently in dogs, but the prognosis is highly site-dependent. In this study, 50 oral canine melanomas, which were subdivided into 3 histologic subtypes, and 17 ocular canine melanocytic neoplasms (14 melanocytomas and 3 melanomas) were used to examine and compare MCT1 expression. Immunohistochemistry using a polyclonal chicken anti-rat MCT1 antibody showed that most oral melanoma exhibited cell membrane staining, although there were no significant differences observed among the 3 histologic subtypes. In contrast, the majority of ocular melanocytic tumors were not immunoreactive. Additionally, we documented the presence of a 45-kDa band in cell membrane protein Western blots, and sequencing of a reverse transcriptase polymerase chain reaction band of expected size confirmed its identity as a partial canine MCT1 transcript in 3 oral tumors. Increased MCT1 expression in oral melanomas compared with ocular melanocytic tumors may reflect the very different biology between these tumors in dogs. These results are the first to document canine MCT1 expression in canine tumors and suggest that increased MCT1 expression may provide a potential therapeutic target for oral melanoma.
Directory of Open Access Journals (Sweden)
Naoya Maekawa
Full Text Available Programmed death 1 (PD-1, an immunoinhibitory receptor, and programmed death ligand 1 (PD-L1, its ligand, together induce the "exhausted" status in antigen-specific lymphocytes and are thus involved in the immune evasion of tumor cells. In this study, canine PD-1 and PD-L1 were molecularly characterized, and their potential as therapeutic targets for canine tumors was discussed. The canine PD-1 and PD-L1 genes were conserved among canine breeds. Based on the sequence information obtained, the recombinant canine PD-1 and PD-L1 proteins were constructed; they were confirmed to bind each other. Antibovine PD-L1 monoclonal antibody effectively blocked the binding of recombinant PD-1 with PD-L1-expressing cells in a dose-dependent manner. Canine melanoma, mastocytoma, renal cell carcinoma, and other types of tumors examined expressed PD-L1, whereas some did not. Interestingly, anti-PD-L1 antibody treatment enhanced IFN-γ production from tumor-infiltrating cells. These results showed that the canine PD-1/PD-L1 pathway is also associated with T-cell exhaustion in canine tumors and that its blockade with antibody could be a new therapeutic strategy for canine tumors. Further investigations are needed to confirm the ability of anti-PD-L1 antibody to reactivate canine antitumor immunity in vivo, and its therapeutic potential has to be further discussed.
Malignant tumors of the nasal cavity: computed tomography and magnetic resonance imaging
International Nuclear Information System (INIS)
Souza, Ricardo Pires de; Paes Junior, Ademar Jose de Oliveira; Gonzalez, Fabio Mota; Cordeiro, Flamarion de Barros; Yamashiro, Ilka; Lenh, Carlos Neutzling; Rapoport, Abrao
2004-01-01
The aim of this study is to evaluate the role of computed tomography and magnetic resonance imaging in the characterization of deep tissue extension of malignant tumors of the nasal cavity. Twelve patients diagnosed with malignant tumors of the nasal cavity were retrospectively evaluated at the Departments of Diagnostic Imaging and Head and Neck Surgery of the 'Complexo Hospitalar Heliopolis', Sao Paulo, Brazil, between 1990 and 2000. All cases were confirmed by histopathologic examination. The results were: extension to the maxillary and ethmoid sinuses was identified in six patients, extension to contralateral nasal cavity, orbit and lamina cribosa in five patients, extension to nasal pharynx and masticator space in two patients, extension to cavernous sinus, anterior/middle cranial fossa, pterygomaxillary fossa, inferior/superior orbital fissure, frontal sinus, contralateral ethmoid sinus, contralateral lamina cribosa, hard palate and pterygopalatine fossa in one patient. Conclusion: It is important to precisely assess the local extension and spread of tumor by computed tomography and magnetic resonance imaging in order to plan the approach to treatment, which will influence the prognosis. (author)
Expression and activity of the urokinase plasminogen activator system in canine primary brain tumors
Directory of Open Access Journals (Sweden)
Rossmeisl JH
2017-04-01
Full Text Available John H Rossmeisl,1–3 Kelli Hall-Manning,4 John L Robertson,1,3,5 Jamie N King,1,2 Rafael V Davalos,3,5 Waldemar Debinski,3 Subbiah Elankumaran6,† 1Veterinary and Comparative Neuro-Oncology Laboratory, 2Department of Small Animal Clinical Sciences, 3The Brain Tumor Center of Excellence, Wake Forest Baptist Medical Center Comprehensive Cancer Center, Winston-Salem, NC, 4Virginia Tech Animal Laboratory Services, Virginia-Maryland College of Veterinary Medicine, 5Department of Biomedical Engineering and Mechanics, Virginia Tech-Wake Forest University School of Biomedical Engineering and Sciences, Virginia Tech, 6Department of Biomedical Sciences and Pathobiology, Virginia-Maryland College of Veterinary Medicine, Blacksburg, VA, USA†The authors regret to advise of the passing of Dr Subbiah Elankumaran prior to publicationBackground: The expression of the urokinase plasminogen activator receptor (uPAR, a glycosylphosphatidylinositol-anchored protein family member, and the activity of its ligand, urokinase-type plasminogen activator (uPA, have been associated with the invasive and metastatic potentials of a variety of human brain tumors through their regulation of extracellular matrix degradation. Domesticated dogs develop naturally occurring brain tumors that share many clinical, phenotypic, molecular, and genetic features with their human counterparts, which has prompted the use of the dogs with spontaneous brain tumors as models to expedite the translation of novel brain tumor therapeutics to humans. There is currently little known regarding the role of the uPA system in canine brain tumorigenesis. The objective of this study was to characterize the expression of uPAR and the activity of uPA in canine brain tumors as justification for the development of uPAR-targeted brain tumor therapeutics in dogs.Methods: We investigated the expression of uPAR in 37 primary canine brain tumors using immunohistochemistry, Western blotting, real
Characterization of the nasal and oral microbiota of detection dogs.
Directory of Open Access Journals (Sweden)
Anitha Isaiah
Full Text Available Little is known about physiological factors that affect the sense of olfaction in dogs. The objectives of this study were to describe the canine nasal and oral microbiota in detection dogs. We sought to determine the bacterial composition of the nasal and oral microbiota of a diverse population of detection canines. Nasal and oral swabs were collected from healthy dogs (n = 81 from four locations-Alabama, Georgia, California, and Texas. Nasal and oral swabs were also collected from a second cohort of detection canines belonging to three different detection job categories: explosive detection dogs (SP-E; n = 22, patrol and narcotics detection dogs (P-NDD; n = 15, and vapor wake dogs (VWD-E; n = 9. To understand if the nasal and oral microbiota of detection canines were variable, sample collection was repeated after 7 weeks in a subset of dogs. DNA was extracted from the swabs and used for 454-pyrosequencing of the16S rRNA genes. Nasal samples had a significantly lower diversity than oral samples (P<0.01. Actinobacteria and Proteobacteria were higher in nasal samples, while Bacteroidetes, Firmicutes, Fusobacteria, and Tenericutes were higher in oral samples. Bacterial diversity was not significantly different based on the detection job. No significant difference in beta diversity was observed in the nasal samples based on the detection job. In oral samples, however, ANOSIM suggested a significant difference in bacterial communities based on job category albeit with a small effect size (R = 0.1079, P = 0.02. Analysis of the composition of bacterial communities using LEfSe showed that within the nasal samples, Cardiobacterium and Riemerella were higher in VWD-E dogs, and Sphingobacterium was higher in the P-NDD group. In the oral samples Enterococcus and Capnocytophaga were higher in the P-NDD group. Gemella and Aggregatibacter were higher in S-PE, and Pigmentiphaga, Chryseobacterium, Parabacteroides amongst others were higher within the VWD-E group
Characterization of the nasal and oral microbiota of detection dogs.
Isaiah, Anitha; Hoffmann, Aline Rodrigues; Kelley, Russ; Mundell, Paul; Steiner, Jörg M; Suchodolski, Jan S
2017-01-01
Little is known about physiological factors that affect the sense of olfaction in dogs. The objectives of this study were to describe the canine nasal and oral microbiota in detection dogs. We sought to determine the bacterial composition of the nasal and oral microbiota of a diverse population of detection canines. Nasal and oral swabs were collected from healthy dogs (n = 81) from four locations-Alabama, Georgia, California, and Texas. Nasal and oral swabs were also collected from a second cohort of detection canines belonging to three different detection job categories: explosive detection dogs (SP-E; n = 22), patrol and narcotics detection dogs (P-NDD; n = 15), and vapor wake dogs (VWD-E; n = 9). To understand if the nasal and oral microbiota of detection canines were variable, sample collection was repeated after 7 weeks in a subset of dogs. DNA was extracted from the swabs and used for 454-pyrosequencing of the16S rRNA genes. Nasal samples had a significantly lower diversity than oral samples (P<0.01). Actinobacteria and Proteobacteria were higher in nasal samples, while Bacteroidetes, Firmicutes, Fusobacteria, and Tenericutes were higher in oral samples. Bacterial diversity was not significantly different based on the detection job. No significant difference in beta diversity was observed in the nasal samples based on the detection job. In oral samples, however, ANOSIM suggested a significant difference in bacterial communities based on job category albeit with a small effect size (R = 0.1079, P = 0.02). Analysis of the composition of bacterial communities using LEfSe showed that within the nasal samples, Cardiobacterium and Riemerella were higher in VWD-E dogs, and Sphingobacterium was higher in the P-NDD group. In the oral samples Enterococcus and Capnocytophaga were higher in the P-NDD group. Gemella and Aggregatibacter were higher in S-PE, and Pigmentiphaga, Chryseobacterium, Parabacteroides amongst others were higher within the VWD-E group. Our initial
Oxygenation of spontaneous canine tumors during fractionated radiation therapy
International Nuclear Information System (INIS)
Achermann, R.E.; Ohlerth, S.M.; Bley, C.R.; Inteeworn, N.; Schaerz, M.; Wergin, M.C.; Kaser-Hotz, B.; Gassmann, M.; Roos, M.
2004-01-01
Background and purpose: tumor oxygenation predicts treatment outcome, and reoxygenation is considered important in the efficacy of fractionated radiation therapy. Therefore, the purpose of this study was to document the changes of the oxygenation status in spontaneous canine tumors during fractionated radiation therapy using polarographic needle electrodes. Material and methods: tumor oxygen partial pressure (pO 2 ) measurements were performed with the eppendorf-pO 2 -Histograph. The measurements were done under general anesthesia, and probe tracks were guided with ultrasound. pO 2 was measured before radiation therapy in all dogs. In patients treated with curative intent, measurements were done sequentially up to eight times (total dose: 45-59.5 Gy). Oxygenation status of the palliative patient group was examined before each fraction of radiation therapy up to five times (total dose: 24-30 Gy). Results: 15/26 tumors had a pretreatment median pO 2 ≤ 10 mmHg. The pO 2 values appeared to be quite variable in individual tumors during fractionated radiation therapy. The pO 2 of initially hypoxic tumors (pretreatment median pO 2 ≤ 10 mmHg) remained unchanged during fractionated radiotherapy, whereas in initially normoxic tumors the pO 2 decreased. Conclusion: hypoxia is common in spontaneous canine tumors, as 57.7% of the recorded values were ≥ 10 mmHg. The data of this study showed that initially hypoxic tumors remained hypoxic, whereas normoxic tumors became more hypoxic. (orig.)
Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors
International Nuclear Information System (INIS)
Webster, Joshua D; Kiupel, Matti; Yuzbasiyan-Gurkan, Vilma
2006-01-01
Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs
Immunohistochemical detection of estrogen receptors in canine mammary tumors
Directory of Open Access Journals (Sweden)
Elena Atanaskova Petrov
2016-03-01
Full Text Available Mammary tumors are among the most common neoplasms in intact female dogs.They have a complex morphology, usually affecting middle age and older bitches. Almost 50% of the mammary tumors in dogs are malignant neoplasms. Prognosis is based on several factors: stage, age, tumor size, metastasis, histopathology, ovariectomy status and hormone-receptor activity. Immunohistochemical (IHC measurement has become increasingly an important diagnostic and prognostic parameter, with the development of monoclonal antibodies against nuclear estrogen and progestin receptors. The aim of this study was to detect the presence of ER receptors in malignant canine mammary tumors and to identify their association with the clinical course of the tumor. Mammary tumor samples have been obtained by mastectomy from dogs presented at our clinic. Detailed clinical examination, CBC and basic serum biochemical profile were performed in all patients. Surgery was the only treatment. Histopathological examination and immunohistochemical detection of estrogen α receptors (ERα was performed on 8 formalin-fixed, paraffin-embedded tissue samples, using the PT LINK immunoperoxidase technique. Histopathological examination of the mammary tumor samples (n=11 revealed tubular adenocarcinoma (n=6,54.5% and ductal adenocarcinoma (n=3, 27.3%, one patient with benign adenoma and one with mastitis. Patients with positive ER tumors are alive, without remission, while 3 of the patients that were ER negative died due to lung metastases. According to our results, it can be concluded that the appearance and development of canine mammary tumors is highly connected with ovarian steroid hormones and that immunostaining of the tumors may be used as a good prognostic parameter in these patients.
Directory of Open Access Journals (Sweden)
Ana Gracanin
Full Text Available Pet dogs very frequently develop spontaneous mammary tumors and have been suggested as a good model organism for breast cancer research. In order to obtain an insight into underlying signaling mechanisms during canine mammary tumorigenesis, in this study we assessed the incidence and the mechanism of canonical Wnt activation in a panel of 12 canine mammary tumor cell lines. We show that a subset of canine mammary cell lines exhibit a moderate canonical Wnt activity that is dependent on Wnt ligands, similar to what has been described in human breast cancer cell lines. In addition, three of the tested canine mammary cell lines have a high canonical Wnt activity that is not responsive to inhibitors of Wnt ligand secretion. Tumor cell lines with highly active canonical Wnt signaling often carry mutations in key members of the Wnt signaling cascade. These cell lines, however, carry no mutations in the coding regions of intracellular Wnt pathway components (APC, β-catenin, GSK3β, CK1α and Axin1 and have a functional β-catenin destruction complex. Interestingly, however, the cell lines with high canonical Wnt activity specifically overexpress LEF1 mRNA and the knock-down of LEF1 significantly inhibits TCF-reporter activity. In addition, LEF1 is overexpressed in a subset of canine mammary carcinomas, implicating LEF1 in ligand-independent activation of canonical Wnt signaling in canine mammary tumors. We conclude that canonical Wnt activation may be a frequent event in canine mammary tumors both through Wnt ligand-dependent and novel ligand-independent mechanisms.
La recidiva tumoral en la reconstrucción nasal oncológica
Directory of Open Access Journals (Sweden)
Julio César Gálvez Chávez
Full Text Available INTRODUCCIÓN. La recidiva tumoral es una de las complicaciones más temidas de la evolución oncológica, y además de ensombrecer el pronóstico de vida, causa la pérdida de muchas reconstrucciones y agota las posibilidades quirúrgicas restauradoras. Este estudio tuvo el objetivo de determinar la frecuencia de recidivas, la repercusión sobre la reconstrucción y la evolución médica posterior de pacientes operados de tumoraciones nasales malignas. MÉTODOS. Se realizó un estudio descriptivo retrospectivo, con 20 pacientes operados de tumoraciones nasales malignas, con reconstrucción inmediata con colgajo frontal. Los pacientes procedían del Instituto Nacional de Oncología y Radiobiología (INOR, donde fueron atendidos entre el año 2002 y el 2007. RESULTADOS. Hubo recidivas en 5 pacientes (25 % de la muestra y el 80 % de estas eran un carcinoma epidermoide. Todos los pacientes con recidiva perdieron los tejidos reconstruidos y recibieron tratamiento con radioterapia. Solo se pudo reconstruir nuevamente el defecto de uno de los pacientes; dos de los restantes fallecieron y dos continuaban vivos, sin recurrencia del tumor pero sin posibilidades de reconstrucción. CONCLUSIONES. Teniendo en cuenta la frecuencia de recidivas de los carcinomas epidermoides nasales y de su repercusión, cuando no se cuenta con la técnica histográfica de Mhos, se sugiere posponer la reconstrucción nasal hasta tanto no se realice la confirmación histológica de la exéresis completa del tumor.
Pisamai, Sirinun; Rungsipipat, Anudep; Kalpravidh, Chanin; Suriyaphol, Gunnaporn
2017-08-01
Perturbation of cell adhesion can be essential for tumor cell invasion and metastasis, but the current knowledge on the gene expression of molecules that mediate cell adhesion in canine oral tumors is limited. The present study aimed to investigate changes in the gene expression of cell adhesion molecules (E-cadherin or CDH1, syndecan 1 or SDC1, NECTIN2 and NECTIN4), matrix metalloproteinases (MMPs) and their tissue inhibitors (TIMPs), in canine oral tumors, including benign tumors, oral melanoma (OM) and non-tonsillar oral squamous cell carcinoma (OSCC), by quantitative real-time reverse transcription PCR. When compared with the normal gingival controls, decreased CDH1, SDC1 and NECTIN4 expression levels were observed in OSCC and OM, reflecting a possible role as cell adhesion molecules and tumor suppressors in canine oral cancers in contrast to the upregulation of MMP2 expression. Downregulated MMP7 was specifically revealed in the OM group. In the late-stage OM, the positive correlation of MMP7 and CDH1 expression was noticed as well as that of SDC1 and NECTIN4. Enhanced TIMP1 expression was shown in all tumor groups with prominent expression in the benign tumors and the early-stage OM. MMP14 expression was notable in the early-stage OM. Higher MMP9 and TIMP1 expression was observed in the acanthomatous ameloblastoma. In conclusion, this study revealed that the altered expression of cell adhesion molecules, MMP7 and MMP2 was correlated with clinicopathologic features in canine oral cancers whereas TIMP1 and MMP14 expression was probably associated with early-stage tumors; therefore, these genes might serve as molecular markers for canine oral tumors. Copyright © 2017 Elsevier Ltd. All rights reserved.
Canine parvovirus-like particles, a novel nanomaterial for tumor targeting
Directory of Open Access Journals (Sweden)
Destito Giuseppe
2006-02-01
Full Text Available Abstract Specific targeting of tumor cells is an important goal for the design of nanotherapeutics for the treatment of cancer. Recently, viruses have been explored as nano-containers for specific targeting applications, however these systems typically require modification of the virus surface using chemical or genetic means to achieve tumor-specific delivery. Interestingly, there exists a subset of viruses with natural affinity for receptors on tumor cells that could be exploited for nanotechnology applications. For example, the canine parvovirus (CPV utilizes transferrin receptors (TfRs for binding and cell entry into canine as well as human cells. TfRs are over-expressed by a variety of tumor cells and are widely being investigated for tumor-targeted drug delivery. We explored whether the natural tropism of CPV to TfRs could be harnessed for targeting tumor cells. Towards this goal, CPV virus-like particles (VLPs produced by expression of the CPV-VP2 capsid protein in a baculovirus expression system were examined for attachment of small molecules and delivery to tumor cells. Structural modeling suggested that six lysines per VP2 subunit are presumably addressable for bioconjugation on the CPV capsid exterior. Between 45 and 100 of the possible 360 lysines/particle could be routinely derivatized with dye molecules depending on the conjugation conditions. Dye conjugation also demonstrated that the CPV-VLPs could withstand conditions for chemical modification on lysines. Attachment of fluorescent dyes neither impaired binding to the TfRs nor affected internalization of the 26 nm-sized VLPs into several human tumor cell lines. CPV-VLPs therefore exhibit highly favorable characteristics for development as a novel nanomaterial for tumor targeting.
Obesity, expression of adipocytokines, and macrophage infiltration in canine mammary tumors.
Lim, H Y; Im, K S; Kim, N H; Kim, H W; Shin, J I; Sur, J H
2015-03-01
Obesity influences the development, progression and prognosis of human breast cancer and canine mammary cancer (MC) but the precise underlying mechanism is not well-documented in the fields of either human or veterinary oncology. In the present study, the expression of major adipocytokines, including leptin, adiponectin, and leptin receptor (ObR) in benign (n = 28) and malignant (n = 70) canine mammary tumors was investigated by immunohistochemistry and on the basis of the subject's body condition score (BCS). To evaluate the relationship between obesity and chronic inflammation of the mammary gland, macrophages infiltrating within and around tumoral areas were counted. The mean age of MC development was lower in overweight or obese dogs (9.0 ± 1.8 years) than in lean dogs or optimal bodyweight (10.2 ± 2.9 years), and the evidence of lymphatic invasion of carcinoma cells was found more frequently in overweight or obese group than in lean or optimal groups. Decreased adiponectin expression and increased macrophage numbers in overweight or obese subjects were significantly correlated with factors related to a poor prognosis, such as high histological grade and lymphatic invasion. Leptin expression was correlated with progesterone receptor status, and ObR expression was correlated with estrogen receptor status of MCs, regardless of BCS. Macrophage infiltration within and around the tumor may play an important role in tumor progression and metastasis in obese female dogs and may represent a prognostic factor for canine MCs. Copyright © 2015 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Kim, Jong-Hyuk; Yu, Chi-Ho; Yhee, Ji-Young; Im, Keum-Soon; Kim, Na-Hyun; Sur, Jung-Hyang
2010-01-01
Human seminoma is classified as classical seminoma (SE) and spermatocytic seminoma (SS). Human SE is known to be more malignant and metastasizing more frequently than SS. Tumor angiogenesis is highly related with tumor progression and metastasis, with microvessel density (MVD) being an important parameter of metastatic potential. Canine seminoma is not yet well-established as SE or SS type including correlation with angiogenesis. We classified canine SE and SS, and then compared them to tumor associated vessels. Twenty-three cases of canine seminomas (2 intratubular, 9 diffuse, and 12 intratubular/diffuse seminomas showing both intratubular and diffuse patterns) were classified as SE or SS by immunohistochemistry (IHC) using monoclonal antibody against PLAP and by PAS stain. The histopathological data were then compared to see if there was a correlation with SE or SS. Angiogenesis of seminomas were evaluated by immunohistochemical assay using polyclonal antibody against Von Willebrand factor (vWF) and by calculating the means of MVD, vessels area and perimeters using computerized image analysis. Statistical Package for Social Sciences (SPSS) program was used for various statistical analyses. The numbers of PLAP+/PAS+ canine SEs were 8/23 (34.8%) and PLAP-/PAS- SSs were 15/23 (61.2%). All SE cases (8/8, 100%) were intratubular/diffuse types. SS types included 2 intratubular (2/15, 13.3%), 9 diffuse (9/15, 60%), and 4 intratubular/diffuse (4/15, 26.7%) types. MVD and vascular parameters in SEs were significantly higher than in SSs, showing the highest value in the intratubular/diffuse type. Seminomas observed with neoplastic cells invasion of vessels presented higher perimeter and area values than seminomas without conformed neoplastic cells invasion. In this study, we demonstrated a positive relationship between canine SE and tumor angiogenesis. Furthermore, we also showed that a tumor cells invasion of vessels were a correlated vascular parameter. Although
Directory of Open Access Journals (Sweden)
Kim Jong-Hyuk
2010-05-01
Full Text Available Abstract Background Human seminoma is classified as classical seminoma (SE and spermatocytic seminoma (SS. Human SE is known to be more malignant and metastasizing more frequently than SS. Tumor angiogenesis is highly related with tumor progression and metastasis, with microvessel density (MVD being an important parameter of metastatic potential. Canine seminoma is not yet well-established as SE or SS type including correlation with angiogenesis. We classified canine SE and SS, and then compared them to tumor associated vessels. Methods Twenty-three cases of canine seminomas (2 intratubular, 9 diffuse, and 12 intratubular/diffuse seminomas showing both intratubular and diffuse patterns were classified as SE or SS by immunohistochemistry (IHC using monoclonal antibody against PLAP and by PAS stain. The histopathological data were then compared to see if there was a correlation with SE or SS. Angiogenesis of seminomas were evaluated by immunohistochemical assay using polyclonal antibody against Von Willebrand factor (vWF and by calculating the means of MVD, vessels area and perimeters using computerized image analysis. Statistical Package for Social Sciences (SPSS program was used for various statistical analyses. Results The numbers of PLAP+/PAS+ canine SEs were 8/23 (34.8% and PLAP-/PAS- SSs were 15/23 (61.2%. All SE cases (8/8, 100% were intratubular/diffuse types. SS types included 2 intratubular (2/15, 13.3%, 9 diffuse (9/15, 60%, and 4 intratubular/diffuse (4/15, 26.7% types. MVD and vascular parameters in SEs were significantly higher than in SSs, showing the highest value in the intratubular/diffuse type. Seminomas observed with neoplastic cells invasion of vessels presented higher perimeter and area values than seminomas without conformed neoplastic cells invasion. Conclusion In this study, we demonstrated a positive relationship between canine SE and tumor angiogenesis. Furthermore, we also showed that a tumor cells invasion of vessels
Canine and human gastrointestinal stromal tumors display similar mutations in c-KIT exon 11
International Nuclear Information System (INIS)
Gregory-Bryson, Emmalena; Bartlett, Elizabeth; Kiupel, Matti; Hayes, Schantel; Yuzbasiyan-Gurkan, Vilma
2010-01-01
Gastrointestinal stromal tumors (GISTs) are common mesenchymal neoplasms in the gastrointestinal tract of humans and dogs. Little is known about the pathogenesis of these tumors. This study evaluated the role of c-KIT in canine GISTs; specifically, we investigated activating mutations in exons 8, 9, 11, 13, and 17 of c-KIT and exons 12, 14, and 18 of platelet-derived growth factor receptor, alpha polypeptide (PDGFRA), all of which have been implicated in human GISTs. Seventeen canine GISTs all confirmed to be positive for KIT immunostaining were studied. Exons 8, 9, 11, 13 and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA, were amplified from DNA isolated from formalin-fixed paraffin-embedded samples. Of these seventeen cases, six amplicons of exon 11 of c-KIT showed aberrant bands on gel electrophoresis. Sequencing of these amplicons revealed heterozygous in-frame deletions in six cases. The mutations include two different but overlapping six base pair deletions. Exons 8, 9, 13, and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA had no abnormalities detected by electrophoresis and sequencing did not reveal any mutations, other than synonymous single nucleotide polymorphisms (SNPs) found in exon 11 of c-KIT and exons 12 and 14 of PDGFRA. The deletion mutations detected in canine GISTs are similar to those previously found in the juxtamembrane domain of c-KIT in canine cutaneous mast cell tumors in our laboratory as well as to those reported in human GISTs. Interestingly, none of the other c-KIT or PDGFRA exons showed any abnormalities in our cases. This finding underlines the critical importance of c-KIT in the pathophysiology of canine GISTs. The expression of KIT and the identification of these activating mutations in c-KIT implicate KIT in the pathogenesis of these tumors. Our results indicate that mutations in c-KIT may be of prognostic significance and that targeting KIT may be a rational approach to treatment of these malignant tumors. This study further
Military Working Dogs and Canine Ehrlichiosis (Tropical Canine Pancytopenia) in the Vietnam War
1981-06-05
anemia, dermatitis, edema of the limbs and scrotum, and petechial hemorrhages on the penis (116). Hematologic findings included a leucopenia with...idiopathic hemorrhagic disease, and canine hemorrhagic fever (116). Attempts to identity the cause of tropical canine pancytopenia continued in 1969...Following inoculation with infective blood, signs of acute disease appear within 7-10 days and consfst of fever , serous nasal and ocular discharges
Salient points in reconstruction of nasal skin after tumor ablation with local flaps
Directory of Open Access Journals (Sweden)
Ali Ebrahimi
2016-01-01
Full Text Available Objective: A variety of nasal skin reconstruction methods are available to meet the esthetic patient's needs. In this article, we review some of modifications of these procedures and share our experience in reconstruction of different parts of the nasal skin following skin tumor ablation. Patients and Methods : From January 2010 to January 2014, 171 patients underwent nasal skin reconstruction after excising cancerous lesions of the involved nasal skin. The patient's history, pre- and post-operation photographs, and the surgery data were collected and assessed. Demographic data related to the type of cancer, defect size and location, type of reconstruction were collected. Results: A variety of local flaps were used based on location and defect features. Nearly all flaps healed primarily without postsurgical significant complications. Conclusion: According to the results and the outcomes of the operations, we concluded that a certain flaps are more effective than others in nasal skin reconstruction. Local flap reconstruction of the nose has good esthetic result with low complication rate.
Downregulation of ATM Gene and Protein Expression in Canine Mammary Tumors.
Raposo-Ferreira, T M M; Bueno, R C; Terra, E M; Avante, M L; Tinucci-Costa, M; Carvalho, M; Cassali, G D; Linde, S D; Rogatto, S R; Laufer-Amorim, R
2016-11-01
The ataxia telangiectasia mutated (ATM) gene encodes a protein associated with DNA damage repair and maintenance of genomic integrity. In women, ATM transcript and protein downregulation have been reported in sporadic breast carcinomas, and the absence of ATM protein expression has been associated with poor prognosis. The aim of this study was to evaluate ATM gene and protein expression in canine mammary tumors and their association with clinical outcome. ATM gene and protein expression was evaluated by reverse transcription-quantitative polymerase chain reaction and immunohistochemistry, respectively, in normal mammary gland samples (n = 10), benign mammary tumors (n = 11), nonmetastatic mammary carcinomas (n = 19), and metastatic mammary carcinomas (n = 11). Lower ATM transcript levels were detected in benign mammary tumors and carcinomas compared with normal mammary glands (P = .011). Similarly, lower ATM protein expression was observed in benign tumors (P = .0003), nonmetastatic mammary carcinomas (P ATM gene or protein levels were detected among benign tumors and nonmetastatic and metastatic mammary carcinomas (P > .05). The levels of ATM gene or protein expression were not significantly associated with clinical and pathological features or with survival. Similar to human breast cancer, the data in this study suggest that ATM gene and protein downregulation is involved in canine mammary gland tumorigenesis. © The Author(s) 2016.
Comparative expression pathway analysis of human and canine mammary tumors
Directory of Open Access Journals (Sweden)
Marconato Laura
2009-03-01
Full Text Available Abstract Background Spontaneous tumors in dog have been demonstrated to share many features with their human counterparts, including relevant molecular targets, histological appearance, genetics, biological behavior and response to conventional treatments. Mammary tumors in dog therefore provide an attractive alternative to more classical mouse models, such as transgenics or xenografts, where the tumour is artificially induced. To assess the extent to which dog tumors represent clinically significant human phenotypes, we performed the first genome-wide comparative analysis of transcriptional changes occurring in mammary tumors of the two species, with particular focus on the molecular pathways involved. Results We analyzed human and dog gene expression data derived from both tumor and normal mammary samples. By analyzing the expression levels of about ten thousand dog/human orthologous genes we observed a significant overlap of genes deregulated in the mammary tumor samples, as compared to their normal counterparts. Pathway analysis of gene expression data revealed a great degree of similarity in the perturbation of many cancer-related pathways, including the 'PI3K/AKT', 'KRAS', 'PTEN', 'WNT-beta catenin' and 'MAPK cascade'. Moreover, we show that the transcriptional relationships between different gene signatures observed in human breast cancer are largely maintained in the canine model, suggesting a close interspecies similarity in the network of cancer signalling circuitries. Conclusion Our data confirm and further strengthen the value of the canine mammary cancer model and open up new perspectives for the evaluation of novel cancer therapeutics and the development of prognostic and diagnostic biomarkers to be used in clinical studies.
A review of nasal, paranasal, and skull base tumors invading the orbit
DEFF Research Database (Denmark)
Jørgensen, Morten; Heegaard, Steffen
2018-01-01
of ophthalmological and otorhinolaryngological symptoms, including proptosis, pain, decreased visual acuity, restrictions in motility of the eye, epistaxis, and nasal obstruction. Sarcomas and benign bone and cartilage tumors arise from surrounding structures, whereas carcinomas usually arise from the paranasal...
Altered anatomy in a case with a buccally impacted maxillary canine tooth.
Rusu, M C; Comes, C A; Stanciu, D; Ciuluvică, R C; Motoc, A; Niculescu, M C; Jianu, Adelina Maria
2010-01-01
Bilateral dissections of maxilla were performed in a human adult cadaver head, male, aged 53 years. After the en block removal of the soft tissues in the oral and infraorbital regions, the antero-lateral surface of maxilla was exposed and also the vestibular aspect of the upper alveolar process. An oblique labially impacted right upper canine was evidenced, completely submucosal: its apex was tangent to the maxillary sinus floor, while the superior side of the apical part of the root was in close relation with the floor of the laterally expanded inferior nasal meatus. Superior and adjacent to the neck of that impacted canine a follicular cyst was evidenced and the antral wall presented distally to the apex of the impacted canine a dehiscent area, where the antral mucosa was only covered by an incomplete thin bony lamella. The incisors on that side were present but no resorption was identified at their level. Within the anterior border of the wall separating the maxillary sinus, small, and the inferior nasal meatus, the nerve for that impacted canine was coursing; the nerves for the upper incisors were initially located within the antero-lateral wall of the inferior nasal meatus. Although small, the maxillary sinus presented a supero-medial recess above the enlarged inferior nasal meatus and lateral to the normally-sized middle nasal meatus.
A Role for T-Lymphocytes in Human Breast Cancer and in Canine Mammary Tumors
Directory of Open Access Journals (Sweden)
Maria Isabel Carvalho
2014-01-01
Full Text Available Chronic inflammation in the tumor microenvironment has a prominent role in carcinogenesis and benefits the proliferation and survival of malignant cells, promoting angiogenesis and metastasis. Mammary tumors are frequently infiltrated by a heterogeneous population of immune cells where T-lymphocytes have a great importance. Interestingly, similar inflammatory cell infiltrates, cytokine and chemokine expression in humans and canine mammary tumors were recently described. However, in both species, despite all the scientific evidences that appoint for a significant role of T-lymphocytes, a definitive conclusion concerning the effectiveness of T-cell dependent immune mechanisms has not been achieved yet. In the present review, we describe similarities between human breast cancer and canine mammary tumors regarding tumor T-lymphocyte infiltration, such as relationship of TILs and mammary tumors malignancy, association of ratio CD4+/ CD8+ T-cells with low survival rates, promotion of tumor progression by Th2 cells actions, and association of great amounts of Treg cells with poor prognostic factors. This apparent parallelism together with the fact that dogs develop spontaneous tumors in the context of a natural immune system highlight the dog as a possible useful biological model for studies in human breast cancer immunology.
Construction of a molecular clone of ovine enzootic nasal tumor virus.
Walsh, Scott R; Gerpe, María Carla Rosales; Wootton, Sarah K
2016-12-30
Enzootic nasal tumor virus (ENTV-1) is an ovine betaretrovirus that has been linked to enzootic nasal adenocarcinoma (ENA), a contagious tumor of the ethmoid turbinates of sheep. Transmission experiments performed using virus isolated from cell free nasal tumor homogenates suggest that ENTV-1 is the causative agent of ENA; however, this etiological relationship has not been conclusively proven due to the fact that the virus cannot be propagated in vitro nor is there an infectious molecular clone of the virus. Here we report construction of a molecular clone of ENTV-1 and demonstrate that transfection of this molecular clone into HEK 293T cells produces mature virus particles. Analysis of recombinant virus particles derived from the initial molecular clone revealed a defect in the proteolytic processing of Gag; however, this defect could be corrected by co-expression of the Gag-Pro-Pol polyprotein from the highly related Jaagsiekte sheep retrovirus (JSRV) suggesting that the polyprotein cleavage sites in the ENTV-1 molecular clone were functional. Mutagenesis of the molecular clone to correct amino acid variants identified within the pro gene did not restore proteolytic processing; whereas deletion of one proline residue from a polyproline tract located in variable region 1 (VR1) of the matrix resulted in production of CA protein of the mature (cleaved) size strongly suggesting that normal virion morphogenesis and polyprotein cleavage took place. Finally, electron microscopy revealed the presence of spherical virus particles with an eccentric capsid and an average diameter of about 100 nm. In summary, we have constructed the first molecular clone of ENTV-1 from which mature virus particles can be produced. Future experiments using virus produced from this molecular clone can now be conducted to fulfill Koch's postulates and demonstrate that ENTV-1 is necessary and sufficient to induce ENA in sheep.
Computed tomographic anatomy of the canine nasal passages
International Nuclear Information System (INIS)
Burk, R.L.
1992-01-01
A normal German shepherd dog underwent CT imaging with contiguous 10 mm thick images made of the nasal cavity from the caudal limit of the frontal sinuses to the rostral aspect of the nose. Normal structures were identified. This normal anatomic information will be of use in assessing CT images of dogs suspected of having nasal cavity disease
Primary oral and nasal transmissible venereal tumor in a mix-breed dog
Rezaei, Mahdieh; Azizi, Shahrzad; Shahheidaripour, Shima; Rostami, Sara
2016-01-01
Transmissible venereal tumor (TVT) is a coitally transmitted tumor of dogs with widespread distribution. The present study describes the occurrence of the primary oral and nasal TVT in a 10-year-old, female, mix-breed dog. The case was presented with a history of anorexia, inability to swallow and dyspnea. Clinical examinations revealed the emaciation, muzzle deformity due to the presence of a friable, fleshy, cauliflower-like mass in the oral cavity and submandibular lymphadenopathy. TVT was...
Nasal Chondromesenchymal Hamartoma in a Child
International Nuclear Information System (INIS)
Finitsis, Stefanos; Giavroglou, Constantinos; Potsi, Stamatia; Constantinidis, Ioannis; Mpaltatzidis, Angelos; Rachovitsas, Dimitrios; Tzioufa, Valentini
2009-01-01
Nasal chondromesenchymal hamartoma (NCMH) is a benign tumor that was described in 1998. The occurrence of this lesion in the nasal cavity of infants and children is especially rare, with only 21 cases reported in the international literature. We report a 12-month-old boy with respiratory distress due to nasal obstruction. Computed tomographic scan and magnetic resonance imaging examination demonstrated a soft-tissue mass obstructing the left nasal cavity. Digital subtraction angiography and preoperative superselective embolization with microparticles were also performed. The tumor was completely resected surgically. Histopathology and immunohistochemical analyses of the tumor disclosed a NCMH. The imaging characteristics of the tumor are described and the radiology literature is reviewed.
Molecular imaging using Cu-ATSM and FDG in solid canine tumors
DEFF Research Database (Denmark)
Hansen, Anders Elias
. Identification of hypoxic tumor and intratumoral hypoxic regions therefore hold the potential to serve as a basis for individualized treatment protocols, including image guided radiation therapy. The current PhD project was undertaken to study tumor hypoxia in cancer bearing dogs, with the aims of 1) identifying...... glycolysis and blood perfu- sion. 3) To compare tumor uptake of 64 Cu-ATSM and [ 18 F]fluoro-D-glucose ( 18 FDG) (glycolytic activity) to pimonidazole (immunological hypoxia marker) immunohistochemistry. 4) To investigate 18 FDG PET as a diagnostic modality in canine cancer patients. The thesis contains...
Davies, Benjamin M; Tirr, Erica; Wang, Yi Yuen; Gnanalingham, Kanna K
2017-06-01
Object Endoscopic transsphenoidal surgery is the commonest approach to pituitary tumors. One disadvantage of this approach is the development of early postoperative nasal symptoms. Our aim was to clarify the peak onset of these symptoms and their temporal evolution. Methods The General Nasal Patient Inventory (GNPI) was administered to 56 patients undergoing endoscopic transsphenoidal surgery for pituitary tumors preoperatively and at 1 day, 3 days, 2 weeks, 3 months, and 6 to 12 months postoperatively. Most patients underwent surgery for pituitary adenomas ( N = 49; 88%) and through a uninostril approach ( N = 55; 98%). Total GNPI (0-135) and scores for the 45 individual components were compared. Results GNPI scores peaked at 1 to 3 days postoperatively, with rapid reduction to baseline by 2 weeks and below baseline by 6 to 12 months postsurgery ( p surgery ( p transsphenoidal pituitary surgery is common, but transient, more so in the functioning subgroup. Nasal symptoms improve below baseline by 6 to 12 months, without the need for specific long-term postoperative interventions in the vast majority of patients.
Tumor-promoting phorbol esters effect alkalinization of canine renal proximal tubular cells
International Nuclear Information System (INIS)
Mellas, J.; Hammerman, M.R.
1986-01-01
We have demonstrated the presence of specific receptors for tumor-promoting phorbol esters in the plasma membrane of the canine renal proximal tubular cell. These compounds affect proximal tubular metabolism in vitro. For example, we have shown that they inhibit gluconeogenesis in canine renal proximal tubular segments. Tumor-promoting phorbol esters have been shown to effect alkalinization of non-renal cells, by enhancing Na + -H + exchange across the plasma membrane. To determine whether the actions of tumor-promoting phorbol esters in proximal tubular segments might be mediated by a similar process, we incubated suspensions of segments from dog kidney with these compounds and measured changes in intracellular pH using [ 14 C]-5,5-dimethoxazoladine-2-4-dione (DMO) and flow dialysis. Incubation of segments with phorbol 12,13 dibutyrate, but not inactive phorbol ester, 4 γ phorbol, effected alkalinization of cells within the segments in a concentration-dependent manner. Alkalinization was dependent upon the presence of extracellular [Na + ] > intracellular [Na + ], was prevented by amiloride and was demonstrable in the presence of SITS. Our findings suggest that tumor-promoting esters stimulate the Na + -H + exchanger known to be present in the brush border membrane of the renal proximal tubular cell. It is possible that the stimulation reflects a mechanism by which phorbol esters affect metabolic processes in these cells
Preoperative measurement of canine primary bone tumors, using radiography and bone scintigraphy
International Nuclear Information System (INIS)
Lamb, C.R.; Berg, J.; Bengston, A.E.
1990-01-01
Specimens of 20 canine primary bone tumors (18 osteosarcoma, 2 fibrosarcoma) were examined to compare the maximal axial length of gross tumor with the length of the lesion seen on preoperative radiographs and 99mTc methylene diphosphonate bone scintigraphic images. Radiographs defined the length of the tumor to within +/- 10% of the gross measurement for 6 (30%), underestimated it for 12 (60%), and overestimated it for 2 (10%) specimens. Bone scintigraphy defined tumor length within +/- 10% for 8 (40%), underestimated it for 1 (5%), and overestimated it for the remaining 11 (55%) specimens. Use of radiographic evaluation alone could result in underestimation of the diaphyseal extent of a primary bone tumor, with risk of incomplete resection. Bone scan images tend to overestimate tumor length and, therefore, may provide safer resection guidelines
Directory of Open Access Journals (Sweden)
Milcah C. Scott
2016-12-01
Full Text Available Osteosarcoma (OS is a heterogeneous and rare disease with a disproportionate impact because it mainly affects children and adolescents. Lamentably, more than half of patients with OS succumb to metastatic disease. Clarification of the etiology of the disease, development of better strategies to manage progression, and methods to guide personalized treatments are among the unmet health needs for OS patients. Progress in managing the disease has been hindered by the extreme heterogeneity of OS; thus, better models that accurately recapitulate the natural heterogeneity of the disease are needed. For this study, we used cell lines derived from two spontaneous canine OS tumors with distinctly different biological behavior (OS-1 and OS-2 for heterotypic in vivo modeling that recapitulates the heterogeneous biology and behavior of this disease. Both cell lines demonstrated stability of the transcriptome when grown as orthotopic xenografts in athymic nude mice. Consistent with the behavior of the original tumors, OS-2 xenografts grew more rapidly at the primary site and had greater propensity to disseminate to lung and establish microscopic metastasis. Moreover, OS-2 promoted formation of a different tumor-associated stromal environment than OS-1 xenografts. OS-2-derived tumors comprised a larger percentage of the xenograft tumors than OS-1-derived tumors. In addition, a robust pro-inflammatory population dominated the stromal cell infiltrates in OS-2 xenografts, whereas a mesenchymal population with a gene signature reflecting myogenic signaling dominated those in the OS-1 xenografts. Our studies show that canine OS cell lines maintain intrinsic features of the tumors from which they were derived and recapitulate the heterogeneous biology and behavior of bone cancer in mouse models. This system provides a resource to understand essential interactions between tumor cells and the stromal environment that drive the progression and metastatic propensity of
Scott, Milcah C; Tomiyasu, Hirotaka; Garbe, John R; Cornax, Ingrid; Amaya, Clarissa; O'Sullivan, M Gerard; Subramanian, Subbaya; Bryan, Brad A; Modiano, Jaime F
2016-12-01
Osteosarcoma (OS) is a heterogeneous and rare disease with a disproportionate impact because it mainly affects children and adolescents. Lamentably, more than half of patients with OS succumb to metastatic disease. Clarification of the etiology of the disease, development of better strategies to manage progression, and methods to guide personalized treatments are among the unmet health needs for OS patients. Progress in managing the disease has been hindered by the extreme heterogeneity of OS; thus, better models that accurately recapitulate the natural heterogeneity of the disease are needed. For this study, we used cell lines derived from two spontaneous canine OS tumors with distinctly different biological behavior (OS-1 and OS-2) for heterotypic in vivo modeling that recapitulates the heterogeneous biology and behavior of this disease. Both cell lines demonstrated stability of the transcriptome when grown as orthotopic xenografts in athymic nude mice. Consistent with the behavior of the original tumors, OS-2 xenografts grew more rapidly at the primary site and had greater propensity to disseminate to lung and establish microscopic metastasis. Moreover, OS-2 promoted formation of a different tumor-associated stromal environment than OS-1 xenografts. OS-2-derived tumors comprised a larger percentage of the xenograft tumors than OS-1-derived tumors. In addition, a robust pro-inflammatory population dominated the stromal cell infiltrates in OS-2 xenografts, whereas a mesenchymal population with a gene signature reflecting myogenic signaling dominated those in the OS-1 xenografts. Our studies show that canine OS cell lines maintain intrinsic features of the tumors from which they were derived and recapitulate the heterogeneous biology and behavior of bone cancer in mouse models. This system provides a resource to understand essential interactions between tumor cells and the stromal environment that drive the progression and metastatic propensity of OS. © 2016
Directory of Open Access Journals (Sweden)
Y Doustar
2010-11-01
Full Text Available The canine transmissible veneral tumor (CTVT is a prevalent tumor in canidae. It is transmitted by coitus, forming multiple neoplastic masses on the external genitalia of both sexes within the family canidae. CTVT have an aberrant karyotype and the origin of the neoplastic cells is undetermined but immunophenotyping suggests that the tumor has a histocytic origin. In this study 10 dogs with canine transmissible veneral tumor were selected and received vincristine sulphate (0.025 mg/kg/b.w chemotrapy to induce apoptosis in neoplastic cells. Biopsy specimens were collected from tumors during the growth phase, before and again after chemotherapy from the same dogs. The specimens were fixed in 10% formalin and then prepared routinely for H&E and TUNEL assays. Histopathological study of tissue section of CTVT before chemotherapy revealed sheets of uniform neoplastic cells, round to oval in shape with defined cytoplasmic border. There were a few TUNEL positive cells and mitotic figures. In tumor specimens after chemotherapy increased TUNEL positive cells and depilation of neoplastic cells in stroma of tumor were observed. Mean deference of histopathological changes and TUNEL positive cells before and after chemotherapy were significant (p
Expression of the tumor suppressor genes NF2, 4.1B, and TSLC1 in canine meningiomas.
Dickinson, P J; Surace, E I; Cambell, M; Higgins, R J; Leutenegger, C M; Bollen, A W; LeCouteur, R A; Gutmann, D H
2009-09-01
Meningiomas are common primary brain tumors in dogs; however, little is known about the molecular genetic mechanisms involved in their tumorigenesis. Several tumor suppressor genes have been implicated in meningioma pathogenesis in humans, including the neurofibromatosis 2 (NF2), protein 4.1B (4.1 B), and tumor suppressor in lung cancer-1 (TSLC1) genes. We investigated the expression of these tumor suppressor genes in a series of spontaneous canine meningiomas using quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) (NF2; n = 25) and western blotting (NF2/merlin, 4.1B, TSLC1; n = 30). Decreased expression of 4.1B and TSLC1 expression on western blotting was seen in 6/30 (20%) and in 15/30 (50%) tumors, respectively, with 18/30 (60%) of meningiomas having decreased or absent expression of one or both proteins. NF2 gene expression assessed by western blotting and RT-PCR varied considerably between individual tumors. Complete loss of NF2 protein on western blotting was not seen, unlike 4.1B and TSLC1. Incidence of TSLC1 abnormalities was similar to that seen in human meningiomas, while perturbation of NF2 and 4.1B appeared to be less common than reported for human tumors. No association was observed between tumor grade, subtype, or location and tumor suppressor gene expression based on western blot or RT-PCR. These results suggest that loss of these tumor suppressor genes is a frequent occurrence in canine meningiomas and may be an early event in tumorigenesis in some cases. In addition, it is likely that other, as yet unidentified, genes play an important role in canine meningioma formation and growth.
Walewska, Magdalena; Dolka, Izabella; Małek, Anna; Wojtalewicz, Anna; Wojtkowska, Agata; Żbikowski, Artur; Lechowski, Roman; Zabielska-Koczywąs, Katarzyna
2017-05-12
The chick embryo chorioallantoic membrane (CAM) model is extensively used in human medicine in preclinical oncological studies. The CAM model has several advantages: low cost, simple experimental approach, time saving and following "3R principles". Research has shown that the human osteosarcoma cell lines U2OS, MMNG-HOS, and SAOS can form tumors on the CAM. In veterinary medicine, this has been described only for feline fibrosarcomas, feline mammary carcinomas and canine osteosarcomas. However, in case of canine osteosarcomas, it has been shown that only non-adherent osteosarcoma stem cells isolated from KTOSA5 and CSKOS cell lines have the ability to form microtumors on the CAM after an incubation period of 5 days, in contrast to adherent KTOSA5 and CSKOS cells. In the presented study, we have proven that the commercial adherent canine osteosarcoma cell line (D-17) can form vascularized tumors on the CAM after the incubation period of 10 days.
Morphological study of maxillary canine region based on CT
International Nuclear Information System (INIS)
Yamada, Maiko; Takamori, Hitoshi; Ide, Yoshiaki; Yosue, Takashi
2010-01-01
The maxilla is generally known as a site where anatomical limitations make it difficult to obtain sufficient bone volume. A large amount of bone exists in the canine region between the anterior margin of the maxillary sinus and the piriform aperture margin. Although this region is crucial for implant treatments, there have not been any reports on morphological studies of the region. In this study, we investigated the morphology of the canine region based on CT, and also the morphology and position of the maxillary sinus located posterior to the canine region. The results were as follows: In the area above the anterior nasal spine, the higher the level, the smaller the mesio-distal length and the bucco-lingual width tended to become. In the area above the anterior nasal spine, the mesio-distal length and the bucco-lingual width tended to be smaller in female patients than in male patients. In the area above the anterior nasal spine, no significant differences in mesio-distal length and bucco-lingual width were observed between dentulous and edentulous jaws. The morphology of the maxillary sinus was mainly of an inverse-trapezoidal, circular, or triangular form. The position of the anterior wall of the maxillary sinus was most frequently found at the site corresponding to the second premolar. Through this study, we have reconfirmed that the canine region is vital for implant treatments in the maxilla. (author)
Chondrosarcoma of the nasal septum
International Nuclear Information System (INIS)
Yamamoto, Seiji; Motoori, Ken; Ueda, Takuya; Osaka, Iwao; Takano, Hideyuki; Nagata, Hiroshi
2002-01-01
The nasal septum is a particularly rare site of origin of chondrosarcoma. Cranial base invasion may be at hand, with such lesions making complete tumor removal difficult. MRI techniques allow precise definition of tumor extent. In the described case, CT and Dynamic MR imaging were performed in a case of chondrosarcoma of the nasal septum. Imaging clearly illustrated size and extent of the mass with central regions of internal calcification. Dynamic MRI was additionally performed, which helped to define the presumed origin of the lesion from the nasal septum. (orig.)
Cell proliferation markers in the transplanted canine transmissible venereal tumor
Directory of Open Access Journals (Sweden)
F.G.A. Santos
2011-12-01
Full Text Available Adult male mongrel dogs were subcutaneously transplanted with the canine transmissible venereal tumor (TVT on the hypogastric region. Twelve specimens of tumors were collected, half during the proliferative phase and the other half during the regressive phase. Fragments of the tumor were fixed in 10% buffered formalin and routinely processed for light microscopy. Sections of 4µm were stained by Schorr or AgNOR or either immunostained for MIB1 (Ki67. Schorr stain, AgNOR and MIB1 showed an increased proliferative activity through mitotic index, nuclear argyrophilic protein stain and cycling tumoral cells in the growing tumors, respectively. All of the three cell proliferation markers were able to distinguish the TVT in both evolution phases. MIB1 monoclonal antibody was the best in the morphologic evaluation of growth and regression of TVT. This resulted in higher values than AgNORs counting and mitotic index. MIB1 immunostaining was the most effective parameter of the proliferative activity of TVT. However, a significant correlation has been detected only between mitosis counting and AgNORs.
Wang, Yi Yuen; Srirathan, Vinothan; Tirr, Erica; Kearney, Tara; Gnanalingham, Kanna K
2011-04-01
The endoscopic approach for pituitary tumors is a recent innovation and is said to reduce the nasal trauma associated with transnasal transsphenoidal surgery. The authors assessed the temporal changes in the rhinological symptoms following endoscopic transsphenoidal surgery for pituitary lesions, using the General Nasal Patient Inventory (GNPI). The GNPI was administered to 88 consecutive patients undergoing endoscopic transsphenoidal surgery at 3 time points (presurgery, 3-6 months postsurgery, and at final follow-up). The total GNPI score and the scores for the individual GNPI questions were calculated and differences between groups were assessed once before surgery, several months after surgery, and at final follow-up. Of a maximum possible score of 135, the mean GNPI score at 3-6 months postsurgery was only 12.9 ± 12 and was not significantly different from the preoperative score (10.4 ± 13) or final follow-up score (10.3 ± 10). Patients with functioning tumors had higher GNPI scores than those with nonfunctioning tumors for each of these time points (p surgery, with partial recovery (nasal sores and bleeding) or complete recovery (nasal blockage, painful sinuses, and unpleasant nasal smell) by final follow-up (p transsphenoidal surgery is a well-tolerated minimally invasive procedure for pituitary fossa lesions. Overall patient-assessed nasal symptoms do not change, but some individual symptoms may show a mild worsening or overall improvement.
Nasal Lobular Capillary Hemangioma
Directory of Open Access Journals (Sweden)
Prashant Patil
2013-01-01
Full Text Available Nasal lobular capillary hemangioma is a rare benign tumor of the paranasal sinuses. This lesion is believed to grow rapidly in size over time. The exact etiopathogenesis is still a dilemma. We discuss a case of nasal lobular capillary hemangioma presenting with a history of epistaxis. Contrast enhanced computed tomography of paranasal sinuses revealed an intensely enhancing soft-tissue mass in the left nasal cavity and left middle and inferior meati with no obvious bony remodeling or destruction. We present imaging and pathologic features of nasal lobular capillary hemangioma and differentiate it from other entities like nasal angiofibroma.
Directory of Open Access Journals (Sweden)
Mauren P. Rocha
2004-06-01
Full Text Available As neoplasias nasais são bastante raras. Os tumores mais observados na cavidade nasal são papilomas epiteliais, angiomas, carcinoma de células transicionais, carcinoma pavimentoso e adenocarcinoma. O adenoma pleomórfico pertence ao grupo de tumores que aparecem com menor freqüência na fossa nasal, e é o tumor benigno glandular mais comum originado na cabeça e pescoço. A apresentação clínica típica dos pacientes com adenoma pleomórfico do septo nasal é de obstrução nasal unilateral, epistaxe e massa indolor na cavidade nasal. Em vista da raridade da apresentação clínica do adenoma pleomórfico nesta localização, os autores descrevem um caso de adenoma pleomórfico nasal em um paciente do sexo masculino, com 69 anos de idade, onde relatam os achados clínicos, critérios diagnósticos, tratamento, prognóstico e revisão da literatura.Nasal tumours are very rare. The neoplasms most frequently seen in the nasal cavity are epithelial papillomas, angiomas, transitional cells carcinoma, pavement carcinoma and adenocarcinoma. The pleomorphic adenoma belongs to the group of tumours less commonly observed in the nasal cavity, and is the most common head and neck benign glandular tumour. The typical clinical presentation of the nasal pleomorphic adenoma is of unilateral nasal obstruction, epistaxis and a painless mass in the nasal cavity. The authors reported an adenoma pleomorphic case that highlights itself by its unusual nasal presentation in the nasal septum of a 45-year-old male patient who was submitted to surgical treatment, and discuss the clinical findings, diagnostic criteria, treatment, prognosis and literature review.
Directory of Open Access Journals (Sweden)
Ozgur Surmelioglu
2011-02-01
Full Text Available Nasal gliomas are rare, benign, congenital tumors that are thought to be result of abnormality in embryonic development. Three types of clinical presentations have been recognized; extranasal, intranasal and combined. Clinically, these masses are non-pulsatile, gray or purple lesions that obstruct the nasal cavity and cause deformity extranasaly. Histologically, they are made up of astrocytic cells, fibrous and vascular connective tissue that is covered with nasal respiratory mucosa. Treatment of the nasal glioma requires a multidisciplinary approach including an radiologist, neurosurgeon and otorhinolaryngologist. Radiological investigation should be performed to describe intracranial extension. In this case, a 2 years old boy with nasal mass that was diagnosed as nasal glioma is reported. . [Cukurova Med J 2011; 36(1.000: 34-36
Directory of Open Access Journals (Sweden)
Ozgur Surmelioglu
2011-03-01
Full Text Available Nasal gliomas are rare, benign, congenital tumors that are thought to be result of abnormality in embryonic development. Three types of clinical presentations have been recognized; extranasal, intranasal and combined. Clinically, these masses are non-pulsatile, gray or purple lesions that obstruct the nasal cavity and cause deformity extranasaly. Histologically, they are made up of astrocytic cells, fibrous and vascular connective tissue that is covered with nasal respiratory mucosa. Treatment of the nasal glioma requires a multidisciplinary approach including an radiologist, neurosurgeon and otorhinolaryngologist. Radiological investigation should be performed to describe intracranial extension. In this case, a 2 years old boy with nasal mass that was diagnosed as nasal glioma is reported. . [Cukurova Med J 2011; 36(1: 34-36
International Nuclear Information System (INIS)
Sun Zhichao; Dong Weihua; Xiao Xiangsheng; Zhu Ruimin; Chen mofan; Wang Zhi
2010-01-01
Objective: To establish an allogeneic transplanted lung cancer model in canine by percutaneously injecting canine transmissible venereal tumor (CTVT) cell suspension and to observe its biological characteristics. Methods: Under CT guidance fresh CTVT cell suspension was inoculated into the middle or posterior lobe of lungs through percutaneous puncturing needle in 12 beagle dogs. Cyclosporin was administrated orally to obtain immunosuppression. Tumor growth and metastasis were judged by chest CT scanning at regular intervals (every 1-2 weeks). The daily mental and physical condition of the dogs was observed. Autopsy and pathological examination were performed when the animals died naturally or at the tenth week after the procedure when the animals were sacrificed. Results: A total of 15 sites were inoculated in 12 dogs. The formation of tumor was observed in 2 dogs at the fifth week and in 9 dogs at the sixth week. Ten weeks after the inoculation the formation of tumor was detected in 10 inoculated points in 9 dogs, the inoculation success rate was 66.67%. The mean largest diameter of the tumor at 6, 8 and 10 weeks after the inoculation was (1.059 ± 0.113)cm, (1.827 ± 0.084)cm and (2.189 ± 0.153)cm, respectively. The largest diameter of the tumor nodule was 3.5 cm. Moderate to severe pleural effusion and mediastinal lymph nodes metastasis were found in all the dogs that showed the formation of the tumor. Conclusion: Percutaneous CTVT cell suspension injection can establish an allogeneic canine lung cancer model, which is helpful for the experimental studies related to lung cancer. (authors)
Bertram, Christof A; Gurtner, Corinne; Dettwiler, Martina; Kershaw, Olivia; Dietert, Kristina; Pieper, Laura; Pischon, Hannah; Gruber, Achim D; Klopfleisch, Robert
2018-07-01
Integration of new technologies, such as digital microscopy, into a highly standardized laboratory routine requires the validation of its performance in terms of reliability, specificity, and sensitivity. However, a validation study of digital microscopy is currently lacking in veterinary pathology. The aim of the current study was to validate the usability of digital microscopy in terms of diagnostic accuracy, speed, and confidence for diagnosing and differentiating common canine cutaneous tumor types and to compare it to classical light microscopy. Therefore, 80 histologic sections including 17 different skin tumor types were examined twice as glass slides and twice as digital whole-slide images by 6 pathologists with different levels of experience at 4 time points. Comparison of both methods found digital microscopy to be noninferior for differentiating individual tumor types within the category epithelial and mesenchymal tumors, but diagnostic concordance was slightly lower for differentiating individual round cell tumor types by digital microscopy. In addition, digital microscopy was associated with significantly shorter diagnostic time, but diagnostic confidence was lower and technical quality was considered inferior for whole-slide images compared with glass slides. Of note, diagnostic performance for whole-slide images scanned at 200× magnification was noninferior in diagnostic performance for slides scanned at 400×. In conclusion, digital microscopy differs only minimally from light microscopy in few aspects of diagnostic performance and overall appears adequate for the diagnosis of individual canine cutaneous tumors with minor limitations for differentiating individual round cell tumor types and grading of mast cell tumors.
ANATOMIC PATHOLOGICAL ASPECTS OF CANINE TRANSMISSIBLE VENEREAL TUMOR
Directory of Open Access Journals (Sweden)
C. Calderon
2016-09-01
Full Text Available Canine transmissible venereal tumor, TVT, is a very common aggressive neoplasm, and the most affected animals are dogs, and other canids may also be affected. There are many forms of transmission, and this naturally occurs between the carriers, sexual intercourse is considered a major route of transmission, it is usually found in urban areas with an environment with a large population of free-roaming dogs and affect dogs and bitches. The TVT can clinically appear macroscopic form with lumps of various sizes, ulcerated, necrotic or not, and its development is usually in the genitals with associated secondary problems, such as urinary retention and others. The tumor diagnosis, in addition to anamnesis should be associated with the cytological or histological analysis. Several techniques are used to collect samples for analysis in microscopy, where the best technique to be used in the diagnosis of TVT is the aspiration cytology. The chemotherapy is considered the most effective method for TVT treatment, and vincristine sulfate is the drug of choice
Erdélyi, Ildikó
2006-01-01
The extracellular matrix (ECM) research has become fundamental to understand cancer. This thesis focuses on the exploration of ECM composition and organization in canine mammary tumors, with a special interest in the large chondroitin-sulfate proteoglycan (PG), versican. Chapter 1 gives an
Directory of Open Access Journals (Sweden)
Debora A.P.C. Zuccari
2009-02-01
Full Text Available The serpin maspin, a tumor suppressor in breast cancer was described as an inhibitor of cell migration and inducer of cell adhesion between the basement membrane and extracellular matrix resulting in inhibition of tumor metastasis. In contrast, overexpression of maspin is correlated with poor prognosis in other types of cancer. Little is known about expression, regulation and function of maspin in canine mammary tumors. It was demonstrated in this study, a loss of maspin expression in malignant canine mammary cells compared with a pool of normal canine mammary tissue, analyzed by quantitative real-time PCR; weak maspin expression in malignant canine mammary tumors were observed by immunohistochemistry. It was also demonstrated that a correlation with nuclear maspin expression and a good prognosis. It is suggested that maspin could be used as a prognostic marker in canine mammary neoplasia.O serpin maspin, um supressor tumoral no câncer de mama foi descrito como inibidor de migração celular e indutor de adesão celular entre a membrana basal e a matriz extracelular resultando na inibição da metástase tumoral. Por outro lado, a alta expressão do maspin está relacionada com um mau prognóstico em outros tipos de câncer. Pouco se sabe sobre a expressão, regulação e função do maspin nos tumores mamários caninos. Neste estudo, foi demonstrada uma perda da expressão de maspin nas células mamárias malignas de cães quando comparadas com um pool de tecido mamário normal de cães, analisado por PCR quantitativa em tempo real. Houve uma expressão fraca maspin em preparações de tumores mamários malignos observadas por imuno-histoquímica. Também foi verificado que a expressão nuclear do maspin em tumores mamários caninos está relacionada a um bom prognóstico. Assim, o maspin pode ser utilizado como um marcador prognóstico nas neoplasias mamárias em cães.
Dailey, Deanna D; Anfinsen, Kristin P; Pfaff, Liza E; Ehrhart, E J; Charles, J Brad; Bønsdorff, Tina B; Thamm, Douglas H; Powers, Barbara E; Jonasdottir, Thora J; Duval, Dawn L
2013-07-01
Hairy and enhancer of split 1 (HES1), a basic helix-loop-helix transcriptional repressor, is a downstream target of Notch signaling. Notch signaling and HES1 expression have been linked to growth and survival in a variety of human cancer types and have been associated with increased metastasis and invasiveness in human osteosarcoma cell lines. Osteosarcoma (OSA) is an aggressive cancer demonstrating both high metastatic rate and chemotherapeutic resistance. The current study examined expression of Notch signaling mediators in primary canine OSA tumors and canine and human osteosarcoma cell lines to assess their role in OSA development and progression. Reverse transcriptase - quantitative PCR (RT-qPCR) was utilized to quantify HES1, HEY1, NOTCH1 and NOTCH2 gene expression in matched tumor and normal metaphyseal bone samples taken from dogs treated for appendicular OSA at the Colorado State University Veterinary Teaching Hospital. Gene expression was also assessed in tumors from dogs with a disease free interval (DFI) of 300 days following treatment with surgical amputation followed by standard chemotherapy. Immunohistochemistry was performed to confirm expression of HES1. Data from RT-qPCR and immunohistochemical (IHC) experiments were analyzed using REST2009 software and survival analysis based on IHC expression employed the Kaplan-Meier method and log rank analysis. Unbiased clustered images were generated from gene array analysis data for Notch/HES1 associated genes. Gene array analysis of Notch/HES1 associated genes suggested alterations in the Notch signaling pathway may contribute to the development of canine OSA. HES1 mRNA expression was elevated in tumor samples relative to normal bone, but decreased in tumor samples from dogs with a DFI 300 days. NOTCH2 and HEY1 mRNA expression was also elevated in tumors relative to normal bone, but was not differentially expressed between the DFI tumor groups. Survival analysis confirmed an association between
Primary oral and nasal transmissible venereal tumor in a mix-breed dog
Directory of Open Access Journals (Sweden)
Mahdieh Rezaei
2016-05-01
Full Text Available Transmissible venereal tumor (TVT is a coitally transmitted tumor of dogs with widespread distribution. The present study describes the occurrence of the primary oral and nasal TVT in a 10-year-old, female, mix-breed dog. The case was presented with a history of anorexia, inability to swallow and dyspnea. Clinical examinations revealed the emaciation, muzzle deformity due to the presence of a friable, fleshy, cauliflower-like mass in the oral cavity and submandibular lymphadenopathy. TVT was diagnosed based on histopathological findings. The dog was discharged with therapeutic intervention with vincristine. Unfortunately, the case died before readmission because of the progressive worsening of the general condition. Our findings highlight the need for considering TVT for the differential diagnosis of the extragenital masses in dogs.
Directory of Open Access Journals (Sweden)
Misato Ueda, MD
2017-09-01
Full Text Available Nasal polyps are inflammatory proliferative tumors arising from the mucosa of the nasal cavity and paranasal sinuses. Although many cases concerning nasal polyps have been reported, those involving external nasal deformities are rare. We report a case of nasal polyposis filling the nasal cavity and paranasal sinuses, leading to external nasal and facial deformities. The condition above is known as Woakes’ syndrome, which is characterized by severe recurrent nasal polyps with deformity of the nasal pyramid, leading to broadening of the nose. We performed nasal osteotomy and facial bone-shaving via the midface degloving approach, which improved the patient’s facial appearance.
Nasal non-hodgkin's lymphoma : CT findings
Energy Technology Data Exchange (ETDEWEB)
No, Tae Youn; Baek, Ho Gil; Won, Jong Bu; Park, Sung Ho; Park, O Bong; Baik, Seung Kug; Shin, Mi Jung; Kim, Bong Ki; Choi, Han Yong [Wallace Memorial Baptist Hospital, Pusan (Korea, Republic of)
1997-05-01
To describe the characteristics of CT findings in nasal lymphoma. We retrospectively reviewed CT findings and pathologic findings of eight patients (six males and two females) aged between 24 and 68 years with pathologically-proven nasal lymphoma. We analyzed mass location, laterality, size, margin, mass effect, adjacent bony change and contrast enhancement pattern. All eight cases were non-Hodgkin's lymphoma, intermediate grade, diffuse large cell type. Seven cases were B-cell type and one was T-cell. In all cases, tumors were located in the medial wall of the inferior turbinate. In four cases, they were also found in the anterior ethmoidal sinus, and in one case, in the nasal septum. The mean size of the main mass was 3.3cm. In seven cases, tumors were unilateral (one on the right; six on the left), and in the remaining case, bilateral. In six cases tumor margin was smooth and in two cases focal nodularity was seen. In two cases there was no bony change, and in four, there was mucosal thickening along the nasal septum; in one of these four, minimal bony erosion was also found. In the other two cases, bony destruction was seen, and tumors were very large(7cm in diameter) or bilterally located. In three cases, the nasal septum was displaced by the mass. In all cases with bony change, the nasal septum was involved. All tumors were homogeneously well enhanced after IV contrast administration. The main CT findings of nasal non-Hodgkin's lymphoma were smooth margin, unilateral location (mainly in the medial wall of the inferior turbinate and growing to the medial side without bony destruction) mucosal thickening along the nasal septum and clear homogeneous enhancement after IV contrast administration. These characteristics will help diagnosis, help deter-mine the appropriate region for radiation and other appropriate therapy, and facilitate prognosis in patients with nasal non-Hodgkin's lymphoma.
Eosinophilic Angiocentric Fibrosis of the Nasal Septum
Directory of Open Access Journals (Sweden)
Yunchuan Li
2013-01-01
Full Text Available Background. Eosinophilic angiocentric fibrosis (EAF is a rare benign condition of unknown aetiology that causes stenosis of the upper respiratory tract. It is most commonly found at the nasal septum and sinus mucosa causing mucosal thickening and nasal obstructive symptoms. The diagnosis is mainly based on characteristic histologic findings. Case Report. A 27-year-old young woman presented with a slow growing mass at her anterior nasal septum for over eight years. She complained of persistent nasal obstruction, epistaxis, sometimes diffused facial pain, and chronic headache. 3 years ago, the tumor was partially resected for ventilation and a nasal septum perforation was left. Imaging findings indicated soft-tissue thickening of the anterior part of septum and adjacent lateral nasal walls. Pathological examination showed numerous inflammatory cells infiltrates containing eosinophils, fibroinflammatory lesion with a whorled appearance fibrosis which typically surrounded vessels. A diagnosis of eosinophilic angiocentric fibrosis was made. All laboratory tests were unremarkable. Skin prick test was positive. The tumor-like lesion was totally resected. Conclusions. EAF is a rare benign and progressive disorder causing destruction. Combined with radiological imaging of EAF historical findings contribute to the diagnosis. It is important to prevent tumor from recurrence by total resection of the lesion.
Nasal septum extramedullary plasmacytoma
Directory of Open Access Journals (Sweden)
Belić Branislav
2013-01-01
Full Text Available Introduction. Plasmacytomas are malignant tumors characterized by abnormal monoclonal proliferation of plasma cells. They originate in either bone - solitary osseous plasmacytoma, or in soft tissue - extramedullary plasmacytoma (EMP. EMP represents less than 1% of all head and neck malignancies. Case report. We presented a case of EMP of the nasal septum in a 44-year-old male who had progressive difficulty in breathing through the nose and frequent heavy epistaxis on the right side. Nasal endoscopy showed dark red, soft, polypoid tumor in the last third of the right nasal cavity arising from the nasal septum. The biopsy showed that it was plasmacytoma. Bence Jones protein in the urine, serum electrophoresis, bone marrow biopsy, skeletal survey and other screening tests failed to detect multiple myeloma. This confirmed the diagnosis of EMP. The mass was completely removed via an endoscopic approach, and then, 4 week later, radiotherapy was conducted with a radiation dose of 50 Gray. No recurrence was noted in a 3-year follow- up period. Conclusion. EMP of the nasal cavity, being rare and having long natural history, represents a diagnostic and therapeutic challenge for any ear, nose and throat surgeon. Depending on the resectability of the lesion, a combined therapy is the accepted treatment.
Brurberg, Kjetil G; Skogmo, Hege K; Graff, Bjørn A; Olsen, Dag R; Rofstad, Einar K
2005-11-01
The spatial heterogeneity in oxygen tension (pO2) in tumor tissue has been studied extensively, whereas, the information about the temporal heterogeneity is sparse. The purpose of the present study was to search for pO2 fluctuations in untreated and irradiated spontaneous canine tumors, and to investigate whether there is a relationship between overall tumor oxygenation status and pO2 fluctuation pattern. Six dogs scheduled for radiation therapy of head and neck cancer were included in the study. The primary tumors were irradiated with 18 fractions of 3 Gy. Eppendorf polarographic electrodes and OxyLite fluorescence probes were used to measure overall oxygenation status and pO2 fluctuation pattern, respectively. Tissue pO2 was recorded at three subsequent days prior to treatment, and immediately before radiation fraction 4, 7, and 10. Overall oxygenation status differed substantially among the tumors. Radiation therapy had no consistent effect on overall oxygenation status. Fluctuations in pO2 were detected in untreated as well as irradiated tumors, and independent of whether the tumors were poorly or well oxygenated. Fluctuations in pO2 can occur in untreated and irradiated spontaneous canine tumors. There is no correlation between pO2 fluctuation pattern and overall tumor oxygenation status.
Canine tumor cross-species genomics uncovers targets linked to osteosarcoma progression
2009-01-01
Background Pulmonary metastasis continues to be the most common cause of death in osteosarcoma. Indeed, the 5-year survival for newly diagnosed osteosarcoma patients has not significantly changed in over 20 years. Further understanding of the mechanisms of metastasis and resistance for this aggressive pediatric cancer is necessary. Pet dogs naturally develop osteosarcoma providing a novel opportunity to model metastasis development and progression. Given the accelerated biology of canine osteosarcoma, we hypothesized that a direct comparison of canine and pediatric osteosarcoma expression profiles may help identify novel metastasis-associated tumor targets that have been missed through the study of the human cancer alone. Results Using parallel oligonucleotide array platforms, shared orthologues between species were identified and normalized. The osteosarcoma expression signatures could not distinguish the canine and human diseases by hierarchical clustering. Cross-species target mining identified two genes, interleukin-8 (IL-8) and solute carrier family 1 (glial high affinity glutamate transporter), member 3 (SLC1A3), which were uniformly expressed in dog but not in all pediatric osteosarcoma patient samples. Expression of these genes in an independent population of pediatric osteosarcoma patients was associated with poor outcome (p = 0.020 and p = 0.026, respectively). Validation of IL-8 and SLC1A3 protein expression in pediatric osteosarcoma tissues further supported the potential value of these novel targets. Ongoing evaluation will validate the biological significance of these targets and their associated pathways. Conclusions Collectively, these data support the strong similarities between human and canine osteosarcoma and underline the opportunities provided by a comparative oncology approach as a means to improve our understanding of cancer biology and therapies. PMID:20028558
Canine tumor cross-species genomics uncovers targets linked to osteosarcoma progression
Directory of Open Access Journals (Sweden)
Triche Timothy
2009-12-01
Full Text Available Abstract Background Pulmonary metastasis continues to be the most common cause of death in osteosarcoma. Indeed, the 5-year survival for newly diagnosed osteosarcoma patients has not significantly changed in over 20 years. Further understanding of the mechanisms of metastasis and resistance for this aggressive pediatric cancer is necessary. Pet dogs naturally develop osteosarcoma providing a novel opportunity to model metastasis development and progression. Given the accelerated biology of canine osteosarcoma, we hypothesized that a direct comparison of canine and pediatric osteosarcoma expression profiles may help identify novel metastasis-associated tumor targets that have been missed through the study of the human cancer alone. Results Using parallel oligonucleotide array platforms, shared orthologues between species were identified and normalized. The osteosarcoma expression signatures could not distinguish the canine and human diseases by hierarchical clustering. Cross-species target mining identified two genes, interleukin-8 (IL-8 and solute carrier family 1 (glial high affinity glutamate transporter, member 3 (SLC1A3, which were uniformly expressed in dog but not in all pediatric osteosarcoma patient samples. Expression of these genes in an independent population of pediatric osteosarcoma patients was associated with poor outcome (p = 0.020 and p = 0.026, respectively. Validation of IL-8 and SLC1A3 protein expression in pediatric osteosarcoma tissues further supported the potential value of these novel targets. Ongoing evaluation will validate the biological significance of these targets and their associated pathways. Conclusions Collectively, these data support the strong similarities between human and canine osteosarcoma and underline the opportunities provided by a comparative oncology approach as a means to improve our understanding of cancer biology and therapies.
Sternberg, R A; Pondenis, H C; Yang, X; Mitchell, M A; O'Brien, R T; Garrett, L D; Helferich, W G; Hoffmann, W E; Fan, T M
2013-01-01
In dogs with appendicular osteosarcoma (OSA), increased pretreatment serum bone-specific alkaline phosphatase (BALP) activity is a negative prognostic factor, associated with shorter disease-free intervals and survival times, but a biologic basis for observed differential serum BALP activities in canine OSA patients remains incompletely defined. Serum BALP activity will correlate with absolute tumor burden in dogs with OSA. This study included 96 client-owned dogs with appendicular OSA. In canine OSA cell lines, the expression and membranous release of BALP was evaluated in vitro. The correlation between serum BALP activity and radiographic primary tumor size was evaluated in OSA-bearing dogs. In dogs developing visceral OSA metastases, serial changes in serum BALP activities were evaluated in relation to progression of macroscopic metastases, and visceral metastatic OSA cells were evaluated for BALP expression. In vitro, BALP expression was not associated with either tumorigenic or metastatic phenotype, rather the quantity of membranous BALP released was proportional with cell density. In dogs devoid of macroscopic metastases, there was a positive correlation between serum BALP activity and absolute primary tumor size. In dogs with progressive OSA metastases, serum BALP activity increased and coincided with the development of macroscopic metastases. OSA cells derived from visceral metastatic lesions retained BALP expression. Tumor burden is a determinant of serum BALP activity in dogs with appendicular OSA. The association between increased pretreatment BALP activity and negative clinical prognosis may simply be attributed to greater initial tumor burden, and consequently more advanced tumor stage. Copyright © 2013 by the American College of Veterinary Internal Medicine.
Immunophenotype Heterogeneity in Nasal Glomangiopericytoma
Directory of Open Access Journals (Sweden)
Adriana Handra-Luca
2015-01-01
Full Text Available Nasal glomangiopericytoma is rare. The immunophenotype is heterogeneous, more frequently smooth-muscle-actin and CD34-positive. We report expression patterns for several vascular-related proteins such as CD99, CD146, Bcl2, and WT1 as well as for treatment-related proteins such as mTOR and EGFR in a nasal glomangiopericytoma. The patient (woman, 86 years presented with a left nasal tumefaction. The resected specimen (1.5-cm showed a glomangiopericytoma. Tumor cells expressed smooth-muscle-actin, CD31, CD34, and progesterone receptor. They also expressed the vascular-cell-related proteins Bcl2, CD99, CD146, and WT1, as well as mTOR and EGFR. Nasal glomangiopericytomas show immunohistochemical heterogeneity for vascular-related markers, suggesting a possible extensive pericytic differentiation. The expression of potential targets for drug treatments such as mTOR and EGFR may impact on the clinical follow-up of these tumors occurring at advanced ages, which may require complex surgery.
Directory of Open Access Journals (Sweden)
Helena Wensman
Full Text Available BACKGROUND: BMPs are currently receiving attention for their role in tumorigenesis and tumor progression. Currently, most BMP expression studies are performed on carcinomas, and not much is known about the situation in sarcomas. METHODOLOGY/PRINCIPAL FINDINGS: We have investigated the BMP expression profiles and Smad activation in clones from different spontaneous canine mammary tumors. Spindle cell tumor and osteosarcoma clones expressed high levels of BMPs, in particular BMP-2, -4 and -6. Clones from a scirrhous carcinoma expressed much lower BMP levels. The various clones formed different tumor types in nude mice but only clones that expressed high levels of BMP-6 gave bone formation. Phosphorylated Smad-1/5, located in the nucleus, was detected in tumors derived from clones expressing high levels of BMPs, indicating an active BMP signaling pathway and BMP-2 stimulation of mammary tumor cell clones in vitro resulted in activation of the Smad-1/5 pathway. In contrast BMP-2 stimulation did not induce phosphorylation of the non-Smad pathway p38 MAPK. Interestingly, an increased level of the BMP-antagonist chordin-like 1 was detected after BMP stimulation of non-bone forming clones. CONCLUSIONS/SIGNIFICANCE: We conclude that the specific BMP expression repertoire differs substantially between different types of mammary tumors and that BMP-6 expression most probably has a biological role in bone formation of canine mammary tumors.
Directory of Open Access Journals (Sweden)
Abadie Jerome
2011-05-01
Full Text Available Abstract Background Histiocytic malignancies in both humans and dogs are rare and poorly understood. While canine histiocytic sarcoma (HS is uncommon in the general domestic dog population, there is a strikingly high incidence in a subset of breeds, suggesting heritable predisposition. Molecular cytogenetic profiling of canine HS in these breeds would serve to reveal recurrent DNA copy number aberrations (CNAs that are breed and/or tumor associated, as well as defining those shared with human HS. This process would identify evolutionarily conserved cytogenetic changes to highlight regions of particular importance to HS biology. Methods Using genome wide array comparative genomic hybridization we assessed CNAs in 104 spontaneously occurring HS from two breeds of dog exhibiting a particularly elevated incidence of this tumor, the Bernese Mountain Dog and Flat-Coated Retriever. Recurrent CNAs were evaluated further by multicolor fluorescence in situ hybridization and loss of heterozygosity analyses. Statistical analyses were performed to identify CNAs associated with tumor location and breed. Results Almost all recurrent CNAs identified in this study were shared between the two breeds, suggesting that they are associated more with the cancer phenotype than with breed. A subset of recurrent genomic imbalances suggested involvement of known cancer associated genes in HS pathogenesis, including deletions of the tumor suppressor genes CDKN2A/B, RB1 and PTEN. A small number of aberrations were unique to each breed, implying that they may contribute to the major differences in tumor location evident in these two breeds. The most highly recurrent canine CNAs revealed in this study are evolutionarily conserved with those reported in human histiocytic proliferations, suggesting that human and dog HS share a conserved pathogenesis. Conclusions The breed associated clinical features and DNA copy number aberrations exhibited by canine HS offer a valuable model
International Nuclear Information System (INIS)
Hedan, Benoit; Thomas, Rachael; Motsinger-Reif, Alison; Abadie, Jerome; Andre, Catherine; Cullen, John; Breen, Matthew
2011-01-01
Histiocytic malignancies in both humans and dogs are rare and poorly understood. While canine histiocytic sarcoma (HS) is uncommon in the general domestic dog population, there is a strikingly high incidence in a subset of breeds, suggesting heritable predisposition. Molecular cytogenetic profiling of canine HS in these breeds would serve to reveal recurrent DNA copy number aberrations (CNAs) that are breed and/or tumor associated, as well as defining those shared with human HS. This process would identify evolutionarily conserved cytogenetic changes to highlight regions of particular importance to HS biology. Using genome wide array comparative genomic hybridization we assessed CNAs in 104 spontaneously occurring HS from two breeds of dog exhibiting a particularly elevated incidence of this tumor, the Bernese Mountain Dog and Flat-Coated Retriever. Recurrent CNAs were evaluated further by multicolor fluorescence in situ hybridization and loss of heterozygosity analyses. Statistical analyses were performed to identify CNAs associated with tumor location and breed. Almost all recurrent CNAs identified in this study were shared between the two breeds, suggesting that they are associated more with the cancer phenotype than with breed. A subset of recurrent genomic imbalances suggested involvement of known cancer associated genes in HS pathogenesis, including deletions of the tumor suppressor genes CDKN2A/B, RB1 and PTEN. A small number of aberrations were unique to each breed, implying that they may contribute to the major differences in tumor location evident in these two breeds. The most highly recurrent canine CNAs revealed in this study are evolutionarily conserved with those reported in human histiocytic proliferations, suggesting that human and dog HS share a conserved pathogenesis. The breed associated clinical features and DNA copy number aberrations exhibited by canine HS offer a valuable model for the human counterpart, providing additional evidence towards
9 CFR 113.316 - Canine Parainfluenza Vaccine.
2010-01-01
... furnished or approved by Animal and Plant Health Inspection Service. (4) The rectal temperature of each dog...: (1) Twenty-five canine parainfluenza susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Nasal swabs shall be collected from each dog on the day the first dose of vaccine is...
NORMAL NASAL GENE EXPRESSION LEVELS USING CDNA ARRAY TECHNOLOGY
Normal Nasal Gene Expression Levels Using cDNA Array Technology. The nasal epithelium is a target site for chemically-induced toxicity and carcinogenicity. To detect and analyze genetic events which contribute to nasal tumor development, we first defined the gene expressi...
DEFF Research Database (Denmark)
Hansen, Anders E; Kristensen, Annemarie T; Law, Ian
2012-01-01
To compare the distribution and uptake of the hypoxia tracer (64)Cu-diacetyl-bis(N(4)-methylthiosemicarbazone) ((64)Cu-ATSM) PET/CT, FDG PET/CT and dynamic contrast enhanced perfusion CT (DCE-pCT) in spontaneous canine tumors. In addition (64)Cu-ATSM distribution over time was evaluated.......To compare the distribution and uptake of the hypoxia tracer (64)Cu-diacetyl-bis(N(4)-methylthiosemicarbazone) ((64)Cu-ATSM) PET/CT, FDG PET/CT and dynamic contrast enhanced perfusion CT (DCE-pCT) in spontaneous canine tumors. In addition (64)Cu-ATSM distribution over time was evaluated....
Evaluation of P16 expression in canine appendicular osteosarcoma.
Murphy, B G; Mok, M Y; York, D; Rebhun, R; Woolard, K D; Hillman, C; Dickinson, P; Skorupski, K
2017-06-20
Osteosarcoma (OSA) is a common malignant bone tumor of large breed dogs that occurs at predictable anatomic sites. At the time of initial diagnosis, most affected dogs have occult pulmonary metastases. Even with aggressive surgical treatment combined with chemotherapy, the majority of dogs diagnosed with OSA live less than 1 year from the time of diagnosis. The ability to identify canine OSA cases most responsive to treatment is needed. In humans, OSA is also an aggressive tumor that is histologically and molecularly similar to canine OSA. The expression of the tumor suppressor gene product P16 by human OSA tissue has been linked to a favorable response to chemotherapy. We identified an antibody that binds canine P16 and developed a canine OSA tissue microarray in order to test the hypothesis that P16 expression by canine OSA tissue is predictive of clinical outcome following amputation and chemotherapy. Although statistical significance was not reached, a trend was identified between the lack of canine OSA P16 expression and a shorter disease free interval. The identification of a molecular marker for canine OSA is an important goal and the results reported here justify a larger study.
Immunohistochemical Expression of FXR1 in Canine Normal Tissues and Melanomas.
Nordio, Laura; Marques, Andreia T; Lecchi, Cristina; Luciano, Alberto M; Stefanello, Damiano; Giudice, Chiara
2018-04-01
Fragile X mental retardation-related protein 1 (FXR1) is a cytoplasmic RNA-binding protein highly conserved among vertebrates. It has been studied for its role in muscle development, inflammation, and tumorigenesis, being related, for example, to metastasizing behavior in human and canine uveal melanoma. Anti-FXR1 antibodies have never been validated in the canine species. To investigate FXR1 expression in canine melanocytic tumors, the present study tested two commercially available polyclonal anti-human FXR1 antibodies, raised in goat and rabbit, respectively. The cross-reactivity of the anti-FXR1 antibodies was assessed by Western blot analysis, and the protein was localized by IHC in a set of normal canine tissues and in canine melanocytic tumors (10 uveal and 10 oral). Western blot results demonstrated that the antibody raised in rabbit specifically recognized the canine FXR1, while the antibody raised in goat did not cross-react with this canine protein. FXR1 protein was immunodetected using rabbit anti-FXR1 antibody, in canine normal tissues with different levels of intensity and distribution. It was also detected in 10/10 uveal and 9/10 oral melanocytic tumors. The present study validated for the first time the use of anti-FXR1 antibody in dogs and highlighted different FXR1 protein expression in canine melanocytic tumors, the significance of which is undergoing further investigations.
Directory of Open Access Journals (Sweden)
Citro Gennaro
2008-11-01
Full Text Available Abstract Sticker's sarcoma (also known as transmissible venereal tumor is a horizontally transmitted neoplasm of the dog, that is passed with coitus. It is a locally aggressive tumor with a low tendency to metastatic spread. The most common locations are the genitals, the nose, the perianal area. Standard treatment consists with chemotherapy with vincristine, however other therapies such as, cryotherapy, immunotherapy or, in selected cases, radiation therapy, have been reported. In this article we describe the outcome of a small cohort of canine patients, with chemotherapy resistant transmissible venereal tumor (TVT, treated with bleomycin selectively driven by trains of biphasic pulses (electrochemotherapy. Three canine patients, with refractory TVT, entered the study and received two sessions of ECT under sedation. The pets had local injection of bleomycin at the concentration of 1.5 mg/ml and five minutes after the chemotherapy, trains of 8 biphasic electric pulses lasting 50 + 50 μs each, with 1 ms interpulse intervals, were delivered by means of modified caliper or, for difficult districts, through paired needle electrode. All the patients responded to the treatment and are still in remission at different times. Electrochemotherapy appears as a safe and efficacious modality for the treatment of TVT and warrants further investigations.
Genetic characterization of canine influenza A virus (H3N2) in Thailand.
Bunpapong, Napawan; Nonthabenjawan, Nutthawan; Chaiwong, Supassama; Tangwangvivat, Ratanaporn; Boonyapisitsopa, Supanat; Jairak, Waleemas; Tuanudom, Ranida; Prakairungnamthip, Duangduean; Suradhat, Sanipa; Thanawongnuwech, Roongroje; Amonsin, Alongkorn
2014-02-01
In January 2012, several clinical cases of dogs with flu-like symptoms, including coughing, sneezing, nasal discharge, and fever, were reported in a small-animal hospital located in Bangkok, Thailand. One influenza A virus was identified and characterized as an avian-like influenza virus H3N2. The virus was named A/canine/Thailand/CU-DC5299/12. A phylogenetic analysis indicated that the canine virus belonged to an avian Eurasian lineage and was genetically related to the canine influenza viruses H3N2 from China and Korea. This canine virus displays a unique genetic signature with two amino acid insertions in the NA protein, which is similar to the canine influenza viruses from eastern China (Zhejiang and Jiangsu). This study constitutes the first report of H3N2 canine influenza virus infection in a small-animal hospital in Thailand.
Meyer, A; Gruber, A D; Klopfleisch, R
2012-11-01
Canine cutaneous mast cell tumors (MCT) of different histological grades have distinct biological behaviors. However, little is known about underlying molecular mechanisms that lead to tumor development and increasing malignancy with higher tumor grade. Recent studies have identified the interleukin-2 receptor (IL-2R) subunits CD25 and CD2 as markers that distinguish nonneoplastic from neoplastic mast cells in human systemic mastocytosis. In this study, their potential as a marker for canine MCT and their possible impact on MCT carcinogenesis were evaluated. mRNA expression levels of both genes were compared between grade 1 (n = 12) and grade 3 (n = 8) MCT, and protein expression levels of CD25 were compared in 90 MCT of different tumor grades. mRNA expression levels of both CD25 and CD2 were upregulated in grade 3 MCT. In contrast, CD25 protein was expressed by fewer tumor cells and at decreased levels in grade 3 tumors, while most grade 1 MCT had strong CD25 protein expression. Moreover, CD25 was not expressed by nonneoplastic, resting cutaneous mast cells, while few presumably activated mast cells in tissue samples from dogs with allergic dermatitis had weak CD25 expression. Taken together, these findings suggest that CD25 may play a critical role in early MCT development and may be a stimulatory factor in grade 1 MCT, while grade 3 MCT seem to be less dependent on CD25. Because of the low number of CD25-positive tumor cells in high-grade tumors, the usefulness of CD25 as a tumor marker is, however, questionable.
Expression of the MDR1 gene and P-glycoprotein in canine mast cell tumor cell lines
NAKAICHI, Munekazu; TAKESHITA, Yoko; OKUDA, Masaru; NAKAMOTO, Yuya; ITAMOTO, Kazuhito; UNE, Satoshi; SASAKI, Nobuo; KADOSAWA, Tsuyoshi; TAKAHASHI, Tomoko; TAURA, Yasuho
2007-01-01
Cellular drug resistance to antineoplastic drugs is often due to the presence of a drug efflux pump that reduces intracellular drug accumulation and chemosensitivity. P-glycoprotein (P-gp), which is encoded by the MDR1 gene, is considered to function as an ATP-driven membrane drug efflux pump and appears to play an important role in tumor cell resistance. In the present report, we assessed the expression of MDR1 by RT-PCR in three canine mast cell tumor cell lines, TiMC, CoMS and LuMC, origin...
A Case of Nasal Glial Heterotopia in an Adult
Directory of Open Access Journals (Sweden)
Akira Hagiwara
2014-01-01
Full Text Available We report a rare case of nasal glial heterotopia in an adult. After the surgery, frontal lobe cerebral hemorrhage developed. A 58-year-old man had unilateral nasal obstruction that progressed for one year. He had been treated for hypertension, chronic heart failure, and cerebral infarction with aspirin and warfarin. A computed tomography scan showed that the tumor occupied the right nasal cavity and the sinuses with small defect in the cribriform plate. The tumor was removed totally with endoscopy. After the operation, the patient developed convulsions and frontal lobe cerebral hemorrhage. The hemorrhage site was located near a defect in the cribriform plate. Nasal glial heterotopia is a rare developmental abnormality, particularly rare in adult. Only few cases were reported. We could not find any report of adult nasal glial heterotopias that developed cerebral hemorrhage as a complication of the surgery.
Local control and intermediate-term cosmetic outcome following IMRT for nasal tumors. An update
Energy Technology Data Exchange (ETDEWEB)
Mukai, Yuki [University Hospital Zurich, Department of Radiation Oncology, Head Neck Cancer Center, Zurich (Switzerland); Yokohama City University Graduate School of Medicine, Department of Radiology, Yokohama (Japan); Janssen, Stefan [University Hospital Zurich, Department of Radiation Oncology, Head Neck Cancer Center, Zurich (Switzerland); Glanzmann, Christoph; Studer, Gabriela [University Hospital Zurich, Department of Radiation Oncology, Head Neck Cancer Center, Zurich (Switzerland); Cantonal Hospital Lucerne, Institute for Radiation Oncology, Lucerne (Switzerland); Holzmann, David [University Hospital Zurich, Department of Otorhinolaryngology, Head and Neck Surgery, Head Neck Cancer Center, Zurich (Switzerland)
2017-04-15
This study aims to evaluate local control and intermediate-term cosmetic outcome in patients with cancer of the nose treated with intensity-modulated radiotherapy (IMRT). From June 2008 to September 2015, 36 consecutive patients presenting with nasal cavity, ala of the nose, or nasal vestibule tumors were treated at the Department of Radiation Oncology, University Hospital Zurich either postoperatively (n = 14; 3/14 with nasal ablation) or with definitive IMRT (n = 22). Of these 36 patients, 8 presented with recurrent disease after surgery only and 1/36 with N1 disease. Concurrent systemic therapy was administered in 18/36 patients (50%). Nasal follow-up (FU) imaging documentation of 13 patients with preserved organ and >6 months FU offers a pre/post IMRT FU comparison. In addition, these patients' subjective evaluation of cosmesis was assessed. Mean/median FU was 41/33 months (range 5-92 months). Salvage ablation with curative intent was undergone by 3 patients with local relapse after definitive (n = 2) and postoperative (n = 1) IMRT. The 3-year local control, ultimate local control, and overall survival rates were 90, 97, and 90 %, respectively. Subjective and objective cosmetic outcome after IMRT is very satisfying so far. IMRT for nasal tumors was found to be effective and well tolerated. Intermediate-term cosmetic results are good. Radical surgical procedures may be saved for curative salvage treatment. (orig.) [German] Evaluation der Lokalkontrolle und des mittelfristigen kosmetischen Resultats nach intensitaetsmodulierter Radiotherapie (IMRT) von Patienten mit Nasentumoren. Von Juni 2008 bis September 2015 wurden an der Klinik fuer RadioOnkologie am UniversitaetsSpital Zuerich 36 konsekutive Patienten mit Tumoren der Nasenhoehle, der Nasenfluegel oder des Vestibulum nasi postoperativ (n = 14; 3/14 nach Nasenablation) oder definitiv IMRT-bestrahlt (n = 22). Von diesen 36 Patienten zeigten 8 ein Lokalrezidiv nach alleiniger vorangegangener Chirurgie und
Effects of Obesity and Obesity-Related Molecules on Canine Mammary Gland Tumors.
Lim, H-Y; Im, K-S; Kim, N-H; Kim, H-W; Shin, J-I; Yhee, J-Y; Sur, J-H
2015-11-01
Obesity can affect the clinical course of a number of diseases, including breast cancer in women and mammary gland tumors in female dogs, via the secretion of various cytokines and hormones. The objective of this study was to examine the expression patterns of obesity-related molecules such as aromatase, leptin, and insulin-like growth factor 1 receptor (IGF-1 R) in canine mammary carcinomas (CMCs) on the basis of the body condition score (BCS). Comparative analyses of the expression of these molecules, together with prognostic factors for CMCs, including hormone receptors (HRs; estrogen and progesterone receptors), lymphatic invasion, central necrosis of the tumor, and histologic grade, were performed on 56 CMCs. The mean age of CMC onset was lower in the overweight or obese group (8.7 ± 1.9 years) than in the lean or ideal body weight group (10.4 ± 2.7 years). The proportion of poorly differentiated (grade III) tumors was significantly higher in the overweight or obese female dogs. Aromatase expression was significantly higher in the overweight or obese group and was correlated with the expression of HRs (P = .025). These findings suggest that overweight or obese status might affect the development and behavior of CMCs by tumor-adipocyte interactions and increased HR-related tumor growth. © The Author(s) 2015.
Failure patterns following cobalt irradiation in dogs with nasal carcinoma
International Nuclear Information System (INIS)
Thrall, D.E.; Heidner, G.L.; Novotney, C.A.; McEntee, M.C.; Page, R.L.
1993-01-01
The pattern of tumor recurrence was assessed in 24 dogs receiving cobalt radiation therapy for nasal carcinoma. Dogs were evaluated using nasal cavity computed tomography prior to treatment, and at 1, 3, 6 and 12 months after treatment, and at 6-month intervals thereafter if still alive. Dogs were treated with various combinations of total dose, and fraction size. Total doses were normalized to equivalent doses given in 3.0 Gy fractions. The extent of tumor regression or duration of tumor control were not dependent on absolute total dose, normalized total dose, or tumor type. The median duration of local control in all dogs was 312 days. Marked tumor regression was observed in 11 of the 24 dogs. Median duration of local control was significantly longer in dogs with marked tumor regression in comparison to dogs without tumor regression; 389 vs. 161 days respectively. When tumor recurrence was documented in dogs having tumor regression, the location of the recurrence was in the nasal cavity. No tumor recurred in a sinus or periorbital region, and only one geographic miss was detected. Tumor recurrence in the irradiated volume, including dogs with and without marked regression, was documented in 13 of the 24 dogs. The high local failure rate, coupled with the recurrence pattern in these dogs, suggests there may be an opportunity for improvement in local control through use of shrinking field techniques
Association between nasal shedding and fever that influenza A (H3N2) induces in dogs.
Song, Daesub; Moon, Hyoungjoon; Jung, Kwonil; Yeom, Minjoo; Kim, Hyekwon; Han, Sangyoon; An, Dongjun; Oh, Jinsik; Kim, Jongman; Park, Bongkyun; Kang, Bokyu
2011-01-05
Avian origin canine influenza virus was reported in Korea. The dog to dog contact transmission of the avian origin canine influenza virus (CIV) H3N2 and CIV H3N8 was shown by experimental contact transmission. This study was focused on viral excretion and fever in order to elucidate the epidemiological associations which might be helpful to control the disease transmissions in CIV outbreak in dogs. An influenza seronegative 10-week-old Beagle dog was experimentally inoculated with the canine influenza virus A/canine/01/2007, subtype H3N2. Eight hours after inoculation, the infected dog was cohoused with seven uninfected Beagle dogs. Clinical signs including fever were recorded for 14 days post inoculation. The infected dog and four of seven contact dogs in the study showed clinical signs (sneezing, nasal discharge and coughing) during the study. Viral shedding occurred in all of the animals tested and began on 1 to 6 DPI in dogs with clinical signs. Elevated body temperatures above 39.5 °C (geometric mean temperature of 39.86 °C ± 0.49) were observed in all symptomatic dogs. The mean viral titer during fever was 2.99 log EID₅₀/ml, which was significantly higher than the viral titer detected in the non fever. The data show that contact dogs with a canine influenza infected dog shed different levels of virus in their nasal excretions and demonstrate that clinical signs, including fever, significantly correlate with the viral shedding.
Association between nasal shedding and fever that influenza A (H3N2 induces in dogs
Directory of Open Access Journals (Sweden)
Oh Jinsik
2011-01-01
Full Text Available Abstract Background Avian origin canine influenza virus was reported in Korea. The dog to dog contact transmission of the avian origin canine influenza virus (CIV H3N2 and CIV H3N8 was shown by experimental contact transmission. This study was focused on viral excretion and fever in order to elucidate the epidemiological associations which might be helpful to control the disease transmissions in CIV outbreak in dogs. Methods An influenza seronegative 10-week-old Beagle dog was experimentally inoculated with the canine influenza virus A/canine/01/2007, subtype H3N2. Eight hours after inoculation, the infected dog was cohoused with seven uninfected Beagle dogs. Clinical signs including fever were recorded for 14 days post inoculation. Results The infected dog and four of seven contact dogs in the study showed clinical signs (sneezing, nasal discharge and coughing during the study. Viral shedding occurred in all of the animals tested and began on 1 to 6 DPI in dogs with clinical signs. Elevated body temperatures above 39.5°C (geometric mean temperature of 39.86°C±0.49 were observed in all symptomatic dogs. The mean viral titer during fever was 2.99 log EID50/ml, which was significantly higher than the viral titer detected in the non fever. Conclusions The data show that contact dogs with a canine influenza infected dog shed different levels of virus in their nasal excretions and demonstrate that clinical signs, including fever, significantly correlate with the viral shedding.
Transnasal endoscopic resection of vascular leiomyomas of the nasal septum
Directory of Open Access Journals (Sweden)
Hai-Hong Chen
2016-01-01
Conclusion: The endoscope technique offers simple, rapid access to the nasal septum, and excellent visualization; it is a safe, minimally invasive, efficient procedure for removing benign nasal septum tumors that leaves no scar on the face.
Plasmocitoma extramedular nasal en un perro
Directory of Open Access Journals (Sweden)
Carlos Giraldo M.
2012-12-01
Full Text Available Se describe un caso de plasmocitoma nasal en un canino, macho entero, de raza Akita de 30 Kg de peso y veintiún meses de edad, con historia de epistaxis unilateral crónica. Se practicó examen clínico y biopsia de la neoplasia visible en la cavidad nasal izquierda. La ubicación y extensión del tumor fue determinada mediante tomografía computarizada de cabeza y cuello. Se realizaron análisis histopatológico e inmunohistoquímico (IHQ del tejido tumoral. La tomografía computarizada evidenció una masa con densidad de tejido blando de 10 cm de longitud x 3.5 cm de diámetro y escasa captación de medio de contraste, que comprometía en su totalidad la cavidad nasal derecha y parte de la porción posterior de la coana izquierda. El análisis histopatológico reveló numerosas células redondas pleomórficas con poco citoplasma, rodeadas por trama escasa de tejido conectivo y bajo índice mitótico. En el examen IHQ la muestra fue negativa a los antígenos CD3 y CD20 para linfocitos T y B, respectivamente. Los hallazgos clínicos y de la tomografía computarizada, así como los resultados del análisis histopatológico del tejido tumoral, fueron compatibles con un plasmocitoma extramedular nasal de bajo grado de malignidad.
Energy Technology Data Exchange (ETDEWEB)
Romero, A.; Delgado, F.; Ramos, M.; Bravo, F. [Hospital Universitario Reina Sofia. Cordoba (Spain)
2000-07-01
Melanoma of the nasal cavity is a rare tumor with a worse prognosis than cutaneous melanoma. It usually presents as nasal obstruction and/or epistaxis. The observation of a pigmented mass in the nasal cavity is highly suggestive of this lesion. Computed tomography shows a mass with nonspecific features. In magnetic resonance studies, it has a characteristics signal consisting of hyperintensity of T1-weighted images and hypointensity on T2-weighted images, depending on the amount of melanin. The treatment of choice is surgical resection. We present a case of melanoma of the nasal cavity in which endovascular embolization of the tumor was performed prior to surgical treatment. (Author) 11 refs.
Extraskeletal primary Ewing's scrcoma in the nasal cavity: A case report
International Nuclear Information System (INIS)
Jeong, Bo Young; Park, Seok Won; Km, Eo Jin; Choi, Jong Sun; Lee, Eun Ja
2013-01-01
Ewing's sarcoma presents a rare tumor of the head and neck, and even rarer in the nasal cavity and/or paranasal sinuses. We report the case of Ewing's sarcoma in the nasal cavity, as presented with nasal obstruction and epistaxis. The CT and MRI examination reveals a mass in the left nasal cavity with extension to contralateral side, ethmoidal sinus, and nasopharynx. We provide an overview of Ewing's sarcoma in the nasal cavity and discuss radiologic findings of this unusual case.
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Interleukin-12 Inhibits Tumor Growth in a Novel Angiogenesis Canine Hemangiosarcoma Xenograft Model
Directory of Open Access Journals (Sweden)
Nasim Akhtar
2004-03-01
Full Text Available We established a canine hemangiosarcoma cell line derived from malignant endothelial cells comprising a spontaneous tumor in a dog to provide a renewable source of endothelial cells for studies of angiogenesis in malignancy. Pieces of the hemangiosarcoma biopsy were engrafted subcutaneously in a bg/nu/XID mouse allowing the tumor cells to expand in vivo. A cell line, SB-HSA, was derived from the xenograft. SB-HSA cells expressed vascular endothelial growth factor (VEGF receptors 1 and 2, CD31, CD146, and αvβ3 integrin, and produced several growth factors and cytokines, including VEGF, basic fibroblast growth factor, and interleukin (IL-8 that are stimulatory to endothelial cell growth. These results indicated that the cells recapitulated features of mitotically activated endothelia. In vivo, SB-HSA cells stimulated robust angiogenic responses in mice and formed tumor masses composed of aberrant vascular channels in immunocompromised mice providing novel opportunities for investigating the effectiveness of antiangiogenic agents. Using this model, we determined that IL-12, a cytokine with both immunostimulatory and antiangiogenic effects, suppressed angiogenesis induced by, and tumor growth of, SB-HSA cells. The endothelial cell model we have described offers unique opportunities to pursue further investigations with IL-12, as well as other antiangiogenic approaches in cancer therapy.
Griffin, Lynn R; Thamm, Doug H; Selmic, Laura E; Ehrhart, E J; Randall, Elissa
2018-03-23
The goal of this prospective pilot study was to use naturally occurring canine mast cell tumors of various grades and stages as a model for attempting to determine how glucose uptake and markers of biologic behavior are correlated. It was hypothesized that enhanced glucose uptake, as measured by 2-[fluorine-18]fluoro-d-glucose-positron emission tomography/computed tomography (F18 FDG PET-CT), would correlate with histologic grade. Dogs were recruited for this study from a population referred for treatment of cytologically or histologically confirmed mast cell tumors. Patients were staged utilizing standard of care methods (abdominal ultrasound and three view thoracic radiographs), followed by a whole body F18 FDG PET-CT. Results of the F18 FDG PET-CT were analyzed for possible metastasis and standard uptake value maximum (SUV max ) of identified lesions. Incisional or excisional biopsies of the accessible mast cell tumors were obtained and histology performed. Results were then analyzed to look for a possible correlation between the grade of mast cell tumors and SUV max . A total of nine animals were included in the sample. Findings indicated that there was a correlation between grade of mast cell tumors and SUV max as determined by F18 FDG PET-CT (p-value = 0.073, significance ≤ 0.1). Based on the limited power of this study, it is felt that further research to examine the relationship between glucose utilization and biologic aggressiveness in canine mast cell tumors is warranted. This study was unable to show that F18 FDG PET-CT was a better staging tool than standard of care methods. © 2018 American College of Veterinary Radiology.
Effects of aurothiomalate treatment on canine osteosarcoma in a murine xenograft model.
Scharf, Valery F; Farese, James P; Siemann, Dietmar W; Abbott, Jeffrey R; Kiupel, Matti; Salute, Marc E; Milner, Rowan J
2014-03-01
Osteosarcoma is a highly fatal cancer, with most patients ultimately succumbing to metastatic disease. The purpose of this study was to evaluate the effects of the antirheumatoid drug aurothiomalate on canine and human osteosarcoma cells and on canine osteosarcoma growth and metastasis in a mouse xenograft model. We hypothesized that aurothiomalate would decrease osteosarcoma cell survival, tumor cellular proliferation, tumor growth, and metastasis. After performing clonogenic assays, aurothiomalate or a placebo was administered to 54 mice inoculated with canine osteosarcoma. Survival, tumor growth, embolization, metastasis, histopathology, cell proliferation marker Ki67, and apoptosis marker caspase-3 were compared between groups. Statistical analysis was carried out using the Kaplan-Meier method with the log-rank test and one-way analysis of variance with the Tukey's test or Dunn's method. Aurothiomalate caused dose-dependent inhibition of osteosarcoma cell survival (Posteosarcoma cell survival and reduced tumor cell proliferation, growth, embolization, and pulmonary metastasis. Given aurothiomalate's established utility in canine and human medicine, our results suggest that this compound may hold promise as an adjunctive therapy for osteosarcoma. Further translational research is warranted to better characterize the dose response of canine and human osteosarcoma to aurothiomalate.
Expression of nociceptive ligands in canine osteosarcoma.
Shor, S; Fadl-Alla, B A; Pondenis, H C; Zhang, X; Wycislo, K L; Lezmi, S; Fan, T M
2015-01-01
Canine osteosarcoma (OS) is associated with localized pain as a result of tissue injury from tumor infiltration and peritumoral inflammation. Malignant bone pain is caused by stimulation of peripheral pain receptors, termed nociceptors, which reside in the localized tumor microenvironment, including the periosteal and intramedullary bone cavities. Several nociceptive ligands have been determined to participate directly or indirectly in generating bone pain associated with diverse skeletal abnormalities. Canine OS cells actively produce nociceptive ligands with the capacity to directly or indirectly activate peripheral pain receptors residing in the bone tumor microenvironment. Ten dogs with appendicular OS. Expression of nerve growth factor, endothelin-1, and microsomal prostaglandin E synthase-1 was characterized in OS cell lines and naturally occurring OS samples. In 10 dogs with OS, circulating concentrations of nociceptive ligands were quantified and correlated with subjective pain scores and tumor volume in patients treated with standardized palliative therapies. Canine OS cells express and secrete nerve growth factor, endothelin-1, and prostaglandin E2. Naturally occurring OS samples uniformly express nociceptive ligands. In a subset of OS-bearing dogs, circulating nociceptive ligand concentrations were detectable but failed to correlate with pain status. Localized foci of nerve terminal proliferation were identified in a minority of primary bone tumor samples. Canine OS cells express nociceptive ligands, potentially permitting active participation of OS cells in the generation of malignant bone pain. Specific inhibitors of nociceptive ligand signaling pathways might improve pain control in dogs with OS. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of American College of Veterinary Internal Medicine.
Clival chordoma manifesting as nasal bleeding. A case report
Energy Technology Data Exchange (ETDEWEB)
Kitai, Ryuhei; Yoshida, Kazuhiko; Kubota, Toshihiko; Sato, Kazufumi; Handa, Yuji; Kasahara, Kazuma [University of Fukui, Department of Neurosurgery, Fukui (Japan); Nakajima, Hirofumi [Tsuruga Municipal Hospital, Department of Neurosurgery, Fukui (Japan)
2005-05-01
Chordoma is a rare cartilaginous tumor, for which bleeding presentation is unusual. We report a case of rare hemorrhaged clival chordoma, which was diagnosed correctly by magnetic resonance imaging. A 32-year-old man presented with nasal bleeding. The tumor was totally removed via a trans-sphenoidal approach, from which the surgical specimen confirmed chordoma. Epistaxis seemed to be caused by the spreading of the intratumoral hemorrhage into the sphenoid sinus. This case demonstrates the importance of an exact differential diagnostic evaluation, including chordoma, by use of modern imaging techniques for nasal bleeding. (orig.)
Clival chordoma manifesting as nasal bleeding. A case report
International Nuclear Information System (INIS)
Kitai, Ryuhei; Yoshida, Kazuhiko; Kubota, Toshihiko; Sato, Kazufumi; Handa, Yuji; Kasahara, Kazuma; Nakajima, Hirofumi
2005-01-01
Chordoma is a rare cartilaginous tumor, for which bleeding presentation is unusual. We report a case of rare hemorrhaged clival chordoma, which was diagnosed correctly by magnetic resonance imaging. A 32-year-old man presented with nasal bleeding. The tumor was totally removed via a trans-sphenoidal approach, from which the surgical specimen confirmed chordoma. Epistaxis seemed to be caused by the spreading of the intratumoral hemorrhage into the sphenoid sinus. This case demonstrates the importance of an exact differential diagnostic evaluation, including chordoma, by use of modern imaging techniques for nasal bleeding. (orig.)
Directory of Open Access Journals (Sweden)
Berrak Akşam
2016-06-01
Full Text Available Objective: Most of the malignant cutaneous carcinomas are seen in the nasal region. Reconstruction of nasal defects is challenging because of the unique anatomic properties and complex structure of this region. In this study, we present our algorithm for the nasal skin defects that occurred after malignant skin tumor excisions. Material and Methods: Patients whose nasal skin was reconstructed after malignant skin tumor excision were included in the study. These patients were evaluated by their age, gender, comorbities, tumor location, tumor size, reconstruction type, histopathological diagnosis, and tumor recurrence. Results: A total of 130 patients (70 female, 60 male were evaluated. The average age of the patients was 67.8 years. Tumors were located mostly at the dorsum, alar region, and tip of the nose. When reconstruction methods were evaluated, primary closure was preferred in 14.6% patients, full thickness skin grafts were used in 25.3% patients, and reconstruction with flaps were the choice in 60% patients. Different flaps were used according to the subunits. Mostly, dorsal nasal flaps, bilobed flaps, nasolabial flaps, and forehead flaps were used. Conclusion: The defect-only reconstruction principle was accepted in this study. Previously described subunits, such as the dorsum, tip, alar region, lateral wall, columella, and soft triangles, of the nose were further divided into subregions by their anatomical relations. An algorithm was planned with these sub regions. In nasal skin reconstruction, this algorithm helps in selection the methods for the best results and minimize the complications.
Gupta, Shishir Kumar; Yadav, Pavan Kumar; Tiwari, A K; Gandham, Ravi Kumar; Sahoo, A P
2016-09-01
The canine parvovirus NS1 (CPV2.NS1) protein selectively induces apoptosis in the malignant cells. However, for an effective in vivo tumor treatment strategy, an oncolytic agent also needs to induce a potent anti-tumor immune response. In the present study, we used poly (I:C), a TLR3 ligand, as an adjuvant along with CPV2.NS1 to find out if the combination can enhance the oncolytic activity by inducing a potent anti-tumor immune response. The 4T1 mammary carcinoma cells were used to induce mammary tumor in Balb/c mice. The results suggested that poly (I:C), when given along with CPV2.NS1, not only significantly reduced the tumor growth but also augmented the immune response against tumor antigen(s) as indicated by the increase in blood CD4+ and CD8+ counts and infiltration of immune cells in the tumor tissue. Further, blood serum analysis of the cytokines revealed that Th1 cytokines (IFN-γ and IL-2) were significantly upregulated in the treatment group indicating activation of cell-mediated immune response. The present study reports the efficacy of CPV2.NS1 along with poly (I:C) not only in inhibiting the mammary tumor growth but also in generating an active anti-tumor immune response without any visible toxicity. The results of our study may help in developing CPV2.NS1 and poly (I: C) combination as a cancer therapeutic regime to treat various malignancies.
International Nuclear Information System (INIS)
Sieskiewicz, A.; Mariak, Z.; Rogowski, M.; Lyson, T.
2008-01-01
Histopathological diagnosis of intraorbital tumors is of crucial value for planning further therapy. The aim of the study was to explore clinical utility of image-guided endoscopy for biopsy of orbital tumors. Trans-nasal endoscopic biopsy of intraorbital mass lesions was performed in 6 patients using a neuro-navigation system (Medtronic Stealth Station Treon plus). The CT and MRI 1 mm slice images were fused by the system in order to visualise both bony and soft tissue structures. The anatomic fiducial registration protocol was used during the procedure. All lesions were precisely localised and the biopsies could be taken from the representative part of the pathological mass. None of the patients developed aggravation of ocular symptoms after the procedure. The operative corridor as well as the size of orbital wall fenestration could be limited to a minimum. The accuracy of neuro-navigation remained high and stable during the entire procedure. The image-guided neuro-navigation system facilitated endoscopic localisation and biopsy of intraorbital tumors and contributed to the reduction of surgical trauma during the procedure. The technique was particularly useful in small, medially located, retrobulbar tumors and in unclear situations when the structure of the lesion resembled surrounding intraorbital tissue. (author)
Extranasopharyngeal angiofibroma of the posterior nasal septum: a rare clinical entity.
Atmaca, Sinan; Bayraktar, Cem; Yıldız, Levent
2013-01-01
Angiofibroma of extranasopharyngeal origin is very rare. Although it is usually originated from any mucosal structure in the head and neck region, maxilla is the most common involvement site. The nasal septum is an exceptional anatomic site of an angiofibroma. Surgery is the best treatment modality and recurrence is very rare. Nasal septal angiofibromas must be considered in the differential diagnosis of nasal vascular masses arising from the nasal septum. In this article, we report a 37-year-old male case with nasal septal angiofibroma who underwent surgical resection of the tumor. This is the 16th case in the literature.
Eileen K. Jenkins; Mallory T. DeChant; Erin B. Perry
2018-01-01
The impact of health, management, and microbiota on olfactory function in canines has not been examined in review. The most important characteristic of the detection canine is its sense of smell. Olfactory receptors are primarily located on the ethmoturbinates of the nasal cavity. The vomeronasal organ is an additional site of odor detection that detects chemical signals that stimulate behavioral and/or physiological changes. Recent advances in the genetics of olfaction suggest that genetic c...
Evaluation of prognostic markers for canine mast cell tumors treated with vinblastine and prednisone
Directory of Open Access Journals (Sweden)
Yuzbasiyan-Gurkan Vilma
2008-08-01
Full Text Available Abstract Background Canine cutaneous mast cell tumor (MCT is a common neoplastic disease associated with a variable biologic behavior. Surgery remains the primary treatment for canine MCT; however, radiation therapy (RT and chemotherapy are commonly used to treat aggressive MCT. The goals of this study were to evaluate the prognostic utility of histologic grade, c-KIT mutations, KIT staining patterns, and the proliferation markers Ki67 and AgNORs in dogs postoperatively treated with vinblastine and prednisone +/- RT, and to compare the outcome of dogs treated with post-operative chemotherapy +/- RT to that of a prognostically matched group treated with surgery alone. Associations between prognostic markers and survival were evaluated. Disease-free intervals (DFI and overall survival times (OS of dogs with similar pretreatment prognostic indices postoperatively treated with chemotherapy were compared to dogs treated with surgery alone. Results Histologic grade 3 MCTs, MCTs with c-KIT mutations, MCTs with increased cytoplasmic KIT, and MCTs with increased Ki67 and AgNOR values were associated with decreased DFI and OS. Dogs with histologic grade 3 MCT had significantly increased DFI and OS when treated with chemotherapy vs. surgery alone. Although not statistically significant due to small sample sizes, MCTs with c-KIT mutations had increased DFI and OS when treated with chemotherapy vs. surgery alone. Conclusion and clinical importance This study confirms the prognostic value of histologic grade, c-KIT mutations, KIT staining patterns, and proliferation analyses for canine MCT. Additionally, the results of this study further define the benefit of postoperative vinblastine and prednisone for histologic grade 3 MCTs.
DEFF Research Database (Denmark)
Guil-Luna, S.; Stenvang, Jan; Brünner, Nils
2014-01-01
and its isoforms in formalin-fixed, paraffin-embedded tissue samples from canine mammary lesions (4 dysplasias, 10 benign tumors, and 46 carcinomas) using 1-step SYBR Green quantitative real-time polymerase chain reaction (RT-qPCR). Progesterone receptor was expressed in 75% of dysplasias, all benign...... in the expression of isoform A versus B. Analysis of progesterone receptor mRNA isoforms by RT-qPCR was successful in routinely formalin-fixed, paraffin-embedded tissue samples and enabled the distribution of isoforms A and B to be identified for the first time in dysplasias, benign tumors, and malignant tumors...
Efficient adenovector CD40 ligand immunotherapy of canine malignant melanoma.
von Euler, Henrik; Sadeghi, Arian; Carlsson, Björn; Rivera, Patricio; Loskog, Angelica; Segall, Thomas; Korsgren, Olle; Tötterman, Thomas H
2008-05-01
Cutaneous canine melanomas are usually benign in contrast to human malignant melanoma. However, the canine oropharyngeal, uveal, and mucocutaneous neoplasms are aggressive and have metastatic potential. Surgery and to a lesser extent radiotherapy and chemotherapy are widely adopted treatments but are seldom curative in advanced stages. The similarities between human and canine melanoma make spontaneous canine melanoma an excellent disease model for exploring novel therapies. Herein, we report the first 2 adenovector CD40L immunogene (AdCD40L) treatments of aggressive canine malignant melanoma. Case no. 1 was an advanced stage III oral melanoma that was cured from malignant melanoma with 2 intratumor AdCD40L injections before cytoreductive surgery. After treatment, the tumor tissue was infiltrated with T lymphocytes and B lymphocytes suggesting immune activation. This dog survived 401 days after the first round of gene therapy and was free of melanoma at autopsy. Case no. 2 had a conjunctival malignant melanoma with a rapid progression. This case was treated with 6 AdCD40L injections over 60 days. One hundred and twenty days after start of gene therapy and 60 days after the last injection, the tumor had regressed dramatically, and the dog had a minimal tumor mass and no signs of progression or metastasis. Our results indicate that AdCD40L immunogene therapy is beneficial in canine malignant melanoma and could be considered for human malignant melanoma as well.
Combined endovascular and surgical treatment of melanoma of the nasal cavity: a case report
International Nuclear Information System (INIS)
Romero, A.; Delgado, F.; Ramos, M.; Bravo, F.
2000-01-01
Melanoma of the nasal cavity is a rare tumor with a worse prognosis than cutaneous melanoma. It usually presents as nasal obstruction and/or epistaxis. The observation of a pigmented mass in the nasal cavity is highly suggestive of this lesion. Computed tomography shows a mass with nonspecific features. In magnetic resonance studies, it has a characteristics signal consisting of hyperintensity of T1-weighted images and hypointensity on T2-weighted images, depending on the amount of melanin. The treatment of choice is surgical resection. We present a case of melanoma of the nasal cavity in which endovascular embolization of the tumor was performed prior to surgical treatment. (Author) 11 refs
Hwang, Kun
2012-03-01
The author created an innovative method of W-pushback and levator repositioning without having to make an incision to the nasal mucosa for submucous cleft palate repair.The W-shaped mucoperiosteal flap is outlined where the 2 peaks of W are the alveolar processes of both canine teeth and the midpoint of W is the anterior limit of the cleft notch of the hard palate. A short incision, medial to and behind the maxillary tuberosity and curved forward onto the palate and extended forward just medial to the alveolar process, is joined by a second incision from the apex of the cleft to the region of the canine tooth. The W-shaped mucoperiosteal flap is raised until the midline notch of the hard palate is exposed. The nasal mucosa and abnormally inserted levator veli palatini muscle to the posterior border of the hard palate bone are detached. By leaving the nasal mucosa intact, the detached levator veli palatini muscle is approximated at the midline and so the zona pellucida is obliterated. The cleft uvulas are cut in half and closed. The approximated W-flap is joined to the small anterior flap by 1 or more sutures (the W-pushback).Three patients were operated on with this technique without serious complications.The author believes that this method can make the levator sling and increase the length of the soft palate without making an incision to the nasal mucosa.
Risk factors for nasal malignancies in German men: the South-German Nasal cancer study.
Greiser, Eberhard M; Greiser, Karin Halina; Ahrens, Wolfgang; Hagen, Rudolf; Lazszig, Roland; Maier, Heinz; Schick, Bernhard; Zenner, Hans Peter
2012-11-06
There are few studies of the effects of nasal snuff and environmental factors on the risk of nasal cancer. This study aimed to investigate the impact of using nasal snuff and of other risk factors on the risk of nasal cancer in German men. A population-based case-control study was conducted in the German Federal States of Bavaria and Baden-Württemberg. Tumor registries and ear, nose and throat departments provided access to patients born in 1926 or later. Telephone interviews were conducted with 427 cases (mean age 62.1 years) and 2.401 population-based controls (mean age 60.8 years). Ever-use of nasal snuff was associated with an odds ratio (OR) for nasal cancer of 1.45 (95% confidence interval [CI] 0.88-2.38) in the total study population, whereas OR in smokers was 2.01 (95% CI 1.00-4.02) and in never smokers was 1.10 (95% CI 0.43-2.80). The OR in ever-smokers vs. never-smokers was 1.60 (95% CI 1.24-2.07), with an OR of 1.06 (95% CI 1.05-1.07) per pack-year smoked, and the risk was significantly decreased after quitting smoking. Exposure to hardwood dust for at least 1 year resulted in an OR of 2.33 (95% CI 1.40-3.91) in the total population, which was further increased in never-smokers (OR 4.89, 95% CI 1.92-12.49) in analyses stratified by smoking status. The OR for nasal cancer after exposure to organic solvents for at least 1 year was 1.53 (1.17-2.01). Ever-use of nasal sprays/nasal lavage for at least 1 month rendered an OR of 1.59 (1.04-2.44). The OR after use of insecticides in homes was 1.48 (95% CI 1.04-2.11). Smoking and exposure to hardwood dust were confirmed as risk factors for nasal carcinoma. There is evidence that exposure to organic solvents, and in-house use of insecticides could represent novel risk factors. Exposure to asbestos and use of nasal snuff were risk factors in smokers only.
Extraskeletal primary Ewing's scrcoma in the nasal cavity: A case report
Energy Technology Data Exchange (ETDEWEB)
Jeong, Bo Young; Park, Seok Won; Km, Eo Jin; Choi, Jong Sun; Lee, Eun Ja [Dongguk University College of Medicine, Ilsan Hospital, Goyang (Korea, Republic of)
2013-08-15
Ewing's sarcoma presents a rare tumor of the head and neck, and even rarer in the nasal cavity and/or paranasal sinuses. We report the case of Ewing's sarcoma in the nasal cavity, as presented with nasal obstruction and epistaxis. The CT and MRI examination reveals a mass in the left nasal cavity with extension to contralateral side, ethmoidal sinus, and nasopharynx. We provide an overview of Ewing's sarcoma in the nasal cavity and discuss radiologic findings of this unusual case.
Energy Technology Data Exchange (ETDEWEB)
Weller, R.E.
1994-03-01
An overview is provided for veterinary care of urogenital tumors in companion animals, especially the dog. Neoplasms discussed include tumors of the kidney, urinary bladder, prostate, testis, ovary, vagina, vulva and the canine transmissible venereal tumor. Topics addressed include description, diagnosis and treatment.
Effect of selenodiglutathione on the metabolism of canine mammary tumor cells
International Nuclear Information System (INIS)
Fico-Santoro, M.; Lebowitz, A.; Milner, J.A.
1986-01-01
Selenodiglutathione (SDG) has been shown to be an effective inhibitor of tumor growth. The present studies were designed to evaluate altered metabolism in canine mammary tumor cells (CMT-13) exposed to various concentrations of SDG. Addition of SDG at 0.025 μg Se/ml did not inhibit growth of CMT-13 cells after 24 h of incubation. At this concentration of SDG, approximately 25% of 75 Se- 35 S-SDG was retained in these tumor cells after 24 h of incubation. The nuclear fraction contained 96% of the 75 Se and 35 S radioactivity. The ratio of 75 Se to 35 S was 1 to 4.5 in the whole cell and in the nuclear fraction. SDG increased glutathione peroxidase activity by 40% compared to CMT-13 cells not exposed to SDG. Glutathione reductase activity was decreased by 63% by the addition of SDG. In addition, supplemental SDG resulted in a 55% decrease in GSH content but did not alter GSSG concentrations. After 4d of incubation, SDG at 0.1 and 0.5 μg Se/ml caused a 43 and 58% inhibition of growth of CMT-13 cells. Addition of GSH (100μM) partially prevented, 68% and 54%, the growth inhibition caused by SDG at concentrations of 0.1 and 0.5 μg Se per ml respectively during the 4d incubation period. Preincubation of CMT-13 cells with GSH for 48 h before addition of SDG (0.5 μg Se/ml) completely prevented the growth inhibition caused by this seleno-compound
Watanabe, Masashi; Tanaka, Kazuaki; Takizawa, Tatsuya; Segawa, Kazuhito; Neo, Sakurako; Tsuchiya, Ryo; Murata, Michiko; Murakami, Masaru; Hisasue, Masaharu
2014-01-01
A polymorphic tetranucleotide (GAAT)n microsatellite in the first intron of the canine tumor necrosis factor alpha (TNFA) gene was characterized in this study; 139 dogs were analyzed: 22 Beagles, 26 Chihuahuas, 20 Miniature Dachshunds, 24 Miniature Poodles, 22 Pembroke Welsh Corgis and 25 Shiba Inus. We detected the presence of the 4 alleles (GAAT)5, (GAAT)6, (GAAT)7 and (GAAT)8, including 9 of the 10 expected genotypes. The expected heterozygosity (He) and the polymorphic information content (PIC) value of this microsatellite locus varied from 0.389 to 0.749 and from 0.333 to 0.682, respectively, among the 6 breeds. The allelic frequency differed greatly among breeds, but this microsatellite marker was highly polymorphic and could be a useful marker for the canine TNFA gene.
Nguyen, D Tien; Ludlow, Martin; van Amerongen, Geert; de Vries, Rory D; Yüksel, Selma; Verburgh, R Joyce; Osterhaus, Albert D M E; Duprex, W Paul; de Swart, Rik L
2012-07-20
Inactivated paramyxovirus vaccines have been associated with hypersensitivity responses upon challenge infection. For measles and canine distemper virus (CDV) safe and effective live-attenuated virus vaccines are available, but for human respiratory syncytial virus and human metapneumovirus development of such vaccines has proven difficult. We recently identified three synthetic bacterial lipopeptides that enhance paramyxovirus infections in vitro, and hypothesized these could be used as adjuvants to promote immune responses induced by live-attenuated paramyxovirus vaccines. Here, we tested this hypothesis using a CDV vaccination and challenge model in ferrets. Three groups of six animals were intra-nasally vaccinated with recombinant (r) CDV(5804P)L(CCEGFPC) in the presence or absence of the infection-enhancing lipopeptides Pam3CSK4 or PHCSK4. The recombinant CDV vaccine virus had previously been described to be over-attenuated in ferrets. A group of six animals was mock-vaccinated as control. Six weeks after vaccination all animals were challenged with a lethal dose of rCDV strain Snyder-Hill expressing the red fluorescent protein dTomato. Unexpectedly, intra-nasal vaccination of ferrets with rCDV(5804P)L(CCEGFPC) in the absence of lipopeptides resulted in good immune responses and protection against lethal challenge infection. However, in animals vaccinated with lipopeptide-adjuvanted virus significantly higher vaccine virus loads were detected in nasopharyngeal lavages and peripheral blood mononuclear cells. In addition, these animals developed significantly higher CDV neutralizing antibody titers compared to animals vaccinated with non-adjuvanted vaccine. This study demonstrates that the synthetic cationic lipopeptides Pam3CSK4 and PHCSK4 not only enhance paramyxovirus infection in vitro, but also in vivo. Given the observed enhancement of immunogenicity their potential as adjuvants for other live-attenuated paramyxovirus vaccines should be considered
Nasal cytochrome P4502A: Identification in rats and humans
Energy Technology Data Exchange (ETDEWEB)
Thornton-Manning, J.R.; Hotchkiss, J.A. [Michigan State Univ., East Lansing, MI (United States); Ding, Xinxin [Wadsworth Center for Laboratories and Research, Albany, NY (United States)] [and others
1995-12-01
The nasal mucosa, the first tissue of contact for inhaled xenobiotics, possesses substantial enobiotic-metabolizing capacti. Enzymes of the nasal cavity may metabolize xenobiotics to innocuous, more water-soluble compounds that are eliminated from the body, or they may bioactivate them to toxic metabolites. These toxic metabolites may find to cellular macromolecules in the nasal cavity or be transported to other parts of the body where they may react. Nasal carcinogenesis in rodents often results from bioactivation of xenobiotics. The increased incidences of nasal tumors associated with certain occupations suggest that xenobiotic bioactivation may be important in human nasal cancer etiology, as well. The increasing popularity of the nose as a route of drug administration makes information concerning nasal drug metabolism and disposition vital to accomplish therapeutic goals. For these reasons, the study of xenobiotic-met abolizing capacity of the nasal cavity is an important area of health-related research. In the present study, we have confirmed the presence of CYP2A6 mRNA in human respiratory mucosa.
Scanning electron microscopy of primary bone tumors
International Nuclear Information System (INIS)
Pool, R.R.; Kerner, B.
1975-01-01
Critical-point-drying of tumor tissue fixed in a glutaraldehyde-paraformaldehyde solution and viewed by scanning electron microscopy (SEM) provides a 3-dimensional view of tumor cells and their matrices. This report describes the SEM appearance of three primary bone tumors: a canine osteosarcoma of the distal radius, a feline chondrosarcoma of the proximal tibia and a canine fibrosarcoma of the proximal humerus. The ultrastructural morphology is compared with the histologic appearance of each tumor
International Nuclear Information System (INIS)
Bradshaw, Tyler; Jeraj, Robert; Fu, Rau; Zhu, Jun; Bowen, Stephen; Forrest, Lisa
2015-01-01
Dose painting relies on the ability of functional imaging to identify resistant tumor subvolumes to be targeted for additional boosting. This work assessed the ability of FDG, FLT, and Cu-ATSM PET imaging to predict the locations of residual FDG PET in canine tumors following radiotherapy. Nineteen canines with spontaneous sinonasal tumors underwent PET/CT imaging with radiotracers FDG, FLT, and Cu-ATSM prior to hypofractionated radiotherapy. Therapy consisted of 10 fractions of 4.2 Gy to the sinonasal cavity with or without an integrated boost of 0.8 Gy to the GTV. Patients had an additional FLT PET/CT scan after fraction 2, a Cu-ATSM PET/CT scan after fraction 3, and follow-up FDG PET/CT scans after radiotherapy. Following image registration, simple and multiple linear and logistic voxel regressions were performed to assess how well pre- and mid-treatment PET imaging predicted post-treatment FDG uptake. R 2 and pseudo R 2 were used to assess the goodness of fits. For simple linear regression models, regression coefficients for all pre- and mid-treatment PET images were significantly positive across the population (P < 0.05). However, there was large variability among patients in goodness of fits: R 2 ranged from 0.00 to 0.85, with a median of 0.12. Results for logistic regression models were similar. Multiple linear regression models resulted in better fits (median R 2 = 0.31), but there was still large variability between patients in R 2 . The R 2 from regression models for different predictor variables were highly correlated across patients (R ≈ 0.8), indicating tumors that were poorly predicted with one tracer were also poorly predicted by other tracers. In conclusion, the high inter-patient variability in goodness of fits indicates that PET was able to predict locations of residual tumor in some patients, but not others. This suggests not all patients would be good candidates for dose painting based on a single biological target. (paper)
Directory of Open Access Journals (Sweden)
Ali MRK
2016-09-01
Full Text Available Moustafa R K Ali,1 Ibrahim M Ibrahim,2,† Hala R Ali,2,3 Salah A Selim,2 Mostafa A El-Sayed1,4 1School of Chemistry and Biochemistry, Georgia Institute of Technology, and Laser Dynamics Laboratory, Atlanta, GA, USA; 2Department of Veterinary Medicine, Cairo University, Giza, Cairo, Egypt; 3Department of Bacteriology and Immunology, Animal Health Research Institute (AHRI, Dokki, Giza, Egypt; 4School of Chemistry, King Abdul Aziz University, Jeddah, Saudi Arabia †Ibrahim M Ibrahim passed away on August 23, 2015 Abstract: Plasmonic photothermal therapy (PPTT is a cancer therapy in which gold nanorods are injected at the site of a tumor before near-infrared light is transiently applied to the tumor causing localized cell death. Previously, PPTT studies have been carried out on xenograft mice models. Herein, we report a study showing the feasibility of PPTT as applied to natural tumors in the mammary glands of dogs and cats, which more realistically represent their human equivalents at the molecular level. We optimized a regime of three low PPTT doses at 2-week intervals that ablated tumors mainly via apoptosis in 13 natural mammary gland tumors from seven animals. Histopathology, X-ray, blood profiles, and comprehensive examinations were used for both the diagnosis and the evaluation of tumor statuses before and after treatment. Histopathology results showed an obvious reduction in the cancer grade shortly after the first treatment and a complete regression after the third treatment. Blood tests showed no obvious change in liver and kidney functions. Similarly, X-ray diffraction showed no metastasis after 1 year of treatment. In conclusion, our study suggests the feasibility of applying the gold nanorods-PPTT on natural tumors in dogs and cats without any relapse or toxicity effects after 1 year of treatment. Keywords: gold nanorods, natural mammary tumors, plasmonic photothermal therapy, canine, feline
Gatti, Monica; Wurth, Roberto; Vito, Guendalina; Pattarozzi, Alessandra; Campanella, Chiara; Thellung, Stefano; Maniscalco, Lorella; De Maria, Raffaella; Villa, Valentina; Corsaro, Alessandro; Nizzari, Mario; Bajetto, Adriana; Ratto, Alessandra; Ferrari, Angelo; Barbieri, Federica; Florio, Tullio
2016-05-01
Cancer stem cells (CSCs) represent a small subpopulation of cells responsible for tumor formation and progression, drug resistance, tumor recurrence and metastasization. CSCs have been identified in many human tumors including osteosarcoma (OSA). CSC distinctive properties are the expression of stem cell markers, sustained growth, self-renewal and tumorigenicity. Here we report the isolation of stem-like cells from two canine OSA cultures, characterized by self-renewal, evaluated by sphere formation ability, differential marker expression, and in vitro proliferation when cultured in a medium containing EGF and bFGF. Current therapies for OSA increased survival time, but prognosis remains poor, due to the development of drug resistance and metastases. Chemotherapy shrinks the tumor mass but CSCs remain unaffected, leading to tumor recurrence. Metformin, a drug for type 2 diabetes, has been shown to possess antitumor properties affecting CSC survival in different human and animal cancers. Here we show that metformin has a significant antiproliferative effect on canine OSA stem-like cells, validating this in vitro model for further pre-clinical drug evaluations. In conclusion, our results demonstrate the feasibility of obtaining CSC-enriched cultures from primary canine OSA cells as a promising model for biological and pharmacological studies of canine and human OSAs.
Preclinical evaluation of oncolytic vaccinia virus for therapy of canine soft tissue sarcoma.
Directory of Open Access Journals (Sweden)
Ivaylo Gentschev
Full Text Available Virotherapy using oncolytic vaccinia virus (VACV strains is one promising new strategy for canine cancer therapy. In this study we describe the establishment of an in vivo model of canine soft tissue sarcoma (CSTS using the new isolated cell line STSA-1 and the analysis of the virus-mediated oncolytic and immunological effects of two different Lister VACV LIVP1.1.1 and GLV-1h68 strains against CSTS. Cell culture data demonstrated that both tested VACV strains efficiently infected and destroyed cells of the canine soft tissue sarcoma line STSA-1. In addition, in our new canine sarcoma tumor xenograft mouse model, systemic administration of LIVP1.1.1 or GLV-1h68 viruses led to significant inhibition of tumor growth compared to control mice. Furthermore, LIVP1.1.1 mediated therapy resulted in almost complete tumor regression and resulted in long-term survival of sarcoma-bearing mice. The replication of the tested VACV strains in tumor tissues led to strong oncolytic effects accompanied by an intense intratumoral infiltration of host immune cells, mainly neutrophils. These findings suggest that the direct viral oncolysis of tumor cells and the virus-dependent activation of tumor-associated host immune cells could be crucial parts of anti-tumor mechanism in STSA-1 xenografts. In summary, the data showed that both tested vaccinia virus strains and especially LIVP1.1.1 have great potential for effective treatment of CSTS.
... Caregivers Contact ARS HOME ANATOMY Nasal Anatomy Sinus Anatomy Nasal Physiology Nasal Endoscopy Skull Base Anatomy Virtual Anatomy Disclosure ... Patient Education About this Website Font Size + - Home > ANATOMY > Nasal Physiology Nasal Anatomy Sinus Anatomy Nasal Physiology Nasal Endoscopy ...
... Caregivers Contact ARS HOME ANATOMY Nasal Anatomy Sinus Anatomy Nasal Physiology Nasal Endoscopy Skull Base Anatomy Virtual Anatomy Disclosure ... Size + - Home > ANATOMY > Nasal Anatomy Nasal Anatomy Sinus Anatomy Nasal Physiology Nasal Endoscopy Skull Base Anatomy Virtual Anatomy Disclosure ...
[Nasal glial heterotopia: Clinical and morphological characteristics].
Bykova, V P; Bakhtin, A A; Polyakov, D P; Yunusov, A S; Daikhes, N A
The paper describes a case of nasal glial heterotopia in a 10-month-old girl with a mixed (intranasal and subcutaneous) localization, which is accompanied by the divergence of the nasal bones. Histological examination supplemented by immunohistochemical reactions with antibodies to vimentin, S100 protein, neuron-specific enolase, as well as Ki-67 and smooth muscle actin confirmed the neural nature of the tumor. Fields of mature astrocytic glia including individual cells with neuronal differentiation were found among the fibrous and fibrovascular tissues. The paper provides a brief overview of the discussed pathology.
Studies on the position of canines, premolars and molars by 450 .deg. oblique lateral cephalography
Energy Technology Data Exchange (ETDEWEB)
Ahn, Hyung Kyu [Department of Radiology, College of Dentistry, Seoul National University, Seoul (Korea, Republic of)
1976-11-15
This study was done using the 45 .deg. oblique lateral cephalograms of 20 year old, 18 male and 27 female, with normal occlusion, on canines, premolars, premolars and molars on upper and lower jaws. Axial inclination to nasal floor, occlusal plane and mandibular plane, and inter-axial inclination were examined. In addition the position of each tooth was examined in height and depth in upper and lower jaws. The results were obtained as follows; 1. The inclination of long axis of upper lst premolar was most nearly perpendicular, upper canine was tilted mesially, and 2nd premolar and molars were tilted distally. 2. The inclination of long axis of lower molars were tilted mesially. 3. There were no severe variation on the inter-axial inclination of canine to 2nd molar.
Studies on the position of canines, premolars and molars by 450 .deg. oblique lateral cephalography
International Nuclear Information System (INIS)
Ahn, Hyung Kyu
1976-01-01
This study was done using the 45 .deg. oblique lateral cephalograms of 20 year old, 18 male and 27 female, with normal occlusion, on canines, premolars, premolars and molars on upper and lower jaws. Axial inclination to nasal floor, occlusal plane and mandibular plane, and inter-axial inclination were examined. In addition the position of each tooth was examined in height and depth in upper and lower jaws. The results were obtained as follows; 1. The inclination of long axis of upper lst premolar was most nearly perpendicular, upper canine was tilted mesially, and 2nd premolar and molars were tilted distally. 2. The inclination of long axis of lower molars were tilted mesially. 3. There were no severe variation on the inter-axial inclination of canine to 2nd molar.
Nasal packing with ventilated nasal packs; a comparison with traditional vaseline nasal pack
International Nuclear Information System (INIS)
Alam, J.; Siddiqui, M.W.; Abbas, A.; Sami, M.; Ayub, Z.
2017-01-01
To compare the benefits of ventilated nasal packing with traditional vaseline guaze nasal packing. Study Design: Randomized controlled trial. Place and Duration of Study: This study was conducted at CMH Multan, from Jun 2014 to Dec 2014. Material and Methods: In this study, sample size of 80 patients was calculated using WHO calculator. Patients were divided in two groups using lottery method endotracheal tube and piece of surgical glove filled with ribbon guaze was utilized for fabricated ventilated nasal pack and compared with traditional nasal packs. Nasal obstruction and sleep disturbance were studied at eight hours and twenty-four hours following surgery using visual analog scale. Results: Mean nasal obstruction with ventilated nasal pack was 45.62 +- 6.17 and with Vaseline nasal pack was 77.67 +- 4.85 which was statistically significant (p=0.001) in both the groups. Mean sleep disturbance in both the groups was 46.32 +- 5.23 and 68.75 +- 2.70 respectively which was statistically significant (p=0.001) in both the groups. Conclusion: Patients with ventilated nasal packs were found to have better tolerance to nasal packs due to less nasal obstruction and sleep disturbance
Rødal, Jan; Rusten, Espen; Søvik, Åste; Skogmo, Hege Kippenes; Malinen, Eirik
2013-10-01
Radiotherapy causes alterations in tumor biology, and non-invasive early assessment of such alterations may become useful for identifying treatment resistant disease. The purpose of the current work is to assess changes in vascular and metabolic features derived from functional imaging of canine head and neck tumors during fractionated radiotherapy. Material and methods. Three dogs with spontaneous head and neck tumors received intensity-modulated radiotherapy (IMRT). Contrast-enhanced cone beam computed tomography (CE-CBCT) at the treatment unit was performed at five treatment fractions. Dynamic (18)FDG-PET (D-PET) was performed prior to the start of radiotherapy, at mid-treatment and at 3-12 weeks after the completion of treatment. Tumor contrast enhancement in the CE-CBCT images was used as a surrogate for tumor vasculature. Vascular and metabolic tumor parameters were further obtained from the D-PET images. Changes in these tumor parameters were assessed, with emphasis on intra-tumoral distributions. Results. For all three patients, metabolic imaging parameters obtained from D-PET decreased from the pre- to the inter-therapy session. Correspondingly, for two of three patients, vascular imaging parameters obtained from both CE-CBCT and D-PET increased. Only one of the tumors showed a clear metabolic response after therapy. No systematic changes in the intra-tumor heterogeneity in the imaging parameters were found. Conclusion. Changes in vascular and metabolic parameters could be detected by the current functional imaging methods. Vascular tumor features from CE-CBCT and D-PET corresponded well. CE-CBCT is a potential method for easy response assessment when the patient is at the treatment unit.
DEFF Research Database (Denmark)
Clausen, Malene M.; Hansen, Anders Elias; af Rosenschold, Per Munck
2013-01-01
: Positron emission tomography/computed tomography (PET/CT) scans of five spontaneous canine solid tumors were included. FDG-PET/CT was obtained at day 1, 64Cu-ATSM at day 2 and 3 (3 and 24 h pi.). GTV was delineated and CT images were co-registered. Sub-volumes for 3 h and 24 h 64Cu-ATSM (Cu3 and Cu24) were...
Javanbakht, J; Pedram, B; Taheriyan, M R; Khadivar, F; Hosseini, S H; Abdi, F S; Hosseini, E; Moloudizargari, M; Aghajanshakeri, S H; Javaherypour, S; Shafiee, R; Emrani Bidi, R
2014-06-01
In this study, 12 dogs affected by canine transmissible venereal tumor (CTVT) and testicular seminoma tumor were studied retrospectively. The cytological sample was smeared onto a glass slide and either air-dried for May-Grünwald-stain, and masses were surgically removed. The tumors were grossly examined, and sections of 4-μm thick were obtained from each sample and stained with H&E. For chemotherapy, vincristine sulfate was administered weekly as an infusion over 3 min via the cephalic vein at a dose of 0.025 mg/kg after diluting with physiological saline to a total amount of 10 ml. If no remission was observed after 8 weeks, chemotherapy was continued with weekly doxorubicin infusion at a dose of 1 mg/kg. All the tumor samples were divided into four cytohistopathologic groups, namely: multilobular (six cases), papillary (two cases), pedunculated (two cases), and tubular (two cases of seminoma). The most frequently represented tumor type was multilobular (6/10, 60 %) followed by pedunculated (2/10, 20 %), papillary (2/10, 20 %), and tubular (two cases of seminoma, 100 %). Cytological smears from eight tumors in regression after chemotherapy were poorly cellular, and many cells were fragmented. In two progressive tumors, there was an average of 1,406 ± 972 CTVT 200 cells/μl or 96.71 % of total cells counted. Thus, tumor cells represented 96.71 % of total cells within the biopsy specimens and the leukocytes 4.29 % (leukocyte, tumor cell ratio=0.062 ± 0.031). In eight regressive tumors, there was an average of 1,245 ± 1,032 CTVT 200 cells/μl or 97.31 % of total cells counted. Thus, tumor cells represented 97.31 % of total cells and leukocytes 2.69 % (leukocyte, tumor cell ratio=0.071 ± 0.174). Our data suggested that combination treatment with vincristine and doxorubicin in the future could be an excellent therapeutic alternative for the treatment of TVT for probably reducing the resistance to vincristine, and also, treatment success could easily be followed
Directory of Open Access Journals (Sweden)
Roseane de A Portela
2010-10-01
Full Text Available Este trabalho descreve as doenças das fossas nasais diagnosticadas em ruminantes no Hospital Veterinário da Universidade Federal de Campina Grande, em Patos, Paraíba, nos anos de 2003-2009. No período foram registrados três diagnósticos de doenças das fossas nasais de bovinos, três em caprinos e nove em ovinos (de um total de 404 diagnósticos em bovinos, 330 em caprinos e 338 em ovinos. Descrevem-se um caso de rinite atópica em bovinos, sete surtos de conidiobolomicose e dois de pitiose rinofacial em ovinos, dois casos de prototecose e um de aspergilose nasal em caprinos e um mixoma e um fibrossarcoma em bovinos. Adicionalmente, é realizada uma revisão de outras doenças das fossas nasais de ruminantes descritas em outras regiões do Brasil, incluindo oestrose, rinosporidiose, carcinoma epidermóide e tumor etmoidal enzoótico.This paper reports diseases of the nasal cavity diagnosed in ruminants in the Veterinary Hospital of the Federal University of Campina Grande, in Patos, state of Paraiba, northeastern Brazil, from 2003 to 2009. During that period three cases or outbreaks of diseases of the nasal cavity were reported in cattle, three in goats and nine in sheep (out of 404 diseases diagnosed in cattle, 330 in goats, and 338 in sheep. At all are reported one case of atopic rhinitis in cattle, seven outbreaks of conidiobolomycosis and two outbreaks of rhinofacial pythiosis in sheep, two cases of protothecosis and one of nasal aspergillosis in goats, and a myxoma and a fibrosarcoma in cattle. Additionally, other diseases of the nasal cavity reported in Brazil are reviewed, including oestrosis, rhinosporidiosis, squamous cell carcinoma, and enzootic ethmoidal tumor.
Angstadt, Andrea Y; Motsinger-Reif, Alison; Thomas, Rachael; Kisseberth, William C; Guillermo Couto, C; Duval, Dawn L; Nielsen, Dahlia M; Modiano, Jaime F; Breen, Matthew
2011-11-01
Osteosarcoma (OS) is the most commonly diagnosed malignant bone tumor in humans and dogs, characterized in both species by extremely complex karyotypes exhibiting high frequencies of genomic imbalance. Evaluation of genomic signatures in human OS using array comparative genomic hybridization (aCGH) has assisted in uncovering genetic mechanisms that result in disease phenotype. Previous low-resolution (10-20 Mb) aCGH analysis of canine OS identified a wide range of recurrent DNA copy number aberrations, indicating extensive genomic instability. In this study, we profiled 123 canine OS tumors by 1 Mb-resolution aCGH to generate a dataset for direct comparison with current data for human OS, concluding that several high frequency aberrations in canine and human OS are orthologous. To ensure complete coverage of gene annotation, we identified the human refseq genes that map to these orthologous aberrant dog regions and found several candidate genes warranting evaluation for OS involvement. Specifically, subsequenct FISH and qRT-PCR analysis of RUNX2, TUSC3, and PTEN indicated that expression levels correlated with genomic copy number status, showcasing RUNX2 as an OS associated gene and TUSC3 as a possible tumor suppressor candidate. Together these data demonstrate the ability of genomic comparative oncology to identify genetic abberations which may be important for OS progression. Large scale screening of genomic imbalance in canine OS further validates the use of the dog as a suitable model for human cancers, supporting the idea that dysregulation discovered in canine cancers will provide an avenue for complementary study in human counterparts. Copyright © 2011 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Mariana B. Mascarenhas
Full Text Available ABSTRACT: Canine transmissible venereal tumor (CTVT is a naturally occurring contagious round-cell neoplasia, with poorly understood origin and transmission. This study aims to further investigate the tumor nature through immunohistochemistry, lectin histochemistry and transmission electron microscopy (TEM analysis, and to provide support for diagnostic and differential diagnoses of CTVT. Immunohistochemistry was performed in 10 genital and six exclusively extragenital tumors, which were previously diagnosed by citology and histopathology. CTVT samples were incubated with biotinylated antibodies to specific membrane and cytoplasmic antigens (anti-lysozyme, anti-macrophage, anti-vimentin, anti-CD18, monoclonal anti-CD117, monoclonal anti-CD3, polyclonal anti-CD117, polyclonal CD3 and anti-CD79a, followed by the avidin-biotin-peroxidase complex technique. The lectins Con A, DBA, SBA, PNA, UEA-1, WGA, sWGA, GSL, JSA, PSA, PHA-L, PHA-E and RCA were additionally tested in four genital CTVTs and TEM was performed in eight genital tumors. The anti-vimentin antibody revealed strong immunoreactivity to neoplastic cells in all the assessed samples (16/16. The polyclonal anti-CD3 antibodies showed moderate to strong immunoreactivity in fourteen (14/16 and the polyclonal anti-CD117 in fifteen cases (15/16. There was no immunoreactivity to anti-lysozyme, anti-macrophage, anti-CD18, monoclonal anti-CD117, monoclonal anti-CD3 and anti-CD79a antibodies. At lectin histochemistry, it was observed strong staining of tumor cells to Con-A, PHA-L and RCA. There was no histopathological and immunoreactivity differences between genital and extragenital CTVTs. These findings do not support the hypothesis of histiocytic origin of CTVT. In contrast, the lectin histochemical results were similar to cells from lymphoid/myeloid origin.
International Nuclear Information System (INIS)
Pang, Lisa Y.; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J.
2011-01-01
Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology
Energy Technology Data Exchange (ETDEWEB)
Pang, Lisa Y., E-mail: lisa.pang@ed.ac.uk; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J. [Royal (Dick) School of Veterinary Studies and Roslin Institute, The University of Edinburgh, Easter Bush, Midlothian, EH25 9RG (United Kingdom)
2011-03-30
Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology.
Intra- and interspecies gene expression models for predicting drug response in canine osteosarcoma.
Fowles, Jared S; Brown, Kristen C; Hess, Ann M; Duval, Dawn L; Gustafson, Daniel L
2016-02-19
Genomics-based predictors of drug response have the potential to improve outcomes associated with cancer therapy. Osteosarcoma (OS), the most common primary bone cancer in dogs, is commonly treated with adjuvant doxorubicin or carboplatin following amputation of the affected limb. We evaluated the use of gene-expression based models built in an intra- or interspecies manner to predict chemosensitivity and treatment outcome in canine OS. Models were built and evaluated using microarray gene expression and drug sensitivity data from human and canine cancer cell lines, and canine OS tumor datasets. The "COXEN" method was utilized to filter gene signatures between human and dog datasets based on strong co-expression patterns. Models were built using linear discriminant analysis via the misclassification penalized posterior algorithm. The best doxorubicin model involved genes identified in human lines that were co-expressed and trained on canine OS tumor data, which accurately predicted clinical outcome in 73 % of dogs (p = 0.0262, binomial). The best carboplatin model utilized canine lines for gene identification and model training, with canine OS tumor data for co-expression. Dogs whose treatment matched our predictions had significantly better clinical outcomes than those that didn't (p = 0.0006, Log Rank), and this predictor significantly associated with longer disease free intervals in a Cox multivariate analysis (hazard ratio = 0.3102, p = 0.0124). Our data show that intra- and interspecies gene expression models can successfully predict response in canine OS, which may improve outcome in dogs and serve as pre-clinical validation for similar methods in human cancer research.
Single-stage osseointegrated implants for nasal prosthodontic rehabilitation: A clinical report.
de Carvalho, Bruna M D F; Freitas-Pontes, Karina M; de Negreiros, Wagner A; Verde, Marcus A R L
2015-08-01
Malignant tumors in the nasal region may be treated by means of invasive surgical procedures, with large facial losses. Nasal prostheses, retained by osseointegrated facial implants, instead of plastic surgery, will, in most patients, offer good biomechanical and cosmetic results. This clinical report describes the prosthetic rehabilitation of a patient with nasal cancer who had the entire nasal vestibule removed in a single-stage surgical procedure in order to shorten the rehabilitation time. The nasal prosthesis was built on a 3-magnet bar and was made of platinum silicone with intrinsic pigmentation, thereby restoring the patient's appearance and self-esteem. The authors concluded that single-stage implants may reduce the rehabilitation time to as little as 1 month, and the correct use of materials and techniques may significantly improve the nasal prosthesis. Copyright © 2015 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.
Seelig, Davis M; Ito, Daisuke; Forster, Colleen L; Yoon, Una A; Breen, Matthew; Burns, Linda J; Bachanova, Veronika; Lindblad-Toh, Kerstin; O'Brien, Timothy D; Schmechel, Stephen C; Rizzardi, Anthony E; Modiano, Jaime F; Linden, Michael A
2017-07-01
Activation of the classical nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) pathway is a common molecular event observed in both human and canine diffuse large B-cell lymphoma (DLBCL). Although the oncogenic potential of the alternative NFκB pathway (ANFκBP) has also been recently identified in DLBCL, its precise role in tumor pathogenesis and potential as a treatment target is understudied. We hypothesized that up-regulation of the ANFκBP plays an important role in the proliferation and survival of canine DLBCL cells, and we demonstrate that the ANFκBP is constitutively active in primary canine DLBCL samples and a cell line (CLBL1). We further demonstrate that a small interfering RNA inhibits the activation of the NFκB pathway and induces apoptosis in canine DLBCL cells. In conclusion, the ANFκBP facilitates survival of canine DLBCL cells, and thus, dogs with spontaneous DLBCL can provide a useful large animal model to study therapies targeting the ANFκBP.
Brinster, Lauren R; Omeir, Romelda L; Foseh, Gideon S; Macauley, Juliete N; Snoy, Philip J; Beren, Joel J; Teferedegne, Belete; Peden, Keith; Lewis, Andrew M
2013-08-01
Tumors that formed in newborn nude mice that were inoculated with 10(7) Madin-Darby canine kidney (MDCK) cells were associated with a failure-to-thrive (FTT) syndrome consisting of growth retardation, lethargy, weakness, and dehydration. Scoliosis developed in 41% of affected pups. Pups were symptomatic by week 2; severely affected pups became moribund and required euthanasia within 3 to 4 wk. Mice with FTT were classified into categories of mild, moderate, and severe disease by comparing their weight with that of age-matched normal nude mice. The MDCK-induced tumors were adenocarcinomas that invaded adjacent muscle, connective tissue, and bone; 6 of the 26 pups examined had lung metastases. The induction of FTT did not correlate with cell-line aggressiveness as estimated by histopathology or the efficiency of tumor formation (tumor-forming dose 50% endpoint range = 10(2.8) to 10(7.5)); however, tumor invasion of the paravertebral muscles likely contributed to the scoliosis noted. In contrast to the effect of MDCK cells, tumor formation observed in newborn mice inoculated with highly tumorigenic, human-tumor-derived cell lines was not associated with FTT development. We suggest that tumor formation and FTT are characteristics of these MDCK cell inocula and that FTT represents a new syndrome that may be similar to the cachexia that develops in humans with cancer or other diseases.
International Nuclear Information System (INIS)
Kodama, Atsushi; Yanai, Tokuma; Sakai, Hiroki; Matsuura, Satoko; Murakami, Mami; Murai, Atsuko; Mori, Takashi; Maruo, Kouji; Kimura, Tohru; Masegi, Toshiaki
2009-01-01
Human hemangiosarcoma (HSA) tends to have a poor prognosis; its tumorigenesis has not been elucidated, as there is a dearth of HSA clinical specimens and no experimental model for HSA. However, the incidence of spontaneous HSA is relatively high in canines; therefore, canine HSA has been useful in the study of human HSA. Recently, the production of angiogenic growth factors and their receptors in human and canine HSA has been reported. Moreover, the growth-factor environment of HSA is very similar to that of pathophysiological angiogenesis, which some homeobox genes regulate in the transcription of angiogenic molecules. In the present study, we established 6 xenograft canine HSA tumors and detected the expression of growth factors, their receptors, and angiogenic homeobox genes. Six primary canine HSAs were xenografted to nude mice subcutaneously and serially transplanted. Subsequently, the expressions of vascular endothelial growth factor (VEGF)-A, basic fibroblast growth factors (bFGF), flt-1 and flk-1 (receptors of VEGF-A), FGFR-1, and angiogenic homeobox genes HoxA9, HoxB3, HoxB7, HoxD3, Pbx1, and Meis1 were investigated in original and xenograft tumors by histopathology, immunostaining, and reverse transcription polymerase chain reaction (RT-PCR), using canine-specific primer sets. Histopathologically, xenograft tumors comprised a proliferation of neoplastic cells that were varied in shape, from spindle-shaped and polygonal to ovoid; some vascular-like structures and vascular clefts of channels were observed, similar to those in the original tumors. The expression of endothelial markers (CD31 and vWF) was detected in xenograft tumors by immunohistochemistry and RT-PCR. Moreover, the expression of VEGF-A, bFGF, flt-1, flk-1, FGFR-1, HoxA9, HoxB3, HoxB7, HoxD3, Pbx1, and Meis1 was detected in xenograft tumors. Interestingly, expressions of bFGF tended to be higher in 3 of the xenograft HSA tumors than in the other tumors. We established 6 xenograft canine HSA
MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.
Lopez, Cecilia M; Yu, Peter Y; Zhang, Xiaoli; Yilmaz, Ayse Selen; London, Cheryl A; Fenger, Joelle M
2018-01-01
Osteosarcoma (OSA) is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease. RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes. These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.
MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.
Directory of Open Access Journals (Sweden)
Cecilia M Lopez
Full Text Available Osteosarcoma (OSA is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease.RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes.These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.
WATANABE, Masashi; TANAKA, Kazuaki; TAKIZAWA, Tatsuya; SEGAWA, Kazuhito; NEO, Sakurako; TSUCHIYA, Ryo; MURATA, Michiko; MURAKAMI, Masaru; HISASUE, Masaharu
2013-01-01
ABSTRACT A polymorphic tetranucleotide (GAAT)n microsatellite in the first intron of the canine tumor necrosis factor alpha (TNFA) gene was characterized in this study; 139 dogs were analyzed: 22 Beagles, 26 Chihuahuas, 20 Miniature Dachshunds, 24 Miniature Poodles, 22 Pembroke Welsh Corgis and 25 Shiba Inus. We detected the presence of the 4 alleles (GAAT)5, (GAAT)6, (GAAT)7 and (GAAT)8, including 9 of the 10 expected genotypes. The expected heterozygosity (He) and the polymorphic informatio...
Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines
Directory of Open Access Journals (Sweden)
Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman
2011-01-01
Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.
Atypical primary meningioma in the nasal septum with malignant transformation and distant metastasis
International Nuclear Information System (INIS)
Baek, Byoung Joon; Shin, Jae–Min; Lee, Chi Kyou; Lee, Ji Hye; Lee, Koen Hyeong
2012-01-01
Primary extracranial meningiomas (PEMs) originating from the nasal septum are extremely rare, as are extracranial metastases of meningiomas. A 44-year-old male presented with a 2-month history of left-side nasal obstruction and frequent episodes of epistaxis. A friable mass originating from the nasal septum was resected completely via an endoscopic endonasal approach. According to WHO criteria, the tumor was diagnosed as an atypical meningioma radiologically and histopathologically. Two years later, a tumor recurred at the primary site with the same histopathological findings, and the patient was given local external radiotherapy (6840 cGy in 38 fractions). Two months after this local recurrence, a left anterior chest wall mass and a left parietal area scalp mass were observed. The subcutaneous mass was resected and showed histological evidence of malignant transformation. Several months after the last operation, the patient died. We describe the clinical, radiological, and bio-pathological features of this unique case and review the literature on atypical PEMs originating in the nasal septum. To our knowledge, this is the first reported case of an atypical PEM originating from the nasal septum that recurred with malignant transformation and extracranial metastasis
Energy Technology Data Exchange (ETDEWEB)
Moran, Jean M. [Univ. of Idaho, Idaho Falls, ID (United States)
1992-02-01
Calculations of radiation flux and dose distributions for Boron Neutron Capture Therapy (BNCT) of brain tumors are typically performed using sophisticated three-dimensional analytical models based on either a homogeneous approximation or a simplified few-region approximation to the actual highly-heterogeneous geometry of the irradiation volume. Such models should be validated by comparison with calculations using detailed models in which all significant macroscopic tissue heterogeneities and geometric structures are explicitly represented as faithfully as possible. This work describes a validation exercise for BNCT of canine brain tumors. Geometric measurements of the canine anatomical structures of interest for this work were performed by dissecting and examining two essentially identical Labrador Retriever heads. Chemical analyses of various tissue samples taken during the dissections were conducted to obtain measurements of elemental compositions for tissues of interest. The resulting geometry and tissue composition data were then used to construct a detailed heterogeneous calculational model of the Labrador Retriever head. Calculations of three-dimensional radiation flux distributions pertinent to BNCT were performed for the model using the TORT discrete-ordinates radiation transport code. The calculations were repeated for a corresponding volume-weighted homogeneous tissue model. Comparison of the results showed that the peak neutron and photon flux magnitudes were quite similar for the two models (within 5%), but that the spatial flux profiles were shifted in the heterogeneous model such that the fluxes in some locations away from the peak differed from the corresponding fluxes in the homogeneous model by as much as 10-20%. Differences of this magnitude can be therapeutically significant, emphasizing the need for proper validation of simplified treatment planning models.
International Nuclear Information System (INIS)
Moran, J.M.
1992-02-01
Calculations of radiation flux and dose distributions for Boron Neutron Capture Therapy (BNCT) of brain tumors are typically performed using sophisticated three-dimensional analytical models based on either a homogeneous approximation or a simplified few-region approximation to the actual highly-heterogeneous geometry of the irradiation volume. Such models should be validated by comparison with calculations using detailed models in which all significant macroscopic tissue heterogeneities and geometric structures are explicitly represented as faithfully as possible. This work describes a validation exercise for BNCT of canine brain tumors. Geometric measurements of the canine anatomical structures of interest for this work were performed by dissecting and examining two essentially identical Labrador Retriever heads. Chemical analyses of various tissue samples taken during the dissections were conducted to obtain measurements of elemental compositions for tissues of interest. The resulting geometry and tissue composition data were then used to construct a detailed heterogeneous calculational model of the Labrador Retriever head. Calculations of three-dimensional radiation flux distributions pertinent to BNCT were performed for the model using the TORT discrete-ordinates radiation transport code. The calculations were repeated for a corresponding volume-weighted homogeneous tissue model. Comparison of the results showed that the peak neutron and photon flux magnitudes were quite similar for the two models (within 5%), but that the spatial flux profiles were shifted in the heterogeneous model such that the fluxes in some locations away from the peak differed from the corresponding fluxes in the homogeneous model by as much as 10-20%. Differences of this magnitude can be therapeutically significant, emphasizing the need for proper validation of simplified treatment planning models
Adenoid cystic carcinoma of the nasal septum: A rare case report
Directory of Open Access Journals (Sweden)
Basavaraj P Belaldavar
2013-01-01
Full Text Available A 60-year-old male patient came to ENT OPD with complaints of left nasal obstruction from the last 5 years and moderate quantity of epistaxis from the last 4 months. It was associated with foul smelling mucopurulent rhinorrhea. On clinical examination, a fleshy mass was seen occupying the posterior part of left nasal cavity and displacing the septum on the right side. The mass was relatively painful, soft, and bleeding on touch. The provisional diagnosis of "vascular-tumor-like" angiofibroma was suspected. Diagnostic nasal endoscopy and CT scan PNS were done which revealed a mass occupying the left nasal cavity arising from the posterior part of septum along the choanae till the anterior part of sphenoid sinus. Biopsy of the same revealed an adenoid cystic carcinoma. Adenoid cystic carcinoma is uncommon and that too of the nasal cavity. The cases of the adenoid cystic carcinoma involving the nasal cavity usually involves the lateral wall and the involvement of the posterior part of nasal septum is extremely rare. Thus the presentation of this uncommon disease is discussed here.
Orthotopic model of canine osteosarcoma in athymic rats for evaluation of stereotactic radiotherapy.
Schwartz, Anthony L; Custis, James T; Harmon, Joseph F; Powers, Barbara E; Chubb, Laura S; LaRue, Susan M; Ehrhart, Nicole P; Ryan, Stewart D
2013-03-01
To develop an orthotopic model of canine osteosarcoma in athymic rats as a model for evaluating the effects of stereotactic radiotherapy (SRT) on osteosarcoma cells. 26 athymic nude rats. 3 experiments were performed. In the first 2 experiments, rats were injected with 1 × 10(6) Abrams canine osteosarcoma cells into the proximal aspect of the tibia (n = 12) or distal aspect of the femur (6). Tumor engraftment and progression were monitored weekly via radiography, luciferase imaging, and measurement of urine pyridinoline concentration for 5 weeks and histologic evaluation after euthanasia. In the third experiment, 8 rats underwent canine osteosarcoma cell injection into the distal aspect of the femur and SRT was administered to the affected area in three 12-Gy fractions delivered on consecutive days (total radiation dose, 36 Gy). Percentage tumor necrosis and urinary pyridinoline concentrations were used to assess local tumor control. The short-term effect of SRT on skin was also evaluated. Tumors developed in 10 of 12 tibial sites and all 14 femoral sites. Administration of SRT to rats with femoral osteosarcoma was feasible and successful. Mean tumor necrosis of 95% was achieved histologically, and minimal adverse skin effects were observed. The orthotopic model of canine osteosarcoma in rats developed in this study was suitable for evaluating the effects of local tumor control and can be used in future studies to evaluate optimization of SRT duration, dose, and fractionation schemes. The model could also allow evaluation of other treatments in combination with SRT, such as chemotherapy or bisphosphonate, radioprotectant, or parathyroid hormone treatment.
Kiser, Patti K; Löhr, Christiane V; Meritet, Danielle; Spagnoli, Sean T; Milovancev, Milan; Russell, Duncan S
2018-05-01
Although quantitative assessment of margins is recommended for describing excision of cutaneous malignancies, there is poor understanding of limitations associated with this technique. We described and quantified histologic artifacts in inked margins and determined the association between artifacts and variance in histologic tumor-free margin (HTFM) measurements based on a novel grading scheme applied to 50 sections of normal canine skin and 56 radial margins taken from 15 different canine mast cell tumors (MCTs). Three broad categories of artifact were 1) tissue deformation at inked edges, 2) ink-associated artifacts, and 3) sectioning-associated artifacts. The most common artifacts in MCT margins were ink-associated artifacts, specifically ink absent from an edge (mean prevalence: 50%) and inappropriate ink coloring (mean: 45%). The prevalence of other artifacts in MCT skin was 4-50%. In MCT margins, frequency-adjusted kappa statistics found fair or better inter-rater reliability for 9 of 10 artifacts; intra-rater reliability was moderate or better in 9 of 10 artifacts. Digital HTFM measurements by 5 blinded pathologists had a median standard deviation (SD) of 1.9 mm (interquartile range: 0.8-3.6 mm; range: 0-6.2 mm). Intraclass correlation coefficients demonstrated good inter-pathologist reliability in HTFM measurement (κ = 0.81). Spearman rank correlation coefficients found negligible correlation between artifacts and HTFM SDs ( r ≤ 0.3). These data confirm that although histologic artifacts commonly occur in inked margin specimens, artifacts are not meaningfully associated with variation in HTFM measurements. Investigators can use the grading scheme presented herein to identify artifacts associated with tissue processing.
Directory of Open Access Journals (Sweden)
Rothuizen Jan
2006-09-01
Full Text Available Abstract Background Apoptosis resistance occurs in various tumors. The anti-apoptotic XIAP protein is responsible for inhibiting apoptosis by reducing caspase-3 activation. Our aim is to evaluate whether RNA inhibition against XIAP increases the sensitivity of canine cell-lines for chemotherapeutics such as TRAIL and doxorubicin. We used small interfering RNA's (siRNA directed against XIAP in three cell-lines derived from bile-duct epithelia (BDE, mammary carcinoma (P114, and osteosarcoma (D17. These cell-lines represent frequently occurring canine cancers and are highly comparable to their human counterparts. XIAP down-regulation was measured by means of quantitative PCR (Q-PCR and Western blotting. The XIAP depleted cells were treated with a serial dilution of TRAIL or doxorubicin and compared to mock- and nonsense-treated controls. Viability was measured with a MTT assay. Results All XIAP siRNA treated cell-lines showed a mRNA down-regulation over 80 percent. Western blot analysis confirmed mRNA measurements. No compensatory effect of IAP family members was seen in XIAP depleted cells. The sensitivity of XIAP depleted cells for TRAIL was highest in BDE cells with an increase in the ED50 of 14-fold, compared to mock- and nonsense-treated controls. The sensitivity of P114 and D17 cell-lines increased six- and five-fold, respectively. Doxorubicin treatment in XIAP depleted cells increased sensitivity in BDE cells more than eight-fold, whereas P114 and D17 cell-lines showed an increase in sensitivity of three- and five-fold, respectively. Conclusion XIAP directed siRNA's have a strong sensitizing effect on TRAIL-reduced cell-viability and a smaller but significant effect with the DNA damaging drug doxorubicin. The increase in efficacy of chemotherapeutics with XIAP depletion provides the rationale for the use of XIAP siRNA's in insensitive canine tumors.
Directory of Open Access Journals (Sweden)
Tadashi Terada
2011-10-01
Full Text Available Although several clinicopathological studies of malignant melanoma of the nasal cavity have been reported, there are no studies of the expression and gene mutation of KIT and platelet derived growth factor receptor-α (PDGFRA in melanoma of the nasal cavity. A 92-year-old Japanese woman consulted to our hospital because of right nasal obstruction and epistaxis. Physical examination and imaging modalities showed a tumor of the right nasal cavity. A biopsy was taken, and it showed malignant epithelioid cells with melanin deposition. Immunohistochemically, the tumor was positive for S100 protein, HMB45, p53, Ki-67 (labeling=20%, KIT and PDGFRA. The tumor was negative for cytokeratins (AE1/3 and CAM5.2. A genetic analysis using PCR-direct sequencing revealed no mutation of KIT gene (exons 9, 11, 13, and 17 or the PDGFRA gene (exons 12 and 18. The pathological diagnosis was primary malignant melanoma of the nasal cavity. The tumor was reduced in size by local resection and chemotherapy (Darthmose regimen: dacarbazine, carmustine, cisplatine, and tamoxifen, and the patient is now alive and free from metastasis 9 months after the first manifestation. In conclusion, the author reported a case of melanoma of the nasal cavity expressing KIT and PDGFRA without gene mutations of KIT and PDGFRA.
Radiation, chemotherapy and surgery for canine osteosarcoma
International Nuclear Information System (INIS)
Powers, B.E.; Withrow, S.J.; La Rue, S.M.; Straw, R.C.; Gillette, E.L.
1987-01-01
Spontaneous canine osteosarcomas is an excellent model for of human osterosarcoma. Twenty dogs with obsteorsarcoma were treated with intravenous or intraarterial cisplatin with or without radiation therapy. This treatment was given 3 weeks prior to limb sparing surgery involving excision of the tumor and allograft replacement. The excised tumor specimen was examined for complete removal and percentage of necrotic tumor measured by planimetry. Intraveneous and intraarterial cisplatin and radiation methods were compared. Data discussing rate of disease development and recurrences is given
Tracheal and laryngeal tumors in the dog and cat: literature review and 13 additional patients
International Nuclear Information System (INIS)
Carlisle, C.H.; Biery, D.N.; Thrall, D.E.
1991-01-01
Primary tumors of the larynx or trachea are uncommon in the dog and cat. In a review of the English language literature, description of 65 such patients were found. In a search of the Veterinary Teaching Hospitals of the University of Pennsylvania and North Carolina State University, an additional 13 previously unreported patients were identified, bringing the total to at least 78. Of these 78, there have been 16 canine tracheal, 7 feline tracheal, 34 canine laryngeal and 21 feline laryngeal tumors. In the canine and feline trachea, osteochondroma and epithelial malignancies, respectively, appear to be the most common. Epithelial malignancies appear to be the most common tumor of the canine larynx whereas lymphosarcoma appears to be the most common feline laryngeal tumor. In patients described herein, tumors produced clinical signs consistent with airway obstruction. Voice alteration was common in patients with laryngeal tumors. Patients were middle-aged to older, except for dogs with osteochondroma. This compares favorably to historical data. All tumors in this study were readily seen radiographically, with most laryngeal and tracheal tumors appearing as masses within the lumen of the airway. Mineralization was uncommon except for canine osteochondromas. Feline laryngeal tumors in this study appeared as generalized laryngeal thickening rather than as a distinct mass. Response of canine and feline tracheal and laryngeal thickening rather than as a distinct mass. Response of canine and feline tracheal and laryngeal tumors to treatment can not be adequately assessed from available data. Benign tumors of the larynx or trachea may be amenable to complete excision. Neoplastic lesions must be differentiated from polyps or abscesses within the upper airway as these may appear radiographically identical to primary tumors. This can be achieved by endoscopic evaluation and biopsy of airway masses before formulating a prognosis
Peña, L; Gama, A; Goldschmidt, M H; Abadie, J; Benazzi, C; Castagnaro, M; Díez, L; Gärtner, F; Hellmén, E; Kiupel, M; Millán, Y; Miller, M A; Nguyen, F; Poli, A; Sarli, G; Zappulli, V; de las Mulas, J Martín
2014-01-01
Although there have been several studies on the use of immunohistochemical biomarkers of canine mammary tumors (CMTs), the results are difficult to compare. This article provides guidelines on the most useful immunohistochemical markers to standardize their use and understand how outcomes are measured, thus ensuring reproducibility of results. We have reviewed the biomarkers of canine mammary epithelial and myoepithelial cells and identified those biomarkers that are most useful and those biomarkers for invasion and lymph node micrometastatic disease. A 10% threshold for positive reaction for most of these markers is recommended. Guidelines on immunolabeling for HER2, estrogen receptors (ERs), and progesterone receptors (PRs) are provided along with the specific recommendations for interpretation of the results for each of these biomarkers in CMTs. Only 3+ HER2-positive tumors should be considered positive, as found in human breast cancer. The lack of any known response to adjuvant endocrine therapy of ER- and PR-positive CMTs prevents the use of the biological positive/negative threshold used in human breast cancer. Immunohistochemistry results of ER and PR in CMTs should be reported as the sum of the percentage of positive cells and the intensity of immunolabeling (Allred score). Incorporation of these recommendations in future studies, either prospective or retrospective, will provide a mechanism for the direct comparison of studies and will help to determine whether these biomarkers have prognostic significance. Finally, these biomarkers may ascertain the most appropriate treatment(s) for canine malignant mammary neoplasms.
Solitary Fibrous Tumor of Nasal Cavity:A Case Report
Directory of Open Access Journals (Sweden)
George Mathew
2015-07-01
Full Text Available Introduction: Solitary fibrous tumours (SFTs of the nose and paranasal sinuses are extremely rare.These were originally described as neoplasms of the pleura originating from spindle cells. It is further sub-classified as a benign type of mesothelial tumour. Its occurrence in many extra pleural sites have been reported earlier, mainly in the liver, parapharyngeal space, sublingual glands, tongue, parotid gland, thyroid, periorbital region, and very occasionally in the nose and paranasal sinus area. Case Report: A 28-year-old man with a 6 month history of persistent progressive left nasal obstruction and watering of the left eye is reported. Further imaging by CT and MRI revealed a large, left-sided, highly vascular, nasal cavity mass (Fig 1,2,3,4 pushing laterally on the medial wall of the maxilla. The patient underwent a lateral rhinotomy, which proceeded with the excision of the mass. Histopathological analysis of the specimen was consistent with SFT. Conclusion: This case is reported to develop insights regarding diagnosis and management of such rare tumours.
Expression of MAGE--A restricted to testis and ovary or to various cancers in dogs.
Chen, Yin-Chu; Hsu, Wei-Li; Chiu, Cheng-Yang; Liao, Jiunn-Wang; Chang, Chao-Chin; Chang, Shih-Chieh
2013-05-15
Expression of MAGE-A protein, a family of cancer/testis antigens, was investigated in normal and neoplastic canine tissues. Immunohistochemical analysis of cross-reactions between a mouse anti-human MAGE-A proteins including MAGE-A1, -A2, -A3, -A4, -A6, -A10, and -A12 monoclonal antibody and canine proteins, showed positive immunoreactivity only in testicular spermatogonia and spermatocytes, and ovary oocytes. The immunoreaction was negative in all other tissues tested, including normal tissues of the skin, gingiva, muscle, adipose, connective, salivary gland, lymph node, intestinal mucosa, mammary gland, liver, cartilage, oviduct, endometrium, cerebrum and cerebellum. Use of a scoring system in the investigated tumors showed positive immunoreactivity in 75% (21/28) of melanomas including oral, cutaneous, eyelid, and interdigital melanomas; in 68.7% (22/32) of oral and nasal tumors; in 52.5% (21/40) discrete round cell tumors; and in 40.5% (15/37) of soft tissue sarcomas. Different tumor types also showed large difference in percentage of MAGE-A expression. Although oral squamous cell carcinomas, multicentric lymphomas and extraosseous osteosarcomas showed no expression, overexpression occurred in oral melanomas (81.82%, 18/21), malignant nasal tumors (100%, 3/3) and in transmissible venereal tumors (100%, 10/10). Based on the characteristic expression of MAGE-A in canine germ cells and in various neoplasms, MAGE-A has potential use as an indicator of malignancy but is probably unsuitable for strictly diagnostic purposes (i.e., diagnosis of tumor type). Copyright © 2013 Elsevier B.V. All rights reserved.
Emanuel, Ivor A; Blaiss, Michael S; Meltzer, Eli O; Evans, Philip; Connor, Alyson
2014-01-01
Sensory attributes of intranasal corticosteroids, such as rundown to the back of the throat, may influence patient treatment preferences. This study compares the nasal deposition and nasal retention of a radiolabeled solution of ciclesonide nasal aerosol (CIC-hydrofluoroalkane [HFA]) with a radiolabeled suspension of mometasone furoate monohydrate aqueous nasal spray (MFNS) in subjects with either perennial allergic rhinitis (AR) or seasonal AR. In this open-label, single-dose, randomized, crossover scintigraphy study, 14 subjects with symptomatic AR received a single dose of radiolabeled 74-μg CIC-HFA (37 μg/spray, 1 spray/each nostril) via a nasal metered-dose inhaler or a single dose of radiolabeled 200-μg MFNS (50 μg/spray, 2 sprays/each nostril), with a minimum 5-day washout period between treatments. Initial deposition (2 minutes postdose) of radiolabeled CIC-HFA and MFNS in the nasal cavity, nasopharynx, and on nasal wipes, and retention of radioactivity in the nasal cavity and nasal run-out on nasal wipes at 2, 4, 6, 8, and 10 minutes postdose were quantified with scintigraphy. At 2 and 10 minutes postdose, deposition of radiolabeled CIC-HFA was significantly higher in the nasal cavity versus radiolabeled MFNS (99.42% versus 86.50% at 2 minutes, p = 0.0046; and 81.10% versus 54.31% at 10 minutes, p Deposition of radioactivity on nasal wipes was significantly higher with MFNS versus CIC-HFA at all five time points, and posterior losses of radiolabeled formulation were significantly higher with MFNS at 6, 8, and 10 minutes postdose. In this scintigraphic study, significantly higher nasal deposition and retention of radiolabeled aerosol CIC-HFA were observed versus radiolabeled aqueous MFNS in subjects with AR.
Analysis of factors in successful nasal endoscopic resection of nasopharyngeal angiofibroma.
Ye, Dong; Shen, Zhisen; Wang, Guoli; Deng, Hongxia; Qiu, Shijie; Zhang, Yuna
2016-01-01
Endoscopic resection of nasopharyngeal angiofibroma is less traumatic, causes less bleeding, and provides a good curative effect. Using pre-operative embolization and controlled hypotension, reasonable surgical strategies and techniques lead to successful resection tumors of a maximum Andrews-Fisch classification stage of III. To investigate surgical indications, methods, surgical technique, and curative effects of transnasal endoscopic resection of nasopharyngeal angiofibroma, this study evaluated factors that improve diagnosis and treatment, prevent large intra-operative blood loss and residual tumor, and increase the cure rate. A retrospective analysis was performed of the clinical data and treatment programs of 23 patients with nasopharyngeal angiofibroma who underwent endoscopic resection with pre-operative embolization and controlled hypotension. The surgical method applied was based on the size of tumor and extent of invasion. Curative effects were observed. No intra-operative or perioperative complications were observed in 22 patients. Upon removal of nasal packing material 3-7 days post-operatively, one patient experienced heavy bleeding of the nasopharyngeal wound, which was treated compression hemostasis using post-nasal packing. Twenty-three patients were followed up for 6-60 months. Twenty-two patients experienced cure; one patient experienced recurrence 10 months post-operatively, and repeat nasal endoscopic surgery was performed and resulted in cure.
Directory of Open Access Journals (Sweden)
Florenza Lüder Ripoli
2016-05-01
Full Text Available Mammary neoplasms are the tumors most affecting female dogs and women. Formalin-fixed, paraffin-embedded (FFPE tissues are an invaluable source of archived biological material. Fresh frozen (FF tissue is considered ideal for gene expression analysis. However, strategies based on FFPE material offer several advantages. Branched-DNA assays permit a reliable and fast workflow when analyzing gene expression. The aim of this study was to assess the comparability of the branched-DNA assay when analyzing certain gene expression patterns between FF and FFPE samples in canine mammary tumors. RNA was isolated from 109 FFPE samples and from 93 FF samples of different canine mammary tissues. Sixteen (16 target genes (Tp53; Myc; HMGA1; Pik3ca; Mcl1; MAPK3; FOXO3; PTEN; GATA4; PFDN5; HMGB1; MAPK1; BRCA2; BRCA1; HMGA2; and Her2 were analyzed via branched-DNA assay (b-DNA. ACTB, GAPDH, and HPRT1 were used as data normalizers. Overall, the relative gene expression of the two different origins of samples showed an agreement of 63%. Still, care should be taken, as FFPE specimens showed lower expression of the analyzed targets when compared to FF samples. The fact that the gene expression in FFPE proved to be lower than in FF specimens is likely to have been caused by the effect of storage time. ACTB had the best performance as a data normalizer.
Angioleiomyoma of nasal septum: Case report and literature review
Directory of Open Access Journals (Sweden)
Varun V. Varadarajan, M.D.
2016-12-01
Conclusion: Angioleiomyoma of the nasal septum is a rare and challenging clinical diagnosis that requires detailed histopathologic examination. The differential diagnosis includes a variety of epithelial and mesenchymal derived tumors. Literature review suggests a female predilection with possible hormonal influence.
A Rare Nasal Bone Fracture: Anterior Nasal Spine Fracture
Directory of Open Access Journals (Sweden)
Egemen Kucuk
2014-04-01
Full Text Available Anterior nasal spine fractures are a quite rare type of nasal bone fractures. Associated cervical spine injuries are more dangerous than the nasal bone fracture. A case of the anterior nasal spine fracture, in a 18-year-old male was presented. Fracture of the anterior nasal spine, should be considered in the differential diagnosis of the midface injuries and also accompanying cervical spine injury should not be ignored.
Prognostic factors in canine appendicular osteosarcoma - a meta-analysis.
Boerman, Ilse; Selvarajah, Gayathri T; Nielen, Mirjam; Kirpensteijn, Jolle
2012-05-15
Appendicular osteosarcoma is the most common malignant primary canine bone tumor. When treated by amputation or tumor removal alone, median survival times (MST) do not exceed 5 months, with the majority of dogs suffering from metastatic disease. This period can be extended with adequate local intervention and adjuvant chemotherapy, which has become common practice. Several prognostic factors have been reported in many different studies, e.g. age, breed, weight, sex, neuter status, location of tumor, serum alkaline phosphatase (SALP), bone alkaline phosphatase (BALP), infection, percentage of bone length affected, histological grade or histological subtype of tumor. Most of these factors are, however, only reported as confounding factors in larger studies. Insight in truly significant prognostic factors at time of diagnosis may contribute to tailoring adjuvant therapy for individual dogs suffering from osteosarcoma. The objective of this study was to systematically review the prognostic factors that are described for canine appendicular osteosarcoma and validate their scientific importance. A literature review was performed on selected studies and eligible data were extracted. Meta-analyses were done for two of the three selected possible prognostic factors (SALP and location), looking at both survival time (ST) and disease free interval (DFI). The third factor (age) was studied in a qualitative manner. Both elevated SALP level and the (proximal) humerus as location of the primary tumor are significant negative prognostic factors for both ST and DFI in dogs with appendicular osteosarcoma. Increasing age was associated with shorter ST and DFI, however, was not statistically significant because information of this factor was available in only a limited number of papers. Elevated SALP and proximal humeral location are significant negative prognosticators for canine osteosarcoma.
Directory of Open Access Journals (Sweden)
Patil Sandeep S
2012-01-01
Full Text Available Abstract Oncolytic viruses refer to those that are able to eliminate malignancies by direct targeting and lysis of cancer cells, leaving non-cancerous tissues unharmed. Several oncolytic viruses including adenovirus strains, canine distemper virus and vaccinia virus strains have been used for canine cancer therapy in preclinical studies. However, in contrast to human studies, clinical trials with oncolytic viruses for canine cancer patients have not been reported. An 'ideal' virus has yet to be identified. This review is focused on the prospective use of oncolytic viruses in the treatment of canine tumors - a knowledge that will undoubtedly contribute to the development of oncolytic viral agents for canine cancer therapy in the future.
Altered expression of versican and hyaluronan in melanocytic tumors of dogs.
Docampo, María-José; Rabanal, Rosa M; Miquel-Serra, Laia; Hernández, Daniel; Domenzain, Clelia; Bassols, Anna
2007-12-01
To analyze the expression of versican and hyaluronan in melanocytomas and malignant melanomas of dogs, to correlate their expression with expression of the hyaluronan receptor CD44, and to identify enzymes responsible for the synthesis and degradation of hyaluronan in canine dermal fibroblasts and canine melanoma cell lines. 35 biopsy specimens from melanocytic tumors of dogs, canine primary dermal fibroblasts, and 3 canine melanoma cell lines. Versican, hyaluronan, and CD44 were detected in tumor samples by use of histochemical or immunohistochemical methods. Expression of hyaluronan-metabolizing enzymes was analyzed with a reverse transcriptase-PCR assay. Versican was found only in some hair follicles and around some blood vessels in normal canine skin, whereas hyaluronan was primarily found within the dermis. Hyaluronan was found in connective tissue of the oral mucosa. Versican and, to a lesser extent, hyaluronan were significantly overexpressed in malignant melanomas, compared with expression in melanocytomas. No significant difference was found between malignant tumors from oral or cutaneous origin. The expression of both molecules was correlated, but hyaluronan had a more extensive distribution than versican. Versican and hyaluronan were mainly associated with tumor stroma. Canine fibroblasts and melanoma cell lines expressed hyaluronan synthase 2 and 3 (but not 1) and hyaluronidase 1 and 2. Versican may be useful as a diagnostic marker for melanocytic tumors in dogs. Knowledge of the enzymes involved in hyaluronan metabolism could reveal new potential therapeutic targets.
Objective Measure of Nasal Air Emission Using Nasal Accelerometry
Cler, Meredith J.; Lien, Yu-An, S.; Braden, Maia N.; Mittleman, Talia; Downing, Kerri; Stepp, Cara, E.
2016-01-01
Purpose: This article describes the development and initial validation of an objective measure of nasal air emission (NAE) using nasal accelerometry. Method: Nasal acceleration and nasal airflow signals were simultaneously recorded while an expert speech language pathologist modeled NAEs at a variety of severity levels. In addition, microphone and…
Development of new therapy for canine mammary cancer with recombinant measles virus
Directory of Open Access Journals (Sweden)
Koichiro Shoji
2016-01-01
Full Text Available Oncolytic virotherapy is a promising treatment strategy for cancer. We previously generated a recombinant measles virus (rMV-SLAMblind that selectively uses a poliovirus receptor-related 4 (PVRL4/Nectin4 receptor, but not signaling lymphocyte activation molecule (SLAM. We demonstrated that the virus exerts therapeutic effects against human breast cancer cells. Here, we examined the applicability of rMV-SLAMblind to treating canine mammary cancers (CMCs. We found that the susceptibilities of host cells to rMV-SLAMblind were dependent on canine Nectin-4 expression. Nectin-4 was detected in four of nine CMC cell lines. The rMV-SLAMblind efficiently infected those four Nectin-4-positive cell lines and was cytotoxic for three of them (CF33, CHMm, and CTBm. In vivo experiment showed that the administration of rMV-SLAMblind greatly suppressed the progression of tumors in mice xenografted with a CMC cell line (CF33. Immunohistochemistry revealed that canine Nectin-4 was expressed in 45% of canine mammary tumors, and the tumor cells derived from one clinical specimen were efficiently infected with rMV-SLAMblind. These results suggest that rMV-SLAMblind infects CMC cells and displays antitumor activity in vitro, in xenografts, and ex vivo. Therefore, oncolytic virotherapy with rMV-SLAMblind can be a novel method for treating CMCs.
Expression and function of survivin in canine osteosarcoma.
Shoeneman, Jenette K; Ehrhart, E J; Eickhoff, Jens C; Charles, J B; Powers, Barbara E; Thamm, Douglas H
2012-01-01
Osteosarcoma has a high mortality rate and remains in need of more effective therapeutic approaches. Survivin is an inhibitor of apoptosis family member protein that blocks apoptosis and drives proliferation in human cancer cells where it is commonly elevated. In this study, we illustrate the superiority of a canine osteosarcoma model as a translational tool for evaluating survivin-directed therapies, owing to the striking similarities in gross and microscopic appearance, biologic behavior, gene expression, and signaling pathway alterations. Elevated survivin expression in primary canine osteosarcoma tissue correlated with increased histologic grade and mitotic index and a decreased disease-free interval (DFI). Survivin attenuation in canine osteosarcoma cells inhibited cell-cycle progression, increased apoptosis, mitotic arrest, and chemosensitivity, and cooperated with chemotherapy to significantly improve in vivo tumor control. Our findings illustrate the utility of a canine system to more accurately model human osteosarcoma and strongly suggest that survivin-directed therapies might be highly effective in its treatment. ©2011 AACR.
Directory of Open Access Journals (Sweden)
Julio César Gálvez Chávez
2009-03-01
Full Text Available INTRODUCCIÓN. La nariz constituye el centro estético de la cara y cualquier deformidad en ella afecta de modo importante a la armonía facial. Este estudio tuvo como objetivo caracterizar las experiencias en reconstrucción nasal con colgajo frontal en pacientes con defectos anatómicos de la nariz, como consecuencia fundamentalmente de una cirugía oncológica. MÉTODOS. Se realizó un estudio descriptivo, prospectivo, para caracterizar la experiencia de la reconstrucción nasal con colgajo frontal en pacientes con defectos nasales, atendidos en el Hospital «Hermanos Ameijeiras» y en el Instituto Nacional de Oncología y Radiobiología, entre junio de 1999 y mayo de 2007. RESULTADOS. Destacó que el motivo más frecuente de reconstrucción fue la lesión neoplásica, con igual número de pacientes afectados por carcinoma basocelular y epidermoide. El ala nasal fue la zona más afectada y se presentó recidiva tumoral en 5 pacientes. En todos los casos se pudo crear una cubierta externa al defecto y el diseño oblicuo fue el más utilizado. Se reconstruyó la cubierta interna nasal fundamentalmente con injerto de piel total y el soporte nasal, mayormente con injertos cartilaginosos de la concha auricular. Todos los colgajos frontales se mantuvieron vitales después de su desconexión en el segundo tiempo quirúrgico. El cierre directo de la zona donante fue el más utilizado y en algunos casos se logró con la utilización de expansión tisular. Se realizó un tercer tiempo de remodelación en los pacientes que lo necesitaron. Las complicaciones no afectaron al resultado final de la reconstrucción. CONCLUSIONES. Se demostró la utilidad y vigencia del colgajo frontal en la reconstrucción nasal.ABSTRACT INTRODUCTION. The nose is the aesthetic center of the face and any deformity in it significantly affects facial harmony. This study was aimed at characterizing the experiences in nasal reconstruction with forehead flap in patients with
Nasal chondromesenchymal hamartoma with no nasal symptoms.
LENUS (Irish Health Repository)
Uzomefuna, Vincent
2012-01-01
The authors present a case of nasal chondromesenchymal hamartoma (NCMH) in an 8-year-old boy with a 4-month history of frontal headache and no symptoms of nasal obstruction, rhinorrhoea or postnasal drip. An ENT examination as well as ophthalmology assessment presented normal results. CT scan showed a lesion involving the sphenoid and ethmoid sinuses. The patient had an endoscopic resection of the lesion that was confirmed histologically to be a NCMH. Though NCMH is known to present usually in infants with obstructing nasal mass, an unusual presentation of a patient with throbbing headache without any nasal symptoms is reported here.
Intranasal tumors in dogs: diagnosis and treatment
International Nuclear Information System (INIS)
Theisen, S.K.; Lewis, D.D.; Hosgood, G.
1996-01-01
Intranasal tumors are rare in dogs and occur mostly in middle-aged and old dogs. The malignant behavior of these tumors is reflected more by their tendency to invade local tissue than by a tendency to produce distant metastasis. Distant metastasis may, however, become more important as success in treatment of the initial lesion improves. The history and clinical signs (sneezing, nasal discharge, and facial deformity) of intranasal tumor in dogs often reflect intranasal disease but are usually nonspecific. Diagnostics should include at least the minimum data base, high-detail radiographs of the nasal cavity obtained while the dog is anesthetized, and biopsy of nasal cavity tissue. Radiotherapy with or without aggressive cytoreduction is the only treatment that significantly extends survival of these dogs. Ortho-voltage, megavoltage, or brachytherapy (implantation of (192)lridium) has been used
Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid
2016-01-01
Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine os...
Agnetti, Lucrecia; Fondello, Chiara; Villaverde, Marcela S.; Glikin, Gerardo C.; Finocchiaro, Liliana M. E.
2017-01-01
We originated and characterized melanoma cell lines derived from tumors of two feline and two canine veterinary patients. These lines reestablished the morphology, physiology and cell heterogeneity of their respective parental tumors. We evaluated the cytotoxicity of bleomycin (BLM) alone, or combined with interferon-β (IFN-β) or HSVtk/GCV suicide gene (SG) lipofection on these cells. Although the four animals presented stage III disease (WHO system), SG treated feline tumors displayed stable disease in vivo, while the canine ones exhibited partial response. Their derived cell lines reflected this behavior. Feline were significantly more sensitive than canine cells to IFN-β gene transfer. BLM improved the antitumor effects of both genes. The higher levels of reactive oxygen species (ROS) significantly correlated with membrane and DNA damages, emphasizing ROS intervention in apoptotic and necrotic cell death. After 3 days of BLM alone or combined with gene treatments, the colony forming capacity of two canine and one feline treatments survivor cells almost disappeared. Taken together, these results suggest that the treatments eradicated tumor initiating cells and support the clinical potential of the tested combinations. PMID:29344558
Energy Technology Data Exchange (ETDEWEB)
Castelo-Branco, Paulo S.M. [Universidade Estacio de Sa, Rio de Janeiro, RJ (Brazil)]. E-mail: p.castelobranco@ig.com.br; Castro, Veronica; Sena, Priscila [Sociedade Uniao Internacional Protetora dos Animais (SUIPA), Rio de Janeiro, RJ (Brazil); Souza, Sergio A. Lopes de; Lopes, Flavia P.P. Lobo; Pereira, Joao Batista; Fonseca, Lea M. Barbosa da; Gutfilen, Bianca [Hospital Universitario Clementino Fraga Filho, Rio de Janeiro, RJ (Brazil). Dept. de Radiologia
2008-08-15
The venereal canine transmissible tumor (VCTT) is described in literature as a rare metastatic tumor. However accurate methods for verification of this affirmative are not available in the veterinary medicine routine. In this study, we evaluated the dissemination from VCTT with cutaneous presentation using the {sup 99m}Tc-Thymine scintigraphy. The labelled thymine was up taken by the three cases of VCTT. {sup 99m}Tc-Thymine is a promising imaging technique for non-invasive veterinarian evaluation of tumoral dissemination degree decurrent from the VCTT cases. (author)
A case report of an inverted papilloma infiltrating into maxillary sinus
International Nuclear Information System (INIS)
Ji, Yong Hwa; Choi, Bo Ram; Huh, Kyung Hoe; Lee, Sam Sun; An, Chang Hyeon
2009-01-01
The present study reports a case of inverted papilloma of the nasal cavity and infiltrating into the maxillary sinus. Inverted papilloma is an uncommon and locally aggressive benign tumor of the sinonasal region. The patient, 51-year-old male, presented with unilateral nasal obstruction and periodic swelling on the palate without pain. Enhanced CT scan revealed a heterogeneously enhancing solid mass in the nasal cavity and infiltrating into the right maxillary sinus, as well as an incidental, secondarily infected residual cyst in the periapical area of the right maxillary canine. The sinonasal mass was revealed as an inverted papilloma on histopathologic examination.
A case report of an inverted papilloma infiltrating into maxillary sinus
Energy Technology Data Exchange (ETDEWEB)
Ji, Yong Hwa; Choi, Bo Ram; Huh, Kyung Hoe; Lee, Sam Sun [School of Dentistry, Seoul National University, Seoul (Korea, Republic of); An, Chang Hyeon [Department of Oral and Maxillofacial Radiology, School of Dentistry, Kyungpook National University, Daegu (Korea, Republic of)
2009-06-15
The present study reports a case of inverted papilloma of the nasal cavity and infiltrating into the maxillary sinus. Inverted papilloma is an uncommon and locally aggressive benign tumor of the sinonasal region. The patient, 51-year-old male, presented with unilateral nasal obstruction and periodic swelling on the palate without pain. Enhanced CT scan revealed a heterogeneously enhancing solid mass in the nasal cavity and infiltrating into the right maxillary sinus, as well as an incidental, secondarily infected residual cyst in the periapical area of the right maxillary canine. The sinonasal mass was revealed as an inverted papilloma on histopathologic examination.
Perić, Aleksandar; Sotirović, Jelena; Cerović, Snezana; Zivić, Ljubica
2013-01-01
Angiofibromas are rare vascular tumors which originate predominantly in the nasopharynx and occur typically in male adolescents. Extranasopharyngeal sites such as nasal cavity and paranasal sinuses are less frequent. This review article was undertaken to evaluate the incidence, clinical features and management of extranasopharyngeal angiofibromas originating exclusivelly from nasal cavity structures. Our focus of interest was to evaluate the significance of immunohistochemical analysis in diagnosis of such extremely rare neoplasms. In the PubMed and Google Search, we found only 39 cases of nasal angifibroma, 27 males and 12 females from 1980 to 2012. The most prevalent site of origin was nasal septum, followed by inferior and middle turbinate. The commonest symptoms were nasal obstruction and epistaxis. Nasal angiofibromas are clinically distinct from nasopharyneal angiofibromas and can therefore be misdiagnosed. The differential diagnosis includes other vascular lesions, such as lobular capillary hemangioma and sinonasal-type hemangiopericytoma. Although immunohistochemistry is not necessary for differentiation between angiofibroma and capillary hemangioma, that diagnostic procedure may be helpful in distinction from sinonasal hemangiopericytoma. As an ilustration for immunohistochemical analysis, we presented a case of an elderly woman with tumor arising from the middle turbinate, diagnosed as angiofibroma. The staining was positive for CD34, CD31, factor VIII, vimentin and smooth muscle alpha-actin, and negative for desmin.
In vivo measurement of cell proliferation in canine brain tumor using C-11-labeled FMAU and PET
International Nuclear Information System (INIS)
Conti, Peter S.; Bading, James R.; Mouton, Peter P.; Links, Jonathan M.; Alauddin, Mian M.; Fissekis, John D.; Ravert, Hayden T.; Hilton, John; Wong, Dean F.; Anderson, James H.
2008-01-01
measured by direct tissue analysis with BUdR in a canine brain tumor model, suggesting that [ 11 C]FMAU is useful for the imaging of cell proliferation in cancers
Dimopoulou, Maria; Kirpensteijn, Jolle; Moens, Hester; Kik, Marja
2008-07-01
To investigate the histologic characteristics of feline osteosarcoma (OS) and compare the histologic data with phenotypically comparable canine OS. The effects of histologic and clinical variables on survival statistics were evaluated. Retrospective study. Cats (n=62) and dogs (22). Medical records of 62 cats with OS were reviewed for clinically relevant data. Clinical outcome was obtained by telephone interview. Histologic characteristics of OS were classified using a standardized grading system. Histologic characteristics in 22 feline skeletal OS were compared with 22 canine skeletal OS of identical location and subtype. Prognostic variables for clinical outcome were determined using multivariate analysis. Feline OS was characterized by moderate to abundant cellular pleomorphism, low mitotic index, small to moderate amounts of matrix, high cellularity, and a moderate amount of necrosis. There was no significant difference between histologic variables in feline and canine OS. Histologic grade, surgery, and mitotic index significantly influenced clinical outcome as determined by multivariate analysis. Tumor invasion into vessels was not identified as a significant prognosticator. Feline and canine skeletal OS have similar histologic but different prognostic characteristics. Prognosis for cats with OS is related to histologic grade and mitotic index of the tumor.
PMab-38 Recognizes Canine Podoplanin of Squamous Cell Carcinomas.
Kaneko, Mika K; Honma, Ryusuke; Ogasawara, Satoshi; Fujii, Yuki; Nakamura, Takuro; Saidoh, Noriko; Takagi, Michiaki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-10-01
Podoplanin, a type I transmembrane protein, is expressed in lymphatic endothelial cells. Although we previously developed an anticanine podoplanin monoclonal antibody (mAb), PMab-38, immunohistochemistry (IHC) showed that it did not react with canine lymphatic endothelial cells. Here, we determined whether PMab-38 recognizes canine podoplanin of squamous cell carcinomas (SCCs) and clarified its epitope. In IHC, PMab-38 reacted with 83% of SCCs (15/18 cases). Flow cytometry showed that the epitope of PMab-38 was different from that of the platelet aggregation-stimulating domain of the N-terminus, which was detected by almost all antipodoplanin mAbs such as D2-40 or NZ-1. PMab-38 is expected to be useful for investigating the function of podoplanin in canine tumors.
Ryan, V H; Trayhurn, P; Hunter, L; Morris, P J; German, A J
2011-10-01
The enzyme 11β-hydroxysteroid dehydrogenase 1 (11β-HSD-1) is expressed in a number of tissues in rodents and humans and is responsible for the reactivation of inert cortisone into cortisol. Its gene expression and activity are increased in white adipose tissue (WAT) from obese humans and may contribute to the adverse metabolic consequences of obesity and the metabolic syndrome. The extent to which 11β-HSD-1 contributes to adipose tissue function in dogs is unknown; the aim of the present study was to examine 11β-HSD-1 gene expression and its regulation by proinflammatory and anti-inflammatory agents in canine adipocytes. Real-time PCR was used to examine the expression of 11β-HSD-1 in canine adipose tissue and canine adipocytes differentiated in culture. The mRNA encoding 11β-HSD-1 was identified in all the major WAT depots in dogs and also in liver, kidney, and spleen. Quantification by real-time PCR showed that 11β-HSD-1 mRNA was least in perirenal and falciform depots and greatest in subcutaneous, omental, and gonadal depots. Greater expression was seen in the omental depot in female than in male dogs (P=0.05). Gene expression for 11β-HSD-1 was also seen in adipocytes, from both subcutaneous and visceral depots, differentiated in culture; expression was evident throughout differentiation but was generally greatest in preadipocytes and during early differentiation, declining as cells progressed to maturity. The inflammatory mediators lipopolysaccharide and tumor necrosis factor α had a main stimulatory effect on 11β-HSD-1 gene expression in canine subcutaneous adipocytes, but IL-6 had no significant effect. Treatment with dexamethasone resulted in a significant time- and dose-dependent increase in 11β-HSD-1 gene expression, with greatest effects seen at 24 h (2 nM: approximately 4-fold; 20 nM: approximately 14-fold; P=0.010 for both). When subcutaneous adipocytes were treated with the peroxisome proliferator activated receptor γ agonist rosiglitazone
Relation between epistaxis, external nasal deformity, and septal deviation following nasal trauma
Daniel, M; Raghavan, U
2005-01-01
Objectives: To find if the presence of epistaxis after nasal trauma can be used to predict post-traumatic external nasal deformity or a symptomatic deviated nasal septum. Methods: Retrospective analysis of all patients seen in the fractured nose clinic by the first author between 17 October 2003 and 27 February 2004. Presence of epistaxis, newly developed external nasal deformity, and the presence of a deviated nasal septum with new symptoms of nasal obstruction were noted. Results: A total of 139 patients were included in the study. Epistaxis following injury was noted in 106 (76%). Newly developed external nasal deformity was noted in 71 (51%), and 33 (24%) had a deviated nasal septum with new symptoms of nasal obstruction. Of the 106 patients with post-trauma epistaxis, 50 (67%) had newly developed external nasal deformity and of the 33 patients without post-traumatic epistaxis, 11 (33%) had nasal deformity (pepistaxis was not associated with the presence of a newly symptomatic deviated septum (25% in patients with epistaxis after injury versus 18% if there was no epistaxis). Conclusions: Presence of epistaxis after nasal trauma is associated with a statistically significant increase in external nasal deformity. However, one third of patients without epistaxis following nasal trauma also had external nasal deformity and hence all patients with a swollen nose after injury, irrespective of post-trauma epistaxis, still need to be referred to the fractured nose clinic. PMID:16244333
International Nuclear Information System (INIS)
Cozer, Thamara C.; Conceicao, Andre L.C.; Paschuk, Sergei A.; Rocha, Anna S.S. da; Fagundes, Alana C.F.; Maciel, Karla F.R.; Pimentel, Gustavo R.O.; Badelli, Juliana C.
2015-01-01
Studies performed with canines indicate that one of the main neoplasia which affect these animals are the breast tumors, representing from 25% to 50% of all kinds of tumors. Moreover, half of them are classified as malignant. In this sense, recent researches on humans have been associated the presence of certain trace elements with the development of breast neoplasia in those individuals. Then, as the breast tissue composition in canines is very similar to the humans, it is expected the same behavior. In this direction, a very effective technique to identify and to determinate trace elements concentration is the EDXRF. However, studies on this area are scarce in the literature. Therefore, in this work it was developed an approach to quantify the main trace elements present into these tumors with high sensitivity. For this purpose, it was determined calibration curves of standards samples diluted in water, with concentrations of Ca, Fe, Cu and Zn, ranging from 400mg/kg to 35mg/kg, from 20mg/kg to 2mg/kg, from 10mg/kg to 1mg/kg and from 100mg/kg to 10mg/kg, respectively. All calibration curves were linearly fitted and on basis in this behavior it was determined the sensitivity of our approach to quantify the concentration of the trace elements mentioned above. In addition, it is important to mention that studies in this area are of great potential, because EDXRF represents a quickly practical and non-destructive alternative to quantify trace elements. (author)
Energy Technology Data Exchange (ETDEWEB)
Cozer, Thamara C.; Conceicao, Andre L.C.; Paschuk, Sergei A.; Rocha, Anna S.S. da; Fagundes, Alana C.F.; Maciel, Karla F.R.; Pimentel, Gustavo R.O.; Badelli, Juliana C., E-mail: thamara.cozer@gmail.com, E-mail: alconceicao@utfpr.edu.br, E-mail: sergei@utfpr.edu.br, E-mail: anna@utfpr.edu.br, E-mail: alanacarolinef@gmail.com, E-mail: karla_rimanski@hotmail.com, E-mail: g_rop@hotmail.com, E-mail: jubadellin@gmail.com [Universidade Tecnologica Federal do Parana (UTFPR), Curitiba, PR (Brazil). Lab. de Espectroscopia de Raio-X
2015-07-01
Studies performed with canines indicate that one of the main neoplasia which affect these animals are the breast tumors, representing from 25% to 50% of all kinds of tumors. Moreover, half of them are classified as malignant. In this sense, recent researches on humans have been associated the presence of certain trace elements with the development of breast neoplasia in those individuals. Then, as the breast tissue composition in canines is very similar to the humans, it is expected the same behavior. In this direction, a very effective technique to identify and to determinate trace elements concentration is the EDXRF. However, studies on this area are scarce in the literature. Therefore, in this work it was developed an approach to quantify the main trace elements present into these tumors with high sensitivity. For this purpose, it was determined calibration curves of standards samples diluted in water, with concentrations of Ca, Fe, Cu and Zn, ranging from 400mg/kg to 35mg/kg, from 20mg/kg to 2mg/kg, from 10mg/kg to 1mg/kg and from 100mg/kg to 10mg/kg, respectively. All calibration curves were linearly fitted and on basis in this behavior it was determined the sensitivity of our approach to quantify the concentration of the trace elements mentioned above. In addition, it is important to mention that studies in this area are of great potential, because EDXRF represents a quickly practical and non-destructive alternative to quantify trace elements. (author)
Jenkins, Eileen K.; DeChant, Mallory T.; Perry, Erin B.
2018-01-01
The impact of health, management, and microbiota on olfactory function in canines has not been examined in review. The most important characteristic of the detection canine is its sense of smell. Olfactory receptors are primarily located on the ethmoturbinates of the nasal cavity. The vomeronasal organ is an additional site of odor detection that detects chemical signals that stimulate behavioral and/or physiological changes. Recent advances in the genetics of olfaction suggest that genetic changes, along with the unique anatomy and airflow of the canine nose, are responsible for the macrosmia of the species. Inflammation, alterations in blood flow and hydration, and systemic diseases alter olfaction and may impact working efficiency of detection canines. The scientific literature contains abundant information on the potential impact of pharmaceuticals on olfaction in humans, but only steroids, antibiotics, and anesthetic agents have been studied in the canine. Physical stressors including exercise, lack of conditioning, and high ambient temperature impact olfaction directly or indirectly in the canine. Dietary fat content, amount of food per meal, and timing of meals have been demonstrated to impact olfaction in mice and dogs. Gastrointestinal (GI) microbiota likely impacts olfaction via bidirectional communication between the GI tract and brain, and the microbiota is impacted by exercise, diet, and stress. The objective of this literature review is to discuss the specific effects of health, management, and microbiota shifts on olfactory performance in working canines. PMID:29651421
Directory of Open Access Journals (Sweden)
Eileen K. Jenkins
2018-03-01
Full Text Available The impact of health, management, and microbiota on olfactory function in canines has not been examined in review. The most important characteristic of the detection canine is its sense of smell. Olfactory receptors are primarily located on the ethmoturbinates of the nasal cavity. The vomeronasal organ is an additional site of odor detection that detects chemical signals that stimulate behavioral and/or physiological changes. Recent advances in the genetics of olfaction suggest that genetic changes, along with the unique anatomy and airflow of the canine nose, are responsible for the macrosmia of the species. Inflammation, alterations in blood flow and hydration, and systemic diseases alter olfaction and may impact working efficiency of detection canines. The scientific literature contains abundant information on the potential impact of pharmaceuticals on olfaction in humans, but only steroids, antibiotics, and anesthetic agents have been studied in the canine. Physical stressors including exercise, lack of conditioning, and high ambient temperature impact olfaction directly or indirectly in the canine. Dietary fat content, amount of food per meal, and timing of meals have been demonstrated to impact olfaction in mice and dogs. Gastrointestinal (GI microbiota likely impacts olfaction via bidirectional communication between the GI tract and brain, and the microbiota is impacted by exercise, diet, and stress. The objective of this literature review is to discuss the specific effects of health, management, and microbiota shifts on olfactory performance in working canines.
Jenkins, Eileen K; DeChant, Mallory T; Perry, Erin B
2018-01-01
The impact of health, management, and microbiota on olfactory function in canines has not been examined in review. The most important characteristic of the detection canine is its sense of smell. Olfactory receptors are primarily located on the ethmoturbinates of the nasal cavity. The vomeronasal organ is an additional site of odor detection that detects chemical signals that stimulate behavioral and/or physiological changes. Recent advances in the genetics of olfaction suggest that genetic changes, along with the unique anatomy and airflow of the canine nose, are responsible for the macrosmia of the species. Inflammation, alterations in blood flow and hydration, and systemic diseases alter olfaction and may impact working efficiency of detection canines. The scientific literature contains abundant information on the potential impact of pharmaceuticals on olfaction in humans, but only steroids, antibiotics, and anesthetic agents have been studied in the canine. Physical stressors including exercise, lack of conditioning, and high ambient temperature impact olfaction directly or indirectly in the canine. Dietary fat content, amount of food per meal, and timing of meals have been demonstrated to impact olfaction in mice and dogs. Gastrointestinal (GI) microbiota likely impacts olfaction via bidirectional communication between the GI tract and brain, and the microbiota is impacted by exercise, diet, and stress. The objective of this literature review is to discuss the specific effects of health, management, and microbiota shifts on olfactory performance in working canines.
Elshafae, Said M; Hassan, Bardes B; Supsavhad, Wachiraphan; Dirksen, Wessel P; Camiener, Rachael Y; Ding, Haiming; Tweedle, Michael F; Rosol, Thomas J
2016-06-01
The gastrin-releasing peptide receptor (GRPr) is upregulated in early and late-stage human prostate cancer (PCa) and other solid tumors of the mammary gland, lung, head and neck, colon, uterus, ovary, and kidney. However, little is known about its role in prostate cancer. This study examined the effects of a heterologous GRPr agonist, bombesin (BBN), on growth, motility, morphology, gene expression, and tumor phenotype of an osteoblastic canine prostate cancer cell line (Ace-1) in vitro and in vivo. The Ace-1 cells were stably transfected with the human GRPr and tumor cells were grown in vitro and as subcutaneous and intratibial tumors in nude mice. The effect of BBN was measured on cell proliferation, cell migration, tumor growth (using bioluminescence), tumor cell morphology, bone tumor phenotype, and epithelial-mesenchymal transition (EMT) and metastasis gene expression (quantitative RT-PCR). GRPr mRNA expression was measured in primary canine prostate cancers and normal prostate glands. Bombesin (BBN) increased tumor cell proliferation and migration in vitro and tumor growth and invasion in vivo. BBN upregulated epithelial-to-mesenchymal transition (EMT) markers (TWIST, SNAIL, and SLUG mRNA) and downregulated epithelial markers (E-cadherin and β-catenin mRNA), and modified tumor cell morphology to a spindle cell phenotype. Blockade of GRPr upregulated E-cadherin and downregulated VIMENTIN and SNAIL mRNA. BBN altered the in vivo tumor phenotype in bone from an osteoblastic to osteolytic phenotype. Primary canine prostate cancers had increased GRPr mRNA expression compared to normal prostates. These data demonstrated that the GRPr is important in prostate cancer growth and progression and targeting GRPr may be a promising strategy for treatment of prostate cancer. Prostate 76:796-809, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
The detection and differentiation of canine respiratory pathogens using oligonucleotide microarrays.
Wang, Lih-Chiann; Kuo, Ya-Ting; Chueh, Ling-Ling; Huang, Dean; Lin, Jiunn-Horng
2017-05-01
Canine respiratory diseases are commonly seen in dogs along with co-infections with multiple respiratory pathogens, including viruses and bacteria. Virus infections in even vaccinated dogs were also reported. The clinical signs caused by different respiratory etiological agents are similar, which makes differential diagnosis imperative. An oligonucleotide microarray system was developed in this study. The wild type and vaccine strains of canine distemper virus (CDV), influenza virus, canine herpesvirus (CHV), Bordetella bronchiseptica and Mycoplasma cynos were detected and differentiated simultaneously on a microarray chip. The detection limit is 10, 10, 100, 50 and 50 copy numbers for CDV, influenza virus, CHV, B. bronchiseptica and M. cynos, respectively. The clinical test results of nasal swab samples showed that the microarray had remarkably better efficacy than the multiplex PCR-agarose gel method. The positive detection rate of microarray and agarose gel was 59.0% (n=33) and 41.1% (n=23) among the 56 samples, respectively. CDV vaccine strain and pathogen co-infections were further demonstrated by the microarray but not by the multiplex PCR-agarose gel. The oligonucleotide microarray provides a highly efficient diagnosis alternative that could be applied to clinical usage, greatly assisting in disease therapy and control. Copyright © 2017 Elsevier B.V. All rights reserved.
Full-genome analysis of a canine pneumovirus causing acute respiratory disease in dogs, Italy.
Directory of Open Access Journals (Sweden)
Nicola Decaro
Full Text Available An outbreak of canine infectious respiratory disease (CIRD associated to canine pneumovirus (CnPnV infection is reported. The outbreak occurred in a shelter of the Apulia region and involved 37 out of 350 dogs that displayed cough and/or nasal discharge with no evidence of fever. The full-genomic characterisation showed that the causative agent (strain Bari/100-12 was closely related to CnPnVs that have been recently isolated in the USA, as well as to murine pneumovirus, which is responsible for respiratory disease in mice. The present study represents a useful contribution to the knowledge of the pathogenic potential of CnPnV and its association with CIRD in dogs. Further studies will elucidate the pathogenicity and epidemiology of this novel pneumovirus, thus addressing the eventual need for specific vaccines.
Characteristics of nasal-associated lymphoid tissue (NALT) and nasal absorption capacity in chicken.
Kang, Haihong; Yan, Mengfei; Yu, Qinghua; Yang, Qian
2013-01-01
As the main mucosal immune inductive site of nasal cavity, nasal-associated lymphoid tissue (NALT) plays an important role in both antigen recognition and immune activation after intranasal immunization. However, the efficiency of intranasal vaccines is commonly restricted by the insufficient intake of antigen by the nasal mucosa, resulting from the nasal mucosal barrier and the nasal mucociliary clearance. The distribution of NALT and the characteristic of nasal cavity have already been described in humans and many laboratory rodents, while data about poultry are scarce. For this purpose, histological sections of the chicken nasal cavities were used to examine the anatomical structure and histological characteristics of nasal cavity. Besides, the absorptive capacity of chicken nasal mucosa was also studied using the materials with different particle size. Results showed that the NALT of chicken was located on the bottom of nasal septum and both sides of choanal cleft, which mainly consisted of second lymphoid follicle. A large number of lymphocytes were distributed under the mucosal epithelium of inferior nasal meatus. In addition, there were also diffuse lymphoid tissues located under the epithelium of the concha nasalis media and the walls of nasal cavity. The results of absorption experiment showed that the chicken nasal mucosa was capable to absorb trypan blue, OVA, and fluorescent latex particles. Inactivated avian influenza virus (IAIV) could be taken up by chicken nasal mucosa except for the stratified squamous epithelium sites located on the forepart of nasal cavity. The intake of IAIV by NALT was greater than that of the nasal mucosa covering on non-lymphoid tissue, which could be further enhanced after intranasal inoculation combined with sodium cholate or CpG DNA. The study on NALT and nasal absorptive capacity will be benefit for further understanding of immune mechanisms after nasal vaccination and development of nasal vaccines for poultry.
Rare occupational cause of nasal septum perforation: Nickel exposure
Directory of Open Access Journals (Sweden)
Ertugrul Cagri Bolek
2017-10-01
Full Text Available Many etiologies are held accountable for nasal septum perforations. Topical nasal drug usage, previous surgeries, trauma, nose picking, squamous cell carcinoma, some rheumatological disorders such as granulomatosis with polyangiitis (Wegener granulomatosis, some infectious diseases such as syphilis and leprosy are among the causes of the perforations. Occupational heavy metal exposures by inhalation rarely may also cause nasal septum perforation. Here, we present a 29-year-old patient without any known diseases, who is a worker at a metallic coating and nickel-plating factory, referred for investigation of his nasal cartilage septum perforation from an otorhinolaryngology clinic. The patient questioning, physical examination and laboratory assessment about rheumatic and infectious diseases were negative. There was a metallic smell in the breath during the physical examination. The analysis showed serum nickel level at 31 μg/l and urine nickel at 18 μg/l (84.11 μg/g creatinine. Other possible serum and urine heavy metal levels were within normal ranges. Nickel exposure is usually together with other heavy metals (chromium or cadmium, it is rarely alone. Nickel ingested by inhalation usually leads to respiratory problems such as reduced olfactory acuity, ulcers, septum perforation or tumors of the nasal sinuses. This case demonstrates the importance of occupational anamnesis and awareness of diagnosis. Int J Occup Med Environ Health 2017;30(6:963–967
Prognostic factors in canine appendicular osteosarcoma – a meta-analysis
2012-01-01
Background Appendicular osteosarcoma is the most common malignant primary canine bone tumor. When treated by amputation or tumor removal alone, median survival times (MST) do not exceed 5 months, with the majority of dogs suffering from metastatic disease. This period can be extended with adequate local intervention and adjuvant chemotherapy, which has become common practice. Several prognostic factors have been reported in many different studies, e.g. age, breed, weight, sex, neuter status, location of tumor, serum alkaline phosphatase (SALP), bone alkaline phosphatase (BALP), infection, percentage of bone length affected, histological grade or histological subtype of tumor. Most of these factors are, however, only reported as confounding factors in larger studies. Insight in truly significant prognostic factors at time of diagnosis may contribute to tailoring adjuvant therapy for individual dogs suffering from osteosarcoma. The objective of this study was to systematically review the prognostic factors that are described for canine appendicular osteosarcoma and validate their scientific importance. Results A literature review was performed on selected studies and eligible data were extracted. Meta-analyses were done for two of the three selected possible prognostic factors (SALP and location), looking at both survival time (ST) and disease free interval (DFI). The third factor (age) was studied in a qualitative manner. Both elevated SALP level and the (proximal) humerus as location of the primary tumor are significant negative prognostic factors for both ST and DFI in dogs with appendicular osteosarcoma. Increasing age was associated with shorter ST and DFI, however, was not statistically significant because information of this factor was available in only a limited number of papers. Conclusions Elevated SALP and proximal humeral location are significant negative prognosticators for canine osteosarcoma. PMID:22587466
Prognostic factors in canine appendicular osteosarcoma – a meta-analysis
Directory of Open Access Journals (Sweden)
Boerman Ilse
2012-05-01
Full Text Available Abstract Background Appendicular osteosarcoma is the most common malignant primary canine bone tumor. When treated by amputation or tumor removal alone, median survival times (MST do not exceed 5 months, with the majority of dogs suffering from metastatic disease. This period can be extended with adequate local intervention and adjuvant chemotherapy, which has become common practice. Several prognostic factors have been reported in many different studies, e.g. age, breed, weight, sex, neuter status, location of tumor, serum alkaline phosphatase (SALP, bone alkaline phosphatase (BALP, infection, percentage of bone length affected, histological grade or histological subtype of tumor. Most of these factors are, however, only reported as confounding factors in larger studies. Insight in truly significant prognostic factors at time of diagnosis may contribute to tailoring adjuvant therapy for individual dogs suffering from osteosarcoma. The objective of this study was to systematically review the prognostic factors that are described for canine appendicular osteosarcoma and validate their scientific importance. Results A literature review was performed on selected studies and eligible data were extracted. Meta-analyses were done for two of the three selected possible prognostic factors (SALP and location, looking at both survival time (ST and disease free interval (DFI. The third factor (age was studied in a qualitative manner. Both elevated SALP level and the (proximal humerus as location of the primary tumor are significant negative prognostic factors for both ST and DFI in dogs with appendicular osteosarcoma. Increasing age was associated with shorter ST and DFI, however, was not statistically significant because information of this factor was available in only a limited number of papers. Conclusions Elevated SALP and proximal humeral location are significant negative prognosticators for canine osteosarcoma.
Directory of Open Access Journals (Sweden)
Aleksandar Perić
2013-01-01
Full Text Available Angiofibromas are rare vascular tumors which originate predominantly in the nasopharynx and occur typically in male adolescents. Extranasopharyngeal sites such as nasal cavity and paranasal sinuses are less frequent. This review article was undertaken to evaluate the incidence, clinical features and management of extranasopharyngeal angiofibromas originating exclusivelly from nasal cavity structures. Our focus of interest was to evaluate the significance of immunohistochemical analysis in diagnosis of such extremely rare neoplasms. In the PubMed and Google Search, we found only 39 cases of nasal angifibroma, 27 males and 12 females from 1980 to 2012. The most prevalent site of origin was nasal septum, followed by inferior and middle turbinate. The commonest symptoms were nasal obstruction and epistaxis. Nasal angiofibromas are clinically distinct from nasopharyneal angiofibromas and can therefore be misdiagnosed. The differential diagnosis includes other vascular lesions, such as lobular capillary hemangioma and sinonasal-type hemangiopericytoma. Although immunohistochemistry is not necessary for differentiation between angiofibroma and capillary hemangioma, that diagnostic procedure may be helpful in distinction from sinonasal hemangiopericytoma. As an ilustration for immunohistochemical analysis, we presented a case of an elderly woman with tumor arising from the middle turbinate, diagnosed as angiofibroma. The staining was positive for CD34, CD31, factor VIII, vimentin and smooth muscle α-actin, and negative for desmin.
Telomere length in normal and neoplastic canine tissues.
Cadile, Casey D; Kitchell, Barbara E; Newman, Rebecca G; Biller, Barbara J; Hetler, Elizabeth R
2007-12-01
To determine the mean telomere restriction fragment (TRF) length in normal and neoplastic canine tissues. 57 solid-tissue tumor specimens collected from client-owned dogs, 40 samples of normal tissue collected from 12 clinically normal dogs, and blood samples collected from 4 healthy blood donor dogs. Tumor specimens were collected from client-owned dogs during diagnostic or therapeutic procedures at the University of Illinois Veterinary Medical Teaching Hospital, whereas 40 normal tissue samples were collected from 12 control dogs. Telomere restriction fragment length was determined by use of an assay kit. A histologic diagnosis was provided for each tumor by personnel at the Veterinary Diagnostic Laboratory at the University of Illinois. Mean of the mean TRF length for 44 normal samples was 19.0 kilobases (kb; range, 15.4 to 21.4 kb), and the mean of the mean TRF length for 57 malignant tumors was 19.0 kb (range, 12.9 to 23.5 kb). Although the mean of the mean TRF length for tumors and normal tissues was identical, tumor samples had more variability in TRF length. Telomerase, which represents the main mechanism by which cancer cells achieve immortality, is an attractive therapeutic target. The ability to measure telomere length is crucial to monitoring the efficacy of telomerase inhibition. In contrast to many other mammalian species, the length of canine telomeres and the rate of telomeric DNA loss are similar to those reported in humans, making dogs a compelling choice for use in the study of human anti-telomerase strategies.
Schuh, Elizabeth M; Portela, Roberta; Gardner, Heather L; Schoen, Christian; London, Cheryl A
2017-10-02
Hyperthermia is an established anti-cancer treatment but is limited by tolerance of adjacent normal tissues. Parenteral administration of gold nanorods (NRs) as a photosensitizer amplifies the effects of hyperthermia treatment while sparing normal tissues. This therapy is well tolerated and has demonstrated anti-tumor effects in mouse models. The purpose of this phase 1 study was to establish the safety and observe the anti-tumor impact of gold NR enhanced (plasmonic) photothermal therapy (PPTT) in client owned canine patients diagnosed with spontaneous neoplasia. Seven dogs underwent gold NR administration and subsequent NIR PPTT. Side effects were mild and limited to local reactions to NIR laser. All of the dogs enrolled in the study experienced stable disease, partial remission or complete remission. The overall response rate (ORR) was 28.6% with partial or complete remission of tumors at study end. PPTT utilizing gold nanorod therapy can be safely administered to canine patients. Further studies are needed to determine the true efficacy in a larger population of canine cancer patients and to and identify those patients most likely to benefit from this therapy.
Mesenchymal stem cells with rhBMP-2 inhibits the growth of canine osteosarcoma cells.
Rici, Rose Eli Grassi; Alcântara, Dayane; Fratini, Paula; Wenceslau, Cristiane Valverde; Ambrósio, Carlos Eduardo; Miglino, Maria Angelica; Maria, Durvanei Augusto
2012-02-22
The bone morphogenetic proteins (BMPs) belong to a unique group of proteins that includes the growth factor TGF-β. BMPs play important roles in cell differentiation, cell proliferation, and inhibition of cell growth. They also participate in the maturation of several cell types, depending on the microenvironment and interactions with other regulatory factors. Depending on their concentration gradient, the BMPs can attract various types of cells and act as chemotactic, mitogenic, or differentiation agents. BMPs can interfere with cell proliferation and the formation of cartilage and bone. In addition, BMPs can induce the differentiation of mesenchymal progenitor cells into various cell types, including chondroblasts and osteoblasts. The aim of this study was to analyze the effects of treatment with rhBMP-2 on the proliferation of canine mesenchymal stem cells (cMSCs) and the tumor suppression properties of rhBMP-2 in canine osteocarcoma (OST) cells. Osteosarcoma cell lines were isolated from biopsies and excisions of animals with osteosarcoma and were characterized by the Laboratory of Biochemistry and Biophysics, Butantan Institute. The mesenchymal stem cells were derived from the bone marrow of canine fetuses (cMSCs) and belong to the University of São Paulo, College of Veterinary Medicine (FMVZ-USP) stem cell bank. After expansion, the cells were cultured in a 12-well Transwell system; cells were treated with bone marrow mesenchymal stem cells associated with rhBMP2. Expression of the intracytoplasmic and nuclear markers such as Caspase-3, Bax, Bad, Bcl-2, Ki-67, p53, Oct3/4, Nanog, Stro-1 were performed by flow citometry. We evaluated the regenerative potential of in vitro treatment with rhBMP-2 and found that both osteogenic induction and tumor regression occur in stem cells from canine bone marrow. rhBMP-2 inhibits the proliferation capacity of OST cells by mechanisms of apoptosis and tumor suppression mediated by p53. We propose that rhBMP-2 has great
Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid
2016-01-01
Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine osteosarcomas, whereas cat samples more often displayed moderate levels. High levels of pro-MMP9, pro-MMP2, and active MMP2 were detected by gelatin zymography in both species, with significantly higher values for active MMP2 in canine osteosarcoma. These findings indicate that MMP2 is probably involved in canine and feline osteosarcoma and their expression and activity could be associated with the different metastatic behavior of canine and feline osteosarcoma.
Mechanical properties of canine osteosarcoma-affected antebrachia.
Steffey, Michele A; Garcia, Tanya C; Daniel, Leticia; Zwingenberger, Allison L; Stover, Susan M
2017-05-01
To determine the influence of neoplasia on the biomechanical properties of canine antebrachia. Ex vivo biomechanical study. Osteosarcoma (OSA)-affected canine antebrachia (n = 12) and unaffected canine antebrachia (n = 9). Antebrachia were compressed in axial loading until failure. A load-deformation curve was used to acquire the structural mechanical properties of neoplastic and unaffected specimens. Structural properties and properties normalized by body weight (BW) and radius length were compared using analysis of variance (ANOVA). Modes of failure were compared descriptively. Neoplastic antebrachia fractured at, or adjacent to, the OSA in the distal radial diaphysis. Unaffected antebrachia failed via mid-diaphyseal radial fractures with a transverse cranial component and an oblique caudal component. Structural mechanical properties were more variable in neoplastic antebrachia than unaffected antebrachia, which was partially attributable to differences in bone geometry related to dog size. When normalized by dog BW and radial length, strength, stiffness, and energy to yield and failure, were lower in neoplastic antebrachia than in unaffected antebrachia. OSA of the distal radial metaphysis in dogs presented for limb amputation markedly compromises the structural integrity of affected antebrachia. However, biomechanical properties of affected bones was sufficient for weight-bearing, as none of the neoplastic antebrachia fractured before amputation. The behavior of tumor invaded bone under cyclic loading warrants further investigations to evaluate the viability of in situ therapies for bone tumors in dogs. © 2017 The American College of Veterinary Surgeons.
uPAR EXPRESSION IN CANINE NORMAL PROSTATE AND WITH PROLIFERATIVE DISORDERS
Directory of Open Access Journals (Sweden)
Mariana Rodrigues Faleiro
2013-06-01
Full Text Available Prostatic lesions such as prostatic intraepithelial neoplasia (PIN and proliferative inflammatory atrophy (PIA are studied in human and canine species due to their malignance potential. The plasminogen activator (PA system has been suggested to play a central role in cell adhesion, angiogenesis, inflammation, and tumor invasion. The urokinase-type plasminogen activator receptor (uPAR is a component of the PA, with a range of expression in tumor and stromal cells. In this study, uPAR expression in both canine normal prostates and with proliferative disorders (benign prostatic hyperplasia-BPH, proliferative inflammatory atrophy-PIA, prostatic intraepithelial neoplasia-PIN, and carcinoma-PC was evaluated by immunohistochemistry in a tissue microarray (TMA slide to establish the role of this enzyme in extracellular matrix (ECM remodeling and in the processes of tissue invasion. A total of 298 cores and 355 diagnoses were obtained, with 36 (10.1% normal prostates, 46 (13.0% with BPH, 128 (36.1% with PIA, 74 (20.8% with PIN and 71 (20.0% with PC. There is variation in the expression of uPAR in canine prostate according to the lesion, with lower expression in normal tissue and with BPH, and higher expression in tissue with PIA, PIN and PC. The high expression of uPAR in inflammatory and neoplastic microenvironment indicates increased proteolytic activity in canine prostates with PIA, PIN, and PC.
Carcinome hybride de la fosse nasale | Ben Mhamed | Journal ...
African Journals Online (AJOL)
Hybrid carcinoma is a rare neoplasm, accounting for less than 0.1% of all registered tumors in salivary glands. Up to now, only one case of hybrid carcinoma of the nasal cavity has been described. In this report, we describe a case of hybrid carcinoma composed of epithelial-myoepithelial carcinoma with an adenoid cystic ...
Successful Treatment of Canine Sporotrichosis with Terbinafine: Case Reports and Literature Review.
Viana, Paula Gonçalves; Figueiredo, Anna Barreto Fernandes; Gremião, Isabella Dib Ferreira; de Miranda, Luisa Helena Monteiro; da Silva Antonio, Isabela Maria; Boechat, Jéssica Sepulveda; de Sá Machado, Ana Caroline; de Oliveira, Manoel Marques Evangelista; Pereira, Sandro Antonio
2018-04-01
Sporotrichosis occurs worldwide, and the metropolitan region of Rio de Janeiro, Brazil, is a main endemic area, with a large number of human and animal cases in the last 19 years. This mycosis is more frequently described in cats rather than in dogs. There are a limited number of oral antifungal agents for the treatment of sporotrichosis in animals. In this context, the effectiveness of terbinafine in the treatment of sporotrichosis in humans, as well as the promising results of in vitro susceptibility tests, inspired us to use this drug in the therapy of this mycosis in dogs. We reported for the first time the use of terbinafine in the treatment of two dogs with sporotrichosis caused by Sporothrix brasiliensis. Moreover, we provided an overview of therapeutic features of canine sporotrichosis cases reported since the 1960s. One of the dogs presented the fixed cutaneous form of the disease, while the other patient presented hyperemia of the nasal mucosa and respiratory signs only. Terbinafine showed high antifungal activity in vitro against the canine Sporothrix isolates. The dogs were successfully treated with terbinafine, with remission of all clinical signs initially presented. The current reports indicate that this drug can emerge as a therapeutic option for canine sporotrichosis.
Wu, Lisa Y; Johnson, Jacqueline M; Simmons, Jessica K; Mendes, Desiree E; Geruntho, Jonathan J; Liu, Tiancheng; Dirksen, Wessel P; Rosol, Thomas J; Davis, William C; Berkman, Clifford E
2014-05-01
Prostate-specific membrane antigen (PSMA) remains an important target for diagnostic and therapeutic application for human prostate cancer. Model cell lines have been recently developed to study canine prostate cancer but their PSMA expression and enzymatic activity have not been elucidated. The present study was focused on determining PSMA expression in these model canine cell lines and the use of fluorescent small-molecule enzyme inhibitors to detect canine PSMA expression by flow cytometry. Western blot and RT-PCR were used to determine the transcriptional and translational expression of PSMA on the canine cell lines Leo and Ace-1. An endpoint HPLC-based assay was used to monitor the enzymatic activity of canine PSMA and the potency of enzyme inhibitors. Flow cytometry was used to detect the PSMA expressed on Leo and Ace-1 cells using a fluorescently tagged PSMA enzyme inhibitor. Canine PSMA expression on the Leo cell line was confirmed by Western blot and RT-PCR, the enzyme activity, and flow cytometry. Kinetic parameters Km and Vmax of PSMA enzymatic activity for the synthetic substrate (PABGγG) were determined to be 393 nM and 220 pmol min(-1) mg protein(-1) , respectively. The inhibitor core 1 and fluorescent inhibitor 2 were found to be potent reversible inhibitors (IC50 = 13.2 and 1.6 nM, respectively) of PSMA expressed on the Leo cell line. Fluorescent labeling of Leo cells demonstrated that the fluorescent PSMA inhibitor 2 can be used for the detection of PSMA-positive canine prostate tumor cells. Expression of PSMA on Ace-1 was low and not detectable by flow cytometry. The results described herein have demonstrated that PSMA is expressed on canine prostate tumor cells and exhibits similar enzymatic characteristics as human PSMA. The findings show that the small molecule enzyme inhibitors currently being studied for use in diagnosis and therapy of human prostate cancer can also be extended to include canine prostate cancer. Importantly
Brusveen, Elin Marie Gravdal; Brudvik, Pongsri; Bøe, Olav Egil; Mavragani, Maria
2012-04-01
The purpose of the study was to evaluate impacted maxillary canines as risk factor for orthodontic apical root resorption. The sample comprised 66 patients treated with fixed appliances. Thirty-two patients with a unilateral impacted maxillary canine, which was distanced from the roots of the incisors at a preliminary phase of treatment before bonding, formed the impaction group, and 34 patients without impactions served as the controls. Root shortening was calculated by using pretreatment and posttreatment intraoral radiographs. Inclination of the eruption path of the impacted canine relative to the midline, axis of the lateral incisor, and nasal line, root development, and the medial and vertical positions of the impacted tooth were recorded on orthopantomograms and lateral cephalometric films. The follicle/tooth ratio was evaluated by using periapical radiographs. No significant difference in apical resorption of the maxillary incisors was detected between the impaction and control groups, or between the incisors of the impacted and contralateral sides in the same subject. Likewise, no difference in the severity of root resorption was found between the incisors of impacted side alone and the incisors of the control group. Mesial and vertical inclinations of the impacted canines were negatively related to a lateral incisor's root resorption. No correlations were found between resorption and medial or vertical position of the crown of the canine. The follicle/tooth ratio was significantly related to the mesial inclination of the impacted canine, but not to root resorption. An impacted maxillary canine, after being distanced from the incisor roots, does not seem to be a risk factor for apical root resorption during orthodontic treatment. Copyright © 2012 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.
Scharf, Valery F; Farese, James P; Coomer, Alastair R; Milner, Rowan J; Taylor, David P; Salute, Marc E; Chang, Myron N; Neal, Dan; Siemann, Dietmar W
2013-05-01
Objective-To investigate the effects of bevacizumab, a human monoclonal antibody against vascular endothelial growth factor, on the angiogenesis and growth of canine osteosarcoma cells xenografted in mice. Animals-27 athymic nude mice. Procedures-To each mouse, highly metastasizing parent osteosarcoma cells of canine origin were injected into the left gastrocnemius muscle. Each mouse was then randomly allocated to 1 of 3 treatment groups: high-dose bevacizumab (4 mg/kg, IP), low-dose bevacizumab (2 mg/kg, IP), or control (no treatment). Tumor growth (the number of days required for the tumor to grow from 8 to 13 mm), vasculature, histomorphology, necrosis, and pulmonary metastasis were evaluated. Results-Mice in the high-dose bevacizumab group had significantly delayed tumor growth (mean ± SD, 13.4 ± 3.8 days; range, 9 to 21 days), compared with that for mice in the low-dose bevacizumab group (mean ± SD, 9.4 ± 1.5 days; range, 7 to 11 days) or control group (mean ± SD, 7. 2 ± 1.5 days; range, 4 to 9 days). Mice in the low-dose bevacizumab group also had significantly delayed tumor growth, compared with that for mice in the control group. Conclusions and Clinical Relevance-Results indicated that bevacizumab inhibited growth of canine osteosarcoma cells xenografted in mice, which suggested that vascular endothelial growth factor inhibitors may be clinically useful for the treatment of osteosarcoma in dogs. Impact for Human Medicine-Canine osteosarcoma is used as a research model for human osteosarcoma; therefore, bevacizumab may be clinically beneficial for the treatment of osteosarcoma in humans.
Neoplasias de Cavidad nasal y senos paranasales en caninos
Directory of Open Access Journals (Sweden)
Giovanni Torres
2008-10-01
Full Text Available Las neoplasias de cavidad nasal y senos paranasales en caninos son de escasa presentación; llegan tan sóloal 1.5% de los quistes diagnosticados en esta especie.Con referencia al total de tumores del tracto respiratorio representan entre el 60 y el 80%. Son más comunes en caninos de nariz larga, no existe predilección por género; por el comportamiento, las neoplasias que se desarrollanen la cavidad nasal y senos paranasales son benignas y malignas, siendo estas últimas las más frecuentes. Teniendo en cuenta el tejido de origen pueden ser epiteliales, mesenquimales y de otro origen como los linfomas y el tumor venéreo transmisible. La apariciónde la sintomatología se asocia con la capacidad de obstruir las vías aéreas, la invasión y destrucción local de tejido. En general los signos clínicos asociados consistenen: dificultad respiratoria, estornudo, secreciónnasal, hemorragia nasal y la presencia de masas de características variadas en tamaño y forma. El diagnóstico se basa en signos clínicos, evaluación citológica e histológica de las lesiones. Esta última es 100% diagnóstica, para el tratamiento se utiliza la extracción quirúrgica combinada con terapia de radiación y quimioterapia.
Characterization of STAT3 activation and expression in canine and human osteosarcoma
Directory of Open Access Journals (Sweden)
Li Pui-Kai
2009-03-01
Full Text Available Abstract Background Dysregulation of signal transducer and activator of transcription 3 (STAT3 has been implicated as a key participant in tumor cell survival, proliferation, and metastasis and is often correlated with a more malignant tumor phenotype. STAT3 phosphorylation has been demonstrated in a subset of human osteosarcoma (OSA tissues and cell lines. OSA in the canine population is known to exhibit a similar clinical behavior and molecular biology when compared to its human counterpart, and is often used as a model for preclinical testing of novel therapeutics. The purpose of this study was to investigate the potential role of STAT3 in canine and human OSA, and to evaluate the biologic activity of a novel small molecule STAT3 inhibitor. Methods To examine STAT3 and Src expression in OSA, we performed Western blotting and RT-PCR. OSA cells were treated with either STAT3 siRNA or small molecule Src (SU6656 or STAT3 (LLL3 inhibitors and cell proliferation (CyQUANT, caspase 3/7 activity (ELISA, apoptosis (Western blotting for PARP cleavage and/or viability (Wst-1 were determined. Additionally, STAT3 DNA binding after treatment was determined using EMSA. Expression of STAT3 targets after treatment was demonstrated with Western blotting, RT-PCR, or gel zymography. Results Our data demonstrate that constitutive activation of STAT3 is present in a subset of canine OSA tumors and human and canine cell lines, but not normal canine osteoblasts. In both canine and human OSA cell lines, downregulation of STAT3 activity through inhibition of upstream Src family kinases using SU6656, inhibition of STAT3 DNA binding and transcriptional activities using LLL3, or modulation of STAT3 expression using siRNA, all resulted in decreased cell proliferation and viability, ultimately inducing caspase-3/7 mediated apoptosis in treated cells. Furthermore, inhibition of either Src or STAT3 activity downregulated the expression of survivin, VEGF, and MMP2, all known
Characterization of STAT3 activation and expression in canine and human osteosarcoma
International Nuclear Information System (INIS)
Fossey, Stacey L; Liao, Albert T; McCleese, Jennifer K; Bear, Misty D; Lin, Jiayuh; Li, Pui-Kai; Kisseberth, William C; London, Cheryl A
2009-01-01
Dysregulation of signal transducer and activator of transcription 3 (STAT3) has been implicated as a key participant in tumor cell survival, proliferation, and metastasis and is often correlated with a more malignant tumor phenotype. STAT3 phosphorylation has been demonstrated in a subset of human osteosarcoma (OSA) tissues and cell lines. OSA in the canine population is known to exhibit a similar clinical behavior and molecular biology when compared to its human counterpart, and is often used as a model for preclinical testing of novel therapeutics. The purpose of this study was to investigate the potential role of STAT3 in canine and human OSA, and to evaluate the biologic activity of a novel small molecule STAT3 inhibitor. To examine STAT3 and Src expression in OSA, we performed Western blotting and RT-PCR. OSA cells were treated with either STAT3 siRNA or small molecule Src (SU6656) or STAT3 (LLL3) inhibitors and cell proliferation (CyQUANT), caspase 3/7 activity (ELISA), apoptosis (Western blotting for PARP cleavage) and/or viability (Wst-1) were determined. Additionally, STAT3 DNA binding after treatment was determined using EMSA. Expression of STAT3 targets after treatment was demonstrated with Western blotting, RT-PCR, or gel zymography. Our data demonstrate that constitutive activation of STAT3 is present in a subset of canine OSA tumors and human and canine cell lines, but not normal canine osteoblasts. In both canine and human OSA cell lines, downregulation of STAT3 activity through inhibition of upstream Src family kinases using SU6656, inhibition of STAT3 DNA binding and transcriptional activities using LLL3, or modulation of STAT3 expression using siRNA, all resulted in decreased cell proliferation and viability, ultimately inducing caspase-3/7 mediated apoptosis in treated cells. Furthermore, inhibition of either Src or STAT3 activity downregulated the expression of survivin, VEGF, and MMP2, all known transcriptional targets of STAT3. These data
Nasal paraganglioma: A case report and literature review
Directory of Open Access Journals (Sweden)
Granato, Lídio
2013-01-01
Full Text Available Introduction: Paragangliomas are neuroendocrine tumors that most commonly originate in the adrenal gland, a type that is called pheochromocytoma; however, 5-10% of paragangliomas are extra-adrenal and may arise in any area between the neck and pelvic region along the sympathetic nervous system. Those located in the head and neck comprise 3% of extra-adrenal tumors, with the majority originating in the tympanic-jugular region and carotid body. Objective: To present a rare case of nasal paraganglioma and review the literature. Case report: The patient was submitted to medial subtotal maxillectomy, and her clinical findings, diagnostic data, and treatment outcome were recorded. Conclusion: Paragangliomas are considered benign tumors, but they occasionally display a malignant character. The most important finding in this case was the need for total resection of the tumor to avoid recurrence.
... Medications Alternative Therapies Nasal Wash Treatment Nasal Wash Treatment Make an Appointment Ask a Question Refer Patient The Centers for Disease Control (CDC) guidelines for preparing water used in a nasal wash are listed below. Many ...
Comparative proteome analysis of monolayer and spheroid culture of canine osteosarcoma cells.
Gebhard, Christiane; Miller, Ingrid; Hummel, Karin; Neschi Née Ondrovics, Martina; Schlosser, Sarah; Walter, Ingrid
2018-04-15
Osteosarcoma is an aggressive bone tumor with high metastasis rate in the lungs and affects both humans and dogs in a similar way. Three-dimensional tumor cell cultures mimic the in vivo situation of micro-tumors and metastases and are therefore better experimental in vitro models than the often applied two-dimensional monolayer cultures. The aim of the present study was to perform comparative proteomics of standard monolayer cultures of canine osteosarcoma cells (D17) and three-dimensional spheroid cultures, to better characterize the 3D model before starting with experiments like migration assays. Using DIGE in combination with MALDI-TOF/TOF we found 27 unique canine proteins differently represented between these two culture systems, most of them being part of a functional network including mainly chaperones, structural proteins, stress-related proteins, proteins of the glycolysis/gluconeogenesis pathway and oxidoreductases. In monolayer cells, a noticeable shift to more acidic pI values was noticed for several proteins of medium to high abundance; two proteins (protein disulfide isomerase A3, stress-induced-phosphoprotein 1) showed an increase of phosphorylated protein species. Protein distribution within the cells, as detected by immunohistochemistry, displayed a switch of stress-induced-phosphoprotein 1 from the cytoplasm (in monolayer cultures) to the nucleus (in spheroid cultures). Additionally, Western blot testing revealed upregulated concentrations of metastasin (S100A4), triosephosphate isomerase 1 and septin 2 in spheroid cultures, in contrast to decreased concentrations of CCT2, a subunit of the T-complex. Results indicate regulation of stress proteins in the process of three-dimensional organization characterized by a hypoxic and nutrient-deficient environment comparable to tumor micro-metastases. Osteosarcoma is an aggressive bone tumor that early spreads to the lungs. Three-dimensional tumor cell cultures represent the avascular stage of micro-tumors
Rare occupational cause of nasal septum perforation: Nickel exposure.
Bolek, Ertugrul Cagri; Erden, Abdulsamet; Kulekci, Cagri; Kalyoncu, Umut; Karadag, Omer
2017-10-06
Many etiologies are held accountable for nasal septum perforations. Topical nasal drug usage, previous surgeries, trauma, nose picking, squamous cell carcinoma, some rheumatological disorders such as granulomatosis with polyangiitis (Wegener granulomatosis), some infectious diseases such as syphilis and leprosy are among the causes of the perforations. Occupational heavy metal exposures by inhalation rarely may also cause nasal septum perforation. Here, we present a 29-year-old patient without any known diseases, who is a worker at a metallic coating and nickel-plating factory, referred for investigation of his nasal cartilage septum perforation from an otorhinolaryngology clinic. The patient questioning, physical examination and laboratory assessment about rheumatic and infectious diseases were negative. There was a metallic smell in the breath during the physical examination. The analysis showed serum nickel level at 31 μg/l and urine nickel at 18 μg/l (84.11 μg/g creatinine). Other possible serum and urine heavy metal levels were within normal ranges. Nickel exposure is usually together with other heavy metals (chromium or cadmium), it is rarely alone. Nickel ingested by inhalation usually leads to respiratory problems such as reduced olfactory acuity, ulcers, septum perforation or tumors of the nasal sinuses. This case demonstrates the importance of occupational anamnesis and awareness of diagnosis. Int J Occup Med Environ Health 2017;30(6):963-967. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.
Comparison of BNCT and GdNCT efficacy in treatment of canine cancer
Energy Technology Data Exchange (ETDEWEB)
Mitin, V.N. [Russian Cancer Research Center of the RAMS, Kashirskoe shosse, 24, 115478 Moscow (Russian Federation); Kulakov, V.N.; Khokhlov, V.F.; Sheino, I.N. [State Research Center Institute of Biophysics, Zhivopisnaya ul., 46, 123182 Moscow (Russian Federation); Arnopolskaya, A.M. [Russian Cancer Research Center of the RAMS, Kashirskoe shosse, 24, 115478 Moscow (Russian Federation)], E-mail: ariana_777@inbox.ru; Kozlovskaya, N.G. [Russian Cancer Research Center of the RAMS, Kashirskoe shosse, 24, 115478 Moscow (Russian Federation); Zaitsev, K.N.; Portnov, A.A. [Moscow Engineering Physics Institute, Kashirskoe shosse, 31, 115409 Moscow (Russian Federation)
2009-07-15
In this study efficacy of antineoplastic action of gadolinium NCT and boron NCT in cases of canine melanoma and osteosarcoma was compared. Canine spontaneous tumors, such as melanoma and osteosarcoma, have clinical common features with human malignancies, so these tumors in dogs can be considered as clinical model of human melanoma and osteosarcoma. The study has been carried out on 33 dogs with oral cavity melanoma and 9 dogs with osteosarcoma. Dogs with spontaneous melanoma of oral cavity and osteosarcoma of extremities were selected by the results of clinical examination. Irradiation was carried out at the NCT facility of the IRT MEPhI reactor. Neutron irradiation without boron or gadolinium was chosen as a control method to evaluate the efficacy of NCT.
Comparison of BNCT and GdNCT efficacy in treatment of canine cancer
International Nuclear Information System (INIS)
Mitin, V.N.; Kulakov, V.N.; Khokhlov, V.F.; Sheino, I.N.; Arnopolskaya, A.M.; Kozlovskaya, N.G.; Zaitsev, K.N.; Portnov, A.A.
2009-01-01
In this study efficacy of antineoplastic action of gadolinium NCT and boron NCT in cases of canine melanoma and osteosarcoma was compared. Canine spontaneous tumors, such as melanoma and osteosarcoma, have clinical common features with human malignancies, so these tumors in dogs can be considered as clinical model of human melanoma and osteosarcoma. The study has been carried out on 33 dogs with oral cavity melanoma and 9 dogs with osteosarcoma. Dogs with spontaneous melanoma of oral cavity and osteosarcoma of extremities were selected by the results of clinical examination. Irradiation was carried out at the NCT facility of the IRT MEPhI reactor. Neutron irradiation without boron or gadolinium was chosen as a control method to evaluate the efficacy of NCT.
Book, Alison P; Fidel, Janean; Wills, Tamara; Bryan, Jeffrey; Sellon, Rance; Mattoon, John
2011-01-01
Cytologic sampling of the ultrasonographically normal spleen and liver is not implemented routinely in the clinical staging of canine cutaneous mast cell tumors and normal ultrasound findings are often accepted as sufficient evidence for ruling out splenic or liver metastasis. Our objective was to define the specificity and sensitivity of ultrasound findings for diagnosis of mast cell infiltration when verified with cytologic evaluation, and to define the prognostic role of cytologic evaluation of liver and splenic aspirates. Dogs with a diagnosis of clinically aggressive grade II, or grade III mast cell tumor treated with a combination vinblastine/CCNU chemotherapy protocol, were selected retrospectively based on availability of cytologic evaluation of spleen plus or minus liver for staging. Out of 19 dogs, 10 dogs had a grade II tumor and nine a grade III tumor. Seven dogs had mast cell infiltration of the spleen, liver, or both. The sensitivity of ultrasound for detecting mast cell infiltration was 43% for the spleen and 0% for the liver. Dogs with positive cytologic evidence of mast cell infiltration to spleen, liver, or both had significantly shorter survival (100 vs. 291 days) than dogs without evidence of mast cell infiltration (Pdogs with a clinically aggressive mast cell tumor. © 2011 Veterinary Radiology & Ultrasound.
A transseptal approach in transsphenoidal surgery for pituitary (hypophyseal) tumors
International Nuclear Information System (INIS)
Gierek, T.; Galuszko-Ignasiak, B.; Krauze, J.; Rudnik, A.
1994-01-01
The authors described the direct transseptal approach in transsphenoidal surgery for hypophyseal tumors. This route gives a good insight into the area of the sella. The above mentioned method is also less destructive to nasal structures in the nasal cavity, because preserves the anterior nasal septum. It is uniformity of actually views of rhinological school. 20 patients were operated using this method and none of them noticed the changes of nasal airway and the sense of smell. (author)
Maxillary canine impactions related to impacted central incisors: two case reports.
Bayram, Mehmet; Ozer, Mete; Sener, Ismail
2007-09-01
The purpose of this case report is to describe the combined surgical and orthodontic treatment of two cases with an impacted maxillary central incisor and canine in the same quadrant and to discuss the causal relationship between them. The most common causes of canine impactions are usually the result of one or more factors such as a long path of eruption, tooth size-arch length discrepancies, abnormal position of the tooth bud, prolonged retention or early loss of the deciduous canine, trauma, the presence of an alveolar cleft, ankylosis, cystic or neoplastic formation, dilaceration of the root, supernumerary teeth, and odontomas. Although impaction of the maxillary central incisor is almost as prevalent as impacted canines its etiology is different. The principal factors involved in causing the anomaly are supernumerary teeth, odontomas, and trauma. Case #1: A 10.5-year-old girl in the early mixed dentition stage presented with a chief complaint of the appearance of her anterior teeth. She had a Class I skeletal pattern and a history of trauma to the maxillary central incisors at age five with premature exfoliation. Radiographs revealed an impacted upper right central incisor in the region of the nasal floor, delayed eruption of the maxillary permanent central incisor, and the adjacent lateral incisor was inclined toward the edentulous space. Treatment was done in two stages consisting of surgical exposure and traction of the impacted central incisor and fixed orthodontic treatment. Case #2: An 11.5-year-old girl presented for orthodontic treatment with the chief complaint of an unerupted tooth and the appearance of her upper anterior teeth. She was in the late mixed dentition period with a Class III skeletal pattern along with an anterior cross-bite with some maxillary transverse deficiency. The maxillary right canine and central incisor were absent, but the maxillary right deciduous canine was still present. Treatment included arch expansion followed by
On the relation of nasal cycling with nasal airway dimensions
Energy Technology Data Exchange (ETDEWEB)
Guilmette, R A; Wolff, R K
1988-12-01
The size and configuration of the nasal airways of humans change with time as a result of the normal process of congestion/decongestion of the erectile tissue of the nasal mucosa. To determine the extent to which airway areas change in vivo, we used magnetic resonance imaging (MRI) to quantitate both the cross-sectional area and perimeter of coronal sections of the entire nasal airway of a human subject. Changes in airway size or patency were indexed to measured changes in unilateral nasal airway resistance determined by posterior rhino manometry. The results of this study in which two MRI scans were performed for presumed left-side patency and two for right-side patency, showed that changes in nasal airway resistance were difficult to ascribe to systematic changes In the sizes of the airways. (author)
On the relation of nasal cycling with nasal airway dimensions
International Nuclear Information System (INIS)
Guilmette, R.A.; Wolff, R.K.
1988-01-01
The size and configuration of the nasal airways of humans change with time as a result of the normal process of congestion/decongestion of the erectile tissue of the nasal mucosa. To determine the extent to which airway areas change in vivo, we used magnetic resonance imaging (MRI) to quantitate both the cross-sectional area and perimeter of coronal sections of the entire nasal airway of a human subject. Changes in airway size or patency were indexed to measured changes in unilateral nasal airway resistance determined by posterior rhino manometry. The results of this study in which two MRI scans were performed for presumed left-side patency and two for right-side patency, showed that changes in nasal airway resistance were difficult to ascribe to systematic changes In the sizes of the airways. (author)
Horta, Rodrigo S; Lavalle, Gleidice E; Monteiro, Lidianne N; Souza, Mayara C C; Cassali, Geovanni D; Araújo, Roberto B
2018-03-01
Mast cell tumor (MCT) is a frequent cutaneous neoplasm in dogs that is heterogeneous in clinical presentation and biological behavior, with a variable potential for recurrence and metastasis. Accurate prediction of clinical outcomes has been challenging. The study objective was to develop a system for classification of canine MCT according to the mortality risk based on individual assessment of clinical, histologic, immunohistochemical, and molecular features. The study included 149 dogs with a histologic diagnosis of cutaneous or subcutaneous MCT. By univariate analysis, MCT metastasis and related death was significantly associated with clinical stage ( P < .0001, r P = -0.610), history of tumor recurrence ( P < .0001, r P = -0.550), Patnaik ( P < .0001, r P = -0.380) and Kiupel grades ( P < .0001, r P = -0.500), predominant organization of neoplastic cells ( P < .0001, r P = -0.452), mitotic count ( P < .0001, r P = -0.325), Ki-67 labeling index ( P < .0001, r P = -0.414), KITr pattern ( P = .02, r P = 0.207), and c-KIT mutational status ( P < .0001, r P = -0.356). By multivariate analysis with Cox proportional hazard model, only 2 features were independent predictors of overall survival: an amendment of the World Health Organization clinical staging system (hazard ratio [95% CI]: 1.824 [1.210-4.481]; P = .01) and a history of tumor recurrence (hazard ratio [95% CI]: 9.250 [2.158-23.268]; P < .001]. From these results, we propose an amendment of the WHO staging system, a method of risk analysis, and a suggested approach to clinical and laboratory evaluation of dogs with cutaneous MCT.
Effect of the nasal cycle on congestive response during bilateral nasal allergen provocation
Directory of Open Access Journals (Sweden)
Tomasz Gotlib
2014-06-01
Full Text Available Background. Bilateral nasal allergen provocation usually produces more pronounced obstruction of one nasal passage. It was found that this could be related to the stage of the nasal cycle before the provocation. objective. To discover whether the stage of the nasal cycle is decisive for asymmetry in congestive response observed during bilateral allergen nasal provocation. methods. Two bilateral nasal allergen provocations were performed in a group of 26 pollen-sensitive volunteers. Acoustic rhinometry measurements were taken during the nasal cycle, and then after the provocation. A cross-sectional area at the level of the inferior turbinate (CSA-2 was measured. Consecutive challenges were performed in the opposite phase of the nasal cycle: the side which had been wide just before the first challenge, was narrow before the second provocation. results. Asymmetry in CSA-2 reduction between the nasal passages was observed in most cases. Significant difference was observed between mean CSA-2 reduction rate (reactivity of the side that responded with greater congestion, and the opposite side. No significant difference was found in mean CSA-2 reduction rate between the side which was narrow, and the side which was wide before provocation. conclusions. Asymmetry of congestive response during bilateral nasal allergen provocation is not dependent on the stage of the nasal cycle preceding the challenge.
Craniofacial resection in nasal cavity and paranasal sinus carcinoma
International Nuclear Information System (INIS)
Arias Garzon, Williams Rene; Cohn, Fabrizio; Toscano Mancheno, Roberto; Chonlong Saltos, Maria Jose
2006-01-01
The nasal cavity and paranasal sinus carcinoma include 1% of all malignant tumors and 3% in head and neck region. The majority of tumors of this region are squamous cell carcinomas, which rises in the maxillary sinus and generates symptoms when it reaches a great size. Treatment is very difficult. The Cat scan and magnetic resonance are helpful to evaluate the tumor extent, asses erode bone boundary and evaluate growth in soft tissues of intra skull like the dura overlying the frontal lobe and brain. The growth of the tumor in the anterior skull base is not a contraindication for surgical treatment. A combined intracranial facial approach to the paranasal sinuses carcinoma enables complete tumor resection and edges without neoplasm. The 5 year survival for patients who undergo anterior craniofacial resection is approximately 50 to 60%, and local tumor control is obtained in 65%. We present a patient with squamous carcinoma of superior maxillary antrum and skull base encroachment invasion resolved with craniofacial resection. (The author)
International Nuclear Information System (INIS)
Klopfleisch, Robert; Lenze, Dido; Hummel, Michael; Gruber, Achim D
2010-01-01
Similar to human breast cancer mammary tumors of the female dog are commonly associated with a fatal outcome due to the development of distant metastases. However, the molecular defects leading to metastasis are largely unknown and the value of canine mammary carcinoma as a model for human breast cancer is unclear. In this study, we analyzed the gene expression signatures associated with mammary tumor metastasis and asked for parallels with the human equivalent. Messenger RNA expression profiles of twenty-seven lymph node metastasis positive or negative canine mammary carcinomas were established by microarray analysis. Differentially expressed genes were functionally characterized and associated with molecular pathways. The findings were also correlated with published data on human breast cancer. Metastatic canine mammary carcinomas had 1,011 significantly differentially expressed genes when compared to non-metastatic carcinomas. Metastatic carcinomas had a significant up-regulation of genes associated with cell cycle regulation, matrix modulation, protein folding and proteasomal degradation whereas cell differentiation genes, growth factor pathway genes and regulators of actin organization were significantly down-regulated. Interestingly, 265 of the 1,011 differentially expressed canine genes are also related to human breast cancer and, vice versa, parts of a human prognostic gene signature were identified in the expression profiles of the metastatic canine tumors. Metastatic canine mammary carcinomas can be discriminated from non-metastatic carcinomas by their gene expression profiles. More than one third of the differentially expressed genes are also described of relevance for human breast cancer. Many of the differentially expressed genes are linked to functions and pathways which appear to be relevant for the induction and maintenance of metastatic progression and may represent new therapeutic targets. Furthermore, dogs are in some aspects suitable as a
Tumor Biology and Immunology | Center for Cancer Research
Tumor Biology and Immunology The Comparative Brain Tumor Consortium is collaborating with National Center for Advanced Translational Sciences to complete whole exome sequencing on canine meningioma samples. Results will be published and made publicly available.
Nasal glial heterotopia or congenital hemangioma? A case report.
Lartizien, R; Durand, C; Blaise, S; Morand, B
2017-10-01
Nasal glial heterotopia (NGH) is a rare benign tumor of the median line. We describe the case of a child presenting a lateral nasal mass. The characteristics of the prenatal ultrasound and the postnatal clinical examination argued in favor of a congenital hemangioma (CH). The MRI performed at 6 weeks of life suggested glial heterotopia. This diagnosis was confirmed by the pathological analysis. Congenital hemangiomas and nasal glial heterotopies have similar clinical presentations. Prenatal ultrasound diagnosis between NGH and CH is difficult. Fetal MRI is not yet highly specific for these two lesions, but it can eliminate an intracerebral connection in cases of NGH. Postnatal exams are more specific. Flow on the Doppler exam is rapid for CH and slow for NGH. On MRI, these two lesions appear as a hypersignal on T2-weighted sequences, but less intense for NGH than for CH. Distinguishing between NGH and CH can be difficult. This does not have a direct incidence on treatment because it is surgical in both cases. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
... the way to your throat as you breathe. Cancer of the nasal cavity and paranasal sinuses is ... be like those of infections. Doctors diagnose nasal cancer with imaging tests, lighted tube-like instruments that ...
Mesenchymal stem cells with rhBMP-2 inhibits the growth of canine osteosarcoma cells
Directory of Open Access Journals (Sweden)
Grassi Rici Rose
2012-02-01
Full Text Available Abstract Background The bone morphogenetic proteins (BMPs belong to a unique group of proteins that includes the growth factor TGF-β. BMPs play important roles in cell differentiation, cell proliferation, and inhibition of cell growth. They also participate in the maturation of several cell types, depending on the microenvironment and interactions with other regulatory factors. Depending on their concentration gradient, the BMPs can attract various types of cells and act as chemotactic, mitogenic, or differentiation agents. BMPs can interfere with cell proliferation and the formation of cartilage and bone. In addition, BMPs can induce the differentiation of mesenchymal progenitor cells into various cell types, including chondroblasts and osteoblasts. The aim of this study was to analyze the effects of treatment with rhBMP-2 on the proliferation of canine mesenchymal stem cells (cMSCs and the tumor suppression properties of rhBMP-2 in canine osteocarcoma (OST cells. Osteosarcoma cell lines were isolated from biopsies and excisions of animals with osteosarcoma and were characterized by the Laboratory of Biochemistry and Biophysics, Butantan Institute. The mesenchymal stem cells were derived from the bone marrow of canine fetuses (cMSCs and belong to the University of São Paulo, College of Veterinary Medicine (FMVZ-USP stem cell bank. After expansion, the cells were cultured in a 12-well Transwell system; cells were treated with bone marrow mesenchymal stem cells associated with rhBMP2. Expression of the intracytoplasmic and nuclear markers such as Caspase-3, Bax, Bad, Bcl-2, Ki-67, p53, Oct3/4, Nanog, Stro-1 were performed by flow citometry. Results We evaluated the regenerative potential of in vitro treatment with rhBMP-2 and found that both osteogenic induction and tumor regression occur in stem cells from canine bone marrow. rhBMP-2 inhibits the proliferation capacity of OST cells by mechanisms of apoptosis and tumor suppression mediated by p
Fenger, Joelle M; Roberts, Ryan D; Iwenofu, O Hans; Bear, Misty D; Zhang, Xiaoli; Couto, Jason I; Modiano, Jaime F; Kisseberth, William C; London, Cheryl A
2016-10-10
MicroRNAs (miRNAs) regulate the expression of networks of genes and their dysregulation is well documented in human malignancies; however, limited information exists regarding the impact of miRNAs on the development and progression of osteosarcoma (OS). Canine OS exhibits clinical and molecular features that closely resemble the corresponding human disease and it is considered a well-established spontaneous animal model to study OS biology. The purpose of this study was to investigate miRNA dysregulation in canine OS. We evaluated miRNA expression in primary canine OS tumors and normal canine osteoblast cells using the nanoString nCounter system. Quantitative PCR was used to validate the nanoString findings and to assess miR-9 expression in canine OS tumors, OS cell lines, and normal osteoblasts. Canine osteoblasts and OS cell lines were stably transduced with pre-miR-9 or anti-miR-9 lentiviral constructs to determine the consequences of miR-9 on cell proliferation, apoptosis, invasion and migration. Proteomic and gene expression profiling of normal canine osteoblasts with enforced miR-9 expression was performed using 2D-DIGE/tandem mass spectrometry and RNA sequencing and changes in protein and mRNA expression were validated with Western blotting and quantitative PCR. OS cell lines were transduced with gelsolin (GSN) shRNAs to investigate the impact of GSN knockdown on OS cell invasion. We identified a unique miRNA signature associated with primary canine OS and identified miR-9 as being significantly overexpressed in canine OS tumors and cell lines compared to normal osteoblasts. Additionally, high miR-9 expression was demonstrated in tumor-specific tissue obtained from primary OS tumors. In normal osteoblasts and OS cell lines transduced with miR-9 lentivirus, enhanced invasion and migration were observed, but miR-9 did not affect cell proliferation or apoptosis. Proteomic and transcriptional profiling of normal canine osteoblasts overexpressing miR-9 identified
International Nuclear Information System (INIS)
Gavin, P.R.; Fike, J.R.; Hoopes, P.J.
1995-01-01
Central nervous system (CNS) tumors are relatively common in veterinary medicine, with most diagnoses occurring in the canine and feline species. Numerous tumor types from various cells or origins have been identified with the most common tumors being meningiomas and glial cell tumors. Radiation therapy is often used as an aid to control the clinical signs associated with these neoplasms. In general, these tumors have a very low metastatic potential, such that local control offers substantial benefit. Experience in veterinary radiation oncology would indicate that many patients benefit from radiation treatment. Current practice indicates the need for computed tomography or magnetic resonance imaging studies. These highly beneficial studies are used for diagnosis, treatment planning, and to monitor treatment response. Improvements in treatment planning and radiation delivered to the tumor, while sparing the normal tissues, should improve local control and decrease potential radiation related problems to the CNS. When possible, multiple fractions of 3 Gy or less should be used. The tolerance dose to the normal tissue with this fractionation schedule is 50 to 55 Gy. The most common and serious complications of radiation for CNS tumors is delayed radiation myelopathy and necrosis. Medical management of the patient during radiation therapy requires careful attention to anesthetic protocols, and medications to reduce intracranial pressure that is often elevated in these patients. Canine brain tumors have served as an experimental model to test numerous new treatments. Increased availability of advanced imaging modalities has spawned increased detection of these neoplasms. Early detection of these tumors with appropriate aggressive therapy should prove beneficial to many patients
Nasal Carriage of 200 Patients with Nasal Bone Fracture in Korea
Directory of Open Access Journals (Sweden)
Jun Wook Lee
2013-09-01
Full Text Available BackgroundPathogens in the nasal cavity during nasal surgery could lead to a systemic infectious condition, such as bacteremia, nosocomial infection, or toxic shock syndrome. However, there is no research about the prevalence of nasal carriage in patients with nasal bone fracture.MethodsThis was a prospective, double-blind, randomized study about the rate of nasal carriage in 200 patients with nasal bone fracture in Korea. Nasal secretions were taken from both the middle nasal meatus and colonized. All analyses were carried out using SPSS software.ResultsPathogens were identified in 178 of the 200 cases. Coagulase-negative staphylococci (CNS were the most cultured bacteria in 127 (66.84% of the 190 total patients after excluding 10 cases of contaminated samples, and methicillin-resistant coagulase-negative staphylococci (MRCNS were found in 48 (25.26%. Staphylococcus aureus was the second most identified pathogen, found in 36 (18.95%, followed by 7 cases (3.68% of methicillin-resistant Staphylococcus aureus (MRSA. The prevalence rate of MRSA in the females was higher than that in the males (RR=4.70; 95% CI, 1.09-20.18, but other demographic factors had no effect on the prevalence rate of MRSA and MRCNS.ConclusionsThe prevalence rate of these pathogens in patients with nasal bone fracture in Korea was similar to other reports. However, few studies have addressed the prevalence rate of CNS and MRCNS in accordance with risk factors or the change in prevalence according to specific prophylaxis against infectious complications. Additional research is needed on the potential connections between clinical factors and microbiological data.
Directory of Open Access Journals (Sweden)
J.V. Moro
2010-04-01
Full Text Available The expression of p53 protein was evaluated in canine transmissible venereal tumor (CTVT, as following: natural occurrence (n=8; resistant to chemotherapy (n=4; and allogeneic transplanted in progression (n=8, stable (n=8, and regression (n=8stages. The collected specimens were submitted to GM1 immunohistochemical reaction. Results showed a mean percentage of immunomarked cells around 18.6% in CTVT of natural occurrence, 23.8% in CTVT resistant to chemotherapy, 22.9% in allogeneic transplanted CTVT in both progression and stable stages, and 35.8% in transplanted CTVT in regression stage. The results suggest that there is a functional abnormality in p53 gene and its products in the studied tumors; although, it is not possible to correlate the percentage of cells marked by p53 and a prognosis.A expressão da proteína p53 foi avaliada em espécimes de tumor venéreo transmissível canino (TVT de ocorrência natural (n=8; resistente à quimioterapia (n=4 e transplantado em cão nas fases de progressão tumoral (n=8, de latência (n=8 e de regressão (n=8. Os espécimes foram submetidos à reação de imunoistoquímica. Os resultados mostraram porcentagem média de células imunomarcadas de 18,6% no TVT de ocorrência natural, de 23,8% no TVT refratário, 22,9% nos TVTs transplantados nas fases de progressão e latência e de 35,8% na fase de regressão. Os resultados sugerem que há uma anormalidade funcional no gene P53 e seus produtos nos tumores estudados, apesar de não ser possível correlacionar a porcentagem de células marcadas pelo p53 ao prognóstico.
Directory of Open Access Journals (Sweden)
Yu-Wen Hu
2010-03-01
Full Text Available Oncocytic carcinomas of the nasal cavity are extremely rare. We report 1 patient whose primary tumor and neck lymphadenopathies were under control nearly 2 years after combined surgery and radiotherapy. An 80-year-old man with a history of nasal oncocytoma had received excision twice previously. Computed tomography demonstrated locally advanced recurrent tumor invading the paranasal sinuses and orbit with lymphadenopathies in the right neck. Skull base surgery was performed. Pathological examination revealed oncocytic carcinoma. Positron emission tomography showed hypermetabolic lesions in the surgical bed and right neck. The patient subsequently received intensity-modulated radiotherapy to the primary site and the whole neck. Follow-up computed tomography 4 months later showed marked shrinkage of the neck lymphadenopathies. There was no progression after nearly 2 years. Although these tumors have historically been regarded as radioresistant, the combined treatment of surgery followed by radiotherapy may offer the best chance for control of locally advanced disease.
Directory of Open Access Journals (Sweden)
Deli Liu
2015-06-01
Full Text Available Spontaneous canine head and neck squamous cell carcinoma (HNSCC represents an excellent model of human HNSCC but is greatly understudied. To better understand and utilize this valuable resource, we performed a pilot study that represents its first genome-wide characterization by investigating 12 canine HNSCC cases, of which 9 are oral, via high density array comparative genomic hybridization and RNA-seq. The analyses reveal that these canine cancers recapitulate many molecular features of human HNSCC. These include analogous genomic copy number abnormality landscapes and sequence mutation patterns, recurrent alteration of known HNSCC genes and pathways (e.g., cell cycle, PI3K/AKT signaling, and comparably extensive heterogeneity. Amplification or overexpression of protein kinase genes, matrix metalloproteinase genes, and epithelial-mesenchymal transition genes TWIST1 and SNAI1 are also prominent in these canine tumors. This pilot study, along with a rapidly growing body of literature on canine cancer, reemphasizes the potential value of spontaneous canine cancers in HNSCC basic and translational research.
Lindemann, J; Leiacker, R; Wiesmiller, K; Rettinger, G; Keck, T
2004-08-01
Benzalkonium chloride is a preservative commonly used in nasal decongestant sprays. It has been suggested that benzalkonium chloride may be harmful to the nasal mucosa. Decongestion with the vasoconstrictor xylometazoline containing benzalkonium chloride has been shown to cause a significant reduction of the nasal mucosal temperature. The purpose of the present study was to determine the short-term influence of xylometazoline nasal spray with and without benzalkonium chloride on the nasal mucosal temperature. Healthy volunteers (30) were included in the study. Fifteen volunteers received xylometazoline nasal spray (1.0 mg/mL) containing benzalkonium chloride (0.1 mg/mL) and 15 age-matched subjects, received xylometazoline nasal spray without benzalkonium chloride. Using a miniaturized thermocouple the septal mucosal temperature was continuously measured at defined intranasal detection sites before and after application of the nasal spray. The mucosal temperature values did not significantly differ between the group receiving xylometazoline containing benzalkonium chloride and the group receiving xylometazoline spray without benzalkonium chloride before and after decongestion (P > 0.05). In both study groups septal mucosal temperatures significantly decreased after decongestion (P reduction of the nasal mucosal blood flow following vasoconstriction. This study indicates that benzalkonium chloride itself does not seem to influence nasal blood flow and nasal mucosal temperature in topical nasal decongestants.
International Nuclear Information System (INIS)
Smith, M.O.; Turrel, J.M.; Bailey, C.S.; Cain, G.R.
1989-01-01
Neurologic abnormalities were the predominant historic and physical findings in 5 dogs and 2 cats with primary nasal cavity tumors that had invaded the cranial vault. Seizures, behavior changes, and obtundation were the most common signs. Other neurologic signs included paresis, ataxia, circling, visual deficit, and proprioceptive deficit. Although 1 dog and 2 cats had historic findings of mild respiratory disease, no physical abnormalities related to the respiratory tract were found in any of the 7 animals. Nasal cavity neoplasia was suggested by radiographic and computed tomographic studies and was confirmed histopathologically in each case. The nasal tumor types in the 5 dogs were epidermoid carcinoma (n = 1), adenocarcinoma (n = 2), solid carcinoma (n = 1), and anaplastic chondrosarcoma (n = 1). An esthesioneuroblastoma was found in each cat. Radiation therapy was effective for 3 months in palliating the clinical signs in the 2 dogs in which it was used. Neoplasia of the nasal cavity should be considered in the differential diagnosis for animals with neurologic signs suggestive of cerebral disorders
Directory of Open Access Journals (Sweden)
Tetsuji Yamashita
2000-01-01
Full Text Available It has recently been shown that vascular endothelial growth factor (VEGF enhances vascular permeability and that mast cells produce VEGF, suggesting the involvement of VEGF in allergic diseases. In the present study we quantitatively analyzed VEGF in the nasal lavage fluid of patients with nasal allergy. We performed nasal antigen challenge with Japanese cedar pollen antigen in 10 healthy adult volunteers and in 10 cedar pollen IgE-positive patients with nasal allergy. In all patients with nasal allergy, VEGF and histamine levels in the nasal lavage fluid reached a peak 30 min after antigen challenge, then returned to prechallenge values 2 h after antigen challenge. In these patients, the histamine level increased three-fold, while the VEGF level increased 10-fold. However, in all healthy adult volunteers, VEGF and histamine levels did not increase. A stronger correlation was noted between the ratio of decreased nasal cavity volume and the ratio of increased VEGF levels (R = 0.823; P < 0.001 than between the ratio of nasal cavity volume and the ratio of increased histamine levels (R = 0.660; P < 0.01. These results suggest that VEGF may contribute to the pathogenesis of nasal obstruction in the early phase of nasal allergy as a new factor involved in increasing vascular permeability.
Identification of myeloid derived suppressor cells in the peripheral blood of tumor bearing dogs
Directory of Open Access Journals (Sweden)
Sherger Matthew
2012-10-01
Full Text Available Abstract Background Myeloid derived suppressor cells (MDSCs are a recently described population of immune cells that significantly contribute to the immunosuppression seen in cancer patients. MDSCs are one of the most important factors that limit the efficacy of cancer immunotherapy (e.g. cancer vaccines and MDSC levels are increased in cancer in multiple species. Identifying and targeting MDSCs is actively being investigated in the field of human oncology and is increasingly being investigated in veterinary oncology. The treatment of canine cancer not only benefits dogs, but is being used for translational studies evaluating and modifcying candidate therapies for use in humans. Thus, it is necessary to understand the immune alterations seen in canine cancer patients which, to date, have been relatively limited. This study investigates the use of commercially available canine antibodies to detect an immunosuppressive (CD11blow/CADO48low cell population that is increased in the peripheral blood of tumor-bearing dogs. Results Commercially available canine antibodies CD11b and CADO48A were used to evaluate white blood cells from the peripheral blood cells of forty healthy control dogs and forty untreated, tumor-bearing dogs. Tumor-bearing dogs had a statistically significant increase in CD11blow/CADO48Alow cells (7.9% as compared to the control dogs (3.6%. Additionally, sorted CD11blow/CADO48Alow generated in vitro suppressed the proliferation of canine lymphocytes. Conclusions The purpose of this study was aimed at identifying potential canine specific markers for identifying MDSCs in the peripheral blood circulation of dogs. This study demonstrates an increase in a unique CD11blow/CADO48Alow cell population in tumor-bearing dogs. This immunophenotype is consistent with described phenotypes of MDSCs in other species (i.e. mice and utilizes commercially available canine-specific antibodies. Importantly, CD11blow/CADO48Alow from a tumor environment
Directory of Open Access Journals (Sweden)
Angélica C. Bertagnolli
2008-08-01
Full Text Available In this study we describe the alterations used to extract and amplify mitochondrial desoxyribonucleic acid (DNA from formalin-fixed paraffin-embedded samples of canine mammary tumors. The epithelial and mesenchymal components (chondromyxoid and chondroid of each tumor, as well as the normal mammary gland tissues, were manually microdissected from 19 mixed canine mammary tumors (10 benign mixed tumors and nine carcinomas arising in mixed tumors. DNA was extracted by Invisorb® Spin Tissue Mini Kit, with protocol changes proposed by the manufacturer. A 273-bp fragment was amplified by polymerase chain reaction (PCR and submitted to automatic sequence analysis. The fragment was successfully analyzed in 100% of the samples. However, an additional lysis step, the reduction of volume in buffer solutions and PCR, a higher annealing temperature and an increase in the number of PCR cycles were required. The initial PCR products were diluted and re-amplified in six samples so that they could be successfully analyzed.A presente comunicação descreve as modificações usadas para extrair e amplificar o DNA mitocondrial obtido de amostras de tumores mamários caninos fixados em formol tamponado a 10% e incluídos em parafina. Os componentes epiteliais e mesenquimais (condromixóide e condróide, bem como a mama normal adjacente, foram microdissectados manualmente de 19 tumores mamários (10 tumores mistos benignos e nove carcinomas em tumores mistos. O DNA foi extraído utilizando-se o Invisorb® Spin Tissue Mini Kit com modificações do protocolo proposto pelo fabricante. Um fragmento de 273-pb foi amplificado por reação em cadeia da polimerase (PCR e seqüenciado em seqüenciador automático. O fragmento foi analisado em 100% das amostras, entretanto modificações como lise adicional, redução do volume das soluções de extração e PCR, aumento da temperatura de anelamento e do número de ciclos de amplificação foram necessárias. Em seis
ter Haar, G.; Buiks, S.C.; Kirpensteijn, J.
2013-01-01
Abstract OBJECTIVE: To report reconstruction of a defect of the nasal plane and the rostral dorsum of the nose in a dog using a nasal rotation flap with Burow's triangles. STUDY DESIGN: Clinical report. ANIMALS: Mixed-breed dog (1.5 years, 8.6 kg). METHODS: A nasal defect caused by chronic
Surgical management of nasal obstruction.
Moche, Jason A; Palmer, Orville
2012-05-01
The proper evaluation of the patient with nasal obstruction relies on a comprehensive history and physical examination. Once the site of obstruction is accurately identified, the patient may benefit from a trial of medical management. At times however, the definitive treatment of nasal obstruction relies on surgical management. Recognizing the nasal septum, nasal valve, and turbinates as possible sites of obstruction and addressing them accordingly can dramatically improve a patient's nasal breathing. Conservative resection of septal cartilage, submucous reduction of the inferior turbinate, and structural grafting of the nasal valve when appropriate will provide the optimal improvement in nasal airflow and allow for the most stable results. Copyright © 2012. Published by Elsevier Inc.
International Nuclear Information System (INIS)
Fenger, Joelle M.; Roberts, Ryan D.; Iwenofu, O. Hans; Bear, Misty D.; Zhang, Xiaoli; Couto, Jason I.; Modiano, Jaime F.; Kisseberth, William C.; London, Cheryl A.
2016-01-01
MicroRNAs (miRNAs) regulate the expression of networks of genes and their dysregulation is well documented in human malignancies; however, limited information exists regarding the impact of miRNAs on the development and progression of osteosarcoma (OS). Canine OS exhibits clinical and molecular features that closely resemble the corresponding human disease and it is considered a well-established spontaneous animal model to study OS biology. The purpose of this study was to investigate miRNA dysregulation in canine OS. We evaluated miRNA expression in primary canine OS tumors and normal canine osteoblast cells using the nanoString nCounter system. Quantitative PCR was used to validate the nanoString findings and to assess miR-9 expression in canine OS tumors, OS cell lines, and normal osteoblasts. Canine osteoblasts and OS cell lines were stably transduced with pre-miR-9 or anti-miR-9 lentiviral constructs to determine the consequences of miR-9 on cell proliferation, apoptosis, invasion and migration. Proteomic and gene expression profiling of normal canine osteoblasts with enforced miR-9 expression was performed using 2D-DIGE/tandem mass spectrometry and RNA sequencing and changes in protein and mRNA expression were validated with Western blotting and quantitative PCR. OS cell lines were transduced with gelsolin (GSN) shRNAs to investigate the impact of GSN knockdown on OS cell invasion. We identified a unique miRNA signature associated with primary canine OS and identified miR-9 as being significantly overexpressed in canine OS tumors and cell lines compared to normal osteoblasts. Additionally, high miR-9 expression was demonstrated in tumor-specific tissue obtained from primary OS tumors. In normal osteoblasts and OS cell lines transduced with miR-9 lentivirus, enhanced invasion and migration were observed, but miR-9 did not affect cell proliferation or apoptosis. Proteomic and transcriptional profiling of normal canine osteoblasts overexpressing miR-9 identified
Keratoacanthoma of the Nasal Septum Secondary to Ranibizumab Use
Directory of Open Access Journals (Sweden)
Jason E. Cohn
2017-01-01
Full Text Available Keratoacanthoma (KA is a benign epithelial tumor that typically presents as a firm, cone-shaped, flesh-colored nodule with a central horn-filled crater. KA is considered to be a low-grade variant of squamous cell carcinoma (SCC. We report a rare case of a 72-year-old male who presented with a KA involving the nasal septum, possibly related to ranibizumab use. A flesh-colored lesion on the right anterior nasal septum lesion was visualized on examination. Histologic examination revealed a well-circumscribed, dome-shaped central crater filled with keratin, well-differentiated squamous epithelium with ground-glass cytoplasm with pushing margins, and intraepithelial microabscesses establishing the diagnosis of KA. KA of the nasal septum has only been reported once in the literature. This case is unusual because it normally presents on sun-exposed areas. Additionally, this patient was taking ranibizumab, a vascular endothelial growth factor (VEGF inhibitor for macular degeneration. Despite ranibizumab not being directly linked to precancerous and cancerous skin lesions, agents in this medication class have been. Although it is difficult to prove associations in this isolated case, the role of ranibizumab causing cutaneous lesions should be further investigated.
Canine distemper virus induces apoptosis in cervical tumor derived cell lines
Directory of Open Access Journals (Sweden)
Rajão Daniela S
2011-06-01
Full Text Available Abstract Apoptosis can be induced or inhibited by viral proteins, it can form part of the host defense against virus infection, or it can be a mechanism for viral spread to neighboring cells. Canine distemper virus (CDV induces apoptotic cells in lymphoid tissues and in the cerebellum of dogs naturally infected. CDV also produces a cytopathologic effect, leading to apoptosis in Vero cells in tissue culture. We tested canine distemper virus, a member of the Paramyxoviridae family, for the ability to trigger apoptosis in HeLa cells, derived from cervical cancer cells resistant to apoptosis. To study the effect of CDV infection in HeLa cells, we examined apoptotic markers 24 h post infection (pi, by flow cytometry assay for DNA fragmentation, real-time PCR assay for caspase-3 and caspase-8 mRNA expression, and by caspase-3 and -8 immunocytochemistry. Flow cytometry showed that DNA fragmentation was induced in HeLa cells infected by CDV, and immunocytochemistry revealed a significant increase in the levels of the cleaved active form of caspase-3 protein, but did not show any difference in expression of caspase-8, indicating an intrinsic apoptotic pathway. Confirming this observation, expression of caspase-3 mRNA was higher in CDV infected HeLa cells than control cells; however, there was no statistically significant change in caspase-8 mRNA expression profile. Our data suggest that canine distemper virus induced apoptosis in HeLa cells, triggering apoptosis by the intrinsic pathway, with no participation of the initiator caspase -8 from the extrinsic pathway. In conclusion, the cellular stress caused by CDV infection of HeLa cells, leading to apoptosis, can be used as a tool in future research for cervical cancer treatment and control.
Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo
2018-01-23
To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.
Mulberry Tumors in Retina and Nasal Hamartoma in a Patient With Tuberous Sclerosis
Directory of Open Access Journals (Sweden)
S. Reshadat
2008-10-01
Full Text Available Introduction: Tuberous Sclerosis (TS is an autosomal dominant disease that affects the brain, skin, eye, heart, kidney even bones. The commonest presentation is seizures in infancy or early childhood (in 80% of cases, mental retardation (in 44%of cases. Characteristic skin lesion includes facial angiofibromas, adenoma sebaceum, hypopigmented macules, shagreen patches ungual ungual fibromas, ash leaf spots, cafe'-au-lait spots.Case Report: A nine years old male was admitted in a pediatric hospital because of the status myoclonic seizures. Seizures had been started since infancy. In physical exam he had some hypopigmented macules, cafe'-au-lait spots and ash leaf lesions, frontal fibrosis and also shagreen patches. Patient was a case of mild mentally retardation with no any focal neurological deficit. Computed tomography scan of brain and MRI imaging revealed sub ependymal tubers with multiple calcification in both sides of parietal region. Electroencephal-ogram recording suggested abnormal spike, sharp wave discharges and lennox-Gastaut pattern. The diagnosis based on the history and physical exam and MRI were tuberous sclerosis. His foundoscopic exam revealed two prominent calcified mass around right optic disc in supratemporal arch, left eye was normal. Retinal angiography revealed the mulberry tumors and right phakoma of retina. Conclusion: Computed tomography also revaled the nasal hamartoma. Histopathologic examination confirmed the diagnosis of angiomyolipoma because the lesion was composed of smooth muscle bundles, mature adipose tissue and blood vessels of different sizes. He remained seizures free after treatment.
International Nuclear Information System (INIS)
Denman, David L.; Levin, Rebecca; Buncher, C. Ralph; Aron, Bernard S.
1996-01-01
Purpose/Objective: This study's ultimate goals involve development of an accelerated fractionation (AF) regimen with an integrated final concomitant boost (CB) and examination of factors prognostic of the CB's therapeutic efficacy which could be measured during the initial AF portion to determine for which patients CB should be used. These endpoints can be accurately determined quickly by evaluating the treatment (tx) of spontaneous canine veterinary patient tumors. Because surviving tumor clonogen growth rate increases after radiotherapy (RT) begins, this accelerated repopulation (AR) should be reduced by AF. Furthermore, CB using a small field encompassing only the tumor bed, given as a second daily tx during the last week of RT, should further reduce AR. The initial portion of this project which is nearing completion was designed to determine if incidentally treated normal tissues could tolerate the AF regimen and project whether addition of the tumor bed CB would also be tolerated. Materials and Methods: Currently 20 canine patients with biopsy proven localized tumors have received canine AF radiotherapy given as 3.2Gy/fraction(fx) administered 5 days a week (Mon-Fri) to a total of 15 fxs (48Gy) within 18 elapsed days. RT is given with a 60 Co teletherapy unit. Their tumor response, control, survival, and acute normal tissue responses are being directly compared to results we previously obtained from canines receiving a nearly equivalent dose/fx and total dose conventional fractionation (CF) regimen which was given alone or with adjuvant hyperthermia (HT). In that study the canines were stratified by tumor histology and anatomic site and randomly assigned to receive canine CF (3.5Gy/fx, 3 fxs/week [Mon-Wed-Fri] to 14 fxs (49Gy) in an elapsed time of approx. 30 days) either alone or followed weekly by local HT (44 deg. +/- 2 deg. C) for 30 minutes (5 HT fxs). As is currently done, these CF+/-HT patients were followed up to 3 years to quantitate the magnitudes
Nasalance norms in Greek adults.
Okalidou, Areti; Karathanasi, Asimina; Grigoraki, Eleni
2011-08-01
The purposes of this study were to derive nasalance norms for monolingual Greek speakers, to examine nasalance scores as a function of gender and to draw cross-linguistic comparisons based on normative data. Participants read aloud a corpus of linguistic material, consisting of (1) a nasal text, an oral text and a balanced text; (2) a set of nasal sentences and four sets of oral sentences and (3) repetitions of each of 12 syllable types (8 oral and 4 nasal). The last two sets of material corpus were based on an adaptation of the Simplified Nasometric Assessment Procedures Test (SNAP test) test ( MacKay and Kummer, 1994 ) in Greek, called the G-SNAP test. Eighty monolingual healthy young adult speakers of Greek, 40 males (mean age = 21 years) and 40 females (mean age = 20.5 years), with normal hearing and speech characteristics and unremarkable history were included in the study. The Nasometer (model 6200-3) was used to derive nasalance scores. Mean normative nasalance for spoken Greek was 25.50%, based on the G-oronasal text (with 8.6% nasals). Nasalance scores did not differ significantly with respect to gender. Finally, spoken Greek consistently yielded lower nasalance scores than other languages examined in past work. The aforementioned normative data on nasalance of young adult speakers of Greek are valid across gender and have direct clinical utility as they provide valuable reference information for the diagnosis and management of Greek adults with resonance disorders caused by velar dysfunction.
Cyclooxygenase expression in canine platelets and Madin-Darby canine kidney cells.
Kay-Mugford, P A; Benn, S J; LaMarre, J; Conlon, P D
2000-12-01
To examine cyclooxygenase (COX) expression in canine platelets and Madin-Darby canine kidney (MDCK) cells in culture. Canine platelets and MDCK cells. Total RNA was recovered from isolated canine platelets and MDCK cells. Northern blot analysis and reverse transcription-polymerase chain reaction (RT-PCR), using complementary DNA probes and primers designed from the human COX sequences, were used to determine COX-1 and -2 (cyclooxygenase isoforms 1 and 2) messenger RNA (mRNA) expression. Following northern blot analysis, canine platelets were found to express only the 2.8-kb COX-1 transcript; COX-2 was not detected. Canine MDCK cells expressed the 4.5-kb COX-2 transcript, in addition to the 2.8-kb COX-1 transcript. A single DNA band of 270 base pairs was identified following gel electrophoresis of the product obtained from RT-PCR of mRNA from canine platelets. Sequencing revealed that this PCR product was 90% homologous to a portion of the human COX-1 gene (Genbank M59979). Detection of COX-1 by RT-PCR of RNA obtained from canine platelets is a novel finding. The 90% homology of the PCR product with the human sequence suggests strong conservation between the canine and human COX-1 gene. Cloning and sequencing of the canine gene will be required to fully characterize homologous regions. Because of the importance of COX in the inflammatory process and as a potential target of currently available nonsteroidal anti-inflammatory drugs (NSAID), a better understanding of canine COX may improve our ability to use NSAID appropriately, achieve efficacy, and avoid potential adverse drug effects in dogs.
Thermosensitive PLA based nanodispersion for targeting brain tumor via intranasal route
International Nuclear Information System (INIS)
Jain, Darshana S.; Bajaj, Amrita N.; Athawale, Rajani B.; Shikhande, Shruti S.; Pandey, Abhijeet; Goel, Peeyush N.; Gude, Rajiv P.; Patil, Satish; Raut, Preeti
2016-01-01
Delivery of drugs to the brain via nasal route has been studied by many researchers. However, low residence time, mucociliary clearance and enzymatically active environment of nasal cavity pose many challenges to successful nasal delivery of drugs. We aim to deliver methotrexate by designing thermosensitive nanodispersion exhibiting enhanced residence time in nasal cavity and bypassing the blood brain barrier (BBB). PLA nanoparticles were developed using solvent evaporation technique. The developed nanoparticles were further dispersed in prepared thermosensitive vehicle of poloxamer 188 and Carbopol 934 to impart the property of increased residence time. The formulated nanoparticles demonstrated no interaction with the simulated nasal fluids (SNF), mucin, serum proteins and erythrocytes which demonstrate the safety of developed formulation for nasal administration. The penetration property of nanoparticles though the nasal mucosa was higher than the pure drug due to low mucociliary clearance. The developed nanoparticles diffused though the membrane pores and rapidly distributed into the brain portions compared to the pure drug. There was detectable and quantifiable amount of drug seen in the brain as demonstrated by in vivo brain distribution studies with considerably low amount of drug deposition in the lungs. The pharmacokinetic parameters demonstrated the enhancement in circulation half life, area under curve (AUC) and Cmax of the drug when administered intranasal in encapsulated form. Thus, the thermosensitive nanodispersions are surely promising delivery systems for delivering anticancer agents though the nasal route for potential treatment of brain tumors. - Highlights: • The present investigation explores intra-nasal route as potential route for targeting brain tumor. • Thermosensitive nanodispersion has been formulated for enhancing nasal residence time. • PLA nanoparticles enhance penetration into the brain owing to hydrophobic nature and small size
Thermosensitive PLA based nanodispersion for targeting brain tumor via intranasal route
Energy Technology Data Exchange (ETDEWEB)
Jain, Darshana S., E-mail: darshanaj_cup@yahoo.com [C.U. Shah College of Pharmacy, S.N.D.T Women' s University, Juhu Tara Road, Santacruz (West), Mumbai 400 049 (India); Bajaj, Amrita N. [C.U. Shah College of Pharmacy, S.N.D.T Women' s University, Juhu Tara Road, Santacruz (West), Mumbai 400 049 (India); Athawale, Rajani B., E-mail: rajani.athawale@gmail.com [C.U. Shah College of Pharmacy, S.N.D.T Women' s University, Juhu Tara Road, Santacruz (West), Mumbai 400 049 (India); Shikhande, Shruti S. [C.U. Shah College of Pharmacy, S.N.D.T Women' s University, Juhu Tara Road, Santacruz (West), Mumbai 400 049 (India); Pandey, Abhijeet [H. R Patel Institute of Pharmaceutical Education and Research, Shirpur, Maharashtra (India); Goel, Peeyush N.; Gude, Rajiv P. [Gude Lab, Advanced Centre for Treatment, Research & Education in Cancer (ACTREC), Tata Memorial Centre, Kharghar, Navi Mumbai 410 210 (India); Patil, Satish; Raut, Preeti [Cipla Pvt. Ltd., Vikhroli (West), Mumbai (India)
2016-06-01
Delivery of drugs to the brain via nasal route has been studied by many researchers. However, low residence time, mucociliary clearance and enzymatically active environment of nasal cavity pose many challenges to successful nasal delivery of drugs. We aim to deliver methotrexate by designing thermosensitive nanodispersion exhibiting enhanced residence time in nasal cavity and bypassing the blood brain barrier (BBB). PLA nanoparticles were developed using solvent evaporation technique. The developed nanoparticles were further dispersed in prepared thermosensitive vehicle of poloxamer 188 and Carbopol 934 to impart the property of increased residence time. The formulated nanoparticles demonstrated no interaction with the simulated nasal fluids (SNF), mucin, serum proteins and erythrocytes which demonstrate the safety of developed formulation for nasal administration. The penetration property of nanoparticles though the nasal mucosa was higher than the pure drug due to low mucociliary clearance. The developed nanoparticles diffused though the membrane pores and rapidly distributed into the brain portions compared to the pure drug. There was detectable and quantifiable amount of drug seen in the brain as demonstrated by in vivo brain distribution studies with considerably low amount of drug deposition in the lungs. The pharmacokinetic parameters demonstrated the enhancement in circulation half life, area under curve (AUC) and Cmax of the drug when administered intranasal in encapsulated form. Thus, the thermosensitive nanodispersions are surely promising delivery systems for delivering anticancer agents though the nasal route for potential treatment of brain tumors. - Highlights: • The present investigation explores intra-nasal route as potential route for targeting brain tumor. • Thermosensitive nanodispersion has been formulated for enhancing nasal residence time. • PLA nanoparticles enhance penetration into the brain owing to hydrophobic nature and small size
Directory of Open Access Journals (Sweden)
Mostfa Shahabi
2017-09-01
Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.
Formaldehyde is cytotoxic and carcinogenic to the rat nasal respiratory epithelium inducing tumors after 12 months. Glutaraldehyde is also cytotoxic but is not carcinogenic to nasal epithelium even after 24 months. Both aldehydes induce similar acute and subchronic histopathology...
Perceiving nasal patency through mucosal cooling rather than air temperature or nasal resistance.
Directory of Open Access Journals (Sweden)
Kai Zhao
Full Text Available Adequate perception of nasal airflow (i.e., nasal patency is an important consideration for patients with nasal sinus diseases. The perception of a lack of nasal patency becomes the primary symptom that drives these patients to seek medical treatment. However, clinical assessment of nasal patency remains a challenge because we lack objective measurements that correlate well with what patients perceive. The current study examined factors that may influence perceived patency, including air temperature, humidity, mucosal cooling, nasal resistance, and trigeminal sensitivity. Forty-four healthy subjects rated nasal patency while sampling air from three facial exposure boxes that were ventilated with untreated room air, cold air, and dry air, respectively. In all conditions, air temperature and relative humidity inside each box were recorded with sensors connected to a computer. Nasal resistance and minimum airway cross-sectional area (MCA were measured using rhinomanometry and acoustic rhinometry, respectively. General trigeminal sensitivity was assessed through lateralization thresholds to butanol. No significant correlation was found between perceived patency and nasal resistance or MCA. In contrast, air temperature, humidity, and butanol threshold combined significantly contributed to the ratings of patency, with mucosal cooling (heat loss being the most heavily weighted predictor. Air humidity significantly influences perceived patency, suggesting that mucosal cooling rather than air temperature alone provides the trigeminal sensation that results in perception of patency. The dynamic cooling between the airstream and the mucosal wall may be quantified experimentally or computationally and could potentially lead to a new clinical evaluation tool.
Ryseff, Julia K; Bohn, Andrea A
2012-09-01
Osteosarcoma (OSA) is a common primary bone tumor in dogs. Demonstration of alkaline phosphatase (ALP) reactivity by tumor cells on unstained slides is useful in differentiating osteosarcoma from other types of sarcoma. However, unstained slides are not always available. The objectives of this study were to evaluate the diagnostic utility of detecting ALP expression in differentiating osteosarcoma from other sarcomas in dogs using cytologic material previously stained with Wright-Giemsa stain and to assess the sensitivity and specificity of ALP expression for diagnosing osteosarcoma using a specific protocol. Archived aspirates of histologically confirmed sarcomas in dogs that had been previously stained with Wright-Giemsa stain were treated with 5-bromo, 4-chloro, 3-indolyl phosphate/nitroblue tetrazolium (BCIP/NBT) as a substrate for ALP. Cells were evaluated for expression of ALP after incubation with BCIP/NBT for 1 hour. Sensitivity and specificity of ALP expression for diagnosis of OSA were calculated. In samples from 83 dogs, cells from 15/17 OSAs and from 4/66 tumors other than OSA (amelanotic melanoma, gastrointestinal stromal tumor, collision tumor, and anaplastic sarcoma) expressed ALP. Sensitivity and specificity of ALP expression detected using BCIP/NBT substrate applied to cells previously stained with Wright-Giemsa stain for OSA were 88 and 94%, respectively. ALP expression detected using BCIP/NBT substrate applied to previously stained cells is useful in differentiating canine OSA from other mesenchymal neoplasms. © 2012 American Society for Veterinary Clinical Pathology.
International Nuclear Information System (INIS)
Zenda, Sadamoto; Kawashima, Mitsuhiko; Arahira, Satoko; Kohno, Ryosuke; Nishio, Teiji; Akimoto, Tetsuo; Tahara, Makoto; Hayashi, Ryuichi
2015-01-01
Although several reports have shown that proton beam therapy (PBT) offers promise for patients with skull base cancer, little is known about the frequency of late toxicity in clinical practice when PBT is used for these patients. Here, we conducted a retrospective analysis to clarify the late toxicity profile of PBT in patients with malignancies of the nasal cavity, para-nasal sinuses, or involving the skull base. Entry to this retrospective study was restricted to patients with (1) malignant tumors of the nasal cavity, para-nasal sinuses, or involving the skull base; (2) definitive or postoperative PBT (>50 GyE) from January 1999 through December 2008; and (3) more than 1 year of follow-up. Late toxicities were graded according to the common terminology criteria for adverse events v4.0 (CTCAE v4.0). From January 1999 through December 2008, 90 patients satisfied all criteria. Median observation period was 57.5 months (range, 12.4-162.7 months), median time to onset of grade 2 or greater late toxicity except cataract was 39.2 months (range, 2.7-99.8 months), and 3 patients had toxicities that occurred more than 5 years after PBT. Grade 3 late toxicities occurred in 17 patients (19%), with 19 events, and grade 4 late toxicities in 6 patients (7%), with 6 events (encephalomyelitis infection 2, optic nerve disorder 4). In conclusion, the late toxicity profile of PBT in patients with malignancy involving the nasal cavity, para-nasal sinuses, or skull base malignancy was partly clarified. Because late toxicity can still occur at 5 years after treatment, long-term follow-up is necessary. (author)
Virkkula, Paula; Maasilta, Paula; Hytönen, Maija; Salmi, Tapani; Malmberg, Henrik
2003-06-01
Nasal obstruction is considered to be a potential etiological factor in sleep-disordered breathing. However, a significant correlation between nasal measurements and obstructive sleep apnea has not been demonstrated so far. The aim of this study was to investigate the relationships between nasal resistance, nasal volumes and selected sleep parameters using nasal measurements performed in both seated and supine positions. We also investigated whether snoring patients in our clinical sample showed increased positional or decongestive nasal mucosal changes. Forty-one snoring men on a waiting list for correction of nasal obstruction underwent polysomnography, anterior rhinomanometry and acoustic rhinometry. Nineteen non-snoring control subjects were also recruited. Nasal measurements were performed in a seated position, after lying down in a supine position and, after decongestion of nasal mucosa, in a seated position again. In the overall patient group, nasal volume at a distance 2-4 cm from the nares in the supine position correlated inversely with apnea-hypopnea index (AHI) (r = -0.32, p patients, total nasal resistance measured in a supine position correlated with AHI (r = 0.50, p position and sleep parameters. Postural or decongestive changes in nasal measurements were not increased in snoring patients compared with control subjects. The relationship found between nasal measurements and sleep parameters suggests that nasal obstruction does augment airway collapse.
Nasal Carriage of 200 Patients with Nasal Bone Fracture in Korea
Directory of Open Access Journals (Sweden)
Jun Wook Lee
2013-09-01
Full Text Available Background Pathogens in the nasal cavity during nasal surgery could lead to a systemicinfectious condition, such as bacteremia, nosocomial infection, or toxic shock syndrome.However, there is no research about the prevalence of nasal carriage in patients with nasalbone fracture.Methods This was a prospective, double-blind, randomized study about the rate of nasalcarriage in 200 patients with nasal bone fracture in Korea. Nasal secretions were taken fromboth the middle nasal meatus and colonized. All analyses were carried out using SPSS software.Results Pathogens were identified in 178 of the 200 cases. Coagulase-negative staphylococci(CNS were the most cultured bacteria in 127 (66.84% of the 190 total patients after excluding10 cases of contaminated samples, and methicillin-resistant coagulase-negative staphylococci(MRCNS were found in 48 (25.26%. Staphylococcus aureus was the second mostidentified pathogen, found in 36 (18.95%, followed by 7 cases (3.68% of methicillin-resistantStaphylococcus aureus (MRSA. The prevalence rate of MRSA in the females was higher thanthat in the males (RR=4.70; 95% CI, 1.09-20.18, but other demographic factors had no effecton the prevalence rate of MRSA and MRCNS.Conclusions The prevalence rate of these pathogens in patients with nasal bone fracture inKorea was similar to other reports. However, few studies have addressed the prevalence rateof CNS and MRCNS in accordance with risk factors or the change in prevalence according tospecific prophylaxis against infectious complications. Additional research is needed on thepotential connections between clinical factors and microbiological data.
Comparison of Early-period Results of Nasal Splint and Merocel Nasal Packs in Septoplasty
Bingöl, Fatih; Budak, Ali; Şimşek, Eda; Kılıç, Korhan; Bingöl, Buket Özel
2017-01-01
Objective Several types of nasal packs are used postoperatively in septoplasty. In this study, we compared two commonly used nasal packing materials, the intranasal septal splint with airway and Merocel tampon, in terms of pain, bleeding, nasal obstruction, eating difficulties, discomfort in sleep, and pain and bleeding during removal of packing in the early period. Methods The study group included 60 patients undergoing septoplasty. Patients were divided into two groups (n=30 in each group). An intranasal splint with airway was used for the patients in the first group after septoplasty, while Merocel nasal packing was used for the second group. Patients were investigated in terms of seven different factors - pain, bleeding while the tampon was in place, nasal obstruction, eating difficulties, night sleep, pain during removal of the nasal packing, and bleeding after removal of packing. Results There was no statistically significant difference between the groups in terms of pain 24 hours after operation (p=0.05), while visual analog scale (VAS) scores for nasal obstruction, night sleep, eating difficulties, and pain during packing removal were lower in the nasal splint group with a statistically significant difference (p<0.05). There was no statistically significant difference between the groups in terms of postoperative bleeding (p=0.23). Significantly less bleeding occurred during removal of the packing in the nasal splint group (p<0.05). Conclusion Our study indicates that the nasal splint was more comfortable and effective in terms of causing lesser bleeding and pain during removal of packing. PMID:29392071
... medlineplus.gov/ency/article/001292.htm Nasal septal hematoma To use the sharing features on this page, please enable JavaScript. A nasal septal hematoma is a collection of blood within the septum ...
International Nuclear Information System (INIS)
King, R.R.; Greiner, E.C.; Ackerman, N.; Woodard, J.C.
1990-01-01
A five-year-old dog was evaluated for chronic nasal discharge. Nasal infection caused by Capillaria aerophila was diagnosed by identification of adult nematodes and eggs in the nasal flush sediment and by nasal biopsy samples and eggs in faecal flotations. Reinfection occurred following treatment with fenbendazole and ivermectin, probably because of a contaminated housing area
Directory of Open Access Journals (Sweden)
Rao Nagesha AS
2009-09-01
Full Text Available Abstract Background Gene expression profiling of spontaneous tumors in the dog offers a unique translational opportunity to identify prognostic biomarkers and signaling pathways that are common to both canine and human. Osteosarcoma (OS accounts for approximately 80% of all malignant bone tumors in the dog. Canine OS are highly comparable with their human counterpart with respect to histology, high metastatic rate and poor long-term survival. This study investigates the prognostic gene profile among thirty-two primary canine OS using canine specific cDNA microarrays representing 20,313 genes to identify genes and cellular signaling pathways associated with survival. This, the first report of its kind in dogs with OS, also demonstrates the advantages of cross-species comparison with human OS. Results The 32 tumors were classified into two prognostic groups based on survival time (ST. They were defined as short survivors (dogs with poor prognosis: surviving fewer than 6 months and long survivors (dogs with better prognosis: surviving 6 months or longer. Fifty-one transcripts were found to be differentially expressed, with common upregulation of these genes in the short survivors. The overexpressed genes in short survivors are associated with possible roles in proliferation, drug resistance or metastasis. Several deregulated pathways identified in the present study, including Wnt signaling, Integrin signaling and Chemokine/cytokine signaling are comparable to the pathway analysis conducted on human OS gene profiles, emphasizing the value of the dog as an excellent model for humans. Conclusion A molecular-based method for discrimination of outcome for short and long survivors is useful for future prognostic stratification at initial diagnosis, where genes and pathways associated with cell cycle/proliferation, drug resistance and metastasis could be potential targets for diagnosis and therapy. The similarities between human and canine OS makes the
Measurement with nasal scintigraphy of nasal mucociliary clearance in normal man
International Nuclear Information System (INIS)
Murai, Sumiko
1989-01-01
Nasal mucociliary function was evaluated by nasal scintigraphy in normal subjects. A microdrop of HSA or saline labelled with 99m Tc was dripped into the middle part of each middle meatus in the nasal cavity and its clearance was observed by scinticamera. The accumulated concentration of RI was determined every 30 seconds for 10 minutes. The changes of accumulated concentration were studied, and a curve of decreasing RI-counts was obtained, with the 'clearance rate' defined as 100% for the count at the initial 30 seconds and 'half time' as the time when radioactivity was reduced to one half the initial count. Nasal resistance was measured by rhinomanometry with the oscillation method. In nonsmokers, 10μl of saline was cleared (78.0±10.4%) significantly faster than 10μl of HSA (59.9±24.6%), and there was no significant difference in the clearance between 10μl and 5μl of HSA (55.9±27.7%). In smakers, the mucociliary clearance of 10μl of HSA and saline was significantly lower than in nonsmokers. The clearance of 10μl of HSA reflects a pathological state much better than that of 5μl. In nonsmokers, there is a significant negative correlation between nasal resistance and clearance rate, suggesting that the more patent the nose, the faster the mucociliary clearance. When both nostrils were closed, the clearance rate was significantly depressed. When one nostril was closed, there was no significant effect on clearance. Nasal resistance was decreased by exercise with a bicycle ergometer. Nasal mucociliary clearance was slightly decreased after exercise but not significantly so. (J.P.N.)
Image diagnosis of nasal bone fracture
International Nuclear Information System (INIS)
Hirota, Yoshiharu; Shimizu, Yayoi; Iinuma, Toshitaka.
1988-01-01
Twenty cases of nasal bone fractures were evaluated as to the types of fractures based upon HRCT findings. Conventional X-Ray films for nasal bones were analyzed and compared with HRCT findings. Nasal bone fractures were classified into lateral and frontal fractures. HRCT images were evaluated in three planes including upper, middle and lower portions of the nasal bone. Fractures favored males of teens. Lateral fracture gave rise to the fractures of the nasal bone opposite to the external force, loosening of the ipsilateral nasomaxillary sutures and fractures of the frontal process of the maxilla. Conventional X-Ray films were reevaluated after HRCT evaluation and indications of nasal bone fractures were determined. In addition to the discontinuity of the nasal dorsum, fracture lines parallel to and beneath the nasal dorsum and indistinct fracture lines along the nasomaxillary sutures are the indication of nasal bone fractures by conventional X-Ray films. (author)
The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.
Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki
2015-04-17
Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Takeshi Nabe
2008-01-01
Conclusions: Local nasal immunotherapy may be clinically useful for allergic nasal blockage associated with nasal hyperresponsiveness. The mechanisms responsible for this effectiveness might not be related to IgE production. Additionally, the effectiveness for nasal tissue was dissociated from that seen for the ocular tissue.
Directory of Open Access Journals (Sweden)
D.A.P.C. Zuccari
2002-12-01
Full Text Available Foram utilizados anticorpos monoclonais para marcação imunoistoquímica dos tecidos tumorais e obtenção de informações sobre a histogênese dos tumores mamários utilizando-se anti-citoqueratinas para marcação de células epiteliais, e anti-actina e anti-vimentina para células mioepiteliais. O procedimento imunoistoquímico mostrou-se esclarecedor com relação à histogênese dos tumores mamários, confirmando a marcação de células epiteliais com as citoqueratinas que perdem sua expressão na transformação celular maligna. A alfa-actina e a vimentina mostraram-se eficientes na marcação de células mioepiteliais. A alfa-actina diminuiu a marcação na metaplasia óssea ou cartilaginosa contrariamente à vimentina cuja marcação foi aumentada. Os resultados permitem melhor entendimento da classificação dos tumores mamários de cadelas com a utilização de anticorpos monoclonais como marcadores do citoesqueleto, que se mostraram eficientes nessa caracterização.Immunohistochemical evaluation was performed to study the histogenesis of canine mammary tumors and to contribute to a better understanding of their classification. Monoclonal antibodies specific for different types of intermediate filaments (cytokeratins, vimentin, alpha-actin were used. Epithelial cells stained positively for cytokeratins and their expression was lost as the malignant transformation occurs. Myoepithelial cells stained positively for vimentin and alpha-actin. In contrast to vimentin, alpha-actin lost the expression as the cartilaginous or osseous metaplasia occurs. Immunohistochemical evaluation with monoclonal antibodies proved to be efficient for identification of tumor histogenesis. alpha-actin were used. Epithelial cells stained positively for cytokeratins and their expression was lost as the malignant transformation occurs. Myoepithelial cells stained positively for vimentin and alpha-actin. In contrast to vimentin, alpha-actin lost the expression
Energy Technology Data Exchange (ETDEWEB)
Wiegner, Ellen A.; Daly, Megan E.; Murphy, James D.; Abelson, Jonathan; Chapman, Chris H.; Chung, Melody; Yu, Yao; Colevas, A. Dimitrios; Kaplan, Michael J.; Fischbein, Nancy; Le, Quynh-Thu [Department of Radiation Oncology, Stanford University, Stanford, CA (United States); Chang, Daniel T., E-mail: dtchang@stanford.edu [Department of Radiation Oncology, Stanford University, Stanford, CA (United States)
2012-05-01
Purpose: To report outcomes in patients treated with intensity-modulated radiotherapy (IMRT) for tumors of the paranasal sinuses and nasal cavity (PNS/NC). Methods/Materials: Between June 2000 and December 2009, 52 patients with tumors of the PNS/NC underwent postoperative or definitive radiation with IMRT. Twenty-eight (54%) patients had squamous cell carcinoma (SCC). Twenty-nine patients (56%) received chemotherapy. The median follow-up was 26.6 months (range, 2.9-118.4) for all patients and 30.9 months for living patients. Results: Eighteen patients (35%) developed local-regional failure (LRF) at median time of 7.2 months. Thirteen local failures (25%) were observed, 12 in-field and 1 marginal. Six regional failures were observed, two in-field and four out-of-field. No patients treated with elective nodal radiation had nodal regional failure. Two-year local-regional control (LRC), in-field LRC, freedom from distant metastasis (FFDM), and overall survival (OS) were 64%, 74%, 71%, and 66% among all patients, respectively, and 43%, 61%, 61%, and 53% among patients with SCC, respectively. On multivariate analysis, SCC and >1 subsite involved had worse LRC (p = 0.0004 and p = 0.046, respectively) and OS (p = 0.003 and p = 0.046, respectively). Cribriform plate invasion (p = 0.005) and residual disease (p = 0.047) also had worse LRC. Acute toxicities included Grade {>=}3 mucositis in 19 patients (37%), and Grade 3 dermatitis in 8 patients (15%). Six patients had Grade {>=}3 late toxicity including one optic toxicity. Conclusions: IMRT for patients with PNS/NC tumors has good outcomes compared with historical series and is well tolerated. Patients with SCC have worse LRC and OS. LRF is the predominant pattern of failure.
BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.
Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B
2015-01-01
BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos
Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.
2011-01-01
INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
Directory of Open Access Journals (Sweden)
Weidong Xiong
2010-06-01
Full Text Available Glioblastoma multiforme (GBM is the most common primary brain tumor in adults and carries a dismal prognosis. We have developed a conditional cytotoxic/immunotherapeutic approach using adenoviral vectors (Ads encoding the immunostimulatory cytokine, human soluble fms-like tyrosine kinase 3 ligand (hsFlt3L and the conditional cytotoxic molecule, i.e., Herpes Simplex Type 1- thymide kinase (TK. This therapy triggers an anti-tumor immune response that leads to tumor regression and anti-tumor immunological memory in intracranial rodent cancer models. We aim to test the efficacy of this immunotherapy in dogs bearing spontaneous GBM. In view of the controversy regarding the effect of human cytokines on dog immune cells, and considering that the efficacy of this treatment depends on hsFlt3L-stimulated dendritic cells (DCs, in the present work we tested the ability of Ad-encoded hsFlt3L to generate DCs from dog peripheral blood and compared its effects with canine IL-4 and GM-CSF.Our results demonstrate that hsFlT3L expressed form an Ad vector, generated DCs from peripheral blood cultures with very similar morphological and phenotypic characteristics to canine IL-4 and GM-CSF-cultured DCs. These include phagocytic activity and expression of CD11c, MHCII, CD80 and CD14. Maturation of DCs cultured under both conditions resulted in increased secretion of IL-6, TNF-alpha and IFN-gamma. Importantly, hsFlt3L-derived antigen presenting cells showed allostimulatory potential highlighting their ability to present antigen to T cells and elicit their proliferation.These results demonstrate that hsFlt3L induces the proliferation of canine DCs and support its use in upcoming clinical trials for canine GBM. Our data further support the translation of hsFlt3L to be used for dendritic cells' vaccination and gene therapeutic approaches from rodent models to canine patients and its future implementation in human clinical trials.
Vascellari, Marta; Capello, Katia; Carminato, Antonio; Zanardello, Claudia; Baioni, Elisa; Mutinelli, Franco
2016-04-01
Although mammary gland tumors (MT) are the most-common type of tumor in intact female dogs, there is little information about their incidence in dog population. Data on MT in female dogs was retrieved from the Animal Tumor registry of dogs and cats of Venice and Vicenza provinces during 2005-2013 and was analyzed to visualize crude incidence rates by breed and across age categories. Overall, 2744 mammary tumors were reported accounting for 54% of all tumors in female dogs. The annual incidence rate (IR) was 250 cases per 100,000 dogs. The most frequent malignant tumors were complex carcinomas, consisting of both epithelial and myoepithelial tissues (IR=71.89), and simple carcinomas (IR=62.59). The MT incidence rate increased through the study period; particularly in the last 4 years, and malignant neoplasms occurred more frequently (70%) than the benign counterparts (30%). Seventy-four percent of tumors were diagnosed in intact females, and the mean age at diagnosis was significantly higher for spayed dogs than for intact ones. MT were less frequent in dogs younger than 6 years and increased up to approximately 60% for ages between 8 and 13 years. The purebred dogs had a higher probability to have a malignant neoplasm than mixed-breed dogs, particularly in dogs younger than 7 years, and the Samoyed, Dobermann, Schnauzer and Yorkshire Terrier breeds were more inclined to develop malignant MT. The incidence of MT in dogs is increasing, and IRs are comparable to that in women. The epidemiological similarities between dogs and women support the validity of canine MT as a model for human breast cancer. Copyright © 2016 Elsevier B.V. All rights reserved.
Cytotoxicity of Different Excipients on RPMI 2650 Human Nasal Epithelial Cells
Directory of Open Access Journals (Sweden)
Tamás Horváth
2016-05-01
Full Text Available The nasal route receives a great deal of attention as a non-invasive method for the systemic administration of drugs. For nasal delivery, specific formulations containing excipients are used. Because of the sensitive respiratory mucosa, not only the active ingredients, but also additives need to be tested in appropriate models for toxicity. The aim of the study was to measure the cytotoxicity of six pharmaceutical excipients, which could help to reach larger residence time, better permeability, and increased solubility dissolution rate. The following excipients were investigated on RPMI 2650 human nasal septum tumor epithelial cells: β-d-mannitol, sodium hyaluronate, α and β-cyclodextrin, polyvinyl alcohol and methylcellulose. 3-(4,5-dimethyltiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT dye conversion assay and real-time impedance analysis were used to investigate cytotoxicity. No excipient showed toxicity at 0.3% (w/v concentration or below while 1% concentration a significantly reduced metabolic activity was measured by MTT assay for methylcellulose and cyclodextrins. Using impedance measurements, only β-cyclodextrin (1% was toxic to cells. Mannitol at 1% concentration had a barrier opening effect on epithelial cells, but caused no cellular damage. Based on the results, all additives at 0.3%, sodium hyaluronate and polyvinyl alcohol at 1% concentrations can be safely used for nasal formulations.
Primary Atypical Meningioma of the Nasal Cavity: A Case Report and Review of the Literature
Neupane, Yogesh; Pradhan, Bibhu
2018-01-01
Background Meningioma is a central nervous system tumor that typically arises in proximity to meninges. Extracranial primary atypical meningioma of sinonasal tract is a rare one. Methods We discuss the clinical, radiological, and histological presentation of an elderly female with primary atypical meningioma of the nasal cavity, which was excised via endoscopic endonasal approach. Results There was no recurrence even up to 20 months of follow-up after endoscopic excision. Conclusion Extracranial primary atypical meningioma should be kept in mind as one of the differential diagnoses of nasal mass. Histopathological diagnosis along with immunohistochemistry should be used for definitive diagnosis. PMID:29682381
Primary Atypical Meningioma of the Nasal Cavity: A Case Report and Review of the Literature
Directory of Open Access Journals (Sweden)
Leison Maharjan
2018-01-01
Full Text Available Background. Meningioma is a central nervous system tumor that typically arises in proximity to meninges. Extracranial primary atypical meningioma of sinonasal tract is a rare one. Methods. We discuss the clinical, radiological, and histological presentation of an elderly female with primary atypical meningioma of the nasal cavity, which was excised via endoscopic endonasal approach. Results. There was no recurrence even up to 20 months of follow-up after endoscopic excision. Conclusion. Extracranial primary atypical meningioma should be kept in mind as one of the differential diagnoses of nasal mass. Histopathological diagnosis along with immunohistochemistry should be used for definitive diagnosis.
Cosmetic and Functional Nasal Deformities
... nasal complaints. Nasal deformity can be categorized as “cosmetic” or “functional.” Cosmetic deformity of the nose results in a less ... taste , nose bleeds and/or recurrent sinusitis . A cosmetic or functional nasal deformity may occur secondary to ...
Smart Polymers in Nasal Drug Delivery.
Chonkar, Ankita; Nayak, Usha; Udupa, N
2015-01-01
Nasal drug delivery has now been recognized as a promising route for drug delivery due to its capability of transporting a drug to systemic circulation and central nervous system. Though nasal mucosa offers improved bioavailability and quick onset of action of the drug, main disadvantage associated with nasal drug delivery is mucocilliary clearance due to which drug particles get cleared from the nose before complete absorption through nasal mucosa. Therefore, mucoadhesive polymeric approach can be successfully used to enhance the retention of the drug on nasal mucosal surface. Here, some of the aspects of the stimuli responsive polymers have been discussed which possess liquid state at the room temperature and in response to nasal temperature, pH and ions present in mucous, can undergo in situ gelation in nasal cavity. In this review, several temperature responsive, pH responsive and ion responsive polymers used in nasal delivery, their gelling mechanisms have been discussed. Smart polymers not only able to enhance the retention of the drug in nasal cavity but also provide controlled release, ease of administration, enhanced permeation of the drug and protection of the drug from mucosal enzymes. Thus smart polymeric approach can be effectively used for nasal delivery of peptide drugs, central nervous system dugs and hormones.
Health risks associated with inhaled nasal toxicants
Feron, VJ; Arts, JHE; Kuper, CF; Slootweg, PJ; Woutersen, RA
2001-01-01
Health risks of inhaled nasal toxicants were reviewed with emphasis on chemically induced nasal lesions in humans, sensory irritation, olfactory and trigeminal nerve toxicity, nasal immunopathology and carcinogenesis, nasal responses to chemical mixtures, in vitro models, and nasal dosimetry- and
Nasal obstruction and human communication.
Malinoff, R; Moreno, C
1989-04-01
Nasal obstruction may cause a variety of communication disorders, particularly in children. The effects of nasal obstruction on hearing, speech, language, and voice are examined. Methods for assessing the effects of nasal obstruction are delineated, and recommendations for therapeutic interventions are described.
Nasal Delivery of High Molecular Weight Drugs
Directory of Open Access Journals (Sweden)
Erdal Cevher
2009-09-01
Full Text Available Nasal drug delivery may be used for either local or systemic effects. Low molecular weight drugs with are rapidly absorbed through nasal mucosa. The main reasons for this are the high permeability, fairly wide absorption area, porous and thin endothelial basement membrane of the nasal epithelium. Despite the many advantages of the nasal route, limitations such as the high molecular weight (HMW of drugs may impede drug absorption through the nasal mucosa. Recent studies have focused particularly on the nasal application of HMW therapeutic agents such as peptide-protein drugs and vaccines intended for systemic effects. Due to their hydrophilic structure, the nasal bioavailability of peptide and protein drugs is normally less than 1%. Besides their weak mucosal membrane permeability and enzymatic degradation in nasal mucosa, these drugs are rapidly cleared from the nasal cavity after administration because of mucociliary clearance. There are many approaches for increasing the residence time of drug formulations in the nasal cavity resulting in enhanced drug absorption. In this review article, nasal route and transport mechanisms across the nasal mucosa will be briefly presented. In the second part, current studies regarding the nasal application of macromolecular drugs and vaccines with nanoand micro-particulate carrier systems will be summarised.
Hippocrates (ca 460-370 BC) on nasal cancer.
Tsoucalas, Gregory; Sgantzos, Markos
2016-01-01
The prevalence of cancer in antiquity is rather an unknown scientific field. Nevertheless, During the 5th century BC, Hippocrates and his followers, studied thoroughly this fatal disease and proposed surgical techniques and palliative drugs to confront and treat the malignant tumors caused by the black bile (the 4 humors theory). Inside Corpus Hippocraticum, nasal cancer was mentioned, alongside with its treatment. Local surgical excision, cautherization, drugs to relief the pain and face possible metastases combined with a possible pessary technique and endotracheal intubation, have been employed by the physicians of the era.
Nagata, Koichi; Pethel, Timothy D
2017-07-01
Although anisotropic analytical algorithm (AAA) and Acuros XB (AXB) are both radiation dose calculation algorithms that take into account the heterogeneity within the radiation field, Acuros XB is inherently more accurate. The purpose of this retrospective method comparison study was to compare them and evaluate the dose discrepancy within the planning target volume (PTV). Radiation therapy (RT) plans of 11 dogs with intranasal tumors treated by radiation therapy at the University of Georgia were evaluated. All dogs were planned for intensity-modulated radiation therapy using nine coplanar X-ray beams that were equally spaced, then dose calculated with anisotropic analytical algorithm. The same plan with the same monitor units was then recalculated using Acuros XB for comparisons. Each dog's planning target volume was separated into air, bone, and tissue and evaluated. The mean dose to the planning target volume estimated by Acuros XB was 1.3% lower. It was 1.4% higher for air, 3.7% lower for bone, and 0.9% lower for tissue. The volume of planning target volume covered by the prescribed dose decreased by 21% when Acuros XB was used due to increased dose heterogeneity within the planning target volume. Anisotropic analytical algorithm relatively underestimates the dose heterogeneity and relatively overestimates the dose to the bone and tissue within the planning target volume for the radiation therapy planning of canine intranasal tumors. This can be clinically significant especially if the tumor cells are present within the bone, because it may result in relative underdosing of the tumor. © 2017 American College of Veterinary Radiology.
Targeting HSP70 and GRP78 in canine osteosarcoma cells in combination with doxorubicin chemotherapy.
Asling, Jonathan; Morrison, Jodi; Mutsaers, Anthony J
2016-11-01
Heat shock proteins (HSPs) are molecular chaperones subdivided into several families based on their molecular weight. Due to their cytoprotective roles, these proteins may help protect cancer cells against chemotherapy-induced cell death. Investigation into the biologic activity of HSPs in a variety of cancers including primary bone tumors, such as osteosarcoma (OSA), is of great interest. Both human and canine OSA tumor samples have aberrant production of HSP70. This study assessed the response of canine OSA cells to inhibition of HSP70 and GRP78 by the ATP-mimetic VER-155008 and whether this treatment strategy could sensitize cells to doxorubicin chemotherapy. Single-agent VER-155008 treatment decreased cellular viability and clonogenic survival and increased apoptosis in canine OSA cell lines. However, combination schedules with doxorubicin after pretreatment with VER-155008 did not improve inhibition of cellular viability, apoptosis, or clonogenic survival. Treatment with VER-155008 prior to chemotherapy resulted in an upregulation of target proteins HSP70 and GRP78 in addition to the co-chaperone proteins Herp, C/EBP homologous transcription protein (CHOP), and BAG-1. The increased GRP78 was more cytoplasmic in location compared to untreated cells. Single-agent treatment also revealed a dose-dependent reduction in activated and total Akt. Based on these results, targeting GRP78 and HSP70 may have biologic activity in canine osteosarcoma. Further studies are required to determine if and how this strategy may impact the response of osteosarcoma cells to chemotherapy.
Aplicaciones del colgajo frontonasal para la cobertura de defectos nasales
Directory of Open Access Journals (Sweden)
M. Pérez
2015-12-01
Full Text Available Presentamos una revisión retrospectiva de los pacientes a los cuales se realizó un colgajo frontonasal para la cobertura de defectos nasales intervenidos en la Unidad de Tumores Cutáneos de nuestro Servicio en el periodo comprendido entre enero de 2010 y mayo de 2014. El objetivo es analizar nuestras aplicaciones y resultados además de describir un algoritmo que permita indicar los distintos diseños en función de la localización y el tamaño del defecto a reparar. Empleamos el colgajo frontonasal en 78 pacientes (49 mujeres y 29 varones con un rango de edad de 47 a 92 años (media de 73 años. Creamos un total de 81 defectos, puesto que en 3 casos se resecaron simultáneamente 2 tumoraciones, todos de etiología tumoral (64 carcinomas basocelulares, 16 carcinomas espinocelulares y 1 caso de léntigo maligno melanoma, localizados en el área nasal, con un tamaño mínimo de 12 x 17 mm y máximo de 30 x 35 mm (media de 22 x 25 mm. El periodo de seguimiento fue de entre 2 meses y 4 años (media de 2,5 años. Respecto a las complicaciones observadas, todas ellas menores, hubo 6 casos de necrosis marginal, 8 de dehiscencia parcial de la herida y 1 de cicatrización hipertrófica, tratándose en su mayor parte de varones fumadores. Todos los colgajos sobrevivieron con resultado estético satisfactorio. El colgajo frontonasal permite la cobertura en un sólo tiempo quirúrgico de defectos nasales independientemente de su localización, de hasta 30 x 35 mm en nuestra serie. Se trata de un colgajo seguro y versátil en sus múltiples modificaciones, con unos resultados estéticos satisfactorios. Estas ventajas son de especial importancia en pacientes de edad avanzada como alternativa a técnicas más complejas. Se trata por lo tanto, a nuestro juicio, de una opción a tener en cuenta para la reconstrucción en un único tiempo quirúrgico de defectos nasales.
Directory of Open Access Journals (Sweden)
Ricardo De F. Strefezzi
2010-07-01
Full Text Available Este estudo teve como objetivo avaliar o valor prognóstico de marcadores de proliferação celular em casos de mastocitomas cutâneos caninos. Vinte e três casos foram analisados quanto à expressão imuno-histoquímica de Ki67 e do Antígeno Nuclear de Proliferação Celular (PCNA, sendo subsequentemente acompanhados clinicamente. Observou-se que a expressão de Ki67 mantém relação negativa com a tradicional graduação histopatológica (p= 0,0418; pThis study evaluated the prognostic value of cell proliferation markers for canine cutaneous mast cell tumor cases. Twenty-three cases were analyzed with regard to immuno-histochemical expression of Ki67 and Proliferating Cell Nuclear Antigen (PCNA, and were clinically followed up. Ki67 expression was related to the traditional histopathological grading (p= 0.0418; p<0.05 between grades I and III, and was a reliable indicator of post-surgical survival (p=0.0089. PCNA immunoexpression did not show statistically significant values in the prediction of disease-related mortality and survival, although it is correlated to Ki67 expression. These results confirm that information about tumoral proliferative activity through Ki67 immunohistochemical detection can improve canine cutaneous mast cell tumor grading with regard to malignancy.
Barril, María F; Ferolla, Fausto M; José, Pablo; Echave, Cecilia; Tomezzoli, Silvana; Fiorini, Sandra; López, Eduardo Luis
2008-12-01
A nasal septal abscess (NA) is defined as a collection of pus between the cartilage or bony septum and its normally applied mucoperichondrium or mucoperiostium. It is an uncommon disease which should be suspected in a patient with acute onset of nasal obstruction and recent history of nasal trauma, periodontal infection or an inflammatory process of the rhinosinusal region. We report a case of an 8-year-old boy with bilateral NA caused by community-acquired methicillin-resistant Staphylococcus aureus(MR-CO) in order to emphasize the importance of prompt diagnosis and adequate treatment to prevent the potentially dangerous spread of infection and the development of severe functional and cosmetic sequelae.
Molecular characterization of the canine HMGB1.
Murua Escobar, H; Meyer, B; Richter, A; Becker, K; Flohr, A M; Bullerdiek, J; Nolte, I
2003-01-01
Due to the close similarities of numerous canine diseases to their human counterparts, the dog could join the mouse as the species of choice to unravel the genetic background of complex diseases as e.g. cancer and metabolic diseases. Accordingly, the role of the dog as a model for therapeutic approaches is strongly increasing. However, prerequisite for such studies is the characterization of the corresponding canine genes. Recently, the human high mobility group protein B1 (HMGB1) has attracted considerable interest of oncologists because of what is called its "double life". Besides its function as an architectural transcription factor HMGB1 can also be secreted by certain cells and then acts as a ligand for the receptor for advanced glycation end products (RAGE). The binding of HMGB1 to RAGE can activate key cell signaling pathways, such as p38(MAPK), JNK, and p42/p44(MAPK) emphasizing the important role of HMGB1 in inflammation and tumor metastasis. These results make HMGB1 a very interesting target for therapeutic studies done in model organisms like the dog. In this study we characterized the molecular structure of the canine HMGB1 gene on genomic and cDNA levels, its predicted protein, the gene locus and a basic expression pattern. Copyright 2003 S. Karger AG, Basel
... to supply extra vitamin B12 to people who need unusually large amounts of this vitamin because they are pregnant or have certain diseases. ... Cyanocobalamin nasal gel will supply you with enough vitamin B12 only as ... it regularly. You may need to use cyanocobalamin nasal gel every week for ...
Neumann, Z L; Pondenis, H C; Masyr, A; Byrum, M L; Wycislo, K L; Fan, T M
2015-01-01
Canine osteosarcoma (OS) is an aggressive sarcoma characterized by pathologic skeletal resorption and pulmonary metastases. A number of negative prognostic factors, including bone alkaline phosphatase, have been identified in dogs with OS, but the underlying biologic factors responsible for such observations have not been thoroughly investigated. Endothelin-1-mediated signaling is active during bone repair, and is responsible for osteoblast migration, survival, proliferation, and bone alkaline phosphatase expression. The endothelin-1 signaling axis is active in canine OS cells, and this pathway is utilized by malignant osteoblasts for promoting cellular migration, survival, proliferation, and bone alkaline phosphatase activities. 45 dogs with appendicular OS. The expressions of endothelin-1 and endothelin A receptor were studied in OS cell lines and in samples from spontaneously occurring tumors. Activities mediated by endothelin-1 signaling were investigated by characterizing responses in 3 OS cell lines. In 45 dogs with OS, bone alkaline phosphatase concentrations were correlated with primary tumor osteoproductivity. Canine OS cells express endothelin-1 and endothelin A receptor, and this signaling axis mediates OS migration, survival, proliferation, and bone alkaline phosphatase activities. In OS-bearing dogs, circulating bone alkaline phosphatase activities were positively correlated with primary tumor relative bone mineral densities. Canine OS cells express endothelin-1 and functional endothelin A receptors, with the potential for a protumorigenic signaling loop. Increases in bone alkaline phosphatase activity are associated with osteoblastic OS lesions, and might be an epiphenomenon of active endothelin-1 signaling or excessive osteoproduction within the localized bone microenvironment. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.
Expression of CD56 and Epstein-Barr virus in nasal/nasopharyngeal lymphoma
International Nuclear Information System (INIS)
Lee, Seung Sook; Cho, Kyung Ja
1997-12-01
We examined malignant lymphomas and polymorphic reticulosis of nasal cavity, nasopharynx, and palate, diagnosed at Korea Cancer Center Hospital from 1987 to 1996. With immunophenotypic study, we reclassified nasal/nasopharyngeal lymphomas into three categories: CD56-positive T/NK lymphoma, CD56-negative lymphoma and B-cell lymphoma. Malignant lymphomas of nasal cavity, nasopharynx and palate were 95 patient, that comprised 11% of the total lymphoma cases, and it was the most common extranodal lymphoma. Twenty-five percent were B-cell lymphomas and 75 % were T/NK lymphomas. According to site, nasal cavity was the most frequent and 91 % of nasal cavity lymphomas were T/NK type. CD56-positive T/NK comprised 82 % of total T/NK lymphomas and CD56-negative cases were 18 %. In 89 % of total T/NK lymphomas, many tumor cells expressed EBER-1 in their nuclei (CD56+ T/NK lymphoma: 97 % of EBV expression, CD56-T-cell lymphoma; 60%). Only one case (5%) of B-cell lymphoma showed EBER-1 positivity in a few cells. CD56+ T/NK lymphomas showed significantly more angiocentricity and severe necrosis than CD56- cases. Although it has no statistical significance, T/NK lymphomas has a tendency to lower survival rates than B-cell lymphomas at 1 year and 2 year. CD56+ T/NK lymphomas has a tendency to lower survival than CD56- T/NK lymphomas (p > 0.05). Our results of this project will serve important basic materials in diagnosing and studying lymphoma. (author). 25 refs., 4 tabs., 4 figs
Cytotoxic action of Brazilian propolis in vitro on canine osteosarcoma cells.
Cinegaglia, N C; Bersano, P R O; Búfalo, M C; Sforcin, J M
2013-09-01
Osteosarcoma (OSA) is a primary bone neoplasm frequently diagnosed in dogs. The biology of OSA in pet dogs is identical to that of pediatric patients, and it has been considered an excellent model in vivo to study human OSA. Since the individual response to chemotherapy is unpredictable and considering that propolis is a natural product with several biological properties, this work evaluated the cytotoxic action of propolis on canine OSA cells. The primary cell culture of canine OSA was obtained from the tumor of a dog with OSA. Cell viability was assessed after incubation with propolis, 70% ethanol (propolis solvent), and carboplatin after 6, 24, 48, and 72 h. Cell viability was analyzed by the crystal violet method. Data showed that canine OSA cells were sensitive to propolis in a dose- and time-dependent manner and had a distinct morphology compared to control. Its solvent (70% ethanol) had no effect on cell viability, suggesting that the cytotoxic action was exclusively due to propolis. Our propolis sample exerted a cytotoxic effect on canine OSA cells, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment. Copyright © 2012 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Carlos Eduardo Fonseca-Alves
2014-01-01
Full Text Available A 10-year-old, intact male, pinscher was presented with unilateral bloodstained nasal discharge, sneezing, dyspnea, zygomatic arch deformity, submandibular lymph node increase, blindness in right eye, and exophthalmia. After clinical examination, it was found that the animal presented with upper respiratory tract dyspnea origin, possibly caused by an obstructive process. Complete blood count (CBC, ocular ultrasonography, thoracic radiographs, mandibular lymph node, and nasal sinus fine needle aspiration were performed. The right mandibular lymph node excisional biopsy was conducted and a tumor sample was obtained through the nasal fistula at hard palate. The material was processed, paraffin embedded, sectioned, and stained with hematoxylin and eosin. Immunohistochemical staining for cytokeratin (AE1/AE3, vimentin, and COX-2 was performed. After histopathological evaluation nasal carcinoma diagnosis was obtained. Chemotherapy was established with carboplatin 300 mg/m2 intravenously—four cycles with intervals of 21 days—and firocoxib 5 mg/kg orally every 24 hours for 7 months. After 7 months the treatment started, the animal presented with ataxia, vocalization, hyperesthesia, and anorexia. Due the clinical condition presented, the animal owner opted for performing euthanasia. The chemotherapy protocol was effective causing the disease stagnation, minimizing the clinical signs, and extending patient survival and quality of life.
International Nuclear Information System (INIS)
Hasegawa, Yuzo; Saeki, Naokatsu; Murai, Hisayuki; Horiguchi, Kentaro; Hanazawa, Toyoyuki; Okamoto, Miyoshi; Yanagawa, Noriyuki
2008-01-01
The endoscope is a new and highly useful instrument for transphenoidal surgery (TSS), and is generally used because of its minimally invasiveness. In addition, endoscopic transsphenoidal surgey (eTSS) has a potential for more radical tumor removal at the pituitary and the parasellar regions by wider visualization and more powerful illumination. To operate these regions safely, we need to know nasal and skull base anatomy under the endoscope which looks different from images under a microscope. In this paper, we demonstrated nasal and skull base anatomy with multi-detector computed tomography, which was performed in 23 recent patients with pituitary and parasellar legions. In the nasal legion, deviation of nasal septum and deviation of sphenoid ostium are important for endonasal approach of eTSS, and often determine the difficulty of surgery in the nasal cavity. Our study showed that deviation of nasal septum was seen in 26% of patients. Deviation of sphenoid ostium was 5.5±1.5 mm from the midline. The anatomy of sphenoid sinus plays a key role in our determination of the safety of a bony opening of the sella. In addition to sellar, presellar, and concha types, carotid prominence and optic prominence are important to determine the midline orientation. Development of carotid prominence was significantly related to the extent of lateral pneumatization of sphenoid sinus (P=0.0016). Reconstructed 3D-image of sphenoid sinus was very useful in visual understanding skull base anatomy. (author)
Nasal Glial Heterotopia with Cleft Palate.
Chandna, Sudhir; Mehta, Milind A; Kulkarni, Abhishek Kishore
2018-01-01
Congenital midline nasal masses are rare anomalies of which nasal glial heterotopia represents an even rarer subset. We report a case of a 25-day-old male child with nasal glial heterotopia along with cleft palate suggesting embryonic fusion anomaly which was treated with excision and primary closure for nasal mass followed by palatal repair at later date.
Measurement of secretion in nasal lavage
DEFF Research Database (Denmark)
Bisgaard, H; Krogsgaard, O W; Mygind, N
1987-01-01
1. The amount of admixture in nasal lavage fluids was determined by addition of 99mTc labelled albumin, providing a correction factor for measurements of cellular material and humoral substances in nasal lavage return as well as a quantitative measure of nasal secretions. 2. Albumin was chosen...... secretion to be carried out on the whole sample of lavage fluid, thereby avoiding the necessity of complete admixture between marker and lavage fluid which would be pertinent to marker molecules measured chemically. The radiation from a nasal lavage is minimal and the procedure is fully acceptable...... of the nose, yet not the oropharynx. 5. A dose related increase in nasal secretion harvested by the nasal lavage in 10 persons challenged with histamine chloride could be demonstrated by this technique. 6. It is concluded that the use of 99mTc-albumin in a nasal washing provides a safe, simple and quick...
Mantovani, Fernanda B; Morrison, Jodi A; Mutsaers, Anthony J
2016-05-31
Radiation therapy is a palliative treatment modality for canine osteosarcoma, with transient improvement in analgesia observed in many cases. However there is room for improvement in outcome for these patients. It is possible that the addition of sensitizing agents may increase tumor response to radiation therapy and prolong quality of life. Epidermal growth factor receptor (EGFR) expression has been documented in canine osteosarcoma and higher EGFR levels have been correlated to a worse prognosis. However, effects of EGFR inhibition on radiation responsiveness in canine osteosarcoma have not been previously characterized. This study examined the effects of the small molecule EGFR inhibitor erlotinib on canine osteosarcoma radiation responses, target and downstream protein expression in vitro. Additionally, to assess the potential impact of treatment on tumor angiogenesis, vascular endothelial growth factor (VEGF) levels in conditioned media were measured. Erlotinib as a single agent reduced clonogenic survival in two canine osteosarcoma cell lines and enhanced the impact of radiation in one out of three cell lines investigated. In cell viability assays, erlotinib enhanced radiation effects and demonstrated single agent effects. Erlotinib did not alter total levels of EGFR, nor inhibit downstream protein kinase B (PKB/Akt) activation. On the contrary, erlotinib treatment increased phosphorylated Akt in these osteosarcoma cell lines. VEGF levels in conditioned media increased after erlotinib treatment as a single agent and in combination with radiation in two out of three cell lines investigated. However, VEGF levels decreased with erlotinib treatment in the third cell line. Erlotinib treatment promoted modest enhancement of radiation effects in canine osteosarcoma cells, and possessed activity as a single agent in some cell lines, indicating a potential role for EGFR inhibition in the treatment of a subset of osteosarcoma patients. The relative radioresistance of
BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.
Directory of Open Access Journals (Sweden)
Mehdi Hayat Shahi
Full Text Available BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA. Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17 expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.
17-AAG and Apoptosis, Autophagy, and Mitophagy in Canine Osteosarcoma Cell Lines.
Massimini, M; Palmieri, C; De Maria, R; Romanucci, M; Malatesta, D; De Martinis, M; Maniscalco, L; Ciccarelli, A; Ginaldi, L; Buracco, P; Bongiovanni, L; Della Salda, L
2017-05-01
Canine osteosarcoma is highly resistant to current chemotherapy; thus, clarifying the mechanisms of tumor cell resistance to treatments is an urgent need. We tested the geldanamycin derivative 17-AAG (17-allylamino-17-demethoxygeldanamycin) prototype of Hsp90 (heat shock protein 90) inhibitors in 2 canine osteosarcoma cell lines, D22 and D17, derived from primary and metastatic tumors, respectively. With the aim to understand the interplay between cell death, autophagy, and mitophagy, in light of the dual effect of autophagy in regulating cancer cell viability and death, D22 and D17 cells were treated with different concentrations of 17-AAG (0.5 μM, 1 μM) for 24 and 48 hours. 17-AAG-induced apoptosis, necrosis, autophagy, and mitophagy were assessed by transmission electron microscopy, flow cytometry, and immunofluorescence. A simultaneous increase in apoptosis, autophagy, and mitophagy was observed only in the D22 cell line, while D17 cells showed low levels of apoptotic cell death. These results reveal differential cell response to drug-induced stress depending on tumor cell type. Therefore, pharmacological treatments based on proapoptotic chemotherapy in association with autophagy regulators would benefit from a predictive in vitro screening of the target cell type.
He, Xing; Li, Hua; Shao, Yan; Shi, Bing
2015-01-01
The purpose of this study is to ascertain objective nasal measurements from the basal view that are predictive of nasal esthetics in individuals with secondary cleft nasal deformity. Thirty-three patients who had undergone unilateral cleft lip repair were retrospectively reviewed in this study. The degree of nasal deformity was subjectively ranked by seven surgeons using standardized basal-view measurements. Nine physical objective parameters including angles and ratios were measured. Correlations and regressions between these objective and subjective measurements were then analyzed. There was high concordance in subjective measurements by different surgeons (Kendall's harmonious coefficient = W = .825, P = .006). The strongest predictive factors for nasal aesthetics were the ratio of length of nasal alar (r = .370, P = .034) and the degree of deviation of the columnar axis (r = .451, P = .008). The columellar angle had a more powerful effect in rating nasal esthetics. There was reliable concordance in subjective ranking of nasal esthetics by surgeons. Measurement of the columnar angle may serve as an independent, objective predictor of esthetics of the nose.
Sehata, Go; Sato, Hiroaki; Ito, Toshihiro; Imaizumi, Yoshitaka; Noro, Taichi; Oishi, Eiji
2015-07-01
We used real-time RT-PCR and virus titration to examine canine distemper virus (CDV) kinetics in peripheral blood and rectal and nasal secretions from 12 experimentally infected dogs. Real-time RT-PCR proved extremely sensitive, and the correlation between the two methods for rectal and nasal (r=0.78, 0.80) samples on the peak day of viral RNA was good. Although the dogs showed diverse symptoms, viral RNA kinetics were similar; the peak of viral RNA in the symptomatic dogs was consistent with the onset of symptoms. These results indicate that real-time RT-PCR is sufficiently sensitive to monitor CDV replication in experimentally infected dogs regardless of the degree of clinical manifestation and suggest that the peak of viral RNA reflects active CDV replication.
Nasal glial heterotopia with cleft palate
Directory of Open Access Journals (Sweden)
Sudhir Chandna
2018-01-01
Full Text Available Congenital midline nasal masses are rare anomalies of which nasal glial heterotopia represents an even rarer subset. We report a case of a 25-day-old male child with nasal glial heterotopia along with cleft palate suggesting embryonic fusion anomaly which was treated with excision and primary closure for nasal mass followed by palatal repair at later date.
Nasal endotracheal intubation in a premature infant with a nasal encephalocele.
Bannister, C M; Kashab, M; Dagestani, H; Placzek, M
1993-01-01
After a difficult nasal intubation a premature infant leaked cerebrospinal fluid (CSF) from one nostril. After developing bacterial meningitis, the baby was referred for neurosurgical management of the CSF fistula. Transaxial computed tomograms demonstrated a nasal encephalocele, but coronal scans were needed to show the defect in the cribriform plate. Images PMID:8346963
Measurement of secretion in nasal lavage
DEFF Research Database (Denmark)
Bisgaard, H; Krogsgaard, O W; Mygind, N
1987-01-01
1. The amount of admixture in nasal lavage fluids was determined by addition of 99mTc labelled albumin, providing a correction factor for measurements of cellular material and humoral substances in nasal lavage return as well as a quantitative measure of nasal secretions. 2. Albumin was chosen...... as marker molecule, since only negligible amounts were absorbed or adsorbed to the mucosa during the nasal lavage. 3. Labelling of the albumin with 99mTc ensured an accuracy of measurements only limited by the precision of the weighing. The isotope allowed for the determination of the amount of admixed...... of the nose, yet not the oropharynx. 5. A dose related increase in nasal secretion harvested by the nasal lavage in 10 persons challenged with histamine chloride could be demonstrated by this technique. 6. It is concluded that the use of 99mTc-albumin in a nasal washing provides a safe, simple and quick...
Appraisal of transverse nasal groove: a study.
Sathyanarayana, Belagola D; Basavaraj, Halevoor B; Nischal, Kuchangi C; Swaroop, Mukunda R; Umashankar, Puttagangu N; Agrawal, Dhruv P; Swamy, Suchetha S; Okram, Sarda
2012-01-01
Transverse nasal groove is a condition of cosmetic concern which awaits due recognition and has been widely described as a shallow groove that extends transversely over the dorsum of nose. However, we observed variations in the clinical presentations of this entity, hitherto undescribed in literature. We conducted a clinicoepidemiological study of transverse nasal lesions in patients attending our outpatient department. We conducted a prospective observational study. We screened all patients attending our out-patient department for presence of transverse nasal lesions, signs of any dermatosis and associated other skin conditions. One hundred patients were recruited in the study. Females (80%) predominated over males. Most patients were of 15-45 years age group (70%). Majority of the transverse nasal lesions were classical transverse nasal groove (39%) and others included transverse nasal line (28%), strip (28%), ridge (4%) and loop (1%). Seborrhoeic diathesis was the most common condition associated with transverse nasal lesion. Occurrence of transverse nasal line, strip, ridge and loop, in addition to classical transverse nasal groove implies that latter is actually a subset of transverse nasal lesions. Common association of this entity with seborrheic dermatitis, seborrhea and dandruff raises a possibility of whether transverse nasal lesion is a manifestation of seborrheic diathesis.
Stern, M A; Wade, A G; Ridout, S M; Cambell, L M
1998-10-01
Allergic rhinitis is usually treated with oral antihistamines or nasal steroids. Topically active nasal antihistamine is a new treatment modality for allergic rhinitis. The efficacy in comparison to well established topical treatment alternatives is not fully known. To compare the efficacy of intranasally administered azelastine to budesonide, at their respectively recommended dosage, on the symptoms of perennial rhinitis patients. A placebo-controlled, randomized, parallel group study was conducted to compare the efficacy and tolerability of intranasal budesonide aqueous suspension (256 microg once daily) with azelastine hydrochloride nasal spray (280 microg twice daily (560 microg/day)) and with placebo in the treatment of perennial allergic rhinitis. The 195 patients (with at least a 2-year history of perennial allergic rhinitis) recorded individual nasal symptom scores, the degree of symptom control achieved and any adverse events experienced over a 2-week baseline period and a 6-week treatment period. Following treatment, the reductions in mean combined and individual nasal symptom scores from baseline values were significantly greater in the budesonide group compared with the placebo group (P < .0001 for all variables except runny nose P = .01). In patients treated with budesonide, there were also significantly larger reductions from baseline values in combined nasal symptom scores (P < .01) and in scores for all individual nasal symptoms (P < or = .05) compared with those treated with azelastine. The reductions from baseline in both combined and individual nasal symptom scores did not differ between azelastine and placebo. The study medications were well tolerated, producing no unexpected or serious treatment-related adverse events. A once-daily dose of 256 microg of intranasal budesonide aqueous suspension is significantly more effective at relieving the symptoms of perennial allergic rhinitis compared with a twice daily dose of 280 microg of azelastine
Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch
2017-01-01
Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...
Efeito do exercício físico sobre o volume nasal Effects of physical exercise in nasal volume
Directory of Open Access Journals (Sweden)
Marconi Teixeira Fonseca
2006-04-01
Full Text Available A variação da permeabilidade nasal tem sido demonstrada usando-se várias técnicas de exame. As estruturas nasais geram uma resistência que representa cerca de 50% da resistência respiratória total. O exercício físico é um dos fatores que pode causar um efeito vasoconstritor sobre a mucosa nasal. OBJETIVO: O objetivo deste estudo é avaliar o grau de mudança do volume nasal após exercício físico e o tempo de retorno aos níveis basais. MATERIAIS E MÉTODOS: Dezenove indivíduos foram submetidos à realização de teste físico em bicicleta ergométrica. O volume nasal foi obtido através da rinometria acústica, realizada em repouso, após o fim do exercício físico, e nos minutos décimo e vigésimo de seu final. RESULTADOS: Os resultados rinométricos mostram um aumento estatisticamente significativo do volume nasal (p The nasal permeability has been demonstrated using several exams. Nasal structures produces a resistance to the nasal air flux that represents over 50% of the total respiratory resistance. Physical exercises is a factor that brings a vasoconstrictor effect over nasal mucosa. AINS: Evaluate the improvement degree of nasal volume after aerobic physical exercises and time to return to previous levels. SUBJECTS AND METHODS: Nineteen heathly subjects were submitted to aerobic exercise in ergometric bike. The nasal volume was obtained by Acoustic Rhinometry perfomed in rest, after aerobic exercise, 10o and 20o minutes after the aerobic exercise. RESULTS: Rhynometrics results shows a statically and significant increase of nasal volume (p<0,001. The nasal volume, in twenty minutes, returns nearby the rest levels. CONCLUSIONS: Aerobic exercises, generally, increases the nasal volume. However, the increase of nasal volume was transitory, and occurs a major reduction of increase in the first ten minutes after the exercises ends, and perform a greater vasoconstrictor effect over nasal mucosa, Twenty minutes after the physical
Bergman, Philip J
2007-05-01
Melanoma is the most common oral malignancy in the dog. Oral and/or mucosal melanoma has been routinely considered an extremely malignant tumor with a high degree of local invasiveness and high metastatic propensity. Primary tumor size has been found to be extremely prognostic. The World Health Organization staging scheme for dogs with oral melanoma is based on size, with stage I = or = 4cm tumor and/or lymph node metastasis, and stage IV = distant metastasis. Median survival times for dogs with oral melanoma treated with surgery are approximately 17 to 18, 5 to 6, and 3 months with stage I, II, and III disease, respectively. Significant negative prognostic factors include stage, size, evidence of metastasis, and a variety of histologic criteria. Standardized treatments such as surgery, coarse-fractionation radiation therapy, and chemotherapy have afforded minimal to modest stage-dependent clinical benefits and death is usually due to systemic metastasis. Numerous immunotherapeutic strategies have been employed to date with limited clinical efficacy; however, the use of xenogeneic DNA vaccines may represent a leap forward in clinical efficacy. Oral melanoma is a spontaneous syngeneic cancer occurring in outbred, immunocompetent dogs and appears to be a more clinically faithful therapeutic model for human melanoma; further use of canine melanoma as a therapeutic model for human melanoma is strongly encouraged. In addition, the development of an expanded but clinically relevant staging system incorporating the aforementioned prognostic factors is also strongly encouraged.
Fungal Agents as a Cause of Nasal Polyposis
Directory of Open Access Journals (Sweden)
Mohammad Nejadkazem
2015-01-01
Full Text Available Introduction: Sinonasal polyposis is the most common tumor of nasal cavity and sinuses. Its complications are but not limited to sinusitis, breathing difficulties, hyposmia, anosmia and bone erosion. Methods and materials: A total of 98 patients with sinonasal polyposis were examined for suspicious causative fungal agent. Results: Direct microscopy and culture confirmed fungal agent in 8 patients (8.1% from which 3 cases had Alternaria spp, 1 patient Aspergillus spp, 1 patient Bipolaris spp, and 3 patients yeast. Conclusion: Fungi may be considered as a potential cause of sinonasal polyposis. Keywords: Sinonasal Polyposis, Rhinosinusitis, Fungi
Does Post Septoplasty Nasal Packing Reduce Complications?
Directory of Open Access Journals (Sweden)
Bijan Naghibzadeh
2011-01-01
Full Text Available The main issues in nasal surgery are to stabilize the nose in the good position after surgery and preserve the cartilages and bones in the favorable situation and reduce the risk of deviation recurrence. Also it is necessary to avoid the synechia formation, nasal valve narrowing, hematoma and bleeding. Due to the above mentioned problems and in order to solve and minimize them nasal packing, nasal splint and nasal mold have been advised. Patients for whom the nasal packing used may faced to some problems like naso-pulmonary reflex, intractable pain, sleep disorder, post operation infection and very dangerous complication like toxic shock syndrome. We have two groups of patients and three surgeons (one of the surgeons used post operative nasal packing in his patients and the two others surgeons did not.Complications and morbidities were compared in these two groups. Comparing the two groups showed that the rate of complication and morbidities between these two groups were same and the differences were not valuable, except the pain and discomfort post operatively and at the time of its removal. Nasal packing has several risks for the patients while its effects are not studied. Septoplasty can be safely performed without postoperative nasal packing. Nasal packing had no main findings that compensated its usage. Septal suture is one of the procedures that can be used as alternative method to nasal packing. Therefore the nasal packing after septoplasty should be reserved for the patients with increased risk of bleeding.
Nasal morphological characteristics of the Serbian population
Directory of Open Access Journals (Sweden)
Jovanović J.
2014-01-01
Full Text Available The aim of this study was to determine the nasal parameters in the population of central Serbia and to compare them with those determined in earlier studies in different populations. The research was conducted on 496 randomly selected persons (262 males and 234 females, aged 18-65 years. The measured parameters were nasal height and nasal breadth and the standard spreading caliper with scale was used for measurements. There were significant differences in the nasal parameters between male and female subjects. The nasal breadth was 34.72 mm in females, and in the male population it was 36.7 mm. The mean values of nasal height were 52.6 mm and 54.32 mm in females and males, respectively. The nasal index in females and males was 66.01 and 67.56, respectively, and the mean value of the nasal index of all respondents was 66.78. After conducting the research it was concluded that the dominant nasal type in the population of the central part of Serbia is leptorrhine. The present study showed the existence of sexual dimorphism in nasal morphology. The data obtained in our study may be useful in anthropological and forensic research, as well as in cosmetic planning and reconstructive surgery.
Goupil, R C; Bushey, J J; Peters-Kennedy, J; Wakshlag, J J
2012-09-01
Canine osteosarcoma is an insidious disease with few effective treatment modalities; therefore, use of pharmacologic intervention to improve mortality or morbidity is constantly sought. The use of cyclooxygenase enzyme inhibitors has been an area of interest with limited efficacy based on retrospective examination of tumor expression and in vivo cell proliferation models. Recently, examination of dual cyclooxygenase and 5-lipoxygenase inhibitors in human and canine oncology suggests that 5-lipoxygenase inhibitors may be an effective approach in vitro and during tumor induction in rodent models. Therefore, the authors decided to examine 5-lipoxygenase expression in primary canine osteosarcoma samples and have shown that approximately 65% of osteosarcomas label positive for cytoplasmic 5-lipoxygenase. Further examination of a cell culture and xenograft model shows similar 5-lipoxygenase expression. Surprisingly, a canine 5-lipoxygenase inhibitor (tepoxalin) significantly reduced cell proliferation at physiologic doses in vitro and diminished xenograft tumor growth in nude mice, suggesting that further investigation is needed. Traditionally, 5-lipoxygense leads to production of lipid mediators, such as leukotriene B(4) and 5-oxo-eicosatetraenoic acid, which, when added back to the media of tepoxalin-treated cells, did not recover cell proliferation. The lack of nuclear staining in primary and xenografted tumors and the lack of response to eicoasanoids suggest that lipid mediator production is not the primary means by which tepoxalin acts to alter proliferation. Regardless of the mechanisms involved in retarding cell proliferation, future investigation is warranted.
Peanchitlertkajorn, Supakit
2018-01-01
Traditional nasoalveolar molding (NAM) requires steep learning curve for clinicians and significant compliance from parents. Nasal springs have been developed by the author to simplify presurgical nasal molding. This article presents the design, construction, and application of the spring. The treatment goal is to improve nasal deformity prior to primary repair in infants born with incomplete unilateral cleft lip with or without cleft palate. The design, fabrication, and utility of the nasal spring are described. The spring has a simpler design and construction compared to a traditional NAM appliance. Two patients with incomplete unilateral cleft lip with and without cleft palate are presented. The spring is constructed and delivered. The active arm of the spring can be 3-dimensionally (3-D) adjusted to mold the alar cartilage of the affected nostril. The spring does not require an oral plate for adherence as a traditional NAM appliance does, hence an oral impression is not needed. The spring is easy for clinicians to adjust. It also requires less compliance by parents. Main Outcome Measures/Results: The presurgical molding achieved by the use of a nasal spring improved surgical nasolabial aesthetic outcomes. The nasal springs are effective in reducing the initial cleft nasal deformity. This facilitates primary surgical cleft lip and nose correction and improves surgical outcomes in patients with incomplete unilateral cleft lip with or without cleft palate.
Expression of Bcl-2 in canine osteosarcoma
Piro, F.; Leonardi, L.
2015-01-01
Osteosarcoma (OS) is the most common primary malignancy of bone. It is responsible for 80-85% of the primary bone tumors affecting dogs and it is characterized by aggressive and invasive behavior, with a high metastatic potential. Several studies on cancer and related tumorigenesis, show an involvement of the mechanisms of programmed cell death and cell survival. Many signals seem to be involved in the related mechanism of autophagy and in particular, our interest is focused on the expression of a family of Bcl-2 that seems to be involved either in the control of biomolecular mechanisms like autophagy and apoptosis. In this study we investigated the expression of Bcl-2 in different cases of spontaneous canine osteosarcoma and the related preliminary results are described. We found Bcl-2 activity was increased in OS tissue compared to normal bone tissue. These results suggested that Bcl-2 activity may play an important role in the formation of OS and as a diagnostic for neoplastic activity. However, further research is needed to confirm the role of Bcl-2 activity in OS in canines. PMID:26623359
Canine oral cavity neoplasias - Brief review
Directory of Open Access Journals (Sweden)
João Filipe Requicha
2015-03-01
Full Text Available ABSTRACT. Requicha J.F., Pires M. dos A., Albuquerque C.M. & Viegas C.A. [Canine oral cavity neoplasias - Brief review.] Neoplasias da cavidade oral do cão - Breve revisão. Revista Brasileira de Medicina Veterinária, 37(1:41-46, 2015. Faculdade de Medicina Veterinária, Universidade Lusófona de Humanidades e Tecnologias, Campo Grande, 1749-024 Lisboa, Portugal e Department of Veterinary Sciences, School of Agriculture and Veterinary Sciences, University of Trás-os-Montes e Alto Douro, P.O. Box 1013, 5001-801 Vila Real, Portugal. E-mail: jfrequicha@gmail.com Oral proliferative lesions are relatively common in domestic carnivores but, fortunately, a lot of these lesions are benign. The oral cavity is place of 6% of all tumours in dogs, being the sixth most important localization of neoplasias in this specie. The non-odontogenic tumors arise from structures of the oral cavity, except from dental tissue, and they are mostly malignant. Odontogenic tumors are those originated from the dental structures. In the case of tumors of non-odontogenic, will be described the oral papillomatosis, the melanoma, the squamous cell carcinoma, and the fibrosarcoma. Among the odontogenic tumors, the focus will be on the epulides, ameloblastoma, odontoma and dentigerous cysts.
GdNCT of spontaneous canine melanoma
International Nuclear Information System (INIS)
Mitin, V.N.; Kulakov, V.N.; Khokhlov, V.F.
2006-01-01
The effectiveness of GdNCT has been studied in dogs with spontaneous melanoma of the mucousmembrane of the oral cavity patients on the NCT base at the IRT MEPhI reactor. The control group with melanomas was treated with neutrons. Fourteen canine patients were selected in the Clinic of Experimental Therapy affiliated with the RCRC RAMS. The calculation of doses has shown that the total dose of energy release depending on Gd concentration in the target can be several times higher than the dose produced by the reactor neutron beam. The calculations were carried out using the diffusion pharmacokinetic model. The gadolinium drug dipentast was administered intratumorally immediately prior to irradiation. The tumor size was estimated by measuring it in three projections. The tumor was irradiated for 60-90 minutes with a thermal neutron flux of 0.7x10 9 n/cm 2 s. The dose on tumor was 80-120 Gy, on surrounding tissues - 12-15 Gy. The treatment plan included immunotherapy with Roncoleikin in a dose of (15-10)x10 3 IE/kg. The results of GdNCT are still under observation. The results conform to those obtained by us earlier in cell cultures and inoculated experimental tumors. GdNCT is also effective in combination with immunotherapy. (author)
99mTc-methoxy-isobutyl-isonitrile (sestamibi) imaging of malignant canine lymphoma
International Nuclear Information System (INIS)
Steyn, P.F.; Ogilvie, G.
1995-01-01
Technetium-99m methoxy-isobutyl-isonitrile (sestamibi) imaging of malignant canine lymphoma was performed in thirteen dogs 1 hour after intravenous injection of 99mTc-sestamibi at 13 MBq (0.35 mCi) per kilogram body weight. Abnormal tracer uptake was visualized in the liver, spleen, bone marrow, and mesenteric, inguinal, popliteal, sternal, cranial cervical and mandibular lymph nodes. Radiopharmaceutical uptake was also noted in a nasal mass. One large neoplastic renal mass did not have demonstrable sestamibi uptake. Other regions had no significant difference in the target:background ratios when compared with values from normal dogs (P > 0.05). 99mTc-sestamibi can be used to image malignant lymphoma, and has potential applications in the management of patients to document response to treatment and to stage of extent of disease
Yee, Karen K; Craven, Brent A; Wysocki, Charles J; Van Valkenburgh, Blaire
2016-07-01
Although the anatomy of the nasal fossa is broadly similar among terrestrial mammals, differences are evident in the intricacies of nasal turbinal architecture, which varies from simple scroll-like to complex branching forms, and in the extent of nonsensory and olfactory epithelium covering the turbinals. In this study, detailed morphological and immunohistochemical examinations and quantitative measurements of the turbinals and epithelial lining of the nasal fossa were conducted in an array of species that include the gray squirrel, bobcat, coyote, and white-tailed deer. Results show that much more of the nose is lined with olfactory epithelium in the smallest species (gray squirrel) than in the larger species. In two species with similar body masses, bobcat and coyote, the foreshortened felid snout influences turbinal size and results in a decrease of olfactory epithelium on the ethmoturbinals relative to the longer canine snout. Ethmoturbinal surface area exceeds that of the maxilloturbinals in all four sampled animals, except the white-tailed deer, in which the two are similar in size. Combining our results with published data from a broader array of mammalian noses, it is apparent that olfactory epithelial surface area is influenced by body mass, but is also affected by aspects of life history, such as diet and habitat, as well as skull morphology, itself a product of multiple compromises between various functions, such as feeding, vision, and cognition. The results of this study warrant further examination of other mammalian noses to broaden our evolutionary understanding of nasal fossa anatomy. Anat Rec, 299:840-852, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Czopowicz, Michał; Gruk-Jurka, Anna; Wojtkowska, Agata; Sapierzyński, Rafał; Jurka, Piotr
2018-01-01
Cytology is a simple, rapid, and inexpensive method used for pre-operative diagnosis of canine mammary tumors (CMTs) in veterinary practice. Studies related to human breast cancer showed the Robinson’s grading system—established for invasive ductal carcinoma, not otherwise specified (IDC, NOS) and used on cytological material—to not only closely correspond to the histopathological grading but also be helpful in assessing prognosis and selecting most suitable treatments before surgery. The objectives of this study were: to evaluate the accuracy of cytological diagnosis and cytological Robinson’s grading system compared to the histopathological examination of CMTs; to compare of cytological features and cytomorphometric parameters with tumor behavior, as well as cytological and histological grading; and to determine an association of the Robinson’s grading system and cytological background details with metastases, and patients’ survival. We report substantial diagnostic accuracy in detecting simple types and high grade tumors. Cytological diagnosis of tumor behavior showed relatively low sensitivity and specificity compared to human studies, and this might be caused by the heterogeneous morphology of CMTs. The presence of mucosecretory material and extracellular matrix was not significantly associated with tumor behavior. We report a positive correlation between both grading systems and cytological features (included in Robinson’s grading), the presence of necrotic debris, inflammation, and red blood cells. A negative correlation was determined only for the presence of extracellular matrix. The univariate and multivariate analyses confirmed a significantly higher risk of developing metastasis and shorter overall survival for dogs with tumors of grade 2 or 3 on cytology. In addition, these tumors were the most common cause of CMT-related deaths in dogs. Taken together, our findings suggest that the Robinson’s method of cytological grading applied for
CT findings of the angiomatous polyp in the nasal cavity and paranasal sinus
Energy Technology Data Exchange (ETDEWEB)
Jang, Young Sim; Youm, Dong Ho; Lee, Myeong Sub; Kang, In Goo; Lee, Jun Ha; Sung, Ki Joon; Cho, Mee Yon; Yang, Suk Woo [Yonsei Univ. College of Medicine, Wonju (Korea, Republic of)
1999-06-01
To assess the characteristic CT findings of the angiomatous polyp. Five cases of pathologically-proven angiomatous polyp were retrospectively evaluated. All underwent CT scanning, but in only four cases were postcontrast CT scans obtained. In analysing CT findings we focused on adjacent bony change, and the extent and enhancement pattern of the mass. All but one case involved the maxillary sinus, showing thickening of the posterolateral wall and erosion or destruction of the medial wall. As for involvement of the anterior wall of this sinus, bony destruction was seen in one case, and thickening in three. In four cases the tumor involved the maxillary sinus and nasal cavity, and two cases showed nasopharyngeal extension. No case involved the pterygopalatine fossa, however. On contrast enhanced CT scans(n=4), all cases showed enhancement as strong as blood vessels, and a multiple focal punctate or tubular pattern. Angiomatous polyp tends to show bone thickening rather than bone destruction, not to involve the pterygopalatine fossa, and to reveal a strong punctate or tubular enhancement pattern. These findings may be helpful in the differential diagnosis of angiomatous polyp from other tumors such as maxillary cancer, angiofibroma and nasal polyp.
Malignant tumors of the upper aerodigestive tract as seen in a ...
African Journals Online (AJOL)
and nasal cavity are more commonly affected than the oral cavity unlike in other populations. Nonepithelial tumors are extremely rare below the age of 20 years. Key words: Malignant tumors, Nigeria, upper aerodigestive tract. Date of Acceptance: 28‑May‑2014. Address for correspondence: Dr. Sabageh Donatus,.
Directory of Open Access Journals (Sweden)
Georg J. Ledderose
2015-01-01
Full Text Available Objectives. Cutaneous metastases can be the first sign of a malignant disease and have an unfavorable prognostic significance. The external nose is rarely affected. The uncommon clinical presentation of these cutaneous metastases may lead to the wrong diagnosis and treatment. Methods. We present the case of a 59-year-old patient with a small indolent tumor on the tip of the nose that turned out to be the first sign of an extended esophageal cancer. Conclusion. The differential diagnosis of tumors of the facial skin and the nasal tip includes metastases from an unknown primary tumor. In rare cases, squamous cell carcinoma of the esophagus needs to be considered.
Immunohistochemical detection of estrogen receptors in canine mammary tumors
Elena Atanaskova Petrov; Ivica Gjurovski; Trpe Ristoski; Goran Nikolovski; Pandorce Trenkoska; Plamen Trojacanec; Ksenija Ilievska; Toni Dovenski; Gordana Petrushevska
2016-01-01
Mammary tumors are among the most common neoplasms in intact female dogs.They have a complex morphology, usually affecting middle age and older bitches. Almost 50% of the mammary tumors in dogs are malignant neoplasms. Prognosis is based on several factors: stage, age, tumor size, metastasis, histopathology, ovariectomy status and hormone-receptor activity. Immunohistochemical (IHC) measurement has become increasingly an important diagnostic and prognostic parameter, with the development of m...
Functional Characterization of Canine Interferon-Lambda
Fan, Wenhui; Xu, Lei; Ren, Liqian; Qu, Hongren; Li, Jing; Liang, Jingjing; Liu, Wenjun
2014-01-01
In this study, we provide the first comprehensive annotation of canine interferon-λ (CaIFN-λ, type III IFN). Phylogenetic analysis based on genomic sequences indicated that CaIFN-λ is located in the same branch with Swine IFN-λ1 (SwIFN-λ), Bat IFN-λ1 (BaIFN-λ), and human IFN-λ1 (HuIFN-λ1). CaIFN-λ was cloned, expressed in Escherichia coli, and purified to further investigate the biological activity in vitro. The recombinant CaIFN-λ (rCaIFN-λ) displayed potent antiviral activity on both homologous and heterologous animal cells in terms of inhibiting the replication of the New Jersey serotype of vesicular stomatitis virus (VSV), canine parvovirus, and influenza virus A/WSN/33 (H1N1), respectively. In addition, we also found that rCaIFN-λ exhibits a significant antiproliferative response against A72 canine tumor cells and MDCK cells in a dose-dependent manner. Furthermore, CaIFN-λ activated the JAK-STAT signaling pathway. To evaluate the expression of CaIFN-λ induced by virus and the expression of IFN-stimulated genes (ISGs) induced by rCaIFN-λ in the MDCK cells, we measured the relative mRNA level of CaIFN-λ and ISGs (ISG15, Mx1, and 2′5′-OAS) by quantitative real-time PCR and found that the mRNA level of CaIFN-λ and the ISGs significantly increased after treating the MDCK cells with viruses and rCaIFN-λ protein, respectively. Finally, to evaluate the binding activity of rCaIFN-λ to its receptor, we expressed the extracellular domain of the canine IFN-λ receptor 1 (CaIFN-λR1-EC) and determined the binding activity via ELISA. Our results demonstrated that rCaIFN-λ bound tightly to recombinant CaIFN-λR1-EC (rCaIFN-λR1-EC). PMID:24950142
Nasal mass removal in the koala (Phascolarctos cinereus).
Bercier, Marjorie; Wynne, Janna; Klause, Stephen; Stadler, Cynthia K; Gorow, April; Pye, Geoffrey W
2012-12-01
Nasal masses in the koala (Phascolarctos cinereus) are not uncommon and can be challenging to diagnose and treat. Differential diagnoses for nasal masses in the koala are cryptococcal granulomas, nasal polyps, nasal adenocarcinoma, and osteochondromatosis. This report describes successful surgical approaches for two adult koalas with nasal masses and includes photodocumentation and description of the anatomy of the koala nasal passages from the postmortem transverse sectioning of a normal koala head. Surgical removal of the nasal masses in these koalas resulted in a rapid resolution of clinical signs.
Directory of Open Access Journals (Sweden)
Kowsar Baghban
2014-01-01
Full Text Available Background and Aim : Nasalization of a vowel refers to the addition of nasal resonance to the vocal tract transfer function. Also, vowel nasalization occurs because of coarticulation. Coupling of the nasal resonating space to the oropharyngeal cavity alters the vocal tract formants in complex ways. The purpose of this study was to investigate the effect of nasalization on /a/ vowel formants in before and after nasal consonant.Methods: In current cross-sectional study, voice samples of 60 normal children ranging the age of four-nine years were investigated. Participants were asked to repeat / ʔ ama/ three times and vowel /a/ after presentation of an auditory model. Then, obtained samples were analyzed using Praat 5.3.13 . Average of F0, F1, F2 and F3 were calculated for /a/ comes before and after /m/ in production of / ʔ ama/ over three trials.Results: There were statistically significant differences of F1, F2 and F3 between / a/ which proceeds nasal consonant and /a/ follows nasal consonant , the before nasal consonant /a/ versus single /a/ and the after nasal consonant /a/ versus single /a/ (p=0.001 for all.Conclusion : F1, F2 and F3 in /a/ before nasal consonant affected by anticipatory nasal coarticulation and in /a/ after nasal consonant affected by carry-over nasal coarticulation . This study showed nasal coarticulation and nasalization result in decreasing F1, F2 and F3 in /a/ vowel.
Lymphoepithelial carcinoma of the nasal cavity mimicking juvenile angiofibroma.
Kim, Young Hyo; Kim, Beom Joon; Jang, Tae Young
2012-10-01
Juvenile angiofibroma, nasopharyngeal carcinoma (NPC) and lymphoepithelial carcinoma of the nasal cavity (LEC NC) all could be found as a hyper-vascular mass in the nasopharynx area. Performing biopsy for histopathologic confirmation is necessary in the case of NPC or LEC NC but could be fatal in the case of angiofibroma. In our case, a 21-year-old male who was suffering from unilateral nasal stuffiness and frequent epistaxis had a mass with an easily bleeding tendency in his right nasal cavity. Juvenile angiofibroma was suspected by clinical and radiologic examinations. We performed preoperative angiography and the feeding vessel from the right internal maxillary artery was obliterated with polyvinyl alcohol nanoparticle. The mass was completely removed endoscopically, and there was profound hemorrhage in spite of the preoperative embolization. The mass turned out to be LEC NC by postoperative histopathologic examination. To avoid this misdiagnosis, the authors suggest that we should perform biopsy under rigid endoscopy 24h after angiographic embolization. If the result of frozen biopsy is juvenile angiofibroma, we could perform surgery another 24h later. If the result is nasopharyngeal carcinoma or LEC NC, we could avoid unnecessary surgical removal and perform radiotherapy. In terms of treatment strategies, we suggest endoscopic removal of gross tumor and postoperative combination of chemoradiotherapy as the more curative regimen with less complications related with radiotherapy. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Cauchois, R; Laccourreye, O; Bremond, D; Testud, R; Küffer, R; Monteil, J P
1994-08-01
Nasal dermoid sinus cyst is one of the diagnoses of midline nasal masses in children. This retrospective study analyzes the various theories regarding the origin of this congenital abnormality, the differential diagnosis, and the value of magnetic resonance imaging, as well as the various surgical options available.
Energy Technology Data Exchange (ETDEWEB)
Wu, Run-Ye [Department of Radiation Oncology, National Cancer Center/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China); Liu, Kang [Department of Imaging Diagnosis, National Cancer Center/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China); Wang, Wei-Hu; Jin, Jing; Song, Yong-Wen; Wang, Shu-Lian; Liu, Yue-Ping; Ren, Hua; Fang, Hui; Liu, Qing-Feng; Yang, Yong; Chen, Bo; Qi, Shu-Nan; Lu, Ning-Ning; Tang, Yu; Tang, Yuan; Li, Ning [Department of Radiation Oncology, National Cancer Center/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China); Ouyang, Han [Department of Imaging Diagnosis, National Cancer Center/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China); Li, Ye-Xiong, E-mail: yexiong12@163.com [Department of Radiation Oncology, National Cancer Center/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China)
2017-01-01
Purpose: This study aimed to determine the pathways of primary tumor invasion (PTI) and regional lymph node (LN) spread based on magnetic resonance imaging (MRI) in early-stage nasal NK/T-cell lymphoma (NKTCL), to improve clinical target volume (CTV) delineation and evaluate the prognostic value of locoregional extension patterns. Methods and Materials: A total of 105 patients with newly diagnosed early-stage nasal NKTCL who underwent pretreatment MRI were retrospectively reviewed. All patients received radiation therapy with or without chemotherapy. Results: The incidences of PTI and regional LN involvement were 64.7% and 25.7%, respectively. Based on the incidence of PTI, involved sites surrounding the nasal cavity were classified into 3 risk subgroups: high-risk (>20%), intermediate-risk (5%-20%), and low-risk (<5%). The most frequently involved site was the nasopharynx (35.2%), followed by the maxillary (21.9%) and ethmoid (21.9%) sinuses. Local disease and regional LN spread followed an orderly pattern without LN skipping. The retropharyngeal nodes (RPNs) were most frequently involved (19.0%), followed by level II (11.4%). The 5-year overall survival (OS), progression-free survival (PFS), and locoregional control (LRC) rates for all patients were 72.8%, 65.2%, and 90.0%, respectively. The presence of PTI and regional LN involvement based on MRI significantly and negatively affected PFS and OS. Conclusions: Early-stage nasal NKTCL presents with a high incidence of PTI but a relatively low incidence of regional LN spread. Locoregional spread followed an orderly pattern, and PTI and regional LN spread are powerful prognostic factors for poorer survival outcomes. CTV reduction may be feasible for selected patients.
Energy Technology Data Exchange (ETDEWEB)
La Fontaine, M; Bradshaw, T [University of Wisconsin, Madison, Wisconsin (United States); Kubicek, L [University of Florida, Gainesville, Florida (United States); Forrest, L [University of Wisconsin-Madison, Madison, Wisconsin (United States); Jeraj, R [University of Wisconsin, Madison, WI (United States)
2014-06-15
Purpose: Regions of poor perfusion within tumors may be associated with higher hypoxic levels. This study aimed to test this hypothesis by comparing measurements of hypoxia from Cu-ATSM PET to vasculature kinetic parameters from DCE-CT kinetic analysis. Methods: Ten canine patients with sinonasal tumors received one Cu-ATSM PET/CT scan and three DCE-CT scans prior to treatment. Cu-ATSM PET/CT and DCE-CT scans were registered and resampled to matching voxel dimensions. Kinetic analysis was performed on DCE-CT scans and for each patient, the resulting kinetic parameter values from the three DCE-CT scans were averaged together. Cu-ATSM SUVs were spatially correlated (r{sub spatial}) on a voxel-to-voxel basis against the following DCE-CT kinetic parameters: transit time (t{sub 1}), blood flow (F), vasculature fraction (v{sub 1}), and permeability (PS). In addition, whole-tumor comparisons were performed by correlating (r{sub ROI}) the mean Cu-ATSM SUV (SUV{sub mean}) with median kinetic parameter values. Results: The spatial correlations (r{sub spatial}) were poor and ranged from -0.04 to 0.21 for all kinetic parameters. These low spatial correlations may be due to high variability in the DCE-CT kinetic parameter voxel values between scans. In our hypothesis, t{sub 1} was expected to have a positive correlation, while F was expected to have a negative correlation to hypoxia. However, in wholetumor analysis the opposite was found for both t{sub 1} (r{sub ROI} = -0.25) and F (r{sub ROI} = 0.56). PS and v{sub 1} may depict angiogenic responses to hypoxia and found positive correlations to Cu-ATSM SUV for PS (r{sub ROI} = 0.41), and v{sub 1} (r{sub ROI} = 0.57). Conclusion: Low spatial correlations were found between Cu-ATSM uptake and DCE-CT vasculature parameters, implying that poor perfusion is not associated with higher hypoxic regions. Across patients, the most hypoxic tumors tended to have higher blood flow values, which is contrary to our initial hypothesis. Funding
Result of radiation therapy of sino-nasal cancers using partial attenuation filter
Energy Technology Data Exchange (ETDEWEB)
Kim, Jin Hee; Kim, Ok Bae; Choi, Tae Jin [Keimyung University College of Medicine, Daegu (Korea, Republic of)
2007-06-15
This study was to evaluate the survival and pattern of failure after radiation therapy of sino-nasal cancer using partial attenuation filer and wedged beams and to help radiotherapy planning of sino-nasal cancer. Between February 1992 and March 2003, 17 patients with sino-nasal cancers underwent radiation therapy using partial attenuation filter at Dongsan Medical Center, Keimyung university. There were 9 male and 8 female patients. Patients' age ranged from 40 to 75 years (median 59 years). There were 10 patients of maxillary sinus cancer, 7 patients of nasal cancer. The histologic type was squamous cell carcinoma in 11, adenoid cystic carcinoma in 4 and olfactory neuroblastoma in 2. The distribution of clinical stage by the AJCC system was 3 for stage II, 7 for III and 6 for IV. The five patients were treated with radiation alone and 12 patients were treated with surgery and postoperative radiation therapy. The range of total radiation dose delivered to the primary tumor was from 44 to 76 Gy (median 60 Gy). The follow-up period ranged from 3 to 173 months with median of 78 months. The overall 2 year survival rate and disease free survival rate was 76.4%. The 5 year and 10 year survival rate were 76.4% and 45.6% and the 5 year and 10 year disease free survival rate was 70.6%. The 5 year disease free survival rate by treatment modality was 91.6% for postoperative radiation group and 20% for radiation alone group, statistical significance was found by treatment modality ({rho} = 0.006). There were no differences in survival by pathology and stage. There were local failure in 5 patients (29%) but no distant failure and no severe complication required surgical intervention. Radiation therapy of sino-nasal cancer using partial attenuation filter was safe and effective. Combined modality with conservative surgery and radiation therapy was more advisable to achieve loco-regional control in sino-nasal cancer. Also we considered high precision radiation therapy with
International Nuclear Information System (INIS)
Milne, Stephen; Amis, Terence C; Wheatley, John R; Kairaitis, Kristina
2014-01-01
Nasal expiratory resistive valves (Provent ® ) have been proposed as novel therapy for obstructive sleep apnea. We compared pressure measurements from a standard nasal pressure catheter used to assess nasal airflow during sleep with those from nasal expiratory resistive device with attached proprietary nasal pressure cannula. Nasal pressure cannula or Provent ® + proprietary nasal pressure cannula were attached to a bench model of human anterior nares and nasal passages, and pressure measured (P). Respiratory airflows generated by a subject breathing were applied to rear of model and airflow ( V-dot ) measured via pneumotachograph. Airflow amplitude (Δ V-dot ) was plotted against pressure amplitude (ΔP). Hypopnoea detection (<50% Δ V-dot ) sensitivity and specificity was tested by expressing ΔP in terms of two reference breaths: reference breath 1, Δ V-dot 0.55 L s −1 = 100%; and reference breath 2, Δ V-dot 0.45 L s −1 = 100%. ΔP/Δ V-dot relationships were linear for Δ V-dot ≤ 0.55 L s −1 ; ΔP = 0.37ΔV + 0.16 (nasal pressure cannula), ΔP = 2.7ΔV + 0.12 (Provent ® + proprietary nasal pressure cannula); both R 2 > 0.65, p < 0.0001; p < 0.0001 for between slope difference). For nasal pressure cannula, specificity of hypopnoea detection differed between reference breaths one and two (80.2% and 40.0%, respectively), and Provent ® + proprietary nasal pressure cannula (30.3% and 74.2%, respectively). Quantification of airflow obstruction in the presence of Provent ® + proprietary nasal pressure cannula is greatly influenced by the reference breath chosen to determine a reduction in nasal airflow. Reported variability in therapeutic response to nasal expiratory resistive devices may relate to differences in measurement technique specificity used to quantify the severity of sleep disordered breathing. (paper)
Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia
2012-11-04
To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.
Directory of Open Access Journals (Sweden)
Annika Mohr
Full Text Available Immunohistochemistry (IHC is currently considered the method of choice for steroid hormone receptor status evaluation in human breast cancer and, therefore, it is commonly utilized for assessing canine mammary tumors. In case of low hormone receptor expression, IHC is limited and thus is complemented by molecular analyses. In the present study, a multiplex bDNA assay was evaluated as a method for hormone receptor gene expression detection in canine mammary tissues. Estrogen receptor (ESR1, progesterone receptor (PGR, prolactin receptor (PRLR and growth hormone receptor (GHR gene expressions were evaluated in neoplastic and non-neoplastic canine mammary tissues. A set of 119 fresh frozen and 180 formalin-fixed, paraffin-embedded (FFPE was comparatively analyzed and used for assay evaluation. Furthermore, a possible association between the hormone receptor expression in different histological subtypes of canine malignant mammary tumors and the castration status, breed and invasive growth of the tumor were analyzed. The multiplex bDNA assay proved to be more sensitive for fresh frozen specimens. Hormone receptor expression found was significantly decreased in malignant mammary tumors in comparison to non-neoplastic tissue and benign mammary tumors. Among the histological subtypes the lowest gene expression levels of ESR1, PGR and PRLR were found in solid, anaplastic and ductal carcinomas. In summary, the evaluation showed that the measurement of hormone receptors with the multiplex bDNA assay represents a practicable method for obtaining detailed quantitative information about gene expression in canine mammary tissue for future studies. Still, comparison with IHC or quantitative real-time PCR is needed for further validation of the present method.
Osteocalcin and Osteonectin Expression in Canine Osteosarcoma.
Wehrle-Martinez, A S; Dittmer, K E; Aberdein, D; Thompson, K G
2016-07-01
Osteosarcoma (OSA) is a malignant heterogeneous primary bone tumor responsible for up to 90% of all primary bone tumors in dogs. In this study, osteocalcin (OC) and osteonectin (ON) immunoreactivity was evaluated in 23 canine OSAs, 4 chondrosarcomas, 4 fibrosarcomas, 2 hemangiosarcomas, and 4 histiocytic sarcomas. The effects of three different decalcification agents (ethylenediaminetetraetic acid [EDTA], formic acid and hydrochloric acid [HCl]) on the immunoreactivity for OC and ON was also assessed. Immunoreactivity to OC was present in 19/23 (83%) cases of OSA and all cases of chondrosarcoma. In three OSAs the extracellular matrix showed immunoreactivity to OC. None of the fibrosarcomas, histiocytic sarcomas or hemangiosarcomas showed immunoreactivity to OC. The sensitivity and specificity for OC in canine OSA in this study was 83% and 71% respectively. For ON, 100% of both OSAs (23/23) and non-OSAs (14/14) showed cytoplasmic immunoreactivity to this antibody, giving a sensitivity of 100% but a complete lack of specificity. There were no significant differences in immunoreactivity for OC and ON between the different decalcification agents used. In conclusion, OC showed high sensitivity for identifying OSA but it failed to distinguish between OSA and chondrosarcoma, and the osteoid produced by neoplastic cells in most cases did not show immunoreactivity to OC. These factors may limit the practical utility of OC in the diagnosis of OSA in dogs when chondrosarcoma is a differential diagnosis. ON showed no specificity in detecting OSA and has little practical application for the diagnosis of OSA in dogs. © The Author(s) 2016.
Distilled water nasal provocation in hyperreactive patients.
Baudoin, T; Anzic, S A; Kalogjera, L
1999-01-01
Nonisotonic aerosol may act as a provocation agent in the upper and lower airways of hyperreactive individuals. The purpose of the study was to compare the results of nasal challenge with distilled water in patients with allergic rhinitis to those with noninfective nonallergic rhinitis (NINAR), with respect to the potential clinical use of the obtained data. A group of 68 ambulatory patients with allergic rhinitis or NINAR (39 perennial allergic, 6 seasonal, 23 NINAR) were challenged with 10 mL of distilled water aerosol after the baseline active anterior rhinomanometry. Patients with nasal polyposis at endoscopy, significant unilateral septal deviation, positive bacteriologic swab, recent nasal surgery, and uncertain anamnestic data about the medication taken 6 weeks before the provocation were excluded from the study. After 10 minutes of nasal provocation, rhinomanometry was repeated to assess the response. In 15 patients of the perennial allergic group, the same measurements were performed after a 2-week oral antihistamine and topical steroid therapy. Nasal resistance was significantly increased on the more patent side of the nose after nasal provocation with distilled water aerosol in allergic patients in comparison to the nasal resistance before provocation. In the patients with NINAR, the provocation resulted in a significant rise on the more patent side, but the total nasal airway resistance (NAR) levels were also significantly increased. The systemic antihistamine and topical steroid 2-week therapy in patients with perennial allergic rhinitis significantly reduced the response to nasal distilled water provocation. Nasal provocation with distilled water aerosol is a cheap, simple, and acceptable method that provides useful clinical data on the level of nonspecific nasal hyperreactivity and the therapy success.
Directory of Open Access Journals (Sweden)
Jennifer Ann Foltz
2016-11-01
Full Text Available Canines spontaneously develop many cancers similar to humans - including osteosarcoma, leukemia, and lymphoma - offering the opportunity to study immune therapies in a genetically heterogeneous and immunocompetent environment. However, a lack of antibodies recognizing canine NK cell markers has resulted in suboptimal characterization and unknown purity of NK cell products, hindering the development of canine models of NK cell adoptive immunotherapy. To this end, we generated a novel antibody to canine NCR1 (NKp46, the putative species-wide marker of NK cells, enabling purification of NK cells for further characterization. We demonstrate that CD3-/NKp46+ cells in healthy and osteosarcoma-bearing canines have phenotypic similarity to human CD3-/NKp46+ NK cells, expressing mRNA for CD16 and the natural cytotoxicity receptors NKp30, NKp44, and NKp80. Functionally, we demonstrate with the calcein release assay that canine CD3-/NKp46+ cells kill canine tumor cell lines without prior sensitization and secrete IFN-γ, TNF-α, IL-8, IL-10, and GM-CSF as measured by Luminex. Like human NK cells, CD3-/NKp46+ cells expand rapidly on feeder cells expressing 4-1BBL and membrane-bound IL-21 (median= 20,283-fold in 21 days. Further, we identify a minor Null population (CD3-/CD21-/CD14-/NKp46- with reduced cytotoxicity against osteosarcoma cells, but similar cytokine secretion as CD3-/NKp46+ cells. Null cells in canines and humans have reduced expression of NKG2D, NKp44, and CD16 compared to NKp46+ NK cells, and can be induced to express NKp46 with further expansion on feeder cells. In conclusion, we have identified and characterized canine NK cells, including an NKp46- subset of canine and human NK cells, using a novel anti-canine NKp46 antibody, and report robust ex vivo expansion of canine NK cells sufficient for adoptive immunotherapy.
International Nuclear Information System (INIS)
Kleiter, Miriam M.; Thrall, Donald E.; Malarkey, David E.; Ji Xiaoshen; Lee, David Y.W.; Chou, S.-C.; Raleigh, James A.
2006-01-01
Purpose: Pimonidazole HCl is widely used in immunohistochemical analyses of hypoxia in normal and malignant tissues. The present study investigates oral administration as a means of minimizing invasiveness. Methods and Materials: Twelve dogs with confirmed malignancy received 0.5 g/m 2 of pimonidazole HCl: 6 by mouth and 6 by i.v. infusion. All dogs received i.v. CCI-103F as a control. Plasma levels of pimonidazole, pimonidazole N-oxide, and CCI-103F were measured. Tumor biopsies were formalin fixed, paraffin embedded, sectioned, immunostained, and analyzed for pimonidazole and CCI-103F binding. pH dependence for pimonidazole and CCI-103F binding was studied in vitro. Results: Pimonidazole and CCI-103F binding in carcinomas and sarcomas was strongly correlated for both oral and i.v. pimonidazole HCl (r 2 = 0.97). On average, the extent of pimonidazole binding exceeded that for CCI-103F by a factor of approximately 1.2, with the factor ranging from 1.0 to 1.65. Binding of both markers was pH dependent, but pimonidazole binding was greater at all values of pH. Conclusions: Oral pimonidazole HCl is effective as a hypoxia marker in spontaneously arising canine tumors. Selective cellular uptake and concomitant higher levels of binding in regions of hypoxia at the high end of pH gradients might account for the greater extent of pimonidazole binding
Directory of Open Access Journals (Sweden)
D. Wang
1995-01-01
Full Text Available In this prospective study, a quantitative determination of histamine and tryptase in nasal secretions after nasal phosphate buffered saline (PBS and allergen challenge was performed in 18 atopic patients who were compared with ten non-allergic healthy volunteers. The aim of the study was to determine the normal and pathological concentrations of these important mediators in nasal secretions. The second objective was to test the relevance of these two mast cell secreted mediators after nasal challenge. Results showed that the concentrations of tryptase in almost all samples were under the minimal detection limit (< 0.5 μU/g and only a sigrtificant increase of tryptase (median, 28 μU/g occurred immediately after nasal allergen challenge in the patient group. Histamine concentration significantly increased after every nasal PBS challenge (median, 69 ng/g after first PBS challenge and 165 ng/g after second PBS challenge in the control group, as well as in the patient group after both PBS (median, 69 ng/g and allergen (median, 214 ng/g challenge. On the other hand, a rapid onset of sneezing and increase in nasal airway resistance was experienced only in the patient group after nasal allergen challenge, but did not occur after PBS challenge even though the histamine concentrations significantly increased in both groups. This study suggests that tryptase is a more preferable marker than histamine in quantitative monitoring of mast cell activation especially during the early phase nasal allergic reaction.
Pathologic and Molecular Virologic Characterization of a Canine Distemper Outbreak in Farmed Civets.
Techangamsuwan, S; Banlunara, W; Radtanakatikanon, A; Sommanustweechai, A; Siriaroonrat, B; Lombardini, E D; Rungsipipat, A
2015-07-01
In October 2011, a fatal disease outbreak occurred in 3 civet species farmed for their use in the coffee industry in Thailand. The disease quickly killed 20 animals in a mixed population of Asian palm civets (Paradoxurus hermaphroditus; n = 18), a masked palm civet (Paguma larvata; n = 1), and small Indian civet (Viverricula indica; n = 1). Clinical signs consisted of severe lethargy, weakness, vomiting, and diarrhea with associated dehydration, dyspnea, nasal and footpad hyperkeratosis, and seizures. All civets were positive for canine morbillivirus using the commercial canine distemper virus (CDV) antigen test kit. Consistently observed necropsy findings consisted of severe pneumonia and hemorrhagic enteritis. Microscopic examination revealed severe gastroenteritis, bronchointerstitial pneumonia, lymphadenitis, necrotizing dermatitis, nonsuppurative polioencephalitis, and characteristic intranuclear/intracytoplasmic eosinophilic viral inclusions in multiple tissues. Immunohistochemical analysis revealed immunoreactivity of varying intensity, while virus isolation demonstrated typical cytopathic effects. To confirm CDV infection, reverse transcription-polymerase chain reaction against fusion (F), phosphoprotein (P), and hemagglutinin (H) genes showed bands of expected size using conjunctival swabs (9 civets, 1 dog [Canis lupus familiaris] living on the farm). Phylogenetic analyses and restriction fragment length polymorphism results indicated that the civets were infected by the Asia-1 strain of CDV commonly found in dogs in Thailand. The deduced amino acid sequences of the signaling lymphocyte activation molecule binding region of the CDV-H proteins revealed a Y549H mutation in both CDV-infected Asian palm civets (n = 4) and a co-located dog. We report a canine distemper outbreak in a civet colony with lineage classification and a Y549H mutation in noncanid species in Thailand. © The Author(s) 2014.
International Nuclear Information System (INIS)
Monticello, T.M.; Morgan, K.T.
1990-01-01
Formaldehyde (HCHO), a ubiquitous chemical and rat nasal carcinogen, enhances cell proliferation in rat, monkey, and xenotransplanted human respiratory epithelium following short-term exposure. The present studies were designed to evaluate cell proliferation in relation to tumor induction in rat nasal respiratory epithelium following subchronic HCHO exposure. Male F-344 rats were whole-body exposed to either 0, 0.7, 2, 6, 10, or 15 ppm HCHO, for wither 4 d (6hr/d), 6 wks (5d/wk) or 3 months. Animals were labeled with tritiated thymidine prior to euthanasia. Nasal sections were processed for autoradiography and cell proliferation data was expressed as unit length labeling indices (ULLI). HCHO-induced lesions and increases in cell proliferation occurred in specific regions of the nose, primarily the wall of the lateral meatus and nasal septum of the anterior nasal cavity. Following 4 d exposure, significant elevations in cell proliferation were observed only in the 6, 10 and 15 ppm groups (16-, 18-, and 20-fold increase over control, respectively). Increases in ULLI were also present in the 6, 10 and 15 ppm groups after 6 wks of exposure (12-, 35-, and 40-fold increase over control). However, after 3 months exposure, elevations in ULLI were present only in the 10 and 15 ppm groups (9- and 14-fold increase over controls). These results demonstrate that (1) low levels of HCHO (0.7 and 2 ppm) do not increase cell proliferation in rat nasal respiratory epithelium; (2) 6 ppm HCHO induces transient increases in cell proliferation; and (3) clearly carcinogenic concentrations of HCHO (10 and 15 ppm) cause sustained elevations in cell proliferation which may play an important role in HCHO-induced carcinogenesis
Lobular Capillary Hemangioma of the Nasal Cavity: A Retrospective Study of 15 Cases in Taiwan
Directory of Open Access Journals (Sweden)
Tzu-Hang Chi Chi
2014-03-01
Full Text Available Background: Lobular capillary hemangioma of the nasal cavity is an uncommon benign vascular tumor of unknown etiology. There have been only very few case reports in Taiwan. Aims: This study aimed to analyze the clinical features, radiological findings, treatment modalities, and outcome of lobular capillary hemangioma treated at a teaching hospital in Taiwan during a period of 10 years. Study Design: Descriptive study. Methods: Retrospective chart reviews were performed on patients who were diagnosed with lobular capillary hemangioma of the nasal cavity at Kaohsiung Armed Forces General Hospital, Kaohsiung, Taiwan, from January 2003 to December 2012. Data retrieved included age, gender, clinical symptoms, computed tomography (CT findings, treatment modalities, and outcome for further analysis. Results: Of the 15 patients identified, there were five males and ten females ranging from 17 to 86 years of age, with a mean age of 43.8±20.2. Epistaxis was the most common presenting symptom. All patients presented a unilateral nasal lobular capillary hemangioma. The most commonly affected site was the anterior nasal septum, followed by the inferior turbinate, vestibule, middle turbinate, and posterior nasal septum. All lesions presented as soft tissue density without bony erosions under CT examination. Endoscopic excisional surgery (n=12 or classical local excision (n=3 was performed for complete removal of the hemangioma. No evidence of recurrence was observed with 6 to 75 months of follow-up. Conclusion: Lobular capillary hemangioma of the nasal cavity was usually found to occur in anterior septum with epistaxis. Complete excision with endoscopic surgery or classical local excision was recommended and recurrence can be prevented.
Sonography for diagnosis of benign and malignant tumors of the nose and paranasal sinuses.
Liu, Jun-jie; Gao, Yong; Wu, Ya-Fei; Zhu, Shang-Yong
2014-09-01
The purpose of this study was to demonstrate the reliability of sonography for diagnosis of nose and paranasal sinus tumors. Ninety-six consecutive patients with tumors underwent sonography and computed tomography (CT) before surgical treatment. Tumor detectability and imaging findings were evaluated independently and then compared with pathologic findings. Of 96 tumors, 75 were detected by sonography, for a detectability rate of 78.1%; 93 tumors were detected by CT, for a detectability rate of 96.9%. By comparison, sonography showed a trend toward higher detectability of nasal vestibular tumors than CT (87.5% for sonography versus 50.0% for CT) and small lumps on the wing of the nose (78.8% for sonography versus 33.3% for CT). Among the sonographic features, boundary, shape, internal echo, calcification, bone invasion, vascular pattern, and cervical lymph node metastasis all had significantly positive correlations with malignancy (P benign and malignant tumors of the nose and paranasal sinuses. Consequently, sonography has high value for diagnosis of benign and malignant tumors of the nose and paranasal sinuses, especially for nasal vestibular tumors and small lumps on the wing of the nose. © 2014 by the American Institute of Ultrasound in Medicine.
2013-01-01
Background Tumor-associated macrophages (TAMs) have high impact on the cancer development because they can facilitate matrix invasion, angiogenesis, and tumor cell motility. It gives cancer cells the capacity to invade normal tissues and metastasize. The signaling of colony-stimulating factor-1 receptor (CSF-1R) which is an important regulator of proliferation and differentiation of monocytes and macrophages regulates most of the tissue macrophages. However, CSF-1R is expressed also in breast epithelial tissue during some physiological stages i.g.: pregnancy and lactation. Its expression has been also detected in various cancers. Our previous study has showed the expression of CSF-1R in all examined canine mammary tumors. Moreover, it strongly correlated with grade of malignancy and ability to metastasis. This study was therefore designed to characterize the role of CSF-1R in canine mammary cancer cells proliferation, apoptosis, migration, and invasion. As far as we know, the study presented hereby is a pioneering experiment in this field of veterinary medicine. Results We showed that csf-1r silencing significantly increased apoptosis (Annexin V test), decreased proliferation (measured as Ki67 expression) and decreased migration (“wound healing” assay) of canine mammary cancer cells. Treatment of these cells with CSF-1 caused opposite effect. Moreover, csf-1r knock-down changed growth characteristics of highly invasive cell lines on Matrigel matrix, and significantly decreased the ability of these cells to invade matrix. CSF-1 treatment increased invasion of cancer cells. Conclusion The evidence of the expression and functional role of the CSF-1R in canine mammary cancer cells indicate that CSF-1R targeting may be a good therapeutic approach. PMID:23561040
EGFR, HER-2 and KRAS in canine gastric epithelial tumors: a potential human model?
Directory of Open Access Journals (Sweden)
Rossella Terragni
Full Text Available Epidermal growth factor receptor (EGFR or HER-1 and its analog c-erbB-2 (HER-2 are protein tyrosine kinases correlated with prognosis and response to therapy in a variety of human cancers. KRAS mediates the transduction of signals between EGFR and the nucleus, and its mutation has been identified as a predictor of resistance to anti-EGFR drugs. In human oncology, the importance of the EGFR/HER-2/KRAS signalling pathway in gastric cancer is well established, and HER-2 testing is required before initiating therapy. Conversely, this pathway has never been investigated in canine gastric tumours. A total of 19 canine gastric epithelial neoplasms (5 adenomas and 14 carcinomas were retrospectively evaluated for EGFR/HER-2 immunohistochemical expression and KRAS mutational status. Five (35.7% carcinomas were classified as intestinal-type and 9 (64.3% as diffuse-type. EGFR was overexpressed (≥ 1+ in 8 (42.1% cases and HER-2 (3+ in 11 (57.9% cases, regardless of tumour location or biological behaviour. The percentage of EGFR-positive tumours was significantly higher in the intestinal-type (80% than in the diffuse-type (11.1%, p = 0.023. KRAS gene was wild type in 18 cases, whereas one mucinous carcinoma harboured a point mutation at codon 12 (G12R. EGFR and HER-2 may be promising prognostic and therapeutic targets in canine gastric epithelial neoplasms. The potential presence of KRAS mutation should be taken into account as a possible mechanism of drug resistance. Further studies are necessary to evaluate the role of dog as a model for human gastric cancer.
Directory of Open Access Journals (Sweden)
Henrik Gutte
2015-06-01
Full Text Available In this communication the mismatch between simultaneous 18F-FDG-PET and a 13C-lactate imaging (hyperPET in a biopsy verified squamous cell carcinoma in the right tonsil of a canine cancer patient is shown. The results demonstrate that 18F-FDG-PET may not always reflect the Warburg effect in all tumors.
York, Dan; Higgins, Robert J.; LeCouteur, Richard A.; Joshi, Nikhil; Bannasch, Danika
2016-01-01
Spontaneous gliomas in dogs occur at a frequency similar to that in humans and may provide a translational model for therapeutic development and comparative biological investigations. Copy number alterations in 38 canine gliomas, including diffuse astrocytomas, glioblastomas, oligodendrogliomas, and mixed oligoastrocytomas, were defined using an Illumina 170K single nucleotide polymorphism array. Highly recurrent alterations were seen in up to 85% of some tumor types, most notably involving chromosomes 13, 22, and 38, and gliomas clustered into 2 major groups consisting of high-grade IV astrocytomas, or oligodendrogliomas and other tumors. Tumor types were characterized by specific broad and focal chromosomal events including focal loss of the INK4A/B locus in glioblastoma and loss of the RB1 gene and amplification of the PDGFRA gene in oligodendrogliomas. Genes associated with the 3 critical pathways in human high-grade gliomas (TP53, RB1, and RTK/RAS/PI3K) were frequently associated with canine aberrations. Analysis of oligodendrogliomas revealed regions of chromosomal losses syntenic to human 1p involving tumor suppressor genes, such as CDKN2C, as well as genes associated with apoptosis, autophagy, and response to chemotherapy and radiation. Analysis of high frequency chromosomal aberrations with respect to human orthologues may provide insight into both novel and common pathways in gliomagenesis and response to therapy. PMID:27251041
DEFF Research Database (Denmark)
Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold
2014-01-01
BACKGROUND: Measurement of C-reactive protein (CRP) is used for diagnosing and monitoring systemic inflammatory disease in canine patients. An automated human immunoturbidimetric assay has been validated for measuring canine CRP, but cross-reactivity with canine CRP is unpredictable. OBJECTIVE......: The purpose of the study was to validate a new automated canine-specific immunoturbidimetric CRP method (Gentian cCRP). METHODS: Studies of imprecision, accuracy, prozone effect, interference, limit of quantification, and stability under different storage conditions were performed. The new method was compared...... with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was
Primary nasal tuberculosis following blunt trauma nose
Directory of Open Access Journals (Sweden)
Kaushik Saha
2014-01-01
Full Text Available Primary nasal tuberculosis is a rare disease with nearly 40 cases reported. Our patient was a young male presented with left sided nasal obstruction, anosmia and occasional epistaxis for last 7 weeks after 6 months of blunt trauma nose. Contrast enhanced computed tomography of the para nasal sinuses showed increased soft-tissue density with contrast enhancement in the left maxillary antrum with extension through left osteomeatal foramen to the left nasal cavity along with further extension through choana to nasopharynx resulting in partial obliteration of the nasopharyngeal airway. Nasal endoscopy revealed a sessile polypoidal pinkish mass arising from the left osteomeatal foramen. Histopathological examination of excisional biopsy of that area showed caseating granuloma. Our patient diagnosed as primary nasal tuberculosis following trauma and treated with anti-tubercular chemotherapy.
Ramsay, Edward; Sadler, Ryan; Rush, Robert; Seimon, Tracie; Tomaszewicz, Ania; Fleetwood, Ellen A; McAloose, Denise; Wilkes, Rebecca P
2016-06-01
Three methods for delivering a live attenuated canine distemper virus (CDV) vaccine to domestic cats ( Felis catus ) were investigated, as models for developing vaccination protocols for tigers (Panthera tigris). Twenty domestic cats were randomly divided into four treatment groups: saline injection (negative controls); and oral, intranasal, and subcutaneous vaccinates. Cats were injected with saline or a CDV vaccine (Nobivac DP, Merck) at wk 0 and 4. Blood and nasal swabs were collected at wk 0 (prior to the initial vaccination) and weekly thereafter for 9 wk. Urine samples were collected on wk 1 to 9 after initial vaccination. Forty-nine weeks following the initial vaccination series, three cats from the subcutaneous group and three cats from the intranasal group were revaccinated. Blood was collected immediately prior, and 7 and 21 days subsequent to revaccination. Nasal swabs and urine samples were collected from each cat prior to wk 49 revaccination and daily for 7 days thereafter. Nasal swabs and urine were analyzed by quantitative PCR for vaccine virus presence. Sera were tested for CDV antibodies by virus neutralization. All cats were sero-negative for CDV antibodies at the beginning of the study, and saline-injected cats remained sero-negative throughout the study. A dramatic anamnestic response was seen following wk 4 subcutaneous vaccinations, with titers peaking at wk 6 (geometric mean = 2,435.5). Following wk 49 revaccination, subcutaneous vaccinates again mounted impressive titers (wk 52 geometric mean = 2,048). Revaccination of the intranasal group cats at wk 49 produced a small increase in titers (wk 52 geometric mean = 203). CDV viral RNA was detected in six nasal swabs but no urine samples, demonstrating low viral shedding postvaccination. The strong antibody response to subcutaneous vaccination and the lack of adverse effects suggest this vaccine is safe and potentially protective against CDV infection in domestic cats.
Canine osteosarcoma: a naturally occurring disease to inform pediatric oncology.
Fenger, Joelle M; London, Cheryl A; Kisseberth, William C
2014-01-01
Osteosarcoma (OSA) is the most common form of malignant bone cancer in children and dogs, although the disease occurs in dogs approximately 10 times more frequently than in people. Multidrug chemotherapy and aggressive surgical techniques have improved survival; however, new therapies for OSA are critical, as little improvement in survival times has been achieved in either dogs or people over the past 15 years, even with significant efforts directed at the incorporation of novel therapeutic approaches. Both clinical and molecular evidence suggests that human and canine OSA share many key features, including tumor location, presence of microscopic metastatic disease at diagnosis, development of chemotherapy-resistant metastases, and altered expression/activation of several proteins (e.g. Met, ezrin, phosphatase and tensin homolog, signal transducer and activator of transcription 3), and p53 mutations, among others. Additionally, canine and pediatric OSA exhibit overlapping transcriptional profiles and shared DNA copy number aberrations, supporting the notion that these diseases are similar at the molecular level. This review will discuss the similarities between pediatric and canine OSA with regard to histology, biologic behavior, and molecular genetic alterations that indicate canine OSA is a relevant, spontaneous, large animal model of the pediatric disease and outline how the study of naturally occurring OSA in dogs will offer additional insights into the biology and future treatment of this disease in both children and dogs. © The Author 2014. Published by Oxford University Press on behalf of the Institute for Laboratory Animal Research. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Nasal Drug Delivery in Traditional Persian Medicine
Zarshenas, Mohammad Mehdi; Zargaran, Arman; Müller, Johannes; Mohagheghzadeh, Abdolali
2013-01-01
Background Over one hundred different pharmaceutical dosage forms have been recorded in literatures of Traditional Persian Medicine among which nasal forms are considerable. Objectives This study designed to derive the most often applied nasal dosage forms together with those brief clinical administrations. Materials and Methods In the current study remaining pharmaceutical manuscripts of Persia during 9th to 18th century AD have been studied and different dosage forms related to nasal application of herbal medicines and their therapeutic effects were derived. Results By searching through pharmaceutical manuscripts of medieval Persia, different nasal dosage forms involving eleven types related to three main groups are found. These types could be derived from powder, solution or liquid and gaseous forms. Gaseous form were classified into fumigation (Bakhoor), vapor bath (Enkebab), inhalation (Lakhlakheh), aroma agents (Ghalieh) and olfaction or smell (Shomoom). Nasal solutions were as drops (Ghatoor), nasal snuffing drops (Saoot) and liquid snuff formulations (Noshoogh). Powders were as nasal insufflation or snorting agents (Nofookh) and errhine or sternutator medicine (Otoos). Nasal forms were not applied only for local purposes. Rather systemic disorders and specially CNS complications were said to be a target for these dosage forms. Discussion While this novel type of drug delivery is known as a suitable substitute for oral and parenteral administration, it was well accepted and extensively mentioned in Persian medical and pharmaceutical manuscripts and other traditional systems of medicine as well. Accordingly, medieval pharmaceutical standpoints on nasal dosage forms could still be an interesting subject of study. Therefore, the current work can briefly show the pharmaceutical knowledge on nasal formulations in medieval Persia and clarify a part of history of traditional Persian pharmacy. PMID:24624204
Spectral features of nasals in Standard Latvian
Directory of Open Access Journals (Sweden)
Jana Taperte
2015-12-01
Full Text Available In the article, the acoustic features of nasals in Standard Latvian are investigated. The aim of the study is to examine whether some of the spectral properties of nasal murmur (namely anti-formant frequency, as well as frequency and bandwidth of the first nasal formant can be considered as efficient cues for distinguishing between nasal places of articulation.Speech recordings from 10 native speakers of Standard Latvian, five male and five female, aged 19–39, without any disorders or dialectal traces in their pronunciation, were used for the analysis. Prevocalic nasals [m; n; ɲ] were analyzed in isolated CVC syllables, where C is one of the nasals and V is one of the vowels [i(ː; e(ː; æ(ː; ɑ(ː; ɔ(ː; u(ː]. The velar [ŋ] — the allophone of the phoneme /n/ — was recorded in postvocalic position in [k]V[ŋks] structure units. 1260 items were analyzed in total.According to the results, the nasals of Standard Latvian can be distinguished by anti-formant frequencies rather efficiently, and the results generally agree with those obtained in previous research of Latvian as well as data reported for other languages. The frequencies and the bandwidths of the first nasal formant are less informative regarding nasal place of articulation and can be used only for distinguishing between [ŋ] and [m; n; ɲ]. Conducting perception tests to assess the auditory relevance of these acoustic features is necessary.
Nasal Septum Perforation due to Methamphetamine abuse
Directory of Open Access Journals (Sweden)
Mehdi Bakhshaee
2012-07-01
Full Text Available Introduction: Spontaneous Perforation of the nasal septum is an uncommon condition. Nasal inhalation of substances such as cocaine has long been linked to this Perforation. Case Report: This report describes the case of a 46-year-old woman who was addicted to methamphetamine and who presented with perforation of the nasal septum.This is the first reported case of nasal septal necrosis linked to nasal inhalation of methamphetamine. Conclusions: Patient history and assurance regardingillegal drug consumption and abuse is a key point for fast and accurate diagnosis. The pathophysiology of drug-induced sinunasal disease and a review of the literature are also presented.
Nasal birth trauma: a review of appropriate treatment.
LENUS (Irish Health Repository)
Cashman, E C
2012-02-01
The aetiology of nasal deformity has frequently included birth trauma. There is no consensus in the literature as to whether nasal surgery, in the form of closed reduction, is indicated in neonates. The majority of studies in the literature that advocate intervention have inadequate followup periods and there is a paucity of evidence for the adverse effects of conservative management. This case highlights the therapeutic dilemma posed by such nasal injuries in the neonate and, to the best of the authors\\' knowledge, at the time of writing, represents the earliest reported case in the literature of nasal deformity in the neonate. The term nasal deformity is used to denote deformity of the nasal pyramid, soft tissue, and septum. Three main aspects of neonatal nasal deformity are addressed including, firstly, if nasal deformity at birth needs to be addressed, secondly, if left unaltered, what the long-term effects are and, finally, if intervention alters the normal course of midfacial development.
ANTHROPOMETRIC STUDY OF NASAL INDEX OF EGYPTIANS
Abdelmonem Awad Hegazy
2014-01-01
Background: The nasal index determination is one of the most commonly used anthropometric parameters in classifying human races. There are few reports in medical literature concerning nasal index that specifically address particular Egyptian populations. The objective of this study was to determine the normal parameters of external nose (width, height and nasal index) in Egyptians. Methods: The study was conducted randomly on healthy Egyptian subjects of both sexes. Nasal height and width ...
Directory of Open Access Journals (Sweden)
F.G.A. Santos
2001-10-01
Full Text Available Fragmentos de tumor venéreo transmissível canino (TVTC de ocorrência natural, com localização genital, foram obtidos de cinco animais, machos, adultos, sem raça definida. "Imprints" da superfície de corte em lâmina de microscopia foram fixadas em metanol, coradas pelo Giemsa e submetidas à avaliação citológica. Os fragmentos foram fixados e processados rotineiramente para inclusão em parafina e coloração com HE e Shorr, para confirmação histológica do tumor e identificação da apoptose. Outros fragmentos foram envolvidos com papel alumínio e acondicionados dentro de frascos de vidro em gelo seco, para serem processados no mesmo dia, visando à extração de DNA e eletroforese em gel de agarose. Análises cito e histológica do TVTC mostraram a distribuição e o padrão celular e tecidual característicos dessa neoplasia, sobressaindo-se a presença de vacúolos claros, bem definidos no citoplasma à análise citológica. Pela coloração com Shorr pôde-se identificar células retraídas, com aumento da acidofilia citoplasmática e condensação da cromatina nuclear, às vezes com fragmentação do núcleo e das células, caracterizando apoptose. A coloração pelo Shorr mostrou ser mais eficiente na distinção de células apoptóticas do que a coloração por HE. A eletroforese de DNA em gel de agarose demonstrou a fragmentação internucleossômica do genoma, que pôde ser reconhecida pelo clássico "padrão em escada".Fragments of canine transmissible venereal tumors, from natural cases and genital localization, were obtained from five adult male mongrel dogs. Imprints of the tumors were fixed, stained by Giemsa and submitted to cytological analysis to confirm the diagnosis. Representative samples of the tumoral tissue were fixed, embedded in paraffin and processed routinely for microscopic examination. Sections were stained with hematoxylin - eosin and Shorr. Another set of fragments was packed and maintained in dry ice
Larson, L J; Schultz, R D
2007-01-01
A group of client-owned dogs and a group of dogs at a commercial kennel were evaluated for duration of antibody responses against canine parvovirus type 2 (CPV-2) and canine adenovirus type 1 (CAV-1) after receiving a combination vaccine containing recombinant canarypox-vectored canine distemper virus (CDV) and modified-live CPV-2, CAV-2, and canine parainfluenza virus, with (C6) or without (C4) two serovars of Leptospira (Recombitek C4 or C6, Merial). Duration of antibody, which correlates with protective immunity, was found to be at least 36 months in both groups. Recombitek combination vaccines can confidently be given every 3 years with assurance of protection in immunocompetent dogs against CPV-2 and CAV-1 as well as CDV. This allows this combination vaccine, like other, similar modified- live virus combination products containing CDV, CAV-2, and CPV-2, to be administered in accordance with the recommendations of the American Animal Hospital Association Canine Vaccine Task Force.
Expression of Bcl-2 in canine osteosarcoma
Directory of Open Access Journals (Sweden)
F. Piro
2015-03-01
Full Text Available Osteosarcoma (OS is the most common primary malignancy of bone. It is responsible for 80-85% of the primary bone tumors affecting dogs and it is characterized by aggressive and invasive behavior, with a high metastatic potential. Several studies on cancer and related tumorigenesis, show an involvement of the mechanisms of programmed cell death and cell survival. Many signals seem to be involved in the related mechanism of autophagy and in particular, our interest is focused on the expression of a family of Bcl-2 that seems to be involved either in the control of biomolecular mechanisms like autophagy and apoptosis. In this study we investigated the expression of Bcl-2 in different cases of spontaneous canine osteosarcoma and the related preliminary results are described. We found Bcl-2 activity was increased in OS tissue compared to normal bone tissue. These results suggested that Bcl-2 activity may play an important role in the formation of OS and as a diagnostic for neoplastic activity. However, further research is needed to confirm the role of Bcl-2 activity in OS in canines.
Directory of Open Access Journals (Sweden)
Fabíola Maria Gomes de Melo
2007-09-01
Full Text Available OBJETIVO: identificar a modificação da aeração nasal após a realização de manobras de massagem e limpeza nasal. MÉTODOS: vinte crianças na faixa etária de quatro a onze anos com diagnóstico de rinite alérgica foram submetidas à avaliação da aeração nasal com o auxílio do espelho milimetrado de Altmann. Inicialmente houve a marcação do ar expirado na placa metálica, posteriormente foram realizadas manobras de massagem e limpeza nasal para retirada da secreção, havendo uma nova marcação para a comparação dos resultados. Foi aplicado o teste Kolmogorov-Smirnov para observar a suposição de normalidade dos dados e o teste t-student para amostras pareadas, sendo todas as conclusões tomadas ao nível de significância de 5%. RESULTADOS: pode-se observar que as médias obtidas da quantificação da aeração nasal após as manipulações e limpeza na região foram significativas pPURPOSE: to identify the modification of nasal aeration after the accomplishment of maneuvers of massage and nasal cleanness. METHODS: twenty children aging from four to eleven years with diagnosis of allergic rhinitis have been submitted to evaluation of nasal aeration with the Altmann's milimetric mirror. Initially, we was marked the air exhaled on the metallic plate, afterwards we made a massage and nasal cleanness for removing of the secretion, having a new benchmark to compare the results. Kolmogorov-Smirnov test was applied to test the assumption of normality for the data and t-student test for paired samples. All conclusions were taken under 5% significance. RESULTS: it was observed that the obtained averages of the nasal aeration after the manipulations and cleanness in the region were significant: p<0,001. CONCLUSION: from the results obtained in this research it was possible to observe a significant increase in the nasal aeration after the massage and nasal cleanness.
Directory of Open Access Journals (Sweden)
Anna McRee
2014-09-01
Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A
2014-09-05
Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
Webb, Craig; Twedt, David C
2003-09-01
Gastritis--inflammation of the stomach--is a frequently cited differential yet rarely characterized diagnosis in cases of canine anorexia and vomiting. Although the list of rule-outs for acute or chronic gastritis is extensive, a review of the veterinary literature reveals fewer than 15 articles that have focused on clinical cases of canine gastritis over the last 25 years. The dog frequently appears in the human literature as an experimentally manipulated model for the study of endoscopic techniques or the effect of medications on gastric mucosa. In the veterinary patient, cases of acute gastritis are rarely pursued with the complete diagnostic armamentarium, and cases of chronic gastritis are rarely found to occur as an entity isolated from the rest of the gastrointestinal tract. This article focuses on those findings most clinically relevant to cases of canine gastritis in veterinary medicine.
Varied clinico-radiological presentations of transmigrated canines
Directory of Open Access Journals (Sweden)
Ishita Gupta
2015-01-01
Full Text Available Canine is one of the most commonly impacted teeth in the dental arch. An unerupted permanent canine crossing the midline is called transmigration and is an unusual event. We report nine cases of impacted canine transmigration. Maxillary canine transmigration, bilateral transmigration, and transmigration associated with odontoma are rare presentations. This article discusses the varied clinico-radiologic presentations, etiology, and treatment options of transmigration. It also emphasizes the importance of panoramic radiographs for evaluation of over-retained deciduous canines or missing permanent canines.
The immunotherapy of canine osteosarcoma: a historical and systematic review.
Wycislo, K L; Fan, T M
2015-01-01
Osteosarcoma is a malignant mesenchymal neoplasm that accounts for the majority of primary bone tumors in dogs and shares biological and clinical similarities with osteosarcoma in humans. Despite dose intensification with conventional cytotoxic therapies, survival times for dogs and humans diagnosed with high-grade osteosarcoma have not changed in the past 20 years, with the principal cause of mortality being the development of pulmonary metastases. Given the therapeutic plateau reached for delaying metastatic progression with cytotoxic agents, exploration of alterative adjuvant therapies for improving management of osteosarcoma micrometastases is clinically justified. Evidence suggests that osteosarcoma is an immunogenic tumor, and development of immunotherapies for the treatment of microscopic lung metastases might improve long-term outcomes. In this review, the history and foundational knowledge of immune interactions to canine osteosarcoma are highlighted. In parallel, immunotherapeutic strategies that have been explored for the treatment of canine osteosarcoma are summarized. With a greater understanding and awareness for how the immune system might be redirected toward combating osteosarcoma metastases, the rational development of diverse immune strategies for managing osteosarcoma holds substantial promise for transforming the therapeutic landscape and improving disease management in both dogs and human beings. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.
Directory of Open Access Journals (Sweden)
John Davies
2012-01-01
Full Text Available Canine osteosarcoma (OS is an aggressive malignant bone tumor. Prognosis is primarily determined by clinical parameters. Vitamin D has been postulated as a novel therapeutic option for many malignancies. Upon activation, vitamin D receptors (VDRs combine with retinoid receptor (RXR forming a heterodimer initiating a cascade of events. Vitamin D's antineoplastic activity and its mechanism of action in OS remain to be clearly established. Expression of VDR, RXR, Ki-67, survivin, and ezrin was studied in 33 archived, canine OS specimens. VDR, RXR, survivin, and ezrin were expressed in the majority of cases. There was no statistically significant difference in VDR expression in relationship with tumor grade, type, or locations or animal breed, age, and/or sex. No significant association (p=0.316 between tumor grade and Ki-67 expression was found; in particular, no difference in Ki-67 expression between grades 2 and 3 OSs was found, while a negative correlation was noted between Ki-67 and VDR expression (ρ=−0.466, a positive correlation between survivin and RXR expression was found (p=0.374. A significant relationship exists between VDR and RXR expression in OSs and proliferative/apoptosis markers. These results establish a foundation for elucidating mechanisms by which vitamin D induces antineoplastic activity in OS.
Yu, Fang; Rasotto, Roberta; Zhang, Hong; Pei, Shimin; Zhou, Bin; Yang, Xu; Jin, Yipeng; Zhang, Di; Lin, Degui
2017-09-30
The Wnt signaling pathway and its key component β-catenin have critical roles in the development of diseases such as tumors in mammals. However, little has been reported about involvement of the Wnt/β-catenin signaling pathway in canine mammary tumors (CMTs). The present study detected expression of 30 Wnt signaling pathway-related genes in CMTs; the results are potentially useful for molecular-based diagnosis of CMTs and the development of new targeted therapies. Significant upregulations of dickkopf-1 protein, secreted frizzled-related sequence protein 1 (SFRP1), frizzled 3, β-catenin, and lymphoid enhancer-binding factor 1 (LEF1) were detected in highly malignant CMTs compared to levels in normal mammary gland tissues; moreover, highly significant upregulation of WNT5A was observed in low malignancy CMTs. Downregulation was only detected for SFRP4 in malignant CMT samples. The subcellular location of β-catenin and cyclin D1 in 100 CMT samples was investigated via immunohistochemical analysis, and significantly increased expressions of β-catenin in cytoplasm and cyclin D1 in nuclei were revealed. Western blotting analysis revealed that the expression of β-catenin and LEF1 increased in in the majority of CMT samples. Taken together, the results provide important evidence of the activation status of the Wnt pathway in CMTs and valuable clues to identifying biomarkers for molecular-based diagnosis of CMT.
Proton Beam Therapy for Unresectable Malignancies of the Nasal Cavity and Paranasal Sinuses
Energy Technology Data Exchange (ETDEWEB)
Zenda, Sadamoto, E-mail: szenda@east.ncc.go.jp [Division of Radiation Oncology, National Cancer Center Hospital East, Chiba (Japan); Kohno, Ryosuke; Kawashima, Mitsuhiko; Arahira, Satoko; Nishio, Teiji [Division of Radiation Oncology, National Cancer Center Hospital East, Chiba (Japan); Tahara, Makoto [Division of Gastrointestinal Oncology and Endoscopy, National Cancer Center Hospital East, Chiba (Japan); Hayashi, Ryuichi [Division of Head and Neck Surgery, National Cancer Center Hospital East, Chiba (Japan); Kishimoto, Seiji [Department of Head and Neck Surgery, Tokyo Medical and Dental University, Tokyo (Japan); Ogino, Takashi [Division of Radiation Oncology, National Cancer Center Hospital East, Chiba (Japan)
2011-12-01
Purpose: The cure rate for unresectable malignancies of the nasal cavity and paranasal sinuses is low. Because irradiation with proton beams, which are characterized by their rapid fall-off at the distal end of the Bragg peak and sharp lateral penumbra, depending on energy, depth, and delivery, provide better dose distribution than X-ray irradiation, proton beam therapy (PBT) might improve treatment outcomes for conditions located in proximity to risk organs. We retrospectively analyzed the clinical profile of PBT for unresectable malignancies of the nasal cavity and paranasal sinuses. Methods and Materials: We reviewed 39 patients in our database fulfilling the following criteria: unresectable malignant tumors of the nasal cavity, paranasal sinuses or skull base; N0M0 disease; and treatment with PBT (>60 GyE) from January 1999 to December 2006. Results: Median patient age was 57 years (range, 22-84 years); 22 of the patients were men and 17 were women. The most frequent primary site was the nasal cavity (n = 26, 67%). The local control rates at 6 months and 1 year were 84.6% and 77.0%, respectively. With a median active follow-up of 45.4 months, 3-year progression-free and overall survival were 49.1% and 59.3%, respectively. The most common acute toxicities were mild dermatitis (Grade 2, 33.3%), but no severe toxicity was observed (Grade 3 or greater, 0%). Five patients (12.8%) experienced Grade 3 to 5 late toxicities, and one treatment-related death was reported, caused by cerebrospinal fluid leakage Grade 5 (2.6%). Conclusion: These findings suggest that the clinical profile of PBT for unresectable malignancies of the nasal cavity and paranasal sinuses make it is a promising treatment option.
Proton Beam Therapy for Unresectable Malignancies of the Nasal Cavity and Paranasal Sinuses
International Nuclear Information System (INIS)
Zenda, Sadamoto; Kohno, Ryosuke; Kawashima, Mitsuhiko; Arahira, Satoko; Nishio, Teiji; Tahara, Makoto; Hayashi, Ryuichi; Kishimoto, Seiji; Ogino, Takashi
2011-01-01
Purpose: The cure rate for unresectable malignancies of the nasal cavity and paranasal sinuses is low. Because irradiation with proton beams, which are characterized by their rapid fall-off at the distal end of the Bragg peak and sharp lateral penumbra, depending on energy, depth, and delivery, provide better dose distribution than X-ray irradiation, proton beam therapy (PBT) might improve treatment outcomes for conditions located in proximity to risk organs. We retrospectively analyzed the clinical profile of PBT for unresectable malignancies of the nasal cavity and paranasal sinuses. Methods and Materials: We reviewed 39 patients in our database fulfilling the following criteria: unresectable malignant tumors of the nasal cavity, paranasal sinuses or skull base; N0M0 disease; and treatment with PBT (>60 GyE) from January 1999 to December 2006. Results: Median patient age was 57 years (range, 22–84 years); 22 of the patients were men and 17 were women. The most frequent primary site was the nasal cavity (n = 26, 67%). The local control rates at 6 months and 1 year were 84.6% and 77.0%, respectively. With a median active follow-up of 45.4 months, 3-year progression-free and overall survival were 49.1% and 59.3%, respectively. The most common acute toxicities were mild dermatitis (Grade 2, 33.3%), but no severe toxicity was observed (Grade 3 or greater, 0%). Five patients (12.8%) experienced Grade 3 to 5 late toxicities, and one treatment-related death was reported, caused by cerebrospinal fluid leakage Grade 5 (2.6%). Conclusion: These findings suggest that the clinical profile of PBT for unresectable malignancies of the nasal cavity and paranasal sinuses make it is a promising treatment option.
Pathogenesis of canine cortisol-secreting adrenocortical tumors
Kool, Miriam
2015-01-01
In dogs, hypercortisolism is one of the most frequently observed endocrine disorders, with an estimated incidence of about 1-2 cases per 1000 dogs per year. Approximately 15% of these cases is due to a cortisol-secreting adrenocortical tumor (AT). Cortisol-secreting ATs are characterized by
NASALIZATION IN BRAZILIAN PORTUGUESE: AN AUTOSEGMENTAL (REVIEW
Directory of Open Access Journals (Sweden)
Consuelo de Paiva Godinho COSTA
2015-06-01
Full Text Available We propose to make a brief review on nasalization phenomena studies in Portuguese, aiming the phonological process of nasal harmonization that occurs in the variety of Brazilian Portuguese spoken in Vitória da Conquista-BA and region, a phenomenon hitherto not described for any Portuguese dialect. To do so, we consider as fundamental, D’Angelis (2002 analysis, which incorporates relevant concepts presented by Trubetzkoy, from the Prague School, and some points of Camara Jr. propose. We also propose to update the discussion with the approaches along the lines of auto segmental phonology, incorporating some insights of Piggott (1992, discussing with other analyzes for nasalization phenomena in other languages, especially Guarani (language of Tupi-Guarani Linguistic Family, as proposed by Costa (2010, which deals with the phonological processes involving nasality and nasal harmony in Brazilian indigenous languages , in order to verify if the researches on nasality phenomena in other languages can shed some light on the processes that occur in Portuguese.
Regional deposition of mometasone furoate nasal spray suspension in humans.
Shah, Samir A; Berger, Robert L; McDermott, John; Gupta, Pranav; Monteith, David; Connor, Alyson; Lin, Wu
2015-01-01
Nasal deposition studies can demonstrate whether nasal sprays treating allergic rhinitis and polyposis reach the ciliated posterior nasal cavity, where turbinate inflammation and other pathology occurs. However, quantifying nasal deposition is challenging, because in vitro tests do not correlate to human nasal deposition; gamma scintigraphy studies are thus used. For valid data, the radiolabel must distribute, as the drug, into different-sized droplets, remain associated with the drug in the formulation after administration, and not alter its deposition. Some nasal deposition studies have demonstrated this using homogenous solutions. However, most commercial nasal sprays are heterogeneous suspensions. Using mometasone furoate nasal suspension (MFS), we developed a technique to validate radiolabel deposition as a surrogate for nasal cavity drug deposition and characterized regional deposition and nasal clearance in humans. Mometasone furoate (MF) formulation was spiked with diethylene triamine pentacaetic acid. Both unlabeled and radiolabeled formulations (n = 3) were sprayed into a regionally divided nasal cast. Drug deposition was quantified by high pressure liquid chromatography within each region; radiolabel deposition was determined by gamma camera. Healthy subjects (n = 12) were dosed and imaged for six hours. Scintigraphic images were coregistered with magnetic resonance imaging scans to quantify anterior and posterior nasal cavity deposition and mucociliary clearance. The ratio of radiolabel to unlabeled drug was 1.05 in the nasal cast and regionally appeared to match, indicating that in vivo radiolabel deposition could represent drug deposition. In humans, MFS delivered 86% (9.2) of metered dose to the nasal cavity, approximately 60% (9.1) of metered dose to the posterior nasal cavity. After 15 minutes, mucociliary clearance removed 59% of the initial radiolabel in the nasal cavity, consistent with clearance rates from the ciliated posterior surface. MFS
Hox, V.; Bobic, S.; Callebaux, I.; Jorissen, M.; Hellings, P. W.
2010-01-01
Chronic rhinosinusitis with nasal polyposis (NP) represents an invalidating disorder that causes mainly nasal blockage and loss of smell. The aim of this study is to investigate correlations between individual subjective and objective parameters of stable NP disease. 65 NP patients scored their
Kimbell, Julia S; Segal, Rebecca A; Asgharian, Bahman; Wong, Brian A; Schroeter, Jeffry D; Southall, Jeremy P; Dickens, Colin J; Brace, Geoff; Miller, Frederick J
2007-01-01
Many studies suggest limited effectiveness of spray devices for nasal drug delivery due primarily to high deposition and clearance at the front of the nose. Here, nasal spray behavior was studied using experimental measurements and a computational fluid dynamics model of the human nasal passages constructed from magnetic resonance imaging scans of a healthy adult male. Eighteen commercially available nasal sprays were analyzed for spray characteristics using laser diffraction, high-speed video, and high-speed spark photography. Steadystate, inspiratory airflow (15 L/min) and particle transport were simulated under measured spray conditions. Simulated deposition efficiency and spray behavior were consistent with previous experimental studies, two of which used nasal replica molds based on this nasal geometry. Deposition fractions (numbers of deposited particles divided by the number released) of 20- and 50-microm particles exceeded 90% in the anterior part of the nose for most simulated conditions. Predicted particle penetration past the nasal valve improved when (1) the smaller of two particle sizes or the lower of two spray velocities was used, (2) the simulated nozzle was positioned 1.0 rather than 0.5 or 1.5 cm into the nostril, and (3) inspiratory airflow was present rather than absent. Simulations also predicted that delaying the appearance of normal inspiratory airflow more than 1 sec after the release of particles produced results equivalent to cases in which no inspiratory airflow was present. These predictions contribute to more effective design of drug delivery devices through a better understanding of the effects of nasal airflow and spray characteristics on particle transport in the nose.
Canine Oral Eosinophilic Granuloma Treated with Electrochemotherapy
Directory of Open Access Journals (Sweden)
Matías Nicolás Tellado
2014-01-01
Full Text Available A case of a canine oral eosinophilic granuloma in a 14-year-old female crossbred is described. The dog was presented with a history of ptyalism, halitosis, local pain, decreased appetite, and blood staining noted on food and water bowls. Clinical, hematologic, and biochemical examinations, abdominal ultrasonography, and 3-view chest radiographs were performed, and no metastases were found. Histopathologic examination of two 6 mm punch biopsies from the oral lesion revealed the presence of eosinophilic granulomatous lesions in the submucosa. After treatment with corticosteroids and wide spectrum antibiotics no significant changes in clinical signs and lesion size were observed. Electrochemotherapy (ECT, a novel tumor treatment routinely used for cutaneous and subcutaneous tumors in human patients in the European Union since 2006, was used to treat the eosinophilic granuloma. The procedure was performed under general anesthesia, followed by intravenous administration of bleomycin. Six weeks after treatment a complete response with disappearance of the mass and improvement of clinical signs were observed.
Milovancev, Milan; Hilgart-Martiszus, Ian; McNamara, Michael J; Goodall, Cheri P; Seguin, Bernard; Bracha, Shay; Wickramasekara, Samanthi I
2013-06-13
Osteosarcoma (OSA) is the most common primary bone tumor of dogs and carries a poor prognosis despite aggressive treatment. An improved understanding of the biology of OSA is critically needed to allow for development of novel diagnostic, prognostic, and therapeutic tools. The surface-exposed proteome (SEP) of a cancerous cell includes a multifarious array of proteins critical to cellular processes such as proliferation, migration, adhesion, and inter-cellular communication. The specific aim of this study was to define a SEP profile of two validated canine OSA cell lines and a normal canine osteoblast cell line utilizing a biotinylation/streptavidin system to selectively label, purify, and identify surface-exposed proteins by mass spectrometry (MS) analysis. Additionally, we sought to validate a subset of our MS-based observations via quantitative real-time PCR, Western blot and semi-quantitative immunocytochemistry. Our hypothesis was that MS would detect differences in the SEP composition between the OSA and the normal osteoblast cells. Shotgun MS identified 133 putative surface proteins when output from all samples were combined, with good consistency between biological replicates. Eleven of the MS-detected proteins underwent analysis of gene expression by PCR, all of which were actively transcribed, but varied in expression level. Western blot of whole cell lysates from all three cell lines was effective for Thrombospondin-1, CYR61 and CD44, and indicated that all three proteins were present in each cell line. Semi-quantitative immunofluorescence indicated that CD44 was expressed at much higher levels on the surface of the OSA than the normal osteoblast cell lines. The results of the present study identified numerous differences, and similarities, in the SEP of canine OSA cell lines and normal canine osteoblasts. The PCR, Western blot, and immunocytochemistry results, for the subset of proteins evaluated, were generally supportive of the mass spectrometry data
Radiation therapy of lethal midline granuloma type nasal T-cell lymphoma
International Nuclear Information System (INIS)
Sakata, Koh-ichi; Hareyama, Masato; Ohuchi, Atushi; Sido, Mitsuo; Nagakura, Hisayasu; Morita, Kazuo; Harabuchi, Yasuaki; Kataura, Akikatsu
1996-01-01
Purpose/Objective: Lethal midline granuloma (LMG) is disorder characterized by progressive, unrelenting ulceration, and necrosis of the nasal cavity and midline facial tissues. Several investigators have demonstrated that LMG (polymorphic reticulosis) is a peripheral T-cell lymphoma, and the term nasal T-cell lymphoma of the LMG type (LMG-NTL) has since been widely used. Recently, expression of the natural killer (NK) cell marker CD56 on tumor cells has been reported in some cases. However, there is very little information about the optimal treatment for this disease. In this study, we report our observations on the clinical behavior of this tumor in comparison with nasal lymphoma of non-LMG-NTL type (non-LMG-NTL) that makes tumor mass and paranasal sinus lymphoma (PSL) to improve management of LMG-NTL. Materials and Methods: Sixteen patients (10 men, 6 women) with LMG-NTL, 8 patients (4 men, 4 women) with non-LMG-NTL, and 6 patients (4 men, 2 women) with PSL were treated with radiation therapy between January 1975 and December 1994. Four of 8 patients with non-LMG-NTL had tumors of B-cell origin and four had T-cell derived tumors. All 6 patients with PSL had B-cell tumors. They had stage I or II disease. The radiation portal encompassed clinically involved areas with a generous margin. The median dose received was 40 Gy (range, 9-74 Gy) and the median TDF delivered was 63.3 (range, 13.7-103.5). One or two courses of VEPA chemotherapy (same drugs as CHOP, however, drugs doses and treatment schedule are a little different) were administered to the patients with non-LMG-NTL after radiotherapy and the patients with PSL before radiotherapy. In patients with LMG-NTL, between 1975 and 1981 one patient was treated with COPP, one with VEMP after radiotherapy, and two with radiotherapy alone. From 1982 to 1986, all three patients treated for LMG-NTL received VEPA before radiotherapy. Since 1987, of 11 patients treated for LMG-NTL, all except one received two courses of
Mata, Melinda; Vera, Juan; Gerken, Claudia; Rooney, Cliona M.; Miller, Tasha; Pfent, Catherine; Wang, Lisa L.; Wilson-Robles, Heather M.; Gottschalk, Stephen
2014-01-01
Adoptive transfer of T cells expressing chimeric antigen receptors (CARs) has shown promising anti-tumor activity in early phase clinical studies, especially for hematological malignancies. However, most preclinical models do not reliably mimic human disease. We reasoned that developing an adoptive T-cell therapy approach for spontaneous osteosarcoma (OS) occurring in dogs would more closely reproduce the condition in human cancer. To generate CAR-expressing canine T cells we developed expansion and transduction protocols that allow for the generation of sufficient numbers of CAR-expressing canine T cells for future clinical studies in dogs within 2 weeks of ex vivo culture. To evaluate the functionality of CAR-expressing canine T cells we targeted HER2-positive OS. We demonstrate that canine OS is positive for HER2, and that canine T cells expressing a HER2-specific CAR with human-derived transmembrane and CD28.ζ signaling domains recognize and kill HER2-positive canine OS cell lines in an antigen-dependent manner. To reduce the potential immunogenicity of the CAR we evaluated a CAR with canine-derived transmembrane and signaling domains, and found no functional difference between human and canine CARs. Hence, we have successfully developed a strategy to generate CAR-expressing canine T cells for future preclinical studies in dogs. Testing T-cell therapies in an immunocompetent, outbred animal model may improve our ability to predict their safety and efficacy prior to conducting studies in humans. PMID:25198528
Development of the canine tooth in the beagle
International Nuclear Information System (INIS)
Amimoto, A.; Iwamoto, S.; Hachimura, H.; Miyamoto, T.; Murata, T.; Taura, Y.; Nakama, S.; Hayashi, K.
1993-01-01
The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla
Nasal juvenile angiofibroma: Current perspectives with emphasis on management.
López, Fernando; Triantafyllou, Asterios; Snyderman, Carl H; Hunt, Jennifer L; Suárez, Carlos; Lund, Valerie J; Strojan, Primož; Saba, Nabil F; Nixon, Iain J; Devaney, Kenneth O; Alobid, Isam; Bernal-Sprekelsen, Manuel; Hanna, Ehab Y; Rinaldo, Alessandra; Ferlito, Alfio
2017-05-01
Juvenile angiofibroma is an uncommon, benign, locally aggressive vascular tumor. It is found almost exclusively in young men. Common presenting symptoms include nasal obstruction and epistaxis. More advanced tumors may present with facial swelling and visual or neurological disturbances. The evaluation of patients with juvenile angiofibroma relies on diagnostic imaging. Preoperative biopsy is not recommended. The mainstay of treatment is resection combined with preoperative embolization. Endoscopic surgery is the approach of choice in early stages, whereas, in advanced stages, open or endoscopic approaches are feasible in expert hands. Postoperative radiotherapy (RT) or stereotactic radiosurgery seem valuable in long-term control of juvenile angiofibroma, particularly those that extend to anatomically critical areas unsuitable for complete resection. Chemotherapy and hormone therapy are ineffective. The purpose of the present review was to update current aspects of knowledge related to this rare and challenging disease. © 2017 Wiley Periodicals, Inc. Head Neck 39: 1033-1045, 2017. © 2017 Wiley Periodicals, Inc.
Ontogeny of canine dimorphism in extant hominoids.
Schwartz, G T; Dean, C
2001-07-01
Many behavioral and ecological factors influence the degree of expression of canine dimorphism for different reasons. Regardless of its socioecological importance, we know virtually nothing about the processes responsible for the development of canine dimorphism. Our aim here is to describe the developmental process(es) regulating canine dimorphism in extant hominoids, using histological markers of tooth growth. Teeth preserve a permanent record of their ontogeny in the form of short- and long-period incremental markings in both enamel and dentine. We selected 52 histological sections of sexed hominoid canine teeth from a total sample of 115, from which we calculated the time and rate of cuspal enamel formation and the rate at which ameloblasts differentiate along the future enamel-dentine junction (EDJ) to the end of crown formation. Thus, we were able to reconstruct longitudinal growth curves for height attainment in male and female hominoid canines. Male hominoids consistently take longer to form canine crowns than do females (although not significantly so for our sample of Homo). Male orangutans and gorillas occasionally take up to twice as long as females to complete enamel formation. The mean ranges of female canine crown formation times are similar in Pan, Gorilla, and Pongo. Interspecific differences between female Pan canine crown heights and those of Gorilla and Pongo, which are taller, result from differences in rates of growth. Differences in canine crown heights between male Pan and the taller, more dimorphic male Gorilla and Pongo canines result both from differences in total time taken to form enamel and from faster rates of growth in Gorilla and Pongo. Although modern human canines do not emerge as significantly dimorphic in this study, it is well-known that sexual dimorphism in canine crown height exists. Larger samples of sexed modern human canines are therefore needed to identify clearly what underlies this. Copyright 2001 Wiley-Liss, Inc.
Evaluation of the nasal shape after orthognathic surgery.
Dantas, Wagner Ranier Maciel; Silveira, Márcia Maria Fonseca da; Vasconcelos, Belmiro Cavalcanti do Egito; Porto, Gabriela Granja
2015-01-01
Patients with dentofacial deformities may benefit from orthognathic surgery in the maxilla. Maxillary osteotomy may include procedures in the bone, cartilaginous, and soft tissues of the nose, leading to shape alterations. To evaluate the anatomic alterations of the nasal region in patients undergoing a Le Fort I osteotomy for advancement or superior impaction. This is a clinical prospective study. Twenty-one patients were evaluated during the pre- and postoperative periods. The positioning of the nasal tip and the modification of the nasal base were evaluated. The results showed that the nasal tip was superiorly positioned in 85% of the cases, advanced in 80%, rotated in 80%, and there was a wide nasal base in 95%, resulting in esthetic improvement. Surgeries of maxillary advancement and superior reposition tend to cause elevation and advancement of the nasal tip, as well as enlargement of the nasal base. Copyright © 2014 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.
Nivolumab and Ipilimumab in Treating Patients With Rare Tumors
2018-05-14
Acinar Cell Carcinoma; Adenoid Cystic Carcinoma; Adrenal Cortex Carcinoma; Adrenal Gland Pheochromocytoma; Anal Canal Neuroendocrine Carcinoma; Anal Canal Undifferentiated Carcinoma; Appendix Mucinous Adenocarcinoma; Bartholin Gland Transitional Cell Carcinoma; Bladder Adenocarcinoma; Cervical Adenocarcinoma; Cholangiocarcinoma; Chordoma; Colorectal Squamous Cell Carcinoma; Desmoid-Type Fibromatosis; Endometrial Transitional Cell Carcinoma; Endometrioid Adenocarcinoma; Esophageal Neuroendocrine Carcinoma; Esophageal Undifferentiated Carcinoma; Extrahepatic Bile Duct Carcinoma; Fallopian Tube Adenocarcinoma; Fallopian Tube Transitional Cell Carcinoma; Fibromyxoid Tumor; Gastric Neuroendocrine Carcinoma; Gastric Squamous Cell Carcinoma; Gastrointestinal Stromal Tumor; Giant Cell Carcinoma; Intestinal Neuroendocrine Carcinoma; Intrahepatic Cholangiocarcinoma; Lung Carcinoid Tumor; Lung Sarcomatoid Carcinoma; Major Salivary Gland Carcinoma; Malignant Odontogenic Neoplasm; Malignant Peripheral Nerve Sheath Tumor; Malignant Testicular Sex Cord-Stromal Tumor; Metaplastic Breast Carcinoma; Metastatic Malignant Neoplasm of Unknown Primary Origin; Minimally Invasive Lung Adenocarcinoma; Mixed Mesodermal (Mullerian) Tumor; Mucinous Adenocarcinoma; Mucinous Cystadenocarcinoma; Nasal Cavity Adenocarcinoma; Nasal Cavity Carcinoma; Nasopharyngeal Carcinoma; Nasopharyngeal Papillary Adenocarcinoma; Nasopharyngeal Undifferentiated Carcinoma; Oral Cavity Carcinoma; Oropharyngeal Undifferentiated Carcinoma; Ovarian Adenocarcinoma; Ovarian Germ Cell Tumor; Ovarian Mucinous Adenocarcinoma; Ovarian Squamous Cell Carcinoma; Ovarian Transitional Cell Carcinoma; Pancreatic Acinar Cell Carcinoma; Pancreatic Neuroendocrine Carcinoma; Paraganglioma; Paranasal Sinus Adenocarcinoma; Paranasal Sinus Carcinoma; Parathyroid Gland Carcinoma; Pituitary Gland Carcinoma; Placental Choriocarcinoma; Placental-Site Gestational Trophoblastic Tumor; Primary Peritoneal High Grade Serous Adenocarcinoma
Bilateral cleft lip nasal deformity
Directory of Open Access Journals (Sweden)
Singh Arun
2009-01-01
Full Text Available Bilateral cleft lip nose deformity is a multi-factorial and complex deformity which tends to aggravate with growth of the child, if not attended surgically. The goals of primary bilateral cleft lip nose surgery are, closure of the nasal floor and sill, lengthening of the columella, repositioning of the alar base, achieving nasal tip projection, repositioning of the lower lateral cartilages, and reorienting the nares from horizontal to oblique position. The multiplicity of procedures in the literature for correction of this deformity alludes to the fact that no single procedure is entirely effective. The timing for surgical intervention and its extent varies considerably. Early surgery on cartilage may adversely affect growth and development; at the same time, allowing the cartilage to grow in an abnormal position and contributing to aggravation of deformity. Some surgeons advocate correction of deformity at an early age. However, others like the cartilages to grow and mature before going in for surgery. With peer pressure also becoming an important consideration during the teens, the current trend is towards early intervention. There is no unanimity in the extent of nasal dissection to be done at the time of primary lip repair. While many perform limited nasal dissection for the fear of growth retardation, others opt for full cartilage correction at the time of primary surgery itself. The value of naso-alveolar moulding (NAM too is not universally accepted and has now more opponents than proponents. Also most centres in the developing world have neither the personnel nor the facilities for the same. The secondary cleft nasal deformity is variable and is affected by the extent of the original abnormality, any prior surgeries performed and alteration due to nasal growth. This article reviews the currently popular methods for correction of nasal deformity associated with bilateral cleft lip, it′s management both at the time of cleft lip repair
International Nuclear Information System (INIS)
Larson, S.M.; Weiden, P.L.; Grunbaum, J.
1981-01-01
Uptake [ 3 H]thymidine was studied in BALB/c mice with EMT-6 sarcoma, in Buffalo rats with Morris 7777 hepatoma, and in nine dogs with spontaneous neoplasms: four lymphomas, two osteosarcomas, two soft-tissue sarcomas, and a thyroid carcinoma. High tumor-to-tissue ratios were observed for all tumor types assayed, and absolute uptakes, when computed as percent dose per gram tumor normalized for body weight, were similar for transplanted and spontaneous tumors. In the rodent tumors, radiothymidine was retained for at least 3 hr in the tumor without appreciable loss. In canine neoplasms, although the highest uptakes were observed in cellular tumors with many mitotic figures, tumor uptake showed significant variability that did not correlate with any obvious histologic change, and thus may reflect true biologic differences in metabolism among tumors at different sites in the same animal. These studies provide additional experimental evidence that the ratios of neoplastic to normal tissue and the kinetics of thymidine uptake by tumors are suitable for positron emission tomography of neoplasms in small and large, animals, including both transplanted and spontaneous tumors
Gore, Thomas C; Lakshmanan, Nallakannu; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J
2005-01-01
A challenge-of-immunity study was conducted to demonstrate immunity in dogs 3 years after their second vaccination with a new multivalent, modified-live vaccine containing canine adenovirus type 2 (CAV-2), canine parvovirus (CPV), and canine distemper virus (CDV). Twenty-three seronegative pups were vaccinated at 7 and 11 weeks of age. Eighteen seronegative pups, randomized into groups of six dogs, served as challenge controls. Dogs were kept in strict isolation for 3 years following the vaccination and then challenged sequentially with virulent canine adenovirus type 1 (CAV-1), CPV, and CDV. For each viral challenge, a separate group of six control dogs was also challenged. Clinical signs of CAV-1, CPV, and CDV infections were prevented in 100% of vaccinated dogs, demonstrating that the multivalent, modified-live test vaccine provided protection against virulent CAV-1, CPV, and CDV challenge in dogs 7 weeks of age or older for a minimum of 3 years following second vaccination.
International Nuclear Information System (INIS)
Noujaim, A.; Selvaraj, S.; Suresh, M.R.; Turner, C.; McLean, G.; Willans, D.; Longenecker, B.M.; Haines, D.M.
1987-01-01
The role of glycoconjugates in tumor cell differentiation has been well documented. We have examined the expression of the two anomers of the Thomsen-Friedenreich antigen on the surface of human, canine and murine tumor cell membranes both in vitro and in vivo. This has been accomplished through the synthesis of the disaccharide terminal residues in both α and β configuration. Both entities were used to generate murine monoclonal antibodies which recognized the carbohydrate determinants. The determination of fine specificities of these antibodies was effected by means of cellular uptake, immunohistopathology and immunoscintigraphy. Examination of pathological specimens of human and canine tumor tissue indicated that the expressed antigen was in the β configuration. More than 89% of all human carcinomas tested expressed the antigen in the above anomeric form. The combination of synthetic antigens and monoclonal antibodies raised specifically against them provide us with invaluable tools for the study of tumor marker expression in humans and their respective animal tumor models. (orig.) [de
Anticancer effects of geopropolis produced by stingless bees on canine osteosarcoma cells in vitro.
Cinegaglia, Naiara Costa; Bersano, Paulo Ricardo Oliveira; Araújo, Maria José Abigail Mendes; Búfalo, Michelle Cristiane; Sforcin, José Maurício
2013-01-01
Geopropolis is produced by indigenous stingless bees from the resinous material of plants, adding soil or clay. Its biological properties have not been investigated, such as propolis, and herein its cytotoxic action on canine osteosarcoma (OSA) cells was evaluated. OSA is a primary bone neoplasm diagnosed in dogs being an excellent model in vivo to study human OSA. spOS-2 primary cultures were isolated from the tumor of a dog with osteosarcoma and incubated with geopropolis, 70% ethanol (geopropolis solvent), and carboplatin after 6, 24, 48, and 72 hours. Cell viability was analyzed by the crystal violet method. Geopropolis was efficient against canine OSA cells in a dose- and time-dependent way, leading to a distinct morphology compared to control. Geopropolis cytotoxic action was exclusively due to its constituents since 70% ethanol (its solvent) had no effect on cell viability. Carboplatin had no effect on OSA cells. Geopropolis exerted a cytotoxic effect on canine osteosarcoma, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment.
Anticancer Effects of Geopropolis Produced by Stingless Bees on Canine Osteosarcoma Cells In Vitro
Directory of Open Access Journals (Sweden)
Naiara Costa Cinegaglia
2013-01-01
Full Text Available Geopropolis is produced by indigenous stingless bees from the resinous material of plants, adding soil or clay. Its biological properties have not been investigated, such as propolis, and herein its cytotoxic action on canine osteosarcoma (OSA cells was evaluated. OSA is a primary bone neoplasm diagnosed in dogs being an excellent model in vivo to study human OSA. spOS-2 primary cultures were isolated from the tumor of a dog with osteosarcoma and incubated with geopropolis, 70% ethanol (geopropolis solvent, and carboplatin after 6, 24, 48, and 72 hours. Cell viability was analyzed by the crystal violet method. Geopropolis was efficient against canine OSA cells in a dose- and time-dependent way, leading to a distinct morphology compared to control. Geopropolis cytotoxic action was exclusively due to its constituents since 70% ethanol (its solvent had no effect on cell viability. Carboplatin had no effect on OSA cells. Geopropolis exerted a cytotoxic effect on canine osteosarcoma, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment.
Ito, K; Miyamoto, R; Tani, H; Kurita, S; Kobayashi, M; Tamura, K; Bonkobara, M
2018-02-01
Canine histiocytic sarcoma (HS) is an aggressive and highly metastatic tumor. Previously, the kinase inhibitor dasatinib was shown to have potent growth inhibitory activity against HS cells in vitro, possibly via targeting the EPHA2 receptor. Here, the in vivo effect of dasatinib in HS cells was investigated using a xenograft mouse model. Moreover, the expression status of EPHA2 was examined in six HS cell lines, ranging from insensitive to highly sensitive to dasatinib. In the HS xenograft mouse model, dasatinib significantly suppressed tumor growth, as illustrated by a decrease in mitotic and Ki67 indices and an increase in apoptotic index in tumor tissues. On Western blot analysis, EPHA2 was only weakly detected in all HS cell lines, regardless of sensitivity to dasatinib. Dasatinib likely results in the inhibition of xenograft tumor growth via a mechanism other than targeting EPHA2. The findings of this study suggest that dasatinib is a targeted therapy drug worthy of further exploration for the treatment of canine HS. © 2017 John Wiley & Sons Ltd.
ΔNp63 mediates cellular survival and metastasis in canine osteosarcoma.
Cam, Maren; Gardner, Heather L; Roberts, Ryan D; Fenger, Joelle M; Guttridge, Denis C; London, Cheryl A; Cam, Hakan
2016-07-26
p63 is a structural homolog within the 53 family encoding two isoforms, ΔNp63 and TAp63. The oncogenic activity of ΔNp63 has been demonstrated in multiple cancers, however the underlying mechanisms that contribute to tumorigenesis are poorly characterized. Osteosarcoma (OSA) is the most common primary bone tumor in dogs, exhibiting clinical behavior and molecular biology essentially identical to its human counterpart. The purpose of this study was to evaluate the potential contribution of ΔNp63 to the biology of canine OSA. As demonstrated by qRT-PCR, nearly all canine OSA cell lines and tissues overexpressed ΔNp63 relative to normal control osteoblasts. Inhibition of ΔNp63 by RNAi selectively induced apoptosis in the OSA cell lines overexpressing ΔNp63. Knockdown of ΔNp63 upregulated expression of the proapoptotic Bcl-2 family members Puma and Noxa independent of p53. However the effects of ΔNp63 required transactivating isoforms of p73, suggesting that ΔNp63 promotes survival in OSA by repressing p73-dependent apoptosis. In addition, ΔNp63 modulated angiogenesis and invasion through its effects on VEGF-A and IL-8 expression, and STAT3 phosphorylation. Lastly, the capacity of canine OSA cell lines to form pulmonary metastasis was directly related to expression levels of ΔNp63 in a murine model of metastatic OSA. Together, these data demonstrate that ΔNp63 inhibits apoptosis and promotes metastasis, supporting continued evaluation of this oncogene as a therapeutic target in both human and canine OSA.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Tsuchiya, Ryo; Sahara, Hiroeki
2012-08-01
Domesticated adult dogs with antibody titer classified as below 'high' to one or more of canine distemper virus (CDV), canine parvovirus type-2 (CPV-2) and canine adenovirus type-1 (CAdV-1) were then given an additional inoculation, and the effectiveness of this booster evaluated 2 months later. Consequently, CDV and CAdV-1 antibody titer experienced a significant increase, but the same effect was not observed in the antibody titer of CPV-2. These findings suggest that with additional inoculation, a booster effect may be expected in increasing antibody titers for CDV and CAdV-1, but it is unlikely to give an increase in CPV-2 antibody titer. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.
SEPTOPLASTY WITH AND WITHOUT NASAL PACKING: A COMPARATIVE STUDY
Directory of Open Access Journals (Sweden)
Mitta
2016-05-01
Full Text Available Septoplasty is one of the most commonly performed surgeries in rhinology to relieve nasal obstruction of patients with distortion in the midline cartilage or septum of the nose to relieve nasal obstruction of patient and findings consistent with nasal endoscopy. The anterior nasal packing routinely done following septoplasty is usually conventional and not evidence based. The purpose of nasal packing is to obtain haemostasis, enhance opposition of septal flaps, avoid septal haematoma formation, close the dead space, avoid synechiae formation, provide support to septal cartilage and prevent its displacement. OBJECTIVE This study intends to evaluate the effects of nasal packing on surgical success and related complications in septoplasty. MATERIALS AND METHODS The present clinical prospective and randomised study was carried out on patients attending Otorhinolaryngology Department of Santhiram Medical College & General Hospital between March 2012 and March 2015. Patients undergoing septoplasty were randomised either to receive anterior nasal packing or to not receive nasal packing postoperatively. RESULTS Levels of pain experienced by patients with nasal packing postoperatively during the initial 24 hours postoperatively and during the removal of the pack were significantly more. Post-operative headache, epiphora, swallowing discomfort and sleep disturbance were more in patients with nasal packing and statistically (p.05. Septal haematoma, adhesions and local infections in both groups were statistically insignificant (p>.05. CONCLUSION Septoplasty enhances the standard of living of patients with septal deviation and nasal obstruction. Our study results suggest that nasal packing after septoplasty is not obligatory. Nasal packing causes considerably more pain and complications, and it should be reserved only for those who have bleeding predisposition.
[Clinical and anatomical characteristic of nasal injuries].
Surikov, E V; Ivanets, I V
2009-01-01
A fracture of nasal bones is becoming a very common injury due to the increasingly greater number of car accidents and aggravated criminal situation. A total of 500 cases of nasal fracture associated with external deformities were included in the present study. The following kinds of deformities were identified: unilateral retraction, lateral displacement of the entire dorsum of the nose, and depressed comminuted fracture. Rhinoscopy revealed in addition such abnormalities associated with septal fracture as submucous hemorrhage, pathological mobility of the pyramid, deflection of the nasal septum at an acute angle. All in all, four types of nasal septum fractures were distinguished depending on the shape and localization of the fracture line. Two of them resulted in marked impairment of nasal breathing while two others required surgical intervention in the acute period after the injury.
Experimental investigation of nasal airflow.
Doorly, D; Taylor, D J; Franke, P; Schroter, R C
2008-05-01
The airway geometry of the nasal cavity is manifestly complex, and the manner in which it controls the airflow to accomplish its various physiological functions is not fully understood. Since the complex morphology and inaccessibility of the nasal passageways precludes detailed in-vivo measurements, either computational simulation or in-vitro experiments are needed to determine how anatomical form and function are related. The fabrication of a replica model of the nasal cavity, of a high optical clarity and derived from in-vivo scan data is described here, together with characteristics of the flow field investigated using particle image velocimetry (PIV) and flow visualization. Flow visualization is shown to be a capable and convenient technique for identifying key phenomena. Specifically the emergence of the jet from the internal nasal valve into the main cavity, how it impacts on the middle turbinate, and the large enhancement of dispersion that accompanies the initial appearance of flow instability are revealed as particularly significant features. The findings from the visualization experiments are complemented by PIV imaging, which provides quantitative detail on the variations in velocity in different regions of the nasal cavity. These results demonstrate the effectiveness of the cavity geometry in partitioning the flow into high shear zones, which facilitate rapid heat transfer and humidification from the nasal mucosa, and slower zones affording greater residence times to facilitate olfactory sensing. The experimental results not only provide a basis for comparison with other computational modelling but also demonstrate an alternative and flexible means to investigate complex flows, relevant to studies in different parts of the respiratory or cardiovascular systems.
Acoustic Analysis of Nasal Vowels in Monguor Language
Zhang, Hanbin
2017-09-01
The purpose of the study is to analyze the spectrum characteristics and acoustic features for the nasal vowels [ɑ˜] and [ɔ˜] in Monguor language. On the base of acoustic parameter database of the Monguor speech, the study finds out that there are five main zero-pole pairs appearing for the nasal vowel [ɔ˜] and two zero-pole pairs appear for the nasal vowel [ɔ˜]. The results of regression analysis demonstrate that the duration of the nasal vowel [ɔ˜] or the nasal vowel [ɔ˜] can be predicted by its F1, F2 and F3 respectively.
Bilateral supernumerary primary maxillary canines
Directory of Open Access Journals (Sweden)
Santanu Mukhopadhyay
2018-01-01
Full Text Available Supernumerary teeth are more common in the permanent than in primary dentition. In the primary dentition, the anomaly is most frequently observed in the maxillary lateral incisor region, followed by the maxillary midline where they are termed as mesiodens. Supernumerary teeth in the primary canine region are rare. This paper describes a rare case of nonsyndromic supernumerary primary maxillary canine distributed bilaterally in a 4-year-old boy. Both the supernumeraries resembled size and shape of normal primary canine. The right supplemental canine is high labially placed, whereas the left one is seen normally aligned in the dental arch distal to lateral incisor. One of the most significant sequelae of primary supernumerary teeth is their duplication in the permanent series. Radiographic examination of supernumerary primary canine did not indicate any such anomaly in the permanent dentition. The patient was kept under observation.
9 CFR 113.306 - Canine Distemper Vaccine.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...
Canine tumor and normal tissue response to heat and radiation
International Nuclear Information System (INIS)
Gillette, E.L.; McChesney, S.L.
1985-01-01
Oral squamous cell carcinomas of dogs were treated with either irradiation alone or combined with hyperthermia. Tumor control was assessed as no evidence of disease one year following treatment. Dogs were randomized to variable radiation doses which were given in ten fractions three times a week for three weeks. Heat was given three hours after the first and third radiation dose each week for seven treatments. The attempt was made to achieve a minimum tumor temperature of 42 0 C for thirty minutes with a maximum normal tissue temperature of 40 0 C. It was usually possible to selectively heat tumors. The TCD 50 for irradiation alone was about 400 rads greater than for heat plus irradiation. The dose response curve for heat plus radiation was much steeper than for radiation alone indicating less heterogeneity of tumor response. That also implies a much greater effectiveness of radiation combined with heat at higher tumor control probabilities. Early necrosis caused by heating healed with conservative management. No increase in late radiation necrosis was observed
Pinto, Valentina; Piccin, Ottavio; Burgio, Luca; Summo, Valeria; Antoniazzi, Elisa; Morselli, Paolo G
2018-05-01
A relatively neglected aspect of cleft lip nasal deformity is the effect of septal deviation and inferior turbinate hypertrophy (ITH) on the functional airway. In particular, ITH in the noncleft side can be especially problematic, because it reduces the healthy nasal area, creating bilateral nasal obstruction that might affect the growth of the maxillofacial skeleton. Although these anatomic and functional changes are documented, few recommendations have been developed regarding the proper approach to ITH. The aim of the present study was to asses the ITH severity and determine the degree of nasal airway patency in patients who have undergone primary correction of the nasal septum during lip repair compared to patients operated on without primary septal correction. The study population included two groups. One group consisted of twenty unilateral cleft lip palate UCLP patients who have previously undergone primary rhinoseptoplasty as part of their treatment plan. The control group consisted of twenty UCLP patients operated on without rhinoseptal correction. The Nasal Obstructive Symptom Evaluation (NOSE) scale and nasal endoscopy were used to assess nasal obstruction. The overall untreated group reported severe symptoms across all NOSE scale dimensions more frequently than children who have undergone primary rhinoseptoplasty. The difference was statistically significant for each dimensions (p cleft lip repair results in a statistically significant reduction in IT size and improvement of nasal patency. Copyright © 2018 Elsevier B.V. All rights reserved.
Enzootic Nasal Adenocarcinoma: Cytological and ...
African Journals Online (AJOL)
Enzootic nasal adenocarcinoma (ENA), a contagious retroviral disease of sheep and goats, characterized by neoplastic growth of the ethmoidal mucosa in the nasal cavity is described in a West African Dwarf goat (WAD). A two-year old WAD goat, weighing approximately 20kg was observed in the Teaching and Research ...
Canine mast cell tumors: diagnosis, treatment, and prognosis
Directory of Open Access Journals (Sweden)
Garrett LD
2014-08-01
Full Text Available Laura D Garrett Department of Veterinary Clinical Medicine, University of Illinois College of Veterinary Medicine, Urbana, IL, USA Abstract: Mast cell tumors (MCTs are the most common malignant skin cancer in dogs, and significant variability exists in their biological behavior. Most MCTs are cured with appropriate local therapy, but a subset shows malignant behavior with the potential to spread to lymph nodes, liver, spleen, and other areas and to thus become a systemic cancer. Because of this variable behavior, it is difficult to predict how any individual tumor is going to behave. The variability thus creates uncertainty in deciding what a particular dog's prognosis is, whether staging tests to assess for metastasis are needed, and even what treatments will be necessary for best outcome. In addition to controversies over the potential for development of systemic disease, or diffuse metastasis, controversies also exist over what treatment is needed to best attain local control of these tumors. This article will briefly discuss the diagnosis of MCTs in dogs and will summarize the literature in regards to the controversial topics surrounding the more aggressive form of this disease, with recommendations made based on published studies. Keywords: mitotic index, mastocytosis, tyrosine kinase inhibitor, histologic grade
J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides
2002-01-01
Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...
Characterization of the canine urinary proteome.
Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E
2014-06-01
Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.
Prevalence of human papilloma virus and human herpes virus types 1-7 in human nasal polyposis.
Zaravinos, Apostolos; Bizakis, John; Spandidos, Demetrios A
2009-09-01
This study aimed to investigate the prevalence of human papilloma virus (HPV), herpes simplex virus-1/-2 (HSV-1/-2), varicella-zoster virus (VZV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), and human herpes virus-6/-7 (HHV-6/-7) in 23 human nasal polyps by applying PCR. Two types of control tissues were used: adjacent inferior/middle turbinates from the patients and inferior/middle turbinates from 13 patients undergoing nasal corrective surgery. EBV was the virus most frequently detected (35%), followed by HPV (13%), HSV-1 (9%), and CMV (4%). The CMV-positive polyp was simultaneously positive for HSV-1. HPV was also detected in the adjacent turbinates (4%) and the adjacent middle turbinate (4%) of one of the HPV-positive patients. EBV, HSV, and CMV were not detected in the adjacent turbinates of the EBV-, HSV- or CMV-positive patients. All mucosae were negative for the VZV, HHV-6, and HHV-7. This is the first study to deal with the involvement of a comparable group of viruses in human nasal polyposis. The findings support the theory that the presence of viral EBV markedly influences the pathogenesis of these benign nasal tumors. The low incidence of HPV detected confirms the hypothesis that HPV is correlated with infectious mucosal lesions to a lesser extent than it is with proliferative lesions, such as inverted papilloma. The low incidence of HSV-1 and CMV confirms that these two herpes viruses may play a minor role in the development of nasal polyposis. Double infection with HSV-1 and CMV may also play a minor, though causative, role in nasal polyp development. VZV and HHV-6/-7 do not appear to be involved in the pathogenesis of these mucosal lesions.
Subjective Evaluation of Vocal Quality in Nasal Polyposis
Directory of Open Access Journals (Sweden)
Ziya Saltürk
2014-12-01
Full Text Available Aim: Nose is a resonator organ in production of voice. The aim of this study was to evaluate the effects of nasal obstruction caused by nasal polyposis on voice quality subjectively. Methods: Thirty-six patients diagnosed with nasal polyposis were included in the study. The 30-item voice handicap index 30 was used in order to evaluate subjective status of voice. Nasal endoscopy and computed tomography imaging of the paranasal sinuses were performed for each patient. Lund-Kennedy endoscopy scores and Lund-MacKay computed tomography scores were evaluated. Control group composed of 20 healthy subjects. Results: The mean voice handicap score in the patient group was 43.16 (SD 15.53 and it was 2.15 (SD 1.92 in control group. There was a statistically significant difference between the groups (p=0.001. The mean Lund-Kennedy and Lund-Mackay scores were 8.58 (SD 2.5 and 17 (SD 5.52, respectively. It was found that increased severity of nasal polyposis was the cause for decreased satisfaction with voice quality. Conclusion: Nasal obstruction caused by nasal polyposis affects voice quality adversely and as the severity of nasal polyposis increases, satisfaction with voice quality decreases.
Tong, Xuwen; Dong, Jingliang; Shang, Yidan; Inthavong, Kiao; Tu, Jiyuan
2016-10-01
In this study, the effects of nasal drug delivery device and the spray nozzle orientation on sprayed droplets deposition in a realistic human nasal cavity were numerically studied. Prior to performing the numerical investigation, an in-house designed automated actuation system representing mean adults actuation force was developed to produce realistic spray plume. Then, the spray plume development was filmed by high speed photography system, and spray characteristics such as spray cone angle, break-up length, and average droplet velocity were obtained through off-line image analysis. Continuing studies utilizing those experimental data as boundary conditions were applied in the following numerical spray simulations using a commercially available nasal spray device, which was inserted into a realistic adult nasal passage with external facial features. Through varying the particle releasing direction, the deposition fractions of selected particle sizes on the main nasal passage for targeted drug delivery were compared. The results demonstrated that the middle spray direction showed superior spray efficiency compared with upper or lower directions, and the 10µm agents were the most suitable particle size as the majority of sprayed agents can be delivered to the targeted area, the main passage. This study elaborates a comprehensive approach to better understand nasal spray mechanism and evaluate its performance for existing nasal delivery practices. Results of this study can assist the pharmaceutical industry to improve the current design of nasal drug delivery device and ultimately benefit more patients through optimized medications delivery. Copyright © 2016 Elsevier Ltd. All rights reserved.
... shrink polyps, and can reduce swelling and nasal congestion. The effect lasts a few months in most ... this procedure, your doctor uses a thin, lighted tube with instruments at the end. The tube is ...
International Nuclear Information System (INIS)
Tamburini, Beth A; Cutter, Gary R; Wojcieszyn, John W; Bellgrau, Donald; Gemmill, Robert M; Hunter, Lawrence E; Modiano, Jaime F; Phang, Tzu L; Fosmire, Susan P; Scott, Milcah C; Trapp, Susan C; Duckett, Megan M; Robinson, Sally R; Slansky, Jill E; Sharkey, Leslie C
2010-01-01
The etiology of hemangiosarcoma remains incompletely understood. Its common occurrence in dogs suggests predisposing factors favor its development in this species. These factors could represent a constellation of heritable characteristics that promote transformation events and/or facilitate the establishment of a microenvironment that is conducive for survival of malignant blood vessel-forming cells. The hypothesis for this study was that characteristic molecular features distinguish hemangiosarcoma from non-malignant endothelial cells, and that such features are informative for the etiology of this disease. We first investigated mutations of VHL and Ras family genes that might drive hemangiosarcoma by sequencing tumor DNA and mRNA (cDNA). Protein expression was examined using immunostaining. Next, we evaluated genome-wide gene expression profiling using the Affymetrix Canine 2.0 platform as a global approach to test the hypothesis. Data were evaluated using routine bioinformatics and validation was done using quantitative real time RT-PCR. Each of 10 tumor and four non-tumor samples analyzed had wild type sequences for these genes. At the genome wide level, hemangiosarcoma cells clustered separately from non-malignant endothelial cells based on a robust signature that included genes involved in inflammation, angiogenesis, adhesion, invasion, metabolism, cell cycle, signaling, and patterning. This signature did not simply reflect a cancer-associated angiogenic phenotype, as it also distinguished hemangiosarcoma from non-endothelial, moderately to highly angiogenic bone marrow-derived tumors (lymphoma, leukemia, osteosarcoma). The data show that inflammation and angiogenesis are important processes in the pathogenesis of vascular tumors, but a definitive ontogeny of the cells that give rise to these tumors remains to be established. The data do not yet distinguish whether functional or ontogenetic plasticity creates this phenotype, although they suggest that cells
Directory of Open Access Journals (Sweden)
Slansky Jill E
2010-11-01
Full Text Available Abstract Background The etiology of hemangiosarcoma remains incompletely understood. Its common occurrence in dogs suggests predisposing factors favor its development in this species. These factors could represent a constellation of heritable characteristics that promote transformation events and/or facilitate the establishment of a microenvironment that is conducive for survival of malignant blood vessel-forming cells. The hypothesis for this study was that characteristic molecular features distinguish hemangiosarcoma from non-malignant endothelial cells, and that such features are informative for the etiology of this disease. Methods We first investigated mutations of VHL and Ras family genes that might drive hemangiosarcoma by sequencing tumor DNA and mRNA (cDNA. Protein expression was examined using immunostaining. Next, we evaluated genome-wide gene expression profiling using the Affymetrix Canine 2.0 platform as a global approach to test the hypothesis. Data were evaluated using routine bioinformatics and validation was done using quantitative real time RT-PCR. Results Each of 10 tumor and four non-tumor samples analyzed had wild type sequences for these genes. At the genome wide level, hemangiosarcoma cells clustered separately from non-malignant endothelial cells based on a robust signature that included genes involved in inflammation, angiogenesis, adhesion, invasion, metabolism, cell cycle, signaling, and patterning. This signature did not simply reflect a cancer-associated angiogenic phenotype, as it also distinguished hemangiosarcoma from non-endothelial, moderately to highly angiogenic bone marrow-derived tumors (lymphoma, leukemia, osteosarcoma. Conclusions The data show that inflammation and angiogenesis are important processes in the pathogenesis of vascular tumors, but a definitive ontogeny of the cells that give rise to these tumors remains to be established. The data do not yet distinguish whether functional or ontogenetic
STRATEGIES AND PROSPECTS OF NASAL DRUG DELIVERY SYSTEMS
Gannu Praveen Kumar
2012-01-01
The recent advancement of nasal drug delivery systems has increased enormously and is gaining significant importance. Intranasal therapy has been an accepted form of treatment in the Ayurvedic system of Indian Medicine. The non-invasive delivery of nasal drug delivery systems made to exploit for the development of successful treatment. The advantages, disadvantages, mechanism of action and application of nasal drug delivery system in local delivery, systematic delivery, nasal vaccines and CNS...
Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J
2012-12-01
To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.
Freeman, A Courtenay; Platt, Simon R; Holmes, Shannon; Kent, M; Robinson, Kelsey; Howerth, Elizabeth; Eagleson, Joe; Bouras, Alexandros; Kaluzova, Milota; Hadjipanayis, Constantinos G
2018-05-01
Cetuximab conjugated iron-oxide nanoparticles (cetuximab-IONPs) have shown both in-vitro and in-vivo anti-tumor efficacy against gliomas. The purpose of this pilot study was to evaluate the safety and potential efficacy of cetuximab-IONPs for treatment of spontaneously occurring intracranial gliomas in canines after convection-enhanced delivery (CED). The use of CED allowed for direct infusion of the cetuximab-IONPs both intratumorally and peritumorally avoiding the blood brain barrier (BBB) and limiting systemic effects. A total of eight dogs participated in the study and only two developed mild post-operative complications, which resolved with medical therapy. All canines underwent a single CED treatment of the cetuximab-IONPs over 3 days and did not receive any further adjuvant treatments. Volumetric analysis showed a median reduction in tumor size of 54.9% by MRI at 1-month (4-6 weeks) follow-up. Five dogs were euthanized due to recurrence of neurological signs other than seizures, two due to recurrent seizures, and one dog died in his sleep. Median survival time after surgery was 248 days (mean 367 days).
A Study of the Pathomorphology of Non-Neoplastic Changes in Canine Mammary Glands
Knauer, Steffen
2010-01-01
Whilst neoplasia in canine mammae has been the subject of a considerable number of studies, little is known about non-neoplastic changes of the mammae. The aim of the present study was therefore to conduct pathological anatomical and histopathological examinations of mammary glands in order to draw up a survey of the type and frequency of non-tumorous changes in the lactiferous tissues. The material under examination consis...
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki
2011-09-01
Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.
Directory of Open Access Journals (Sweden)
Rabiu O. Jimoh
2011-10-01
Full Text Available Nasal parameters measurements are useful in anthropology to distinguish people into racial and ethnic groups. MATERIALS AND METHODS: A cross-sectional survey among Nigerians aged 18 to 70 years of Nigerian parentage randomly selected at the ENT Clinic of the University of Ilorin teaching hospital (U.I.T.H., Ilorin, Nigeria without gender discrimination had measurement of their nasal parameters done using a sliding caliper: Nasal height, width, tip protrusion, alar thickness, nasal septal thickness and nares diameter. RESULTS: 105 subjects were seen, the age range 18 to 70 years (mean of 28.63 + 13.06 years. There was 58 males and 47 females with a male/female ratio of 1.2:1. The mean nasal width/height (Nasal index -NI was 90.7 in males and 88.2 in females. Males had a higher NI compared to female (p As medidas de parâmetros nasais são úteis em antropologia para distinguir pessoas em grupos étnicos e raciais. MATERIAIS E MÉTODOS: Pesquisa transversal entre nigerianos com idades entre 18 e 70 anos, filhos de pais nigerianos, aleatoriamente selecionados na clínica de otorrinolaringologia do Hospital Universitário de Ilorin (U.I.T.H., Ilorin, Nigéria; sem discriminação de gênero, tiveram seus parâmetros nasais medidos usando-se um compasso deslizante: altura nasal, largura, protrusão da ponta, espessura alar, espessura do septo nasal e diâmetro das narinas. RESULTADOS: 105 indivíduos foram avaliados, e suas idades variaram entre 18 e 70 anos (média de 28,63 + 13,06 anos. Havia 58 homens e 47 mulheres, com coeficiente entre homens de mulheres de: 1.2:1. A medida largura/ altura nasal média (Índice nasal - IN foi de 90,7 em homens e 88,2 em mulheres. Os homens tiveram IN mais alto quando comparados às mulheres (p < 0,03. O tipo mais comum de variabilidade nasal foi o Tipo A (70,5%, Platirrinia, Tipo B (26,7%, especialmente em mulheres, (mosorrinia e o Tipo C (leptorrinia (2,8%. CONCLUSÕES: Há associação significativa entre o g
Nasal Myiasis in Hinduism and Contemporary Otorhinolaryngology.
Bosmia, Anand N; Zimmermann, Terence M; Griessenauer, Christoph J; Shane Tubbs, R; Rosenthal, Eben L
2017-08-01
Various case reports on nasal myiasis written during the 1990s and 2000s state that nasal myiasis, which is known as peenash among South Asian natives, is a form of divine punishment in Hindu mythology, but do not provide citations from Hindu scriptures that would suggest this interpretation. This paper aims to discuss the phenomenon of peenash in a historical context by examining medical literature written during the nineteenth and early twentieth centuries, to identify Hindu texts contributing to the belief of some Hindus that nasal myiasis is a form of divine punishment, and to provide an overview of contemporary treatment for and management of nasal myiasis.
Rassnick, Kenneth M.; Muindi, Josephia R.; Johnson, Candace S.; Balkman, Cheryl E.; Ramnath, Nithya; Yu, Wei-Dong; Engler, Kristie L.; Page, Rodney L.; Trump, Donald L.
2009-01-01
Purpose Calcitriol potentiates cisplatin-mediated activity in a variety of tumor models. We examine here, the effect of calcitriol and cisplatin pre-clinically and clinically in canine spontaneous tumors through in vitro studies on tumor cells and through a phase I study of calcitriol and cisplatin to identify the maximum-tolerated dosage (MTD) of this combination in dogs with cancer and to characterize the pharmacokinetic disposition of calcitriol in dogs. Methods Canine tumor cells were investigated for calcitriol/cisplatin interactions on proliferation using an MTT assay in a median-dose effect analysis; data were used to derive a combination index (CI). Cisplatin was given at a fixed dosage of 60 mg/m2. Calcitriol was given i.v. and the dosage was escalated in cohorts of three dogs until the MTD was defined. Serum calcitriol concentrations were quantified by radioimmunoassay. Results In vitro, CIs1.5 μg/kg achieved Cmax ≥ 9.8 ng/mL and dosages >1.0 μg/kg achieved AUC ≥ 45 h ng/mL. Conclusions Calcitriol and cisplatin have synergistic antiproliferative effects on multiple canine tumor cells and high-dosages of i.v. calcitriol in combination with cisplatin can be safely administered to dogs. Cmax and AUC at the MTD 3.75 μg/kg calcitriol exceed concentrations associated with antitumor activity in a murine model, indicating this combination might have significant clinical utility in dogs. PMID:18246349
Unilateral nasal pain with migraine features.
Alvarez, Mónica; Montojo, Teresa; de la Casa, Beatriz; Vela, Lydia; Pareja, Juan A
2013-09-01
Migraine attacks exclusively felt in the face are very rare, the pain involving the territories supplied by the second and third branches of the trigeminal nerve. Two patients suffering from heminasal pain attacks accompanied with typical migrainous features and responsive to oral or intranasal triptans - but not to intranasal lidocaine or oxymetazoline. In one patient, the attacks could be precipitated upon slight touching on the tip of the nose, in the other attacks were preceded by the nasal sensation typically heralding sneezing. Migraine pain mostly develops within the innervation territory of the first branch of the trigeminal nerve, which includes the nose. Therefore, episodes of unilateral nasal pain with migrainous features could be considered a migraine with unusual topography (nasal migraine). Painful nasal attacks occasionally preceded by stimulation of trigeminal afferents in the nose, could be conceived of as migraine-tic syndrome.
Directory of Open Access Journals (Sweden)
Cornelia Egger
Full Text Available Allergen exposure via the respiratory tract and in particular via the nasal mucosa boosts systemic allergen-specific IgE production. Intranasal corticosteroids (INCS represent a first line treatment of allergic rhinitis but their effects on this boost of allergen-specific IgE production are unclear.Here we aimed to determine in a double-blind, placebo-controlled study whether therapeutic doses of an INCS preparation, i.e., nasal fluticasone propionate, have effects on boosts of allergen-specific IgE following nasal allergen exposure.Subjects (n = 48 suffering from grass and birch pollen allergy were treated with daily fluticasone propionate or placebo nasal spray for four weeks. After two weeks of treatment, subjects underwent nasal provocation with either birch pollen allergen Bet v 1 or grass pollen allergen Phl p 5. Bet v 1 and Phl p 5-specific IgE, IgG1-4, IgM and IgA levels were measured in serum samples obtained at the time of provocation and one, two, four, six and eight weeks thereafter.Nasal allergen provocation induced a median increase to 141.1% of serum IgE levels to allergens used for provocation but not to control allergens 4 weeks after provocation. There were no significant differences regarding the boosts of allergen-specific IgE between INCS- and placebo-treated subjects.In conclusion, the application of fluticasone propionate had no significant effects on the boosts of systemic allergen-specific IgE production following nasal allergen exposure.http://clinicaltrials.gov/NCT00755066.
Rhinoescleroma and nasal syphilis cases treated with radiotherapy (1935)
International Nuclear Information System (INIS)
Barbosa, German; Pineros, Marion
2004-01-01
A review is presented of patient with rhinoescleroma, corresponding to the first years of operation of the then National Institute of Radium. It is a 35 year-old patient, the current illness it began before three years with a frequent nasal cold and difficulty of the step of the air until arriving to the total obstruction; additionally, a mass appears inside the nose, with painful ulceration that extends, first to the lip, to the hard palate and the place of installation of the teeth, and then to the part previous of the palatine vault, with fall of the teeth and communication with the skin. The patient also refers loss of the audition of the left side. The tumor to the physical exam measures 6 centimeters of diameter and of height, and there is extension with ulceration of the vestibular area. The rhinoscopy shows obstruction with ulceration and purulent secretion. The x-rays of July 9 1935 show partial destruction of the maxillary superiors that includes the alveolar edges, the palatine apophysis and the nasal spine. In the clinical history, it reports two biopsies; the biopsy of the nose concludes that it is a rhinoescleroma with atypical epithelioma and the biopsy gingival says that it is an incipient epithelioma spine-cellular
The effect of nasal surgery on apnea-hypopnea index
Directory of Open Access Journals (Sweden)
Navid Nourizadeh
2014-04-01
Full Text Available One of the factors, which is involved in obstructive sleep apnea, is anatomic or inflammatory pathologies of nasal airway obstruction. Thus, it is logical to observe improvement of polysomnographic parameters of sleep-disordered breathing after nasal surgery. The authors performed a review of the literature, up to 2013, to determine the impact of nasal surgery on obstructive sleep apnea. Most current idea in this field is based on case series studies while randomized controlled trials evaluating the effect of surgery for nasal obstruction on sleep apnea are few and far between. According to these studies, surgery for nasal obstruction does not improve objective parameters of sleep apnea. Although nasal obstruction is one of the factors involved in obstructive apnea, one has to keep in mind that surgery will not result in major reduction of obstructive sleep apnea severity to relieve nasal obstruction. Detailed upper airway analysis has to be considered when surgery is an option for obstructive sleep apnea. Thus, nasal surgeries are beneficial when they are part of a multilevel approach in obstructive sleep apnea treatment.
Patient experience with mupirocin or povidone-iodine nasal decolonization.
Maslow, Jed; Hutzler, Lorraine; Cuff, Germaine; Rosenberg, Andrew; Phillips, Michael; Bosco, Joseph
2014-06-01
Led by the federal government, the payers of health care are enacting policies designed to base provider reimbursement on the quality of care they render. This study evaluated and compared patient experiences and satisfaction with nasal decolonization with either nasal povidone-iodine (PI) or nasal mupirocin ointment (MO). A total of 1903 patients were randomized to undergo preoperative nasal decolonization with either nasal MO or PI solution. All randomized patients were also given 2% chlorhexidine gluconate topical wipes. Patients were interviewed prior to discharge to assess adverse events and patient experience with their assigned preoperative antiseptic protocol. Of the 1903 randomized patients, 1679 (88.1%) were interviewed prior to discharge. Of patients receiving PI, 3.4% reported an unpleasant or very unpleasant experience, compared with 38.8% of those using nasal MO (P.05). Being recruited as an active participant in surgical site infection prevention was a positive experience for 87.2% of MO patients and 86.3% of PI patients (P=.652). Those assigned to receive PI solution preoperatively reported significantly fewer adverse events than the nasal MO group (P<.01). Preoperative nasal decolonization with either nasal PI or MO was considered somewhat or very helpful by more than two-thirds of patients. Copyright 2014, SLACK Incorporated.
Characterization of nasal cavity-associated lymphoid tissue in ducks.
Kang, Haihong; Yan, Mengfei; Yu, Qinghua; Yang, Qian
2014-05-01
The nasal mucosa is involved in immune defense, as it is the first barrier for pathogens entering the body through the respiratory tract. The nasal cavity-associated lymphoid tissue (NALT), which is found in the mucosa of the nasal cavity, is considered to be the main mucosal immune inductive site in the upper respiratory tract. NALT has been found in humans and many mammals, which contributes to local and systemic immune responses after intranasal vaccination. However, there are very few data on NALT in avian species, especially waterfowl. For this study, histological sections of the nasal cavities of Cherry Valley ducks were used to examine the anatomical location and histological characteristics of NALT. The results showed that several lymphoid aggregates are present in the ventral wall of the nasal cavity near the choanal cleft, whereas several more lymphoid aggregates were located on both sides of the nasal septum. In addition, randomly distributed intraepithelial lymphocytes and isolated lymphoid follicles were observed in the regio respiratoria of the nasal cavity. There were also a few lymphoid aggregates located in the lamina propria of the regio vestibularis, which was covered with a stratified squamous epithelium. This study focused on the anatomic and histological characteristics of the nasal cavity of the duck and performed a systemic overview of NALT. This will be beneficial for further understanding of immune mechanisms after nasal vaccination and the development of effective nasal vaccines for waterfowls. Copyright © 2014 Wiley Periodicals, Inc.
Nasal reaction to changes in whole body temperature.
Lundqvist, G R; Pedersen, O F; Hilberg, O; Nielsen, B
1993-11-01
The changes in nasal patency following a 1.5 degrees C decrease or increase in whole body temperature were measured in 8 healthy young males, during and after 30 min of immersion in a 15 degrees C cold or a 40 degrees C warm bath, breathing air at the same temperature, in a cross-over experimental design. The nasal reactions were traced by consecutive measurements of changes in nasal cavity volumes by acoustic rhinometry. Swelling of the mucosa during cooling and an almost maximal shrinkage of the mucosa during heating were indicated by respectively a decrease and an increase in nasal cavity volumes. The reactions were determined predominantly by the whole body thermal balance, but were also influenced by the temperature of the inhaled air, either enhanced, reduced or temporarily reversed. The greatest change occurred in the nasal cavity, left or right, which differed most from the final state at the beginning of exposure due to the actual state of nasal cycle.
Directory of Open Access Journals (Sweden)
Filipe Braz
2015-10-01
Full Text Available A prevalência da obstrução nasal vem crescendo nos últimos anos. A obstrução nasal tem como causa etiológica uma série de patologias as mais comuns são: polipose nasal, rinossinusites, doenças metabólicas, defeito septal, corpos estranhos, tumores. Pacientes que sofrem de obstrução nasal além de possuírem os sintomas clássicos de coriza, distúrbios do olfato, apresentam também uma perda significativa na qualidade de vida, uma vez que a acarreta alterações nas atividades cotidianas como: insônia e ronco noturno e apneia, dificuldade na prática de exercício físico. O trabalho visa mensurar o quanto as cirurgias funcionais nasais melhoram a qualidade de vida e a permeabilidade das vias aéreas superiores de pacientes com obstrução nasal, e se a melhora é apenas no pós operatório imediato ou se essa é a longo prazo. Para tal objetivo, o estudo utilizará de duas ferramentas sendo uma delas uma escala objetiva e a outra subjetiva. A escala objetiva de uso será o peak flow nasal inspiratório, aparelho capaz de avaliar a permeabilidade das vias aéreas proximais, sendo assim capaz de mensurar o grau da obstrução nasal. Já a escala subjetiva de escolha é Nasal Obstruction Syndrome Evaluation (NOSEscale, sendo hoje uma referência para estudos que visam avaliar a obstrução nasal sobre a qualidade de vida e comparar o pré e pós de tratamentos clínicos e cirúrgicos. Realizada a analise dos 30 pacientes, a cirurgia funcional nasal se mostrou muito benéfica revelando uma melhora na escala NOSE de 76% e no Peak Flow de 65%. O estudo tem como objetivo secundário comparar a evolução dos pacientes no primeiro e no sexto mês de pós operatório. Os pacientes apresentaram uma melhora de 18% no NOSE e de 8% no Peak Flow, revelando uma melhora no pós-operatório mais tardio. Em relação à melhora dos pacientes após o ato cirúrgico, notamos que nenhum dos pacientes passa a apresentar um peak flow
Current aspects in reconstructive surgery for nasal cavity and paranasal sinus cancer
Shtin, V. I.; Novikov, V. A.; Gjunter, V. E.; Choinzonov, E. L.; Ryabova, A. I.; Sirkashev, V. A.; Surkova, P. V.; Vasilev, R. V.; Menkova, E. N.
2017-09-01
Tumors of the nasal cavity and paranasal sinuses present a challenge to treat them. A combination of surgery and radiation therapy can improve treatment outcomes in 49-56% [1, 2] of the patients with locally advanced nasal cavity and paranasal sinus cancer. The midface reconstruction poses a formidable challenge to the reconstructive surgeon due to the region's complex skeletal and soft-tissue anatomy. The rehabilitation program including the reconstruction of the resected orbital walls using the porous and mesh implants from titanium nickelid (TiNi) was developed at the Cancer Research institute jointly with the Research Institute of Medical Materials. The technique was proven effective, allowing the natural position of the eye and visual function to be preserved in 90% [1-3] of the patients. A long period of reparative processes and risk of developing inflammation in the implant area, as well as the need to decrease length of surgery, contributed to the development of a novel approach to repairing the midface bone structures using the implant based on the microporous wire and TiNi mesh. Eighteen patients with nasal cavity and paranasal sinus cancer were treated using the combined thin implants. The novel technique allowed the time of the implant installation to be reduced to 5-10 min. The structure of the implant contributed to prevention of inflammatory processes in 97% [1, 2] of cases. Thus, the natural position of the eyeball and visual function were preserved in 100% [1, 3, 4] of patients. The use of the TiNi implants in reconstructive surgery for patients with nasal cavity and paranasal sinus cancer led to reduced time of surgery and rehabilitation, increased level of social adaptation of patients and improved cosmetic and functional results.
C-kit expression in canine mucosal melanomas.
Newman, S J; Jankovsky, J M; Rohrbach, B W; LeBlanc, A K
2012-09-01
The c-kit receptor is responsible for transmission of promigration signals to melanocytes; its downregulation may be involved in malignant progression of human melanocytic neoplasms. Expression of this receptor has not been examined in normal or neoplastic melanocytes from dogs. In this study, 14 benign dermal and 61 malignant mucosal melanocytic tumors were examined for c-kit (KIT) expression. Sites of the mucosal melanomas were gingiva (not further specified; n = 30), buccal gingiva (n = 6), soft palate (n = 4), hard palate (n = 5), tongue (n = 7), lip (n = 6), and conjunctiva (n = 3). Melan A was expressed in all 14 dermal melanocytomas and in 59 of 61 (96.7%) tumors from oral or conjunctival mucosa, confirming melanocytic origin. C-kit receptor expression was strong and diffuse throughout the cytoplasm in all 14 dermal melanocytomas and was identified in basilar mucosal melanocytes over submucosal neoplasms (27 of 61, 44.3%), junctional (neoplastic) melanocytes (17 of 61, 27.9%), and, less commonly, neoplastic melanocytes of the subepithelial tumors (6 of 61, 9.8%). KIT expression anywhere within the resected melanomas correlated with significantly longer survival. These results suggest that c-kit receptor expression may be altered in canine melanomas and may have potential as a prognostic indicator for mucosal melanomas.
Mastocitoma cutâneo canino: estudo de 45 casos Canine cutaneous mast cell tumor: study of 45 cases
Directory of Open Access Journals (Sweden)
R.R. Rech
2004-08-01
Full Text Available Quarenta e cinco mastocitomas cutâneos caninos foram graduados histologicamente com o uso de hematoxilina-eosina. Foram empregados os métodos azul de toluidina e região organizadora nucleolar argirofílica (AgNOR para, respectivamente, evidenciar os grânulos citoplasmáticos e avaliar o índice de proliferação celular. Diversas características histológicas foram observadas, como distribuição das células na pele, tamanho, forma, aspecto de citoplasma e núcleo, quantidade de estroma, presença de eosinófilos e alterações associadas. Com base nessas caracteríscas, 37,8% dos mastocitomas foram classificados como grau I, 51,1% como grau II e 11,1% como grau III. A média geral de AgNOR nos mastocitomas foi de 1,9 (1,2 a 4,3 e as médias para os graus I, II e III foram, respectivamente, de 1,5, 1,85 e 3,25. A técnica de AgNOR mostrou ser de fácil execução, custo acessível e confiável como meio auxiliar para estimar um prognóstico mais objetivo para os mastocitomas.Forty-five cutaneous canine mast cell tumors were graded histologically on haematoxylin and eosin-stained sections. Toluidine blue and AgNOR methods were employed to enhance the intracytoplasmic granules and to assess cell proliferation, respectively. From these 45 samples histological features were observed as cell distribution, size, shape, nuclear and cytoplasmic appearance, amount of stroma, presence of eosinophils and some associated changes. Based on those features, 37.8% of the mast cell tumors were classified as grade I, 51.1% as grade II and 11.1% as grade III. General AgNOR mean value was 1.9 (range 1.2-4.3 whereas the means for grades I, II and III were, respectively, 1.2, 1.85 and 3.25. The AgNOR method proved to be feasible, inexpensive and a reliable tool to predict a more accurate prognosis for mast cell tumors.
Kartagener's syndrome presented with nasal obstruction: A case report
Directory of Open Access Journals (Sweden)
Suna Asilsoy
2014-08-01
Full Text Available The nasal polyposis is a chronic inflammatory process of the nasal mucosa. Although it is rare in children, there may be also association with cystic fibrosis and primary ciliary dyskinesia. About 50% of primary ciliary dyskinesia patients develop situs inversus and it is known as Kartagener's syndrome. The Kartagener's sydrome is a rare autosomal recessive disorder characterized by sinusitis, bronchiectasis, situs inversus. Clinically, patients present to the otolaryngologist with nasal obstruction. We as pediatricians, should consider nasal polyposis as a rare cause of nasal obstruction in children. In the presence of recurrent upper and lower respiratory tract infections accompanying nasal polyposis, Kartagener's syndrome must be kept in mind as a rare reason. [Cukurova Med J 2014; 39(4.000: 942-945
Tumores de la nasofaringe en la infancia
Directory of Open Access Journals (Sweden)
José Vargas Díaz
2002-03-01
Full Text Available Los tumores de la nasofaringe son poco frecuentes en la infancia. Su forma clínica de presentación característica y la posibilidad de realizar un diagnóstico temprano e indicar el tratamiento oportuno, permitiría modificar favorablemente la evolución y el pronóstico de estos pacientes. Se reporta una serie de 4 niños con tumores de la nasofaringe (2 linfoepiteliomas y 2 neuroblastomas atendidos en el Hospital Infantil Docente "Pedro Borrás Astorga". Todos los pacientes mostraron en algún momento de su evolución obstrucción nasal unilateral y epistaxis. El 50 % de los casos comenzó su enfermedad presentando cefaleas y uno de ellos lo hizo con compromiso de pares craneales (VII, VI, IV, VI. La radioterapia representa la modalidad de tratamiento más útil y la resonancia magnética nuclear resulta de gran valor para el diagnóstico inicial, así como para la identificación de la recidiva tumoral.Nasopharyngeal tumors are infrequent in childhood. Their characteristic clinical presentation and the possibility of making an early diagnosis and indicating an adequate treatment will allow positively changing the development and prognosis of the patients. Four children with nasopharyngeal tumors (two lymphoepitheliomas and two neuroblastomas, who were seen at "Pedro Borrás Astorga" Teaching Pediatric Hospital, are reported. All the patients showed at some moment of the disease development unilateral nasal obstruction and epistaxis. 50% of the cases had headaches at the beginning of the disease whereas one of them had involvement of cranial pairs (7th,6th, 4th,6th. Radiotherapy represents the most useful treatment and nuclear magnetic resonance is of great value for the initial diagnosis and the identification of tumor relapse.
Effects of retro-nasal aroma release on satiation
Ruijschop, R.; Boelrijk, A.E.M.; Ru, de J.A.; Graaf, de C.; Westerterp-Plantenga, M.
2008-01-01
It is suggested that the brain response of a food odour sensed retro-nasally is related to satiation. The extent of retro-nasal aroma release during consumption depends on the physical structure of a food, i.e. solid foods generate a longer, more pronounced retro-nasal aroma release than liquid
Nasal morphological characteristics of the Serbian population
Jovanović J.; Jeremić D.; Jovanović B.; Vulović Maja; Sazdanović P.; Sazdanović Maja; Ognjanović Neda; Stojadinović D.; Jeremić Katarina; Marković N.; Živanović-Mačužić Ivana
2014-01-01
The aim of this study was to determine the nasal parameters in the population of central Serbia and to compare them with those determined in earlier studies in different populations. The research was conducted on 496 randomly selected persons (262 males and 234 females), aged 18-65 years. The measured parameters were nasal height and nasal breadth and the standard spreading caliper with scale was used for measurements. There were significant differences in ...
Clinical aspects of patients with nasal polyposis
Directory of Open Access Journals (Sweden)
Crespo, Cassio Caldini
2009-09-01
Full Text Available Introduction: The nasal Polyposis is a non-neoplastic chronic inflammatory process of the nasal mucosa. It causes a large impact to the patients' life quality. Objective: To analyze the characteristics of patients with polyposis in the Brazilian population. Method: 50 records of patients followed up in a tertiary hospital and submitted to surgical treatment of nasal polyposis were reviewed. The following variables were analyzed: age, sex, smoking, presence of asthma, presence of AAS intolerance and also the clinical manifestations: anterior and posterior rhinorrhea, nasal obstruction, hyposmia, sneezing and pruritus. The tomographic evaluation system applied was that of Lund-McKay. For statistical analysis we applied the chi-square test with p<0.05. Results: Out of 50 patients evaluated, 28 were male and 22 were female. The mean age range was of 40.8 years. The main clinical manifestation was nasal obstruction in 100% of the patients. In the tomographic evaluation, according to the Lund-McKay system, the average scoring was of 10.9. Discussion: No statistically significant difference was obtained in the patients' general symptoms compared to the patients with asthma or AAS intolerance. The difference in the Lund-McKay score was statistically significant in the populations studied. The symptoms were similar to the frequency of symptoms of other works. Conclusion: We concluded that the main complaint of the patients with nasal polyposis is nasal obstruction, the most affected age is of about 40 years old, without preference of sex. The severity of tomographic findings is higher in patients with asthma and AAS intolerance.
Torres, Cristian Gabriel; Pino, Ana María; Sierralta, Walter Daniel
2009-06-01
The effects of estradiol (E2) and of an AFP-derived cyclized peptide (cP) on the proliferation of primary cultures of cancer cells isolated from spontaneous canine mammary tumors were studied. The cellular response to E2 and cP was related to the expression of estradiol receptor (isoforms alpha and beta). In ER-positive cells, 2 nM estradiol increased cell proliferation and the phosphorylation of ERK1/2; 2 microg/ml cP inhibited all these effects. Estradiol also increased HER2 immunoreactivity in ER-positive cells, an effect that was reverted to its basal values by cP. Estradiol stimulated in these cells the release of MMP2 and MMP9 and the shedding of HB-EGF, effects that the cP did not affect. ER-negative cells were refractory to estradiol or cP. All canine mammary tumor cells in culture responded to treatments analogously to human mammary cancer cells. Our results support the proposal of cP as a new, potentially effective therapeutic agent for the management of mammary cancer.
Kundoor, Vipra; Dalby, Richard N
2011-08-01
To systematically evaluate the effect of formulation- and administration-related variables on nasal spray deposition using a nasal cast. Deposition pattern was assessed by uniformly coating a transparent nose model with Sar-Gel®, which changes from white to purple on contact with water. Sprays were subsequently discharged into the cast, which was then digitally photographed. Images were quantified using Adobe® Photoshop. The effects of formulation viscosity (which influences droplet size), simulated administration techniques (head orientation, spray administration angle, spray nozzle insertion depth), spray pump design and metering volume on nasal deposition pattern were investigated. There was a significant decrease in the deposition area associated with sprays of increasing viscosity. This appeared to be mediated by an increase in droplet size and a narrowing of the spray plume. Administration techniques and nasal spray pump design also had a significant effect on the deposition pattern. This simple color-based method provides quantitative estimates of the effects that different formulation and administration variables may have on the nasal deposition area, and provides a rational basis on which manufacturers of nasal sprays can base their patient instructions or post approval changes when it is impractical to optimize these using a clinical study.
LENUS (Irish Health Repository)
O'Donnell, Sinéad M
2013-07-01
To determine if low-flow nasal prongs therapy with room air, compared with no treatment, facilitates weaning from nasal continuous positive airway pressure (NCPAP) in very low birth weight (VLBW, birth weight <1500 g) infants.
International Nuclear Information System (INIS)
Stankeova, S.; Kaser-Hotz, B.; Crompton, N.E.A.; Blattmann, H.; Theiler, P.; Emery, G.C.; Roos, M.
2003-01-01
Background: Evaluation of radiation-induced apoptosis in T-lymphocytes was developed for human medicine in order to predict the sensitivity of individual patients to radiation therapy and has regular use in cases of suspected hypersensitivity. A major goal of the present study was to evaluate the usefulness of the apoptosis assay in veterinary medicine for application in radiation sensitivity testing. The main goal was to examine potential changes in sensitivity of T-lymphocytes to radiation-induced apoptosis during the course of radiation treatment. This is a clear example of the advantageous use of spontaneous canine tumors to augment human cancer research. Material and Methods: Blood was collected in heparin tubes, diluted 1:10 in RPMI medium, irradiated with X-rays and incubated for 48 h. T-lymphocytes were labeled using FITC-conjugated antibodies, erythrocytes were lysed, and DNA stained with propidium iodide. For cell analysis, a Becton Dickinson FACScan flow cytometer was used. Radiation-induced apoptosis in T-lymphocytes was quantified. Blood samples from tumor-bearing dogs were taken before the first fraction and at the end of radiation therapy. Results: Apoptosis in lymphocytes is dependent on donor age and donor weight. Tumor-bearing dogs when compared with healthy dogs showed no significant differences in levels of induced apoptosis. No significant changes were seen in the levels of radiation-induced apoptosis in blood taken before, during, or after radiation therapy. Conclusion: The leukocyte apoptosis assay can be successfully applied to canine patients, and a wide spectrum of sensitivities to radiation-induced apoptosis is observed. The sensitivity of a patient's peripheral blood T-lymphocytes to radiation-induced apoptosis does not change as a result of the trauma of radiotherapy during the course of tumor treatment. (orig.)
New and emerging pathogens in canine infectious respiratory disease.
Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J
2014-03-01
Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.
Hoving, Eelco W.
2000-01-01
Nasal encephaloceles can be divided into frontoethmoidal and basal encephaloceles. Both conditions are very rare, but frontoethmoidal encephaloceles show a relatively high incidence (1:5,000) in Southeast Asia. The pathogenesis of encephaloceles may be explained by a disturbance in separation of
Augmentation Rhinoplasty in Cleft Lip Nasal Deformity: Preliminary Patients’ Perspective
Directory of Open Access Journals (Sweden)
William H. C. Tiong
2014-01-01
Full Text Available The correction of cleft lip nasal deformity is challenging and there have been numerous methods described in the literature with little demonstrated technical superiority of one over another. The common clinical issues associated with cleft lip nasal deformity are its lack of symmetry, alar collapse on the affected side, obtuse nasal labial angle, short nasal length, loss of tip definition, and altered columella show among others. We carried out augmentation of cleft lip rhinoplasties with rib graft in 16 patients over the one-year study period. Each of these patients was reviewed and given questionnaire before and after surgery to evaluate their response on the outcome to the approach. Preoperatively, nasal asymmetry is the main complaint (14/16, 87.5% among our series of patients. Postoperatively, 12 (75% patients out of the 16 reported significant improvement in their nasal symmetry with the other four marginal. All patients reported excellent nasal projection postoperatively with good nasal tip definition. Our series of patients reported overall good satisfaction outcome and will recommend this procedure to other patients with cleft lip nasal deformity. In conclusion, augmentation of cleft lip rhinoplasty can be employed to achieve perceivable and satisfactory outcome in patients with cleft lip nasal deformity.
Recurrent nodule on the nasal columella: a good reason to re-biopsy.
Vujevich, Justin J; Goldberg, Leonard H; Kimyai-Asadi, Arash; Law, Robert
2008-07-01
A 15-year-old Caucasian male presented with 9-month history of a recurrent nodule on the nasal columella. The previous biopsy was reported as a neurofibroma. Frozen sections revealed a spindle cell neoplasm. Permanent section immunohistochemistry sections stained positive for vimentin and smooth muscle actin and negative for S100 and CD34, confirming the diagnosis of leiomyosarcoma. The tumor was removed using Mohs micrographic surgery. Radiological work-up revealed no distant metastasis. There has been no local recurrence to date. Leiomyosarcoma is a difficult diagnosis to make clinically and requires histological confirmation. Re-biopsy of a "benign" growth may be necessary if clinicopathological correlation does not match with the clinical behavior of the tumor in question. Finally, Mohs micrographic surgery is a useful treatment modality for leiomyosarcomas, particularly those located in cosmetically-sensitive regions of the body such as the nose.
Impact of Facial Conformation on Canine Health: Corneal Ulceration
Packer, Rowena M. A.; Hendricks, Anke; Burn, Charlotte C.
2015-01-01
Concern has arisen in recent years that selection for extreme facial morphology in the domestic dog may be leading to an increased frequency of eye disorders. Corneal ulcers are a common and painful eye problem in domestic dogs that can lead to scarring and/or perforation of the cornea, potentially causing blindness. Exaggerated juvenile-like craniofacial conformations and wide eyes have been suspected as risk factors for corneal ulceration. This study aimed to quantify the relationship between corneal ulceration risk and conformational factors including relative eyelid aperture width, brachycephalic (short-muzzled) skull shape, the presence of a nasal fold (wrinkle), and exposed eye-white. A 14 month cross-sectional study of dogs entering a large UK based small animal referral hospital for both corneal ulcers and unrelated disorders was carried out. Dogs were classed as affected if they were diagnosed with a corneal ulcer using fluorescein dye while at the hospital (whether referred for this disorder or not), or if a previous diagnosis of corneal ulcer(s) was documented in the dogs’ histories. Of 700 dogs recruited, measured and clinically examined, 31 were affected by corneal ulcers. Most cases were male (71%), small breed dogs (mean± SE weight: 11.4±1.1 kg), with the most commonly diagnosed breed being the Pug. Dogs with nasal folds were nearly five times more likely to be affected by corneal ulcers than those without, and brachycephalic dogs (craniofacial ratio dogs. A 10% increase in relative eyelid aperture width more than tripled the ulcer risk. Exposed eye-white was associated with a nearly three times increased risk. The results demonstrate that artificially selecting for these facial characteristics greatly heightens the risk of corneal ulcers, and such selection should thus be discouraged to improve canine welfare. PMID:25969983
Nasal mucosal blood flow after intranasal allergen challenge
International Nuclear Information System (INIS)
Holmberg, K.; Bake, B.; Pipkorn, U.
1988-01-01
The nasal mucosal blood flow in patients with allergic rhinitis was determined at nasal allergen challenges with the 133 Xenon washout method. Determinations were made in 12 subjects before and 15 minutes after challenge with diluent and increasing doses of allergen. The time course was followed in eight subjects by means of repeated measurements during 1 hour after a single allergen dose. Finally, the blood flow was measured after unilateral allergen challenge in the contralateral nasal cavity. A dose-dependent decrease in blood flow was found after nasal challenge with increasing doses of allergens, whereas challenge with diluent alone did not induce any changes. The highest allergen dose, which also induced pronounced nasal symptoms, resulted in a decrease in blood flow of 25% (p less than 0.001). The time-course study demonstrated a maximum decrease in blood flow 10 to 20 minutes after challenge and then a gradual return to baseline. Unilateral allergen challenge resulted in a decrease in blood flow in the contralateral, unchallenged nasal cavity, suggesting that part of the allergen-induced changes in blood flow were reflex mediated
Application of direct digital radiography of nasal bone
International Nuclear Information System (INIS)
Gao Dengfa; Wang Haijun; Zhang Ailian; Wang Yulin
2005-01-01
Objective: To research the application value of direct digital radiograph (DDR ) in nasal bone imaging. Methods: One hundred cases were examined by DDR, 30 cases of them were examined by two methods both DDR and conventional radiography. All digital images were post-processed with 'MUSICA' (Multi-Scale Image Contrast Amplification), incision and largamente, analyzed and diagnosed by experienced two radiologists and two technicians. Results: One hundred cases of nasal bone, soft tissue of nose were showed excellent in DDR, and satisfactory cases were 95 and 92, respectively. Forty-six cases of nasal bone fractures were found. Thirty cases were examined by both DDR and conventional radiography, images of nasal bone, soft tissue of nose were showed, satisfactory cases were 28 in DDR; and satisfactory cases were 6 (χ 2 =20.05, P 2 =15.06, P 2 =5.14, P<0.05) in conventional and digital radiography, respectively. Conclusion: DDR images of nasal bone, soft tissue of nose was excellent, more fractures were discovered than conventional radiography. Image quality of DDR is better than conventional radiography in nasal bone imaging. (authors)
Genetics of Human and Canine Dilated Cardiomyopathy.
Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S
2015-01-01
Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
A Comparison of Over-the-Counter Mechanical Nasal Dilators: A Systematic Review.
Kiyohara, Nicole; Badger, Christopher; Tjoa, Tjoson; Wong, Brian
2016-09-01
The internal nasal valve is the narrowest part of the nasal airway and a common site of inspiratory collapse and obstruction of nasal airflow. Over-the-counter mechanical nasal dilators are an alternative to surgical intervention that attempts to improve airflow through the internal nasal valve. To determine the efficacy of over-the-counter mechanical nasal dilators and classify these products by mechanism. A database of 33 available over-the-counter mechanical nasal dilators was generated via a PubMed search as well as an internet search via Amazon.com and Google, conducted from April 1, 2013, through December 31, 2015. Products determined to be unavailable or discontinued were excluded from the database. Of the devices examined in published literature, efficacy was based on objective measures, such as measured airflow, the cross-sectional area of the nasal valve, and changes in resistance. Measures of reported sleep quality or patient perception were excluded. An analysis of each product's mechanism revealed 4 broad classes: external nasal dilator strips, nasal stents, nasal clips, and septal stimulators. A review demonstrated 5 studies supporting the use of external nasal dilator strips, 4 studies supporting the use of nasal clips, 1 study supporting the use of nasal stents, and no studies supporting the use of septal stimulators. Our findings suggest that external nasal dilator strips and nasal clips effectively relieve obstruction of the internal nasal valve and may be an alternative to surgical intervention in some patients.
Profiling of plasma metabolites in canine oral melanoma using gas chromatography-mass spectrometry.
Kawabe, Mifumi; Baba, Yuta; Tamai, Reo; Yamamoto, Ryohei; Komori, Masayuki; Mori, Takashi; Takenaka, Shigeo
2015-08-01
Malignant melanoma is one of the most common and aggressive tumors in the oral cavity of dog. The tumor has a poor prognosis, and methods for diagnosis and prediction of prognosis after treatment are required. Here, we examined metabolite profiling using gas chromatography-mass spectrometry (GC-MS) for development of a discriminant model for evaluation of prognosis. Metabolite profiles were evaluated in healthy and melanoma plasma samples using orthogonal projection to latent structure using discriminant analysis (OPLS-DA). Cases that were predicted to be healthy using the OPLS discriminant model had no advanced lesions after radiation therapy. These results indicate that metabolite profiling may be useful in diagnosis and prediction of prognosis of canine malignant melanoma.
9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.
2010-01-01
... Type 2 Vaccine, Killed Virus. 113.202 Section 113.202 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine...
Paoloni, Melissa; Webb, Craig; Mazcko, Christina; Cherba, David; Hendricks, William; Lana, Susan; Ehrhart, E J; Charles, Brad; Fehling, Heather; Kumar, Leena; Vail, David; Henson, Michael; Childress, Michael; Kitchell, Barbara; Kingsley, Christopher; Kim, Seungchan; Neff, Mark; Davis, Barbara; Khanna, Chand; Trent, Jeffrey
2014-01-01
Molecularly-guided trials (i.e. PMed) now seek to aid clinical decision-making by matching cancer targets with therapeutic options. Progress has been hampered by the lack of cancer models that account for individual-to-individual heterogeneity within and across cancer types. Naturally occurring cancers in pet animals are heterogeneous and thus provide an opportunity to answer questions about these PMed strategies and optimize translation to human patients. In order to realize this opportunity, it is now necessary to demonstrate the feasibility of conducting molecularly-guided analysis of tumors from dogs with naturally occurring cancer in a clinically relevant setting. A proof-of-concept study was conducted by the Comparative Oncology Trials Consortium (COTC) to determine if tumor collection, prospective molecular profiling, and PMed report generation within 1 week was feasible in dogs. Thirty-one dogs with cancers of varying histologies were enrolled. Twenty-four of 31 samples (77%) successfully met all predefined QA/QC criteria and were analyzed via Affymetrix gene expression profiling. A subsequent bioinformatics workflow transformed genomic data into a personalized drug report. Average turnaround from biopsy to report generation was 116 hours (4.8 days). Unsupervised clustering of canine tumor expression data clustered by cancer type, but supervised clustering of tumors based on the personalized drug report clustered by drug class rather than cancer type. Collection and turnaround of high quality canine tumor samples, centralized pathology, analyte generation, array hybridization, and bioinformatic analyses matching gene expression to therapeutic options is achievable in a practical clinical window (strategies may aid cancer drug development.
Establishment and Characterization of New Canine and Feline Osteosarcoma Primary Cell Lines
Directory of Open Access Journals (Sweden)
Florian R. L. Meyer
2016-06-01
Full Text Available Osteosarcomas are the most abundant form of bone malignancies in multiple species. Canine osteosarcomas are considered a valuable model for human osteosarcomas because of their similar features. Feline osteosarcomas, on the other hand, are rarely studied but have interesting characteristics, such as a better survival prognosis than dogs or humans, and less likelihood of metastasis. To enable experimental approaches to study these differences we have established five new canine osteosarcoma cell lines out of three tumors, COS_1186h, COS_1186w, COS_1189, and COS_1220, one osteosarcoma-derived lung metastasis, COS_1033, and two new feline osteosarcoma cell lines, FOS_1077 and FOS_1140. Their osteogenic and neoplastic origin, as well as their potential to produce calcified structures, was determined by the markers osteocalcin, osteonectin, tissue unspecific alkaline phosphatase, p53, cytokeratin, vimentin, and alizarin red. The newly developed cell lines retained most of their markers in vitro but only spontaneously formed spheroids produced by COS_1189 showed calcification in vitro.
The Effect of Menstrual Cycle on Nasal Resonance Characteristics in Females
Kumar, Suman; Basu, Shriya; Sinha, Anisha; Chatterjee, Indranil
2012-01-01
The purpose of this study was to analyze resonance characteristics (nasality and nasalance values) during the menstrual cycle. Previous studies indicate changes in voice quality and nasal mucosa due to temporary falling estrogen levels in human females during their menstrual cycle. The present study compared the nasality and "nasalance scores"…
Disposition of nasal, intravenous, and oral methadone in healthy volunteers.
Dale, Ola; Hoffer, Christine; Sheffels, Pamela; Kharasch, Evan D
2002-11-01
Nasal administration of many opioids demonstrates rapid uptake and fast onset of action. Nasal administration may be an alternative to intravenous and oral administration of methadone and was therefore studied in human volunteers. The study was approved by the Institutional Review Board of the University of Washington, Seattle. Eight healthy volunteers (6 men and 2 women) aged 19 to 33 years were enrolled after informed written consent was obtained. Subjects received 10 mg methadone hydrochloride nasally, orally, or intravenously on 3 separate occasions in a crossover design. Nasal methadone (50 mg/mL in aqueous solution) was given as a 100-microL spray in each nostril (Pfeiffer BiDose sprayer). Blood samples for liquid chromatography-mass spectrometry analyses of methadone and the metabolite 2-ethyl-1,5-dimethyl-3,3-diphenylpyrrolinium were drawn for up to 96 hours. The methadone effect was measured by noninvasive infrared pupilometry coincident with blood sampling. Nasal uptake of methadone was rapid, with maximum plasma concentrations occurring within 7 minutes. The maximum effects of intravenous, nasal, and oral methadone, on the basis of dark-adapted pupil diameter, were reached in about 15 minutes, 30 minutes, and 2 hours, respectively. The respective durations were 24, 10, and 8 hours. Both nasal and oral bioavailabilities were 0.85. Subjects reported that nasal methadone caused a burning sensation. Nasal administration of methadone results in rapid absorption and onset of effect and high bioavailability, which was greater than that reported for other nasal opioids, with a similar duration of effect. Nasal administration may be an alternative route of methadone administration; however, improved formulations are desirable to reduce nasal irritation.
International Nuclear Information System (INIS)
Zhou, Jien Jie; Gonzalez, Arnulfo; Lenox, Mark W.; Fossum, Theresa W.; Frank, R. Keith; Simon, Jaime; Stearns, Stan; Ruoff, Catherine M.; Wendt, Richard E.; Akabani, Gamal
2015-01-01
A new treatment strategy based on direct injections of 90 Y-hydroxide into the tumor bed in dogs with osteosarcoma was studied. Direct injections of the radiopharmaceutical into the tumor bed were made according to a pretreatment plan established using 18 F-FDG images. Using a special drill, cannulas were inserted going through tissue, tumor and bone. Using these cannulas, direct injections of the radiopharmaceutical were made. The in vivo biodistribution of 90 Y-hydroxide and the anatomical tumor bed were imaged using a time-of-flight (TOF) PET/CT scanner. The material properties of the tissues were estimated from corresponding CT numbers using an electron-density calibration. Radiation absorbed dose estimates were calculated using Monte Carlo methods where the biodistribution of the pharmaceutical from PET images was sampled using a collapsing 3-D rejection technique. Dose distributions in the tumor bed and surrounding tissues were calculated, showing significant heterogeneity with multiple hot spots at injection sites. Dose volume histograms showed that approximately 33.9% of bone and tumor and 70.2% of bone marrow and trabecular bone received an absorbed dose over 200 Gy; approximately 3.2% of bone and tumor and 31.0% of bone marrow and trabecular bone received a total dose of over 1000 Gy. - Graphical abstract: Treatment of canine osteosarcoma using 90 Y-hydroxide using localized liquid brachytherapy. A 3-D co-registered PET/CT image showing the distribution of 90 Y in the left tibia of a dog with osteosarcoma. Multiple high activity hotspots are shown within bone marrow and isolated hotspots within the tumor bed, corresponding to the sites of administration. Absorbed doses were estimated to be as high as 2000 Gy to tumor. - Highlights: • A liquid brachytherapy treatment of canine osteosarcoma using 90 Y hydroxyapatite is presented. • Dosimetry of 90 Y hydroxyapatite liquid brachytherapy was carried out using PET-CT. • Activity distribution correlated
Resident aerobic microbiota of the adult human nasal cavity
DEFF Research Database (Denmark)
Rasmussen, TT; Kirkeby Nielsen, LP; Poulsen, Knud
2000-01-01
Recent evidence strongly suggests that the microbiota of the nasal cavity plays a crucial role in determining the reaction patterns of the mucosal and systemic immune system. However, little is known about the normal microbiota of the nasal cavity. The purpose of this study was to determine...... the microbiota in different parts of the nasal cavity and to develop and evaluate methods for this purpose. Samples were collected from 10 healthy adults by nasal washes and by swabbing of the mucosa through a sterile introduction device. Both methods gave results that were quantitatively and qualitatively...... reproducible, and revealed significant differences in the density of the nasal microbiota between individuals. The study revealed absence of gram-negative bacteria that are regular members of the commensal microbiota of the pharynx. Likewise, viridans type streptococci were sparsely represented. The nasal...
Nasal septal angiofibroma, a subclass of extranasopharyngeal angiofibroma.
Garcia-Rodriguez, Laura; Rudman, Kelli; Cogbill, Christopher H; Loehrl, Todd; Poetker, David M
2012-01-01
Extranasopharyngeal angiofibromas (ENA) arising from the nasal septum or nasal septal angiofibromas are extremely rare; only 13 such cases have been reported in the international literature. Our objective is to describe the presentation, workup, and surgical management of these lesions. Case reports were done. The setting was a tertiary care referral center and the Veterans Affairs Medical Center. PATIENTS, INTERVENTIONS, AND RESULTS: We present 2 cases of extranasopharyngeal angiofibroma occurring on the nasal septum. In this report, we discuss the occurrence, the histopathologic findings, and the treatment of nasal septal angiofibroma. Copyright © 2012 Elsevier Inc. All rights reserved.
Capillary hemangioma of adult nasal cavity: a case report
International Nuclear Information System (INIS)
Paik, Sang Hyun; Kim, Hyun Sook; Kim, Wan Seop; Cho, Sung Bum; Choi, Yun Sun; Chung, Myung Jin; Kim, Seog Joon; Yoon, Sook Ja; Yoon, Yong Kyu
2002-01-01
Capillary hemangioma of the adult nasal cavity is rare. We report a case which occurred in the right nasal cavity of a 25-year-old woman, together with the multiphase enhanced CT findings. The patients who had a history of recurrent nasal bleeding, had experienced nasal obstruction and swelling during the two-month period prior to presentation, and one month before presentation, spontaneous vaginal delivery occurred. Physical examination revealed the presence of a well-defined round mass, with redness in the right nasal vertibule. The mass showed rim enhancement at early arterial-phase CT scanning, increased enhancement at the late arterial phase, and moderately homogeneous enhancement at the delayed phase
Ramos-Vara, J A; Beissenherz, M E; Miller, M A; Johnson, G C; Pace, L W; Fard, A; Kottler, S J
2000-11-01
Diagnostic records from 338 canine oral melanomas in 338 dogs received at the Veterinary Medical Diagnostic Laboratory (1992-1999) were reviewed. Of these tumors, 122 plus an additional 7 metastatic melanomas of unknown origin were selected for clinical follow-up, histologic review, and immunohistochemistry. Chow Chow, Golden Retriever, and Pekingese/Poodle mix breeds were overrepresented, whereas Boxer and German Shepherd breeds were underrepresented. There was no gender predisposition and the average age at presentation was 11.4 years. Forty-nine dogs were euthanized due to recurrence or metastasis. The average postsurgical survival time was 173 days. The gingiva and the labial mucosa were the most common sites. Most tumors were composed of either polygonal cells (27 cases, 20.9%), spindle cells (44 cases, 34.1%), or a mixture of the two (polygonal and spindle) (54 cases, 41.9%). Clear cell (3 cases, 2.3%) and adenoid/papillary (1 case, 0.8%) patterns were uncommon. The metastases of 6/6 oral melanomas had morphologic and immunohistochemical features similar to those of the primary tumors. Immunohistochemically, Melan A was detected in 113/122 oral (92.6%) and 5/7 (71.9%) metastatic melanomas. Only 4/163 nonmelanocytic tumors were focally and weakly positive for Melan A. Antibodies against vimentin, S100 protein, and neuron-specific enolase stained 129 (100%), 98 (76%), and 115 (89.1%) of 129 melanomas, respectively. Antibodies against other melanocytic-associated antigens (tyrosinase, glycoprotein 100) did not yield adequate staining. We conclude that Melan A is a specific and sensitive marker for canine melanomas.
Directory of Open Access Journals (Sweden)
J. Van Heerden
2002-07-01
Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
van Heerden, J; Bingham, J; van Vuuren, M; Burroughs, R E J; Stylianides, E
2002-03-01
Wild dogs Lycaon pictuis (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
9 CFR 113.317 - Parvovirus Vaccine (Canine).
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... from each dog shall be individually tested for neutralizing antibody against canine parvovirus to...
Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L
2016-11-01
The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pdistemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.
Genetics of Human and Canine Dilated Cardiomyopathy
Directory of Open Access Journals (Sweden)
Siobhan Simpson
2015-01-01
Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
Borah, Ballav M; Halter, Timothy J; Xie, Baoquan; Henneman, Zachary J; Siudzinski, Thomas R; Harris, Stephen; Elliott, Matthew; Nancollas, George H
2014-07-01
This work identifies carbonated hydroxyapatite (CAP) as the primary component of canine dental calculus, and corrects the long held belief that canine dental calculus is primarily CaCO3 (calcite). CAP is known to be the principal crystalline component of human dental calculus, suggesting that there are previously unknown similarities in the calcification that occurs in these two unique oral environments. In vitro kinetic experiments mimicking the inorganic components of canine saliva have examined the mechanisms of dental calculus formation. The solutions were prepared so as to mimic the inorganic components of canine saliva; phosphate, carbonate, and magnesium ion concentrations were varied individually to investigate the roll of these ions in controlling the nature of the phases that is nucleated. To date, the inorganic components of the canine oral systems have not been investigated at concentrations that mimic those in vivo. The mineral composition of the synthetic calculi grown under these conditions closely resembled samples excised from canines. This finding adds new information about calculus formation in humans and canines, and their sensitivity to chemicals used to treat these conditions. Copyright © 2014 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
F.G.A. Santos
2008-06-01
Full Text Available Twelve male, mongrel, adult dogs were subcutaneously transplanted with cells originated from two canine transmissible venereal tumors (TVT. The aim was to demonstrate and to quantify the occurrence of apoptosis in the TVT regression. After six months of transplantation, a tumor sample was obtained from each dog, being six dogs with TVT in the growing phase and six in the regression phase as verified by daily measurements. Samples were processed for histological and ultrastructural purposes as well as for DNA extraction. Sections of 4µm were stained by HE, Shorr, methyl green pyronine, Van Gieson, TUNEL reaction and immunostained for P53. The Shorr stained sections went through morphometry that demonstrated an increase of the apoptotic cells per field in the regressive tumors. It was also confirmed by transmission electron microscopy, which showed cells with typical morphology of apoptosis and by the TUNEL reaction that detected in situ the 3'OH nick end labeling mainly in the regressive tumors. The regressive TVTs also showed an intensified immunostaining for P53 besides a more intense genomic DNA fragmentation detected by the agarose gel electrophoresis. In conclusion, apoptosis has an important role in the regression of the experimental TVT in a way that is P53-dependent.Doze cães, adultos, machos e sem raça definida foram transplantados subcutaneamente, na região hipogástrica, com células originadas de dois tumores venéreos transmissíveis caninos (TVT. O objetivo do estudo foi demonstrar e quantificar a ocorrência de apoptose na regressão do TVT. Após seis meses, foi obtido um tumor de cada animal, totalizando seis em crescimento e seis em regressão. Fragmentos dos tumores foram processados para avaliação histológica, ultra-estrutural e também para extração de DNA. Cortes de 4µm foram corados em HE, Shorr, verde de metila pironina e Van Gieson e alguns foram submetidos à reação do TUNEL e à imunoistoquímica para P53
Nasal carriage of multi-drug resistant Staphylococcus aureus in ...
African Journals Online (AJOL)
Background: Nasal Staphylococcus aureus is a major source of community and hospital associated staphylococcal infections. This study determined the prevalence of nasal S. aureus isolates and investigated their antimicrobial resistance profile in healthy volunteers. Methods: Nasal specimens of healthy volunteers in ...
Directory of Open Access Journals (Sweden)
Nathalie Tiemi Ota
2013-09-01
Full Text Available OBJETIVO: Analisar, em recém-nascidos de muito baixo peso e com indicação de ventilação não invasiva via pronga nasal, a incidência do aparecimento precoce de lesão nasal. MÉTODOS: Série de casos prospectiva de nascidos com idade gestacional <37 semanas, peso <1.500g e idade pós-natal <29 dias. Os pacientes foram avaliados desde a instalação da pronga nasal até o 3o dia de uso, três vezes ao dia. Foram analisadas as condições clínicas dos pacientes, características do dispositivo e de sua aplicação. A análise inicial foi descritiva, verificando-se a prevalência de lesão nasal bem como os fatores a ela associados. Os dados categóricos foram analisados por qui-quadrado ou exato de Fisher e os dados numéricos, por teste t ou Mann-Whitney. RESULTADOS: Dezoito recém-nascidos foram incluídos, dos quais 12 (idade gestacional de 29,8±3,1 semanas, peso ao nascer de 1.070±194g e Score for Neonatal Acute Phisiology - Perinatal Extension (SNAPPE de 15,4±17,5 evoluíram com lesão nasal (Grupo Lesão e 6 (idade gestacional de 28,0±1,9 semanas, peso de 1.003±317g e SNAPPE de 26,2±7,5 não apresentaram lesão nasal (Grupo Sem Lesão. No Grupo Lesão, houve maior frequência do gênero masculino (75% versus 17%, a lesão apareceu em média após 18 horas e predominantemente no período notur no (75%. CONCLUSÃO: A incidência de lesão nasal em prematuros submetidos à ventilação não invasiva via pronga nasal foi elevada, sendo possível planejar estudo dos fatores associados, com base neste piloto.
Role of canine circovirus in dogs with acute haemorrhagic diarrhoea.
Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S
2017-06-03
Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.
Nasal valve evaluation in the Mexican-Hispanic (mestizo) nose.
Jasso-Ramírez, Elizabeth; Sánchez Y Béjar, Fernando; Arcaute Aizpuru, Fernando; Maulen Radován, Irene E; de la Garza Hesles, Héctor
2018-04-01
Our aim in this study was to determine the angle of the internal nasal valve in Mexican patients with the "mestizo nose" feature and without nasal obstructive symptoms. The work was prospective, comparative, and observational in nature and included patients >14 years of age who were seen in the Otolaryngology Department at the Los Angeles Lomas Hospital between April and May 2016. The angle of the internal nasal valve was measured in 30 patients without obstructive symptoms. Endoscopic examination was performed with a 0° endoscope framed with tape at a 13-mm distance from the endoscope's tip, and digital photographs of the internal nasal valve were taken. The measurement of the angle of the internal nasal valve was made in sexagesimal degrees using Golden Ratio v3.1 (2012) software. Statistical analysis was performed using Excel v15.13.3. The angles of the internal nasal valve of the patients were (mean ± standard deviation) 24.07 ± 4.8° for the right nasal cavity and 25.07 ± 5.0° for the left nasal cavity, wider than the angle reported in the normal Caucasian nose established in the literature. According to our results, the Mexican-Hispanic mestizo nose has a wider angle in the internal nasal valve than that considered normal in the literature (10°-15°). We believe it is necessary to undertake a second study and add an airflow resistance measurement with a rhinomanometry procedure so we can compare the results with those in the Caucasian population. © 2018 ARS-AAOA, LLC.
Staphylococcus aureus and the ecology of the nasal microbiome
DEFF Research Database (Denmark)
Liu, Cindy M; Price, Lance B; Hungate, Bruce A
2015-01-01
The human microbiome can play a key role in host susceptibility to pathogens, including in the nasal cavity, a site favored by Staphylococcus aureus. However, what determines our resident nasal microbiota-the host or the environment-and can interactions among nasal bacteria determine S. aureus...
Reliability of mandibular canines as indicators for sexual dichotomy.
Hosmani, Jagadish V; Nayak, Ramakant S; Kotrashetti, Vijayalakshmi S; S, Pradeep; Babji, Deepa
2013-02-01
Amongst the various calcified structures in the human body, teeth have gained lot of popularity in estimating the sex of an individual as they are highly resistant to destruction and decomposition. Using permanent mandibular canines many researchers have predicted a high level of accuracy in identifying the sex correctly. The purpose of our study was to gauge the effectiveness of mandibular canines in discerning sex. Fifty dental casts each of males and females were utilized for the study. Mesio-distal dimension and inter-canine distance of mandibular right and left canine was recorded using digital vernier caliper and mandibular canine index was calculated. The mean value of mesio-distal dimensions of right and left mandibular canine was slightly greater in males compared to females. The mandibular canine index was equal in both sexes. Inter-canine distance was marginally higher in males compared to females. Despite of higher values in males none of the parameters were statistically significant. The results herein bolster contemporary studies that mesio-distal dimensions of mandibular canines and mandibular canine index do not reflect sexual dimorphism and that its application should be discontinued in sex prediction among Indian populations. How to cite this article: Hosmani J V, Nayak R S, Kotrashetti V S, Pradeep S, Babji D. Reliability of Mandibular Canines as Indicators for Sexual Dichotomy. J Int Oral Health 2013; 5(1):1-7.
Approaches to canine health surveillance.
O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C
2014-01-01
Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.
Canine neoplasia and exposure to uranium mill tailings in Mesa County, Colorado
International Nuclear Information System (INIS)
Reif, J.S.; Schweitzer, D.J.; Ferguson, S.W.; Benjamin, S.A.
1983-01-01
A canine cancer registry was established for Mesa County, Colorado in order to collect material for a case control analysis of exposure to uranium tailings. Between 1979 and 1981, 212 cases of canine cancer were confirmed histologically. Based on the address provided at the time of diagnosis, 33 dogs (15.6%) lived in a house with some exposure to uranium tailings. A control group, comprised of dogs with a histologic diagnosis other than cancer, was stratified according to hospital and matched with cases on a 1:1 basis. No significant differences were noted with respect to exposure to uranium tailings for total cancers or cancers of specific sites including lymph node, breast, liver, testicle and bone. The overall estimated relative risk was 0.70 (95% CI 0.04 to 1.16). Canine population estimates were derived for Mesa County in order to develop crude incidence rates for the major types and sites of cancer. Crude rates were compared with those published previously for Alameda County, California and Tulsa County, Oklahoma. Mesa County rates for total cancer incidence, connective tissue tumors and non melanoma skin cancer were higher than those reported for Alameda County. When compared with Tulsa County, Mesa County rates for total cancer, breast cancer, melanoma and mastocytoma were lower than expected while rates for osteosarcoma, hemangiosarcoma and fibrosarcoma significantly exceeded expected values
Exhaled and nasal nitric oxide in chronic rhinosinusitis patients with nasal polyps in primary care
DEFF Research Database (Denmark)
Frendø, M; Håkansson, K; Schwer, S
2018-01-01
BACKGROUND: Chronic rhinosinusitis with nasal polyps (CRSwNP) is a common inflammatory disorder associated with lower airway disease. However, only few studies of CRSwNP from outside secondary/tertiary care centres have been published. We recently reported an asthma frequency of 44% and 65...... patients. Compared with controls, a high level of exhaled NO was significantly more prevalent in CRSwNP irrespective of asthma-status. Nasal NO was significantly lower in patients with CRSwNP compared with controls. CONCLUSION: Subclinical eosinophilic lower airway inflammation is common in CRSwNP......% in primary and secondary care patients respectively. Therefore, we hypothesise that inflammation of the lower airways could be present in all CRSwNP patients, even without asthma. Here, we assessed the degree of lower and upper airway inflammation using exhaled and nasal nitric oxide (NO) in primary care...
Human nasal rhinosporidiosis: a case report from Malawi | Sefu ...
African Journals Online (AJOL)
Patient presented with long standing history of nasal obstruction and intermittent epistaxis for three years. Diagnosis was confirmed by histopathological examination and he was successfully treated by complete surgical excision. This was a very unusual cause of nasal masses in our setting. Nasal rhinosporidioss lesions ...
Angiomatous nasal polyp: Clinical diagnostic dilemma
Directory of Open Access Journals (Sweden)
Sunder Goyal
2015-03-01
Full Text Available Angiomatous polyp (Angiectatic nasal polyps is rare and its incidence is 4-5% of all nasal polyps. As it occurs with variable clinical features and there is no confirmatory preoperative investigation, clinical diagnosis can be a dilemma. Clinical picture of angiofibroma, simple antrochoanal polyp and inverted papilloma may resemble with each other. As polyps invade surrounding bone, these should be distinguished from a malignant mass. We present an interesting case of an infarcted angiectatic nasal polyp with extensive surrounding bony destruction. Correct preoperative radiological diagnosis is important to avoid unnecessary extensive surgery. Histopathological evaluation of polyps is mandatory since they require different treatment due to difference in the prognosis.
Al-Ainawi, Khaled I; Al-Mdalal, Yaser; Hajeer, Mohammad Y
2016-01-01
New studies have been published and aimed to retract canines by means of distraction osteogenesis to reduce treatment time. Although a great care has been given to achieve a bodily movement of the canines, a significant amount of tipping of the canines has been observed. This trial aimed to assess the effect of applying a modified distractor on canine angulation. The sample of the study consisted of 14 canines in seven patients (16-25 years). After the osteotomy procedure, two distractors were applied (one distractor on each side). After 5 days of a latency period, the two distractors were activated at a rate of 1 mm/day. There was a significant difference between the two distractors regarding the time required to retract the canines (p = 0.008) and the observed change in canine angulation following retraction (p = 0.028). The change in the overjet and the mandibular plane angle was statistically insignificant. Eight out of 14 distracted canines reacted positively to the pulp vitality tester after 3 months of completion of distraction. There was no clinical sign of discoloration or pulpal pain in any canine. Within the limits of this study, the modified distractor caused a bodily movement of the canine with a minimal tipping. Further research is required on a long-term basis on a larger group of patients to gain more insight on the observed changes.
Omalizumab a new prospective: a nasal polyposis.
Cavaliere, C; Begvarfaj, E; Frati, F; Masieri, S
2018-01-01
Omalizumab, a monoclonal antibody against IgE, may be effective on nasal polyps, but its use is not currently authorized to treat that disease. We report the cases of three patients who were given omalizumab for asthma after undergoing nasal surgical polypectomy. Although such procedure is frequently followed by polyp recurrence, none of the three patients developed this complication, and in one subject the regression of initial polyp return was registered after starting omalizumab. Our data support the hypothesis that omalizumab may be useful to treat nasal polyposis.
Nasal Inserts for Drug Delivery: An Overview
African Journals Online (AJOL)
In this review, the benefits, limitations and absorption mechanisms of the nasal route, as well ... molecules including peptide and proteins for ... (Mw) drugs, rapid and fast onset of action due to ... while the former act by disrupting the nasal.
International Nuclear Information System (INIS)
Aronsohn, M.
1985-01-01
Thymoma is an uncommon canine neoplasm of thymic epithelial cells. It is seen in various breeds but may occur more frequently in German Shepherd Dogs. Middle-aged or older dogs can be affected and no sex predilection exists. A paraneoplastic syndrome of myasthenia gravis, nonthymic malignant tumors, and/or polymyositis occurs in a significant number of dogs with thymoma. Clinical signs are variable and are related to a space-occupying cranial mediastinal mass and/or manifestations of the paraneo-plastic syndrome. Dyspnea is the most common presenting clinical sign. Thoracic radiographs usually show a cranial mediastinal mass. Lymphoma is the main differential diagnosis. A definitive diagnosis may be made by closed biopsy but is more likely to be confirmed by thoracotomy. Thymomas may be completely contained within the thymic capsule or may spread by local invasion or metastasis. A staging system allows for an accurate prognosis and a therapeutic plan. Surgical removal of encapsulated thymomas may result in long-term survival or cure. Invasive or metastatic thymomas carry a guarded prognosis. Manifestations of the paraneoplastic syndrome complicate treatment. Adjuvant radiation and chemotherapy may be of value for advanced cases; however, adequate clinical trials have not been done in the dog
NASAL INVERTED PAPILLOMA OF UNUSUAL ORIGIN
kasim s. kasim; Universiti Tunku Abdul Rahman; BALWANT SINGH GENDEH
2013-01-01
Two cases of Schneiderian papilloma of the nasal septum are presented. The condition is rare, as indicated by a review of previously published cases. The clinical course of the lesion suggests that it behaves like Schneiderian papillomas elsewhere in the nasal cavity and paranasal sinuses. The need for aggressive surgical management and careful follow-up is emphasized.
Boron neutron capture therapy: Brain Tumor Treatment Evaluation Program
International Nuclear Information System (INIS)
Griebenow, M.L.; Dorn, R.V. III; Gavin, P.R.; Spickard, J.H.
1988-01-01
The United States (US) Department of Energy (DOE) recently initiated a focused, multidisciplined program to evaluate Boron Neutron Capture Therapy (BNCT) for the treatment of brain tumors. The program, centered at the DOE/endash/Idaho National Engineering Laboratory (INEL), will develop the analytical, diagnostic and treatment tools, and the database required for BNCT technical assessment. The integrated technology will be evaluated in a spontaneously-occurring canine brain-tumor model. Successful animal studies are expected to lead to human clinical trials within four to five years. 2 refs., 3 figs
Nasal inflammation in sleep apnoea patients using CPAP and effect of heated humidification.
Koutsourelakis, I; Vagiakis, E; Perraki, E; Karatza, M; Magkou, C; Kopaka, M; Roussos, C; Zakynthinos, S
2011-03-01
Nasal continuous positive airway pressure (CPAP) can cause undesirable nasal symptoms, such as congestion to obstructive sleep apnoea (OSA) patients, whose symptoms can be attenuated by the addition of heated humidification. However, neither the nature of nasal symptoms nor the effect of heated humidification on nasal pathophysiology and pathology are convincingly known. 20 patients with OSA on nasal CPAP who exhibited symptomatic nasal obstruction were randomised to receive either 3 weeks of CPAP treatment with heated humidification or 3 weeks of CPAP treatment with sham-heated humidification, followed by 3 weeks of the opposite treatment, respectively. Nasal symptom score, nasal resistance, nasal lavage interleukin-6, interleukin-12 and tumour necrosis factor-α and nasal mucosa histopathology were assessed at baseline and after each treatment arm. Heated humidification in comparison with sham-heated humidification was associated with decrease in nasal symptomatology, resistance and lavage cytokines, and attenuation of inflammatory cell infiltration and fibrosis of the nasal mucosa. In conclusion, nasal obstruction of OSA patients on CPAP treatment is inflammatory in origin and the addition of heated humidification decreases nasal resistance and mucosal inflammation.
Directory of Open Access Journals (Sweden)
Ferri Ricardo Gimenes
2004-01-01
Full Text Available Desde 1981, o uso da pressão aérea positiva através do CPAP nasal vem sendo considerado o principal tratamento clínico da síndrome da apnéia-hipopnéia obstrutiva do sono (SAHOS, apesar de sua adesão parcial a longo prazo. Alguns autores referem que as queixas nasais provenientes do fluxo de ar sob pressão positiva na cavidade nasal são as principais responsáveis pela interrupção do tratamento. Isto ocorreria porque o uso do CPAP levaria a alterações na mucosa e mudanças no transporte mucociliar e, conseqüentemente, um maior número de infecções nasosinusais. OBJETIVO: Avaliar o clearance mucociliar nasal em pacientes com SAHOS em uso de CPAP nasal através do teste de sacarina e correlacionar os efeitos adversos desta terapia com o tempo de tratamento e o nível de pressão utilizada no mesmo. FORMA DE ESTUDO: Estudo clínico caso-controle. MATERIAL E MÉTODO: Foram avaliados 25 pacientes com SAHOS entre 18 a 70 anos em uso de CPAP nasal a partir de um mês acompanhados no Instituto do Sono (UNIFESP-EPM e submetidos ao teste de sacarina cujos resultados foram comparados com um grupo de 25 indivíduos sem doenças nasosinusais. RESULTADOS: Não houve diferença estatística entre os grupos em relação ao teste de sacarina.Os efeitos adversos estavam presentes em 84% da amostra, sendo 60% ressecamento e 36% obstrução nasal. Não houve correlação entre estas queixas e o tempo de tratamento ou a pressão aplicada pelo aparelho. CONCLUSÕES: O clearance mucociliar nasal no grupo com SAHOS em uso de CPAP nasal foi semelhante ao grupo controle e a obstrução nasal e o ressecamento não apresentaram correlação com o tempo de tratamento e o nível de pressão utilizada pelo aparelho.
Nasal granuloma gravidarum presenting with recurrent massive epistaxis.
Tantinikorn, Weerachai; Uiprasertkul, Mongkol; Assanasen, Paraya
2003-05-01
Nasal granuloma gravidarum is a rare condition associated with pregnancy and minor trauma. This condition presents with a nasal mass with varying degree of bleeding and obstruction. We report a patient with nasal granuloma gravidarum in the third trimester of pregnancy. Surgical excision is the definite treatment for this condition in order to stop the vicious cycle of recurrent massive bleeding. Possible etiology, clinical features and management are discussed.
Effect of nasal deviation on quality of life.
de Lima Ramos, Sueli; Hochman, Bernardo; Gomes, Heitor Carvalho; Abla, Luiz Eduardo Felipe; Veiga, Daniela Francescato; Juliano, Yara; Dini, Gal Moreira; Ferreira, Lydia Masako
2011-07-01
Nasal deviation is a common complaint in otorhinolaryngology and plastic surgery. This condition not only causes impairment of nasal function but also affects quality of life, leading to psychological distress. The subjective assessment of quality of life, as an important aspect of outcomes research, has received increasing attention in recent decades. Quality of life is measured using standardized questionnaires that have been tested for reliability, validity, and sensitivity. The aim of this study was to evaluate health-related quality of life, self-esteem, and depression in patients with nasal deviation. Sixty patients were selected for the study. Patients with nasal deviation (n = 32) were assigned to the study group, and patients without nasal deviation (n = 28) were assigned to the control group. The diagnosis of nasal deviation was made by digital photogrammetry. Quality of life was assessed using the Medical Outcomes Study 36-Item Short Form Health Survey questionnaire; the Rosenberg Self-Esteem/Federal University of São Paulo, Escola Paulista de Medicina Scale; and the 20-item Self-Report Questionnaire. There were significant differences between groups in the physical functioning and general health subscales of the Medical Outcomes Study 36-Item Short Form Health Survey (p < 0.05). Depression was detected in 11 patients (34.4 percent) in the study group and in two patients in the control group, with a significant difference between groups (p < 0.05). Nasal deviation is an aspect of rhinoplasty of which the surgeon should be aware so that proper psychological diagnosis can be made and suitable treatment can be planned because psychologically the patients with nasal deviation have significantly worse quality of life and are more prone to depression. Risk, II.(Figure is included in full-text article.).
Platelets Inhibit Migration of Canine Osteosarcoma Cells.
Bulla, S C; Badial, P R; Silva, R C; Lunsford, K; Bulla, C
2017-01-01
The interaction between platelets and tumour cells is important for tumour growth and metastasis. Thrombocytopenia or antiplatelet treatment negatively impact on cancer metastasis, demonstrating potentially important roles for platelets in tumour progression. To our knowledge, there is no information regarding the role of platelets in cancer progression in dogs. This study was designed to test whether canine platelets affected the migratory behaviour of three canine osteosarcoma cell lines and to give insights of molecular mechanisms. Intact platelets, platelet lysate and platelet releasate inhibited the migration of canine osteosarcoma cell lines. Addition of blood leucocytes to the platelet samples did not alter the inhibitory effect on migration. Platelet treatment also significantly downregulated the transcriptional levels of SNAI2 and TWIST1 genes. The interaction between canine platelets or molecules released during platelet activation and these tumour cell lines inhibits their migration, which suggests that canine platelets might antagonize metastasis of canine osteosarcoma. This effect is probably due to, at least in part, downregulation of genes related to epithelial-mesenchymal transition. Copyright © 2016. Published by Elsevier Ltd.
Inter- and intra-rater reliability of nasal auscultation in daycare children.
Santos, Rita; Silva Alexandrino, Ana; Tomé, David; Melo, Cristina; Mesquita Montes, António; Costa, Daniel; Pinto Ferreira, João
2018-02-01
The aim of this study was to assess nasal auscultation's intra- and inter-rater reliability and to analyze ear and respiratory clinical condition according to nasal auscultation. Cross-sectional study performed in 125 children aged up to 3 years old attending daycare centers. Nasal auscultation, tympanometry and Paediatric Respiratory Severity Score (PRSS) were applied to all children. Nasal sounds were classified by an expert panel in order to determine nasal auscultation's intra and inter- rater reliability. The classification of nasal sounds was assessed against tympanometric and PRSS values. Nasal auscultation revealed substantial inter-rater (K=0.75) and intra-rater (K=0.69; K=0.61 and K=0.72) reliability. Children with a "non-obstructed" classification revealed a lower peak pressure (t=-3.599, Pauscultation revealed substantial intra- and inter-rater reliability. Nasal auscultation exhibited important differences according to ear and respiratory clinical conditions. Nasal auscultation in pediatrics seems to be an original topic as well as a simple method that can be used to identify early signs of nasopharyngeal obstruction.
Systematic review: the influence of nasal obstruction on sleep apnea
Directory of Open Access Journals (Sweden)
Debora Petrungaro Migueis
2016-04-01
Full Text Available ABSTRACT INTRODUCTION: Obstructive sleep apnea syndrome (OSAS is a common disorder that can lead to cardiovascular morbidity and mortality, as well as to metabolic, neurological, and behavioral consequences. It is currently believed that nasal obstruction compromises the quality of sleep when it results in breathing disorders and fragmentation of sleep. However, recent studies have failed to objectively associate sleep quality and nasal obstruction. OBJECTIVE: The aim of this systematic review is to evaluate the influence of nasal obstruction on OSAS and polysomnographic indices associated with respiratory events. METHODS: Eleven original articles published from 2003 to 2013 were selected, which addressed surgical and non-surgical treatment for nasal obstruction, performing polysomnography type 1 before and after the intervention. RESULTS/CONCLUSIONS: In most trials, nasal obstruction was not related to the apnea-hypopnea index (AHI, indicating no improvement in OSAS with reduction in nasal resistance. However, few researchers evaluated other polysomnography indices, such as the arousal index and rapid eye movement (REM sleep percentage. These could change with nasal obstruction, since it is possible that the nasal obstruction does not completely block the upper airways, but can increase negative intrathoracic pressure, leading to sleep fragmentation.
9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...
Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao
2012-07-20
Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.