Correction of self-reported BMI based on objective measurements: a Belgian experience.
Drieskens, S; Demarest, S; Bel, S; De Ridder, K; Tafforeau, J
2018-01-01
Based on successive Health Interview Surveys (HIS), it has been demonstrated that also in Belgium obesity, measured by means of a self-reported body mass index (BMI in kg/m 2 ), is a growing public health problem that needs to be monitored as accurately as possible. Studies have shown that a self-reported BMI can be biased. Consequently, if the aim is to rely on a self-reported BMI, adjustment is recommended. Data on measured and self-reported BMI, derived from the Belgian Food Consumption Survey (FCS) 2014 offers the opportunity to do so. The HIS and FCS are cross-sectional surveys based on representative population samples. This study focused on adults aged 18-64 years (sample HIS = 6545 and FCS = 1213). Measured and self-reported BMI collected in FCS were used to assess possible misreporting. Using FCS data, correction factors (measured BMI/self-reported BMI) were calculated in function of a combination of background variables (region, gender, educational level and age group). Individual self-reported BMI of the HIS 2013 were then multiplied with the corresponding correction factors to produce a corrected BMI-classification. When compared with the measured BMI, the self-reported BMI in the FCS was underestimated (mean 0.97 kg/m 2 ). 28% of the obese people underestimated their BMI. After applying the correction factors, the prevalence of obesity based on HIS data significantly increased (from 13% based on the original HIS data to 17% based on the corrected HIS data) and approximated the measured one derived from the FCS data. Since self-reported calculations of BMI are underestimated, it is recommended to adjust them to obtain accurate estimates which are important for decision making.
Directory of Open Access Journals (Sweden)
Schoenborn Charlotte A
2009-11-01
Full Text Available Abstract Background The Body Mass Index (BMI based on self-reported height and weight ("self-reported BMI" in epidemiologic studies is subject to measurement error. However, because of the ease and efficiency in gathering height and weight information through interviews, it remains important to assess the extent of error present in self-reported BMI measures and to explore possible adjustment factors as well as valid uses of such self-reported measures. Methods Using the combined 2001-2006 data from the continuous National Health and Nutrition Examination Survey, discrepancies between BMI measures based on self-reported and physical height and weight measures are estimated and socio-demographic predictors of such discrepancies are identified. Employing adjustments derived from the socio-demographic predictors, the self-reported measures of height and weight in the 2001-2006 National Health Interview Survey are used for population estimates of overweight & obesity as well as the prediction of health risks associated with large BMI values. The analysis relies on two-way frequency tables as well as linear and logistic regression models. All point and variance estimates take into account the complex survey design of the studies involved. Results Self-reported BMI values tend to overestimate measured BMI values at the low end of the BMI scale ( 28. The discrepancies also vary systematically with age (younger and older respondents underestimate their BMI more than respondents aged 42-55, gender and the ethnic/racial background of the respondents. BMI scores, adjusted for socio-demographic characteristics of the respondents, tend to narrow, but do not eliminate misclassification of obese people as merely overweight, but health risk estimates associated with variations in BMI values are virtually the same, whether based on self-report or measured BMI values. Conclusion BMI values based on self-reported height and weight, if corrected for biases
Stommel, Manfred; Schoenborn, Charlotte A
2009-11-19
The Body Mass Index (BMI) based on self-reported height and weight ("self-reported BMI") in epidemiologic studies is subject to measurement error. However, because of the ease and efficiency in gathering height and weight information through interviews, it remains important to assess the extent of error present in self-reported BMI measures and to explore possible adjustment factors as well as valid uses of such self-reported measures. Using the combined 2001-2006 data from the continuous National Health and Nutrition Examination Survey, discrepancies between BMI measures based on self-reported and physical height and weight measures are estimated and socio-demographic predictors of such discrepancies are identified. Employing adjustments derived from the socio-demographic predictors, the self-reported measures of height and weight in the 2001-2006 National Health Interview Survey are used for population estimates of overweight & obesity as well as the prediction of health risks associated with large BMI values. The analysis relies on two-way frequency tables as well as linear and logistic regression models. All point and variance estimates take into account the complex survey design of the studies involved. Self-reported BMI values tend to overestimate measured BMI values at the low end of the BMI scale ( 28. The discrepancies also vary systematically with age (younger and older respondents underestimate their BMI more than respondents aged 42-55), gender and the ethnic/racial background of the respondents. BMI scores, adjusted for socio-demographic characteristics of the respondents, tend to narrow, but do not eliminate misclassification of obese people as merely overweight, but health risk estimates associated with variations in BMI values are virtually the same, whether based on self-report or measured BMI values. BMI values based on self-reported height and weight, if corrected for biases associated with socio-demographic characteristics of the survey
Associations between Three School-Based Measures of Health: Is BMI Enough?
Morgan, Emily H.; Houser, Robert F.; Au, Lauren E.; Sacheck, Jennifer M.
2013-01-01
School-based body mass index (BMI) notification programs are often used to raise parental awareness of childhood overweight and obesity, but how BMI results are associated with physical fitness and diet is less clear. This study examined the relationship between BMI, fitness, and diet quality in a diverse sample of urban schoolchildren…
Natamba, Barnabas K; Sanchez, Sixto E; Gelaye, Bizu; Williams, Michelle A
2016-07-26
The 2009 Institute of Medicine (IOM) gestational weight recommendations are tailored to women's pre-pregnancy body mass index (BMI). Limited evidence exists on methods for estimating women's pre-pregnancy BMI, particularly for women living in low and middle income countries. Using data from collected among Peruvian pregnant women, we compared the concordance between self-reported pre-pregnancy BMI with BMI measured at the earliest prenatal study visit. Data were from the Pregnancy Outcomes Maternal and Infant Study (PrOMIS), a cohort of pregnant women at the Instituto Nacional Materno Perinatal (INMP) in Lima, Peru. 2605 women aged 18 to 49 years (mean ± SD gestational age = 10.9 ± 3.3 weeks) were included in the study. Self-reported pre-pregnancy weight and height and measured weight and height were collected at the first prenatal study contact. We assessed the concordance between measured and self-reported BMI; and, the agreement among indicators of nutritional status obtained using measured and self-reported BMI. On average, weight measured at the first prenatal study visit was 0.27 kg higher than self-reported pre-pregnancy weight (p overweight or obese BMI categories tended to be lower when using self-reported BMI (38.2 %) than when using measured BMI (47.7 %). Self-reported pre-pregnancy BMI was strongly correlated with BMI measured at the first prenatal study contact. The findings potentially suggest that, in this context, there is minimal change between pre-pregnancy BMI and BMI measured at the first prenatal study contact; or, that women in this study just recalled their most recent measured anthropometrics (including values obtained during the index pregnancy but before enrollment in the PrOMIS study).
Is BMI a valid measure of obesity in postmenopausal women?
Banack, Hailey R; Wactawski-Wende, Jean; Hovey, Kathleen M; Stokes, Andrew
2018-03-01
Body mass index (BMI) is a widely used indicator of obesity status in clinical settings and population health research. However, there are concerns about the validity of BMI as a measure of obesity in postmenopausal women. Unlike BMI, which is an indirect measure of obesity and does not distinguish lean from fat mass, dual-energy x-ray absorptiometry (DXA) provides a direct measure of body fat and is considered a gold standard of adiposity measurement. The goal of this study is to examine the validity of using BMI to identify obesity in postmenopausal women relative to total body fat percent measured by DXA scan. Data from 1,329 postmenopausal women participating in the Buffalo OsteoPerio Study were used in this analysis. At baseline, women ranged in age from 53 to 85 years. Obesity was defined as BMI ≥ 30 kg/m and body fat percent (BF%) greater than 35%, 38%, or 40%. We calculated sensitivity, specificity, positive predictive value, and negative predictive value to evaluate the validity of BMI-defined obesity relative BF%. We further explored the validity of BMI relative to BF% using graphical tools, such as scatterplots and receiver-operating characteristic curves. Youden's J index was used to determine the empirical optimal BMI cut-point for each level of BF% defined obesity. The sensitivity of BMI-defined obesity was 32.4% for 35% body fat, 44.6% for 38% body fat, and 55.2% for 40% body fat. Corresponding specificity values were 99.3%, 97.1%, and 94.6%, respectively. The empirical optimal BMI cut-point to define obesity is 24.9 kg/m for 35% BF, 26.49 kg/m for 38% BF, and 27.05 kg/m for 40% BF according to the Youden's index. Results demonstrate that a BMI cut-point of 30 kg/m does not appear to be an appropriate indicator of true obesity status in postmenopausal women. Empirical estimates of the validity of BMI from this study may be used by other investigators to account for BMI-related misclassification in older women.
Butler, Rose; McClinchy, Jane; Morreale-Parker, Claudia; Marsh, Wendy; Rennie, Kirsten L
2017-12-01
There is currently no consensus on which measure of height should be used in older people's body mass index (BMI) calculation. Most estimates of nutritional status include a measurement of body weight and height which should be reliable and accurate, however at present several different methods are used interchangeably. BMI, a key marker in malnutrition assessment, does not reflect age-related changes in height or changes in body composition such as loss of muscle mass or presence of oedema. The aim of this pilot study was to assess how the use of direct and surrogate measures of height impacts on BMI calculation in people aged ≥75 years. A cross-sectional study of 64 free-living older people (75-96 yrs) quantified height by two direct measurements, current height (H C ), and self-report (H R ) and surrogate equations using knee height (H K ) and ulna length (H U ). BMI calculated from current height measurement (BMI C ) was compared with BMI calculated using self-reported height (BMI R ) and height estimated from surrogate equations for knee height (BMI K ) and ulna length (BMI U ). Median difference of BMI C -BMI R was 2.31 kg/m 2 . BMI K gave the closest correlation to BMI C . The percentage of study participants identified at increased risk of under-nutrition (BMI BMI; from 5% (BMI C ), 7.8% (BMI K ), 12.5% (BMI U ), to 14% (BMI R ) respectively. The results of this pilot study in a relatively healthy sample of older people suggest that interchangeable use of current and reported height in people ≥75 years can introduce substantial significant systematic error. This discrepancy could impact nutritional assessment of older people in poor health and lead to misclassification during nutritional screening if other visual and clinical clues are not taken into account. This could result in long-term clinical and cost implications if individuals who need nutrition support are not correctly identified. A consensus is required on which method should be used to
BMI and BMI SDS in childhood: annual increments and conditional change.
Brannsether, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Júlíusson, Pétur Benedikt
2017-02-01
Background Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods The distributions of 1-year increments of BMI (kg/m 2 ) and BMI SDS are summarised by percentiles. Differences according to sex, age, height, weight, initial BMI and weight status on the BMI and BMI SDS increments were assessed with multiple linear regression. Conditional change in BMI SDS was based on the correlation between annual BMI measurements converted to SDS. Results BMI increments depended significantly on sex, height, weight and initial BMI. Changes in BMI SDS depended significantly only on the initial BMI SDS. The distribution of conditional change in BMI SDS using a two-correlation model was close to normal (mean = 0.11, SD = 1.02, n = 1167), with 3.2% (2.3-4.4%) of the observations below -2 SD and 2.8% (2.0-4.0%) above +2 SD. Conclusion Conditional change in BMI SDS can be used to detect unexpected large changes in BMI SDS. Although this method requires the use of a computer, it may be clinically useful to detect aberrant weight development.
Know Your Body Mass Index (BMI)
... Past Issues Special Section Know Your Body Mass Index (BMI) Past Issues / Winter 2007 Table of Contents ... aging, it pays to understand your body mass index (BMI), a measure of body fat based on ...
Behavioural measures of child's eating temperament and their link with BMI.
Godefroy, Valérie; Trinchera, Laura; Darcel, Nicolas; Rigal, Natalie
2017-03-01
Rothbart's model of temperament, defined as individual differences in reactivity and self-regulation, has a strong heuristic value with applications in a wide variety of children's outcomes. Our objective was to test Rothbart's model applied to children's food behaviours and BMI outcome through behavioural measures. Our hypotheses, according to Rothbart's model, were as follows: (i) self-regulation in eating modulates appetite reactivity; (ii) appetite reactivity increases the risk of excess BMI, whereas self-regulation in eating limits this risk. One hundred and four children aged between 7 and 12 years completed four behavioural tasks to assess scores for two components of appetite reactivity (i.e. appetite arousal and appetite persistence) and two components of self-regulation in eating (i.e. self-regulation in eating without hunger and self-regulation in eating speed). Their heights and weights were measured in order to calculate their BMI-for-age. T-tests and regression analysis were used to verify our hypotheses. None of the scores of self-regulation in eating was directly associated with BMI but we observed a significant impact of self-regulation in eating without hunger on appetite arousal (p-value = 0.04), together with a modest but significant association between appetite persistence and BMI (p-value = 0.02). We can thus conclude that our behavioural measures could be used for the determination of the child's eating temperament. Further studies are needed to investigate how to use these measures to improve the treatment of overweight in children. Copyright © 2016 Elsevier Ltd. All rights reserved.
BMI and Lifetime Changes in BMI and Cancer Mortality Risk
Taghizadeh, Niloofar; Boezen, H Marike; Schouten, Jan P; Schröder, Carolien P; de Vries, Elisabeth G. E.; Vonk, Judith M
2015-01-01
Body Mass Index (BMI) is known to be associated with cancer mortality, but little is known about the link between lifetime changes in BMI and cancer mortality in both males and females. We studied the association of BMI measurements (at baseline, highest and lowest BMI during the study-period) and
Earlier BMI rebound and lower pre-rebound BMI as risk of obesity among Japanese preschool children.
Kato, N; Isojima, T; Yokoya, S; Tanaka, T; Ono, A; Yokomichi, H; Yamagata, Z; Tanaka, S; Matsubara, H; Ishikuro, M; Kikuya, M; Chida, S; Hosoya, M; Kuriyama, S; Kure, S
2018-01-01
Longitudinal growth data of children were analyzed to clarify the relationship between the timing of body mass index (BMI) rebound and obesity risk in later ages. Of 54 558 children born between April 2004 and March 2005 and longitudinally measured in April and October every year in the preschool period, 15 255 children were analyzed wherein no longitudinal measurement is missing after 1 year of age. BMI rebound age was determined as the age with smallest BMI value across longitudinal individual data after 1 year of age. Rebound age was compared between overweight and non-overweight groups. The subjects were divided into groups based on the timing of rebound. The sex- and age-adjusted mean of the BMI, height and weight s.d. scores for age group, along with 6 months weight and height gain, were compared among groups using analysis of covariance. Among those who were overweight at 66-71 months of age, BMI rebound age obtained at approximately 3 years of age was compared with the non-overweight group, whose BMI rebound age was utmost 66 months or later (PBMI age group showed that earlier BMI rebound results in larger BMI (PBMI rebound earlier than 30 months of age, low BMI was observed (PBMI rebound among groups with rebound age earlier than 60 months of age (PBMI rebound timing with pre-rebound low BMI leads to greater childhood obesity risk; hence, early detection and prevention is necessary for such cases.
Energy Technology Data Exchange (ETDEWEB)
Odedra, Devang [Queen' s University, School of Medicine, Kingston, ON (Canada); Blobel, Joerg [Toshiba Medical Systems Europe BV, Zoetermeer (Netherlands); University of Toronto, Division of Cardiothoracic Imaging, Department of Medical Imaging, Toronto General Hospital, Toronto, ON (Canada); AlHumayyd, Saad; Durand, Miranda; Jimenez-Juan, Laura; Paul, Narinder [University of Toronto, Division of Cardiothoracic Imaging, Department of Medical Imaging, Toronto General Hospital, Toronto, ON (Canada)
2014-01-15
To compare the image quality and radiation dose using image-noise (IN)-based determination of X-ray tube settings compared with a body mass index (BMI)-based protocol during CT coronary angiography (CTCA). Two hundred consecutive patients referred for CTCA to our institution were divided into two groups: BMI-based, 100 patients had CTCA with the X-ray tube current adjusted to the patient's BMI while maintaining a fixed tube potential of 120 kV; IN-based, 100 patients underwent imaging with the X-ray tube current and voltage adjusted to the IN measured within the mid-left ventricle on a pre-acquisition trans-axial image. Two independent cardiac radiologists performed blinded image quality assessment with quantification of the IN and signal-to-noise ratio (SNR) from the mid-LV and qualitative assessment using a three-point score. Radiation dose (CTDI and DLP) was recorded from the console. Results showed: IN (HU): BMI-based, 30.1 ± 9.9; IN-based, 33.1 ± 6.7; 32 % variation reduction (P = 0.001); SNR: BMI-based, 18.6 ± 7.1; IN-based, 15.4 ± 3.7; 48 % variation reduction (P < 0.0001). Visual scores: BMI-based, 2.3 ± 0.6; IN-based, 2.2 ± 0.5 (P = 0.54). Radiation dose: CTDI (mGy), BMI-based, 22.68 ± 8.9; IN-based, 17.16 ± 7.6; 24.3 % reduction (P < 0.001); DLP (mGy.cm), BMI-based, 309.3 ± 127.5; IN-based, 230.6 ± 105.5; 25.4 % reduction (P < 0.001). Image-noise-based stratification of X-ray tube parameters for CTCA results in 32 % improvement in image quality and 25 % reduction in radiation dose compared with a BMI-based protocol. (orig.)
LENUS (Irish Health Repository)
Fattah, Chro
2012-02-01
OBJECTIVE: We set out to compare measurement of Body Mass Index (BMI) with selfreporting in women early in pregnancy. STUDY DESIGN: We studied 100 women booking for antenatal care in the first trimester with a normal ongoing pregnancy. Selfreported maternal weight and height were recorded and the Body Mass Index was calculated. Afterwards maternal weight and height were digitally measured and actual BMI was calculated. RESULTS: If selfreporting is used for BMI classification, we found that 22% of women were classified incorrectly when BMI was measured. 12% of the women who were classified as having a normal selfreported BMI were overweight and 5% classified as overweight were obese. Similar findings have been reported outside pregnancy. CONCLUSIONS: These findings have implications for clinical practice, and for research studies exploring the relationship between maternal adiposity and pregnancy complications.
International Nuclear Information System (INIS)
Haque, Z.; Haleem, D. J.
2014-01-01
Objective: To evaluate and compare the gender based variations in stress perception induced changes in leptin, cortisol and serotonin (5-HT) trends, appetite and Body Mass Index (BMI). Study Design: An analytical comparative study. Place and Duration of Study: Neurochemistry Laboratory, University of Karachi, from January to August 2013. Methodology: Appetite, BMI and serum leptin, cortisol, and 5-HT were measured in 100 men and women of aged 30 - 60 years, working in teaching institutes of Karachi, to evaluate gender based, stress perception induced variations. The samples were identified by stratified random technique. The chemical variables were estimated through ELISA. Results were analysed using one-way ANOVA and multivariate general linear model using SPSS version 17. Results: Mean stress perception, BMI and serum leptin levels were significantly more in women (p < 0.05). Serum cortisol and 5-HT were found significantly reduced in women (p < 0.05). BMI, serum cortisol and leptin were found to be increased with increasing level of stress perception (p < 0.05). VAS for hunger and desire to eat as the measure of appetite was significantly higher in men (p < 0.05). Conclusion: Stress perception attenuates the positive effect of cortisol and negative effects of leptin and 5-HT on appetite through changes in their circulatory levels. Women perceive more stress and exhibit significantly attenuated changes in hormonal levels and appetite which may be the contributing factor towards obesity. Increased BMI in women despite decreased appetite merits more studies. (author)
LENUS (Irish Health Repository)
Power, RF
2018-02-01
Nineteen percent of 9 years old Irish children are overweight; seven percent are obese. Our aims were: to examine whether differences exist between paternal self-reported and measured height, weight and BMI in a population representative sample; and to explore paternal perceptions of their own weight status.\\r\
Can self-reported BMI be used as a valid measure among novice runners
DEFF Research Database (Denmark)
Juul, Martin Serup; Nielsen, R.O.; Rasmussen, Sten
There is an increased risk of running related injuries (RRI) among novice runners with a Body Mass Index (BMI) above 25. Information about BMI can be collected through questionnaires, when studies investigate if there is an association between BMI and RRI among novice runners. But can self...... of RRI. Healthy novice runners between the age of 18 to 65 and without lower extremity injuries were able to participate in the study. During July and August 2011 the participants were included in the study based on an online questionnaire. 1532 persons completed the questionnaire, of these, 970 were...
BMI Trajectories Associated With Resolution of Elevated Youth BMI and Incident Adult Obesity.
Buscot, Marie-Jeanne; Thomson, Russell J; Juonala, Markus; Sabin, Matthew A; Burgner, David P; Lehtimäki, Terho; Hutri-Kähönen, Nina; Viikari, Jorma S A; Jokinen, Eero; Tossavainen, Paivi; Laitinen, Tomi; Raitakari, Olli T; Magnussen, Costan G
2018-01-01
Youth with high BMI who become nonobese adults have the same cardiovascular risk factor burden as those who were never obese. However, the early-life BMI trajectories for overweight or obese youth who avoid becoming obese adults have not been described. We aimed to determine and compare the young-childhood BMI trajectories of participants according to their BMI status in youth and adulthood. Bayesian hierarchical piecewise regression modeling was used to analyze the BMI trajectories of 2717 young adults who had up to 8 measures of BMI from childhood (ages 3-18 years) to adulthood (ages 34-49 years). Compared with those with persistently high BMI, those who resolved their high youth BMI by adulthood had lower average BMI at age 6 years and slower rates of BMI change from young childhood. In addition, their BMI levels started to plateau at 16 years old for females and 21 years old for males, whereas the BMI of those whose high BMI persisted did not stabilize until 25 years old for male subjects and 27 years for female subjects. Compared with those youth who were not overweight or obese and who remained nonobese in adulthood, those who developed obesity had a higher BMI rate of change from 6 years old, and their BMI continued to increase linearly until age 30 years. Efforts to alter BMI trajectories for adult obesity should ideally commence before age 6 years. The natural resolution of high BMI starts in adolescence for males and early adulthood for females, suggesting a critical window for secondary prevention. Copyright © 2018 by the American Academy of Pediatrics.
BMI and Lifetime Changes in BMI and Cancer Mortality Risk
Taghizadeh, Niloofar; Boezen, H. Marike; Schouten, Jan P.; Schröder, Carolien P.; de Vries, E. G. Elisabeth; Vonk, Judith M.
2015-01-01
Body Mass Index (BMI) is known to be associated with cancer mortality, but little is known about the link between lifetime changes in BMI and cancer mortality in both males and females. We studied the association of BMI measurements (at baseline, highest and lowest BMI during the study-period) and lifetime changes in BMI (calculated over different time periods (i.e. short time period: annual change in BMI between successive surveys, long time period: annual change in BMI over the entire study period) with mortality from any cancer, and lung, colorectal, prostate and breast cancer in a large cohort study (n=8,645. Vlagtwedde-Vlaardingen, 1965-1990) with a follow-up on mortality status on December 31st 2008. We used multivariate Cox regression models with adjustments for age, smoking, sex, and place of residence. Being overweight at baseline was associated with a higher risk of prostate cancer mortality (hazard ratio (HR) =2.22; 95% CI 1.19-4.17). Obesity at baseline was associated with a higher risk of any cancer mortality [all subjects (1.23 (1.01-1.50)), and females (1.40 (1.07-1.84))]. Chronically obese females (females who were obese during the entire study-period) had a higher risk of mortality from any cancer (2.16 (1.47-3.18), lung (3.22 (1.06-9.76)), colorectal (4.32 (1.53-12.20)), and breast cancer (2.52 (1.15-5.54)). We found no significant association between long-term annual change in BMI and cancer mortality risk. Both short-term annual increase and decrease in BMI were associated with a lower mortality risk from any cancer [all subjects: (0.67 (0.47-0.94)) and (0.73 (0.55-0.97)), respectively]. In conclusion, a higher BMI is associated with a higher cancer mortality risk. This study is the first to show that short-term annual changes in BMI were associated with lower mortality from any type of cancer. PMID:25881129
Associations between parity and maternal BMI in a population-based cohort study.
Iversen, Ditte S; Kesmodel, Ulrik S; Ovesen, Per G
2018-02-07
We aimed to investigate the change in prevalence of overweight and obesity in pregnant Danish women from 2004 to 2012, and investigate whether increasing parity was associated with a change in body mass index (BMI) prevalence. We obtained a population-based cohort from the Danish Medical Birth Registry consisting of all Danish women giving birth in 2004-2012 (n = 572 321). This registry contains information on 99.8% of all births in Denmark. We calculated the overall change in prepregnancy BMI status among pregnant women in Denmark, and a multiple linear regression model with adjustment for several potential confounders was used to examine the change in prepregnancy BMI with increasing parity. In 2004, the prevalence of prepregnancy overweight and obesity (BMI ≥ 25) and obesity alone (BMI ≥ 30) was 31.9 and 11%, respectively. In 2012, the prevalence had reached 34.2 and 12.8%. The mean BMI increased for every additional parity from 23.80 (95% CI 23.77-23.82) in parity group 1 to 26.70 (26.52-26.90) in parity group 5+. A multiple linear regression adjusted for potential confounders showed that women on average gained 0.62 (0.58-0.65) BMI units after every additional birth. This study showed a 7.2% increase in overweight and obesity (BMI ≥ 25) and a 16.4% increase in obesity alone (BMI ≥ 30) for pregnant women in Denmark from 2004 to 2012. In addition, an increase in interpregnancy BMI was seen at every additional delivery, suggesting that obesity is an increasing challenge in obstetrics. © 2018 Nordic Federation of Societies of Obstetrics and Gynecology.
Sun, Jie; Nwaru, Bright I; Hua, Jing; Li, Xiaohong; Wu, Zhuochun
2017-01-01
Objectives Infant body mass index (BMI) peak has proven to be a useful indicator for predicting childhood obesity risk in American and European populations. However, it has not been assessed in China. We characterised infant BMI trajectories in a Chinese longitudinal cohort and evaluated whether BMI peak can predict overweight and obesity at age 2 years. Methods Serial measurements (n=6–12) of weight and length were taken from healthy term infants (n=2073) in a birth cohort established in urban Shanghai. Measurements were used to estimate BMI growth curves from birth to 13.5 months using a polynomial regression model. BMI peak characteristics, including age (in months) and magnitude (BMI, in kg/m2) at peak and prepeak velocities (in kg/m2/month), were estimated. The relationship between infant BMI peak and childhood BMI at age 2 years was examined using binary logistic analysis. Results Mean age at peak BMI was 7.61 months, with a magnitude of 18.33 kg/m2. Boys (n=1022) had a higher average peak BMI (18.60 vs 18.07 kg/m2, pBMI and 1 month increase in peak time, the risk of overweight at age 2 years increased by 2.11 times (OR 3.11; 95% CI 2.64 to 3.66) and 35% (OR 1.35; 95% CI 1.21 to 1.50), respectively. Similarly, higher BMI magnitude (OR 2.69; 95% CI 2.00 to 3.61) and later timing of infant BMI peak (OR 1.35; 95% CI 1.08 to 1.68) were associated with an increased risk of childhood obesity at age 2 years. Conclusions We have shown that infant BMI peak is valuable for predicting early childhood overweight and obesity in urban Shanghai. Because this is the first Chinese community-based cohort study of this nature, future research is required to examine infant populations in other areas of China. PMID:28988164
BMI, health behaviors, and quality of life in children and adolescents: a school-based study.
Chen, Gang; Ratcliffe, Julie; Olds, Tim; Magarey, Anthea; Jones, Michelle; Leslie, Eva
2014-04-01
To explore the relationship between weight status (BMI) and health-related quality of life in children and adolescents through application of the Child Health Utility 9D, a new generic preference-based instrument. Data were collected from primary and high school students in rural and metropolitan regions of South Australia. Consenting participants (2588 in grades 4-6 and 765 in grades 9-10) were weighed and measured and categorized as underweight, healthy weight, overweight, or obese according to International Obesity Taskforce BMI cutoff points (primary outcome). Participants also completed a questionnaire including the Child Health Utility 9D and standardized measures of physical activity, sedentary behavior, sleep patterns, and eating behavior (secondary outcomes). Descriptive and multivariate linear regression analyses were undertaken to calculate mean utility differences. In comparison with healthy-weight primary school students, adjusted mean utilities were lower for overweight (-0.016, P = .02) or obese (-0.039, P = .001) students. For high school students, the adjusted mean utilities were also lower for overweight and obese students but were nonsignificant (-0.018, P > .10). Physical activity, sedentary behavior, sleep patterns, and eating behavior were all found to be significantly associated with utilities. Irrespective of BMI, young people engaging in more physical activities or less sedentary behavior, and having healthier sleep patterns or eating behavior exhibited higher utilities. Associations between utilities and sleep patterns or eating behavior were stronger than the associations with BMI. Future economic evaluations for obesity interventions should more formally investigate the relationship between changes over time in weight status and health-related quality of life for children and adolescents.
Bhagat, Nikunj A.; Venkatakrishnan, Anusha; Abibullaev, Berdakh; Artz, Edward J.; Yozbatiran, Nuray; Blank, Amy A.; French, James; Karmonik, Christof; Grossman, Robert G.; O'Malley, Marcia K.; Francisco, Gerard E.; Contreras-Vidal, Jose L.
2016-01-01
This study demonstrates the feasibility of detecting motor intent from brain activity of chronic stroke patients using an asynchronous electroencephalography (EEG)-based brain machine interface (BMI). Intent was inferred from movement related cortical potentials (MRCPs) measured over an optimized set of EEG electrodes. Successful intent detection triggered the motion of an upper-limb exoskeleton (MAHI Exo-II), to guide movement and to encourage active user participation by providing instantaneous sensory feedback. Several BMI design features were optimized to increase system performance in the presence of single-trial variability of MRCPs in the injured brain: (1) an adaptive time window was used for extracting features during BMI calibration; (2) training data from two consecutive days were pooled for BMI calibration to increase robustness to handle the day-to-day variations typical of EEG, and (3) BMI predictions were gated by residual electromyography (EMG) activity from the impaired arm, to reduce the number of false positives. This patient-specific BMI calibration approach can accommodate a broad spectrum of stroke patients with diverse motor capabilities. Following BMI optimization on day 3, testing of the closed-loop BMI-MAHI exoskeleton, on 4th and 5th days of the study, showed consistent BMI performance with overall mean true positive rate (TPR) = 62.7 ± 21.4% on day 4 and 67.1 ± 14.6% on day 5. The overall false positive rate (FPR) across subjects was 27.74 ± 37.46% on day 4 and 27.5 ± 35.64% on day 5; however for two subjects who had residual motor function and could benefit from the EMG-gated BMI, the mean FPR was quite low (< 10%). On average, motor intent was detected −367 ± 328 ms before movement onset during closed-loop operation. These findings provide evidence that closed-loop EEG-based BMI for stroke patients can be designed and optimized to perform well across multiple days without system recalibration. PMID:27065787
Directory of Open Access Journals (Sweden)
Nikunj Arunkumar Bhagat
2016-03-01
Full Text Available This study demonstrates the feasibility of detecting motor intent from brain activity of chronic stroke patients using an asynchronous electroencephalography (EEG-based brain machine interface (BMI. Intent was inferred from movement related cortical potentials (MRCPs measured over an optimized set of EEG electrodes. Successful intent detection triggered the motion of an upper-limb exoskeleton (MAHI Exo-II, to guide movement and to encourage active user participation by providing instantaneous sensory feedback. Several BMI design features were optimized to increase system performance in the presence of single-trial variability of MRCPs in the injured brain: 1 an adaptive time window was used for extracting features during BMI calibration; 2 training data from two consecutive days were pooled for BMI calibration to increase robustness to handle the day-to-day variations typical of EEG, and 3 BMI predictions were gated by residual electromyography (EMG activity from the impaired arm, to reduce the number of false positives. This patient-specific BMI calibration approach can accommodate a broad spectrum of stroke patients with diverse motor capabilities. Following BMI optimization on day 3, testing of the closed-loop BMI-MAHI exoskeleton, on 4th and 5th days of the study, showed consistent BMI performance with overall mean true positive rate (TPR = 62.7 +/- 21.4 % on day 4 and 67.1 +/- 14.6 % on day 5. The overall false positive rate (FPR across subjects was 27.74 +/- 37.46 % on day 4 and 27.5 +/- 35.64 % on day 5; however for two subjects who had residual motor function and could benefit from the EMG-gated BMI, the mean FPR was quite low (< 10 %. On average, motor intent was detected -367 +/- 328 ms before movement onset during closed-loop operation. These findings provide evidence that closed-loop EEG-based BMI for stroke patients can be designed and optimized to perform well across multiple days without system recalibration.
Muscle mass, BMI, and mortality among adults in the United States: A population-based cohort study.
Abramowitz, Matthew K; Hall, Charles B; Amodu, Afolarin; Sharma, Deep; Androga, Lagu; Hawkins, Meredith
2018-01-01
The level of body-mass index (BMI) associated with the lowest risk of death remains unclear. Although differences in muscle mass limit the utility of BMI as a measure of adiposity, no study has directly examined the effect of muscle mass on the BMI-mortality relationship. Body composition was measured by dual-energy x-ray absorptiometry in 11,687 participants of the National Health and Nutrition Examination Survey 1999-2004. Low muscle mass was defined using sex-specific thresholds of the appendicular skeletal muscle mass index (ASMI). Proportional hazards models were created to model associations with all-cause mortality. At any level of BMI ≥22, participants with low muscle mass had higher body fat percentage (%TBF), an increased likelihood of diabetes, and higher adjusted mortality than other participants. Increases in %TBF manifested as 30-40% smaller changes in BMI than were observed in participants with preserved muscle mass. Excluding participants with low muscle mass or adjustment for ASMI attenuated the risk associated with low BMI, magnified the risk associated with high BMI, and shifted downward the level of BMI associated with the lowest risk of death. Higher ASMI was independently associated with lower mortality. Effects were similar in never-smokers and ever-smokers. Additional adjustment for waist circumference eliminated the risk associated with higher BMI. Results were unchanged after excluding unintentional weight loss, chronic illness, early mortality, and participants performing muscle-strengthening exercises or recommended levels of physical activity. Muscle mass mediates associations of BMI with adiposity and mortality and is inversely associated with the risk of death. After accounting for muscle mass, the BMI associated with the greatest survival shifts downward toward the normal range. These results provide a concrete explanation for the obesity paradox.
The Report Card on BMI Report Cards.
Thompson, Hannah R; Madsen, Kristine A
2017-06-01
Half of states in the USA have legislation requiring that schools conduct body mass index (BMI) screening among students; just under half of these states report results to parents. The effectiveness of school-based BMI screening and reporting in reducing childhood obesity is not established and the practice has raised concerns about the potential for increased weight-based stigmatization. Recent experimental studies of BMI screening and reporting have not demonstrated a positive impact on students' weight status. However, the language and formatting of BMI reports used in studies to date have been suboptimal and have likely limited the potential effectiveness of the practice. This article reviews the recent literature on school-based BMI screening and reporting and highlights important areas for future inquiry. The present review suggests that evidence to date is not sufficient to support definitive conclusions about the value of school-based BMI screening and reporting as a childhood obesity prevention tool.
A BMI-based occupational therapy assist suit: asynchronous control by SSVEP.
Sakurada, Takeshi; Kawase, Toshihiro; Takano, Kouji; Komatsu, Tomoaki; Kansaku, Kenji
2013-01-01
A brain-machine interface (BMI) is an interface technology that uses neurophysiological signals from the brain to control external machines. Recent invasive BMI technologies have succeeded in the asynchronous control of robot arms for a useful series of actions, such as reaching and grasping. In this study, we developed non-invasive BMI technologies aiming to make such useful movements using the subject's own hands by preparing a BMI-based occupational therapy assist suit (BOTAS). We prepared a pre-recorded series of useful actions-a grasping-a-ball movement and a carrying-the-ball movement-and added asynchronous control using steady-state visual evoked potential (SSVEP) signals. A SSVEP signal was used to trigger the grasping-a-ball movement and another SSVEP signal was used to trigger the carrying-the-ball movement. A support vector machine was used to classify EEG signals recorded from the visual cortex (Oz) in real time. Untrained, able-bodied participants (n = 12) operated the system successfully. Classification accuracy and time required for SSVEP detection were ~88% and 3 s, respectively. We further recruited three patients with upper cervical spinal cord injuries (SCIs); they also succeeded in operating the system without training. These data suggest that our BOTAS system is potentially useful in terms of rehabilitation of patients with upper limb disabilities.
A BMI-based occupational therapy assist suit: asynchronous control by SSVEP
Directory of Open Access Journals (Sweden)
Takeshi eSakurada
2013-09-01
Full Text Available A brain-machine interface (BMI is an interface technology that uses neurophysiological signals from the brain to control external machines. Recent invasive BMI technologies have succeeded in the asynchronous control of robot arms for a useful series of actions, such as reaching and grasping. In this study, we developed non-invasive BMI technologies aiming to make such useful movements using the subject's own hands by preparing a BMI-based occupational therapy assist suit (BOTAS. We prepared a pre-recorded series of useful actionsa grasping-a-ball movement and a carrying-the-ball movementand added asynchronous control using steady-state visual evoked potential (SSVEP signals. A SSVEP signal was used to trigger the grasping-a-ball movement and another SSVEP signal was used to trigger the carrying-the-ball movement. A support vector machine was used to classify EEG signals recorded from the visual cortex (Oz in real time. Untrained, able-bodied participants (n = 12 operated the system successfully. Classification accuracy and time required for SSVEP detection were approximately 88% and 3 s, respectively. We further recruited three patients with upper cervical spinal cord injuries; they also succeeded in operating the system without training. These data suggest that our BOTAS system is potentially useful in terms of rehabilitation of patients with upper limb disabilities.
BMI and BMI SDS in childhood: annual increments and conditional change
Brannsether-Ellingsen, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Juliusson, Petur Benedikt
2016-01-01
Background: Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim: To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods: The distributions of 1-year increments of BMI (kg/m2) and BMI SDS are summarised by...
The role of culture in the context of school-based BMI screening.
Fitzgibbon, Marian L; Beech, Bettina M
2009-09-01
The high prevalence of overweight and obesity is a significant public health concern in the United States. Minority populations are disproportionately affected, and the impact of obesity on minority children is especially alarming. In this article we discuss school-based BMI reporting, which is intended to increase parental awareness of their children's weight status. This information could potentially lead parents of overweight and obese children to carefully examine and possibly change their children's diet and activity patterns. However, any program related to child weight status must consider culturally defined aspects of body size and shape. In other words, the cultural context in which information on child BMI is presented to and received by parents must be considered. In this article we review parental perceptions of child weight. Multiple studies have shown that parents of overweight or obese children often fail to correctly perceive their children as overweight. Possible reasons for, and implications of, this misperception of child weight status among minority parents are then explored within a cultural framework. The PEN-3 model is used to examine influences on health behaviors and could help inform the development of a culturally sensitive BMI-notification program for minority parents. Reporting materials congruent with the social and cultural values and practices of the target audience are likely to maximize program effectiveness. A culturally based BMI-notification program should be conceptualized as a small step in a comprehensive plan to reduce childhood obesity and improve the current and future health of minority children.
Laxer, Rachel E; Cooke, Martin; Dubin, Joel A; Brownson, Ross C; Chaurasia, Ashok; Leatherdale, Scott T
2018-01-01
Youth are engaging in multiple risky behaviours, increasing their risk of overweight, obesity, and related chronic diseases. The objective of this study was to examine the effect of engaging in unique clusters of unhealthy behaviours on youths' body mass index (BMI) trajectories. This study used a linked-longitudinal sample of Grades 9 and 10 students (13 to 17 years of age) participating in the COMPASS host study. Students reported obesity-related and other risky behaviours at baseline and height and weight (to derive BMI) at baseline (2012/2013) and annually for 2 years post-baseline (2013/14 and 2014/15). Students were grouped into behavioural clusters based on response probabilities. Linear mixed effects models, using BMI as a continuous outcome measure, were used to examine the effect of engaging in clusters of risky behaviours on BMI trajectories. There were significant differences in BMI of the four behavioural clusters at baseline that remained consistent over time. Higher BMI values were found among youth classified at baseline to be Typical High School Athletes (β = 0.232 kg/m2, [confidence interval (CI): 0.03-0.50]), Inactive High Screen-User (β = 0.348 kg/m2, CI: 0.11-0.59) and Moderately Active Substance Users (β = 0.759 kg/m2, CI: 0.36-1.15) compared to students classified as Health Conscious. Despite these baseline differences, BMI appeared to increase across all behavioural clusters annually by the same amount (β = 0.6097 kg/m2, (CI) = 0.57-0.64). Although annual increases in BMI did not differ by behavioural clusters, membership in a particular behavioural cluster was associated with baseline BMI, and these differences remained consistent over time. Results indicate that intervening and modifying unhealthy behaviours earlier might have a greater impact than during adolescence. Health promotion strategies targeting the highest risk youth as they enter secondary school might be promising means to prevent or delay the onset of obesity.
Community-Specific BMI Cutoff Points for South Indian Females
Directory of Open Access Journals (Sweden)
K. B. Kishore Mohan
2011-01-01
Full Text Available Objective. To analyze multiparameters related to total body composition, with specific emphasis on obesity in South Indian females, in order to derive community-specific BMI cutoff points. Patients and Methods. A total number of 87 females (of age 37.33±13.12 years from South Indian Chennai urban population participated in this clinical study. Body composition analysis and anthropometric measurements were acquired after conducting careful clinical examination. Results. BMI demonstrated high significance when normal group (21.02±1.47 kg/m2 was compared with obese group (29.31±3.95 kg/m2, <0.0001. BFM displayed high significance when normal group (14.92±4.28 kg was compared with obese group (29.94 ± 8.1 kg, <0.0001. Conclusion. Community-specific BMI cutoffs are necessary to assess obesity in different ethnic groups, and relying on WHO-based universal BMI cutoff points would be a wrong strategy.
BMI Trajectories from Birth to Young Adulthood.
McGinty, Shannon M; Osganian, Stavroula K; Feldman, Henry A; Milliren, Carly E; Field, Alison E; Richmond, Tracy K
2018-04-19
This study aimed to compare BMI trajectories from childhood to early adulthood in those with overweight and/or obesity versus severe obesity. Longitudinal BMI values (2,542 measurements) were calculated from measured heights and weights for 103 children, adolescents, or young adults with overweight, obesity, or severe obesity. Segmented regression with splines was used to model BMI trajectories. Sixty-nine participants were classified as ever having severe obesity versus 34 who never had severe obesity. Trajectories and slopes did not differ by sex or race/ethnicity. Compared with those who never had severe obesity, BMI was higher in the group with severe obesity at all ages, and BMI slope was higher for those with severe obesity at age 14 (P = 0.002), with peak slope occurring later (18 years vs. 16 years) and higher (4.5 ± 0.5 kg/m 2 /y vs. 2.9 ± 0.5 kg/m 2 /y; P BMI fell below zero by the mid-20s (-0.3 ± 0.6 kg/m 2 /y); in those with severe obesity, BMI slope never reached zero (0.9 ± 0.5 kg/m 2 /y). Youth with severe obesity, compared with their peers without, started with higher BMIs, had more rapid rates of BMI increase beginning at age 14, as well as a higher peak and longer period of increase, and never achieved weight stabilization. © 2018 The Obesity Society.
Soekadar, Surjo R; Witkowski, Matthias; Mellinger, Jürgen; Ramos, Ander; Birbaumer, Niels; Cohen, Leonardo G
2011-10-01
Event-related desynchronization (ERD) of sensori-motor rhythms (SMR) can be used for online brain-machine interface (BMI) control, but yields challenges related to the stability of ERD and feedback strategy to optimize BMI learning.Here, we compared two approaches to this challenge in 20 right-handed healthy subjects (HS, five sessions each, S1-S5) and four stroke patients (SP, 15 sessions each, S1-S15). ERD was recorded from a 275-sensor MEG system. During daily training,motor imagery-induced ERD led to visual and proprioceptive feedback delivered through an orthotic device attached to the subjects' hand and fingers. Group A trained with a heterogeneous reference value (RV) for ERD detection with binary feedback and Group B with a homogenous RV and graded feedback (10 HS and 2 SP in each group). HS in Group B showed better BMI performance than Group A (p learning was significantly better (p learning relative to use of a heterogeneous RV and binary feedback.
Correlation between physical activity measured by accelerometry and BMI in adolescents
Directory of Open Access Journals (Sweden)
Antonio Stabelini Neto
2013-03-01
The aim of this study was to investigate the correlation between physical activity measured by accelerometry and excess weight in schoolchildren. Three hundred and ninety one school-age adolescents (10 to 18 years old participated in the study. The cut-off points used to estimate time spent in physical activity were: moderate ≥3.0 METs and vigorous ≥6.0 METs. Student’s t-test and Pearson product-moment correlation coefficient were used to verify statistical differences and correlations between physical activity and body mass index (BMI. Statistical significance was set at p<0.05. Male schoolchildren spent more time in moderate (96.1 ± 39.6 min.day-1 and vigorous (9.7 ± 8.8 min.day-1 physical activity than their female peers (moderate: 73.7 ± 37.7 min.day-1; vigorous: 6.1 ± 6.8 min.day-1. For both sexes, younger schoolchildren (10 to 14 years old were more physically active than older ones (14 to 18 years old. Time spent in moderate-vigorous physical activity was inversely related to BMI. These findings suggest that regular physical activity (RPA is related to body weight reduction in schoolchildren. Therefore, RPA can be used as an obesity prevention strategy in elementary school.
BMI, total and abdominal fat distribution, and cardiovascular risk factors in school-age children.
Gishti, Olta; Gaillard, Romy; Durmus, Busra; Abrahamse, Marieke; van der Beek, Eline M; Hofman, Albert; Franco, Oscar H; de Jonge, Layla L; Jaddoe, Vincent W V
2015-05-01
More specific total body and abdominal fat mass measures might be stronger associated with cardiovascular risk factors in childhood, than BMI. We examined the independent associations of total and abdominal fat measures with cardiovascular risk factors in school age children. We performed a population-based cohort study among 6,523 children. At the age of 6 y, we measured childhood BMI, and general and abdominal fat mass, using dual-energy X-ray absorptiometry, and ultrasound and cardiovascular risk factors. Conditional on BMI, higher fat mass percentage and abdominal fat mass were associated with higher blood pressure, total- and low-density lipoprotein (LDL)-cholesterol, insulin and c-peptide levels, but with lower left ventricular mass and high-density lipoprotein (HDL)-cholesterol (P values children. Higher childhood adiposity measures were associated with increased odds of cardiovascular risk factors clustering, with the strongest effect for fat mass percentage (odds ratios: 3.01 (95% confidence interval: 2.67, 3.9). Our results suggest that general and abdominal fat measures are associated with cardiovascular risk factors in childhood, independent from BMI. These measures may provide additional information for identification of children with an adverse cardiovascular profile.
Nugent, Stephen D; Kaats, Gilbert R; Preuss, Harry G
2018-01-01
A general assumption is that the body mass index (BMI) reflects changes in fat mass (FM). However, it fails to distinguish the type of weight that is lost or gained-fat mass (FM) or fat-free mass (FFM). The BMI treats both changes the same although they have opposite health consequences. The objective of this study was to propose a more precise measure, a body composition change index (BCCI), which distinguishes between changes in FM and FFM, and this study compares it with using the BMI as an outcome measure. Data were obtained from 3,870 subjects who had completed dual-energy x-ray absorptiometry (DEXA) total body scans at baseline and end-of-study when participating in a variety of weight-loss interventions. Since height remained constant in this adult cohort, changes in the BMI corresponded with scale weight changes (r = 0.994), allowing BMI changes to be converted to "lbs." to match the statistic used for calculation of the BCCI. The BCCI is calculated by scoring increases in FFM (lbs.) and decreases in FM (lbs.) as positive outcomes and scoring decreases in FFM and increases in FM as negative outcomes. The BCCI is the net sum of these calculations. Differences between scale weight changes and BCCI values were subsequently compared to obtain "discordance scores." Discordance scores ranged from 0.0 lbs. to >30.0 lbs. with a mean absolute value of between the two measures of 7.79 lbs. (99% confidence interval: 7.49-8.10, p BCCI and the BMI to evaluate the efficacy of weight loss interventions. If assessing changes in body composition is a treatment goal, use of the BMI could result in significantly erroneous conclusions.
Bhaskaran, Krishnan; Forbes, Harriet J; Douglas, Ian; Leon, David A; Smeeth, Liam
2013-01-01
Objectives To assess the completeness and representativeness of body mass index (BMI) data in the Clinical Practice Research Datalink (CPRD), and determine an optimal strategy for their use. Design Descriptive study. Setting Electronic healthcare records from primary care. Participants A million patient random sample from the UK CPRD primary care database, aged ≥16 years. Primary and secondary outcome measures BMI completeness in CPRD was evaluated by age, sex and calendar period. CPRD-based summary BMI statistics for each calendar year (2003–2010) were age-standardised and sex-standardised and compared with equivalent statistics from the Health Survey for England (HSE). Results BMI completeness increased over calendar time from 37% in 1990–1994 to 77% in 2005–2011, was higher among females and increased with age. When BMI at specific time points was assigned based on the most recent record, calendar–year-specific mean BMI statistics underestimated equivalent HSE statistics by 0.75–1.1 kg/m2. Restriction to those with a recent (≤3 years) BMI resulted in mean BMI estimates closer to HSE (≤0.28 kg/m2 underestimation), but excluded up to 47% of patients. An alternative strategy of imputing up-to-date BMI based on modelled changes in BMI over time since the last available record also led to mean BMI estimates that were close to HSE (≤0.37 kg/m2 underestimation). Conclusions Completeness of BMI in CPRD increased over time and varied by age and sex. At a given point in time, a large proportion of the most recent BMIs are unlikely to reflect current BMI; consequent BMI misclassification might be reduced by employing model-based imputation of current BMI. PMID:24038008
Socioeconomic differences in childhood BMI trajectories in Belarus.
Patel, Rita; Tilling, Kate; Lawlor, Debbie A; Howe, Laura D; Hughes, Rachael A; Bogdanovich, Natalia; Matush, Lidia; Nicoli, Emily; Oken, Emily; Kramer, Michael S; Martin, Richard M
2018-02-28
To examine associations of parental socioeconomic position with early-life offspring body mass index (BMI) trajectories in a middle-income country. Overall, 12,385 Belarusian children born 1996-97 and enrolled in a randomised breastfeeding promotion trial at birth, with 3-14 measurements of BMI from birth to 7 years. Cohort analysis in which exposures were parental education (common secondary or less; advanced secondary or partial university; completed university) and occupation (manual; non-manual) at birth, and the outcome was BMI z-score trajectories estimated using multilevel linear spline models, controlling for trial arm, location, parental BMI, maternal smoking status and number of older siblings. Infants born to university-educated mothers were heavier at birth than those born to secondary school-educated mothers [by 0.13 BMI z-score units (95% confidence interval, CI: 0.07, 0.19) for girls and 0.11 (95% CI: 0.05, 0.17) for boys; equivalent for an infant of average birth length to 43 and 38 g, respectively]. Between the ages of 3-7 years children of the most educated mothers had larger BMI increases than children of the least educated mothers. At age 7 years, after controlling for trial arm and location, children of university-educated mothers had higher BMIs than those born to secondary school-educated mothers by 0.11 z-score (95% CI: 0.03, 0.19) among girls and 0.18 (95% CI: 0.1, 0.27) among boys, equivalent to differences in BMI for a child of average height of 0.19 and 0.26 kg/m 2 , respectively. After further controlling for parental BMI, these differences attenuated to 0.08 z-score (95% CI: 0, 0.16) and 0.16 z-score (95% CI: 0.07, 0.24), respectively, but changed very little after additional adjustment for number of older siblings and mother's smoking status. Associations were similar when based on paternal educational attainment and highest household occupation. In Belarus, consistent with some middle-income countries, higher socioeconomic
Bidirectional associations between mothers' and fathers' parenting consistency and child BMI.
Jansen, Pauline W; Giallo, Rebecca; Westrupp, Elizabeth M; Wake, Melissa; Nicholson, Jan M
2013-12-01
Research suggests that general parenting dimensions and styles are associated with children's BMI, but directionality in this relationship remains unknown. Moreover, there has been little attention to the influences of both mothers' and fathers' parenting. We aimed to examine reciprocal relationships between maternal and paternal parenting consistency and child BMI. Participants were 4002 children and their parents in the population-based Longitudinal Study of Australian Children. Mothers and fathers self-reported parenting consistency, and children's BMI was measured at 4 biennial waves starting at age 4 to 5 years in 2004. Bidirectionality between parenting and child BMI was examined by using regression analyses in cross-lagged models. The best-fitting models indicated a modest influence from parenting to child BMI, whereas no support was found for bidirectional influences. For mothers, higher levels of parenting consistency predicted lower BMI in children from Waves 1 to 2 and 3 to 4; for example, for every SD increase in mothers' parenting consistency at Wave 1, child BMIz fell by 0.025 in Wave 2 (95% confidence interval: -0.05 to -0.003). For fathers, higher levels of parenting consistency were associated with lower child BMI from Waves 1 to 2 and 2 to 3. Parenting inconsistency of mothers and fathers prospectively predicted small increases in offspring BMI over 2-year periods across middle childhood. However, child BMI did not appear to influence parenting behavior. These findings support recent calls for expanding childhood overweight interventions to address the broad parenting context while involving both mothers and fathers.
Body image, BMI, and physical activity in girls and boys aged 14-16 years.
Kantanista, Adam; Osiński, Wiesław; Borowiec, Joanna; Tomczak, Maciej; Król-Zielińska, Magdalena
2015-09-01
The aim of this study was to investigate the relationship between body image, body mass index (BMI), and physical activity in adolescents. The study included 1702 girls and 1547 boys aged 14-16 years. Moderate-to-vigorous physical activity (MVPA) was evaluated by the Physical Activity Screening Measure. Body image was assessed using the Feelings and Attitudes Towards the Body Scale, and participants' BMI was determined based on measured height and weight. Compared to boys, girls reported more negative body image (pboys than in girls. These findings suggest that body image, rather than BMI, is important in undertaking physical activity in adolescents and should be considered when preparing programs aimed at improving physical activity. Copyright © 2015 Elsevier Ltd. All rights reserved.
Low birth weight, adult BMI and inflammation in middle age
DEFF Research Database (Denmark)
Pedersen, Jolene Lee Masters; Rod, Naja Hulvej; Avlund, Kirsten
2013-01-01
This study examines the association between birthweight and adult BMI with inflammation in middle age measured by interleukin 6 (IL- 6), interleukin 10 (IL-10), interleukin 18 (IL-18), high sensitivity Creactive protein (hsCRP) and tumor necrosis factor alpha (tnf-α). The study is based on partic...
... between the BMI and body fatness is fairly strong 1,2,3,7 , but even if 2 people have the same BMI, their level of body fatness may differ 12 . In general, At the same BMI, women tend to have more body fat than men. At the same BMI, Blacks have less body ...
Association between Infancy BMI Peak and Body Composition and Blood Pressure at Age 5–6 Years
Hof, Michel H. P.; Vrijkotte, Tanja G. M.; de Hoog, Marieke L. A.; van Eijsden, Manon; Zwinderman, Aeilko H.
2013-01-01
Introduction The development of overweight is often measured with the body mass index (BMI). During childhood the BMI curve has two characteristic points: the adiposity rebound at 6 years and the BMI peak at 9 months of age. In this study, the associations between the BMI peak and body composition measures and blood pressure at age 5–6 years were investigated. Methods Measurements from the Amsterdam Born Children and their Development (ABCD) study were available for this study. Blood pressure (systolic and diastolic) and body composition measures (BMI, waist-to-height ratio, fat percentage) were gathered during a health check at about 6 years of age (n = 2822). All children had multiple BMI measurements between the 0–4 years of age. For boys and girls separately, child-specific BMI peaks were extracted from mixed effect models. Associations between the estimated BMI peak and the health check measurements were analysed with linear models. In addition, we investigated the potential use of the BMI at 9 months as a surrogate measure for the magnitude of the BMI peak. Results After correction for the confounding effect of fetal growth, both timing and magnitude of the BMI peak were significantly and positively associated (pBMI peak showed no direct association with blood pressure at the age 5–6 year, but was mediated by the current BMI. The correlation between the magnitude of the BMI peak and BMI at 9 months was approximately 0.93 and similar associations with the measures at 5–6 years were found. Conclusion The magnitude of the BMI peak was associated with body composition measures at 5–6 years of age. Moreover, the BMI at 9 months could be used as surrogate measure for the magnitude of the BMI peak. PMID:24324605
Gurka, Matthew J; Filipp, Stephanie L; Musani, Solomon K; Sims, Mario; DeBoer, Mark D
2018-02-01
Estimates of adiposity in evaluating the metabolic syndrome (MetS) have traditionally utilized measures of waist circumference (WC), whereas body mass index (BMI) is more commonly used clinically. Our objective was to determine if a MetS severity Z-score employing BMI as its measure of adiposity (MetS-Z-BMI) would perform similarly to a WC-based score (MetS-Z-WC) in predicting future disease. To formulate the MetS-Z-BMI, we performed confirmatory factor analysis on a sex- and race/ethnicity-specific basis on MetS-related data for 6870 adult participants of the National Health and Nutrition Survey 1999-2010. We then validated this score and compared it to MetS-Z-WC in assessing correlations with future coronary heart disease (CHD) and Type 2 diabetes mellitus (T2DM) using Cox proportional hazard analysis of 13,094 participants of the Atherosclerosis Risk in Communities study and Jackson Heart Study. Loading factors, which represent the relative contribution of each component to the latent MetS factor, were lower for BMI than for WC in formulating the two respective scores (MetS-Z-BMI and MetS-Z-WC). Nevertheless, MetS-Z-BMI and MetS-Z-WC exhibited similar hazard ratios (HR) toward future disease. For each one standard-deviation-unit increase in MetS-Z-BMI, HR for CHD was 1.76 (95% confidence interval [CI]: 1.65, 1.88) and HR for T2DM was 3.39 (CI 3.16, 3.63) (both p BMI scores in their associations with future CHD and T2DM. A MetS severity Z-score utilizing BMI as its measure of adiposity operated similarly to a WC-based score in predicting future CHD and T2DM, suggesting overall similarity in MetS-based risk as estimated by both measures of adiposity. This indicates potential clinical usefulness of MetS-Z-BMI in assessing and following MetS-related risk over time. Copyright © 2018. Published by Elsevier Inc.
International Nuclear Information System (INIS)
Muto, Natalia Sayuri; Kamishima, Tamotsu; Harris, Ardene A.; Kato, Fumi; Onodera, Yuya; Terae, Satoshi; Shirato, Hiroki
2011-01-01
Purpose: To evaluate the relationship between renal cortical volume, measured by an automatic contouring software, with body mass index (BMI), age and renal function. Materials and methods: The study was performed in accordance to the institutional guidelines at our hospital. Sixty-four patients (34 men, 30 women), aged 19 to 79 years had their CT scans for diagnosis or follow-up of hepatocellular carcinoma retrospectively examined by a computer workstation using a software that automatically contours the renal cortex and the renal parenchyma. Body mass index and estimated glomerular filtration rate (eGFR) were calculated based on data collected. Statistical analysis was done using the Student t-test, multiple regression analysis, and intraclass correlation coefficient (ICC). Results: The ICC for total renal and renal cortical volumes were 0.98 and 0.99, respectively. Renal volume measurements yielded a mean cortical volume of 105.8 cm 3 ± 28.4 SD, mean total volume of 153 cm 3 ± 39 SD and mean medullary volume of 47.8 cm 3 ± 19.5 SD. The correlation between body weight/height/BMI and both total renal and cortical volumes presented r = 0.6, 0.6 and 0.4, respectively, p < 0.05, while the correlation between renal cortex and age was r = -0.3, p < 0.05. eGFR showed correlation with renal cortical volume r = 0.6, p < 0.05. Conclusion: This study demonstrated that renal cortical volume had a moderate positive relationship with BMI, moderate negative relationship with age, and a strong positive relationship with the renal function, and provided a new method to routinely produce volumetric assessment of the kidney.
Self-control mediates the relationship between time perspective and BMI.
Price, Menna; Higgs, Suzanne; Lee, Michelle
2017-01-01
Trait future time perspective measures the extent to which behaviour is dominated by a striving for future goals and rewards. Trait present time perspective measures orientation towards immediate pleasure. Previous research has explored the relationship between future and present time perspective and BMI with mixed findings. In addition, the psychological mechanism underlying this relationship is unclear. Self-control is a likely candidate, as it has been related to both BMI and time perspective, but the relationship between all of these concepts has not been examined in a single study. Therefore, the aim of this study was to examine if trait self-control mediates the relationship between time perspective (future and present) and BMI. Self-report time perspective (ZTPI), self-control (SCS) and height/weight data were collected using an online survey from a mixed student and community sample (N = 218) with wide ranging age (mean 29, SD 11, range 18-73 years) and BMI (mean 24, SD 4, range 15-43). The results of a structural equation model including both facets of time perspective suggested that the traits are related yet distinct measures that independently predict BMI through changes in self-control. Bootstrap mediation analysis showed that self-control mediated the relationship between both future time perspective (95% CI, -0.10 to -0.02) and present time perspective (95% CI, 0.03 to 0.17), and BMI in opposite directions. Participants with higher future time perspective scores (higher present time perspective scores) had higher (lower) self-control, which predicted lower (higher) BMI. These results are consistent with previous research suggesting an important role for time perspective in health outcomes. Self-control likely mediates the relationship between temporal perspectives and BMI, suggesting that time perspective may be a target for individualised interventions. Copyright © 2016 Elsevier Ltd. All rights reserved.
Food brand recognition and BMI in preschoolers.
Harrison, Kristen; Moorman, Jessica; Peralta, Mericarmen; Fayhee, Kally
2017-07-01
Children's food brand recognition predicts health-related outcomes such as preference for obesogenic foods and increased risk for overweight. However, it is uncertain to what degree food brand recognition acts as a proxy for other factors such as parental education and income, child vocabulary, child age, child race/ethnicity, parent healthy eating guidance, child commercial TV viewing, and child dietary intake, all of which may influence or be influenced by food brand recognition. U.S. preschoolers (N = 247, average age 56 months) were measured for BMI and completed the Peabody Picture Vocabulary Test plus recognition and recall measures for a selection of U.S. food brands. Parents completed measures of healthy eating guidance, child dietary intake, child commercial TV viewing, parent education, household income, parent BMI, and child age and race/ethnicity. Controlling these variables, child food brand recognition predicted higher child BMI percentile. Further, qualitative examination of children's incorrect answers to recall items demonstrated perceptual confusion between brand mascots and other fantasy characters to which children are exposed during the preschool years, extending theory on child consumer development. Copyright © 2017 Elsevier Ltd. All rights reserved.
A hybrid BMI-based exoskeleton for paresis: EMG control for assisting arm movements.
Kawase, Toshihiro; Sakurada, Takeshi; Koike, Yasuharu; Kansaku, Kenji
2017-02-01
Brain-machine interface (BMI) technologies have succeeded in controlling robotic exoskeletons, enabling some paralyzed people to control their own arms and hands. We have developed an exoskeleton asynchronously controlled by EEG signals. In this study, to enable real-time control of the exoskeleton for paresis, we developed a hybrid system with EEG and EMG signals, and the EMG signals were used to estimate its joint angles. Eleven able-bodied subjects and two patients with upper cervical spinal cord injuries (SCIs) performed hand and arm movements, and the angles of the metacarpophalangeal (MP) joint of the index finger, wrist, and elbow were estimated from EMG signals using a formula that we derived to calculate joint angles from EMG signals, based on a musculoskeletal model. The formula was exploited to control the elbow of the exoskeleton after automatic adjustments. Four able-bodied subjects and a patient with upper cervical SCI wore an exoskeleton controlled using EMG signals and were required to perform hand and arm movements to carry and release a ball. Estimated angles of the MP joints of index fingers, wrists, and elbows were correlated well with the measured angles in 11 able-bodied subjects (correlation coefficients were 0.81 ± 0.09, 0.85 ± 0.09, and 0.76 ± 0.13, respectively) and the patients (e.g. 0.91 ± 0.01 in the elbow of a patient). Four able-bodied subjects successfully positioned their arms to adequate angles by extending their elbows and a joint of the exoskeleton, with root-mean-square errors exoskeleton, successfully carried a ball to a goal in all 10 trials. A BMI-based exoskeleton for paralyzed arms and hands using real-time control was realized by designing a new method to estimate joint angles based on EMG signals, and these may be useful for practical rehabilitation and the support of daily actions.
A hybrid BMI-based exoskeleton for paresis: EMG control for assisting arm movements
Kawase, Toshihiro; Sakurada, Takeshi; Koike, Yasuharu; Kansaku, Kenji
2017-02-01
Objective. Brain-machine interface (BMI) technologies have succeeded in controlling robotic exoskeletons, enabling some paralyzed people to control their own arms and hands. We have developed an exoskeleton asynchronously controlled by EEG signals. In this study, to enable real-time control of the exoskeleton for paresis, we developed a hybrid system with EEG and EMG signals, and the EMG signals were used to estimate its joint angles. Approach. Eleven able-bodied subjects and two patients with upper cervical spinal cord injuries (SCIs) performed hand and arm movements, and the angles of the metacarpophalangeal (MP) joint of the index finger, wrist, and elbow were estimated from EMG signals using a formula that we derived to calculate joint angles from EMG signals, based on a musculoskeletal model. The formula was exploited to control the elbow of the exoskeleton after automatic adjustments. Four able-bodied subjects and a patient with upper cervical SCI wore an exoskeleton controlled using EMG signals and were required to perform hand and arm movements to carry and release a ball. Main results. Estimated angles of the MP joints of index fingers, wrists, and elbows were correlated well with the measured angles in 11 able-bodied subjects (correlation coefficients were 0.81 ± 0.09, 0.85 ± 0.09, and 0.76 ± 0.13, respectively) and the patients (e.g. 0.91 ± 0.01 in the elbow of a patient). Four able-bodied subjects successfully positioned their arms to adequate angles by extending their elbows and a joint of the exoskeleton, with root-mean-square errors exoskeleton, successfully carried a ball to a goal in all 10 trials. Significance. A BMI-based exoskeleton for paralyzed arms and hands using real-time control was realized by designing a new method to estimate joint angles based on EMG signals, and these may be useful for practical rehabilitation and the support of daily actions.
Monnereau, Claire; Vogelezang, Suzanne; Kruithof, Claudia J.; Jaddoe, Vincent W. V.; Felix, Janine F.
2016-01-01
Background Results from genome-wide association studies (GWAS) identified many loci and biological pathways that influence adult body mass index (BMI). We aimed to identify if biological pathways related to adult BMI also affect infant growth and childhood adiposity measures. Methods We used data from a population-based prospective cohort study among 3,975 children with a mean age of 6?years. Genetic risk scores were constructed based on the 97 SNPs associated with adult BMI previously identi...
DEFF Research Database (Denmark)
Østergaard, Lars; Grøntved, Anders; Bjørkelund Børrestad, Line Anita
2012-01-01
Previous studies have been inconclusive concerning the effect of active transport on BMI. Our objective was to investigate the association between travel mode and BMI in a large community-based sample of Danish adolescents.......Previous studies have been inconclusive concerning the effect of active transport on BMI. Our objective was to investigate the association between travel mode and BMI in a large community-based sample of Danish adolescents....
Kakoly, Nadira Sultana; Earnest, Arul; Moran, Lisa J; Teede, Helena J; Joham, Anju E
2017-11-06
Obesity is common in young women, increasing insulin resistance (IR) and worsening pregnancy complications, including gestational diabetes (GDM). Women with polycystic ovary syndrome (PCOS) are commonly obese, which aggravates the severity of PCOS clinical expression. Relationships between these common insulin-resistant conditions, however, remain unclear. We conducted a secondary analysis of the Australian Longitudinal Study on Women's Health (ALSWH) database, including data from 8009 women aged 18-36 years across six surveys. We used latent-curve growth modelling to identify distinct body mass index (BMI) trajectories and multinomial logistic regression to explore sociodemographic and health variables characterizing BMI group membership. Logistic regression was used to assess independent risk of GDM. A total of 662 women (8.29%, 95% CI 7.68-8.89) reported PCOS. Three distinct BMI trajectories emerged, namely low stable (LSG) (63.8%), defined as an average trajectory remaining at ~25 kg/m 2 ; moderately rising (MRG) (28.8%), a curvilinear trajectory commencing in a healthy BMI and terminating in the overweight range; and high-rising (HRG) (7.4%), a curvilinear trajectory starting and terminating in the obese range. A high BMI in early reproductive life predicted membership in higher trajectories. The HRG BMI trajectory was independently associated with GDM (OR 2.50, 95% CI 1.80-3.48) and was a stronger correlate than PCOS (OR 1.89, 95% CI 1.41-2.54), maternal age, socioeconomic status, or parity. Our results suggest heterogeneity in BMI change among Australian women of reproductive age, with and without PCOS. Reducing early adult life weight represents an ideal opportunity to intervene at an early stage of reproductive life and decreases the risk of long-term metabolic complications such as GDM.
Chen, Ling-Wei; Aris, Izzuddin M; Bernard, Jonathan Y; Tint, Mya-Thway; Colega, Marjorelee; Gluckman, Peter D; Tan, Kok Hian; Shek, Lynette Pei-Chi; Chong, Yap-Seng; Yap, Fabian; Godfrey, Keith M; van Dam, Rob M; Chong, Mary Foong-Fong; Lee, Yung Seng
2017-03-01
Background: Infant body mass index (BMI) peak characteristics and early childhood BMI are emerging markers of future obesity and cardiometabolic disease risk, but little is known about their maternal nutritional determinants. Objective: We investigated the associations of maternal macronutrient intake with infant BMI peak characteristics and childhood BMI in the Growing Up in Singapore Towards healthy Outcomes study. Design: With the use of infant BMI data from birth to age 18 mo, infant BMI peak characteristics [age (in months) and magnitude (BMI peak ; in kg/m 2 ) at peak and prepeak velocities] were derived from subject-specific BMI curves that were fitted with the use of mixed-effects model with a natural cubic spline function. Associations of maternal macronutrient intake (assessed by using a 24-h recall during late gestation) with infant BMI peak characteristics ( n = 910) and BMI z scores at ages 2, 3, and 4 y were examined with the use of multivariable linear regression. Results: Mean absolute maternal macronutrient intakes (percentages of energy) were 72 g protein (15.6%), 69 g fat (32.6%), and 238 g carbohydrate (51.8%). A 25-g (∼100-kcal) increase in maternal carbohydrate intake was associated with a 0.01/mo (95% CI: 0.0003, 0.01/mo) higher prepeak velocity and a 0.04 (95% CI: 0.01, 0.08) higher BMI peak These associations were mainly driven by sugar intake, whereby a 25-g increment of maternal sugar intake was associated with a 0.02/mo (95% CI: 0.01, 0.03/mo) higher infant prepeak velocity and a 0.07 (95% CI: 0.01, 0.13) higher BMI peak Higher maternal carbohydrate and sugar intakes were associated with a higher offspring BMI z score at ages 2-4 y. Maternal protein and fat intakes were not consistently associated with the studied outcomes. Conclusion: Higher maternal carbohydrate and sugar intakes are associated with unfavorable infancy BMI peak characteristics and higher early childhood BMI. This trial was registered at clinicaltrials.gov as NCT
Directory of Open Access Journals (Sweden)
Barbara B. Brown
2017-12-01
Full Text Available Few studies examine how objectively measured use of local physical activity resources contributes to objectively-measured healthy physical activity and weight changes over time. We utilized objective measures to test whether changes in active travel and uses of three physical activity (PA resources–parks, recreation centers, and transit– related to changes in PA and BMI. Adults (n=536 in Salt Lake City, UT, wore accelerometer and GPS units in 2012 and 2013, before and after neighborhood rail completion. Regression outcomes included accelerometer counts per minute (cpm, MVPA (moderate-to-vigorous activity minutes/10h accelerometer wear and measured BMI; key predictors were changes in active travel and PA resource uses (former and new uses. Significant results (all p<0.05 showed that increased active travel related to increased total PA (59.86cpm and 8.50 MVPA; decreased active travel related to decreased MVPA (−3.01 MVPA. Poorer outcomes were seen after discontinuing use of parks (−36.29cpm, −5.73 MVPA, and +0.44 BMI points, recreation centers (−6.18 MVPA, and transit (−48.14cpm, −5.43 MVPA, and +0.66 BMI. Healthier outcomes were seen after commencing use of parks (29.83cpm, 5.25 MVPA, recreation centers (44.63cpm and transit (38.44cpm, 4.17 MVPA, and −0.56 BMI. Transit and park/recreational center uses were unrelated, although park users were more likely to be recreation center users. Active travel and use of three neighborhood PA resources relate to healthy activity and could be fostered by policy and design. Keywords: Recreation center, Accelerometry, Active transport, Built environment, Parks, Global positioning system
EFFECTS OF A SCHOOL-BASED INTERVENTION ON BMI AND MOTOR ABILITIES IN CHILDHOOD
Directory of Open Access Journals (Sweden)
Christine Graf
2005-09-01
Full Text Available Obesity in childhood is increasing worldwide. To combat overweight and obesity in childhood, the school-based Children's Health InterventionaL Trial (CHILT project combines health education and physical activity. This paper examines the effect of intervention on the body mass index (BMI and motor abilities after 20.8 ± 1.0 months in 12 randomly selected primary schools compared with 5 randomly selected control schools. The anthropometric data were assessed, BMI was calculated. Coordination was determined by lateral jumping and endurance performance by a 6-minute run. No difference in the prevalence of overweight and obesity was found between the intervention (IS and control schools (CS either at baseline or following intervention (each p > 0.05. The increase in the number of lateral jumps was significantly higher in the IS than in the CS (p < 0.001. For the 6-minute run the increase in distance run was significantly improved in IS (p = 0.020. All variables were controlled for gender and age. Overweight and obese children in both IS and CS produced significantly lower scores in coordination and endurance tasks than normal and underweight children during both examinations (each p < 0.001, adjusted for gender and age. Preventive intervention in primary schools offers an effective means to improve motor skills in childhood and to break through the vicious circle of physical inactivity - motor deficits - frustration - increasing inactivity possibly combined with an excess energy intake and weight gain. To prevent overweight and obesity these measures have to be intensified
Postoperative Complications of Total Joint Arthroplasty in Obese Patients Stratified by BMI.
Zusmanovich, Mikhail; Kester, Benjamin S; Schwarzkopf, Ran
2018-03-01
High body mass index (BMI) is associated with significant complications in patients undergoing total joint arthroplasty. Many studies have evaluated this trend, but few have looked at the rates of complications based on BMI as a continuous variable. The purpose of this study was to stratify obese patients into 3 BMI categories and evaluate their rates of complications and gauge whether transitioning from higher to lower BMI category lowers complication. Patients undergoing primary total joint arthroplasty were selected from the National Surgical Quality Improvement Program database from 2008-2015 and arranged into 3 groups based on BMI: O1 (BMI 30-34.9 kg/m 2 ), O2 (BMI 35-39.9 kg/m 2 ), and O3 (BMI >40 kg/m 2 ). Thirty-day complications were recorded and evaluated utilizing univariate and multivariate analyses stratified by BMI. A total of 268,663 patients were identified. Patients with a BMI >30 kg/m 2 had more infectious and medical complications compared with nonobese patients. Furthermore, there were increased complications as the BMI categories increased. Patients with a BMI >40 kg/m 2 (O3) had longer operating times, length of stay, higher rates of readmissions, reoperations, deep venous thrombosis, renal insufficiency, superficial infections, deep infections, and wound dehiscence. These trends were present when comparing the O2 with O1 category as well. We have demonstrated increased rates of medical and surgical complications in obese patients. Furthermore, we demonstrated a stepwise increase in complication rates when transitioning to higher BMI groups. Based on our data, we believe that preoperative counseling and interventions to decrease BMI should be explored before offering elective surgery to obese patients. Copyright © 2017 Elsevier Inc. All rights reserved.
Frayon, Stéphane; Cavaloc, Yolande; Wattelez, Guillaume; Cherrier, Sophie; Lerrant, Yannick; Ashwell, Margaret; Galy, Olivier
2017-12-15
Waist-to-height ratio (WHtR) is a simple anthropometric proxy for central body fat; it is easy to use from a health education perspective. A WHtR value >0.5 has been proposed as a first level indicator of health risk. The first aim of this study was to compare WHtR with values based on body mass index (BMI) in their prediction of the percentage of body fat (%BF) in a multi-ethnic population of adolescents from New-Caledonia (age 11-16year). Secondly, to see whether WHtR >0.5 could be used to detect overfat subjects whose BMI was in the normal range. Body fat percentage (%BF, based on skinfold measurements), BMI and WHtR were calculated for New Caledonian adolescents from different ethnic backgrounds. The relationship between %BF, BMI and WHtR was determined using quadratic models and from linear regression equations. The sensitivity and specificity of WHtR for detecting overfat adolescents (%BF >25% in boys and >30% in girls) were assessed and compared with those from the BMI-based classification. WHtR showed better correlation with %BF than BMI-based measurements. WHtR >0.5 was also more accurate than BMI in detecting overfat adolescents. Moreover, using this boundary value, 8% of adolescents in the normal BMI range were shown to be over-fat. WHtR is a good anthropometric proxy to detect overfat adolescents. Detecting overfat adolescents within the normal BMI range is particularly important for preventing non communicable diseases. We therefore recommend using WHtR for health education programs in the Pacific area and more generally. Copyright © 2017 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.
Laxy, Michael; Stark, Renée; Peters, Annette; Hauner, Hans; Holle, Rolf; Teuner, Christina M
2017-08-30
This study aims to analyse the non-linear relationship between Body Mass Index (BMI) and direct health care costs, and to quantify the resulting cost fraction attributable to obesity in Germany. Five cross-sectional surveys of cohort studies in southern Germany were pooled, resulting in data of 6757 individuals (31-96 years old). Self-reported information on health care utilisation was used to estimate direct health care costs for the year 2011. The relationship between measured BMI and annual costs was analysed using generalised additive models, and the cost fraction attributable to obesity was calculated. We found a non-linear association of BMI and health care costs with a continuously increasing slope for increasing BMI without any clear threshold. Under the consideration of the non-linear BMI-cost relationship, a shift in the BMI distribution so that the BMI of each individual is lowered by one point is associated with a 2.1% reduction of mean direct costs in the population. If obesity was eliminated, and the BMI of all obese individuals were lowered to 29.9 kg/m², this would reduce the mean direct costs by 4.0% in the population. Results show a non-linear relationship between BMI and health care costs, with very high costs for a few individuals with high BMI. This indicates that population-based interventions in combination with selective measures for very obese individuals might be the preferred strategy.
Physical activity modifies the FTO effect on BMI change in Japanese adolescents.
Shinozaki, Keiko; Okuda, Masayuki; Okayama, Naoko; Kunitsugu, Ichiro
2018-04-14
Evidence of the effects of fat mass and obesity-associated (FTO) gene variation and long-term effects of physical activity (PA) on adiposity in adolescents is largely scarce. This study aimed to investigate whether physical activity modulates the effects of the FTO gene on body mass index (BMI) changes in Japanese adolescents between the ages of 13 and 18 years. Data of 343 subjects (156 boys; 187 girls) who were enrolled in 2006 and 2007 from schools on Shunan City, Japan, were collected. Genotyping (rs1558902) was conducted, and anthropometric measurements and blood test results were recorded for subjects in the eighth grade. A second survey involving self-reporting of anthropometric measurements was conducted when the subjects were in the twelfth grade. PA was estimated using the International Physical Activity Questionnaire in this survey. BMI and the standard deviation score for BMI (BMI-SDS) were calculated. BMI changes and BMI-SDS changes were compared among FTO genotypes using a multivariate model. The effect of the interaction between PA and the FTO genotype on BMI changes was significant among boys but not girls. Among boys, PA had a significant negative influence on BMI-SDS changes in those with the AA genotype and a significant positive influence on BMI and BMI-SDS changes in those with the TT genotype. These data suggest that the influence of PA on BMI changes and BMI-SDS changes varied on the basis of genotype. PA modified the effect of the FTO gene on BMI changes in Japanese boys. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Reduced cortical thickness associated with visceral fat and BMI
Directory of Open Access Journals (Sweden)
Ralf Veit
2014-01-01
Full Text Available Structural brain imaging studies have shown that obesity is associated with widespread reductions in gray matter (GM volume. Although the body mass index (BMI is an easily accessible anthropometric measure, substantial health problems are more related to specific body fat compartments, like visceral adipose tissue (VAT. We investigated cortical thickness measures in a group of 72 healthy subjects (BMI range 20–35 kg/m2, age range 19–50 years. Multiple regression analyses were performed using VAT and BMI as predictors and age, gender, total surface area and education as confounds. BMI and VAT were independently associated with reductions in cortical thickness in clusters comprising the left lateral occipital area, the left inferior temporal cortex, and the left precentral and inferior parietal area, while the right insula, the left fusiform gyrus and the right inferior temporal area showed a negative correlation with VAT only. In addition, we could show significant reductions in cortical thickness with increasing VAT adjusted for BMI in the left temporal cortex. We were able to detect widespread cortical thinning in a young to middle-aged population related to BMI and VAT; these findings show close resemblance to studies focusing on GM volume differences in diabetic patients. This may point to the influence of VAT related adverse effects, like low-grade inflammation, as a potentially harmful factor on brain integrity already in individuals at risk of developing diabetes, metabolic syndromes and arteriosclerosis.
Rossi, Isabelle A; Rousson, Valentin; Viswanathan, Bharathi; Bovet, Pascal
2011-12-09
The relationship between body mass index (BMI) and socioeconomic status (SES) tends to change over time and across populations. In this study, we examined, separately in men and women, whether the association between BMI and SES changed over successive birth cohorts in the Seychelles (Indian Ocean, African region). We used data from all participants in three surveys conducted in 1989, 1994 and 2004 in independent random samples of the population aged 25-64 years in the Seychelles (N = 3'403). We used linear regression to model mean BMI according to age, cohort, SES and smoking status, allowing for a quadratic term for age to account for a curvilinear relation between BMI and age and interactions between SES and age and between SES and cohorts to test whether the relation between SES and BMI changed across subsequent cohorts. All analyses were performed separately in men and women. BMI increased with age in all birth cohorts. BMI was lower in men of low SES than high SES but was higher in women of low SES than high SES. In all SES categories, BMI increased over successive cohorts (1.24 kg/m2 in men and 1.51 kg/m2 for a 10-year increase in birth cohorts, p < 0.001). The difference in BMI between men or women of high vs. low SES did not change significantly across successive cohorts (the interaction between SES and year of birth of cohort was statistically not significant). Smoking was associated with lower BMI in men and women (respectively -1.55 kg/m2 and 2.46 kg/m2, p < 0.001). Although large differences exist between men and women, social patterning of BMI did not change significantly over successive cohorts in this population of a middle-income country in the African region.
Childhood BMI growth trajectories and endometrial cancer risk
DEFF Research Database (Denmark)
Aarestrup, Julie; Gamborg, Michael; Tilling, Kate
2017-01-01
Previously, we found that excess weight already in childhood has positive associations with endometrial cancer, however, associations with changes in body mass index (BMI) during childhood are not well understood. Therefore, we examined whether growth in childhood BMI is associated with endometrial...... cancer and its sub-types. A cohort of 155,505 girls from the Copenhagen School Health Records Register with measured weights and heights at the ages of 6 to 14 years and born 1930-89 formed the analytical population. BMI was transformed to age-specific z-scores. Using linear spline multilevel models......, each girl's BMI growth trajectory was estimated as the deviance from the average trajectory for three different growth periods (6.25-7.99, 8.0-10.99, 11.0-14.0 years). Via a link to health registers, 1020 endometrial cancer cases were identified, and Cox regressions were performed. A greater gain...
Association between infancy BMI peak and body composition and blood pressure at age 5-6 years
Hof, Michel H. P.; Vrijkotte, Tanja G. M.; de Hoog, Marieke L. A.; van Eijsden, Manon; Zwinderman, Aeilko H.
2013-01-01
The development of overweight is often measured with the body mass index (BMI). During childhood the BMI curve has two characteristic points: the adiposity rebound at 6 years and the BMI peak at 9 months of age. In this study, the associations between the BMI peak and body composition measures and
Directory of Open Access Journals (Sweden)
Rossi Isabelle A
2011-12-01
Full Text Available Abstract Background The relationship between body mass index (BMI and socioeconomic status (SES tends to change over time and across populations. In this study, we examined, separately in men and women, whether the association between BMI and SES changed over successive birth cohorts in the Seychelles (Indian Ocean, African region. Methods We used data from all participants in three surveys conducted in 1989, 1994 and 2004 in independent random samples of the population aged 25-64 years in the Seychelles (N = 3'403. We used linear regression to model mean BMI according to age, cohort, SES and smoking status, allowing for a quadratic term for age to account for a curvilinear relation between BMI and age and interactions between SES and age and between SES and cohorts to test whether the relation between SES and BMI changed across subsequent cohorts. All analyses were performed separately in men and women. Results BMI increased with age in all birth cohorts. BMI was lower in men of low SES than high SES but was higher in women of low SES than high SES. In all SES categories, BMI increased over successive cohorts (1.24 kg/m2 in men and 1.51 kg/m2 for a 10-year increase in birth cohorts, p 2 and 2.46 kg/m2, p Conclusions Although large differences exist between men and women, social patterning of BMI did not change significantly over successive cohorts in this population of a middle-income country in the African region.
Food and drinking patterns as predictors of 6-year BMI-adjusted changes in waist circumference
DEFF Research Database (Denmark)
Halkjær, Jytte; Sørensen, Thorkild I A; Tjønneland, Anne
2004-01-01
Few studies have investigated the prospective associations between diet or drinking patterns and abdominal obesity; we therefore investigated whether food and beverage groups or patterns predicted 6-year changes in waist circumference (WC) and whether these associations were independent...... of concurrent changes in BMI as a measure of general obesity. The subjects were 2300 middle-aged men and women with repeated measurements of dietary intake, BMI and WC from 1982 to 1993. Intakes from ten food groups and from coffee, tea, wine, beer and spirits were assessed; gender-specific food factors were......, but the associations were weakened, especially for women, after adjustment for BMI changes. None of the food factors was associated with WC changes. Based on the present study, we conclude that very few food items and no food patterns seem to predict changes in WC, whereas high intakes of beer and spirits among women...
Exercise mitigates cumulative associations between stress and BMI in girls age 10–19
Prather, Aric A.; Epel, Elissa S.; Loharuka, Sheila; Adler, Nancy E.; Laraia, Barbara
2015-01-01
Objective Long-term psychological stress is associated with BMI increases in children as they transition to adulthood, while long-term maintenance of physical activity can slow excess weight gain. We hypothesized that in addition to these main effects, long-term physical activity mitigates the relationship between long-term stress and BMI increase. Methods The NHLBI Growth and Health Study enrolled 2,379 10-year-old Black and White girls, following them annually for 10 measurement points. Growth curve modeling captured the dynamics of BMI, measured yearly, and stress and physical activity, measured every other year. Results At average levels of activity and stress, with all covariates remaining fixed, average BMI at baseline was 19.74 (SE = 0.38) and increased 0.64 BMI (SE= 0.01, p psychological stress. PMID:26301595
Warm Parenting Associated with Decreasing or Stable Child BMI during Treatment.
Rhee, Kyung E; Jelalian, Elissa; Boutelle, Kerri; Dickstein, Susan; Seifer, Ronald; Wing, Rena
2016-04-01
While authoritative parenting, which includes high levels of warmth and behavioral control, has been associated with lower risk of obesity, little is known about how general parenting impacts child weight loss during treatment. Our goal was to examine the relationship between several general parenting dimensions and 'decreasing /stable' child BMI during a 16-week family-based behavioral weight control program. Forty-four overweight parent-child dyads (child age 8 to 12 years) enrolled in the program. Families were videotaped at baseline eating dinner in their home. Using the General Parenting Observational Scale (GPOS), meals were coded for several general parenting dimensions. Primary outcome was percent of children whose BMI 'decreased or stayed the same.' Multivariable logistic regression was used to determine the relationship between general parenting and decreasing/stable child BMI. Forty families (91%) completed the program. Children had a mean BMI change of -0.40 (SD 1.57), which corresponds to a -0.15 (SD 0.20) change in BMI z-score (BMI-Z); 75% of children had decreasing/stable BMI. In the unadjusted models, lower parent BMI, higher parent education, and higher levels of parental warmth were significantly associated with decreasing/stable child BMI. In the multivariable model, only higher level of warmth was associated with increased odds of decreasing/stable child BMI (OR = 1.28; 95% CI, 1.01, 1.62). Baseline parental warmth may influence a child's ability to lower/maintain BMI during a standard family-based behavioral weight control program. Efforts to increase parent displays of warmth and emotional support towards their overweight child may help to increase the likelihood of treatment success.
Silventoinen, Karri; Jelenkovic, Aline; Sund, Reijo; Yokoyama, Yoshie; Hur, Yoon-Mi; Cozen, Wendy; Hwang, Amie E; Mack, Thomas M; Honda, Chika; Inui, Fujio; Iwatani, Yoshinori; Watanabe, Mikio; Tomizawa, Rie; Pietiläinen, Kirsi H; Rissanen, Aila; Siribaddana, Sisira H; Hotopf, Matthew; Sumathipala, Athula; Rijsdijk, Fruhling; Tan, Qihua; Zhang, Dongfeng; Pang, Zengchang; Piirtola, Maarit; Aaltonen, Sari; Öncel, Sevgi Y; Aliev, Fazil; Rebato, Esther; Hjelmborg, Jacob B; Christensen, Kaare; Skytthe, Axel; Kyvik, Kirsten O; Silberg, Judy L; Eaves, Lindon J; Cutler, Tessa L; Ordoñana, Juan R; Sánchez-Romera, Juan F; Colodro-Conde, Lucia; Song, Yun-Mi; Yang, Sarah; Lee, Kayoung; Franz, Carol E; Kremen, William S; Lyons, Michael J; Busjahn, Andreas; Nelson, Tracy L; Whitfield, Keith E; Kandler, Christian; Jang, Kerry L; Gatz, Margaret; Butler, David A; Stazi, Maria A; Fagnani, Corrado; D'Ippolito, Cristina; Duncan, Glen E; Buchwald, Dedra; Martin, Nicholas G; Medland, Sarah E; Montgomery, Grant W; Jeong, Hoe-Uk; Swan, Gary E; Krasnow, Ruth; Magnusson, Patrik Ke; Pedersen, Nancy L; Dahl Aslan, Anna K; McAdams, Tom A; Eley, Thalia C; Gregory, Alice M; Tynelius, Per; Baker, Laura A; Tuvblad, Catherine; Bayasgalan, Gombojav; Narandalai, Danshiitsoodol; Spector, Timothy D; Mangino, Massimo; Lachance, Genevieve; Burt, S Alexandra; Klump, Kelly L; Harris, Jennifer R; Brandt, Ingunn; Nilsen, Thomas S; Krueger, Robert F; McGue, Matt; Pahlen, Shandell; Corley, Robin P; Huibregtse, Brooke M; Bartels, Meike; van Beijsterveldt, Catharina Em; Willemsen, Gonneke; Goldberg, Jack H; Rasmussen, Finn; Tarnoki, Adam D; Tarnoki, David L; Derom, Catherine A; Vlietinck, Robert F; Loos, Ruth Jf; Hopper, John L; Sung, Joohon; Maes, Hermine H; Turkheimer, Eric; Boomsma, Dorret I; Sørensen, Thorkild Ia; Kaprio, Jaakko
2017-08-01
Background: Genes and the environment contribute to variation in adult body mass index [BMI (in kg/m 2 )], but factors modifying these variance components are poorly understood. Objective: We analyzed genetic and environmental variation in BMI between men and women from young adulthood to old age from the 1940s to the 2000s and between cultural-geographic regions representing high (North America and Australia), moderate (Europe), and low (East Asia) prevalence of obesity. Design: We used genetic structural equation modeling to analyze BMI in twins ≥20 y of age from 40 cohorts representing 20 countries (140,379 complete twin pairs). Results: The heritability of BMI decreased from 0.77 (95% CI: 0.77, 0.78) and 0.75 (95% CI: 0.74, 0.75) in men and women 20-29 y of age to 0.57 (95% CI: 0.54, 0.60) and 0.59 (95% CI: 0.53, 0.65) in men 70-79 y of age and women 80 y of age, respectively. The relative influence of unique environmental factors correspondingly increased. Differences in the sets of genes affecting BMI in men and women increased from 20-29 to 60-69 y of age. Mean BMI and variances in BMI increased from the 1940s to the 2000s and were greatest in North America and Australia, followed by Europe and East Asia. However, heritability estimates were largely similar over measurement years and between regions. There was no evidence of environmental factors shared by co-twins affecting BMI. Conclusions: The heritability of BMI decreased and differences in the sets of genes affecting BMI in men and women increased from young adulthood to old age. The heritability of BMI was largely similar between cultural-geographic regions and measurement years, despite large differences in mean BMI and variances in BMI. Our results show a strong influence of genetic factors on BMI, especially in early adulthood, regardless of the obesity level in the population. © 2017 American Society for Nutrition.
DEFF Research Database (Denmark)
Jensen, Britt Wang; Nielsen, Birgit Marie; Husby, Ida
Introduction: The consumption of sugar-sweetened beverages is one of the few dietary components that have been associated with the development of obesity. However, most previous studies have been based on children or adolescents aged 8 years or more. Method: The study was based on the Copenhagen......-days pre-printed food record. Analyses were conducted using the mixed model approach for repeated measurements and were adjusted for gender, puberty, parental BMI, municipality, school, baseline BMI, SES and physical activity. Results: 154 children, 68 boys and 86 girls were included in the analyses....... Mean intake of soft drinks was 0.14 l/d at age 6 and 0.12 l/d at age 9 (difference p=0.08). No associations were found between intake of soft drink at age 6 and BMI at age 13 (b:-0.8; p=0.91), or intake at age 9 and BMI at age 13 (b:-0.3; p= 0.80). Neither was the change in intake of soft drinks from...
Optimum BMI cut points to screen asian americans for type 2 diabetes.
Araneta, Maria Rosario G; Kanaya, Alka M; Hsu, William C; Chang, Healani K; Grandinetti, Andrew; Boyko, Edward J; Hayashi, Tomoshige; Kahn, Steven E; Leonetti, Donna L; McNeely, Marguerite J; Onishi, Yukiko; Sato, Kyoko K; Fujimoto, Wilfred Y
2015-05-01
Asian Americans manifest type 2 diabetes at low BMI levels but may not undergo diagnostic testing for diabetes if the currently recommended BMI screening cut point of ≥25 kg/m(2) is followed. We aimed to ascertain an appropriate lower BMI cut point among Asian-American adults without a prior diabetes diagnosis. We consolidated data from 1,663 participants, ages ≥45 years, without a prior diabetes diagnosis, from population- and community-based studies, including the Mediators of Atherosclerosis in South Asians Living in America study, the North Kohala Study, the Seattle Japanese American Community Diabetes Study, and the University of California San Diego Filipino Health Study. Clinical measures included a 2-h 75-g oral glucose tolerance test, BMI, and glycosylated hemoglobin (HbA1c). Mean age was 59.7 years, mean BMI was 25.4 kg/m(2), 58% were women, and type 2 diabetes prevalence (American Diabetes Association 2010 criteria) was 16.9%. At BMI ≥25 kg/m(2), sensitivity (63.7%), specificity (52.8%), and Youden index (0.16) values were low; limiting screening to BMI ≥25 kg/m(2) would miss 36% of Asian Americans with type 2 diabetes. For screening purposes, higher sensitivity is desirable to minimize missing cases, especially if the diagnostic test is relatively simple and inexpensive. At BMI ≥23 kg/m(2), sensitivity (84.7%) was high in the total sample and by sex and Asian-American subgroup and would miss only ∼15% of Asian Americans with diabetes. The BMI cut point for identifying Asian Americans who should be screened for undiagnosed type 2 diabetes should be <25 kg/m(2), and ≥23 kg/m(2) may be the most practical. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.
Madsen, Kristine A.; Linchey, Jennifer
2012-01-01
Background: School-based body mass index (BMI) or body composition screening is increasing, but little is known about the process of parent notification. Since 2001, California has required annual screening of body composition via the FITNESSGRAM, with optional notification. This study sought to identify the prevalence of parental notification…
Young, B E; Patinkin, Z; Palmer, C; de la Houssaye, B; Barbour, L A; Hernandez, T; Friedman, J E; Krebs, N F
2017-09-01
The impact of maternal BMI and insulin sensitivity on bioactive components of human milk (HM) is not well understood. As the prevalence of obesity and diabetes rises, it is increasingly critical that we understand how maternal BMI and hormones associated with metabolic disease relate to concentrations of bioactive components in HM. This longitudinal cohort design followed 48 breastfeeding mothers through the first four months of lactation, collecting fasting morning HM samples at 2-weeks and 1, 2, 3 and 4-months, and fasting maternal blood at 2-weeks and 4-months. Insulin, glucose, adipokines leptin and adiponectin, appetite regulating hormone ghrelin, marker of oxidative stress 8OHdG and inflammatory cytokines (IL-6, IL-8, and TNF-a) were measured in HM and maternal plasma. A total of 26 normal weight (NW) (BMI=21.4±2.0 kg/m 2 ) and 22 overweight/obese (OW/Ob) (BMI=30.4±4.2 kg/m 2 ) were followed. Of all HM analytes measured, only insulin and leptin were different between groups - consistently higher in the OW/Ob group (leptin: P<0.001; insulin: P<0.03). HM insulin was 98% higher than maternal plasma insulin at 2-weeks and 32% higher at 4-months (P<0.001). Maternal fasting plasma insulin and HOMA-IR were positively related to HM insulin at 2-weeks (P<0.001, R 2 ⩾0.38, n=31), and 4-months (P⩽0.005, R 2 ⩾0.20, n=38). The concentrations of insulin in HM are higher than in maternal plasma and are related to maternal BMI and insulin sensitivity. With the exception of leptin, there were minimal other differences observed in HM composition across a wide range in maternal BMI.
BMI change during puberty and the risk of heart failure.
Kindblom, J M; Bygdell, M; Sondén, A; Célind, J; Rosengren, A; Ohlsson, C
2018-03-12
Hospitalization for heart failure amongst younger men has increased. The reason for this is unknown but it coincides with the obesity epidemic. The aim of this study was to evaluate the association between childhood BMI (Body Mass Index) and BMI change during puberty for risk of adult heart failure in men. Using the BMI Epidemiology Study (BEST), a population-based study in Gothenburg, Sweden, we collected information on childhood BMI at age 8 years and BMI change during puberty (BMI at age 20 - BMI at 8) for men born 1945-1961, followed until December 2013 (n = 37 670). BMI was collected from paediatric growth charts and mandatory military conscription tests. Information on heart failure was retrieved from high-quality national registers (342 first hospitalizations for heart failure). BMI change during puberty was independently of childhood BMI associated with risk of heart failure in a nonlinear J-shaped manner. Subjects in the upper quartile of BMI change during puberty (Q4) had more than twofold increased risk of heart failure compared with subjects in Q1 [HR (Hazard Ratio) = 2.29, 95% CI (Confidence Interval) 1.68-3.12]. Childhood BMI was not independently associated with risk of heart failure. Boys developing overweight during puberty (HR 3.14; 95% CI 2.25-4.38) but not boys with childhood overweight that normalized during puberty (HR 1.12, 95% CI 0.63-2.00) had increased risk of heart failure compared with boys without childhood or young adult overweight. BMI change during puberty is a novel risk factor for adult heart failure in men. © 2018 The Association for the Publication of the Journal of Internal Medicine.
Longitudinal Analysis of Genetic Susceptibility and BMI Throughout Adult Life.
Song, Mingyang; Zheng, Yan; Qi, Lu; Hu, Frank B; Chan, Andrew T; Giovannucci, Edward L
2018-02-01
Little is known about the genetic influence on BMI trajectory throughout adulthood. We created a genetic risk score (GRS) comprising 97 adult BMI-associated variants among 9,971 women and 6,405 men of European ancestry. Serial measures of BMI were assessed from 18 (women) or 21 (men) years to 85 years of age. We also examined BMI change in early (from 18 or 21 to 45 years of age), middle (from 45 to 65 years of age), and late adulthood (from 65 to 80 years of age). GRS was positively associated with BMI across all ages, with stronger associations in women than in men. The associations increased from early to middle adulthood, peaked at 45 years of age in men and at 60 years of age in women (0.91 and 1.35 kg/m 2 per 10-allele increment, respectively) and subsequently declined in late adulthood. For women, each 10-allele increment in the GRS was associated with an average BMI gain of 0.54 kg/m 2 in early adulthood, whereas no statistically significant association was found for BMI change in middle or late adulthood or for BMI change in any life period in men. Our findings indicate that genetic predisposition exerts a persistent effect on adiposity throughout adult life and increases early adulthood weight gain in women. © 2017 by the American Diabetes Association.
Alternative regression models to assess increase in childhood BMI
Beyerlein, Andreas; Fahrmeir, Ludwig; Mansmann, Ulrich; Toschke, André M
2008-01-01
Abstract Background Body mass index (BMI) data usually have skewed distributions, for which common statistical modeling approaches such as simple linear or logistic regression have limitations. Methods Different regression approaches to predict childhood BMI by goodness-of-fit measures and means of interpretation were compared including generalized linear models (GLMs), quantile regression and Generalized Additive Models for Location, Scale and Shape (GAMLSS). We analyzed data of 4967 childre...
BMI at birth and overweight at age four.
Winter, Jonathan D; Taylor, Yhenneko; Mowrer, Lauren; Winter, Katherine M; Dulin, Michael F
Extensive investigation has established that an elevated weight at birth is associated with subsequent obesity and obesity related negative health outcomes. The significance of overweight at birth, however, remains ill-defined. Historically, it has been difficult to approximate adiposity in infancy in a way that is both simple and meaningful. Body-mass-index (BMI) growth charts for children younger than two years of age only became available in 2006 when published by the WHO. This retrospective cohort analysis utilised anthropometric data extracted from the electronic medical record of a large integrated healthcare system in North Carolina. BMI and weight-for-age (WFA) >85% of WHO growth charts measured newborn overweight and macrosomia respectively. Logistic regression models assessed the associations between newborn macrosomia and overweight and overweight at 4 years of age, as well as associations with maternal BMI. Models included demographic data, gestational age, and maternal diabetes status as covariates. Both BMI and WFA >85% at birth were significantly associated with overweight at age 4 years. However, the greater odds of overweight was associated with newborn BMI >85%, with an adjusted odds ratio (AOR) of 2.08 (95% confidence interval [CI]: 1.4-3.08) versus 1.57 (95% CI: 1.08-2.27). Maternal obesity was also more robustly correlated with newborn BMI >85%, AOR of 4.14 (95% CI: 1.6-10.7), than with newborn WFA >85%, AOR of 3.09 (95% CI: 1.41-6.77). BMI >85% at birth is independently associated with overweight at 4 years. Newborn overweight is perhaps superior to newborn macrosomia in predicting overweight at age 4. Copyright © 2016 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.
Television, sleep, outdoor play and BMI in young children: the GECKO Drenthe cohort.
Sijtsma, Anna; Koller, Marjory; Sauer, Pieter J J; Corpeleijn, Eva
2015-05-01
In this study, we investigated the interplay between screen time, sleep duration, outdoor play, having a television in the bedroom and the number of televisions at home and their association with body mass index (BMI) in preschool children. All participants, 3-4 years of age (n = 759), were part of the Groningen expert center for kids with obesity (GECKO) Drenthe birth cohort. Weight and height were measured. Total screen time, number of televisions at home, a television in the bedroom, sleep duration and time of outdoor play were self-reported by parents in a questionnaire. Ordinary least square (OLS) regression-based path analysis was used to estimate direct and indirect effects on BMI in mediation models. A television in the bedroom or more televisions at home gave a higher screen time, which were associated with decreased sleep duration and resulted in higher BMI (indirect effect = 0.0115, 95% bootstrap interval = 0.0016; 0.0368 and indirect effect = 0.0026, 95% bootstrap interval = 0.0004; 0.0078, respectively). In contrast to the direct effect of screen time, sleep duration and a television in the bedroom on BMI, no direct effect was found for outdoor play and number or televisions at home on BMI. Short sleep duration, long screen time and a television in the bedroom were associated with the presence of overweight in preschool children.
Analysis list: BMI1 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available BMI1 Blood,Digestive tract,Neural,Prostate + hg19 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI...1.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.5.tsv http://db...archive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI...1.Blood.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Diges...tive_tract.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Neural.tsv,http://dbarchive.bioscie
Neurodevelopmental problems and extremes in BMI
Directory of Open Access Journals (Sweden)
Nóra Kerekes
2015-07-01
Full Text Available Background. Over the last few decades, an increasing number of studies have suggested a connection between neurodevelopmental problems (NDPs and body mass index (BMI. Attention deficit/hyperactivity disorder (ADHD and autism spectrum disorders (ASD both seem to carry an increased risk for developing extreme BMI. However, the results are inconsistent, and there have been only a few studies of the general population of children.Aims. We had three aims with the present study: (1 to define the prevalence of extreme (low or high BMI in the group of children with ADHD and/or ASDs compared to the group of children without these NDPs; (2 to analyze whether extreme BMI is associated with the subdomains within the diagnostic categories of ADHD or ASD; and (3 to investigate the contribution of genetic and environmental factors to BMI in boys and girls at ages 9 and 12.Method. Parents of 9- or 12-year-old twins (n = 12,496 were interviewed using the Autism—Tics, ADHD and other Comorbidities (A-TAC inventory as part of the Child and Adolescent Twin Study in Sweden (CATSS. Univariate and multivariate generalized estimated equation models were used to analyze associations between extremes in BMI and NDPs.Results. ADHD screen-positive cases followed BMI distributions similar to those of children without ADHD or ASD. Significant association was found between ADHD and BMI only among 12-year-old girls, where the inattention subdomain of ADHD was significantly associated with the high extreme BMI. ASD scores were associated with both the low and the high extremes of BMI. Compared to children without ADHD or ASD, the prevalence of ASD screen-positive cases was three times greater in the high extreme BMI group and double as much in the low extreme BMI group. Stereotyped and repetitive behaviors were significantly associated with high extreme BMIs.Conclusion. Children with ASD, with or without coexisting ADHD, are more prone to have low or high extreme BMIs than
The effect of prenatal maternal cigarette smoking on children's BMI z-score with SGA as a mediator.
Salahuddin, Meliha; Pérez, Adriana; Ranjit, Nalini; Hoelscher, Deanna M; Kelder, Steven H
2018-02-21
The goal of this study was to assess the effect of prenatal maternal cigarette smoking on children's BMI z-score trajectories, and to evaluate whether small-for-gestational-age (SGA) acts as a potential mediator between prenatal maternal cigarette smoking and child's BMI z-score at 4 years of age. Group-based trajectory modeling (GBTM) methods were employed to describe and classify developmental BMI z-score trajectories (the outcome of interest) in children from 9 months to 4 years of age (n = 5221) in the Early Childhood Longitudinal Study, Birth Cohort (ECLS-B) study (2001-2005). Further analysis examined whether the identified BMI z-score trajectories varied with the exposure, prenatal maternal cigarette smoking. Mediation analyses were utilized to examine whether being SGA (binary measure) acted as a potential mediator in the relationship between prenatal maternal cigarette smoking and BMI z-score among 4-year-old children. Using GBTM, two BMI z-score trajectory groups were identified: normal BMI z-score (57.8%); and high BMI z-score (42.2%). Children of mothers who smoked cigarettes during pregnancy were 2.1 times (RR 95% CI: 1.1-4.0, P value = 0.023) more at risk of being in the high BMI z-score trajectory group. Prenatal cigarette smoking was positively related to SGA at birth, but SGA was inversely related to BMI z-score at 4 years. The direct effect (0.19, 95% CI: 0.18, 0.19; P value BMI z-score among 4-year-old children was stronger and in the opposite direction of the indirect effect (-0.04, 95% CI: -0.04, -0.04; P value BMI z-score group, as well with SGA. The effects of prenatal smoking on BMI z-score at 4 years appears to act through pathways other than SGA.
Relationship of glycemic and triglycerides with BMI in diabetic patients
International Nuclear Information System (INIS)
Parvez, A.; Ihsanullah; Rafiq, A.; Ahmad, N.; Khan, E.H.
2010-01-01
Background: Diabetes mellitus (DM) is a metabolic disorder characterised by chronic hyperglycaemia with disturbances in carbohydrate, fat and protein metabolism arising from defect in insulin secretion or action or both. The clinical guidelines recommend measurement of BMI as vital signs for evaluating the obese and diabetic patients. Methods: This study was carried out on 160 diabetics, which were divided on the basis of BMI into obese (120) and non-obese (40) diabetics from Peshawar district. All patients had their triglycerides and glucose checked after over night fast. Results: The serum triglyceride in diabetics having BMI >30 (obese) was increased as compared to patients having BMI <30 (non-obese). The comparison of serum glucose level in obese diabetics was found to be significantly raised as compared to non-obese diabetics. Conclusions and Recommendations: It was concluded that dyslipidemia is common in all diabetics. The abnormal triglyceride level can improve with good glycemic control, but do not reach the normal state. Good glycaemic control, Reducing BMI, periodic checkups of lipids and blood glucose are recommended for all diabetics in order to avoid complications. (author)
Relationship of glycemic and triglycerides with BMI in diabetic patients
Energy Technology Data Exchange (ETDEWEB)
Parvez, A; Ihsanullah,; Rafiq, A; Ahmad, N; Khan, E H [Khyber Teaching Hospital, Peshawar (Pakistan). Department of Pathology
2010-04-15
Background: Diabetes mellitus (DM) is a metabolic disorder characterised by chronic hyperglycaemia with disturbances in carbohydrate, fat and protein metabolism arising from defect in insulin secretion or action or both. The clinical guidelines recommend measurement of BMI as vital signs for evaluating the obese and diabetic patients. Methods: This study was carried out on 160 diabetics, which were divided on the basis of BMI into obese (120) and non-obese (40) diabetics from Peshawar district. All patients had their triglycerides and glucose checked after over night fast. Results: The serum triglyceride in diabetics having BMI >30 (obese) was increased as compared to patients having BMI <30 (non-obese). The comparison of serum glucose level in obese diabetics was found to be significantly raised as compared to non-obese diabetics. Conclusions and Recommendations: It was concluded that dyslipidemia is common in all diabetics. The abnormal triglyceride level can improve with good glycemic control, but do not reach the normal state. Good glycaemic control, Reducing BMI, periodic checkups of lipids and blood glucose are recommended for all diabetics in order to avoid complications. (author)
Raised BMI cut-off for overweight in Greenland Inuit--a review.
Andersen, Stig; Fleischer Rex, Karsten; Noahsen, Paneeraq; Sørensen, Hans Christian Florian; Mulvad, Gert; Laurberg, Peter
2013-01-01
Obesity is associated with increased morbidity and premature death. Obesity rates have increased worldwide and the WHO recommends monitoring. A steep rise in body mass index (BMI), a measure of adiposity, was detected in Greenland from 1963 to 1998. Interestingly, the BMI starting point was in the overweight range. This is not conceivable in a disease-free, physically active, pre-western hunter population. This led us to reconsider the cut-off point for overweight among Inuit in Greenland. We found 3 different approaches to defining the cut-off point of high BMI in Inuit. First, the contribution to the height by the torso compared to the legs is relatively high. This causes relatively more kilograms per centimetre of height that increases the BMI by approximately 10% compared to Caucasian whites. Second, defining the cut-off by the upper 90-percentile of BMI from height and weight in healthy young Inuit surveyed in 1963 estimated the cut-off point to be around 10% higher compared to Caucasians. Third, if similar LDL-cholesterol and triglycerides are assumed for a certain BMI in Caucasians, the corresponding BMI in Inuit in both Greenland and Canada is around 10% higher. However, genetic admixture of Greenland Inuit and Caucasian Danes will influence this difference and hamper a clear distinction with time. Defining overweight according to the WHO cut-off of a BMI above 25 kg/m(2) in Greenland Inuit may overestimate the number of individuals with elevated BMI.
Moon, Kilson; Krems, Carolin; Heuer, Thorsten; Roth, Alexander; Hoffmann, Ingrid
2017-01-01
Objective The objective of the study was to identify predictors of BMI in German adults by considering the BMI distribution and to determine whether the association between BMI and its predictors varies along the BMI distribution. Methods The sample included 9,214 adults aged 18–80 years from the German National Nutrition Survey II (NVS II). Quantile regression analyses were conducted to examine the association between BMI and the following predictors: age, sports activities, socio-economic status (SES), healthy eating index-NVS II (HEI-NVS II), dietary knowledge, sleeping duration and energy intake as well as status of smoking, partner relationship and self-reported health. Results Age, SES, self-reported health status, sports activities and energy intake were the strongest predictors of BMI. The important outcome of this study is that the association between BMI and its predictors varies along the BMI distribution. Especially, energy intake, health status and SES were marginally associated with BMI in normal-weight subjects; this relationships became stronger in the range of overweight, and were strongest in the range of obesity. Conclusions Predictors of BMI and the strength of these associations vary across the BMI distribution in German adults. Consequently, to identify predictors of BMI, the entire BMI distribution should be considered. PMID:28219069
Bliddal, Mette; Olsen, Jørn; Støvring, Henrik; Eriksen, Hanne-Lise F; Kesmodel, Ulrik S; Sørensen, Thorkild I A; Nøhr, Ellen A
2014-01-01
An association between maternal pre-pregnancy BMI and childhood intelligence quotient (IQ) has repeatedly been found but it is unknown if this association is causal or due to confounding caused by genetic or social factors. We used a cohort of 1,783 mothers and their 5-year-old children sampled from the Danish National Birth Cohort. The children participated between 2003 and 2008 in a neuropsychological assessment of cognitive ability including IQ tests taken by both the mother and the child. Linear regression analyses were used to estimate the associations between parental BMI and child IQ adjusted for a comprehensive set of potential confounders. Child IQ was assessed with the Wechsler Primary and Preschool Scales of Intelligence--Revised (WPPSI-R). The crude association between maternal BMI and child IQ showed that BMI was adversely associated with child IQ with a reduction in IQ of -0.40 point for each one unit increase in BMI. This association was attenuated after adjustment for social factors and maternal IQ to a value of -0.27 (-0.50 to -0.03). After mutual adjustment for the father's BMI and all other factors except maternal IQ, the association between paternal BMI and child IQ yielded a regression coefficient of -0.26 (-0.59 to 0.07), which was comparable to that seen for maternal BMI (-0.20 (-0.44 to 0.04)). Although maternal pre-pregnancy BMI was inversely associated with the IQ of her child, the similar association with paternal BMI suggests that it is not a specific pregnancy related adiposity effect.
Percutaneous Nephrolithotomy in Patients With BMI >50: Single Surgeon Outcomes and Feasibility.
Streeper, Necole M; Radtke, Andrew C; Penniston, Kristina L; McDermott, John C; Nakada, Stephen Y
2016-01-01
To evaluate the use of percutaneous nephrolithotomy (PNL) and technical approach in the super obese population (body mass index [BMI] ≥ 50). We performed a retrospective review of 31 consecutive PNL cases with a BMI > 50 from a single surgeon (SYN) from 1995 to 2013. Procedures were performed in the prone position, and upper pole access was used. Operative time, length of hospital stay, stone burden, complication rates, and stone-free rates were measured. Of the 31 patients who underwent PNL (age 51.2 ± 12; 71% female), the mean BMI was 59.1 ± 6 kg/m(2) (range 50.4-71.7 kg/m(2)). Mean stone burden was 3.8 cm ± 2. The majority of patients (90.3%) had an upper pole puncture site for access with an operative time of 122.1 ± 75 minutes. The technique was similar to non-obese patients; however, there was a need for extra-long instrumentation. The overall stone-free rate was 71%, with utilization of a second-look PNL in 11 cases. The complication rate, Clavien grade 3 or higher, was 9.7% (3 of 31). PNL is technically feasible, safe, and effective in patients with a BMI ≥ 50. The complication rate, length of hospital stay, and stone-free rate with use of second-look PNL in super obese patients are comparable to severely obese patients. Intervention should not be automatically ruled out or delayed based on the patient's BMI alone. Copyright © 2015 Elsevier Inc. All rights reserved.
Maternal and offspring intelligence in relation to BMI across childhood and adolescence.
Wraw, Christina; Deary, Ian J; Der, Geoff; Gale, Catharine R
2018-01-30
The present study tested the association between both mothers' and offspring's intelligence and offspring's body mass index (BMI) in youth. Participants were members of the National Longitudinal Survey of Youth 1979 (NLSY-79) Children and Young Adults cohort (n = 11,512) and their biological mothers who were members of the NLSY-79 (n = 4932). Offspring's IQ was measured with the Peabody Individual Achievement Test (PIAT). Mothers' IQ was measured with the Armed Forces Qualification Test (AFQT). A series of regression analyses tested the association between IQ and offspring's BMI by age group, while adjusting for pre-pregnancy BMI and family SES. The analyses were stratified by sex and ethnicity (non-Black and non-Hispanic, Black, and Hispanic). The following associations were observed in the fully adjusted analyses. For the non-Blacks and non-Hispanics, a SD increment in mothers' IQ was negatively associated with daughters' BMI across all age-groups, ranging from β = -0.12 (95% CI -0.22 to -0.02, p = 0.021) in late childhood, to β = -0.17 (95% C.I. -0.27 to -0.07, p = 0001), in early adolescence and a SD increment in boys' IQ was positively associated with their BMI in early adolescence β = 0.09 (95% CI 0.01-0.18, p = 0.031). For Blacks, there was a non-linear relationship between mothers' IQ and daughters' BMI across childhood and between girls' IQ and BMI across adolescence. There was a positive association between mothers' IQ and sons' BMI in early adolescence (β = 0.17, 95% CI 0.02-0.32, p = 0.030). For Hispanic boys, there was a positive IQ-BMI association in late childhood (β = 0.19, 95% CI 0.05-0.33, p = 0.008) and early adolescence (β = 0.17, 95% CI 0.04-0.31, p = 0.014). Mothers' IQ and offspring's IQ were associated with offspring's BMI. The relationships varied in direction and strength across ethnicity, age group and sex. Obesity interventions may benefit from acknowledging the heterogeneous
Change in BMI accurately predicted by social exposure to acquaintances.
Oloritun, Rahman O; Ouarda, Taha B M J; Moturu, Sai; Madan, Anmol; Pentland, Alex Sandy; Khayal, Inas
2013-01-01
Research has mostly focused on obesity and not on processes of BMI change more generally, although these may be key factors that lead to obesity. Studies have suggested that obesity is affected by social ties. However these studies used survey based data collection techniques that may be biased toward select only close friends and relatives. In this study, mobile phone sensing techniques were used to routinely capture social interaction data in an undergraduate dorm. By automating the capture of social interaction data, the limitations of self-reported social exposure data are avoided. This study attempts to understand and develop a model that best describes the change in BMI using social interaction data. We evaluated a cohort of 42 college students in a co-located university dorm, automatically captured via mobile phones and survey based health-related information. We determined the most predictive variables for change in BMI using the least absolute shrinkage and selection operator (LASSO) method. The selected variables, with gender, healthy diet category, and ability to manage stress, were used to build multiple linear regression models that estimate the effect of exposure and individual factors on change in BMI. We identified the best model using Akaike Information Criterion (AIC) and R(2). This study found a model that explains 68% (pchange in BMI. The model combined social interaction data, especially from acquaintances, and personal health-related information to explain change in BMI. This is the first study taking into account both interactions with different levels of social interaction and personal health-related information. Social interactions with acquaintances accounted for more than half the variation in change in BMI. This suggests the importance of not only individual health information but also the significance of social interactions with people we are exposed to, even people we may not consider as close friends.
The associations of Bmi-1 with progression of glomerular chronic kidney disease .
Yang, Xiaoxia; Bai, Ming; Ning, Xiaoxuan; Ma, Feng; Liu, Limin; Liu, Ting; Liu, Minna; Wang, Hanmin; Sun, Shiren
2018-02-01
Our previous studies indicated that Bmi-1 plays an important role in hypoxia-induced tubular epithelial-mesenchymal transition and the development of kidney fibrosis in cellular and animal models. However, circulating Bmi-1 levels in human chronic kidney disease (CKD) and their relation to progression remains unknown. We conducted a post-hoc analysis of a prospective cohort study. The blood samples and clinical data of 230 patients with glomerular CKD and 67 healthy adults were prospectively collected between January 2010 and June 2012. Serum Bmi-1 was measured using enzyme-linked immunosorbent assay (ELISA). CKD patients had significantly higher serum Bmi-1 concentrations than the healthy controls (496.4 (363.1 - 675.4) pg/mL compared with 257.3 (235.4 - 303.8) pg/mL, p Bmi-1 level inversely correlated with the estimated glomerular filtration rate (eGFR) (r = -0.346, p Bmi-1 levels and serum creatinine, blood urea nitrogen, cystatin C concentration, and the severity of tubulointerstitial fibrosis (r = 0.248, p Bmi-1 level was associated with a shorter duration of renal survival. Cox multivariate analyses further demonstrated that serum Bmi-1 concentration was an independent prognostic factor for CKD patients (HR = 6.48, p Bmi-1 levels were associated with adverse kidney disease outcome, suggesting that Bmi-1 is a novel biomarker for glomerular CKD progression. More data from larger longitudinal studies are required to validate our findings. .
Taylor, Anne W; Winefield, Helen; Kettler, Lisa; Roberts, Rachel; Gill, Tiffany K
2012-04-01
To describe the relationship between maternal full time employment and health-related and demographic variables associated with children aged 5-15 years, and the factors associated with child overweight/obesity. Data from a chronic disease and risk factor surveillance system were limited to children aged 5-15 years whose mothers responded on their behalf (n = 641). Univariate/multivariate analyses described the differences between mothers who did and did not work full time. The same data were analysed comparing children who are overweight/obese against those with a normal BMI. The children of mothers who worked full time are more likely to be older, live in a household with a higher household income, be an only child or have one sibling or other child in the household, have a sole mother family structure and not spend any time reading for pleasure. No relationship was found between maternal employment and BMI. Compared with children of normal weight, those who were overweight/obese were more likely to spend no time studying, spend more than 2 h per day in screen-based activity and sleep less than 10 h per night. Child BMI status was not related to maternal employment. Although this analysis included eight diet related variables none proved to be significant in the final models.This study has shown that mothers' working status is not related to children's BMI. The relationship between overweight/obesity of children and high levels of screen-based activity, low levels of studying, and short sleep duration suggests a need for better knowledge and understanding of sedentary behaviours of children.
Is BMI a relevant marker of fat mass in 4 year old children? Results from the MINISTOP trial.
Delisle Nyström, Christine; Henriksson, Pontus; Ek, Anna; Henriksson, Hanna; Ortega, Francisco B; Ruiz, Jonatan R; Löf, Marie
2018-03-20
Due to the increase in childhood obesity, identifying children with excess body fat as early as possible is essential. Body mass index (BMI) is commonly used as a marker of body fat in children, adolescents, and adults, yet whether BMI is a valid marker of body fat in pre-school aged children remains to be confirmed. Therefore, we analyzed the associations of BMI with fat and fat-free mass in healthy 4-year-old Swedish children. The study comprised of 303 children (135 girls) participating in the MINISTOP obesity prevention trial. Fat and fat-free mass were measured using air displacement plethysmography and we computed fat mass index (FMI) and fat free mass index (FFMI) as fat and fat free mass (kg)/height 2 (m). BMI was positively yet weakly associated with percent fat mass (boys: r 2 = 0.120, P Children classified as normal weight had a wide range of percent fat mass (12.3 to 35.3%) and FMI (1.75 to 5.78 kg/m 2 ). BMI was strongly associated to both FMI and FFMI. Therefore, caution is needed when interpreting body fat status based on BMI values in pre-school children.
Eating tasty food to cope. Longitudinal association with BMI.
Boggiano, M M; Wenger, L E; Turan, B; Tatum, M M; Morgan, P R; Sylvester, M D
2015-04-01
The goals of this study were to determine if a change in certain motives to eat highly palatable food, as measured by the Palatable Eating Motives Scale (PEMS), could predict a change in body mass index (BMI) over time, to assess the temporal stability of these motive scores, and to test the reliability of previously reported associations between eating tasty foods to cope and BMI. BMI, demographics, and scores on the PEMS and the Binge Eating Scale were obtained from 192 college students. Test-retest analysis was performed on the PEMS motives in groups varying in three gap times between tests. Regression analyses determined what PEMS motives predicted a change in BMI over two years. The results replicated previous findings that eating palatable food for Coping motives (e.g., to forget about problems, reduce negative feelings) is associated with BMI. Test-retest correlations revealed that motive scores, while somewhat stable, can change over time. Importantly, among overweight participants, a change in Coping scores predicted a change in BMI over 2 years, such that a 1-point change in Coping predicted a 1.76 change in BMI (equivalent to a 10.5 lb. change in body weight) independent of age, sex, ethnicity, and initial binge-eating status (Cohen's f(2) effect size = 1.44). The large range in change of Coping scores suggests it is possible to decrease frequency of eating to cope by more than 1 scale point to achieve weight losses greater than 10 lbs. in young overweight adults, a group already at risk for rapid weight gain. Hence, treatments aimed specifically at reducing palatable food intake for coping reasons vs. for social, reward, or conformity reasons, should help achieve a healthier body weight and prevent obesity if this motive-type is identified prior to significant weight gain. Copyright © 2015 Elsevier Ltd. All rights reserved.
Alternative regression models to assess increase in childhood BMI.
Beyerlein, Andreas; Fahrmeir, Ludwig; Mansmann, Ulrich; Toschke, André M
2008-09-08
Body mass index (BMI) data usually have skewed distributions, for which common statistical modeling approaches such as simple linear or logistic regression have limitations. Different regression approaches to predict childhood BMI by goodness-of-fit measures and means of interpretation were compared including generalized linear models (GLMs), quantile regression and Generalized Additive Models for Location, Scale and Shape (GAMLSS). We analyzed data of 4967 children participating in the school entry health examination in Bavaria, Germany, from 2001 to 2002. TV watching, meal frequency, breastfeeding, smoking in pregnancy, maternal obesity, parental social class and weight gain in the first 2 years of life were considered as risk factors for obesity. GAMLSS showed a much better fit regarding the estimation of risk factors effects on transformed and untransformed BMI data than common GLMs with respect to the generalized Akaike information criterion. In comparison with GAMLSS, quantile regression allowed for additional interpretation of prespecified distribution quantiles, such as quantiles referring to overweight or obesity. The variables TV watching, maternal BMI and weight gain in the first 2 years were directly, and meal frequency was inversely significantly associated with body composition in any model type examined. In contrast, smoking in pregnancy was not directly, and breastfeeding and parental social class were not inversely significantly associated with body composition in GLM models, but in GAMLSS and partly in quantile regression models. Risk factor specific BMI percentile curves could be estimated from GAMLSS and quantile regression models. GAMLSS and quantile regression seem to be more appropriate than common GLMs for risk factor modeling of BMI data.
Physical Activity, Sleep, and BMI Percentile in Rural and Urban Ugandan Youth.
Christoph, Mary J; Grigsby-Toussaint, Diana S; Baingana, Rhona; Ntambi, James M
Uganda is experiencing a dual burden of over- and undernutrition, with overweight prevalence increasing while underweight remains common. Potential weight-related factors, particularly physical activity, sleep, and rural/urban status, are not currently well understood or commonly assessed in Ugandan youth. The purpose of this study was to pilot test a survey measuring weight-related factors in rural and urban Ugandan schoolchildren. A cross-sectional survey measured sociodemographics, physical activity, sleep patterns, and dietary factors in 148 rural and urban schoolchildren aged 11-16 in central Uganda. Height and weight were objectively measured. Rural and urban youth were compared on these factors using χ 2 and t tests. Regression was used to identify correlates of higher body mass index (BMI) percentile in the full sample and nonstunted youth. Youth were on average 12.1 ± 1.1 years old; underweight (10%) was more common than overweight (1.4%). Self-reported sleep duration and subjective sleep quality did not differ by rural/urban residence. Rural children overall had higher BMI percentile and marginally higher stunting prevalence. In adjusted analyses in both the full and nonstunted samples, higher BMI percentile was related to living in a rural area, higher frequency of physical activity, and higher subjective sleep quality; it was negatively related to being active on weekends. In the full sample, higher BMI percentile was also related to female gender, whereas in nonstunted youth, higher BMI was related to age. BMI percentile was unrelated to sedentary time, performance of active chores and sports, and dietary factors. This study is one of the first to pilot test a survey assessing weight-related factors, particularly physical activity and sleep, in Ugandan schoolchildren. BMI percentile was related to several sociodemographic, sleep, and physical activity factors among primarily normal-weight school children in Uganda, providing a basis for
Adrenocortical regulation, eating in the absence of hunger and BMI in young children.
Francis, L A; Granger, D A; Susman, E J
2013-05-01
The purpose of this study was to examine relations among adrenocortical regulation, eating in the absence of hunger, and body mass index (BMI) in children ages 5-9years (N=43). Saliva was collected before and after the Trier Social Stress Test for Children (TSST-C), and was later assayed for cortisol. Area under the curve with respect to increase (AUCi) was used as a measure of changes in cortisol release from baseline to 60min post-TSST-C. Age- and sex-specific BMI scores were calculated from measured height and weight, and eating in the absence of hunger was assessed using weighed food intake during a behavioral procedure. We also included a measure of parents' report of child impulsivity, as well as family demographic information. Participants were stratified by age into younger (5-7years) and older (8-9years) groups. In younger children, parents' reports of child impulsivity were significantly and positively associated with BMI; cortisol AUCi was not associated with BMI or eating in the absence of hunger. In older children, however, greater stress-related cortisol AUCi was related to higher BMI scores and greater energy intake in the absence of hunger. The results suggest that cortisol AUCi in response to psychosocial stress may be linked to problems with energy balance in children, with some variation by age. Published by Elsevier Ltd.
BMI modulates calorie-dependent dopamine changes in accumbens from glucose intake.
Directory of Open Access Journals (Sweden)
Gene-Jack Wang
Full Text Available Dopamine mediates the rewarding effects of food that can lead to overeating and obesity, which then trigger metabolic neuroadaptations that further perpetuate excessive food consumption. We tested the hypothesis that the dopamine response to calorie intake (independent of palatability in striatal brain regions is attenuated with increases in weight.We used positron emission tomography with [11C]raclopride to measure dopamine changes triggered by calorie intake by contrasting the effects of an artificial sweetener (sucralose devoid of calories to that of glucose to assess their association with body mass index (BMI in nineteen healthy participants (BMI range 21-35.Neither the measured blood glucose concentrations prior to the sucralose and the glucose challenge days, nor the glucose concentrations following the glucose challenge vary as a function of BMI. In contrast the dopamine changes in ventral striatum (assessed as changes in non-displaceable binding potential of [11C]raclopride triggered by calorie intake (contrast glucose - sucralose were significantly correlated with BMI (r = 0.68 indicating opposite responses in lean than in obese individuals. Specifically whereas in normal weight individuals (BMI <25 consumption of calories was associated with increases in dopamine in the ventral striatum in obese individuals it was associated with decreases in dopamine.These findings show reduced dopamine release in ventral striatum with calorie consumption in obese subjects, which might contribute to their excessive food intake to compensate for the deficit between the expected and the actual response to food consumption.
Maternal depression and child BMI: longitudinal findings from a US sample.
Duarte, C S; Shen, S; Wu, P; Must, A
2012-04-01
To examine the association between maternal depression and child body mass index (BMI) from Kindergarten (K) to fifth grade. Analysis of four waves of data from the Early Childhood Longitudinal Study - Kindergarten spanning K to fifth grade. Maternal depressive symptoms (MDSs) were measured by a brief version of the Center for Epidemiological Studies Depression scale. Data were analyzed using multiple regression analyses, adjusting for key covariates and potential confounders. The analytic sample was restricted to children of normal birth weight. The relationship between MDS and child BMI varies by child gender and age. Among girls, severe MDS at K was related to lower BMI at third grade (but not later at fifth grade) and to an increase in BMI from K to third and K to fifth grades. Among boys, severe MDS at K was related to higher boys' BMI at fifth grade. When severe MDS occurred at third grade, it was related to higher BMI at fifth grade among girls whereas no statistically significant relationship was found for boys. Low levels of physical activity in comparison to peers at fifth grade and more screen time on weekends at third grade are likely mediators of the relationship between MDS and child BMI among girls, while among boys the relationship appears to be mediated by unhealthy eating habits. Our findings, indicating developmental and gender differences in the relationship between maternal depression and child BMI, if confirmed, suggest that interventions addressing maternal depression may have concomitant impact on childhood obesity. © 2012 The Authors. Pediatric Obesity © 2012 International Association for the Study of Obesity.
BMI1 loss delays photoreceptor degeneration in Rd1 mice. Bmi1 loss and neuroprotection in Rd1 mice.
Zencak, Dusan; Crippa, Sylvain V; Tekaya, Meriem; Tanger, Ellen; Schorderet, Daniel E; Munier, Francis L; van Lohuizen, Maarten; Arsenijevic, Yvan
2006-01-01
Retinitis pigmentosa (RP) is a heterogeneous group of genetic disorders leading to blindness, which remain untreatable at present. Rd1 mice represent a recognized model of RP, and so far only GDNF treatment provided a slight delay in the retinal degeneration in these mice. Bmi1, a transcriptional repressor, has recently been shown to be essential for neural stem cell (NSC) renewal in the brain, with an increased appearance of glial cells in vivo in Bmi1 knockout (Bmi1-/-) mice. One of the roles of glial cells is to sustain neuronal function and survival. In the view of a role of the retinal Miller glia as a source of neural protection in the retina, the increased astrocytic population in the Bmi1-/- brain led us to investigate the effect of Bmi1 loss in Rd1 mice. We observed an increase of Müller glial cells in Rd1-Bmi1-/- retinas compared to Rd1. Moreover, Rd1-Bmi1-/- mice showed 7-8 rows of photoreceptors at 30 days of age (P30), while in Rd1 littermates there was a complete disruption of the outer nuclear layer (ONL). Preliminary ERG results showed a responsiveness of Rd1-Bmi1-/- mice in scotopic vision at P35. In conclusion, Bmi1 loss prevented, or rescued, photoreceptors from degeneration to an unanticipated extent in Rd1 mice. In this chapter, we will first provide a brief review of our work on the cortical NSCs and introduce the Bmi1 oncogene, thus offering a rational to our observations on the retina.
Shifting Patterns of BMI and Skinfold Fatness among US Children: 1985/87 vs. 2012
Directory of Open Access Journals (Sweden)
Yan Yang
2016-12-01
Full Text Available Background: Childhood obesity has been recognized as a major public health concern. The purpose of this study was to determine specific shifting patterns of BMI and skinfold fatness across different age and sex groups between 1985/87 and 2012. Methods: The data of 9,366 children aged 8-15 years from two nationally representative surveys, i.e., 1985/87 National Children and Youth Fitness Study I & II and 2012 National Health and Nutrition Examination Survey National Youth Fitness Survey, were analyzed. Specifically, changes of BMI-based obesity prevalence and shifting patterns of BMI, height, weight, skinfold body fat percentage (skinfold-fat%, subscapular skinfold, and triceps skinfold from 1985/87 to 2012 were estimated by age and sex using the 1985/87 quartiles as the baseline. Results: Significantly increased obesity prevalence were reconfirmed for both boys (12.12%, P <.001 and girls (3.53%, P <.001 from 1985/87 to 2012. Except for height, all other measures in 2012 experienced an unbalanced shifting pattern, mainly from other quartiles into the 4th quartile of 1985/87. Conclusion: The shifting of both boys’ and girls’ BMI and skinfold-fat% were all concentrated in the 4th quartile of 1985/87, indicating not only that there was a significant increase in BMI and skinfold-fat% in the U.S. children from 1985/87 to 2012, but also into the overweight and obese subgroups, which serves as a serious warning for childhood obesity epidemic and public health.
Change in BMI accurately predicted by social exposure to acquaintances.
Directory of Open Access Journals (Sweden)
Rahman O Oloritun
Full Text Available Research has mostly focused on obesity and not on processes of BMI change more generally, although these may be key factors that lead to obesity. Studies have suggested that obesity is affected by social ties. However these studies used survey based data collection techniques that may be biased toward select only close friends and relatives. In this study, mobile phone sensing techniques were used to routinely capture social interaction data in an undergraduate dorm. By automating the capture of social interaction data, the limitations of self-reported social exposure data are avoided. This study attempts to understand and develop a model that best describes the change in BMI using social interaction data. We evaluated a cohort of 42 college students in a co-located university dorm, automatically captured via mobile phones and survey based health-related information. We determined the most predictive variables for change in BMI using the least absolute shrinkage and selection operator (LASSO method. The selected variables, with gender, healthy diet category, and ability to manage stress, were used to build multiple linear regression models that estimate the effect of exposure and individual factors on change in BMI. We identified the best model using Akaike Information Criterion (AIC and R(2. This study found a model that explains 68% (p<0.0001 of the variation in change in BMI. The model combined social interaction data, especially from acquaintances, and personal health-related information to explain change in BMI. This is the first study taking into account both interactions with different levels of social interaction and personal health-related information. Social interactions with acquaintances accounted for more than half the variation in change in BMI. This suggests the importance of not only individual health information but also the significance of social interactions with people we are exposed to, even people we may not consider as
Alternative regression models to assess increase in childhood BMI
Directory of Open Access Journals (Sweden)
Mansmann Ulrich
2008-09-01
Full Text Available Abstract Background Body mass index (BMI data usually have skewed distributions, for which common statistical modeling approaches such as simple linear or logistic regression have limitations. Methods Different regression approaches to predict childhood BMI by goodness-of-fit measures and means of interpretation were compared including generalized linear models (GLMs, quantile regression and Generalized Additive Models for Location, Scale and Shape (GAMLSS. We analyzed data of 4967 children participating in the school entry health examination in Bavaria, Germany, from 2001 to 2002. TV watching, meal frequency, breastfeeding, smoking in pregnancy, maternal obesity, parental social class and weight gain in the first 2 years of life were considered as risk factors for obesity. Results GAMLSS showed a much better fit regarding the estimation of risk factors effects on transformed and untransformed BMI data than common GLMs with respect to the generalized Akaike information criterion. In comparison with GAMLSS, quantile regression allowed for additional interpretation of prespecified distribution quantiles, such as quantiles referring to overweight or obesity. The variables TV watching, maternal BMI and weight gain in the first 2 years were directly, and meal frequency was inversely significantly associated with body composition in any model type examined. In contrast, smoking in pregnancy was not directly, and breastfeeding and parental social class were not inversely significantly associated with body composition in GLM models, but in GAMLSS and partly in quantile regression models. Risk factor specific BMI percentile curves could be estimated from GAMLSS and quantile regression models. Conclusion GAMLSS and quantile regression seem to be more appropriate than common GLMs for risk factor modeling of BMI data.
The Role of BMI in Hip Fracture Surgery.
Akinleye, Sheriff D; Garofolo, Garret; Culbertson, Maya Deza; Homel, Peter; Erez, Orry
2018-01-01
Obesity is an oft-cited cause of surgical morbidity and many institutions require extensive supplementary screening for obese patients prior to surgical intervention. However, in the elderly patients, obesity has been described as a protective factor. This article set out to examine the effect of body mass index (BMI) on outcomes and morbidity after hip fracture surgery. The National Surgical Quality Improvement Program database was queried for all patients undergoing 1 of 4 surgical procedures to manage hip fracture between 2008 and 2012. Patient demographics, BMI, and known factors that lead to poor surgical outcomes were included as putative predictors for complications that included infectious, cardiac, pulmonary, renal, and neurovascular events. Using χ 2 tests, 30-day postoperative complication rates were compared between 4 patient groups stratified by BMI as low weight (BMI BMI = 20-30), obese (BMI = 30-40), and morbidly obese (BMI > 40). A total of 15 108 patients underwent surgery for hip fracture over the examined 5-year period. Of these, 18% were low weight (BMI BMI = 20-30), 13% were obese (BMI = 30-40), and 2% were morbidly obese (BMI > 40). The low-weight and morbidly obese patients had both the highest mortality rates and the lowest superficial infection rates. There was a significant increase in blood transfusion rates that decreased linearly with increasing BMI. Deep surgical site infection and renal failure increased linearly with increasing BMI, however, these outcomes were confounded by comorbidities. This study demonstrates that patients at either extreme of the BMI spectrum, rather than solely the obese, are at greatest risk of major adverse events following hip fracture surgery. This runs contrary to the notion that obese hip fracture patients automatically require additional preoperative screening and perioperative services, as currently implemented in many institutions.
Correlation between BMI and motor coordination in children.
Lopes, Vítor P; Stodden, David F; Bianchi, Mafalda M; Maia, Jose A R; Rodrigues, Luis P
2012-01-01
To analyze the association between motor coordination (MC) and body mass index (BMI) across childhood and early adolescence. This study is cross-sectional. Data were collected in 7175 children (boys n=3616, girls n=3559), ages 6-14 years. BMI was calculated from measured height and weight [body mass (kg)/height (m(2))]. Motor coordination was evaluated using Kiphard-Schilling's body coordination test (KTK). Spearman's rank correlation was used to study the association between BMI and MC. A Kruskal-Wallis test was used to analyze the differences in MC between children of normal weight, overweight and obese children. Correlations between MC and BMI were negative and varied between 0.05 and 0.49. The highest negative correlations for both boys and girls was at 11 years of age. There was a general pattern of increasing negative correlations in both genders from 6 to 11 years of age and then a decrease in correlation strengths through 14 years of age. In both boys (χ(2)((2))=324.01; p<0.001) and girls (χ(2)((2))=291.20; p<0.001) there were significant differences in MC between the three groups' weight status. Normal weight children of both sexes demonstrated significantly higher MC scores than overweight. Obese children in both sexes had the lowest MC scores among all three groups. Motor coordination demonstrated an inverse relationship with BMI across childhood and into early adolescence. The strength of the inverse relation increased during childhood, but decreased through early adolescence. Overweight and obese children of both sexes demonstrated significantly lower MC than normal weight children. Copyright © 2011 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.
Raised BMI cut-off for overweight in Greenland Inuit – a review
Andersen, Stig; Fleischer Rex, Karsten; Noahsen, Paneeraq; Sørensen, Hans Christian Florian; Mulvad, Gert; Laurberg, Peter
2013-01-01
Background Obesity is associated with increased morbidity and premature death. Obesity rates have increased worldwide and the WHO recommends monitoring. A steep rise in body mass index (BMI), a measure of adiposity, was detected in Greenland from 1963 to 1998. Interestingly, the BMI starting point was in the overweight range. This is not conceivable in a disease-free, physically active, pre-western hunter population. Objective This led us to reconsider the cut-off point for overweight among Inuit in Greenland. Design and findings We found 3 different approaches to defining the cut-off point of high BMI in Inuit. First, the contribution to the height by the torso compared to the legs is relatively high. This causes relatively more kilograms per centimetre of height that increases the BMI by approximately 10% compared to Caucasian whites. Second, defining the cut-off by the upper 90-percentile of BMI from height and weight in healthy young Inuit surveyed in 1963 estimated the cut-off point to be around 10% higher compared to Caucasians. Third, if similar LDL-cholesterol and triglycerides are assumed for a certain BMI in Caucasians, the corresponding BMI in Inuit in both Greenland and Canada is around 10% higher. However, genetic admixture of Greenland Inuit and Caucasian Danes will influence this difference and hamper a clear distinction with time. Conclusion Defining overweight according to the WHO cut-off of a BMI above 25 kg/m2 in Greenland Inuit may overestimate the number of individuals with elevated BMI. PMID:23986904
Raised BMI cut-off for overweight in Greenland Inuit – a review
Directory of Open Access Journals (Sweden)
Stig Andersen
2013-08-01
Full Text Available Background. Obesity is associated with increased morbidity and premature death. Obesity rates have increased worldwide and the WHO recommends monitoring. A steep rise in body mass index (BMI, a measure of adiposity, was detected in Greenland from 1963 to 1998. Interestingly, the BMI starting point was in the overweight range. This is not conceivable in a disease-free, physically active, pre-western hunter population. Objective. This led us to reconsider the cut-off point for overweight among Inuit in Greenland. Design and findings. We found 3 different approaches to defining the cut-off point of high BMI in Inuit. First, the contribution to the height by the torso compared to the legs is relatively high. This causes relatively more kilograms per centimetre of height that increases the BMI by approximately 10% compared to Caucasian whites. Second, defining the cut-off by the upper 90-percentile of BMI from height and weight in healthy young Inuit surveyed in 1963 estimated the cut-off point to be around 10% higher compared to Caucasians. Third, if similar LDL-cholesterol and triglycerides are assumed for a certain BMI in Caucasians, the corresponding BMI in Inuit in both Greenland and Canada is around 10% higher. However, genetic admixture of Greenland Inuit and Caucasian Danes will influence this difference and hamper a clear distinction with time. Conclusion. Defining overweight according to the WHO cut-off of a BMI above 25 kg/m2 in Greenland Inuit may overestimate the number of individuals with elevated BMI.
Clarke, Philippa; O'Malley, Patrick M; Johnston, Lloyd D; Schulenberg, John E
2009-04-01
The prevalence of obesity and overweight is rapidly increasing in industrialized countries, with long-term health and social consequences. There is also a strong social patterning of obesity and overweight, with a higher prevalence among women, racial/ethnic minorities and those from a lower socio-economic position (SEP). Most of the existing work in this area, however, is based on cross-sectional data or single cohort studies. No national studies to date have examined how social disparities in obesity and overweight differ by age and historical period using longitudinal data with repeated measures. We used panel data from the nationally representative Monitoring the Future Study (1986-2004) to examine social disparities in trajectories of body mass index (BMI) over adulthood (age 18-45). Self-reported height and weight were collected in this annual US survey of high-school seniors, followed biennially since 1976. Using growth curve models, we analysed BMI trajectories over adulthood by gender, race/ethnicity and lifetime SEP (measured by parents' education and respondent's education). BMI trajectories exhibit a curvilinear rate of change from age 18 to 45, but there was a strong period effect, such that weight gain was more rapid for more recent cohorts. As a result, successive cohorts become overweight (BMI>25) at increasingly earlier points in the life course. BMI scores were also consistently higher for women, racial/ethnic minority groups and those from a lower SEP. However, BMI scores for socially advantaged groups in recent cohorts were actually higher than those for their socially disadvantaged counterparts who were born 10 years earlier. Results highlight the importance of social status and socio-economic resources for maintaining optimal weight. Yet, even those in advantaged social positions have experienced an increase in BMI in recent years.
Mechanism by which BMI influences leisure-time physical activity behavior.
Godin, Gaston; Bélanger-Gravel, Ariane; Nolin, Bertrand
2008-06-01
The objective of this prospective study was to clarify the mechanism by which BMI influences leisure-time physical activity. This was achieved in accordance with the assumptions underlying the Theory of Planned Behavior (TPB), considered as one of the most useful theories to predict behavior adoption. At baseline, a sample of 1,530 respondents completed a short questionnaire to measure intention and perceived behavioral control (PBC), the two proximal determinants of behavior of TPB. Past behavior, sociodemographic variables, and weight and height were also assessed. The dependent variable, leisure-time physical activity was assessed 3 months later. Hierarchical multiple regression analyses revealed that BMI is a direct predictor of future leisure-time physical activity, not mediated by the variables of TPB. Additional hierarchical analyses indicated that BMI was not a moderator of the intention-behavior and PBC-behavior relationships. The results of this study suggest that high BMI is a significant negative determinant of leisure-time physical activity. This observation reinforces the importance of preventing weight gain as a health promotion strategy for avoiding a sedentary lifestyle.
Han, Jennifer; Nguyen, John; Kim, Yuna; Geng, Bob; Romanowski, Gale; Alejandro, Lawrence; Proudfoot, James; Xu, Ronghui; Leibel, Sydney
2018-04-19
Assess the relationship between inhaled corticosteroid use (ICS) and weight (BMI) in pediatric patients with moderate-severe asthma. Assess if the number of emergency department (ED) visits correlates with overall BMI trajectory. Assess the trend of prescribing biologic therapy in pediatric patients with moderate-severe asthma and determine its relationship with weight (BMI). A retrospective chart review was performed on 93 pediatric patients with moderate-severe asthma to determine the relationship between ICS use and weight (BMI), biologic therapy and BMI, and number of ED visits and BMI trajectory. A mixed effects model was employed with the correlation between repeated measures accounted for through the random effects. There is a statistically significant increase of 0.369 kg/m 2 in BMI trajectory per year in subjects on high-dose steroids compared to an increase of 0.195 kg/m 2 in the low dose group (p BMI of subjects initiated on biologic therapy (omalizumab or mepolizumab) had a statistically significant decrease in BMI trajectory of 0.818 kg/m 2 per year (p BMI trajectory (p BMI trajectory; the higher the dose, the greater the projected BMI increase per year. Initiation of biologic therapy decreased BMI trajectory over time. Lastly, those with frequent ED visits had a higher BMI trend. Future prospective studies are warranted that further evaluate the potential metabolic impacts of ICS and assess the effects of biologic therapy on BMI.
Lindkvist, Marie; Ivarsson, Anneli; Silfverdal, Sven Arne; Eurenius, Eva
2015-12-17
It is well established that the pregnancy and the first years of life are important for future childhood health and body weight. Even though current evidence suggests that both parents are important for childhood health, the influence that parents' BMI and socio-demography has on toddlers' BMI has so far received little attention. This study aimed to increase our knowledge on the association between toddlers' and parents' BMI, in relation to family socio-demography. Further, the aim was to investigate the interaction between the mothers' and fathers' BMI in relation to their child's BMI. A total of 697 children with a median age of 18 months (range 16-24 months) participated in the study along with their mothers (n = 697) and fathers (n = 674). As regards representability, our parental sample had a lower proportion of immigrants and the parents were more gainfully employed compared to parents in the rest of Sweden (when the child was 18 months old). The parents completed a questionnaire on parental and child health. Data on parental weight, height, and socio-demographics were recorded along with the child's weight and height measured at an ordinary child health care visit. We used the thresholds for children's BMI that were recommended for surveillance by the Royal College of Paediatrics and Child Health in 2012 based on the WHO reference population. Among the toddlers, 33 % had a BMI above the WHO 85(th) percentile and 14 % had a BMI above the WHO 95(th) percentile. The probability of a toddler having a BMI above the WHO 95(th) percentile was significantly increased if either the mother or father was overweight (BMI ≥ 25 kg/m(2)). Furthermore, we found a positive synergistic effect between the mother and father being overweight and their child having a BMI above the WHO 85(th) percentile. No associations were found between the toddlers' BMI and the family's socio-demographics, but there were associations between the parents' BMI and the family
Zhang, Hui-Jie; Han, Peng; Sun, Su-Yun; Wang, Li-Ying; Yan, Bing; Zhang, Jin-Hua; Zhang, Wei; Yang, Shu-Yu; Li, Xue-Jun
2013-01-01
Obesity is related to hyperlipidemia and risk of cardiovascular disease. Health benefits of vegetarian diets have well-documented in the Western countries where both obesity and hyperlipidemia were prevalent. We studied the association between BMI and various lipid/lipoprotein measures, as well as between BMI and predicted coronary heart disease probability in lean, low risk populations in Southern China. The study included 170 Buddhist monks (vegetarians) and 126 omnivore men. Interaction between BMI and vegetarian status was tested in the multivariable regression analysis adjusting for age, education, smoking, alcohol drinking, and physical activity. Compared with omnivores, vegetarians had significantly lower mean BMI, blood pressures, total cholesterol, low density lipoprotein cholesterol, high density lipoprotein cholesterol, total cholesterol to high density lipoprotein ratio, triglycerides, apolipoprotein B and A-I, as well as lower predicted probability of coronary heart disease. Higher BMI was associated with unfavorable lipid/lipoprotein profile and predicted probability of coronary heart disease in both vegetarians and omnivores. However, the associations were significantly diminished in Buddhist vegetarians. Vegetarian diets not only lower BMI, but also attenuate the BMI-related increases of atherogenic lipid/ lipoprotein and the probability of coronary heart disease.
Directory of Open Access Journals (Sweden)
M K Gupta
2011-12-01
Full Text Available Background: With the adoption of western lifestyle the problem of overweight and obesity is gradually increasing in children, while problem of malnutrition is persisting continuously in the country. With this background a school based cross sectional study was conducted to assess the nutritional status of school going children in a rural area: Chiraigaon block of Varanasi. Study period: July 2010 to September 2010 Methods: A school-based study with cross-sectional design was adopted. A total of 1448 school children were examined from 3 middle-schools that were selected by simple random sampling method. Height and weight of the children were measured, and BMI and other parameters were assessed. Results: On applying the BMI-for-age criteria, twelve percent of the children (12.4% boys and 11.1% girls were found underweight while 5.4% were overweight or obese (5.71% of the boys and 4.63% of the girls. But when the previous WHO’s BMI classification was used, 86.5% children had BMI <18.5 (88.4% of total boys and 81.9% of all girls. Conclusion: Nutritional status of school going children based on WHO criteria of BMI for age has been satisfactory. However, this approach needs scientific validation by undertaking a multi-centric study.
Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.
Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D
2007-07-01
Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.
Noahsen, Paneeraq; Andersen, Stig
2013-01-01
To identify thresholds of BMI at which similar levels of serum lipids occur in Inuit and in non-Inuit as the impact of obesity on metabolic risk factors differ in Inuit compared to other ethnic groups. Published comparative data among Inuit and non-Inuit whites on BMI and HDL-cholesterol and triglyceride were identified for analysis. A literature search was done for BMI, lipids, Inuit and Greenland or Canada. Studies with data on triglycerides and HDL-cholesterol in Inuit and non-Inuit Caucasians were selected and data were retrieved. Regression equations were computed for BMI and HDL-cholesterol and BMI and triglycerides. BMI for similar levels of lipids in Inuit and non-Inuit and ratios of Inuit/non-Inuit BMI's were calculated. At BMI 25 kg/m2 HDL-cholesterol was 1.7/1.6 mM in Greenland Inuit/non-Inuit women and 1.7/1.5 mM in men in a major comparative study. HDL cholesterol decreased by 0.09 for each 1 kg/m2 increase in BMI. Serum triglycerides were 1.0/1.1 mM for Greenland Inuit/non-Inuit women and 0.9/ 1.4 mM for men at BMI 25 kg/m2. Slopes were around 0.1. A comparative study in Canadian Inuit/non-Inuit gave similar results. The BMI levels required for similar HDL-cholesterol or triglycerides were around 27.5 kg/m2, and Inuit/non-Inuit BMI-ratios were around 1.1. The same degree of dyslipidaemia was seen when Inuit had a 10% higher BMI compared to non-Inuit. This may support the establishment of Inuit-specific BMI cut-offs for the purposes of health screening and population health surveillance.
Differential models of twin correlations in skew for body-mass index (BMI).
Tsang, Siny; Duncan, Glen E; Dinescu, Diana; Turkheimer, Eric
2018-01-01
Body Mass Index (BMI), like most human phenotypes, is substantially heritable. However, BMI is not normally distributed; the skew appears to be structural, and increases as a function of age. Moreover, twin correlations for BMI commonly violate the assumptions of the most common variety of the classical twin model, with the MZ twin correlation greater than twice the DZ correlation. This study aimed to decompose twin correlations for BMI using more general skew-t distributions. Same sex MZ and DZ twin pairs (N = 7,086) from the community-based Washington State Twin Registry were included. We used latent profile analysis (LPA) to decompose twin correlations for BMI into multiple mixture distributions. LPA was performed using the default normal mixture distribution and the skew-t mixture distribution. Similar analyses were performed for height as a comparison. Our analyses are then replicated in an independent dataset. A two-class solution under the skew-t mixture distribution fits the BMI distribution for both genders. The first class consists of a relatively normally distributed, highly heritable BMI with a mean in the normal range. The second class is a positively skewed BMI in the overweight and obese range, with lower twin correlations. In contrast, height is normally distributed, highly heritable, and is well-fit by a single latent class. Results in the replication dataset were highly similar. Our findings suggest that two distinct processes underlie the skew of the BMI distribution. The contrast between height and weight is in accord with subjective psychological experience: both are under obvious genetic influence, but BMI is also subject to behavioral control, whereas height is not.
Bidirectional associations between mothers' and fathers' parenting consistency and child bmi
Jansen, Pauline; Giallo, Rebecca; Westrupp, Elizabeth; Wake, Melissa; Nicholson, Jan
2013-01-01
textabstractBACKGROUND: Research suggests that general parenting dimensions and styles are associated with children's BMI, but directionality in this relationship remains unknown. Moreover, there has been little attention to the influences of both mothers' and fathers' parenting. We aimed to examine reciprocal relationships between maternal and paternal parenting consistency and child BMI. METHODS: Participants were 4002 children and their parents in the population-based Longitudinal Study of...
Intuitive eating: associations with physical activity motivation and BMI.
Gast, Julie; Campbell Nielson, Amy; Hunt, Anne; Leiker, Jason J
2015-01-01
To determine whether university women who demonstrated internal motivation related to eating behavior may also be internally motivated to participate in regular physical activity (PA) and have a lower body mass index (BMI) when controlling for age. Traditional approaches for health promotion related to healthy weight include restrictive eating and exercise prescription. Examining motivation for eating and PA may prove an effective alternative for achieving or maintaining healthy weight for university women. Design was a cross-sectional study. Study setting was a large, public university in the western United States. Subjects . Study subjects were 200 undergraduate women with a mean age of 19 years, mostly white (90%) and of healthy weight (69%, with a BMI range of 18.5-24.9). Study measures were the Intuitive Eating Scale and the Behavioral Regulation in Exercise Questionnaire. Correlations and regression models were used. Intuitive eating was examined in the sample as a whole and among subgroups of respondents grouped based on tertile rankings of intuitive eating scores. There was evidence that women who demonstrated internal motivation related to eating were also internally motivated to participate in regular PA. Women who reported being internally motivated to eat were significantly more likely to engage in PA for pleasure and to view PA as part of their self-concept. Women who reported high levels of intuitive eating had significantly lower BMI scores than those reporting medium or low levels when controlling for age. For women to achieve or maintain a healthy weight, it may be best for health professionals to examine motivation for eating and PA rather than the encouragement of restrictive eating and exercise prescriptions.
Variations in BMI and prevalence of health risks in diverse racial and ethnic populations.
Stommel, Manfred; Schoenborn, Charlotte A
2010-09-01
When examining health risks associated with the BMI, investigators often rely on the customary BMI thresholds of the 1995 World Health Organization report. However, within-interval variations in morbidity and mortality can be substantial, and the thresholds do not necessarily correspond to identifiable risk increases. Comparing the prevalence of hypertension, diabetes, coronary heart disease (CHD), asthma, and arthritis among non-Hispanic whites, blacks, East Asians and Hispanics, we examine differences in the BMI-health-risk relationships for small BMI increments. The analysis is based on 11 years of data of the National Health Interview Survey (NHIS), with a sample size of 337,375 for the combined 1997-2007 Sample Adult. The analysis uses multivariate logistic regression models, employing a nonparametric approach to modeling the BMI-health-risk relationship, while relying on narrowly defined BMI categories. Rising BMI levels are associated with higher levels of chronic disease burdens in four major racial and ethnic groups, even after adjusting for many socio-demographic characteristics and three important health-related behaviors (smoking, physical activity, alcohol consumption). For all population groups, except East Asians, a modestly higher disease risk was noted for persons with a BMI ethnic groups regardless of BMI levels, the evidence presented here does not support the notion that the BMI-health-risk profile of East Asians and others warrants race-specific BMI cutoff points.
Effects of social mobility from childhood to adolescence on BMI.
Muraro, Ana Paula; Gonçalves-Silva, Regina Maria Veras; Ferreira, Márcia Gonçalves; Sichieri, Rosely
2016-04-01
Little is known about the contribution of childhood socio-economic position (SEP) and social mobility to weight change. The present study evaluated the effect of family SEP during the pre-school years and social mobility on BMI between birth and adolescence. Longitudinal. The SEP of each child's family was classified according to an asset-based wealth index as low, medium or high. Four different categories of childhood-adolescence SEP groups were created in order to examine social mobility: low-medium/high, medium-medium, medium-high and high-high/medium. For each of these categories, BMI was tracked from birth to adolescence. Linear mixed-effects models were used to analyse the data. Cuiabá-MT, Brazil. A population-based cohort of children born between 1994 and 1999 was assessed between 1999 and 2000, and again between 2009 and 2011. A total of 1716 adolescents were followed from childhood to adolescence (71·4 % of baseline). The prevalence of overweight/obesity was 20·4 % in childhood and 27·7 % in adolescence. A higher SEP in childhood was associated with a greater prevalence of overweight in adolescence. Expressive upward social mobility occurred, mainly in the lowest SEP group. There was a greater rate of change in BMI between birth and adolescence among children with a higher SEP in childhood and children who remained in the higher SEP from childhood to adolescence. Individuals from a higher SEP in childhood and those who remained in the higher social classes showed greater rate of change in BMI. Thus, initial SEP was the major determinant of changes in BMI.
The impact of serum adropin and ischemia modified albumin levels based on BMI in PCOS.
Inal, Zeynep Ozturk; Erdem, Sami; Gederet, Yavuz; Duran, Cevdet; Kucukaydin, Zehra; Kurku, Huseyin; Sakarya, Derya Kilic
2018-02-21
The aim of this study was to evaluate the effects of polycystic ovary syndrome (PCOS) and body mass index (BMI) on serum adropin and ischemia modified albumin (IMA) levels. This prospective cross-sectional study was performed with a total of 120 women [group1; non-PCOS = 60 (BMI PCOS = 60 (BMI PCOS and non-PCOS patients in the lean and overweight groups (pPCOS group were lower than in the lean non-PCOS group (pPCOS group than in the overweight non-PCOS group (pPCOS group than in the non-PCOS group in both the lean and overweight groups (pPCOS group, IMA levels increased. Further studies are needed to determine the effects of adropin and IMA in women with PCOS and to use a new marker to monitorize treatment outcomes.
Kuhle, Stefan; Kirk, Sara F L; Ohinmaa, Arto; Veugelers, Paul J
2011-12-21
Administrative health databases are a valuable research tool to assess health care utilization at the population level. However, their use in obesity research limited due to the lack of data on body weight. A potential workaround is to use the ICD code of obesity to identify obese individuals. The objective of the current study was to investigate the sensitivity and specificity of an ICD code-based diagnosis of obesity from administrative health data relative to the gold standard measured BMI. Linkage of a population-based survey with anthropometric measures in elementary school children in 2003 with longitudinal administrative health data (physician visits and hospital discharges 1992-2006) from the Canadian province of Nova Scotia. Measured obesity was defined based on the CDC cut-offs applied to the measured BMI. An ICD code-based diagnosis obesity was defined as one or more ICD-9 (278) or ICD-10 code (E66-E68) of obesity from a physician visit or a hospital stay. Sensitivity and specificity were calculated and health care cost estimates based on measured obesity and ICD-based obesity were compared. The sensitivity of an ICD code-based obesity diagnosis was 7.4% using ICD codes between 2002 and 2004. Those correctly identified had a higher BMI and had higher health care utilization and costs. An ICD diagnosis of obesity in Canadian administrative health data grossly underestimates the true prevalence of childhood obesity and overestimates the health care cost differential between obese and non-obese children.
Directory of Open Access Journals (Sweden)
Hong Mei
Full Text Available To assess if the maternal pre-pregnancy weight status (MPWS alters the association of early infant feeding pattern (at one and third months with infant body mass index (BMI in the first two years of life.A cohort of 2,220 neonates were recruited in a community-based study conducted in China. Body weight and length were measured at birth, at age one and two, with BMI calculated accordingly. The BMI z-scores (BMI-Z were computed according to the World Health Organization Growth Standard (2006. Feeding patterns were classified as exclusive breastfeeding (EBF, mixed feeding (MF, and formula feeding (FF. General linear models (GLM were employed to estimate main and interaction effects of EBF and MPWS on children's BMI-Z.No main effect of MPWS was found on child BMI-Z at ages one and two, nor the feeding patterns. An interaction between MPWS and feeding patterns was detected (p<0.05. For children who were formula fed during the first month, those who were born to overweight/obesity (OW/OB mothers had a significantly greater BMI-Z at ages one and two, compared with those with underweight/normal weight (UW/NW mothers. FF children had greater BMI-Z at ages one and two compared with their EBF and MF counterparts, when they were born to OW/OB mothers.Maternal pre-pregnancy weight control and early initiation of EBF for children are essential for healthy development in children's BMI, hence the prevention of early life obesity.
2017-10-01
that inhibiting BMI1 decreased prostate cancer tumor growth in VCaP murine xenograft. 15. SUBJECT TERMS: Polycomb, BMI1, Androgen Receptor ...Repressive Complex, Androgen Receptor , Castration- Resistant Prostate Cancer , small molecule inhibitor 4 ACCOMPLISHMENTS A. What were the major...Qi Cao. A Novel Role of BMI1 in Androgen Receptor Pathway. 23rd Prostate Cancer Foundation Annual Scientific Retreat, Oct 26-29, 2016, Carlsbad, CA
Two functional serotonin polymorphisms moderate the effect of food reinforcement on BMI.
Carr, Katelyn A; Lin, Henry; Fletcher, Kelly D; Sucheston, Lara; Singh, Prashant K; Salis, Robbert J; Erbe, Richard W; Faith, Myles S; Allison, David B; Stice, Eric; Epstein, Leonard H
2013-06-01
Food reinforcement, or the motivation to eat, has been associated with increased energy intake, greater body weight, and prospective weight gain. Much of the previous research on the reinforcing value of food has focused on the role of dopamine, but it may be worthwhile to examine genetic polymorphisms in the serotonin and opioid systems as these neurotransmitters have been shown to be related to reinforcement processes and to influence energy intake. We examined the relationship among 44 candidate genetic polymorphisms in the dopamine, serotonin, and opioid systems, as well as food reinforcement and body mass index (BMI) in a sample of 245 individuals. Polymorphisms in the monoamine oxidase A (MAOA-LPR) and serotonin receptor 2A genes (rs6314) moderated the effect of food reinforcement on BMI, accounting for an additional 5-10% variance and revealed a potential role of the single nucleotide polymorphism, rs6314, in the serotonin 2A receptor as a differential susceptibility factor for obesity. Differential susceptibility describes a factor that can confer either risk or protection depending on a second variable, such that rs6314 is predictive of both high and low BMI based on the level of food reinforcement, while the diathesis stress or dual-gain model only influences one end of the outcome measure. The interaction with MAOA-LPR better fits the diathesis stress model, with the 3.5R/4R allele conferring protection for individuals low in food reinforcement. These results provide new insight into genes theoretically involved in obesity, and support the hypothesis that genetics moderate the association between food reinforcement and BMI. PsycINFO Database Record (c) 2013 APA, all rights reserved.
Connell, Lauren E.; Francis, Lori A.
2014-01-01
Objective This study sought to determine whether parenting style moderated the effects of delay of gratification on BMI trajectories from age 4 to 15 years. Methods Longitudinal data were analyzed on 778 children drawn from the Study of Early Child Care and Youth Development. Parenting style (authoritative, authoritarian, permissive, neglectful) was created from measures of mothers’ sensitivity and expectations for self-control when children were age 4 years. Self-regulation was also measured at 4 years using a well-known delay of gratification protocol. BMI was calculated from measured height and weight at each time point. Mixed modeling was used to test the interaction of parenting styles and ability to delay gratification on BMI trajectories from 4 to 15 years. Results There was a significant interaction effect of parenting and ability to delay on BMI growth from 4 to 15 years for boys. Boys who had authoritarian mothers and failed to delay gratification had a significantly steeper rate of growth in BMI from childhood through adolescence than children in any other parenting x delay group. Conclusions Authoritative and permissive parenting styles were protective against more rapid BMI gains for boys who could not delay gratification. Ability to delay gratification was protective against BMI gains for boys who had parents with authoritarian or neglectful parenting styles. PMID:23977874
To evaluate the percentage of body fat (%BF)-BMI relationship, identify %BF levels corresponding to adult BMI cut points, and examine %BF-BMI agreement in a diverse Hispanic/Latino population. %BF by bioelectrical impedance analysis was corrected against %BF by 18O dilution in 434 participants of th...
Mustelin, L; Silventoinen, K; Pietiläinen, K; Rissanen, A; Kaprio, J
2009-01-01
Both obesity and exercise behavior are influenced by genetic and environmental factors. However, whether obesity and physical inactivity share the same genetic vs environmental etiology has rarely been studied. We therefore analyzed these complex relationships, and also examined whether physical activity modifies the degree of genetic influence on body mass index (BMI) and waist circumference (WC). The FinnTwin16 Study is a population-based, longitudinal study of five consecutive birth cohorts (1975-1979) of Finnish twins. Data on height, weight, WC and physical activity of 4343 subjects at the average age of 25 (range, 22-27 years) years were obtained by a questionnaire and self-measurement of WC. Quantitative genetic analyses based on linear structural equations were carried out by the Mx statistical package. The modifying effect of physical activity on genetic and environmental influences was analyzed using gene-environment interaction models. The overall heritability estimates were 79% in males and 78% in females for BMI, 56 and 71% for WC and 55 and 54% for physical activity, respectively. There was an inverse relationship between physical activity and WC in males (r = -0.12) and females (r=-0.18), and between physical activity and BMI in females (r = -0.12). Physical activity significantly modified the heritability of BMI and WC, with a high level of physical activity decreasing the additive genetic component in BMI and WC. Physically active subjects were leaner than sedentary ones, and physical activity reduced the influence of genetic factors to develop high BMI and WC. This suggests that the individuals at greatest genetic risk for obesity would benefit the most from physical activity.
Smoking and Socio-demographic correlates of BMI
Directory of Open Access Journals (Sweden)
Peizhi Wang
2016-06-01
Full Text Available Abstract Background The aim of the current study was to examine the associations between Body Mass Index (BMI and socio-demographic factors and to examine the relationship between BMI, smoking status and ethnicity. Methods The Singapore Mental Health Study (SMHS surveyed Singapore Residents (Singapore Citizens and Permanent Residents aged 18 years old and above. BMI was calculated using height and weight which were self-reported by respondents. Socio-demographic characteristics and smoking status were recorded in a standardized data collection form. Results Six thousand and six hundred sixteen respondents completed the study (response rate of 75.9 % which constituted a representative sample of the adult resident population in Singapore. Ethnicity, gender and education status were associated with obesity. There was an interaction effect between ethnicity smoking status, and BMI. Indian and Malay smokers were less likely to be obese compared to Chinese smokers. The relationship between ethnicity and BMI was thus reversed when smoking was taken into account. Conclusions The study identified certain subgroups and risk factors that are associated with obesity. There is a need for further research to explore and identify genetic, metabolic and ethnic differences that underlie the interaction between ethnicity and smoking status which affects BMI.
Serlachius, Anna; Pulkki-Råback, Laura; Juonala, Markus; Sabin, Matthew; Lehtimäki, Terho; Raitakari, Olli; Elovainio, Marko
2017-09-01
The transmission of overweight from one generation to the next is well established, however little is known about what psychosocial factors may protect against this familial risk. The aim of this study was to examine whether optimism plays a role in the intergenerational transmission of obesity. Our sample included 1043 participants from the prospective Cardiovascular Risk in Young FINNS Study. Optimism was measured in early adulthood (2001) when the cohort was aged 24-39years. BMI was measured in 2001 (baseline) and 2012 when they were aged 35-50years. Parental BMI was measured in 1980. Hierarchical linear regression and logistic regression were used to examine the association between optimism and future BMI/obesity, and whether an interaction existed between optimism and parental BMI when predicting BMI/obesity 11years later. High optimism in young adulthood demonstrated a negative relationship with high BMI in mid-adulthood, but only in women (β=-0.127, p=0.001). The optimism×maternal BMI interaction term was a significant predictor of future BMI in women (β=-0.588, p=0.036). The logistic regression results confirmed that high optimism predicted reduced obesity in women (OR=0.68, 95% CI, 0.55-0.86), however the optimism × maternal obesity interaction term was not a significant predictor (OR=0.50, 95% CI, 0.10-2.48). Our findings supported our hypothesis that high optimism mitigated the intergenerational transmission of high BMI, but only in women. These findings also provided evidence that positive psychosocial factors such as optimism are associated with long-term protective effects on BMI in women. Copyright © 2017 Elsevier Inc. All rights reserved.
Savanur, Mitravinda S; Ghugre, Padmini S
2016-06-01
To compare the BMI, body fat and waist-to-height ratio (WHtR) of stunted and non-stunted children following different growth trajectories from low socio-economic strata in Mumbai, India. Cross-sectional, case-control study. Weight, height, skinfold thicknesses and waist circumference were measured. Information regarding the duration of breast-feeding, age at initiation of complementary feeding and income was obtained. Birth weight was obtained from records. BMI, body fat, WHtR and change in weight sd were calculated. Children who were beneficiaries of anganwadis, Mumbai city, India. Three hundred and thirty children aged 2-4 years were selected in each of the stunted and non-stunted groups after matching for age and sex. After adjusting for birth weight, change in weight sd, duration of breast-feeding, age at complementary feeding initiation and income, stunted children had significantly higher body fat, WHtR and BMI than the non-stunted (Pchildren were classified based on their change in weight sd. Stunted children with no change in weight sd had higher mean body fat, BMI (Pchildren had higher BMI and WHtR than the non-stunted (both Pchildren had higher BMI than the non-stunted (Pfat in young children. Such a tendency, if continued during later childhood and adolescence, can increase the risk of obesity and non-communicable diseases.
de Wilde, J A; Dekker, M; Middelkoop, B J C
2018-03-01
South Asians are prone to cardiometabolic disease at lower BMI levels than most other ethnic groups, starting in childhood. The magnitude of BMI misclassifications is unknown. To compare the BMI distribution of contemporary South Asian 0-20 year olds in the Netherlands with: (1) The South Asian norm reference (secular trends); and (2) The WHO child growth standard and reference. The BMI-for-age distribution of 6677 routine measurements of 3322 South Asian children, aged 0-20 years, was described with the LMS method and BMI z-scores. The BMI distribution in South Asian 0-4 year olds was almost similar to the norm reference (mean BMI z-score = 0.11, skewness = 0.31, SD = 1.0), whereas in 5-19 year olds the distribution had shifted upwards (mean = 0.53) and widened (skewness = -0.12, SD = 1.08). Overweight (incl. obesity) and obesity peaked at 8-10 years, at 45-48% and 35-37%, respectively. Relative to the WHO references, the BMI distribution was left-shifted at ages 0-4 years (mean BMI z-score = -0.46, skewness = 0.23, SD = 0.98) and widened at ages 5-20 years (mean = 0.05; skewness = -0.02, SD = 1.40). At most ages, thinness rates were significantly higher and obesity rates lower than based on South Asian norms. A secular change of BMI-for-age in South Asian children mostly affected children >4 years. WHO references likely under-estimate overweight and obesity rates in South Asian children.
International Nuclear Information System (INIS)
Bracht, K.; Friedrichs, H.G.
1989-01-01
A number of analytical studies were initial in the past by the Federal Ministry of Interior (BMI) of FRG, to investigate the potential of additional constructive measures for risk reduction. Those measures were proposed especially against uncontrolled overpressurization of the containment due to continuous gas/steam generation, penetration of the foundation of the reactor building by melt-concrete interaction, and failure of the containment due to violent hydrogen combustion. This report gives an overview about those studies and summarizes their results. Concerning uncontrolled overpressurization, only filtered venting may be a reasonable measure, while it seems to make not much sense, to look at measures against penetration of the foundation like 'core-catcher' in further detail. To prevent hydrogen combustion with severe consequences, several potential possibilities exist, but none of them can be considered as a safe measure. Additional analysis concerning hydrogen distribution and combustion in a multi-compartment containment are necessary. All studies mentioned in this report, deal with additional constructive measures to mitigate the consequences of severe accidents. Up to day in FRG, the potential of accident prevention and mitigation of its consequences by still or again operable and already existing systems of a plant have not been investigated in detail. As indicated by first results, the use of those systems in the frame of an appropriate accident management may have a large potential for risk reduction. (orig.) [de
Monitoring cure properties of out-of-autoclave BMI composites using IFPI sensor
Kaur, Amardeep; Anandan, Sudharshan; Yuan, Lei; Watkins, Steve E.; Chandrashekhara, K.; Xiao, Hai; Phan, Nam
2016-04-01
A non-destructive technique for inspection of a Bismaleimide (BMI) composite is presented using an optical fiber sensor. High performance BMI composites are used for Aerospace application for their mechanical strength. They are also used as an alternative to toughened epoxy resins. A femtosecond-laser-inscribed Intrinsic Fabry-Perot Interferometer (IFPI) sensor is used to perform real time cure monitoring of a BMI composite. The composite is cured using the out-of-autoclave (OOA) process. The IFPI sensor was used for in-situ monitoring; different curing stages are analyzed throughout the curing process. Temperature-induced-strain was measured to analyze the cure properties. The IFPI structure comprises of two reflecting mirrors inscribed on the core of the fiber using a femtosecond-laser manufacturing process. The manufacturing process makes the sensor thermally stable and robust for embedded applications. The sensor can withstand very high temperatures of up to 850 °C. The temperature and strain sensitivities of embedded IFPI sensor were measured to be 1.4 pm/μepsilon and 0.6 pm/μepsilon respectively.
Universal equation for estimating ideal body weight and body weight at any BMI.
Peterson, Courtney M; Thomas, Diana M; Blackburn, George L; Heymsfield, Steven B
2016-05-01
Ideal body weight (IBW) equations and body mass index (BMI) ranges have both been used to delineate healthy or normal weight ranges, although these 2 different approaches are at odds with each other. In particular, past IBW equations are misaligned with BMI values, and unlike BMI, the equations have failed to recognize that there is a range of ideal or target body weights. For the first time, to our knowledge, we merged the concepts of a linear IBW equation and of defining target body weights in terms of BMI. With the use of calculus and approximations, we derived an easy-to-use linear equation that clinicians can use to calculate both IBW and body weight at any target BMI value. We measured the empirical accuracy of the equation with the use of NHANES data and performed a comparative analysis with past IBW equations. Our linear equation allowed us to calculate body weights for any BMI and height with a mean empirical accuracy of 0.5-0.7% on the basis of NHANES data. Moreover, we showed that our body weight equation directly aligns with BMI values for both men and women, which avoids the overestimation and underestimation problems at the upper and lower ends of the height spectrum that have plagued past IBW equations. Our linear equation increases the sophistication of IBW equations by replacing them with a single universal equation that calculates both IBW and body weight at any target BMI and height. Therefore, our equation is compatible with BMI and can be applied with the use of mental math or a calculator without the need for an app, which makes it a useful tool for both health practitioners and the general public. © 2016 American Society for Nutrition.
Smoking, physical exercise, BMI and late foetal death
DEFF Research Database (Denmark)
Morales-Suárez-Varela, Maria; Nohr, Ellen A; Bech, Bodil H
2016-01-01
The aim of this paper was to estimate the effect of maternal and paternal smoking on foetal death (miscarriage and stillbirth) and to estimate potential interactions with physical exercise and pre-pregnancy body mass index. We selected 87,930 pregnancies from the population-based Danish National......) for predominantly late foetal death (miscarriage and stillbirth). An interaction contrast ratio was used to assess potential effect measure modification of smoking by physical exercise and body mass index. The adjusted hazard ratio of foetal death was 1.22 (95 % CI 1.02-1.46) for couples where both parents smoked...... with a slightly higher hazard ratio for foetal death if both parents smoked. This study suggests that smoking may increase the negative effect of a high BMI on foetal death, but results were not statistically significant for the interaction between smoking and physical exercise....
Restaurants in the Neighborhood, Eating Away from Home and BMI in China.
Tian, Xu; Zhong, Li; von Cramon-Taubadel, Stephan; Tu, Huakang; Wang, Hui
2016-01-01
To investigate the association between environmental risk factors, eating away from home, and increasing BMI of Chinese adults. Participants were selected from the recent four waves (2004, 2006, 2009, and 2011) of the China Health and Nutrition Survey (CHNS). 10633 participants, including 5084 men and 5549 women, were used in the analysis. 24-h dietary recall data for three consecutive days with information on the time and place of consumption were collected. Nearby restaurants were measured by the number of fast food outlets, indoor restaurants, and food stands in the neighborhood. Random effects multivariable regression was used to assess associations between these variables. People living in neighborhoods with large numbers of indoor restaurants are more likely to eat away from home (paway from home is positively associated with BMI, but this effect is only significant for men (paway from home contributes to BMI increase for men (paway from home is positively associated with BMI for Chinese men. Labeling energy and portion size for the dishes served in indoor restaurants is recommended in China.
Liang, Hui; Cao, Qing; Liu, Huan; Guan, Wei; Wong, Claudia; Tong, Daniel
2018-01-15
Roux-en-Y gastric bypass has been proven to be beneficial for patients with obesity and type 2 diabetes mellitus (T2DM). In less-obese patient (BMI 30-35 kg/m 2 ), surgical treatment is indicated when medication fails to control the T2DM. Asian develops diabetes at a lower BMI. For lower-BMI patients, the rate of diabetes amelioration varies significantly with patients of higher BMI after surgical treatment. The factors that contribute to the post-operative diabetes response rate in lower-BMI patients have not been elucidated. Between 2010 and 2014, a total of 144 patients who underwent gastric bypass for the treatment of T2DM were included for study. Patients were divided into two groups for subgroup analysis, namely BMI > 30 kg/m 2 and BMI BMI group (BMI > 30 kg/m 2 ) was 80% (n = 90) whereas for the lower BMI (BMI BMI group, low HbA1c and high fasting C-peptide are predictive factors whereas for lower-BMI group, along with elevated C-peptide level, disease duration is the positive predictive factor for DM remission. Patients with BMI > 30 kg/m 2 and those with BMI BMI patients while duration of diabetes is for high-low-BMI patients. C-peptide is a predictor of remission in both groups. Further large-scale studies are required to define the predictors of diabetes remission after gastric bypass in low- and high-BMI patients.
The Association between BMI and Different Frailty Domains: A U-Shaped Curve?
Rietman, M L; van der A, D L; van Oostrom, S H; Picavet, H S J; Dollé, M E T; van Steeg, H; Verschuren, W M M; Spijkerman, A M W
2018-01-01
Previous studies showed a U-shaped association between BMI and (physical) frailty. We studied the association between BMI and physical, cognitive, psychological, and social frailty. Furthermore, the overlap between and prevalence of these frailty domains was examined. Cross-sectional study. The Doetinchem Cohort Study is a longitudinal population-based study starting in 1987-1991 examining men and women aged 20-59 with follow-up examinations every 5 yrs. For the current analyses, we used data from round 5 (2008-2012) with 4019 participants aged 41-81 yrs. Physical frailty was defined as having ≥ 2 of 4 frailty criteria from the Frailty Phenotype (unintentional weight loss, exhaustion, physical activity, handgrip strength). Cognitive frailty was defined as the BMI was divided into four classes. Analyses were adjusted for sex, age, level of education, and smoking. A U-shaped association was observed between BMI and physical frailty, a small linear association for BMI and cognitive frailty and no association between BMI and psychological and social frailty. The four frailty domains showed only a small proportion of overlap. The prevalence of physical, cognitive and social frailty increased with age, whereas psychological frailty did not. We confirm that not only underweight but also obesity is associated with physical frailty. Obesity also seems to be associated with cognitive frailty. Further, frailty prevention should focus on multiple domains and target individuals at a younger age (<65yrs).
Bmi1 Is Required for Hedgehog Pathway-Driven Medulloblastoma Expansion
Directory of Open Access Journals (Sweden)
Lowell Evan Michael
2008-12-01
Full Text Available Inappropriate Hedgehog (Hh signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in transgenic mice expressing an oncogenic Hh effector, SmoA1, driven by a glial fibrillary acidic protein (GFAP promoter. Whereas 100% of SmoA1; Bmi1+/+ or SmoA1;Bmi1+/- mice examined between postnatal (P days 14 and 26 had typical medulloblastomas (N = 29, tumors were not detected in any of the SmoA1;Bmi1-/- animals examined (N = 6. Instead, small ectopic collections of cells were present in the region of greatest tumor load in SmoA1 animals, suggesting that medulloblastomas were initiated but failed to undergo expansion into frank tumors. Cells within these Bmi1-/- lesions expressed SmoA1 but were largely nonproliferative, in contrast to cells in Bmi1+/+ tumors (6.2% vs 81.9% PCNA-positive, respectively. Ectopic cells were negative for the progenitor marker nestin, strongly GFAP-positive, and highly apoptotic, relative to Bmi1+/+ tumor cells (29.6% vs 6.3% TUNEL-positive. The alterations in proliferation and apoptosis in SmoA1;Bmi1-/- ectopic cells are associated with reduced levels of Cyclin D1 and elevated expression of cyclin-dependent kinase inhibitor p19Arf, two inversely regulated downstream targets of Bmi1. These data provide the first demonstration that Bmi1 is required for spontaneous de novo development of a solid tumor arising in the brain, suggest a crucial role for Bmi1-dependent, nestin-expressing progenitor cells in medulloblastoma expansion, and implicate Bmi1 as a key factor required for Hh pathway-driven tumorigenesis.
BMI-1, a promising therapeutic target for human cancer
WANG, MIN-CONG; LI, CHUN-LI; CUI, JIE; JIAO, MIN; WU, TAO; JING, LI; NAN, KE-JUN
2015-01-01
BMI-1 oncogene is a member of the polycomb-group gene family and a transcriptional repressor. Overexpression of BMI-1 has been identified in various human cancer tissues and is known to be involved in cancer cell proliferation, cell invasion, distant metastasis, chemosensitivity and patient survival. Accumulating evidence has revealed that BMI-1 is also involved in the regulation of self-renewal, differentiation and tumor initiation of cancer stem cells (CSCs). However, the molecular mechanisms underlying these biological processes remain unclear. The present review summarized the function of BMI-1 in different human cancer types and CSCs, and discussed the signaling pathways in which BMI-1 is potentially involved. In conclusion, BMI-1 may represent a promising target for the prevention and therapy of various cancer types. PMID:26622537
The effects of media, self-esteem, and BMI on youth's unhealthy weight control behaviors.
Mayer-Brown, Sarah; Lawless, Casey; Fedele, David; Dumont-Driscoll, Marilyn; Janicke, David M
2016-04-01
Youth engage in a variety of methods to manage their weight, including unhealthy weight control behaviors (UWCBs). The purpose of this study was to examine factors associated with youth's engagement in UWCBs, including media influence, youth's BMI z-score and self-esteem. Participants were 179 youth, aged 10-17, attending a primary care clinic appointment. Youth completed questionnaires assessing frequency of UWCBs, global self-worth, and perception of media influence to lose weight. BMI z-score was calculated based on height and weight measurements obtained from medical charts. The SPSS macro, PROCESS, was used to conduct moderation analyses. Over 40% of youth endorsed using at least one UWCB in the past year. Girls reported using more UWCBs and engaging in UWCBs more frequently than boys. For boys, media influence to lose weight was only related to UWCB frequency for those with a BMI z-score of 1.23 and above. For girls, media influence was only related to UWCB frequency for those with low to average levels of global self-worth. Girls' and boys' use of UWCBs is impacted by different factors. Prevention efforts should consider targeting factors, such as weight status and self-esteem, which are uniquely associated with gender. Copyright © 2015. Published by Elsevier Ltd.
Differences in the association between childhood trauma and BMI in ...
African Journals Online (AJOL)
between childhood trauma and BMI in black and white South African women ... finding, including measures of body image and body size satisfaction that may explain these findings. Keywords: Childhood trauma questionnaire; Body fat; Body image; Sexual abuse; Ethnicity, ... Self-reported exposure to childhood trauma was.
Longitudinal association between marital disruption and child BMI and obesity.
Arkes, Jeremy
2012-08-01
This research examines whether family disruptions (i.e., divorces and separation) contribute to children's weight problems. The sample consists of 7,299 observations for 2,333 children, aged 5-14, over the 1986-2006 period, from a US representative sample from the Child and Young Adult Survey accompanying the National Longitudinal Survey of Youth (NLSY). The study uses individual-fixed-effects models in a longitudinal framework to compare children's BMI and weight problems before and after a disruption. Furthermore, besides doing a before-after comparison for children, the study also estimates the effects at various periods relative to the disruption in order to examine whether children are affected before the disruption and whether any effects change as time passes from the disruption, as some effects may be temporary or slow to develop. Despite having a larger sample than the previous studies, the results provide no evidence that, on average, children's BMI and BMI percentile scores (measured with continuous outcomes) are affected before the disruption, after the disruption, and as time passes from the disruption, relative to a baseline period a few years before the disruption. However, children experiencing a family disruption do have an increased risk of obesity (having a BMI percentile score of 95 or higher) in the two years leading up to the disruption as well as after the disruption, and as time passes from the disruption.
de Souza, M C; Eisenmann, J C; e Santos, D V; de Chaves, R N; de Moraes Forjaz, C L; Maia, J A R
2015-07-01
The aims of this study were twofold: (i) to model changes in body mass index (BMI) of 10-18-year-old adolescents, and (ii) to investigate the effects of total physical activity (TPA), physical fitness (PF), sleep duration and fruit/vegetable consumption in BMI trajectories across time. Data were obtained from the Oporto Growth, Health and Performance Study and comprised 6894 adolescents (3418 girls) divided into four age cohorts (10, 12, 14 and 16 years) measured annually for 3 years. BMI was computed using the standard formula (kg m(-2)); TPA was estimated with the Baecke questionnaire; PF measures included 1-mile run/walk, 50 yard dash (50YD), standing long jump (SLJ), handgrip strength (HGr) and agility shuttle run. Longitudinal changes in BMI were analyzed using the multilevel modeling approach. The average BMI at age of peak of height velocity was 20.7±0.07 kg m(-2) for girls (P<0.001) and 20.58±0.06 kg m(-2) for boys (P<0.001). The annual increment in BMI was 1.36±0.04 kg m(-2), P<0.001 and 1.23±0.03 kg m(-2), P<0.001 for girls and boys, respectively. PF were related to BMI trajectories in both sexes (Girls: β1mile=0.12±0.02, P<0.001; βSLJ=-0.01±0.00, P<0.001; β50YD=0.28±0.05, P<0.001; βHGr=-8.91±0.54, P<0.001; Boys: β1mile=0.18±0.02, P<0.001; βSLJ=-0.01±0.00, P<0.001; β50YD=0.26±0.04, P<0.001; and βHGr=-8.15±0.45, P<0.001). TPA only showed significant, but positive, association with girls' BMI trajectories (β=0.10±0.03, P=0.001). After adjusting for the covariates, sleep duration and fruit/vegetable intake did not show any significant association with BMI trajectories either sex. BMI increased linearly with age in both gender. PF levels are negatively associated with BMI across time in both boys and girls. Therefore, promotion of PF in the adolescent years seems to be effective in the early prevention of obesity.
Eating behaviour patterns and BMI in Portuguese higher education students.
Poínhos, Rui; Oliveira, Bruno M P M; Correia, Flora
2013-12-01
Our aim was to determine prototypical patterns of eating behaviour among Portuguese higher education students, and to relate these patterns with BMI. Data from 280 higher education students (63.2% females) aged between 18 and 27 years were analysed. Several eating behaviour dimensions (emotional and external eating, flexible and rigid restraint, binge eating, and eating self-efficacy) were assessed, and eating styles were derived through cluster analysis. BMI for current, desired and maximum self-reported weights and the differences between desired and current BMI and between maximum and current BMI were calculated. Women scored higher in emotional eating and restraint, whereas men showed higher eating self-efficacy. Men had higher current, desired and maximum BMI. Cluster analysis showed three eating styles in both male and female subsamples: "Overeating", "High self-efficacy" and "High restraint". High self-efficacy women showed lower BMI values than the others, and restrictive women had higher lost BMI. High self-efficacy men showed lower desired BMI than overeaters, and lower maximum and lost BMI than highly restrictive ones. Restrictive women and men differ on important eating behaviour features, which may be the cause of differences in the associations with BMI. Eating self-efficacy seems to be a central variable influencing the relationships between other eating behaviour dimensions and BMI. Copyright © 2013 Elsevier Ltd. All rights reserved.
Association Between BMI and Recurrence of Primary Spontaneous Pneumothorax.
Tan, Juntao; Yang, Yang; Zhong, Jianhong; Zuo, Chuantian; Tang, Huamin; Zhao, Huimin; Zeng, Guang; Zhang, Jianfeng; Guo, Jianji; Yang, Nuo
2017-05-01
Whether body mass index (BMI) is a significant risk factor for recurrence of primary spontaneous pneumothorax (PSP) remains controversial. The purpose of this study was to examine whether BMI and other factors are linked to risk of PSP recurrence. A consecutive cohort of 273 patients was retrospectively evaluated. Patients were divided into those who experienced recurrence (n = 81) and those who did not (n = 192), as well as into those who had low BMI (n = 75) and those who had normal or elevated BMI (n = 198). The two pairs of groups were compared in terms of baseline data, and Cox proportional hazards modeling was used to identify predictors of PSP recurrence. Rates of recurrence among all 273 patients were 20.9% at 1 year, 23.8% at 2 years, and 28.7% at 5 years. Univariate analysis identified the following significant predictors of PSP recurrence: height, weight, BMI, size of pneumothorax, and treatment modality. Multivariate analyses identified several risk factors for PSP recurrence: low BMI, pneumothorax size ≥50%, and non-surgical treatment. Kaplan-Meier survival analysis indicated that patients with low BMI showed significantly lower recurrence-free survival than patients with normal or elevated BMI (P pneumothorax size ≥50%, and non-surgical treatment were risk factors for PSP recurrence in our cohort. Low BMI may be a clinically useful predictor of PSP recurrence.
Integrated genomic and BMI analysis for type 2 diabetes risk assessment.
Directory of Open Access Journals (Sweden)
Dayanara eLebrón-Aldea
2015-03-01
Full Text Available Type 2 Diabetes (T2D is a chronic disease arising from the development of insulin absence or resistance within the body, and a complex interplay of environmental and genetic factors. The incidence of T2D has increased throughout the last few decades, together with the occurrence of the obesity epidemic. The consideration of variants identified by Genome Wide Association Studies (GWAS into risk assessment models for T2D could aid in the identification of at-risk patients who could benefit from preventive medicine. In this study, we build several risk assessment models, and evaluated them with two different classification approaches (Logistic Regression and Neural Networks, to measure the effect of including genetic information in the prediction of T2D. We used data from to the Original and the Offspring cohorts of the Framingham Heart Study, which provides phenotypic and genetic information for 5,245 subjects (4,306 controls and 939 cases. Models were built by using several covariates: gender, exposure time, cohort, body mass index (BMI, and 65 established T2D-associated SNPs. We fitted Logistic Regressions and Bayesian Regularized Neural Network and then assessed their predictive ability by using a ten-fold cross validation. We found that the inclusion of genetic information into the risk assessment models increased the predictive ability by 2%, when compared to the baseline model. Furthermore, the models that included BMI at the onset of diabetes as a possible effector, gave an improvement of 6% in the area under the curve derived from the ROC analysis. The highest AUC achieved (0.75 belonged to the model that included BMI, and a genetic score based on the 65 established T2D-associated SNPs. Finally, the inclusion of SNPs and BMI raised predictive ability in all models as expected; however, results from the AUC in Neural Networks and Logistic Regression did not differ significantly in their prediction accuracy.
Prospective associations between sedentary lifestyle and BMI in midlife
DEFF Research Database (Denmark)
Mortensen, Laust Hvas; Siegler, Ilene C; Barefoot, John C
2006-01-01
A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle.......A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle....
Characteristics of screen media use associated with higher BMI in young adolescents.
Bickham, David S; Blood, Emily A; Walls, Courtney E; Shrier, Lydia A; Rich, Michael
2013-05-01
This study investigates how characteristics of young adolescents' screen media use are associated with their BMI. By examining relationships between BMI and both time spent using each of 3 screen media and level of attention allocated to use, we sought to contribute to the understanding of mechanisms linking media use and obesity. We measured heights and weights of 91 13- to 15-year-olds and calculated their BMIs. Over 1 week, participants completed a weekday and a Saturday 24-hour time-use diary in which they reported the amount of time they spent using TV, computers, and video games. Participants carried handheld computers and responded to 4 to 7 random signals per day by completing onscreen questionnaires reporting activities to which they were paying primary, secondary, and tertiary attention. Higher proportions of primary attention to TV were positively associated with higher BMI. The difference between 25th and 75th percentiles of attention to TV corresponded to an estimated +2.4 BMI points. Time spent watching television was unrelated to BMI. Neither duration of use nor extent of attention paid to video games or computers was associated with BMI. These findings support the notion that attention to TV is a key element of the increased obesity risk associated with TV viewing. Mechanisms may include the influence of TV commercials on preferences for energy-dense, nutritionally questionable foods and/or eating while distracted by TV. Interventions that interrupt these processes may be effective in decreasing obesity among screen media users.
Calzo, Jerel P.; Sonneville, Kendrin R.; Haines, Jess; Blood, Emily A.; Field, Alison E.; Austin, S. Bryn
2012-01-01
Purpose To examine how the associations among BMI and body dissatisfaction and weight and shape concern evolve from late childhood through late adolescence in boys and girls. Methods We analyze data from 9–18-year-olds from the Growing Up Today Study, a national prospective cohort of U.S. Youth (n= 16,882, yielding 59,750 repeated measures observations during five waves of data collection). Generalized additive models produced curves of association for body dissatisfaction and weight concern across BMI percentiles. Generalized estimating equations (adjusting for correlated within-subject repeated measures, sibling clusters, pubertal maturation, and region of residence) tested main and interactive effects of BMI, age, and gender. Results Girls above the 50th BMI percentile reported greater body dissatisfaction than girls below the 50th percentile. By contrast, boys who reported the most body dissatisfaction were either above the 75th BMI percentile (approaching overweight) or below the 10th percentile (approaching underweight). Body dissatisfaction increased with age for both girls and boys, but the gender-specific patterns of BMI effects remained constant. Male and female participants in the overweight/obese BMI range reported the greatest weight concern, but among older adolescents (particularly girls), healthy weight became increasingly associated with greater weight and shape concern. Conclusions Body dissatisfaction and weight and shape concern intensify across adolescence, but associations between the constructs and BMI remain gender-specific. Findings have important implications for eating disorder risk assessment and prevention. PMID:23084175
Linares, Jeannette; Corvalán, Camila; Galleguillos, Bárbara; Kain, Juliana; González, Laura; Uauy, Ricardo; Garmendia, María Luisa; Mericq, Verónica
2016-06-01
To assess the effect of pre-pregnancy body mass index (BMI), gestational weight gain (GWG), and other maternal factors on the timing of adiposity rebound (AR). In this study, 594 mothers (mothers who do not have diabetes and not underweight) from the longitudinal Growth and Obesity Chilean Cohort Study self-reported their weights at the beginning and end of their pregnancies, and their heights were measured. Pre-pregnancy BMI was categorized as normal weight, overweight, or obesity, and GWG was assessed according to Institute of Medicine guidelines. For children, weight and height measurements from 0 to 3 years were retrieved from records, and they were measured from age 4 to 7 years. BMI curves from 0 to 7 years were used to estimate the age at AR, which was categorized as early (7 years). The associations between pre-pregnancy BMI and GWG and early AR were tested using logistic regression models. In total, 33% of the mothers had excess pre-pregnancy weight, 31.2% exceeded Institute of Medicine recommendations, and 45% of children had early AR. The pre-pregnancy BMI and parity were associated with earlier AR (OR = 1.07, 95% CI = 1.02-1.11; OR = 0.86; 95% CI = 0.74-0.99, respectively), but GWG was unrelated. These results suggest that preventive strategies for promoting normal pre-pregnancy BMI, especially in women's first pregnancies, could delay the timing of AR, with protective metabolic effects on offspring. © 2016 The Obesity Society.
Nielsen, Tenna Ruest Haarmark; Fonvig, Cilius Esmann; Dahl, Maria; Mollerup, Pernille Maria; Lausten-Thomsen, Ulrik; Pedersen, Oluf; Hansen, Torben; Holm, Jens-Christian
2018-01-01
The body mass index (BMI) standard deviation score (SDS) may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during childhood obesity treatment. 876 children and adolescents (498 girls) with overweight/obesity, median age 11.2 years (range 1.6-21.7), and median BMI SDS 2.8 (range 1.3-5.7) were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0.4-7.4). Height and weight, body composition measured by dual-energy X-ray absorptiometry, and fasting plasma lipid concentrations were assessed at baseline and at follow-up. Lipid concentrations (total cholesterol (TC), low-density lipoprotein (LDL), high-density lipoprotein (HDL), non-HDL, and triglycerides (TG)) were available in 469 individuals (264 girls). Linear regressions were performed to investigate the associations between BMI SDS, body composition indices, and lipid concentrations. At baseline, BMI SDS was negatively associated with concentrations of HDL (p = 6.7*10-4) and positively with TG (p = 9.7*10-6). Reductions in BMI SDS were associated with reductions in total body fat percentage (pobesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma lipid concentrations. Even in individuals increasing their BMI SDS, body composition and lipid concentrations may improve.
Impact of non-physician health professionals' BMI on obesity care and beliefs.
Bleich, Sara N; Bandara, Sachini; Bennett, Wendy L; Cooper, Lisa A; Gudzune, Kimberly A
2014-12-01
Examine the impact of non-physician health professional body mass index (BMI) on obesity care, self-efficacy, and perceptions of patient trust in weight loss advice. A national cross-sectional Internet-based survey of 500 US non-physician health professionals specializing in nutrition, nursing, behavioral/mental health, exercise, and pharmacy collected between January 20 and February 5, 2014 was analyzed. Normal-BMI professionals were more likely than overweight/obese professionals to report success in helping patients achieve clinically significant weight loss (52% vs. 29%, P = 0.01). No differences by health professional BMI about the appropriate patient body weight for weight-related care (initiate weight loss discussions and success in helping patients lose weight), confidence in ability to help patients lose weight, or in perceived patient trust in their advice were observed. Most health professionals (71%) do not feel successful in helping patients lose weight until they are morbidly obese, regardless of BMI. Normal-BMI non-physician health professionals report being more successful than overweight and obese health professionals at helping obese patients lose weight. More research is needed to understand how to improve self-efficacy for delivering obesity care, particularly among overweight and class I obese patients. © 2014 The Obesity Society.
Genetic Influences on Growth Traits of BMI
DEFF Research Database (Denmark)
Hjelmborg, Jacob V B; Fagnani, Corrado; Silventoinen, Karri
2008-01-01
Objective:To investigate the interplay between genetic factors influencing baseline level and changes in BMI in adulthood.Methods and Procedures:A longitudinal twin study of the cohort of Finnish twins (N = 10,556 twin individuals) aged 20-46 years at baseline was conducted and followed up 15 years....... Data on weight and height were obtained from mailed surveys in 1975, 1981, and 1990.Results:Latent growth models revealed a substantial genetic influence on BMI level at baseline in males and females (heritability (h(2)) 80% (95% confidence interval 0.79-0.80) for males and h(2) = 82% (0.81, 0.......84) for females) and a moderate-to-high influence on rate of change in BMI (h(2) = 58% (0.50, 0.69) for males and h(2) = 64% (0.58, 0.69) for females). Only very weak evidence for genetic pleiotropy was observed; the genetic correlation between baseline and rate of change in BMI was very modest (-0.070 (-0.13, -0...
Gender expression associated with BMI in a prospective cohort study of US adolescents.
Bryn Austin, S; Ziyadeh, Najat J; Calzo, Jerel P; Sonneville, Kendrin R; Kennedy, Grace A; Roberts, Andrea L; Haines, Jess; Scherer, Emily A
2016-02-01
To examine the relationship between gender expression (GE) and BMI in adolescence. Repeated measures of weight-related behaviors and BMI were collected from 1996 to 2011 via annual/biennial self-report surveys from youth aged 10 to 23 years (6,693 females, 2,978 males) in the longitudinal Growing Up Today Study. GE (very conforming [referent], mostly conforming, nonconforming) was assessed in 2010/11. Sex-stratified, multivariable linear models estimated GE group differences in BMI and the contribution of sexual orientation and weight-related exposures to group differences. Models for males included interaction terms for GE with age. In females, mostly conforming youth had 0.53 kg m(-2) and nonconforming had 1.23 kg m(-2) higher BMI; when adding adjustment for sexual orientation and weight-related exposures, GE group estimates were attenuated up to 8% and remained statistically significant. In males, mostly conforming youth had -0.67 kg m(-2) and nonconforming had -1.99 kg m(-2) lower BMI (age [in years]) interactions were between -0.09 and -0.14 kg m(-2) ; when adding adjustment for sexual orientation and weight-related exposures, GE group estimates were attenuated up to 11% and remained statistically significant. GE is a strong independent predictor of BMI in adolescence. Obesity prevention and treatment interventions with youth must address ways that gender norms may reinforce or undermine healthful behaviors. © 2016 The Obesity Society.
Nagl, Michaela; Hilbert, Anja; de Zwaan, Martina; Braehler, Elmar; Kersting, Anette
The Dutch Eating Behavior Questionnaire is an internationally widely used instrument assessing different eating styles that may contribute to weight gain and overweight: emotional eating, external eating, and restraint. This study aimed to evaluate the psychometric properties of the 30-item German version of the DEBQ including its measurement invariance across gender, age, and BMI-status in a representative German population sample. Furthermore, we examined the distribution of eating styles in the general population and provide population-based norms for DEBQ scales. A representative sample of the German general population (N = 2513, age ≥ 14 years) was assessed with the German version of the DEBQ along with information on sociodemographic characteristics and body weight and height. The German version of the DEQB demonstrates good item characteristics and reliability (restraint: α = .92, emotional eating: α = .94, external eating: α = .89). The 3-factor structure of the DEBQ could be replicated in exploratory and confirmatory factor analyses and results of multi-group confirmatory factor analyses supported its metric and scalar measurement invariance across gender, age, and BMI-status. External eating was the most prevalent eating style in the German general population. Women scored higher on emotional and restrained eating scales than men, and overweight individuals scored higher in all three eating styles compared to normal weight individuals. Small differences across age were found for external eating. Norms were provided according to gender, age, and BMI-status. Our findings suggest that the German version of the DEBQ has good reliability and construct validity, and is suitable to reliably measure eating styles across age, gender, and BMI-status. Furthermore, the results demonstrate a considerable variation of eating styles across gender and BMI-status.
Gathirua-Mwangi, Wambui G; Monahan, Patrick; Song, Yiqing; Zollinger, Terrell W; Champion, Victoria L; Stump, Timothy E; Imperiale, Thomas F
2017-11-01
Waist circumference (WC) is a stronger predictor of colon cancer (CRC) risk than body mass index (BMI). However, how well change in either WC or BMI predicts risk of advanced colorectal neoplasia (AN) is unclear. To determine the relationship between change in BMI and WC from early adulthood to later age and the risk of AN and which change measure is a stronger predictor. In 4500 adults, ages 50-80, with no previous neoplasia and undergoing screening colonoscopy, BMI and WC at age 21 and at time of screening were reported. Changes in BMI and WC were defined using universal risk cutoffs. Known CRC risk factors were controlled in the logistic models. Overall, model statistics showed WC change (omnibus test χ 2 = 10.15, 2 DF, p value = 0.006) was a statistically stronger predictor of AN than BMI change (omnibus test χ 2 = 5.66, 5 DF, p value = 0.34). Independent of BMI change, participants who increased WC (OR 1.44; 95% CI 1.05-1.96) or maintained a high-risk WC (OR 2.50; 95% CI 1.38-4.53) at age 21 and at screening had an increased risk of AN compared to those with a low-risk WC. Study participants who were obese at age 21 and at screening had an increased risk of AN (OR 1.87; 95% CI 1.08-3.23) compared to those who maintained a healthy BMI. Maintaining an overweight BMI or increasing BMI was not associated with AN. Maintaining an unhealthy BMI and WC throughout adult life may increase risk of AN. WC change may be a better predictor of AN than BMI change.
The measurement of maternal adiposity.
LENUS (Irish Health Repository)
Fattah, C
2012-02-01
The issue of maternal obesity has become a major public health problem. Internationally, the diagnosis of obesity is based on body mass index (BMI) that is, weight in kg\\/height in m2. While epidemiological associations have been shown between different BMI categories and adverse clinical outcomes, there is also a growing realisation that BMI has significant limitations. In this review, we assess current methods to measure body fat and, in particular, their application in pregnant women.
Effect of weight, height and BMI on injury outcome in side impact crashes without airbag deployment.
Pal, Chinmoy; Tomosaburo, Okabe; Vimalathithan, K; Jeyabharath, M; Muthukumar, M; Satheesh, N; Narahari, S
2014-11-01
A comprehensive analysis is performed to evaluate the effect of weight, height and body mass index (BMI) of occupants on side impact injuries at different body regions. The accident dataset for this study is based on the National Automotive Sampling System-Crashworthiness Data System (NASS-CDS) for accident year 2000-08. The mean BMI values for driver and front passenger are estimated from all types of crashes using NASS database, which clearly indicates that mean BMI has been increasing over the years in the USA. To study the effect of BMI in side impact injuries, BMI was split into three groups namely (1) thin (BMI30). For more clear identification of the effect of BMI in side impact injuries, a minimum gap of three BMI is set in between each adjacent BMI groups. Car model years from MY1995-1999 to MY2000-2008 are chosen in order to identify the degree of influence of older and newer generation of cars in side impact injuries. Impact locations particularly side-front (F), side-center (P) and side-distributed (Y) are chosen for this analysis. Direction of force (DOF) considered for both near side and far side occupants are 8 o'clock, 9 o'clock, 10 o'clock and 2 o'clock, 3 o'clock and 4 o'clock respectively. Age <60 years is also one of the constraints imposed on data selection to minimize the effect of bone strength on the occurrence of occupant injuries. AIS2+ and AIS3+ injury risk in all body regions have been plotted for the selected three BMI groups of occupant, delta-V 0-60kmph, two sets (old and new) of car model years. The analysis is carried with three approaches: (a) injury risk percentage based on simple graphical method with respect to a single variable, (b) injury distribution method where the injuries are marked on the respective anatomical locations and (c) logistic regression, a statistical method, considers all the related variables together. Lower extremity injury risk appears to be high for thin BMI group. It is found that BMI does not have much
Williams, Julianne; Scarborough, Peter; Townsend, Nick; Matthews, Anne; Burgoine, Thomas; Mumtaz, Lorraine; Rayner, Mike
2015-01-01
Researchers and policy-makers are interested in the influence that food retailing around schools may have on child obesity risk. Most previous research comes from North America, uses data aggregated at the school-level and focuses on associations between fast food outlets and school obesity rates. This study examines associations between food retailing and BMI among a large sample of primary school students in Berkshire, England. By controlling for individual, school and home characteristics and stratifying results across the primary school years, we aimed to identify if the food environment around schools had an effect on BMI, independent of socio-economic variables. We measured the densities of fast food outlets and food stores found within schoolchildren's home and school environments using Geographic Information Systems (GIS) and data from local councils. We linked these data to measures from the 2010/11 National Child Measurement Programme and used a cross-classified multi-level approach to examine associations between food retailing and BMI z-scores. Analyses were stratified among Reception (aged 4-5) and Year 6 (aged 10-11) students to measure associations across the primary school years. Our multilevel model had three levels to account for individual (n = 16,956), home neighbourhood (n = 664) and school (n = 268) factors. After controlling for confounders, there were no significant associations between retailing near schools and student BMI, but significant positive associations between fast food outlets in home neighbourhood and BMI z-scores. Year 6 students living in areas with the highest density of fast food outlets had an average BMI z-score that was 0.12 (95% CI: 0.04, 0.20) higher than those living in areas with none. We found little evidence to suggest that food retailing around schools influences student BMI. There is some evidence to suggest that fast food outlet densities in a child's home neighbourhood may have an effect on BMI, particularly
Directory of Open Access Journals (Sweden)
Julianne Williams
Full Text Available Researchers and policy-makers are interested in the influence that food retailing around schools may have on child obesity risk. Most previous research comes from North America, uses data aggregated at the school-level and focuses on associations between fast food outlets and school obesity rates. This study examines associations between food retailing and BMI among a large sample of primary school students in Berkshire, England. By controlling for individual, school and home characteristics and stratifying results across the primary school years, we aimed to identify if the food environment around schools had an effect on BMI, independent of socio-economic variables.We measured the densities of fast food outlets and food stores found within schoolchildren's home and school environments using Geographic Information Systems (GIS and data from local councils. We linked these data to measures from the 2010/11 National Child Measurement Programme and used a cross-classified multi-level approach to examine associations between food retailing and BMI z-scores. Analyses were stratified among Reception (aged 4-5 and Year 6 (aged 10-11 students to measure associations across the primary school years.Our multilevel model had three levels to account for individual (n = 16,956, home neighbourhood (n = 664 and school (n = 268 factors. After controlling for confounders, there were no significant associations between retailing near schools and student BMI, but significant positive associations between fast food outlets in home neighbourhood and BMI z-scores. Year 6 students living in areas with the highest density of fast food outlets had an average BMI z-score that was 0.12 (95% CI: 0.04, 0.20 higher than those living in areas with none.We found little evidence to suggest that food retailing around schools influences student BMI. There is some evidence to suggest that fast food outlet densities in a child's home neighbourhood may have an effect on BMI
Prospective associations between sedentary lifestyle and BMI in midlife.
Mortensen, Laust H; Siegler, Ilene C; Barefoot, John C; Grønbaek, Morten; Sørensen, Thorkild I A
2006-08-01
A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle. Using data from four follow-ups of the University of North Carolina Alumni Heart Study, we examined the prospective associations between BMI and sedentary lifestyle in a cohort of 4595 middle-aged men and women who had responded to questionnaires at the ages of 41 (standard deviation 2.3), 44 (2.3), 46 (2.0), and 54 (2.0). BMI was consistently related to increased risk of becoming sedentary in both men and women. The odds ratios of becoming sedentary as predicted by BMI were 1.04 (95% confidence limits, 1.00, 1.07) per 1 kg/m(2) from ages 41 to 44, 1.10 (1.07, 1.14) from ages 44 to 46, and 1.12 (1.08, 1.17) from ages 46 to 54. Controlling for concurrent changes in BMI marginally attenuated the effects. Sedentary lifestyle did not predict changes in BMI, except when concurrent changes in physical activity were taken into account (p sedentary lifestyle but did not provide unambiguous evidence for an effect of sedentary lifestyle on weight gain.
Roy, Sani M.; Chesi, Alessandra; Mentch, Frank; Xiao, Rui; Chiavacci, Rosetta; Mitchell, Jonathan A.; Kelly, Andrea; Hakonarson, Hakon; Grant, Struan F.A.; Zemel, Babette S.
2015-01-01
Context: No consensus definition exists for excess adiposity during infancy. After age 2 years, high body mass index (BMI) is related to adverse cardiometabolic outcomes. Before age 2 years, the utility of BMI as a metric of excess adiposity is unknown. Objectives: The objective of the study was to characterize infant BMI trajectories in a diverse, longitudinal cohort and investigate the relationship between the infancy BMI trajectory and childhood obesity. Subjects: Healthy, nonpreterm infants (n = 2114) in the Genetic Causes for Complex Pediatric Disorders study (The Children's Hospital of Philadelphia) with six or more BMI measurements in the first 13.5 months participated in the study. Design: For each infant, the BMI trajectory was modeled using polynomial regression. Independent effects of clinical factors on magnitude and timing of peak BMI were assessed. The relationship between infancy BMI and early childhood BMI (age 4 y) was examined (n = 1075). Results: The cohort was 53% male and 61% African-American. Peak BMI was 18.6 ± 1.7 kg/m2 and occurred at 8.6 ± 1.4 months. In multivariate analysis, boys had a higher (0.50 kg/m2, P BMI than girls. The peak was higher (0.53 kg/m2, P ≤ .001) and occurred earlier (by 12 d, P BMI. Conclusions: We demonstrate sex- and ancestry-specific differences in infancy BMI and an association of infancy peak BMI with childhood BMI. These findings support the potential utility of infancy BMI to identify children younger than age 2 years with increased risk for later obesity. PMID:25636051
Prediction of BMI by impulsivity, eating behavior and activity level
Directory of Open Access Journals (Sweden)
Jiang Xiaxia
2016-01-01
Full Text Available Objective: Discuss the relationship between the impulsivity, eating behavior and activity level and the body mass index (BMI. Method: Test 147 female college students with the impulsivity questionnaire (BIS-11 and BIS/BAS, Dutch Eating Behavior Questionnaire (DBEQ, Sitting Time Scale (STS and Exercising Time Scale (ETS. Results: (1 The correlation analysis indicates that BMI and impulsivity (r = 0.43 and 0.52 have a significant positive correlation with the sitting time (r = 0.61 and a significant negative correlation with the activity level (r= −0.49. (2 The path analysis indicates that the reward sensitivity directly affects BMI and indirectly affects BMI through the activity level as well; the eating behavior has an insignificantly direct impact on BMI, because its impact is generated by the intermediary role of induced diet. Conclusion: (1 The impulsivity, eating behavior and activity level are closely related to BMI; (2 the activity level, sitting time and induced diet play an intermediary role between the impulsivity and BMI.
Expression of Bmi-1 is a prognostic marker in bladder cancer
International Nuclear Information System (INIS)
Qin, Zi-Ke; Zeng, Mu-Sheng; Yang, Jian-An; Ye, Yun-lin; Zhang, Xing; Xu, Li-Hua; Zhou, Fang-Jian; Han, Hui; Liu, Zuo-Wei; Song, Li-Bing
2009-01-01
The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P < 0.01). By immunohistochemical examination, five of 30 adjacent normal bladder specimens (16.7%) versus 75 of 137 bladder cancers (54.3%) showed Bmi-1 protein expression (P < 0.05). Bmi-1 protein expression was intense in 20.6%, 54.3%, and 78.8% of tumors of histopathological stages G1, G2, and G3, respectively (P < 0.05). Expression of Bmi-1 protein was greater in invasive bladder cancers than in superficial bladder cancers (81.5% versus 32.5%, P < 0.05). In invasive bladder cancers, the expression of Bmi-1 protein in progression-free cancers was similar to that of cancers that have progressed (80.0% versus 82.4%, P > 0.5). In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P < 0.05). Bmi-1 expression was positively correlated with tumor classification and TNM stage (P < 0.05), but not with tumor number (P > 0.05). Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P < 0.05). Patients with higher Bmi-1 expression had shorter survival time, whereas patients with lower Bmi-1 expression had longer
Decoding of top-down cognitive processing for SSVEP-controlled BMI
Min, Byoung-Kyong; Dähne, Sven; Ahn, Min-Hee; Noh, Yung-Kyun; Müller, Klaus-Robert
2016-11-01
We present a fast and accurate non-invasive brain-machine interface (BMI) based on demodulating steady-state visual evoked potentials (SSVEPs) in electroencephalography (EEG). Our study reports an SSVEP-BMI that, for the first time, decodes primarily based on top-down and not bottom-up visual information processing. The experimental setup presents a grid-shaped flickering line array that the participants observe while intentionally attending to a subset of flickering lines representing the shape of a letter. While the flickering pixels stimulate the participant’s visual cortex uniformly with equal probability, the participant’s intention groups the strokes and thus perceives a ‘letter Gestalt’. We observed decoding accuracy of 35.81% (up to 65.83%) with a regularized linear discriminant analysis; on average 2.05-fold, and up to 3.77-fold greater than chance levels in multi-class classification. Compared to the EEG signals, an electrooculogram (EOG) did not significantly contribute to decoding accuracies. Further analysis reveals that the top-down SSVEP paradigm shows the most focalised activation pattern around occipital visual areas; Granger causality analysis consistently revealed prefrontal top-down control over early visual processing. Taken together, the present paradigm provides the first neurophysiological evidence for the top-down SSVEP BMI paradigm, which potentially enables multi-class intentional control of EEG-BMIs without using gaze-shifting.
Bmi-1 Regulates Extensive Erythroid Self-Renewal
Directory of Open Access Journals (Sweden)
Ah Ram Kim
2015-06-01
Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.
Delgado-Rico, Elena; Río-Valle, Jacqueline S; González-Jiménez, Emilio; Campoy, Cristina; Verdejo-García, Antonio
2012-08-01
Adolescent obesity is increasingly viewed as a brain-related dysfunction, whereby reward-driven urges for pleasurable foods "hijack" response selection systems, such that behavioral control progressively shifts from impulsivity to compulsivity. In this study, we aimed to examine the link between personality factors (sensitivity to reward (SR) and punishment (SP), BMI, and outcome measures of impulsivity vs. flexibility in--otherwise healthy--excessive weight adolescents. Sixty-three adolescents (aged 12-17) classified as obese (n = 26), overweight (n = 16), or normal weight (n = 21) participated in the study. We used psychometric assessments of the SR and SP motivational systems, impulsivity (using the UPPS-P scale), and neurocognitive measures with discriminant validity to dissociate inhibition vs. flexibility deficits (using the process-approach version of the Stroop test). We tested the relative contribution of age, SR/SP, and BMI on estimates of impulsivity and inhibition vs. switching performance using multistep hierarchical regression models. BMI significantly predicted elevations in emotion-driven impulsivity (positive and negative urgency) and inferior flexibility performance in adolescents with excess weight--exceeding the predictive capacity of SR and SP. SR was the main predictor of elevations in sensation seeking and lack of premeditation. These findings demonstrate that increases in BMI are specifically associated with elevations in emotion-driven impulsivity and cognitive inflexibility, supporting a dimensional path in which adolescents with excess weight increase their proneness to overindulge when under strong affective states, and their difficulties to switch or reverse habitual behavioral patterns.
Fukuda, David H; Smith-Ryan, Abbie E; Kendall, Kristina L; Moon, Jordan R; Stout, Jeffrey R
2013-12-01
The purpose of this investigation was to determine body composition classification using field-based testing measurements in healthy elderly men and women. The use of isoperformance curves is presented as a method for this determination. Baseline values from 107 healthy Caucasian men and women, over the age of 65years old, who participated in a separate longitudinal study, were used for this investigation. Field-based measurements of age, height, weight, body mass index (BMI), and handgrip strength were recorded on an individual basis. Relative skeletal muscle index (RSMI) and body fat percentage (FAT%) were determined by dual-energy X-ray absorptiometry (DXA) for each participant. Sarcopenia cut-off values for RSMI of 7.26kg·m(-2) for men and 5.45kg·m(-2) for women and elderly obesity cut-off values for FAT% of 27% for men and 38% for women were used. Individuals above the RSMI cut-off and below the FAT% cut-off were classified in the normal phenotype category, while individuals below the RSMI cut-off and above the FAT% cut-off were classified in the sarcopenic-obese phenotype category. Prediction equations for RSMI and FAT% from sex, BMI, and handgrip strength values were developed using multiple regression analysis. The prediction equations were validated using double cross-validation. The final regression equation developed to predict FAT% from sex, BMI, and handgrip strength resulted in a strong relationship (adjusted R(2)=0.741) to DXA values with a low standard error of the estimate (SEE=3.994%). The final regression equation developed to predict RSMI from the field-based testing measures also resulted in a strong relationship (adjusted R(2)=0.841) to DXA values with a low standard error of the estimate (SEE=0.544kg·m(-2)). Isoperformance curves were developed from the relationship between BMI and handgrip strength for men and women with the aforementioned clinical phenotype classification criteria. These visual representations were used to aid in the
Trends in BMI of urban Australian adults, 1980-2000
DEFF Research Database (Denmark)
Walls, Helen L; Wolfe, Rory; Haby, Michelle M
2010-01-01
of 7.4 kg/m2 at the higher end for women aged 55-64 years. While the prevalence of obesity (BMI >or= 30 kg/m2) doubled, the prevalence of obesity class III (BMI >or= 40 kg/m2) increased fourfold. CONCLUSIONS: BMI in urban Australian adults has increased and its distribution has become increasingly...... right-skewed. This has resulted in a large increase in the prevalence of obesity, particularly the more severe levels of obesity. It will be important to monitor changes in the different classes of obesity and the extent to which obesity interventions both shift the BMI distribution leftwards...
Eating frequency in relation to BMI in very young children: a longitudinal analysis.
Taylor, Rachael W; Iosua, Ella; Heath, Anne-Louise M; Gray, Andrew R; Taylor, Barry J; Lawrence, Julie A; Hanna, Maha; Cameron, Sonya L; Sayers, Rachel; Galland, Barbara
2017-06-01
Eating less frequently is associated with increased obesity risk in older children but data are potentially confounded by reverse causation, where bigger children eat less often in an effort to control their weight. Longitudinal data, particularly in younger children, are scarce. We aimed to determine whether eating frequency (meals and snacks) at 2 years of age is associated with past, current or subsequent BMI. Cohort analysis of a randomised controlled trial. Eating frequency at 2 years of age was estimated using 48 h diaries that recorded when each child ate meals and snacks (parent-defined) in five-minute blocks. Body length/height and weight were measured at 1, 2 and 3·5 years of age. Linear regression assessed associations between the number of eating occasions and BMI Z-score, before and after adjustment for potential confounding variables. Prevention of Overweight in Infancy (POI) study, Dunedin, New Zealand. Children (n 371) aged 1-3·5 years. On average, children ate 5·5 (sd 1·2) times/d at 2 years of age, with most children (88-89 %) eating 4-7 times/d. Eating frequency at 2 years was not associated with current (difference in BMI Z-score per additional eating occasion; 95 % CI: -0·02; -0·10, 0·05) or subsequent change (0·02; -0·03, 0·06) in BMI. Similarly, BMI at age 1 year did not predict eating frequency at 2 years of age (difference in eating frequency per additional BMI Z-score unit; 95 % CI: -0·03; -0·19, 0·13). Number of eating occasions per day was not associated with BMI in young children in the present study.
Adrenocortical Regulation, Eating in the Absence of Hunger and BMI in Young Children
Francis, L. A.; Granger, D. A.; Susman, E. J.
2012-01-01
The purpose of this study was to examine relations among adrenocortical regulation, eating in the absence of hunger, and body mass index (BMI) in children ages 5 to 9 years (N = 43). Saliva was collected before and after the Trier Social Stress Test for children (TSST-C), and was later assayed for cortisol. Area under the curve with respect to increase (AUCi) was used as a measure of changes in cortisol release from baseline to 60 minutes post-TSST-C. Age- and sex-specific BMI scores were cal...
The decline in BMI among Japanese women after World War II.
Maruyama, Shiko; Nakamura, Sayaka
2015-07-01
The body mass index (BMI) of the Japanese is significantly lower than is found in other high-income countries. Moreover, the average BMI of Japanese women is lower than that of Japanese men, and the age-specific BMI of Japanese women has decreased over time. The average BMI of Japanese women at age 25 decreased from 21.8 in 1948 to 20.4 in 2010 whereas that of men increased from 21.4 to 22.3 over the same period. We examine the long-term BMI trend in Japan by combining several historical data sources spanning eleven decades, from 1901 to 2012, to determine not only when but also how the BMI decline among women began: whether its inception was period-specific or cohort-specific. Our nonparametric regression analysis generated five findings. First, the BMI of Japanese women peaked with the 1930s birth cohort. This means that the trend is cohort-specific. Second, the BMI of men outpaced that of women in the next cohort. Third, the BMI of Japanese children, boys and girls alike, increased steadily throughout the 20th century. Fourth, the gender difference in the BMI trend is due to a gender difference in the weight trend, not the height trend. Fifth, these BMI trends are observed in urban and rural populations alike. We conclude that the BMI decline among Japanese women began with those who were in their late teens shortly after World War II. Copyright © 2015 Elsevier B.V. All rights reserved.
Are BMI and Sedentariness Correlated? A Multilevel Study in Children
Directory of Open Access Journals (Sweden)
Thayse Natacha Gomes
2015-07-01
Full Text Available The purpose of this research was to investigate the relationship between body mass index (BMI and sedentariness (Sed in children and to examine the influence of child and school correlates on their variation. The sample comprises 580 children (337 girls, 9–11 years. Sedentariness was assessed with an accelerometer, and BMI was computed. Child- and school-level covariates were analyzed using multilevel models. No significant correlation between Sed and BMI was found. School context explains 5% and 1.5% of the total variance in Sed and BMI, respectively. At the child level, only moderate-to-vigorous physical activity was associated with both Sed (β = −0.02 ± 0.002 and BMI (β = −0.005 ± 0.002. Sleep time is related to Sed (β = −0.42 ± 0.04, while sex (β = 1.97 ± 0.13, biological maturity (β = 1.25 ± 0.07, media in the bedroom (β = 0.26 ± 0.08 and healthy (β = −0.09 ± 0.03 and unhealthy (β = −0.07 ± 0.04 diet scores were associated with BMI. None of the school-level covariates were related to BMI, but access to cafeteria (β = −0.97 ± 0.25, playground equipment (β = −0.67 ± 0.20 and restaurants (β = 0.16 ± 0.08 were related to Sed. In conclusion, Sed and BMI were not correlated. Further, they have different correlates, while children’s traits seem to play more relevant roles in their differences in Sed and BMI than the school milieu. This information should be taken into account when strategies to reduce Sed and BMI are implemented.
Effects of injected dose, BMI and scanner type on NECR and image noise in PET imaging
International Nuclear Information System (INIS)
Chang Tingting; Chang Guoping; Clark, John W Jr; Kohlmyer, Steve; Rohren, Eric; Mawlawi, Osama R
2011-01-01
Noise equivalent count rate (NECR) and image noise are two different but related metrics that have been used to predict and assess image quality, respectively. The aim of this study is to investigate, using patient studies, the relationships between injected dose (ID), body mass index (BMI) and scanner type on NECR and image noise measurements in PET imaging. Two groups of 90 patients each were imaged on a GE DSTE and a DRX PET/CT scanner, respectively. The patients in each group were divided into nine subgroups according to three BMI (20-24.9, 25-29.9, 30-45 kg m -2 ) and three ID (296-444, 444-555, 555-740 MBq) ranges, resulting in ten patients/subgroup. All PET data were acquired in 3D mode and reconstructed using the VuePoint HD (registered) fully 3D OSEM algorithm (2 iterations, 21(DRX) or 20 (DSTE) subsets). NECR and image noise measurements for bed positions covering the liver were calculated for each patient. NECR was calculated from the trues, randoms and scatter events recorded in the DICOM header of each patient study, while image noise was determined as the standard deviation of 50 non-neighboring voxels in the liver of each patient. A t-test compared the NECR and image noise for different scanners but with the same BMI and ID. An ANOVA test on the other hand was used to compare the results of patients with different BMI but the same ID and scanner type as well as different ID but the same BMI and scanner type. As expected the t-test showed a significant difference in NECR between the two scanners for all BMI and ID subgroups. However, contrary to what is expected no such findings were observed for image noise measurement. The ANOVA results showed a statistically significant difference in both NECR and image noise among the different BMI for each ID and scanner subgroup. However, there was no statistically significant difference in NECR and image noise across different ID for each BMI and scanner subgroup. Although the GE DRX PET/CT scanner has better
Bmi-1: At the crossroads of physiological and pathological biology
Bhattacharya, Resham; Mustafi, Soumyajit Banerjee; Street, Mark; Dey, Anindya; Dwivedi, Shailendra Kumar Dhar
2015-01-01
Bmi-1 is a member of the Polycomb Repressor Complex1 that mediates gene silencing by regulating chromatin structure and is indispensable for self-renewal of both normal and cancer stem cells. Despite three decades of research that have elucidated the transcriptional regulation, post-translational modifications and functions of Bmi-1 in regulating the DNA damage response, cellular bioenergetics, and pathologies, the entire potential of a protein with such varied function remains to be realized. This review attempts to synthesize the current knowledge on Bmi-1 with an emphasis on its role in both normal physiology and cancer. Additionally, since cancer stem cells are emerging as a new paradigm for therapy resistance, the role of Bmi-1 in this perspective is also highlighted. The wide spectrum of malignancies that implicate Bmi-1 as a signature for stemness and oncogenesis also make it a suitable candidate for therapy. Nonetheless new approaches are vitally needed to further characterize physiological roles of Bmi-1 with the long-term goal of using Bmi-1 as a prognostic marker and a therapeutic target. PMID:26448339
Balasubramanian, Sivaprakasam; Scharadin, Tiffany M.; Han, Bingshe; Xu, Wen; Eckert, Richard L.
2016-01-01
The Bmi-1 Polycomb group (PcG) protein is an important epigenetic regulator of chromatin status. Elevated Bmi-1 expression is observed in skin cancer and contributes to cancer cell survival. (–) Epigallocatechin-3-gallate (EGCG), an important green tea-derived cancer prevention agent, reduces Bmi-1 level resulting in reduced skin cancer cell survival. This is associated with increased p21Cip1 and p27Kip1 expression, reduced cyclin, and cyclin dependent kinase expression, and increased cleavage of apoptotic markers. These EGCG-dependent changes are attenuated by vector-mediated maintenance of Bmi-1 expression. In the present study, we identify Bmi-1 functional domains that are required for this response. Bmi-1 expression reverses the EGCG-dependent reduction in SCC-13 cell survival, but Bmi-1 mutants lacking the helix–turn–helix–turn–helix–turn (Bmi-1ΔHT) or ring finger (Bmi-1ΔRF) domains do not reverse the EGCG impact. The reduction in Ring1B ubiquitin ligase activity, observed in the presence of mutant Bmi-1, is associated with reduced ability of these mutants to interact with and activate Ring1B ubiquitin ligase, the major ligase responsible for the ubiquitination of histone H2A during chromatin condensation. This results in less chromatin condensation leading to increased tumor suppressor gene expression and reduced cell survival; thereby making the cells more susceptible to the anti-survival action of EGCG. We further show that these mutants act in a dominant-negative manner to inhibit the action of endogenous Bmi-1. Our results suggest that the HT and RF domains are required for Bmi-1 ability to maintain skin cancer cell survival in response to cancer preventive agents. PMID:25843776
Directory of Open Access Journals (Sweden)
Tenna Ruest Haarmark Nielsen
Full Text Available The body mass index (BMI standard deviation score (SDS may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during childhood obesity treatment.876 children and adolescents (498 girls with overweight/obesity, median age 11.2 years (range 1.6-21.7, and median BMI SDS 2.8 (range 1.3-5.7 were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0.4-7.4. Height and weight, body composition measured by dual-energy X-ray absorptiometry, and fasting plasma lipid concentrations were assessed at baseline and at follow-up. Lipid concentrations (total cholesterol (TC, low-density lipoprotein (LDL, high-density lipoprotein (HDL, non-HDL, and triglycerides (TG were available in 469 individuals (264 girls. Linear regressions were performed to investigate the associations between BMI SDS, body composition indices, and lipid concentrations.At baseline, BMI SDS was negatively associated with concentrations of HDL (p = 6.7*10-4 and positively with TG (p = 9.7*10-6. Reductions in BMI SDS were associated with reductions in total body fat percentage (p<2*10-16 and percent truncal body fat (p<2*10-16. Furthermore, reductions in BMI SDS were associated with improvements in concentrations of TC, LDL, HDL, non-HDL, LDL/HDL-ratio, and TG (all p <0.0001. Changes in body fat percentage seemed to mediate the changes in plasma concentrations of TC, LDL, and non-HDL, but could not alone explain the changes in HDL, LDL/HDL-ratio or TG. Among 81 individuals with available lipid concentrations, who increased their BMI SDS, 61% improved their body composition, and 80% improved their lipid concentrations.Reductions in the degree of obesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma
Process Optimization of Bismaleimide (BMI) Resin Infused Carbon Fiber Composite
Ehrlich, Joshua W.; Tate, LaNetra C.; Cox, Sarah B.; Taylor, Brian J.; Wright, M. Clara; Caraccio, Anne J.; Sampson, Jeffery W.
2013-01-01
Bismaleimide (BMI) resins are an attractive new addition to world-wide composite applications. This type of thermosetting polyimide provides several unique characteristics such as excellent physical property retention at elevated temperatures and in wet environments, constant electrical properties over a vast array of temperature settings, and nonflammability properties as well. This makes BMI a popular choice in advance composites and electronics applications [I]. Bismaleimide-2 (BMI-2) resin was used to infuse intermediate modulus 7 (IM7) based carbon fiber. Two panel configurations consisting of 4 plies with [+45deg, 90deg]2 and [0deg]4 orientations were fabricated. For tensile testing, a [90deg]4 configuration was tested by rotating the [0deg]4 configirration to lie orthogonal with the load direction of the test fixture. Curing of the BMI-2/IM7 system utilized an optimal infusion process which focused on the integration of the manufacturer-recommended ramp rates,. hold times, and cure temperatures. Completion of the cure cycle for the BMI-2/IM7 composite yielded a product with multiple surface voids determined through visual and metallographic observation. Although the curing cycle was the same for the three panellayups, the surface voids that remained within the material post-cure were different in abundance, shape, and size. For tensile testing, the [0deg]4 layup had a 19.9% and 21.7% greater average tensile strain performance compared to the [90deg]4 and [+45deg, 90deg, 90deg,-45degg] layups, respectively, at failure. For tensile stress performance, the [0deg]4 layup had a 5.8% and 34.0% greater average performance% than the [90deg]4 and [+45deg, 90deg, 90deg,-45deg] layups.
Education modifies genetic and environmental influences on BMI
DEFF Research Database (Denmark)
Johnson, Wendy; Kyvik, Kirsten Ohm; Skytthe, Axel
2011-01-01
environmental correlations between education and BMI differed by level of education, analyzing women and men separately. Correlations between education and BMI were -.13 in women, -.15 in men. High BMI's were less frequent among well-educated participants, generating less variance. In women, this was due...... to restriction of all forms of variance, overall by a factor of about 2. In men, genetic variance did not vary with education, but results for shared and nonshared environmental variance were similar to those for women. The contributions of the shared environment to the correlations between education and BMI......Obesity is more common among the less educated, suggesting education-related environmental triggers. Such triggers may act differently dependent on genetic and environmental predisposition to obesity. In a Danish Twin Registry survey, 21,522 twins of same-sex pairs provided zygosity, height, weight...
Restaurants in the Neighborhood, Eating Away from Home and BMI in China.
Directory of Open Access Journals (Sweden)
Xu Tian
Full Text Available To investigate the association between environmental risk factors, eating away from home, and increasing BMI of Chinese adults.Participants were selected from the recent four waves (2004, 2006, 2009, and 2011 of the China Health and Nutrition Survey (CHNS. 10633 participants, including 5084 men and 5549 women, were used in the analysis. 24-h dietary recall data for three consecutive days with information on the time and place of consumption were collected. Nearby restaurants were measured by the number of fast food outlets, indoor restaurants, and food stands in the neighborhood. Random effects multivariable regression was used to assess associations between these variables.People living in neighborhoods with large numbers of indoor restaurants are more likely to eat away from home (p<0.05. Higher frequency of eating away from home is positively associated with BMI, but this effect is only significant for men (p<0.05. Moreover, while eating dinner or breakfast away from home contributes to BMI increase for men (p<0.05, no such association is found for lunch.Eating dinner and breakfast away from home is positively associated with BMI for Chinese men. Labeling energy and portion size for the dishes served in indoor restaurants is recommended in China.
BMI trajectory groups in veterans of the Iraq and Afghanistan wars.
Rosenberger, Patricia H; Ning, Yuming; Brandt, Cynthia; Allore, Heather; Haskell, Sally
2011-09-01
The study sought to determine BMI trajectories in Iraq/Afghanistan veterans over 6 years and to examine sociodemographic factors associated with BMI trajectory membership. Our study sample included 16,656 veterans post-deployment and entering the Veteran Healthcare Administration (VHA) healthcare system. We used national VHA administrative sociodemographic data, tracked veteran BMI for 6 years, and used trajectory modeling to identify BMI trajectories and sociodemographic characteristics associated with trajectory membership. Five trajectory groups determined in the full sample were primarily differentiated by their post-deployment initial BMI: "healthy" (14.1%), "overweight" (36.3%), "borderline obese" (27.9%), "obese" (15.7%), and "severely obese" (6.0). Being female, younger, and white were associated with lower initial BMI trajectory group membership (p'seducation and white female Veterans were associated with the lowest initial BMI group (p'sEducation level and racial status are differentially related to BMI trajectory by gender. Published by Elsevier Inc.
Expression of Bmi-1 is a prognostic marker in bladder cancer
Directory of Open Access Journals (Sweden)
Xu Li-Hua
2009-02-01
Full Text Available Abstract Background The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. Methods We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Results Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P P P P P > 0.5. In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P P P > 0.05. Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P P Conclusion Expression of Bmi-1 was greater in bladder cancers than in the adjacent normal tissues. The examination of Bmi-1 protein expression is potentially valuable in prognostic evaluation of bladder cancer.
Asthma, Smoking and BMI in Adults with Intellectual Disabilities: A Community-Based Survey
Gale, L.; Naqvi, H.; Russ, L.
2009-01-01
Background: Recent research evidence from the general population has shown that tobacco smoking and raised body mass index (BMI) are associated with worse asthma outcomes. There are indications that asthma morbidity and mortality may be higher among people with intellectual disabilities (ID) than the general population, but the reason for this is…
Maternal Prepregnancy BMI and Risk of Cerebral Palsy in Offspring
DEFF Research Database (Denmark)
Forthun, Ingeborg; Wilcox, Allen J; Strandberg-Larsen, Katrine
2016-01-01
OBJECTIVES: To investigate the association between maternal pre-pregnancy BMI and risk of cerebral palsy (CP) in offspring. METHODS: The study population consisted of 188 788 children in the Mothers and Babies in Norway and Denmark CP study, using data from 2 population-based, prospective birth...
Benson, Rebecca; von Hippel, Paul T; Lynch, Jamie L
2017-03-21
More educated adults have lower average body mass index (BMI). This may be due to selection, if adolescents with lower BMI attain higher levels of education, or it may be due to causation, if higher educational attainment reduces BMI gain in adulthood. We test for selection and causation in the National Longitudinal Survey of Youth 1979, which has followed a representative US cohort from age 14-22 in 1979 through age 47-55 in 2012. Using ordinal logistic regression, we test the selection hypothesis that overweight and obese adolescents were less likely to earn high school diplomas and bachelor's degrees. Then, controlling for selection with individual fixed effects, we estimate the causal effect of degree completion on BMI and obesity status. Among 18-year-old women, but not among men, being overweight or obese predicts lower odds of attaining higher levels of education. At age 47-48, higher education is associated with lower BMI, but 70-90% of the association is due to selection. Net of selection, a bachelor's degree predicts less than a 1 kg reduction in body weight, and a high school credential does not reduce BMI. Copyright © 2017 Elsevier Ltd. All rights reserved.
The impact of follicular fluid adiponectin and ghrelin levels based on BMI on IVF outcomes in PCOS.
Inal, H A; Yilmaz, N; Gorkem, U; Oruc, A S; Timur, H
2016-04-01
This study aimed at evaluating the effects of polycystic ovary syndrome (PCOS) and body mass index (BMI) on follicular fluid (FF) adiponectin and ghrelin levels, and on in vitro fertilization outcomes in patients who underwent controlled ovarian hyperstimulation. This prospective cross-sectional study was performed with a total of 120 primary infertile women [group 1; non-PCOS = 60 (BMI PCOS = 60 (BMI lean PCOS group than the lean non-PCOS group (p = 0.001), and these levels were lower in the overweight non-PCOS group compared to lean non-PCOS group (0.001). However, there was no difference in the FF ghrelin levels between the groups. Additionally, we could not find a relationship between clinical pregnancy and adiponectin and ghrelin levels. The FF adiponectin and ghrelin levels have no effects on clinical pregnancy in PCOS. Therefore, further studies are needed to elucidate this issue.
Bmi-1 expression modulates non-small cell lung cancer progression
Xiong, Dan; Ye, Yunlin; Fu, Yujie; Wang, Jinglong; Kuang, Bohua; Wang, Hongbo; Wang, Xiumin; Zu, Lidong; Xiao, Gang; Hao, Mingang; Wang, Jianhua
2015-01-01
Previous studies indicate that the role of B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1) is responsible for multiple cancer progression. However, Bmi-1 in controlling gene expression in non-small cell lung cancer (NSCLC) development is not well explored. Here we report that the Bmi-1 level is highly increased in primary NSCLC tissues compared to matched adjacent non-cancerous tissues and required for lung tumor growth in xenograft model. Furthermore, we also demonstrate that Bmi-1 level is lower in matched involved lymph node cancerous tissues than the respective primary NSCLC tissues. We find that Bmi-1 does not affect cell cycle and apoptosis in lung cancer cell lines as it does not affect the expression of p16/p19, Pten, AKT and P-AKT. Mechanistic analyses note that reduction of Bmi-1 expression inversely regulates invasion and metastasis of NSCLC cells in vitro and in vivo, followed by induction of epithelial-mesenchymal transition (EMT). Using genome microarray assays, we find that RNAi-mediated silence of Bmi-1 modulates some important molecular genetics or signaling pathways, potentially associated with NSCLC development. Taken together, our findings disclose for the first time that Bmi-1 level accumulates strongly in early stage and then declines in late stage, which is potentially important for NSCLC cell invasion and metastasis during progression. PMID:25880371
Comparison of Aorta-sacral Promontory Distance with Age and BMI in Female Patients Undergoing CT
Sneha Mary Varghese; Suresh Sukumar; Abhimanyu Pradhan
2017-01-01
Introduction: Sacral colpopexy is the gold standard procedure for pelvic organ prolapse. During sacral colpopexy, various complications such as haemorrhage can occur. Careful dissection of presacral space is essential to minimize complications. Aim: The aim of the study was to compare patient age and Body Mass Index (BMI) with Computed Tomography (CT) measured aorta-sacral promontory distance. Materials and Methods: From 172 samples data such as age and BMI of female patients aged 18 ye...
Bmi1 is required for hedgehog pathway-driven medulloblastoma expansion
Michael, Lowell Evan; Westerman, Bart A.; Ermilov, Alexandre N.; Wang, Aiqin; Ferris, Jennifer; Liu, Jianhong; Blom, Marleen; Ellison, David W.; van Lohuizen, Maarten; Dlugosz, Andrzej A.
2008-01-01
Inappropriate Hedgehog (Hh) signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in
Diagnostic performance of BMI percentiles to identify adolescents with metabolic syndrome.
Laurson, Kelly R; Welk, Gregory J; Eisenmann, Joey C
2014-02-01
To compare the diagnostic performance of the Centers for Disease Control and Prevention (CDC) and FITNESSGRAM (FGram) BMI standards for quantifying metabolic risk in youth. Adolescents in the NHANES (n = 3385) were measured for anthropometric variables and metabolic risk factors. BMI percentiles were calculated, and youth were categorized by weight status (using CDC and FGram thresholds). Participants were also categorized by presence or absence of metabolic syndrome. The CDC and FGram standards were compared by prevalence of metabolic abnormalities, various diagnostic criteria, and odds of metabolic syndrome. Receiver operating characteristic curves were also created to identify optimal BMI percentiles to detect metabolic syndrome. The prevalence of metabolic syndrome in obese youth was 19% to 35%, compared with <2% in the normal-weight groups. The odds of metabolic syndrome for obese boys and girls were 46 to 67 and 19 to 22 times greater, respectively, than for normal-weight youth. The receiver operating characteristic analyses identified optimal thresholds similar to the CDC standards for boys and the FGram standards for girls. Overall, BMI thresholds were more strongly associated with metabolic syndrome in boys than in girls. Both the CDC and FGram standards are predictive of metabolic syndrome. The diagnostic utility of the CDC thresholds outperformed the FGram values for boys, whereas FGram standards were slightly better thresholds for girls. The use of a common set of thresholds for school and clinical applications would provide advantages for public health and clinical research and practice.
Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway
International Nuclear Information System (INIS)
Jiang, Lili; Wu, Jueheng; Yang, Yi; Liu, Liping; Song, Libing; Li, Jun; Li, Mengfeng
2012-01-01
The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF-kappaB/MMP-9 pathway and therefore might represent a novel therapeutic
Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway
Directory of Open Access Journals (Sweden)
Jiang Lili
2012-09-01
Full Text Available Abstract Background The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1 has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. Methods A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Results Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Conclusions Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF
Hübers, M; Pourhassan, M; Braun, W; Geisler, C; Müller, M J
2017-09-01
This study aims to determine associations between anthropometric traits, regional fat depots and insulin resistance in children, adolescents and adults to define new cut-offs of body mass index (BMI) or waist circumference (WC). Cross-sectional data were assessed in 433 children, adolescents and adults (aged: 6-60 years, BMI: 23.6 [21.0-27.7] kg m -2 ). Total adipose tissue (TAT), regional subcutaneous adipose tissue (SAT total , SAT trunk ) and visceral adipose tissue (VAT) were determined by whole-body magnetic resonance imaging, fat mass by air-displacement plethysmography. Insulin resistance was evaluated by homeostasis model assessment of insulin resistance (HOMA-IR). Bivariate as well as partial correlations and regression analyses were used. Cut-off values of BMI and WC related to regional fat depots and HOMA-IR were analysed by receiver operating characteristics curve. In adults, TAT, SAT total and SAT trunk increased linearly with increasing BMI and WC, whereas they followed a cubic function in children and adolescents with a steep increase at BMI and WC ≥1 standard deviation score and VAT at WC ≥2 standard deviation score. Sex differences were apparent in adults with women having higher masses of TAT and SAT and men having higher VAT. Using established BMI or WC cut-offs, correspondent masses of TAT, SAT total , SAT trunk and VAT increased from childhood to adulthood. In all age groups, there were positive associations between BMI, WC, SAT trunk , VAT and HOMA-IR. When compared with normative cut-offs of BMI or WC, HOMA-IR-derived cut-offs of regional fat depots were lower in all age groups. Associations between BMI, WC and regional fat depots varied between children, adolescents, young and older adults. When compared with BMI-derived and WC-derived values, an insulin resistance-derived cut-off corresponded to lower masses of regional fat depots. Thus, established BMI and WC cut-offs are not appropriate to assess metabolic disturbances associated
Wang, Xiaofeng; Liu, Xinyang; Huang, Mingzhu; Gan, Lu; Cheng, Yufan; Li, Jin
2016-01-01
Bmi-1 is aberrantly activated in various cancers and plays a vital role in maintaining the self-renewal of stem cells. Our previous research revealed that Bmi-1 was overexpressed in gastric cancer (GC) and it's overexpression was an independent negative prognostic factor, suggesting it can be a therapeutic target. The main purpose of this investigation was to explore the antitumor activity of Bmi-1 interference driven by its own promoter (Ad-Bmi-1i) for GC. In this study, we used adenoviral vector to deliver Bmi-1 shRNA driven by its own promoter to treat GC. Our results revealed that Ad-Bmi-1i could selectively silence Bmi-1 in GC cells which overexpress Bmi-1 and suppress the malignant phenotypes and stem-like properties of GC cells in vitro and in vivo. Moreover, direct injection of Ad-Bmi-1i into xenografts suppressed tumor growth and destroyed cancer cells in vivo. Ad-Bmi-1i inhibited the proliferation of GC cells mainly via inducing senescence in vitro, but it suppressed tumor through inducing senescence and apoptosis, and inhibiting angiogenesis in vivo. Bmi-1 knockdown by Ad-Bmi-1i downregulated VEGF via inhibiting AKT activity. These results suggest that Ad-Bmi-1i not only inhibits tumor growth and stem cell-like phenotype by inducing cellular senescence directly, but also has an indirect anti-tumor activity by anti-angiogenesis effects via regulating PTEN/AKT/VEGF pathway. Transfer of gene interference guided by its own promoter by an adeno-associated virus (AAV) vector might be a potent antitumor approach for cancer therapy. PMID:27009837
Racette, Susan B; Yu, Liyang; DuPont, Nicholas C; Clark, B Ruth
2017-05-24
Severe obesity is an important and distinct weight status classification that is associated with disease risk and is increasing in prevalence among youth. The ability to graphically present population weight status data, ranging from underweight through severe obesity class 3, is novel and applicable to epidemiologic research, intervention studies, case reports, and clinical care. The aim was to create body mass index (BMI) graphing tools to generate sex-specific BMI-for-age graphs that include severe obesity percentile curves. We used the Centers for Disease Control and Prevention youth reference data sets and weight status criteria to generate the percentile curves. The statistical software environments SAS and R were used to create two different graphing options. This article provides graphing tools for creating sex-specific BMI-for-age graphs for males and females ages 2 to obesity classes 2 and 3, the ability to plot individual data for thousands of children and adolescents on a single graph, and the ability to generate cross-sectional and longitudinal graphs. These new BMI graphing tools will enable investigators, public health professionals, and clinicians to view and present youth weight status data in novel and meaningful ways.
Maternal BMI during Pregnancy: Effect on trace elements Status and ...
African Journals Online (AJOL)
Maternal BMI was significantly positively related to age, parity and socioeconomic status. While a negative relationship was found between plasma copper and maternal BMI, significantly (p < 0.05) lower zinc levels were found in underweight and obese women when compared to women with normal BMI. Maternal anaemia ...
Brown, Mark A; Goodwin, James L; Silva, Graciela E; Behari, Ajay; Newman, Anne B; Punjabi, Naresh M; Resnick, Helaine E; Robbins, John A; Quan, Stuart F
2011-12-08
INTRODUCTION: It is well known that obesity is a risk factor for sleep-disordered breathing (SDB). However, whether SDB predicts increase in BMI is not well defined. Data from the Sleep Heart Health Study (SHHS) were analyzed to determine whether SDB predicts longitudinal increase in BMI, adjusted for confounding factors. METHODS: A full-montage unattended home polysomnogram (PSG) and body anthropometric measurements were obtained approximately five years apart in 3001 participants. Apnea-hypopnea index (AHI) was categorized using clinical thresholds: sleep apnea), and ≥ 15 (moderate to severe sleep apnea). Linear regression was used to examine the association between the three AHI groups and increased BMI. The model included age, gender, race, baseline BMI, and change in AHI as covariates. RESULTS: Mean (SD) age was 62.2 years (10.14), 55.2% were female and 76.1% were Caucasian. Five-year increase in BMI was modest with a mean (SD) change of 0.53 (2.62) kg/m(2) (p=0.071). A multivariate regression model showed that subjects with a baseline AHI between 5-15 had a mean increase in BMI of 0.22 kg/m(2) (p=0.055) and those with baseline AHI ≥ 15 had a BMI increase of 0.51 kg/m(2) (plosing weight.
Parental nonstandard work schedules during infancy and children's BMI trajectories
Directory of Open Access Journals (Sweden)
Afshin Zilanawala
2017-09-01
Full Text Available Background: Empirical evidence has demonstrated adverse associations between parental nonstandard work schedules (i.e., evenings, nights, or weekends and child developmental outcomes. However, there are mixed findings concerning the relationship between parental nonstandard employment and children's body mass index (BMI, and few studies have incorporated information on paternal work schedules. Objective: This paper investigated BMI trajectories from early to middle childhood (ages 3-11 by parental work schedules at 9 months of age, using nationally representative cohort data from the United Kingdom. This study is the first to examine the link between nonstandard work schedules and children's BMI in the United Kingdom. Methods: We used data from the Millennium Cohort Study (2001‒2013, n = 13,021 to estimate trajectories in BMI, using data from ages 3, 5, 7, and 11 years. Joint parental work schedules and a range of biological, socioeconomic, and psychosocial covariates were assessed in the initial interviews at 9 months. Results: Compared to children in two-parent families where parents worked standard shifts, we found steeper BMI growth trajectories for children in two-parent families where both parents worked nonstandard shifts and children in single-parent families whose mothers worked a standard shift. Fathers' shift work, compared to standard shifts, was independently associated with significant increases in BMI. Conclusions: Future public health initiatives focused on reducing the risk of rapid BMI gain in childhood can potentially consider the disruptions to family processes resulting from working nonstandard hours. Contribution: Children in families in which both parents work nonstandard schedules had steeper BMI growth trajectories across the first decade of life. Fathers' nonstandard shifts were independently associated with increases in BMI.
de Souza, Natalia Cavalheri; de Oliveira, Erick Prado
2013-01-01
Background Obesity (abdominal adiposity) is a risk factor for cardiovascular diseases and the most used methods to measure the adiposity are body mass index (BMI), waist circumference (WC), and sagittal abdominal diameter (SAD). Objective To correlate BMI, WC, and SAD with biochemical parameters and blood pressure in adults. Methods A non-experimental exploratory/descriptive and cross sectional study was developed and it was assessed 133 subjects (59 men and 74 women) aging between 18 and 87?...
The link between BMI and waist circumference in northern Iranian ...
African Journals Online (AJOL)
Background and Objectives: Waist circumference and not body mass index explains a greater variance in obesity-related health risk. The present study assesses the link between BMI and WC in Iranian adults. Methods: In a population based cross- sectional study on 3600 adults, northern Iran, we investigated the link ...
Bmi-1-targeting suppresses osteosarcoma aggressiveness through the NF-κB signaling pathway
Liu, Jiaguo; Luo, Bin; Zhao, Meng
2017-01-01
Bone cancer is one of the most lethal malignancies and the specific causes of tumor initiation are not well understood. B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been reported to be associated with the initiation and progression of osteosarcoma, and as a prognostic indicator in the clinic. In the current study, a full-length antibody targeting Bmi-1 (AbBmi-1) was produced and the preclinical value of Bmi-1-targeted therapy was evaluated in bone carcinoma cells and tumor xenograft mice. The results indicated that the Bmi-1 expression level was markedly upregulated in bone cancer cell lines, and inhibition of Bmi-1 by AbBmi-1 reduced the invasiveness and migration of osteosarcoma cells. Overexpression of Bmi-1 promoted proliferation and angiogenesis, and increased apoptosis resistance induced by cisplatin via the nuclear factor-κB (NF-κB) signal pathway. In addition, AbBmi-1 treatment inhibited the tumorigenicity of osteosarcoma cells in vivo. Furthermore, AbBmi-1 blocked NF-κB signaling and reduced MMP-9 expression. Furthermore, Bmi-1 promoted osteosarcoma tumor growth, whereas AbBmi-1 significantly inhibited osteosarcoma tumor growth in vitro and in vivo. Notably, AbBmi-1 decreased the percentages of Ki67-positive cells and terminal deoxynucleotidyl transferase dUTP nick end labeling-positive cells in tumors compared with Bmi-1-treated and PBS controls. Notably, MMP-9 and NF-κB expression were downregulated by treatment with AbBmi-1 in MG-63 osteosarcoma cells. In conclusion, the data provides evidence that AbBmi-1 inhibited the progression of osteosarcoma, suggesting that AbBmi-1 may be a novel anti-cancer agent through the inhibition of Bmi-1 via activating the NF-κB pathway in osteosarcoma. PMID:28983587
Effects of BMI, Fat Mass, and Lean Mass on Asthma in Childhood: A Mendelian Randomization Study
Granell, Raquel; Henderson, A. John; Evans, David M.; Smith, George Davey; Ness, Andrew R.; Lewis, Sarah; Palmer, Tom M.; Sterne, Jonathan A. C.
2014-01-01
Background Observational studies have reported associations between body mass index (BMI) and asthma, but confounding and reverse causality remain plausible explanations. We aim to investigate evidence for a causal effect of BMI on asthma using a Mendelian randomization approach. Methods and Findings We used Mendelian randomization to investigate causal effects of BMI, fat mass, and lean mass on current asthma at age 7½ y in the Avon Longitudinal Study of Parents and Children (ALSPAC). A weighted allele score based on 32 independent BMI-related single nucleotide polymorphisms (SNPs) was derived from external data, and associations with BMI, fat mass, lean mass, and asthma were estimated. We derived instrumental variable (IV) estimates of causal risk ratios (RRs). 4,835 children had available data on BMI-associated SNPs, asthma, and BMI. The weighted allele score was strongly associated with BMI, fat mass, and lean mass (all p-valuesBMI on asthma was 1.55 (95% CI 1.16–2.07) per kg/m2, p = 0.003. This effect appeared stronger for non-atopic (1.90, 95% CI 1.19–3.03) than for atopic asthma (1.37, 95% CI 0.89–2.11) though there was little evidence of heterogeneity (p = 0.31). The estimated causal RRs for the effects of fat mass and lean mass on asthma were 1.41 (95% CI 1.11–1.79) per 0.5 kg and 2.25 (95% CI 1.23–4.11) per kg, respectively. The possibility of genetic pleiotropy could not be discounted completely; however, additional IV analyses using FTO variant rs1558902 and the other BMI-related SNPs separately provided similar causal effects with wider confidence intervals. Loss of follow-up was unlikely to bias the estimated effects. Conclusions Higher BMI increases the risk of asthma in mid-childhood. Higher BMI may have contributed to the increase in asthma risk toward the end of the 20th century. Please see later in the article for the Editors' Summary PMID:24983943
Wang, Yangming; Sugita, Noriko; Yoshihara, Akihiro; Iwasaki, Masanori; Miyazaki, Hideo; Nakamura, Kazutoshi; Yoshie, Hiromasa
2016-03-01
Several studies have reported inconsistent results regarding the association between the PPARγPro12Ala polymorphism and obesity. Obese individuals had higher C-reactive protein (CRP) levels compared with those of normal weight, and PPARγ activation could significantly reduce serum high-sensitive CRP level. We have previously suggested that the Pro12Ala polymorphism represents a susceptibility factor for periodontitis, which is a known risk factor for increased CRP level. The aim was to investigate associations between PPARγ gene polymorphism, serum CRP level, BMI and/or periodontitis among post-menopausal Japanese women. The final sample in this study comprised 359 post-menopausal Japanese women. Periodontal parameters, including PD, CAL and BOP, were measured per tooth. PPARγPro12Ala genotype was determined by PCR-RFLP. Hs-CRP value was measured by a latex nephelometry assay. No significant differences in age, BMI or periodontal parameters were found between the genotypes. The percentages of sites with PD ≥ 4 mm were significantly higher among the hsCRP ≥ 1 mg/l group than the hsCRP periodontitis, serum CRP level or BMI in post-menopausal Japanese women. However, serum hsCRP level correlated with periodontitis in Ala allele carriers, and with BMI in non-carriers. © 2014 John Wiley & Sons A/S and The Gerodontology Society. Published by John Wiley & Sons Ltd.
Rakusa, Matej; Jensterle, Mojca; Božič-Mijovski, Mojca; Janez, Andrej
2017-05-01
Overall hemostatic potential (OHP) captures all factors that affect coagulation and fibrinolysis cascade. It has not yet been assessed in polycystic ovary syndrome (PCOS). The aim of the study was to identify the relationship of OHP with a syndrome per se and body mass index (BMI). In 90 women with PCOS aged 30.9 ± 8.1 years (50 obese, 13 overweight, and 27 lean) and 21 healthy age-matched controls (11 obese and 10 lean), OHP with overall coagulation potential (OCP) and overall fibrinolytic potential (OFP) was determined spectrophotometrically. OFP was calculated. OHP increased with BMI in PCOS (9.6 ± 2.3 in lean, 12.5 ± 5.1 in overweight, and 15.5 ± 3.8 Abs-sum in obese) and in controls (9.1 ± 1.0 in lean and 17.3 ± 4.6 Abs-sum in obese). There was significant difference between lean and obese PCOS (P PCOS (P PCOS (P PCOS did not differ significantly, while OHP for healthy obese was increased in comparison to overweight and lean PCOS (P PCOS was not associated with increased OHP compared with BMI and age-matched controls. However, increase in OHP was positively associated with BMI in PCOS and healthy women.
To Assess the Effect of Maternal BMI on Obstetrical Outcome
Lakhanpal, Shuchi; Aggarwal, Asha; Kaur, Gurcharan
2012-06-01
AIMS: To assess the effect of maternal BMI on complications in pregnancy, mode of delivery, complications of labour and delivery.METHODS:A crossectional study was carried out in the Obst and Gynae department, Kasturba Hospital, Delhi. The study enrolled 100 pregnant women. They were divided into 2 groups based on their BMI, more than or equal to 30.0 kg/m2 were categorized as obese and less than 30 kg/m2 as non obese respectively. Maternal complications in both types of patients were studied.RESULTS:CONCLUSION: As the obstetrical outcome is significantly altered due to obesity, we can improve maternal outcome by overcoming obesity. As obesity is a modifiable risk factor, preconception counseling creating awareness regarding health risk associated with obesity should be encouraged and obstetrical complications reduced.
Inter-individual inequality in BMI: An analysis of Indonesian Family Life Surveys (1993–2007
Directory of Open Access Journals (Sweden)
Masoud Vaezghasemi
2016-12-01
Full Text Available Widening inequalities in mean Body Mass Index (BMI between social and economic groups are well documented. However, whether changes in mean BMI are followed by changes in dispersion (or variance and whether these inequalities are also occurring within social groups or across individuals remain understudied. In addition, a substantial body of literature exists on the global increase in mean BMI and prevalence of overweight and obesity. However, whether this weight gain is shared proportionately across the whole spectrum of BMI distribution, also remains understudied. We examined changes in the distribution of BMI at the population level over time to understand how changes in the dispersion reflect between-group compared to within-group inequalities in weight gain. Moreover, we investigated the entire distribution of BMI to determine in which percentiles the most weight gain is occurring over time. Utilizing four waves (from 1993 to 2007 of Indonesian Family Life Surveys (IFLS, we estimated changes in the mean and the variance of BMI over time and across various socioeconomic groups based on education and households’ expenditure per capita in 53,648 men and women aged 20–50 years. An increase in mean and standard deviation was observed among men (by 4.3% and 25%, respectively and women (by 7.3% and 20%, respectively over time. Quantile-Quantile plots showed that higher percentiles had greater increases in BMI compared to the segment of the population at lower percentiles. While between socioeconomic group differences decreased over time, within-group differences increased and were more prominent among individuals with poor education and lower per capita expenditures. Population changes in BMI cannot be fully described by average trends or single parameters such as the mean BMI. Moreover, greater increases in within-group dispersion compared with between-group differences imply that growing inequalities are not merely driven by these
Directory of Open Access Journals (Sweden)
Pilato Valentina
2011-07-01
Full Text Available Abstract Background Parents are responsible not only for the genetic structure of their children, but also for passing onto them their behaviours and attitudes toward life. The aim of this study was to analyse the connection between school-age children's obesity and that of their parents as well as between child obesity and parents' educational level, as a proxy indicator of the socio-economic status (SES of families in Tuscany. Methods The children sample was selected from "OKkio alla Salute 2010" (a cross sectional survey carried out by the Italian Institute of Health and consisted of 1,751 (922 males and 855 females 8-9 year-old school children. Weight and height were measured by ad hoc trained personnel, and Body Mass Index (BMI categories were calculated using Cole et al.'s cut-off. Parents' weight, height and educational level were collected by a self-administered questionnaire. The educational levels were classified as high, medium and low. Results The prevalence of obese children increased along the parents' BMI category: from 1.4% for underweight mothers to 30.3% for obese mothers and from 4% for under-normal-weight fathers to 23.9% for obese fathers (p Conclusion Parents' obesity and the cultural resources of the family, particularly the father's, seem to influence the prevalence of overweight and obesity in Tuscan children.
Prescott, Hallie C; Chang, Virginia W
2018-02-06
Obesity has been associated with improved short-term mortality following common acute illness, but its relationship with longer-term mortality is unknown. Observational study of U.S. Health and Retirement Study (HRS) participants with federal health insurance (fee-for-service Medicare) coverage, hospitalized with congestive heart failure (N = 4287), pneumonia (N = 4182), or acute myocardial infarction (N = 2001), 1996-2012. Using cox proportional hazards models, we examined the association between overweight or obese BMI (BMI ≥ 25.0 kg/m 2 ) and mortality to 5 years after hospital admission, adjusted for potential confounders measured at the same time as BMI, including age, race, sex, education, partnership status, income, wealth, and smoking status. Body mass index (BMI) was calculated from self-reported height and weight collected at the HRS survey prior to hospitalization (a median 1.1 year prior to hospitalization). The referent group was patients with a normal BMI (18.5 to BMI was associated with lower mortality at 1 year after hospitalization for congestive heart failure, pneumonia, and acute myocardial infarction-with adjusted hazard ratios of 0.68 (95% CI 0.59-0.79), 0.74 (95% CI: 0.64-0.84), and 0.65 (95%CI: 0.53-0.80), respectively. Among participants who lived to one year, however, subsequent survival was similar between patients with normal versus overweight/obese BMI. In older Americans, overweight or obese BMI was associated with improved survival following hospitalization for congestive heart failure, pneumonia, and acute myocardial infarction. This association, however, is limited to the shorter-term. Conditional on surviving to one year, we did not observe a survival advantage associated with excess weight.
Modeling Late-Onset Sporadic Alzheimer’s Disease through BMI1 Deficiency
Directory of Open Access Journals (Sweden)
Anthony Flamier
2018-05-01
Full Text Available Late-onset sporadic Alzheimer’s disease (AD is the most prevalent form of dementia, but its origin remains poorly understood. The Bmi1/Ring1 protein complex maintains transcriptional repression of developmental genes through histone H2A mono-ubiquitination, and Bmi1 deficiency in mice results in growth retardation, progeria, and neurodegeneration. Here, we demonstrate that BMI1 is silenced in AD brains, but not in those with early-onset familial AD, frontotemporal dementia, or Lewy body dementia. BMI1 expression was also reduced in cortical neurons from AD patient-derived induced pluripotent stem cells but not in neurons overexpressing mutant APP and PSEN1. BMI1 knockout in human post-mitotic neurons resulted in amyloid beta peptide secretion and deposition, p-Tau accumulation, and neurodegeneration. Mechanistically, BMI1 was required to repress microtubule associated protein tau (MAPT transcription and prevent GSK3beta and p53 stabilization, which otherwise resulted in neurodegeneration. Restoration of BMI1 activity through genetic or pharmaceutical approaches could represent a therapeutic strategy against AD.
BMI1 and Mel-18 oppositely regulate carcinogenesis and progression of gastric cancer.
Zhang, Xiao-Wei; Sheng, Ya-Ping; Li, Qian; Qin, Wei; Lu, You-Wei; Cheng, Yu-Fan; Liu, Bing-Ya; Zhang, Feng-Chun; Li, Jin; Dimri, Goberdhan P; Guo, Wei-Jian
2010-02-21
The BMI1 oncogene is overexpressed in several human malignancies including gastric cancer. In addition to BMI1, mammalian cells also express Mel-18, which is closely related to BMI1. We have reported that Mel-18 functions as a potential tumor suppressor by repressing the expression of BMI1 and consequent downregulation of activated AKT in breast cancer cells. However, the mechanisms of BMI1 overexpression and the role of Mel-18 in other cancers are still not clear. The purpose of this study is to investigate the role of BMI1 and Mel-18 in gastric cancer. BMI1 was found to be overexpressed in gastric cancer cell lines and gastric tumors. Overexpression of BMI1 correlated with advanced clinical stage and lymph node metastasis; while the expression of Mel-18 negatively correlated with BMI1. BMI1 but not Mel-18 was found to be an independent prognostic factor. Downregulation of BMI1 by Mel-18 overexpression or knockdown of BMI1 expression in gastric cancer cell lines led to upregulation of p16 (p16INK4a or CDKN2A) in p16 positive cell lines and reduction of phospho-AKT in both p16-positive and p16-negative cell lines. Downregulation of BMI1 was also accompanied by decreased transformed phenotype and migration in both p16- positive and p16-negative gastric cancer cell lines. In the context of gastric cancer, BMI1 acts as an oncogene and Mel-18 functions as a tumor suppressor via downregulation of BMI1. Mel-18 and BMI1 may regulate tumorigenesis, cell migration and cancer metastasis via both p16- and AKT-dependent growth regulatory pathways.
International Nuclear Information System (INIS)
Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang
2017-01-01
The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 −/− ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN.
Directory of Open Access Journals (Sweden)
Vinay K Gupta
2016-06-01
Full Text Available Objective: The aim of the study is to assess the trend in mean BMI z-score among private schools’ students from their anthropometric records when there were missing values in the outcome. Methodology: The anthropometric measurements of student from class 1 to 12 were taken from the records of two private schools in Delhi, India from 2005 to 2010. These records comprise of an unbalanced longitudinal data that is not all the students had measurements recorded at each year. The trend in mean BMI z-score was estimated through growth curve model. Prior to that, missing values of BMI z-score were imputed through multiple imputation using the same model. A complete case analysis was also performed after excluding missing values to compare the results with those obtained from analysis of multiply imputed data. Results: The mean BMI z-score among school student significantly decreased over time in imputed data (β= -0.2030, se=0.0889, p=0.0232 after adjusting age, gender, class and school. Complete case analysis also shows a decrease in mean BMI z-score though it was not statistically significant (β= -0.2861, se=0.0987, p=0.065. Conclusions: The estimates obtained from multiple imputation analysis were better than those of complete data after excluding missing values in terms of lower standard errors. We showed that anthropometric measurements from schools records can be used to monitor the weight status of children and adolescents and multiple imputation using growth curve model can be useful while analyzing such data
Trajectories of BMI change impact glucose and insulin metabolism.
Walsh, E I; Shaw, J; Cherbuin, N
2018-03-01
The aim of this study was to examine, in a community setting, whether trajectory of weight change over twelve years is associated with glucose and insulin metabolism at twelve years. Participants were 532 community-living middle-aged and elderly adults from the Personality and Total Health (PATH) Through Life study. They spanned the full weight range (underweight/normal/overweight/obese). Latent class analysis and multivariate generalised linear models were used to investigate the association of Body Mass Index (BMI, kg/m 2 ) trajectory over twelve years with plasma insulin (μlU/ml), plasma glucose (mmol/L), and HOMA2 insulin resistance and beta cell function at follow-up. All models were adjusted for age, gender, hypertension, pre-clinical diabetes status (normal fasting glucose or impaired fasting glucose) and physical activity. Four weight trajectories were extracted; constant normal (mean baseline BMI = 25; follow-up BMI = 25), constant high (mean baseline BMI = 36; follow-up BMI = 37), increase (mean baseline BMI = 26; follow-up BMI = 32) and decrease (mean baseline BMI = 34; follow-up BMI = 28). At any given current BMI, individuals in the constant high and increase trajectories had significantly higher plasma insulin, greater insulin resistance, and higher beta cell function than those in the constant normal trajectory. Individuals in the decrease trajectory did not differ from the constant normal trajectory. Current BMI significantly interacted with preceding BMI trajectory in its association with plasma insulin, insulin resistance, and beta cell function. The trajectory of preceding weight has an independent effect on blood glucose metabolism beyond body weight measured at any given point in time. Copyright © 2017 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier
Ketterl, Tyler G; Dundas, Nicolas J; Roncaioli, Steven A; Littman, Alyson J; Phipps, Amanda I
2018-03-06
Background Maternal overweight and obesity is one of the most common high-risk obstetric conditions associated with adverse birth outcomes. Smaller studies have suggested that pre-pregnancy body mass index (BMI) is associated with postpartum weight retention. Objective The primary objective of this study was to examine the association between pre-pregnancy BMI status and maternal weight retention. Study design We conducted a population-based retrospective cohort study using Washington State birth certificate data from 2003-2013. We included women who had two sequential births during this time period, with the second birth occurring within 18-36 months of the first singleton delivery date. BMI before a women's first pregnancy ("pre-pregnancy BMI") was categorized as normal (18.5-24.9 kg/m 2 ) and overweight/obese (25-40 kg/m 2 ). Women were classified as having returned to first pre-pregnancy BMI if their BMI before their second pregnancy was no more than 1 kg/m 2 more compared to their BMI before their first pregnancy. Analyses were stratified by gestational weight gain during the first pregnancy (below, met, exceeded recommended gestational weight gain). Results A total of 49,132 mothers were included in the study. Among women who met their recommended gestational weight gain, compared to mothers with a normal BMI, obese/overweight mothers were less likely to return to their pre-pregnancy BMI (76.5 vs 72.3%; RR Obese/Overweight = 0.88; 95% CI: 0.85-0.92). A similar pattern was observed among women who exceeded their recommended gestational weight gain (62.6 vs 53.2%; RR Obese/Overweight = 0.79, 95% CI: 0.78-0.80). Conclusion Pre-pregnancy BMI in the overweight/obese range is associated with a decreased likelihood of returning to pre-pregnancy BMI. Further research to support women during and after their pregnancy to promote behavior changes that prevent excessive weight gain during pregnancy and weight retention after birth is needed.
Liao, Qiuju; Zheng, Zheng; Xiu, Shuangling; Chan, Piu
2018-03-27
Obesity is found to be associated with frailty. Body mass index (BMI) and waist circumference (WC) are the commonly used measures for obesity, the former is more closely related to general obesity and body weight; the latter can more accurately reflect abdominal obesity and is more closely associated with metabolic disorders. In this study, we intend to study the relationship between frailty, BMI and WC among older people. Data were derived from the Beijing Longitudinal Study on Aging II Cohort, which included 6320 people 65 years or older from three urban districts in Beijing. A Frailty Index derived from 33 items was developed according to Rockwood's cumulative deficits method. A Frailty Index ≥ 0.25 was used as the cut-off criteria. BMI was classified as underweight, normal, overweight, or obese (BMI (≥ 28.0 kg/m 2 , 22.6%) or a larger WC (18.5%) were more likely to be frail. People with normal BMI and overweight people do not suffer from higher prevalence for frailty. In comparison with individuals with normal BMI (18.5-BMI and large WC (odds ratio 1.68; 95% CI 1.33-2.12), have overweight and large WC (odds ratio 1.58; 95% CI 1.23-1.96), or have obesity and large WC (odds ratio 2.28; 95% CI 1.79-2.89). In people with normal WC, only those who are underweight have a higher risk for frailty (odds ratio 1.65, 95% CI 1.08-2.52). In comparison with BMI, the relation of WC with the risk for frailty was much closer. Abdominal obesity is more closely associated with incidence of frailty than general obesity in the elderly. Older adults with large waist circumference are more likely to be frail. Frailty in the elderly might be more closely related to metabolic disorders. WC might be a better measurement to detect frailty than BMI, given its relationship with metabolic disorders.
Directory of Open Access Journals (Sweden)
Claudia Börnhorst
Full Text Available Starting from birth, this explorative study aimed to investigate between-country differences in body mass index (BMI trajectories and whether early life factors explain these differences.The sample included 7,644 children from seven European countries (Belgium, Cyprus, Germany, Hungary, Italy, Spain, Sweden participating in the multi-centre IDEFICS study. Information on early life factors and in total 53,409 repeated measurements of height and weight from 0 to <12 years of age were collected during the baseline (2007/2008 and follow-up examination (2009/2010 supplemented by records of routine child health visits. Country-specific BMI growth curves were estimated using fractional polynomial mixed effects models. Several covariates focussing on early life factors were added to the models to investigate their role in the between-countries differences.Large between-country differences were observed with Italian children showing significantly higher mean BMI values at all ages ≥ 3 years compared to the other countries. For instance, at age 11 years mean BMI values in Italian boys and girls were 22.3 [21.9;22.8; 99% confidence interval] and 22.0 [21.5;22.4], respectively, compared to a range of 18.4 [18.1;18.8] to 20.3 [19.8;20.7] in boys and 18.2 [17.8;18.6] to 20.3 [19.8;20.7] in girls in the other countries. After adjustment for early life factors, differences between country-specific BMI curves became smaller. Maternal BMI was the factor being most strongly associated with BMI growth (p<0.01 in all countries with associations increasing during childhood. Gestational weight gain (GWG was weakly associated with BMI at birth in all countries. In some countries, positive associations between BMI growth and children not being breastfed, mothers' smoking during pregnancy and low educational level of parents were found.Early life factors seem to explain only some of the inter-country variation in growth. Maternal BMI showed the strongest association
Schott, Timm Cornelius; Ludwig, Björn
2014-01-01
The relationship between unhealthy body mass index (BMI) and adherence to orthodontic treatment with removable appliances has not previously been evaluated. The aim of this study was to quantify the association between BMI and wear time of removable orthodontic appliances and to evaluate BMI changes during orthodontic treatment. Fifty-three normal-weight and 39 overweight/obese children and adolescents (7-15 years old) undergoing orthodontic treatment with removable appliances were enrolled into the study. BMI categories were determined using standardized age-specific and sex-specific BMI criteria, using data measured at the beginning of therapy and once during orthodontic treatment. Wear times of removable appliances were measured at 15-minute intervals over a period of 5 months using implanted microelectronic sensors. Median wear-time values were used in the analysis with the Mann-Whitney U-test used to test statistical differences between groups. The median wear time of removable orthodontic appliances was 9.3 hours for normal-weight patients and 9.2 hours for overweight/obese patients. No statistically significant (P>0.05) or clinically relevant differences in usage or adherence were detected between normal-weight and overweight/obese patients. BMI did not influence wear time or behavior of removable orthodontic appliances by young patients. The majority of patients showed qualitative decreases in BMI during therapy. The orthodontic treatment of young patients with removable devices does not require BMI-dependent changes in the treatment strategy. However, the use of removable appliances during meal times raises the possibility of reducing food intake, and in this way the orthodontist may have an active role to play in weight reduction.
Miranda-Ríos, L Lizette; Vásquez-Garibay, Edgar M; Romero-Velarde, Enrique; Nuño-Cosío, M Eugenia; Campos-Barrera, Liliana R
2015-12-01
to identify the association between the percentage of adequacy of energy and protein and the distribution of macronutrients and sugar in the diets of mothers and schoolchildren with their respective BMI. in a cross-sectional study, 174 5-12-year-old schoolchildren and their mothers were randomly selected. BMI was measured, and 24-hour dietary surveys were administered on weekdays and weekends. The associations between the dietetic indicators in the mothers and their children and the BMI of the mothers and their children were assessed. The chi-square test, linear regression and odds ratio were used for analysis. excessive energy consumption in the mothers increased the risk of excessive energy consumption in their daughters by 11-fold (p=0.04). Maternal lipid intake was associated with the consumption of lipids in their sons and daughters (p. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.
2016-10-01
we discovered that BMI1 directly binds to Androgen Receptor and prevents it from MDM2-mediated protein degradation. We further demonstrated that...lysates. As shown in Fig. 1B, IP with anti-BMI1 pulled down full-length and AR-NTD, but not AR-DBD or AR-LBD. On the other hand , pulldown with Halo...harvested at the indicated time points and immunoblot analysis with anti-AR and anti-β-actin antibodies on the same membrane ( left panel). Density of
Gene-diet interaction effects on BMI levels in the Singapore Chinese population.
Chang, Xuling; Dorajoo, Rajkumar; Sun, Ye; Han, Yi; Wang, Ling; Khor, Chiea-Chuen; Sim, Xueling; Tai, E-Shyong; Liu, Jianjun; Yuan, Jian-Min; Koh, Woon-Puay; van Dam, Rob M; Friedlander, Yechiel; Heng, Chew-Kiat
2018-02-24
Recent genome-wide association studies (GWAS) have identified 97 body-mass index (BMI) associated loci. We aimed to evaluate if dietary intake modifies BMI associations at these loci in the Singapore Chinese population. We utilized GWAS information from six data subsets from two adult Chinese population (N = 7817). Seventy-eight genotyped or imputed index BMI single nucleotide polymorphisms (SNPs) that passed quality control procedures were available in all datasets. Alternative Healthy Eating Index (AHEI)-2010 score and ten nutrient variables were evaluated. Linear regression analyses between z score transformed BMI (Z-BMI) and dietary factors were performed. Interaction analyses were performed by introducing the interaction term (diet x SNP) in the same regression model. Analysis was carried out in each cohort individually and subsequently meta-analyzed using the inverse-variance weighted method. Analyses were also evaluated with a weighted gene-risk score (wGRS) contructed by BMI index SNPs from recent large-scale GWAS studies. Nominal associations between Z-BMI and AHEI-2010 and some dietary factors were identified (P = 0.047-0.010). The BMI wGRS was robustly associated with Z-BMI (P = 1.55 × 10 - 15 ) but not with any dietary variables. Dietary variables did not significantly interact with the wGRS to modify BMI associations. When interaction analyses were repeated using individual SNPs, a significant association between cholesterol intake and rs4740619 (CCDC171) was identified (β = 0.077, adjP interaction = 0.043). The CCDC171 gene locus may interact with cholesterol intake to increase BMI in the Singaporean Chinese population, however most known obesity risk loci were not associated with dietary intake and did not interact with diet to modify BMI levels.
Kawachi, Asuka; Shimazu, Taichi; Budhathoki, Sanjeev; Sawada, Norie; Yamaji, Taiki; Iwasaki, Motoki; Inoue, Manami; Tsugane, Shoichiro
2018-04-18
Evidence on the association between BMI, height, and endometrial cancer risk, including by subtypes, among Asian populations remains limited. We evaluated the impact of BMI and height on the risk of endometrial cancer, overall and by histological subtype. We prospectively investigated 53 651 Japanese women aged 40-69 years. With an average follow-up duration of 18.6 years, 180 newly diagnosed endometrial cancers were reported, including 119 type 1 and 21 type 2. The association between BMI, height, and endometrial cancer risk was assessed using a Cox proportional hazards regression model with adjustment for potential confounders. Overweight and obesity were associated positively with the risk of endometrial cancer. Compared with BMI of 23.0-24.9 kg/m, hazard ratios (HRs) (95% confidence intervals) were 1.93 (1.17-3.16) for BMI of 27.0-29.9 kg/m and 2.37 (1.20-4.66) for BMI of at least 30.0 kg/m. On analysis by histological subtype, with each increase in BMI of 5 U, the estimated HR of type 1 endometrial cancer increased (HR=1.54, 95% confidence interval: 1.21-1.98), but HR of type 2 endometrial cancer was unaffected. There was no statistically significant association between height and endometrial cancer risk. In conclusion, the risk of endometrial cancer was elevated in women with a BMI of at least 27.0 kg/m. By histological subtype, BMI was associated with type 1, but not type 2 endometrial cancer risk among a population with a relatively low BMI compared with western populations.
Jingya, Bai; Ye, He; Jing, Wang; Xi, Huanjiu; Tao, Hai
2013-01-01
Objectives. To fully analyze and compare BMI among Han, Tibetan, and Uygur university students, to discuss the differences in their physical properties and physical health, and thus to provide some theoretical suggestions for the improvement of students’ physical health. Methods. The cross-sectional random cluster sampling was used to investigate 10103 Han, Tibetan, and Uygur university students, aged 20–24 in Northwest China, and their height and weight were measured to calculate BMI. The BM...
Relationship between BMI and blood pressure in girls and boys.
Gundogdu, Zuhal
2008-10-01
To investigate the relationship between BMI and blood pressure as this is of crucial interest in evaluating both public health and the clinical impact of the so-called obesity epidemic. Data were gathered from 1899 children aged between 6 and 14 years, analysing and evaluating a possible relationship between BMI and systolic and diastolic blood pressure values for both girls and boys. Each child was classified on the basis of age- and sex-specific BMI percentile as normal weight (<85th percentile), overweight (95th percentile). In comparisons among age BMI percentile groups, systolic and diastolic blood pressure values were higher in obese and overweight groups than in normal weight groups for both sexes. Although BMI among girls was higher than among boys in all three percentile groups, there were no significant differences between sexes with respect to blood pressure values. The present findings emphasize the importance of the prevention of obesity in order to prevent future related problems such as hypertension in children and adolescents.
Lower Bmi-1 Expression May Predict Longer Survival of Colon Cancer Patients
Directory of Open Access Journals (Sweden)
Xiaodong Li
2016-11-01
Full Text Available Background: This study aimed to investigate the Bmi-1 expression and the clinical significance in colon cancer (CC. Patients and Methods: Bmi-1 expression in tumor tissue and the corresponding normal tissue was detected using immunohistological staining. The correlations between Bmi-1 expression and clinicopathological characteristics and the overall survival (OS time were analyzed. Results: The median H-scores of Bmi-1 in CC tissues and the corresponding tissues were 80.0 (0-270 and 5.0 (0-90, with no statistically significant difference (Z=-13.7, PP = 0.123. The survival rates of patients with low Bmi-1 expression were higher than those of patients with high Bmi-1 expression but the differences were not statistically significant. Conclusion: Bmi-1 expression in CC tissue is significantly higher than that in corresponding normal tissue. While there may be a trend towards improved survival, this is not statistically significant.
Laxy, M; Teuner, C; Holle, R; Kurz, C
2018-03-01
Obesity is a major public health problem. Detailed knowledge about the relationship between body mass index (BMI) and health-related quality of life (HRQL) is important for deriving effective and cost-effective prevention and weight management strategies. This study aims to describe the sex-, age- and ethnicity-specific association between BMI and HRQL in the US adult population. Analyses are based on pooled cross-sectional data from 41 459 participants of the Medical Expenditure Panel Survey (MEPS) Household Component (HC) for the years 2000-2003. BMI was calculated using self-reported height and weight, and HRQL was assessed with the EuroQol five-dimensional questionnaire. Generalized additive models were fitted with a smooth function for BMI and a smooth-factor interaction for BMI with sex adjusted for age, ethnicity, poverty, smoking and physical activity. Models were further stratified by age and ethnicity. The association between BMI and HRQL is inverse U-shaped with a HRQL high point at a BMI of 22 kg m -2 in women and a HRQL high plateau at BMI values of 22-30 kg m -2 in men. Men aged 50 years and older with a BMI of 29 kg m -2 reported on average five-point higher visual analog scale (VAS) scores than peers with a BMI of 20 kg m -2 . The inverse U-shaped association is more pronounced in older people, and the BMI-HRQL relationship differs between ethnicities. In Hispanics, the BMI associated with the highest HRQL is higher than in white people and, in black women, the BMI-HRQL association has an almost linear negative slope. The results show that a more differentiated use of BMI cutoffs in scientific discussions and daily practice is indicated. The findings should be considered in the design of future weight loss and weight management programs.
Directory of Open Access Journals (Sweden)
Maria Adesilda Silva Pestana
2016-06-01
Full Text Available Recent studies have shown that the elderly exhibit a subclinical state of inflammation associated with increased adipose tissue and several comorbidities. To compare the effects of mat Pilates based exercises and resistance exercise on the serum levels of reactive C protein of high sensitivity (hs-CRP, in the abdominal circumference (AC and the body mass index (BMI in the elderly. It is a randomised clinical trial with a sample of 78 elderly individuals (median age 69 years. The active independent variable investigated was nature of treatment intervention (Pilates mat based exercises vs resistance exercise, and the dependent variables were hs-CRP level, AC and BMI. The statistical analysis used Wilcoxon signed rank and Mann-Whitney tests. The correlation between the continuous variables was assessed using Spearman’s coefficient of correlation. The data were analysed using SPSS software version 17.0, and probability values lower than 5% (p< 0.05 were considered statistically significant. Mat Pilates based exercises exhibited reductions in serum hs-CPR level (Wilcoxon signed rank test; z = -2.466, p = 0.01, BMI (Wilcoxon signed rank test; z = -3.295, p = 0.001 and AC (Wilcoxon signed rank test; z = -3.398, p = 0.01. Mat Pilates based exercises promoted a significant reduction of the serum hs-CRP levels and anthropometric measurements in elderly individuals.
Association of BMI with risk of CVD mortality and all-cause mortality.
Kee, Chee Cheong; Sumarni, Mohd Ghazali; Lim, Kuang Hock; Selvarajah, Sharmini; Haniff, Jamaiyah; Tee, Guat Hiong Helen; Gurpreet, Kaur; Faudzi, Yusoff Ahmad; Amal, Nasir Mustafa
2017-05-01
To determine the relationship between BMI and risk of CVD mortality and all-cause mortality among Malaysian adults. Population-based, retrospective cohort study. Participants were followed up for 5 years from 2006 to 2010. Mortality data were obtained via record linkages with the Malaysian National Registration Department. Multiple Cox regression was applied to compare risk of CVD and all-cause mortality between BMI categories adjusting for age, gender and ethnicity. Models were generated for all participants, all participants the first 2 years of follow-up, healthy participants, healthy never smokers, never smokers, current smokers and former smokers. All fourteen states in Malaysia. Malaysian adults (n 32 839) aged 18 years or above from the third National Health and Morbidity Survey. Total follow-up time was 153 814 person-years with 1035 deaths from all causes and 225 deaths from CVD. Underweight (BMIBMI ≥30·0 kg/m2) was associated with a heightened risk of CVD mortality. Overweight (BMI=25·0-29·9 kg/m2) was inversely associated with risk of all-cause mortality. Underweight was significantly associated with all-cause mortality in all models except for current smokers. Overweight was inversely associated with all-cause mortality in all participants. Although a positive trend was observed between BMI and CVD mortality in all participants, a significant association was observed only for severe obesity (BMI≥35·0 kg/m2). Underweight was associated with increased risk of all-cause mortality and obesity with increased risk of CVD mortality. Therefore, maintaining a normal BMI through leading an active lifestyle and healthy dietary habits should continue to be promoted.
C. Monnereau; S. Vogelezang; C.J. Kruithof (Claudia); V.W.V. Jaddoe (Vincent); J.F. Felix (Janine)
2016-01-01
textabstractBackground: Results from genome-wide association studies (GWAS) identified many loci and biological pathways that influence adult body mass index (BMI). We aimed to identify if biological pathways related to adult BMI also affect infant growth and childhood adiposity measures. Methods:
Directory of Open Access Journals (Sweden)
Mayr Andreas
2012-01-01
Full Text Available Abstract Background The construction of prediction intervals (PIs for future body mass index (BMI values of individual children based on a recent German birth cohort study with n = 2007 children is problematic for standard parametric approaches, as the BMI distribution in childhood is typically skewed depending on age. Methods We avoid distributional assumptions by directly modelling the borders of PIs by additive quantile regression, estimated by boosting. We point out the concept of conditional coverage to prove the accuracy of PIs. As conditional coverage can hardly be evaluated in practical applications, we conduct a simulation study before fitting child- and covariate-specific PIs for future BMI values and BMI patterns for the present data. Results The results of our simulation study suggest that PIs fitted by quantile boosting cover future observations with the predefined coverage probability and outperform the benchmark approach. For the prediction of future BMI values, quantile boosting automatically selects informative covariates and adapts to the age-specific skewness of the BMI distribution. The lengths of the estimated PIs are child-specific and increase, as expected, with the age of the child. Conclusions Quantile boosting is a promising approach to construct PIs with correct conditional coverage in a non-parametric way. It is in particular suitable for the prediction of BMI patterns depending on covariates, since it provides an interpretable predictor structure, inherent variable selection properties and can even account for longitudinal data structures.
Joint Effects of Physical Activity and BMI on Risk of Hypertension in Women: A Longitudinal Study
Directory of Open Access Journals (Sweden)
Caroline Jackson
2014-01-01
Full Text Available Introduction. There is debate as to whether physical activity counteracts the adverse effect of weight on health outcomes. We investigated how physical activity modifies the effect of body mass index (BMI on hypertension risk. Methods. BMI, physical activity, and hypertension were measured at baseline and at three-year interval for 14 years (from 1996 to 2010, in 10,339 participants in the Australian Longitudinal Study on Women’s Health. Generalised estimating equation models for binary repeated measures were performed to determine the individual and joint effects of BMI and physical activity on incident hypertension. Results. At baseline (mean age 47.6±1.5 SD, 57% were healthy weight, 28% overweight, and 14% obese. Increasing BMI and decreasing physical activity were associated with increased risk of hypertension. Physical activity attenuated the positive association between weight and risk of hypertension, especially for obese women. Compared to healthy weight high active women, risk of hypertension in obese high active women was 3.4 times greater (OR 3.43, 95% CI 2.68, 4.39 and in obese inactive women 4.9 times greater (OR 4.91, 95% CI 3.92, 6.13. Conclusions. Both physical activity and maintenance of a healthy body weight are associated with lower risk of hypertension. Physical activity reduced but did not remove the effect of obesity on hypertension risk.
Prognostic relevance of Bmi-1 expression and autoantibodies in esophageal squamous cell carcinoma
International Nuclear Information System (INIS)
Liu, Wan-li; Li, Man-zhi; Song, Li-bing; Zeng, Mu-sheng; Guo, Xian-zhi; Zhang, Lan-jun; Wang, Jun-ye; Zhang, Ge; Guan, Su; Chen, Yu-min; Kong, Qing-li; Xu, Li-hua
2010-01-01
Overexpression of Bmi-1 has been observed in a variety of cancers, and it has been suggested to be an independent prognostic marker for the patients. The objective of this study was to determine the level of Bmi-1 expression or its autoantibodies in human esophageal squamous cell carcinoma (ESCC) and to correlate it with clinicopathologic data. We first examined Bmi-1 expression in ESCC cell lines and tumor samples by RT-PCR and Western blot analysis. We then analyzed Bmi-1 protein expression in 171 clinicopathologically characterized ESCC cases by immunohistochemistry. In addition, we detected its autoantibodies in sera of patients with ESCC by ELISA. We found that Bmi-1 expression was higher in the immortalized cells, cancer cell lines and most cancer tissue than in non-tumorous control tissue at both mRNA and protein level. In addition, Bmi-1 expression was observed in 64.3% (110 of 171) archive ESCC specimen by immunohistochemistry analysis, and the location of Bmi-1 in ESCC was in the nuclei instead of cytoplasm of tumor cells. There was a significant difference of Bmi-1 expression in patients categorized according to stage (P = 0.003) and pN classification (P = 0.047). Multivariate analysis suggested that Bmi-1 expression was an independent prognostic marker for ESCC patients. A prognostic significance of Bmi-1 was also found in the subgroup of T3~T4 and N1 tumor classification. Bmi-1 autoantibodies were detected in sera of 39.0% (62 of 159) ESCC patients. The correlations between anti-Bmi-1 antibodies and tumor stage (P = 0.040), or lymph node status (P < 0.001) were significant. Our results suggest that Bmi-1 protein is a valuable marker of ESCC progression. The presence of Bmi-1 autoantibodies in sera from patients with ESCC may have clinical utility in esophageal cancer diagnosis
Dinner rituals that correlate with child and adult BMI.
Wansink, Brian; van Kleef, Ellen
2014-05-01
What predicts whether a child will be at risk for obesity? Whereas past research has focused on foods, eating habits, feeding styles, and family meal patterns, this study departs from a food-centric approach to examine how various dinner rituals might influence the BMIs of children and adults. In this study of 190 parents (BMI = 29.1 ± 7.2) and 148 children (BMI = 20.3 ± 4.4), the relationship between their BMIs and everyday family dinner rituals was examined using both correlation and regression analysis (controlled for educational level of parents). Families who frequently ate dinner in the kitchen or dining room had significantly lower BMIs for both adults (r = -0.31) and children (r = -0.24) compared to families who ate elsewhere. Additionally, helping cook dinner was associated with higher BMI for girls (r = 0.26), and remaining at the table until everyone is finished with eating was associated with lower BMI for boys (r = -0.31). Dinner tables may be one place where social support and family involvement meet-both of which relate to the BMI of children as well as parents. Family meals and their rituals might be an underappreciated battleground to fight obesity. Copyright © 2013 The Obesity Society.
Blood Pressure Variation Throughout Pregnancy According to Early Gestational BMI: A Brazilian Cohort
Directory of Open Access Journals (Sweden)
Fernanda Rebelo
2015-04-01
Full Text Available Background: The maternal cardiovascular system undergoes progressive adaptations throughout pregnancy, causing blood pressure fluctuations. However, no consensus has been established on its normal variation in uncomplicated pregnancies. Objective: To describe the variation in systolic blood pressure (SBP and diastolic blood pressure (DBP levels during pregnancy according to early pregnancy body mass index (BMI. Methods: SBP and DBP were measured during the first, second and third trimesters and at 30-45 days postpartum in a prospective cohort of 189 women aged 20-40 years. BMI (kg/m2 was measured up to the 13th gestational week and classified as normal-weight (<25.0 or excessive weight (≥25.0. Longitudinal linear mixed-effects models were used for statistical analysis. Results: A decrease in SBP and DBP was observed from the first to the second trimester (βSBP=-0.394; 95%CI: -0.600- -0.188 and βDBP=-0.617; 95%CI: -0.780- -0.454, as was an increase in SBP and DBP up to 30-45 postpartum days (βSBP=0.010; 95%CI: 0.006-0.014 and βDBP=0.015; 95%CI: 0.012-0.018. Women with excessive weight at early pregnancy showed higher mean SBP in all gestational trimesters, and higher mean DBP in the first and third trimesters. Excessive early pregnancy BMI was positively associated with prospective changes in SBP (βSBP=7.055; 95%CI: 4.499-9.610 and in DBP (βDBP=3.201; 95%CI: 1.136-5.266. Conclusion: SBP and DBP decreased from the first to the second trimester and then increased up to the postpartum period. Women with excessive early pregnancy BMI had higher SBP and DBP than their normal-weight counterparts throughout pregnancy, but not in the postpartum period.
A comparison of chewing rate between overweight and normal BMI individuals.
White, Amy Kristin; Venn, Bernard; Lu, Louise Weiwei; Rush, Elaine; Gallo, Luigi Maria; Yong, Janet Lee Ching; Farella, Mauro
2015-06-01
Previous attempts to identify an 'obese eating style' have led to conflicting findings. This observational study compared the chewing features of overweight or obese young adults with those of normal range BMI. We hypothesised that chewing features are individual-specific and differ between participants of a normal BMI and high BMI. Fourteen overweight to obese participants (BMI≥25.0) were pairwise matched with 14 normal range BMI participants (18.5chewing episodes, including rate, duration, and power. Masticatory performance was assessed by a sieve test and was expressed as the percentage of particles ≤2mm after a standardised chewing test. Regardless of the meal, chewing rate was remarkably consistent among participants (ICC=0.89; 95% CI=0.79-0.94). Chewing rate did not differ between high and normal BMI participants (p>0.05), whereas chewing power was significantly higher in high BMI participants (pchewing characteristics were found between BMI groups. Participants chewed at similar rate in the natural environment (pizza) and in the laboratory (rice) setting (p>0.05). Masticatory performance did not differ significantly (p>0.05) between the high (55.9%) and normal (52.4%) BMI groups. Within the limitations of the present study, chewing characteristics appear to be individual-specific with wide variability. Overweight participants chew at a similar rate to control participants, albeit slightly stronger. Our preliminary findings need to be replicated in larger samples. Copyright © 2015. Published by Elsevier Inc.
Bmi1 confers resistance to oxidative stress on hematopoietic stem cells.
Directory of Open Access Journals (Sweden)
Shunsuke Nakamura
Full Text Available The polycomb-group (PcG proteins function as general regulators of stem cells. We previously reported that retrovirus-mediated overexpression of Bmi1, a gene encoding a core component of polycomb repressive complex (PRC 1, maintained self-renewing hematopoietic stem cells (HSCs during long-term culture. However, the effects of overexpression of Bmi1 on HSCs in vivo remained to be precisely addressed.In this study, we generated a mouse line where Bmi1 can be conditionally overexpressed under the control of the endogenous Rosa26 promoter in a hematopoietic cell-specific fashion (Tie2-Cre;R26Stop(FLBmi1. Although overexpression of Bmi1 did not significantly affect steady state hematopoiesis, it promoted expansion of functional HSCs during ex vivo culture and efficiently protected HSCs against loss of self-renewal capacity during serial transplantation. Overexpression of Bmi1 had no effect on DNA damage response triggered by ionizing radiation. In contrast, Tie2-Cre;R26Stop(FLBmi1 HSCs under oxidative stress maintained a multipotent state and generally tolerated oxidative stress better than the control. Unexpectedly, overexpression of Bmi1 had no impact on the level of intracellular reactive oxygen species (ROS.Our findings demonstrate that overexpression of Bmi1 confers resistance to stresses, particularly oxidative stress, onto HSCs. This thereby enhances their regenerative capacity and suggests that Bmi1 is located downstream of ROS signaling and negatively regulated by it.
He, Yao; Lam, Tai Hing; Jiang, Bin; Li, Lan Sun; Sun, Dong Ling; Wu, Lei; Liu, Miao; Yang, Shan Shan; Wang, Yi Yan; Tobias, Deirdre K; Sun, Qi; Hu, Frank B
2014-09-01
It is unclear whether changes in BMI during rapid economic development influence subsequent mortality. We analyzed whether BMI in 1976 and 1994 and changes in BMI during 1976-1994 predict cardiovascular disease (CVD) and all-cause mortality in a 35-year follow-up cohort of 1,696 Chinese (1,124 men and 572 women, aged 35-65 years) in Xi'an, China. Participants were categorized as underweight (economic development was associated with elevated risks of all-cause and CVD mortality. Higher BMI measured before economic development was associated with lower mortality risk, whereas BMI measured afterward was associated with increased mortality. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.
Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang
2017-01-22
The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 -/- ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN. Copyright © 2016 Elsevier Inc. All rights reserved.
Impact of baseline BMI and weight change in CCTG adjuvant breast cancer trials.
Yerushalmi, R; Dong, B; Chapman, J W; Goss, P E; Pollak, M N; Burnell, M J; Levine, M N; Bramwell, V H C; Pritchard, K I; Whelan, T J; Ingle, J N; Shepherd, L E; Parulekar, W R; Han, L; Ding, K; Gelmon, K A
2017-07-01
We hypothesized that increased baseline BMI and BMI change would negatively impact clinical outcomes with adjuvant breast cancer systemic therapy. Data from chemotherapy trials MA.5 and MA.21; endocrine therapy MA.12, MA.14 and MA.27; and trastuzumab HERA/MA.24 were analyzed. The primary objective was to examine the effect of BMI change on breast cancer-free interval (BCFI) landmarked at 5 years; secondary objectives included BMI changes at 1 and 3 years; BMI changes on disease-specific survival (DSS) and overall survival (OS); and effects of baseline BMI. Stratified analyses included trial therapy and composite trial stratification factors. In pre-/peri-/early post-menopausal chemotherapy trials (N = 2793), baseline BMI did not impact any endpoint and increased BMI from baseline did not significantly affect BCFI (P = 0.85) after 5 years although it was associated with worse BCFI (P = 0.03) and DSS (P = 0.07) after 1 year. BMI increase by 3 and 5 years was associated with better DSS (P = 0.01; 0.01) and OS (P = 0.003; 0.05). In pre-menopausal endocrine therapy trial MA.12 (N = 672), patients with higher baseline BMI had worse BCFI (P = 0.02) after 1 year, worse DSS (P = 0.05; 0.004) after 1 and 5 years and worse OS (P = 0.01) after 5 years. Increased BMI did not impact BCFI (P = 0.90) after 5 years, although it was associated with worse BCFI (P = 0.01) after 1 year. In post-menopausal endocrine therapy trials MA.14 and MA.27 (N = 8236), baseline BMI did not significantly impact outcome for any endpoint. BMI change did not impact BCFI or DSS after 1 or 3 years, although a mean increased BMI of 0.3 was associated with better OS (P = 0.02) after 1 year. With the administration of trastuzumab (N = 1395) baseline BMI and BMI change did not significantly impact outcomes. Higher baseline BMI and BMI increases negatively affected outcomes only in pre-/peri-/early post-menopausal trial patients. Otherwise, BMI
The relation between anxiety and BMI - is it all in our curves?
Haghighi, Mohammad; Jahangard, Leila; Ahmadpanah, Mohammad; Bajoghli, Hafez; Holsboer-Trachsler, Edith; Brand, Serge
2016-01-30
The relation between anxiety and excessive weight is unclear. The aims of the present study were three-fold: First, we examined the association between anxiety and Body Mass Index (BMI). Second, we examined this association separately for female and male participants. Next, we examined both linear and non-linear associations between anxiety and BMI. The BMI was assessed of 92 patients (mean age: M=27.52; 57% females) suffering from anxiety disorders. Patients completed the Beck Anxiety Inventory. Both linear and non-linear correlations were computed for the sample as a whole and separately by gender. No gender differences were observed in anxiety scores or BMI. No linear correlation between anxiety scores and BMI was observed. In contrast, a non-linear correlation showed an inverted U-shaped association, with lower anxiety scores both for lower and very high BMI indices, and higher anxiety scores for medium to high BMI indices. Separate computations revealed no differences between males and females. The pattern of results suggests that the association between BMI and anxiety is complex and more accurately captured with non-linear correlations. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Body size estimation of self and others in females varying in BMI.
Directory of Open Access Journals (Sweden)
Anne Thaler
Full Text Available Previous literature suggests that a disturbed ability to accurately identify own body size may contribute to overweight. Here, we investigated the influence of personal body size, indexed by body mass index (BMI, on body size estimation in a non-clinical population of females varying in BMI. We attempted to disentangle general biases in body size estimates and attitudinal influences by manipulating whether participants believed the body stimuli (personalized avatars with realistic weight variations represented their own body or that of another person. Our results show that the accuracy of own body size estimation is predicted by personal BMI, such that participants with lower BMI underestimated their body size and participants with higher BMI overestimated their body size. Further, participants with higher BMI were less likely to notice the same percentage of weight gain than participants with lower BMI. Importantly, these results were only apparent when participants were judging a virtual body that was their own identity (Experiment 1, but not when they estimated the size of a body with another identity and the same underlying body shape (Experiment 2a. The different influences of BMI on accuracy of body size estimation and sensitivity to weight change for self and other identity suggests that effects of BMI on visual body size estimation are self-specific and not generalizable to other bodies.
Body size estimation of self and others in females varying in BMI.
Thaler, Anne; Geuss, Michael N; Mölbert, Simone C; Giel, Katrin E; Streuber, Stephan; Romero, Javier; Black, Michael J; Mohler, Betty J
2018-01-01
Previous literature suggests that a disturbed ability to accurately identify own body size may contribute to overweight. Here, we investigated the influence of personal body size, indexed by body mass index (BMI), on body size estimation in a non-clinical population of females varying in BMI. We attempted to disentangle general biases in body size estimates and attitudinal influences by manipulating whether participants believed the body stimuli (personalized avatars with realistic weight variations) represented their own body or that of another person. Our results show that the accuracy of own body size estimation is predicted by personal BMI, such that participants with lower BMI underestimated their body size and participants with higher BMI overestimated their body size. Further, participants with higher BMI were less likely to notice the same percentage of weight gain than participants with lower BMI. Importantly, these results were only apparent when participants were judging a virtual body that was their own identity (Experiment 1), but not when they estimated the size of a body with another identity and the same underlying body shape (Experiment 2a). The different influences of BMI on accuracy of body size estimation and sensitivity to weight change for self and other identity suggests that effects of BMI on visual body size estimation are self-specific and not generalizable to other bodies.
In a safety net population HPV4 vaccine adherence worsens as BMI increases.
Directory of Open Access Journals (Sweden)
Diane M Harper
Full Text Available Obesity adversely inhibits antibody response to vaccination. Three doses of HPV4 may or may not provide adequate long term protection against HPV 16/18 in obese females. The aim of this study was to determine whether adherence to HPV4 vaccination in a safety net population was reduced with increasing body mass index (BMI.We designed a historical prospective study evaluating the number and dates of HPV4 dosing that occurred from July 1, 2006 through October 1, 2009 by the demographic characteristics of the 10-26 year old recipient females. The defined dosing intervals were adapted from the literature and obesity categories were defined by the WHO.1240 females with BMI measurements received at least one dose of HPV4; 38% were obese (class I, II and III and 25% were overweight. Females with normal BMI received on-time triplet dosing significantly more often than did the obese class II and III females (30% vs. 18%, p<0.001. Obese class II/III females have a significant 45% less chance of completing the on-time triplet HPV4 series than normal women (OR = 0.55, 95% CI: 0.37, 0.83. Pregnancy history has a significant influence on BMI and HPV4 dosing compliance in this safety net population where 71% had been gravid. Hispanic females were less likely to complete HPV4 dosing regardless of BMI (aOR = 0.39, 95% CI: 0.16, 0.95.Obesity, as well as gravidity and Hispanic race, are risk factors for lack of HPV4 vaccine adherence among young females in a safety net population.
Directory of Open Access Journals (Sweden)
Lannfelt Lars
2009-12-01
Full Text Available Abstract Background Common FTO (fat mass and obesity associated gene variants have recently been strongly associated with body mass index and obesity in several large studies. Here we set out to examine the association of the FTO variant rs9939609 with BMI in a 32 year follow up study of men born 1920-1924. Moreover, we analyzed the effect of physical activity on the different genotypes. Methods The FTO rs9936609 was genotyped using an Illumina golden gate assay. BMI was calculated using standard methods and body fat was estimated by measuring skinfold thickness using a Harpenden caliper. Physical activity was assessed using a four question medical questionnaire. Results FTO rs9939609 was genotyped in 1153 elderly Swedish men taking part of a population-based cohort study, the ULSAM cohort. The risk of obesity and differences in BMI according to genotype at the ages of 50, 60, 70, 77 and 82 were investigated. We found no increased risk of obesity and no association with BMI at any age with the FTO rs9939609 variant. We found however interaction between physical activity at the age of 50 years and genotype on BMI levels (p = 0.039 and there was a clear trend towards larger BMI differences between the TT and AA carriers as well as between AT and AA carriers in the less physically active subjects. Conclusion Here we found that the well established obesity risk allele for a common variant in FTO does not associate with increased BMI levels in a Swedish population of adult men which reached adulthood before the appearance of today's obesogenic enviroment. There is an interaction between physical activity and the effect of the FTO genotype on BMI levels suggesting that lack of physical activity is a requirement for an association of FTO gene variants to obesity.
Bmi-1 confers adaptive radioresistance to KYSE-150R esophageal carcinoma cells
Energy Technology Data Exchange (ETDEWEB)
Wang, Guanyu [Department of General Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Liu, Luying [Department of Radiotherapy, Zhejiang Cancer Hospital, Hangzhou (China); Sharma, Sherven [David Geffen School of Medicine at UCLA, and the Department of Veterans Affairs, Los Angeles, CA (United States); Liu, Hai; Yang, Weifang; Sun, Xiaonan [Department of Radiotherapy, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Dong, Qinghua, E-mail: dongqinghua@zju.edu.cn [Biomedical Research Center, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China)
2012-08-24
Highlights: Black-Right-Pointing-Pointer Adaptive radioresistant KYSE-150R cells expressed high level of Bmi-1. Black-Right-Pointing-Pointer Bmi-1 depletion sensitized KYSE-150R cells to RT. Black-Right-Pointing-Pointer Bmi-1 depletion increased the generation of ROS in KYSE-150R cells exposed to radiation. Black-Right-Pointing-Pointer Bmi-1 depletion impaired DNA repair capacities in KYSE-150R cells exposed to radiation. -- Abstract: Radiotherapy (RT) is a major modality of cancer treatment. However, tumors often acquire radioresistance, which causes RT to fail. The exact mechanisms by which tumor cells subjected to fractionated irradiation (FIR) develop an adaptive radioresistance are largely unknown. Using the radioresistant KYSE-150R esophageal squamous cell carcinoma (ESCC) model, which was derived from KYSE-150 parental cells using FIR, the role of Bmi-1 in mediating the radioadaptive response of ESCC cells to RT was investigated. The results showed that the level of Bmi-1 expression was significantly higher in KYSE-150R cells than in the KYSE-150 parental cells. Bmi-1 depletion sensitized the KYSE-150R cells to RT mainly through the induction of apoptosis, partly through the induction of senescence. A clonogenic cell survival assay showed that Bmi-1 depletion significantly decreased the radiation survival fraction in KYSE-150R cells. Furthermore, Bmi-1 depletion increased the generation of reactive oxygen species (ROS) and the expression of oxidase genes (Lpo, Noxo1 and Alox15) in KYSE-150R cells exposed to irradiation. DNA repair capacities assessed by {gamma}-H2AX foci formation were also impaired in the Bmi-1 down-regulated KYSE-150R cells. These results suggest that Bmi-1 plays an important role in tumor radioadaptive resistance under FIR and may be a potent molecular target for enhancing the efficacy of fractionated RT.
The impact of sleep-disordered breathing on body mass index (BMI: the sleep heart health study (SHHS
Directory of Open Access Journals (Sweden)
Robbins JA
2011-12-01
Full Text Available Introduction: It is well known that obesity is a risk factor for sleep-disordered breathing (SDB. However, whether SDB predicts increase in BMI is not well defined. Data from the Sleep Heart Health Study (SHHS were analyzed to determine whether SDB predicts longitudinal increase in BMI, adjusted for confounding factors.Methods: A full-montage unattended home polysomnogram (PSG and body anthropometric measurements were obtained approximately five years apart in 3001 participants. Apnea-hypopnea index (AHI was categorized using clinical thresholds: < 5 (normal, ≥ 5 to <15 (mild sleep apnea, and ³ 15 (moderate to severe sleep apnea. Linear regression was used to examine the association between the three AHI groups and increased BMI. The model included age, gender, race, baseline BMI, and change in AHI as covariates.Results: Mean (SD age was 62.2 years (10.14, 55.2% were female and 76.1% were Caucasian. Five-year increase in BMI was modest with a mean (SD change of 0.53 (2.62 kg/m2 (p=0.071. A multivariate regression model showed that subjects with a baseline AHI between 5-15 had a mean increase in BMI of 0.22 kg/m2 (p=0.055 and those with baseline AHI ≥ 15 had a BMI increase of 0.51 kg/m2 (p<0.001 compared to those with baseline AHI of <5.Conclusion: Our findings suggest that there is a positive association between severity of SDB and subsequent increased BMI over approximately 5 years. This observation may help explain why persons with SDB have difficulty losing weight.
BMI is not a good indicator for metabolic risk in adolescent girls
BMI (kg/m2) does not provide information about body fat percentile.Adolescents with BMI girls with low BMI can have high body fat percentile. We hypothesized that these girls are already insulin resi...
Excess BMI in Childhood: A Modifiable Risk Factor for Type 1 Diabetes Development?
Ferrara, Christine Therese; Geyer, Susan Michelle; Liu, Yuk-Fun; Evans-Molina, Carmella; Libman, Ingrid M; Besser, Rachel; Becker, Dorothy J; Rodriguez, Henry; Moran, Antoinette; Gitelman, Stephen E; Redondo, Maria J
2017-05-01
We aimed to determine the effect of elevated BMI over time on the progression to type 1 diabetes in youth. We studied 1,117 children in the TrialNet Pathway to Prevention cohort (autoantibody-positive relatives of patients with type 1 diabetes). Longitudinally accumulated BMI above the 85th age- and sex-adjusted percentile generated a cumulative excess BMI (ceBMI) index. Recursive partitioning and multivariate analyses yielded sex- and age-specific ceBMI thresholds for greatest type 1 diabetes risk. Higher ceBMI conferred significantly greater risk of progressing to type 1 diabetes. The increased diabetes risk occurred at lower ceBMI values in children <12 years of age compared with older subjects and in females versus males. Elevated BMI is associated with increased risk of diabetes progression in pediatric autoantibody-positive relatives, but the effect varies by sex and age. © 2017 by the American Diabetes Association.
Directory of Open Access Journals (Sweden)
Bai Jingya
2013-01-01
Full Text Available Objectives. To fully analyze and compare BMI among Han, Tibetan, and Uygur university students, to discuss the differences in their physical properties and physical health, and thus to provide some theoretical suggestions for the improvement of students’ physical health. Methods. The cross-sectional random cluster sampling was used to investigate 10103 Han, Tibetan, and Uygur university students, aged 20–24 in Northwest China, and their height and weight were measured to calculate BMI. The BMI classification criteria for Chinese established by Work Group on Obesity in China (WGOC were used for screening. Results. Han, Tibetan, and Uygur university students show low obesity rates but high overweight rates. Han, Tibetan, and Uygur university students present a high rate of underweight, normal weight, and overweight, respectively. Female Han students show higher underweight and normal weight rates, but lower overweight and obesity rates, than male Han students. Female Tibetan students show higher normal weight rate, but lower overweight and obesity rates, than male Tibetan students. BMI increases with age for male students but decreases with age for female students. Male Uygur students show higher obesity rate than female Uygur students. Tibetan and Uygur university students have higher BMI than other minorities in South China.
Jingya, Bai; Ye, He; Jing, Wang; Xi, Huanjiu; Tao, Hai
2013-01-01
Objectives. To fully analyze and compare BMI among Han, Tibetan, and Uygur university students, to discuss the differences in their physical properties and physical health, and thus to provide some theoretical suggestions for the improvement of students' physical health. Methods. The cross-sectional random cluster sampling was used to investigate 10103 Han, Tibetan, and Uygur university students, aged 20–24 in Northwest China, and their height and weight were measured to calculate BMI. The BMI classification criteria for Chinese established by Work Group on Obesity in China (WGOC) were used for screening. Results. Han, Tibetan, and Uygur university students show low obesity rates but high overweight rates. Han, Tibetan, and Uygur university students present a high rate of underweight, normal weight, and overweight, respectively. Female Han students show higher underweight and normal weight rates, but lower overweight and obesity rates, than male Han students. Female Tibetan students show higher normal weight rate, but lower overweight and obesity rates, than male Tibetan students. BMI increases with age for male students but decreases with age for female students. Male Uygur students show higher obesity rate than female Uygur students. Tibetan and Uygur university students have higher BMI than other minorities in South China. PMID:24453807
BMI may underestimate the socioeconomic gradient in true obesity
van den Berg, G.; van Eijsden, M.; Vrijkotte, T. G. M.; Gemke, R. J. B. J.
2013-01-01
Body mass index (BMI) does not make a distinction between fat mass and lean mass. In children, high fat mass appears to be associated with low maternal education, as well as low lean mass because maternal education is associated with physical activity. Therefore, BMI might underestimate true obesity
Does the sex of one's co-twin affect height and BMI in adulthood?
DEFF Research Database (Denmark)
Bogl, Leonie H; Jelenkovic, Aline; Vuoksimaa, Eero
2017-01-01
BACKGROUND: The comparison of traits in twins from opposite-sex (OS) and same-sex (SS) dizygotic twin pairs is considered a proxy measure of prenatal hormone exposure. To examine possible prenatal hormonal influences on anthropometric traits, we compared mean height, body mass index (BMI), and th...
Body Mass Index (BMI) and All-Cause Mortality Pooling Project
The BMI and All-Cause Mortality Pooling Project quantified the risk associated with being overweight and the extent to which the relationship between BMI and all-cause mortality varies by certain factors.
Yang, Xing-Xiao; Ma, Ming; Sang, Mei-Xiang; Zhang, Xue-Yuan; Liu, Zhi-Kun; Song, Heng; Zhu, Shu-Chai
2018-02-01
B-cell‑specific Moloney murine leukaemia virus integration site-1 (BMI-1) contributes to the growth of tumour cells post-irradiation (IR). The aim of the present study was to characterize the effects of BMI-1 on cell viability, radiosensitivity and its mechanisms of action in oesophageal squamous cell cancer (ESCC). Western blotting and immunohistochemistry were employed to evaluate the protein expression of BMI-1 in ESCC cells and specimens, respectively. Additionally, the protein expression levels of BMI-1, H2AK119ub and γH2AX in ESCC cells were detected following different doses of IR and at different times after IR. The protein expression levels of MDC1 and 53BP1 were also measured. Flow cytometry and MTT assays were used to determine cell cycle progression, apoptosis and cell viability. The phosphatidylinositol 3-kinase inhibitor LY294002 and the agonist IGF-1 were employed to suppress or induce the phosphorylation of Akt to determine whether BMI-1 induces radioresistance in ESCC cells via activation of the PI3K/Akt pathway. The expression of BMI-1 was higher in ESCC tissues and cells compared with that in normal oesophageal tissues and cells. In addition, BMI-1 was positively related to tumour size and lymph node metastases and negatively to the overall survival of ESCC patients. IR induced the expression of BMI-1, H2AK119ub and γH2AX in a dose- and time-dependent manner. BMI-1 knockdown lowered the expression of γH2AX, MDC1 and 53BP1, suppressed cell viability and increased radiosensitivity. G2/M phase arrest was eliminated; this was followed by an increased proportion of cells entering the G0/G1 phase after IR and BMI-1 knockdown via the upregulation of P16 and downregulation of cyclin D2 and cyclin-dependent kinase-4. Moreover, BMI-1 knockdown increased cell apoptosis, downregulated MCL-1 and p-Akt and upregulated Bax. Additionally, the inhibitory effect of the downregulation of p-Akt by LY294002 on tumour cell viability was identical to that of
Nakagawa, Yuichi; Nakanishi, Toshiki; Satake, Eiichiro; Matsushita, Rie; Saegusa, Hirokazu; Kubota, Akira; Natsume, Hiromune; Shibata, Yukinobu; Fujisawa, Yasuko
2018-01-01
Abstract. The purpose of this study was to clarify the degree of early postnatal growth by birthweight and detect early predictive factors for pediatric obesity. Body mass index (BMI) and degree of obesity were examined in children in the fourth year of elementary school and second year of junior high school. Their BMI at birth and three years of age were also examined. Based on birthweight, participants were divided into three groups: low ( 3500 g). Furthermore, according to the degree of obesity, they were divided into two groups: obese (20% ≤) and non-obese (20% >). The change of BMI from birth to three years of age (ΔBMI) showed a strong inverse relationship with birthweight and was significantly different among the three birthweight groups (low > middle > high). The ΔBMI and BMI at three years of age were higher in obese than in non-obese children and showed significant positive correlations with the degree of obesity. Early postnatal growth might be determined by birthweight and was higher in obese than in non-obese children. The ΔBMI from birth to three years of age and BMI at age of three years could be predictive factors for pediatric obesity. PMID:29403153
Infant BMI peak, breastfeeding, and body composition at age 3 y
DEFF Research Database (Denmark)
Jensen, Signe Marie; Ritz, Christian; Ejlerskov, Katrine Tschentscher
2015-01-01
BACKGROUND: With the increasing focus on obesity, growth patterns in infancy and early childhood have gained much attention. Although the adiposity rebound has been in focus because of a shown association with adult obesity, not much has been published about the infant peak in body mass index (BMI......) cohort were used to estimate BMI growth curves for the age span from 14 d to 19 mo by using a nonlinear mixed-effects model. BMI growth velocity before peak and age and BMI at peak were derived from the subject-specific models. Information about pregnancy and breastfeeding was assessed from background...
GFAP-Cre-mediated transgenic activation of Bmi1 results in pituitary tumors.
Directory of Open Access Journals (Sweden)
Bart A Westerman
Full Text Available Bmi1 is a member of the polycomb repressive complex 1 and plays different roles during embryonic development, depending on the developmental context. Bmi1 over expression is observed in many types of cancer, including tumors of astroglial and neural origin. Although genetic depletion of Bmi1 has been described to result in tumor inhibitory effects partly through INK4A/Arf mediated senescence and apoptosis and also through INK4A/Arf independent effects, it has not been proven that Bmi1 can be causally involved in the formation of these tumors. To see whether this is the case, we developed two conditional Bmi1 transgenic models that were crossed with GFAP-Cre mice to activate transgenic expression in neural and glial lineages. We show here that these mice generate intermediate and anterior lobe pituitary tumors that are positive for ACTH and beta-endorphin. Combined transgenic expression of Bmi1 together with conditional loss of Rb resulted in pituitary tumors but was insufficient to induce medulloblastoma therefore indicating that the oncogenic function of Bmi1 depends on regulation of p16(INK4A/Rb rather than on regulation of p19(ARF/p53. Human pituitary adenomas show Bmi1 overexpression in over 50% of the cases, which indicates that Bmi1 could be causally involved in formation of these tumors similarly as in our mouse model.
The effects of breastfeeding on childhood BMI: a propensity score matching approach.
Gibson, Laura A; Hernández Alava, Mónica; Kelly, Michael P; Campbell, Michael J
2017-12-01
Many studies have found a statistical association between breastfeeding and childhood adiposity. This paper investigates whether breastfeeding has an effect on subsequent childhood body mass index (BMI) using propensity scores to account for confounding. We use data from the Millennium Cohort Study, a nationally representative UK cohort survey, which contains detailed information on infant feeding and childhood BMI. Propensity score matching is used to investigate the mean BMI in children breastfed exclusively and partially for different durations of time. We find statistically significant influences of breastfeeding on childhood BMI, particularly in older children, when breastfeeding is prolonged and exclusive. At 7 years, children who were exclusively breastfed for 16 weeks had a BMI 0.28 kg/m2 (95% confidence interval 0.07 to 0.49) lower than those who were never breastfed, a 2% reduction from the mean BMI of 16.6 kg/m2. For this young cohort, even small effects of breastfeeding on BMI could be important. In order to reduce BMI, breastfeeding should be encouraged as part of wider lifestyle intervention. This evidence could help to inform public health bodies when creating public health guidelines and recommendations. © The Author 2016. Published by Oxford University Press on behalf of Faculty of Public Health.
Convergence of BMI1 and CHD7 on ERK Signaling in Medulloblastoma
Directory of Open Access Journals (Sweden)
Sara Badodi
2017-12-01
Full Text Available Summary: We describe molecular convergence between BMI1 and CHD7 in the initiation of medulloblastoma. Identified in a functional genomic screen in mouse models, a BMI1High;CHD7Low expression signature within medulloblastoma characterizes patients with poor overall survival. We show that BMI1-mediated repression of the ERK1/2 pathway leads to increased proliferation and tumor burden in primary human MB cells and in a xenograft model, respectively. We provide evidence that repression of the ERK inhibitor DUSP4 by BMI1 is dependent on a more accessible chromatin configuration in G4 MB cells with low CHD7 expression. These findings extend current knowledge of the role of BMI1 and CHD7 in medulloblastoma pathogenesis, and they raise the possibility that pharmacological targeting of BMI1 or ERK may be particularly indicated in a subgroup of MB with low expression levels of CHD7. : Badodi et al. find convergence of the chromatin modifiers BMI1 and CHD7 in medulloblastoma pathogenesis, and they show that this pathway regulates tumor proliferation and growth via ERK signaling. Keywords: BMI1, CHD7, DUSP4, ERK, medulloblastoma, PcG genes, mouse models, epigenetics, chromatin
Long-term BMI and growth profiles in offspring of women with gestational diabetes.
Hammoud, Nurah M; Visser, Gerard H A; van Rossem, Lenie; Biesma, Douwe H; Wit, Jan M; de Valk, Harold W
2018-05-01
Gestational diabetes mellitus (GDM) is reported to be associated with childhood obesity, however the magnitude of this association and relation to intrauterine growth is uncertain. We, therefore, aimed to assess whether the growth trajectories of large for gestational age (LGA) and non-LGA offspring of mothers with GDM (OGDM) are different until early adolescence. We also aimed to explore whether growth trajectories of OGDM differ from those of offspring of mothers with type 1 or 2 diabetes (ODM1, ODM2). We studied height and BMI standard deviation score (SDS) of the OGDM group, up to the age of 14 years, with subgroup analysis comparing LGA with non-LGA at birth as a reflection of the intrauterine environment. All mothers with GDM who delivered at the University Medical Center Utrecht between 1990 and 2006 were contacted to participate; informed consent was received for 104 OGDM of 93 mothers. Offspring data were collected through Dutch infant welfare centres. Recorded height and weight were converted to BMI and age- and sex-specific SDS values for Dutch children. Additionally, we compared the OGDM group with ODM1 and ODM2 groups in order to identify those offspring with the highest risk of becoming overweight. Growth trajectories were compared between non-LGA and LGA OGDM and between OGDM, ODM1 and ODM2, using a random-effects model. In the longitudinal follow-up a mean of 7.4 ± 2 measurements per infant were available. Mothers had a prepregnancy BMI of 25.8 kg/m 2 and 24% of their infants were LGA at birth. Heights of OGDM were no different from those of the Dutch Growth Study. Non-LGA OGDM showed a BMI SDS comparable with that of the reference population, with a slight increase in early adolescence. LGA OGDM had a higher BMI SDS trajectory than non-LGA OGDM and the reference population, which plateaued at around 10 years of age. Comparison of growth trajectories of OGDM, ODM1 and ODM2 showed ODM2 to have the highest trajectory followed by ODM1 and OGDM
Directory of Open Access Journals (Sweden)
Claire V. Farrow
2018-06-01
Full Text Available Overt parental restriction of food has previously been associated with child weight; however, most research has relied on self-reported feeding behaviour, or observations which give little opportunity to observe restriction of food. Using a novel lab-based observational technique to increase the opportunity to observe maternal feeding restriction, we explored the relationships between maternal restriction, child responses to restriction and child temperament with child body mass index (BMI Z-scores over time. Sixty-two mother child dyads were recruited to the study when their children were aged 3–5 years and were followed up 2 years later (N = 39 dyads. Families were observed during a feeding interaction in the laboratory where cookies were offered with the main meal to increase the opportunity for maternal restriction of food. Feeding observations were coded and child temperament and BMI were measured. Controlling for current child BMI Z-scores, greater maternal verbal and physical restriction of food at 3–5 years was related to higher child BMI Z-scores at 5–7 years. More emotional children were less likely to experience restriction and less likely to accept attempts to restrict their food intake. Further research should consider children’s reactions to parental feeding behaviours in greater depth and explore how feeding practices interact with child temperament in the prediction of changes in child weight.
DEFF Research Database (Denmark)
Zhang, Dong Feng; Pang, Zengchang; Li, Shuxia
2012-01-01
The genetic loci affecting the commonly used BMI have been intensively investigated using linkage approaches in multiple populations. This study aims at performing the first genome-wide linkage scan on BMI in the Chinese population in mainland China with hypothesis that heterogeneity in genetic...... linkage could exist in different ethnic populations. BMI was measured from 126 dizygotic twins in Qingdao municipality who were genotyped using high-resolution Affymetrix Genome-Wide Human SNP arrays containing about 1 million single-nucleotide polymorphisms (SNPs). Nonparametric linkage analysis...... in western countries. Multiple loci showing suggestive linkage were found on chromosome 1 (lod score 2.38 at 242 cM), chromosome 8 (2.48 at 95 cM), and chromosome 14 (2.2 at 89.4 cM). The strong linkage identified in the Chinese subjects that is consistent with that found in populations of European origin...
Directory of Open Access Journals (Sweden)
Soulmaz Fazeli Farsani PharmD, MSc
2015-01-01
Full Text Available Objectives. To evaluate body mass index standard deviation score (BMI-SDS, insulin sensitivity, and progression to type 2 diabetes mellitus (T2DM in children at risk for T2DM approximately 3 years after being diagnosed with overweight/obesity and insulin resistance (measured by Homeostasis Model Assessment of Insulin Resistance [HOMA-IR]. Methods. Out of 86 invited children, 44 (mean age 15.4 ± 3.6 years participated. Medical history, physical examination, and laboratory workup were performed. Results. While the mean BMI-SDS significantly increased from 2.9 to 3.4, the mean HOMA-IR significantly decreased from 5.5 to 4.6 (baseline vs follow-up visit. Change in HOMA-IR was only due to a decrease in mean fasting plasma insulin (24.1 vs 21.1, P = .073. Conclusions. Although increase in BMI-SDS in these children is worrisome, the American Diabetes Association recommended screening interval of 3 years for children at risk for T2DM is not too long based on the fact that none of our study participants developed T2DM.
National Research Council Canada - National Science Library
Qin, Haihu; Mather, Patrick T; Baek, Jong-Beom; Tan, Loon-Seng
2006-01-01
... bismaleimide resin (BPA-BMI). This was pursued in anticipation of improvements in processability as well as physical properties including glass transition temperature, elastic modulus, and fracture toughness...
File list: Oth.Neu.10.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Neu.10.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.10.BMI1.AllCell.bed ...
File list: Oth.Neu.05.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Neu.05.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.05.BMI1.AllCell.bed ...
File list: Oth.Neu.50.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Neu.50.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.50.BMI1.AllCell.bed ...
File list: Oth.Neu.20.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Neu.20.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.20.BMI1.AllCell.bed ...
Duncan, Michael J; Bryant, Elizabeth; Stodden, David
2017-11-01
This study examined differences in children's body mass index (BMI) and body fatness (BF%) as a function of gender and fundamental movement skill (FMS) proficiency. Following ethics approval and parental consent, 248, 6-11 year-old children (112 boys, 136 girls) underwent assessment of 7 FMS: sprint run, side gallop, hop, kick, catch, throw and vertical jump. FMS tertiles ("high", "medium" or "low" FMS) were created based on the summed components of the FMS. Skinfold measures were used to calculate BF%. Physical activity (PA) was assessed using pedometry and maturation predicted using anthropometry. Data were analysed using a 2 (Gender) × 3 (FMS tertile) ways analysis of covariance (ANCOVA), controlling for age, maturation and PA. Age (P = .001) and maturation (P = .006) were associated with BMI. Girls classified as high FMS proficiency had significantly lower BMI compared to girls with low and medium FMS proficiency. Age (P = .0001) and maturation (P = .007) were associated with BF%. BF% was also higher for girls with low FMS compared to those with medium and high FMS. BF% and BMI were not different across FMS tertile in boys. Such findings suggest focusing on FMS may be especially important for healthy weight, particularly in girls.
Associations between BMI Change and Cardiometabolic Risk in Retired Football Players.
Trexler, Eric T; Smith-Ryan, Abbie E; Defreese, J D; Marshall, Stephen W; Guskiewicz, Kevin M; Kerr, Zachary Y
2018-04-01
Elevated rates of cardiometabolic diseases have been observed in former American football players. The current study sought to determine whether change in body mass index (ΔBMI) after retirement influences the prevalence of CHD, diabetes, or high blood pressure (HBP) in former professional football players. Retired professional football players (n = 3729) were sent a survey with questions regarding health status, playing history, and demographic information. Self-reported BMI at the time of retirement was subtracted from current self-reported BMI to calculate ΔBMI. Prevalence of CHD, diabetes, and HBP were determined by asking participants if they had ever been diagnosed by a health care professional. Binomial regression with a Poisson residual and robust variance estimation was used to compute crude prevalence ratios (PR) and 95% confidence intervals (CI) for each outcome. Adjusted PR values were calculated by adjusting for BMI at the time of retirement, age, years of football experience, race, exercise habits, alcohol use, steroid history, smoking history, and playing position. Complete data were available for 2062 respondents. Prevalence of CHD increased 25%-31% for each five-point increase in ΔBMI after retirement (crude PR = 1.25, 95% CI = 1.03-1.52, P = 0.026; adjusted PR = 1.31, 95% CI = 1.11-1.55, P = 0.001). Diabetes prevalence increased 69%-88% for each five-point ΔBMI increase (crude = 1.88, 95% CI = 1.45-2.44, P football players.
The validity of self-reported vs. measured body weight and height and the effect of self-perception.
Gokler, Mehmet Enes; Bugrul, Necati; Sarı, Ahu Ozturk; Metintas, Selma
2018-01-01
The objective was to assess the validity of self-reported body weight and height and the possible influence of self-perception of body mass index (BMI) status on the actual BMI during the adolescent period. This cross sectional study was conducted on 3918 high school students. Accurate BMI perception occurred when the student's self-perception of their BMI status did not differ from their actual BMI based on measured height and weight. Agreement between the measured and self-reported body height and weight and BMI values was determined using the Bland-Altman metod. To determine the effects of "a good level of agreement", hierarchical logistic regression models were used. Among male students who reported their BMI in the normal region, 2.8% were measured as overweight while 0.6% of them were measured as obese. For females in the same group, these percentages were 1.3% and 0.4% respectively. Among male students who perceived their BMI in the normal region, 8.5% were measured as overweight while 0.4% of them were measured as obese. For females these percentages were 25.6% and 1.8% respectively. According to logistic regression analysis, residence and accurate BMI perception were significantly associated with "good agreement" ( p ≤ 0.001). The results of this study demonstrated that in determining obesity and overweight statuses, non-accurate weight perception is a potential risk for students.
Montazeri, Parisa; Vrijheid, Martine; Martinez, David; Basterrechea, Mikel; Fernandez-Somoano, Ana; Guxens, Monica; Iñiguez, Carmen; Lertxundi, Aitana; Murcia, Mario; Tardon, Adonina; Sunyer, Jordi; Valvi, Damaskini
2018-03-01
The objective of this study was to evaluate the associations between maternal metabolic parameters and early childhood BMI trajectories. Two thousand two hundred fifty-one children born in Spain between 2004 and 2008 were analyzed. Five BMI z score trajectories from birth to age 4 years were identified by using latent class growth analysis. Multinomial regression assessed the associations between maternal metabolic parameters and offspring's BMI trajectories. Children in the reference BMI trajectory had average size at birth followed by a slower BMI gain. Maternal prepregnancy obesity was associated with trajectories of accelerated BMI gain departing from either higher (relative risk ratio [RRR] = 1.77; 95% CI: 1.07-2.91) or lower size at birth (RRR = 1.91; 95% CI: 1.17-3.12). Gestational weight gain (GWG) above clinical guidelines was associated with a trajectory of higher birth size followed by accelerated BMI gain (RRR = 2.14; 95% CI: 1.53-2.97). Maternal serum triglycerides were negatively associated with BMI trajectories departing from lower birth sizes. Gestational diabetes, maternal serum cholesterol, and C-reactive protein were unrelated to children's BMI trajectories. Maternal prepregnancy obesity, GWG, and serum triglycerides are associated with longitudinal BMI trajectories in early childhood that may increase disease risk in later life. Health initiatives should promote healthy weight status before and during pregnancy to improve maternal and child health. © 2018 The Obesity Society.
Directory of Open Access Journals (Sweden)
Tahergorabi Zoya
2017-08-01
Full Text Available Background: Birth weight has been shown to be influenced by numerous factors including, maternal characteristics such as maternal BMI. In pregnancy, there is increased adipose tissue which can cause to maternal obesity and insulin resistance. There is visfatin expression increase specific to pregnancy. Aim: We planned this study to assess relationships of the first trimester maternal BMI with new-born anthropometric characteristics and visfatin levels throughout pregnancy. Methods and Material: This longitudinal, observational study on 100 nulliparous pregnant women carried out in Birjand, Iran, over three trimesters in 2016. The researcher asked the participants to fill out the Researcher-made questionnaire including demographic and anthropometric characteristics including first trimester BMI and then referred them to laboratory to serum sample taking from mothers and visfatin levels measurement in the three trimesters. Neonate’s anthropometric measures (weight, height, head circumference and sex of new-borns were obtained from hospital reports. Results: Pearson correlation test indicated significant correlation between birth weight and the first trimester maternal BMI (r= 0.27, P=0.02. Also, Spearman’s correlation test showed a weak negative correlation between head circumference with mean visfatin level (r= -0.23, P=0.04. Linear regression showed that birth weight predicts 28% of variation of BMI. Also, there was significant difference between the maternal level of education and the mean of birth weight (P=0.027. Conclusions: Results of the present study showed that the mean of birth weight was comparable with capital cities in Iran, it is necessary to strengthen the existing mother and child health care program and to develop new approaches.
Pratt, Keeley J; Lazorick, Suzanne; Lamson, Angela L; Ivanescu, Andrada; Collier, David N
2013-07-10
Changes in Quality of Life (QOL) measures over time with treatment of obesity have not previously been described for youth. We describe the changes from baseline through two follow up visits in youth QOL (assessed by the Pediatric Quality Life Inventory, PedsQL4.0), teen depression (assessed by the Patient Health Questionnaire, PHQ9A), Body Mass Index (BMI) and BMI z-score. We also report caregiver proxy ratings of youth QOL. A sample of 267 pairs of youth and caregiver participants were recruited at their first visit to an outpatient weight-treatment clinic that provides care integrated between a physician, dietician, and mental health provider; of the 267, 113 attended a visit two (V2) follow-up appointment, and 48 attended visit three (V3). We investigated multiple factors longitudinally experienced by youth who are overweight and their caregivers across up to three different integrated care visits. We determined relationships at baseline in QOL, PHQ9A, and BMI z-score, as well as changes in variables over time using linear mixed models with time as a covariate. Overall across three visits the results indicate that youth had slight declines in relative BMI, significant increases in their QOL and improvements in depression. We encourage clinicians and researchers to track youth longitudinally throughout treatment to investigate not only youth's BMI changes, but also psychosocial changes including QOL.
BMI in relation to sperm count
DEFF Research Database (Denmark)
Sermondade, N; Faure, C; Fezeu, L
2013-01-01
BACKGROUND The global obesity epidemic has paralleled a decrease in semen quality. Yet, the association between obesity and sperm parameters remains controversial. The purpose of this report was to update the evidence on the association between BMI and sperm count through a systematic review...... with meta-analysis. METHODS A systematic review of available literature (with no language restriction) was performed to investigate the impact of BMI on sperm count. Relevant studies published until June 2012 were identified from a Pubmed and EMBASE search. We also included unpublished data (n = 717 men...... studies were included in the meta-analysis, resulting in a sample of 13 077 men from the general population and attending fertility clinics. Data were stratified according to the total sperm count as normozoospermia, oligozoospermia and azoospermia. Standardized weighted mean differences in sperm...
Kosti, Rena I.; Panagiotakos, Demosthenes B.; Zampelas, Antonis; Mihas, Costas; Alevizos, Alevizos; Leonard, Clare; Tountas, Yannis; Mariolis, Anargiros
2017-01-01
Abstract Objective To evaluate whether consumption of breakfast cereals is associated with BMI in a sample of Greek adolescents. Design A cross-sectional health and nutrition survey. Setting and subjects During 2004-5, 2008 schoolchildren aged 12-17 years were selected from twelve schools located in Vyronas region (Athens metropolitan area). Height and weight were measured and BMI was calculated. A semi-quantitative FFQ was applied and multiple logistic regression analysis was used. Results O...
The Impact of Waiting List BMI Changes on the Short-term Outcomes of Lung Transplantation.
Jomphe, Valérie; Mailhot, Geneviève; Damphousse, Véronic; Tahir, Muhammad-Ramzan; Receveur, Olivier; Poirier, Charles; Ferraro, Pasquale
2018-02-01
Obesity and underweight are associated with a higher postlung transplantation (LTx) mortality. This study aims to assess the impact of the changes in body mass index (BMI) during the waiting period for LTx on early postoperative outcomes. Medical records of 502 consecutive cases of LTx performed at our institution between 1999 and 2015 were reviewed. Patients were stratified per change in BMI category between pre-LTx assessment (candidate BMI) and transplant BMI as follows: A-candidate BMI, less than 18.5 or 18.5 to 29.9 and transplant BMI, less than 18.5; B-candidate BMI, less than 18.5 and transplant BMI, 18.5 to 29.9; C-candidate BMI, 18.5 to 29.9 and transplant BMI, 18.5 to 29.9; D-candidate BMI, 30 or greater and transplant BMI, 18.5 to 29.9; and E-candidate BMI, 30 or greater or 18.5 to 29.9 and transplant BMI, 30 or greater. Our primary outcome was in-hospital mortality and secondary outcomes were length of mechanical ventilation, intensive care unit length of stay (LOS), hospital LOS and postoperative complications. BMI variation during the waiting time was common, as 1/3 of patients experienced a change in BMI category. Length of mechanical ventilation (21 days vs 9 days; P = 0.018), intensive care unit LOS (26 days vs 15 days; P = 0.035), and rates of surgical complications (76% vs 44%; P = 0.018) were significantly worse in patients of group E versus group D. Obese candidates who failed to decrease BMI less than 30 by transplant exhibited an increased risk of postoperative mortality (odds ratio, 2.62; 95% confidence interval, 1.01-6.48) compared with patients in group C. Pre-LTx BMI evolution had no impact on postoperative morbidity and mortality in underweight patients. Our results suggest that obese candidates with an unfavorable pretransplant BMI evolution are at greater risk of worse post-LTx outcomes.
Directory of Open Access Journals (Sweden)
Kristian Traberg Larsen
Full Text Available The objective of the present study was to evaluate the effectiveness of a one-year multi-component immersive day-camp weight-loss intervention for children with overweight and obesity. The study design was a parallel-group randomized controlled trial. One hundred fifteen 11-13-year-old children with overweight and obesity were randomized into either: A six-week day-camp intervention arm focusing on increased physical activity, and healthy diet followed by a subsequent one-year family-based intervention, or a standard intervention arm consisting of one weekly exercise session for six weeks. Body mass index (BMI was the primary outcome. BMI z-score, clustered cardiovascular risk z-score, and body composition were secondary outcomes. All outcomes were measured at baseline, six week-, and 52 week follow-up. After six weeks, children from the day-camp intervention arm had improved their BMI (-2.2 kg/m2 (95% CI -2.6 to -1.7, P<0.001 and all secondary outcomes when compared to the children from the standard intervention arm. After 52 weeks, the day-camp intervention arm had a lower BMI (-1.2 kg/m2 (95% CI -1.8 to -0.5, P = 0.001, and BMI z-score (-0.20 (95% CI -0.35 to -0.05, P = 0.008, and clustered cardiovascular risk z-score (-0.23 (95% CI -0.37 to -0.08, P = 0.002 compared to the standard intervention arm. No group differences were detected in body composition after 52 weeks. This study shows that the day-camp intervention arm is effective in reducing BMI and improving the metabolic health of children with overweight and obesity. However, the effects seem to be diminishing over time.
Mohsena, Masuda; Goto, Rie; Mascie-Taylor, Cg Nicholas
2016-06-01
To analyse trends in maternal nutritional status in Bangladesh over a 12-year period and to examine the associations between nutritional status and socio-economic variables. Maternal nutritional status indicators were height, weight and BMI. Socio-economic variables used were region, residency, education and occupation of the mothers and their husbands, house type, and possession score in the household. Bangladesh Demographic and Health Surveys (1996, 2000, 2004 and 2007) were the source of data. A total of 16 278 mothers were included. All of the socio-economic variables showed significant associations with maternal nutritional status indicators. Regional variation was found to be present; all three indicators were found to be lowest in the Sylhet division. Upward trends in maternal height, weight and BMI were evident from no possessions to four possessions in households, and for no education to higher education of women and their husbands. Bangladeshi mothers measured in 2007 were found to be on average 0·34 cm taller and 3·36 kg heavier than mothers measured in 1996. Between 1996 and 2007 maternal underweight fell from nearly 50 % to just over 30 % while overweight and obesity increased from about 3 % to over 9 % (WHO cut-offs) or from 7 % to nearly 18 % (Asian cut-offs). The study reveals that over the 12-year period in Bangladesh there has been a substantial reduction in maternal underweight accompanied by a considerable increase in obesity. It is also evident that malnutrition in Bangladesh is a multidimensional problem that warrants a proper policy mix and programme intervention.
Cost of fertility treatment and live birth outcome in women of different ages and BMI.
Pandey, Shilpi; McLernon, David J; Scotland, Graham; Mollison, Jill; Wordsworth, Sarah; Bhattacharya, Siladitya
2014-10-10
What is the impact of different age and BMI groups on total investigation and treatment costs in women attending a secondary/tertiary care fertility clinic? Women in their early to mid-30s and women with normal BMI had higher cumulative investigation and treatment costs, but also higher probability of live birth. Female age and BMI have been used as criteria for rationing publically funded fertility treatments. Population-based data on the costs of investigating and treating infertility are lacking. A retrospective cohort study of 2463 women was conducted in a single secondary/tertiary care fertility clinic in Aberdeen, Scotland from 1998 to 2008. Participants included all women living in a defined geographical area referred from primary care to a specialized fertility clinic over an 11-year period. Women were followed up for 5 years or until live birth if this occurred sooner. Mean discounted cumulative National Health Service costs (expressed in 2010/2011 GBP) of fertility investigations, treatments (including all types of assisted reproduction), and pregnancy (including delivery episode) and neonatal admissions were calculated and summarized by age (≤ 30, 31-35, 36-40, >40 years) and BMI groupings (years, with 694 (55.1%) of these being natural conceptions. The live birth rate was highest among women in the youngest age group (64.3%), and lowest in those aged >40 years (13.4%). Overall live birth rates were generally lower in women with BMI >30 kg/m(2). The total costs of investigations were generally highest among women younger than 30 years (£491 in those with normal BMI), whilst treatment costs tended to be higher in 31-35 year olds (£1,840 in those with normal BMI). Multivariate modelling predicted a cost increase associated with treatment which was highest among women in the lowest BMI group (across all ages), and also highest among women aged 31-35 years. The increase in the predicted probability of live birth with exposure to treatment was consistent
Changes in blood pressure, bmi and ecg patterns in women using low-dose contraceptives
International Nuclear Information System (INIS)
Syed, S.; Rahim, M.; Javed, M.; Qureshi, M.A.
2008-01-01
To determine the cardiovascular risk factors in users of second generation contraceptives by recording changes in body mass index, blood pressure and electrocardiogram. Sixty four women volunteered for this study (age range 20-35 years), belonging to low-income group with similar socio-cultural background. The Body Mass Index (BMI) was calculated by measuring height and weight of the subjects, systolic and diastolic blood pressure and ECG recording by standard method. The group means, standard deviations and coefficient correlation for interrelationship among variables in respective groups of subjects were calculated using relevant statistical method and software program. There was no significant difference between BMI of two types of contraceptive users as compared to non users, but BMI was significantly correlated with both systolic and diastolic blood pressures in injectable users as compared to controls. ECG alterations frequently observed in contraceptive users (40%) as compared to controls were normal findings. It was observed that women aged < 30 years and using contraceptives for more than three years had a tendency to gain weight and developed a mild increase in systolic and diastolic blood pressures. (author)
Does the cortisol awakening response link childhood adversity to adult BMI?
Miller, Kelly F; Arbel, Reout; Shapiro, Lauren S; Han, Sohyun C; Margolin, Gayla
2018-04-26
Childhood adversity is a risk factor for the development of obesity in adulthood. Dysregulated hypothalamic-pituitary-adrenal (HPA) activity, which has been associated separately with both adverse childhood experiences and obesity, has been posited as a mechanism by which stressful experiences influence body mass index (BMI); however, this mechanism has not yet been tested longitudinally. The present study uses multireporter, longitudinal data across three time points to test whether the adolescent cortisol awakening response (CAR), an index of diurnal HPA activity, mediates the association between adversity in childhood and BMI in adulthood. Eighty-two youth, mothers, and fathers reported on adverse childhood experiences from middle childhood to late adolescence. During adolescence, youth provided saliva samples three times each morning across three days, which were assayed for cortisol to calculate CAR. During early adulthood, youth reported height and weight to calculate BMI. Greater adversity predicted flatter CAR and higher young adult BMI. Flatter CAR partially mediated the association between childhood adversity and young adult BMI. Stress-related alterations to HPA activity account in part for the childhood adversity-adult obesity link. Findings are consistent with theoretical models implicating HPA alterations as linking childhood adversity to metabolic and behavioral determinants of BMI in adulthood. (PsycINFO Database Record (c) 2018 APA, all rights reserved).
Maternal BMI and migration status as predictors of childhood obesity in Mexico.
Jiménez-Cruz, A; Wojcicki, J M; Bacardí-Gascón, M; Castellón-Zaragoza, A; García-Gallardo, J L; Schwartz, N; Heyman, M B
2011-01-01
To assess the association of maternal migration to Baja California, body mass index (BMI) status, children's perceived food insecurity, and childhood lifestyle behaviors with overweight (BMI > 85% ile), obesity (BMI > 95% ile) and abdominal obesity (Waist Circumference > 90% ile). Convenience sampling methods were used to recruit a cross-sectional sample of 4th, 5th and 6th grade children and their parents at Tijuana and Tecate Public Schools. Children's and parents' weights and heights were measured. Children were considered to have migrant parents if parents were not born in Baja California. One hundred and twenty-two children and their parents were recruited. The mean age of the children was 10.1 ± 1.0 years. Forty nine per cent of children were overweight or obese. Children with obese parents (BMI > 30) had greater odds of being obese, Odds Ratio (OR) 4.9 (95% Confidence Interval (CI), 1.2-19, p = 0.03). Children with migrant parents had greater odds of being obese, OR= 3.7 (95% CI, 1.6-8.3), p = 0.01) and of having abdominal obesity, OR = 3.2 (95% CI, 1.4-7.1, p = 0.01). Children from migrant parents have greater risk of higher consumption of potato chips, OR = 8.0 (95% CI, 2.1-29.1, p = 0.01). Children from non-migrant parents had greater odds of being at risk of hunger. Parental obesity and migration are associated with increased risk of obesity among Mexican children. Children whose parents were born in Baja California have greater odds of being at risk of hunger. Further studies should evaluate the role of migration on risk for childhood obesity.
Physical activity and its related motivational attributes in adolescents with different BMI.
Hwang, J; Kim, Y H
2013-03-01
A number of obesity studies have been focused on identifying the relationships between socioeconomic status and physical activity involvement. In behavioral medicine, the limited data are available on obese people's physical activity and its related psychological predictors based on psychological theories. To identify the differences in physical activity and its related motivational attributes among normal weight, overweight, and obese adolescents and to find the effect of body mass index (BMI) and the Self-Determination Theory (SDT) constructs in predicting physical activity. One thousand seventy-one students ranging from seventh to ninth grades were randomly selected from three junior high schools in Seoul (359 normal weight students, 468 overweight students, and 244 obese students). A Korean version of Behavioral Regulation in Exercise Questionnaire-2 and Leisure Time Exercise Questionnaire were applied to measure the participants' motivational attributes and physical activity. Overweight and obese adolescents showed higher scores on amotivation and externally motivated regulations for physical activity than their normal weight counterparts. Internal regulation was more significant for physical activity in normal weight adolescent. However, there was no difference in physical activity among the three groups. Additionally, the findings identified that BMI and the SDT constructs were significant to explain physical activity. This study offers fundamental knowledge in gaining a clearer understanding of the types of motivation most likely to contribute to the initiation and promotion of physical activity in overweight and obese adolescents.
The dose-response analysis between BMI and common chronic diseases in northeast China.
Yu, Jianxing; Tao, Yuchun; Dou, Jing; Ye, Junsen; Yu, Yaqin; Jin, Lina
2018-03-09
High body mass index (BMI) predisposes to several chronic diseases, but a large-scale systematic and detailed study of dose-response relationship between BMI and chronic diseases has not been reported previously. In this study, we aimed to investigate the relationship between BMI and 3 chronic diseases (hypertension, dyslipidemia and MetS) in northeast China. A sample of 16412 participants aged 18~79 years old were included in Jilin province in 2012. The lambda-mu-sigma (LMS) method was applied to examine the trend of BMI by age, and the restricted cubic splines were used to investigate the non-linear associations (dose-response curve) between BMI and chronic diseases. It was pointed out that BMI increased rapidly when young, then kept steady in middle age, and finally declined slowly in old age, and accordingly age was divided into 3 segments, which were different by gender. The odds ratios (ORs) of BMI for the chronic diseases increased relatively slowly when young, then increased dramatically in middle-age and old population, especially for men. Further, the ORs of BMI among non-smokers were lower than those among smokers, and the same trend was shown to be more apparent among drinkers and non-drinkers. The risk of BMI for common chronic diseases increased dramatically in middle-aged, especially for men with drinking and smoking habits.
File list: Oth.ALL.05.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.ALL.05.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX644721,SRX109477...79,SRX149715,SRX359986,SRX644717,SRX644709,SRX644713 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.05.BMI1.AllCell.bed ...
File list: Oth.ALL.20.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.ALL.20.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...17,SRX113591,SRX644729,SRX359986,SRX109479,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.20.BMI1.AllCell.bed ...
File list: Oth.ALL.10.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.ALL.10.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...86,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.10.BMI1.AllCell.bed ...
File list: Oth.ALL.50.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.ALL.50.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...08,SRX644729,SRX113591,SRX359986,SRX644717,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.50.BMI1.AllCell.bed ...
Maternal Pre-pregnancy BMI and Reproductive Health of Daughters in Young Adulthood
DEFF Research Database (Denmark)
Mariansdatter, Saga Elise; Ernst, Andreas; Toft, Gunnar
2016-01-01
Objective To investigate the possible associations between maternal pre-pregnancy body mass index (BMI) and daughters' age of menarche and subsequent markers of reproductive health. Methods Nine hundred eighty-five pregnant women (80 %) were enrolled at their routine 30th week examinations in 1988...... dehydroepiandrosterone-sulphate (DHEAS), estradiol, and free estrogen index (FEI), compared to the middle BMI tertile. This was supported by a sub-analysis using the WHO classification (underweight, BMI obese, BMI ≥ 25.00 kg/m2) as exposure groups, in which daughters...... of overweight mothers had lower levels of DHEAS and estradiol, and lower FEI compared to daughters of normal weight mothers. No associations were found for ovarian follicle count in any of the groups. Conclusions for Practice We found that higher maternal BMI is associated with earlier age of menarche...
International Nuclear Information System (INIS)
Jang, Young Ill; June, Woon Kwan; Dong, Kyeong Rae
2007-01-01
In this study, Bolus Tracking method was used to investigate the parameters affecting the time when contrast media is reached at 100 HU (T 100 ) and studied the relationship between parameters and T 100 because the time which is reached at aorta through antecubital vein after injecting contrast media is different from person to person. Using 64 MDCT, Cadiac CT, the data were obtained from 100 patients (male: 50, female: 50, age distribution: 21⁓81, average age: 57.5) during July and September, 2007 by injecting the contrast media at 4 ml∙sec -1 through their antecubital vein except having difficulties in stopping their breath and having arrhythmia. Using Somatom Sensation Cardiac 64 Siemens, patients’ height and weight were measured to know their mean Heart rate and BMI. Ejection Fraction was measured using Argus Program at Wizard Workstation. Variances of each parameter were analyzed depending on T 100 ’s variation with multiple comparison and the correlation of Heart rate, Ejection Fraction and BMI were analyzed, as well. According to T 100 ’s variation caused by Heart rate, Ejection Fraction and BMI variations, the higher patients’ Heart Rate and Ejection Fraction were, the faster T 100 ’s variations caused by Heart Rate and Ejection Fraction were. The lower their Heart Rate and Ejection Fraction were, the slower T 100 ’s variations were, but T 100 ’s variations caused by BMI were not affected. In the correlation between T 100 and parameters, Heart Rate (p⁄0.01) and Ejection Fraction (p⁄0.05) were significant, but BMI was not significant (p¤0.05). In the Heart Rate, Ejection Fraction and BMI depending on Fast (17 sec and less), Medium (18⁓21 sec), Slow (22 sec and over) Heart Rate was significant at Fast and Slow and Ejection Fraction was significant Fast and Slow as well as Medium and Slow (p⁄0.05), but BMI was not statistically significant. Of the parameters (Heart Rate, Ejection Fraction and BMI) which would affect T 100 , Heart
Sex differences in heritability of BMI
DEFF Research Database (Denmark)
Schousboe, Karoline; Willemsen, Gonneke; Kyvik, Kirsten O
2003-01-01
pairs (including opposite sex pairs) aged 20-29 and 30-39 from eight different twin registries participating in the GenomEUtwin project. Quantitative genetic analyses were conducted and sex differences were explored. Variation in BMI was greater for women than for men, and in both sexes was primarily...... explained by additive genetic variance in all countries. Sex differences in the variance components were consistently significant. Results from analyses of opposite sex pairs also showed evidence of sex-specific genetic effects suggesting there may be some differences between men and women in the genetic...... factors that influence variation in BMI. These results encourage the continued search for genes of importance to the body composition and the development of obesity. Furthermore, they suggest that strategies to identify predisposing genes may benefit from taking into account potential sex specific effects....
DEFF Research Database (Denmark)
Coutinho, Thais; Goel, Kashish; Corrêa de Sá, Daniel
2013-01-01
This study sought to assess the mortality risk of patients with coronary artery disease (CAD) based ona combination of body mass index (BMI) with measures of central obesity.......This study sought to assess the mortality risk of patients with coronary artery disease (CAD) based ona combination of body mass index (BMI) with measures of central obesity....
Orthorexia nervosa: Assessment and correlates with gender, BMI, and personality.
Oberle, Crystal D; Samaghabadi, Razieh O; Hughes, Elizabeth M
2017-01-01
This study investigated whether orthorexia nervosa (ON; characterized by an obsessive fixation on eating healthy) may be predicted from the demographics variables of gender and BMI, and from the personality variables of self-esteem, narcissism, and perfectionism. Participants were 459 college students, who completed several online questionnaires that assessed these variables. A principal components analysis confirmed that the Eating Habits Questionnaire (Gleaves, Graham, & Ambwani, 2013) assesses three internally-consistent ON components: healthy eating behaviors, problems resulting from those behaviors, and positive feelings associated with those behaviors. A MANOVA and its tests of between subjects effects then revealed significant interactions between gender and BMI, such that for men but not women, a higher BMI was associated with greater symptomatology for all ON components. Partial correlation analyses, after controlling for gender and BMI, revealed that both narcissism and perfectionism were positively correlated with all aspects of ON symptomatology. Copyright © 2016 Elsevier Ltd. All rights reserved.
Lin, Cheng-Yuan; Huang, Tao; Zhao, Ling; Zhong, Linda L D; Lam, Wai Ching; Fan, Bao-Min; Bian, Zhao-Xiang
2018-05-01
Spexin is a newly identified neuropeptide that is involved in satiety control, glucose, and lipids metabolism. It has also been related to human diseases, such as obesity and type 2 diabetes. However, whether spexin changes with age or not is still unclear. The aim of this study is to investigate the relationship between circulating spexin levels and age and to study their interaction effects on body mass index (BMI), fasting glucose, and -lipids. This is a cross-sectional study, including 68 healthy adult women whose ages are in a wide range (minimum: 23; median: 38.5; maximum: 64). The serum spexin levels were measured by an enzyme-linked immunosorbent assay. Fasting glucose, total cholesterol, triglycerides (TG), alkaline phosphatase, alanine aminotransferase, aspartate aminotransferase, urea, and creatinine were measured by routine biochemical test. Shapiro-Wilk's test, Spearman and Pearson correlation analyses, χ 2 test, and two-way analysis of variance were used to interpret the data. Serum spexin levels are significantly correlated with age (Spearman r = -0.277, P = 0.022), BMI (Spearman r = -0.445, P glucose (Spearman r = -0.302, P = 0.014), and TG (Spearman r = -0.324, P = 0.008). Spexin levels independently predict the risk of high BMI and high fasting glucose. No interaction effects of spexin and age on BMI and fasting glucose were found. Circulating spexin levels decrease with age, suggesting a possible role of this peptide in aging-related functions and disorders. Further investigations are needed to expand the clinical significance of this finding.
File list: Oth.Kid.10.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Kid.10.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX149704,SRX644725,SRX1497...08,SRX644729,SRX149712,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.10.BMI1.AllCell.bed ...
File list: Oth.Kid.20.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Kid.20.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644713,SRX644709,SRX149708,SRX644717,SRX113591,SRX644729,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.20.BMI1.AllCell.bed ...
File list: Oth.Kid.50.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Kid.50.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644709,SRX644713,SRX644721,SRX149708,SRX644729,SRX113591,SRX644717 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.50.BMI1.AllCell.bed ...
LENUS (Irish Health Repository)
Brestoff, Jonathan R
2011-05-18
Abstract Background Cultural pressures to be thin and tall are postulated to cause people to misreport their body weight and height towards more socially normative (i.e., desirable) values, but a paucity of direct evidence supports this idea. We developed a novel non-linear approach to examining weight, height, and BMI misreporting biases and used this approach to examine the association between socially non-normative weight and misreporting biases in adults. Methods The Survey of Lifestyles, Attitudes, and Nutrition 2007 (SLÁN 2007), a nationally representative survey of the Republic of Ireland (N = 1942 analyzed) was used. Self-reported weight (height) was classified as under-reported by ≥2.0 kg (2.0 cm), over-reported by ≥2.0 kg (2.0 cm), or accurately reported within 2.0 kg (2.0 cm) to account for technical errors of measurement and short-term fluctuations in measured weight (height). A simulation strategy was used to define self-report-based BMI as under-estimated by more than 1.40 kg\\/m2, over-estimated by more than 1.40 kg\\/m2, or accurately estimated within 1.40 kg\\/m2. Patterns of biases in self-reported weight, height, and BMI were explored. Logistic regression was used to identify factors associated with mis-estimated BMI and to calculate adjusted odds ratios (AOR) and 99% confidence intervals (99%CI). Results The patterns of bias contributing the most to BMI mis-estimation were consistently, in decreasing order of influence, (1) under-reported weight combined with over-reported height, (2) under-reported weight with accurately reported height, and (3) accurately reported weight with over-reported height. Average bias in self-report-based BMI was -1.34 kg\\/m2 overall and -0.49, -1.33, and -2.66 kg\\/m2 in normal, overweight, and obese categories, respectively. Despite the increasing degree of bias with progressively higher BMI categories, persons describing themselves as too heavy were, within any given BMI category, less likely to have under
Ogunleye, Ayodele A; Sandercock, Gavin R; Voss, Christine; Eisenmann, Joey C; Reed, Katharine
2013-11-01
Cardiorespiratory fitness is known to be cardioprotective and its association with the components of the metabolic syndrome in children is becoming clearer. The aim of the present study was to examine the extent to which cardiorespiratory fitness may offset the weight-related association with mean arterial pressure (MAP) in schoolchildren. Cross-sectional study. Schoolchildren from the East of England, U.K. A total of 5983 (48% females) schoolchildren, 10 to 16 years of age, had height, weight and blood pressure measured by standard procedures and cardiorespiratory fitness assessed by the 20 m shuttle-run test. Participants were classified as fit or unfit using internationally accepted fitness cut-off points; and as normal weight, overweight or obese based on BMI, again using international cut-off points. Age-adjusted ANCOVA was used to determine the main effects and interaction of fitness and BMI on MAP Z-score. Logistic regression models were used to estimate odds ratios of elevated MAP. Prevalence of elevated MAP in schoolchildren was 14.8% overall and 35.7% in those who were obese-unfit. Approximately 21% of participants were overweight and 5% obese, while 23% were classified as unfit. MAP generally increased across BMI categories and was higher in the aerobically unfit participants. Obese-fit males had lower MAP compared with obese-unfit males (P < 0.001); this trend was similar in females (P = 0.05). Increasing fitness level may have a positive impact on the weight-related elevations of MAP seen in obese and overweight schoolchildren.
The relationship between BMI and striatal dopamine transporter with 99Tcm-TRODAT-1 brain SPECT
International Nuclear Information System (INIS)
Lu Rongbin; Liu Xingdang; Liu Congjin; Wang Yuankai; Zhang Guangming; Tang Jie; Chen Zhengqing; Luo Shineng
2011-01-01
Objective: To assess the relationship between the BMI and the brain DAT, and the influence of BMI on the brain SPECT imaging with 99 Tc m -TRODAT-1. Methods: MRI and 99 Tc m -TRODAT-1SPECT imaging were performed in 31 healthy volunteers (16 males and 15 females), and then the three-dimensional reconstruction of SPECT images were completed. Based on the MRI images, right striatum (RST) and the left striatum (LST) were drawn as ROI on the 4 most clearly consecutive transverse slices.The cerebellum (CB) was taken as the background reference area and the corresponding uptake ratios of ST/CB, LST/CB and RST/CB were calculated. The Pearson correlation tests for radio-uptake ratios (ST/CB, LST/CB, RST/CB), BMI and age were performed, Then multiple linear regression analysis using ST/CB as dependent variable and BMI and age as independent variables was performed. SPSS 15.0 was used in data analysis. Results: The ST imaging was symmetrical. The radioactivity was higher in the ST front area than that of the back area. The average uptake ratios of ST/CB, LST/CB, RST/CB were 1.71±0.16,1.70±0.16 and 1.72±0.17 respectively, in which the three ratios of the female were 1.74±0.18, 1.71±0.19 and 1.76±0.19 respectively and those of the male were 1.68±0.14, 1.68±0.13 and 1.69±0.15 respectively. ST/CB, LST/CB and RST/CB were negatively correlated with patients' BMI (r = -0.53, -0.57, -0.47, all P<0.05). The ST/CB was negatively correlated with patients' age (r=-0.39, P=0.03). The multiple linear regression analysis showed that the BMI was significant independent variable (β=-0.53, t= -3.36, P=0.002). Conclusions: The ST DAT level may decrease as patients' BMI and age increase. Females' DAT level is slightly higher than males'. For ST DAT imaging, age, gender and BMI should be all taken into consideration. (authors)
Social disparities in body mass index (BMI) trajectories among Chinese adults in 1991-2011.
Fang, Changchun; Liang, Ying
2017-08-16
Obesity is a serious public health problem in China. The relationship between obesity and socio-economic status (SES) is changing and affected by uncertainty, particularly, in developing countries. The sex-related differences in body mass index (BMI) trajectories are controversial and require substantial empirical data for updating and enriching. This study examined the relationship between SES and BMI in Chinese adults from a dynamic perspective using longitudinal data (1991-2011) from the China Health and Nutrition Survey (CHNS). Then, sex-related differences were determined. A hierarchical linear model was used. SES positively affected the male BMI changes, with faster BMI growth rates in the high-SES males over the past 20 years. By contrast, female BMI was only affected by BMI baseline and residential area. Specifically, greater BMI baseline led to greater BMI growth rate and earlier BMI decline. In the past 20 years, the BMI growth rate has been greater in the urban females than in the rural females. The relationship between SES and obesity is complex in China, and a substantial sex-related difference exists. We argue that this large sex-related difference is due to the rapid economic and social changes that have affected national health and increased the gender inequality and social role restrictions in females. We provide insights for further research and policy recommendations.
Lazzeri, Giacomo; Pammolli, Andrea; Pilato, Valentina; Giacchi, Mariano V
2011-07-19
Parents are responsible not only for the genetic structure of their children, but also for passing onto them their behaviours and attitudes toward life. The aim of this study was to analyse the connection between school-age children's obesity and that of their parents as well as between child obesity and parents' educational level, as a proxy indicator of the socio-economic status (SES) of families in Tuscany. The children sample was selected from "OKkio alla Salute 2010" (a cross sectional survey carried out by the Italian Institute of Health) and consisted of 1,751 (922 males and 855 females) 8-9 year-old school children. Weight and height were measured by ad hoc trained personnel, and Body Mass Index (BMI) categories were calculated using Cole et al.'s cut-off. Parents' weight, height and educational level were collected by a self-administered questionnaire. The educational levels were classified as high, medium and low. The prevalence of obese children increased along the parents' BMI category: from 1.4% for underweight mothers to 30.3% for obese mothers and from 4% for under-normal-weight fathers to 23.9% for obese fathers (p parents' educational level and child obesity, the lowest educational level corresponding to the highest prevalence of obese children: 9.3% for mothers with a low educational level compared to 5.8% for mothers with a high educational level (p = 0.15); similarly, the corresponding prevalence for fathers was 9.5% compared to 4.5% (p = 0.03). Parents' obesity and the cultural resources of the family, particularly the father's, seem to influence the prevalence of overweight and obesity in Tuscan children.
Directory of Open Access Journals (Sweden)
Zhang Jianduan
2011-12-01
Full Text Available Abstract Background Overweight and obesity are highly prevalent among American Indian children, especially those living on reservations. There is little scientific evidence about the effects of summer vacation on obesity development in children. The purpose of this study was to investigate the effects of summer vacation between kindergarten and first grade on growth in height, weight, and body mass index (BMI for a sample of American Indian children. Methods Children had their height and weight measured in four rounds of data collection (yielded three intervals: kindergarten, summer vacation, and first grade as part of a school-based obesity prevention trial (Bright Start in a Northern Plains Indian Reservation. Demographic variables were collected at baseline from parent surveys. Growth velocities (Z-score units/year for BMI, weight, and height were estimated and compared for each interval using generalized linear mixed models. Results The children were taller and heavier than median of same age counterparts. Height Z-scores were positively associated with increasing weight status category. The mean weight velocity during summer was significantly less than during the school year. More rapid growth velocity in height during summer than during school year was observed. Obese children gained less adjusted-BMI in the first grade after gaining more than their counterparts during the previous two intervals. No statistically significant interval effects were found for height and BMI velocities. Conclusions There was no indication of a significant summer effect on children's BMI. Rather than seasonal or school-related patterns, the predominant pattern indicated by weight-Z and BMI-Z velocities might be related to age or maturation. Trial registration Bright Start: Obesity Prevention in American Indian Children Clinical Trial Govt ID# NCT00123032
Cardiac Bmi1(+) cells contribute to myocardial renewal in the murine adult heart.
Valiente-Alandi, Iñigo; Albo-Castellanos, Carmen; Herrero, Diego; Arza, Elvira; Garcia-Gomez, Maria; Segovia, José C; Capecchi, Mario; Bernad, Antonio
2015-10-26
The mammalian adult heart maintains a continuous, low cardiomyocyte turnover rate throughout life. Although many cardiac stem cell populations have been studied, the natural source for homeostatic repair has not yet been defined. The Polycomb protein BMI1 is the most representative marker of mouse adult stem cell systems. We have evaluated the relevance and role of cardiac Bmi1 (+) cells in cardiac physiological homeostasis. Bmi1 (CreER/+);Rosa26 (YFP/+) (Bmi1-YFP) mice were used for lineage tracing strategy. After tamoxifen (TM) induction, yellow fluorescent protein (YFP) is expressed under the control of Rosa26 regulatory sequences in Bmi1 (+) cells. These cells and their progeny were tracked by FACS, immunofluorescence and RT-qPCR techniques from 5 days to 1 year. FACS analysis of non-cardiomyocyte compartment from TM-induced Bmi1-YFP mice showed a Bmi1 (+)-expressing cardiac progenitor cell (Bmi1-CPC: B-CPC) population, SCA-1 antigen-positive (95.9 ± 0.4 %) that expresses some stemness-associated genes. B-CPC were also able to differentiate in vitro to the three main cardiac lineages. Pulse-chase analysis showed that B-CPC remained quite stable for extended periods (up to 1 year), which suggests that this Bmi1 (+) population contains cardiac progenitors with substantial self-maintenance potential. Specific immunostaining of Bmi1-YFP hearts serial sections 5 days post-TM induction indicated broad distribution of B-CPC, which were detected in variably sized clusters, although no YFP(+) cardiomyocytes (CM) were detected at this time. Between 2 to 12 months after TM induction, YFP(+) CM were clearly identified (3 ± 0.6 % to 6.7 ± 1.3 %) by immunohistochemistry of serial sections and by flow cytometry of total freshly isolated CM. B-CPC also contributed to endothelial and smooth muscle (SM) lineages in vivo. High Bmi1 expression identifies a non-cardiomyocyte resident cardiac population (B-CPC) that contributes to the main lineages of the heart in
Fuller-Tyszkiewicz, Matthew; Skouteris, Helen; Hardy, Louise L; Halse, Christine
2012-12-01
Despite cross-sectional evidence of a link between TV viewing and BMI in early childhood, there has been limited longitudinal exploration of this relationship. The aim of the present study was to explore the potential bi-directionality of the relationship between TV viewing and child BMI. A secondary aim was to evaluate whether this relationship is mediated by dietary intake. Parents of 9064 children (4724 recruited at birth, 4340 recruited at age 4) from the Longitudinal Study of Australian Children (LSAC) completed measures of their child's dietary intake and TV viewing habits at three equidistant time points, separated by 2years. Objective measures of height and weight were also obtained at each time point to calculate BMI. Cross-lagged panel analyses were conducted to evaluate potential bi-directional associations between TV viewing and child BMI, and to evaluate mediation effects of dietary intake for this relationship. Our longitudinal findings suggest that the relationship between TV viewing and BMI is bi-directional: Individuals who watch TV are more likely to gain weight, and individuals who are heavier are also more likely to watch TV. Interestingly, dietary intake mediated the BMI-TV viewing relationship for the older children, but not for the birth cohort. Present findings suggest that sedentary behaviours, particularly when coupled with unhealthy dietary habits, constitute a significant risk factor for excessive weight gain in early childhood. Interventions targeted at helping parents to develop healthy TV viewing and eating habits in their young children are clearly warranted. Copyright © 2012 Elsevier Ltd. All rights reserved.
Maternal BMI, IGF-I Levels, and Birth Weight in African American and White Infants
Directory of Open Access Journals (Sweden)
Adriana C. Vidal
2013-01-01
Full Text Available At birth, elevated IGF-I levels have been linked to birth weight extremes; high birth weight and low birth weight are risk factors for adult-onset chronic diseases including obesity, cardiovascular disease, and type 2 diabetes. We examined associations between plasma IGF-I levels and birth weight among infants born to African American and White obese and nonobese women. Prepregnancy weight and height were assessed among 251 pregnant women and anthropometric measurements of full term infants (≥37 weeks of gestation were taken at birth. Circulating IGF-I was measured by ELISA in umbilical cord blood plasma. Linear regression models were utilized to examine associations between birth weight and high IGF-I, using the bottom two tertiles as referents. Compared with infants with lower IGF-I levels (≤3rd tertile, those with higher IGF-I levels (>3rd tertile were 130 g heavier at birth, (β-coefficient=230, se=58.0, P=0.0001, after adjusting for gender, race/ethnicity, gestational age, delivery route, maternal BMI and smoking. Stratified analyses suggested that these associations are more pronounced in infants born to African American women and women with BMI ≥30 kg/m2; the cross product term for IGF-I and maternal BMI was statistically significant (P≤0.0004. Our findings suggest that the association between IGF-I levels and birth weight depends more on maternal obesity than African American race/ethnicity.
Jago, R; Mendoza, J A; Chen, T; Baranowski, T
2013-03-01
This study examined whether change in body mass index (BMI) or waist circumference (WC) is associated with change in cardiometabolic risk factors and differences between cardiovascular disease specific and diabetes specific risk factors among adolescents. We also sought to examine any differences by gender or baseline body mass status. The article is a longitudinal analysis of pre- and post-data collected in the HEALTHY trial. Participants were 4,603 ethnically diverse adolescents who provided complete data at 6th and 8th grade assessments. The main outcome measures were percent change in the following cardiometabolic risk factors: fasting triglycerides, systolic and diastolic blood pressure, high density lipoprotein cholesterol, and glucose as well as a clustered metabolic risk score. Main exposures were change in BMI or WC z-score. Models were run stratified by gender; secondary models were additionally stratified by baseline BMI group (normal, overweight, or obese). Analysis showed that when cardiometabolic risk factors were treated as continuous variables, there was strong evidence (P fasting glucose and the combined risk factor score for both boys and girls. There was some evidence that change in WC z-score was associated with some cardiovascular risk factors, but change in WC z-score was consistently associated with changes in fasting glucose. In conclusion, routine monitoring of BMI should be continued by health professionals, but additional information on disease risk may be provided by assessing WC. Copyright © 2013 The Obesity Society.
The relationship between the BMI and the emotional status of Alexandria University students, Egypt.
Abdel Sadek, Heba A; Abu-Nazel, Mervat W; Shata, Zeinab N; Abd El-Fatah, Nesrin K
2016-09-01
Although the relationship between obesity and depression has been researched extensively, the relation of the wide range of body-weight problems, as indicated by the BMI, to emotional health problems has received little attention. To assess the rate of concomitant co-occurrence of emotional health and weight problems in Alexandria University students, and to investigate the relationship between their BMI and emotional status. A cross-sectional study was carried out on 842 university students (17-27 years), enrolled in four faculties of Alexandria University, Egypt, during the academic year 2012-2013. Participants of both sexes were interviewed to collect sociodemographic data. Weight and height were measured, and then the BMI was calculated and classified into underweight, normal weight, overweight, and obese according to age-corresponding and sex-corresponding standards. The Arabic version of Depression Anxiety Stress Scales was used to assess the emotional status of students. The curve of fit was used to test the statistical quadratic trend. Co-occurrence of depression, anxiety, or stress with any weight problem was prevalent among 7.4, 6.7, and 9.6% of the students, respectively. Obese and underweight students recorded higher rates of emotional problems compared with normal and overweight students, revealing a U-shaped relationship between the BMI and emotional states (R=0.01). This relationship was significant only for anxiety and stress (Pstudents, where sex differences were evident. University preventive strategies and treatment services should address such alarming coexisting problems among youth.
Higher BMI Is Associated with Reduced Cognitive Performance in Division I Athletes
Directory of Open Access Journals (Sweden)
Andrew Fedor
2013-04-01
Full Text Available Objective: Poor cardiovascular fitness has been implicated as a possible mechanism for obesity-related cognitive decline, though no study has examined whether BMI is associated with poorer cognitive function in persons with excellent fitness levels. The current study examined the relationship between BMI and cognitive function by the Immediate Post Concussion and Cognitive Test (ImPACT in Division I collegiate athletes. Methods: Participants had an average age of 20.14 ± 1.78 years, were 31.3% female, and 53.9% football players. BMI ranged from 19.04 to 41.14 and averaged 26.72 ± 4.62. Results: Regression analyses revealed that BMI incrementally predicted performance on visual memory (R2 change = 0.015, p = 0.026 beyond control variables. Follow-up partial correlation analyses revealed small but significant negative correlations between BMI and verbal memory (r = -0.17, visual memory (r = -0.16, and visual motor speed (r = -0.12. Conclusions: These results suggest that higher BMI is associated with reduced cognitive function, even in a sample expected to have excellent levels of cardiovascular fitness. Further work is needed to better understand mechanisms for these associations.
Higher BMI is associated with reduced cognitive performance in division I athletes.
Fedor, Andrew; Gunstad, John
2013-01-01
Poor cardiovascular fitness has been implicated as a possible mechanism for obesity-related cognitive decline, though no study has examined whether BMI is associated with poorer cognitive function in persons with excellent fitness levels. The current study examined the relationship between BMI and cognitive function by the Immediate Post Concussion and Cognitive Test (ImPACT) in Division I collegiate athletes. Participants had an average age of 20.14 ± 1.78 years, were 31.3% female, and 53.9% football players. BMI ranged from 19.04 to 41.14 and averaged 26.72 ± 4.62. Regression analyses revealed that BMI incrementally predicted performance on visual memory (R(2) change = 0.015, p = 0.026) beyond control variables. Follow-up partial correlation analyses revealed small but significant negative correlations between BMI and verbal memory (r = -0.17), visual memory (r = -0.16), and visual motor speed (r = -0.12). These results suggest that higher BMI is associated with reduced cognitive function, even in a sample expected to have excellent levels of cardiovascular fitness. Further work is needed to better understand mechanisms for these associations. Copyright © 2013 S. Karger GmbH, Freiburg.
BMI-1 Promotes Self-Renewal of Radio- and Temozolomide (TMZ)-Resistant Breast Cancer Cells.
Yan, Yanfang; Wang, Ying; Zhao, Pengxin; Ma, Weiyuan; Hu, Zhigang; Zhang, Kaili
2017-12-01
Breast cancer is a hormone-dependent malignancy and is the most prevalent cause of cancer-related mortality among females. Radiation therapy and chemotherapy are common treatments of breast cancer. However, tumor relapse and metastasis following therapy are major clinical challenges. The importance of B-lymphoma Moloney murine leukemia virus insertion region-1 (BMI-1) was implicated in cell proliferation, stem cell maintenance, and tumor initiation. We established radio- and temozolomide (TMZ)-resistant (IRC-R) MCF-7 and MDA-MB-231 cell lines to investigate the mechanism involved in therapeutic resistance. Cell proliferation and sphere number were dramatically elevated, and BMI-1 was remarkably upregulated, in IRC-R cells compared to parental cells. Silencing BMI-1 by RNA interference only affected the cell proliferation of IRC-R but not parental cells, suggesting the critical role of BMI-1 in radio- and TMZ resistance. We used a xenograft mice model to elucidate that BMI-1 was necessary in tumor development by assessing tumor volume and Ki67 expression. We found that Hedgehog (Hhg) signaling exerted synergized functions together with BMI-1, implicating the importance of BMI-1 in Hhg signaling. Downregulation of BMI-1 could be an effective strategy to suppress tumor growth, which supports the potential clinical use of targeting BMI-1 in breast cancer treatment.
Venous and autonomic function in formerly pre-eclamptic women and BMI-matched controls.
Heidema, Wieteke M; van Drongelen, Joris; Spaanderman, Marc E A; Scholten, Ralph R
2018-03-25
Pre-pregnancy reduced plasma volume increases the risk on subsequent pre-eclamptic pregnancy. Reduced plasma volume is thought to reflect venous reserve capacity, especially when venous vasculature is constricted and sympathetic tone is elevated. As obesity might affect these variables and also relates to pre-eclampsia, increased body weight may underlie these observations. We hypothesized that the relationship between reduced venous reserve and preeclampsia is independent of body mass index (BMI). We compared the non-pregnant venous reserve capacity in 30 formerly pre-eclamptic women, equally divided in 3 BMI-classes (BMI 19.5-24.9, BMI 25-29.9, BMI ≥30) to 30 controls. Cases and controls were matched for BMI, age and parity. The venous reserve capacity was quantified by assessing plasma volume and venous compliance. The autonomic nervous system regulating the venous capacitance was evaluated with heart rate variability analysis in resting supine position and during positive head-up tilt (HUT). Formerly pre-eclamptic women had in supine position lower plasma volume than controls (1339 ± 79 vs 1547 ± 139 ml/m 2 (pBMI-matched controls, reduced venous reserve capacity. This is reflected by lower plasma volume and venous compliance, the autonomic balance is shifted towards sympathetic dominance and lower baroreceptor sensitivity. This suggests that not BMI, but underlying reduced venous reserve relates to pre-eclampsia. This article is protected by copyright. All rights reserved.
Directory of Open Access Journals (Sweden)
Marga B M Bekkers
Full Text Available OBJECTIVE: Childhood and adolescent overweight, defined by body mass index (BMI are associated with an increased risk of cardiovascular disease in later life. Abdominal adiposity may be more important in associations with cardiovascular diseases but waist circumference (WC has been rarely studied in children. We studied associations between BMI and WC and blood pressure (BP and cholesterol in 12-year-old children and prospectively changes in BMI or WC status between age 8 and 12 years and BP and cholesterol at age 12. STUDY DESIGN: Weight, height, WC, BP and cholesterol concentrations were measured in 1432 children at age 12 years. Linear regression was used to study the associations between high BMI and large WC (>90(th percentile and BP and cholesterol. RESULTS: Systolic BP was 4.9 mmHg higher (95% (CI 2.5, 7.2 in girls and 4.2 mmHg (95%CI 1.9, 6.5 in boys with a high BMI. Large WC was also associated with higher systolic BP in girls (3.7 mmHg (95%CI 1.3, 6.1 and boys (3.5 mmHg (95%CI 1.2, 5.8. Diastolic BP and cholesterol concentrations were significantly positively (HDL cholesterol negatively associated with high BMI and large WC, too. Normal weight children with a history of overweight did not have higher blood pressure levels or adverse cholesterol concentrations than children that were normal weight at both ages. CONCLUSION: A high BMI and large WC were associated with higher BP levels and adverse cholesterol concentrations. WC should be taken into account when examining cardiovascular risk factors in children.
Defining a BMI Cut-Off Point for the Iranian Population: The Shiraz Heart Study.
Directory of Open Access Journals (Sweden)
Mohammad Ali Babai
Full Text Available In this study we evaluated and redefined the optimum body mass index (BMI cut-off point for the Iranian population based on metabolic syndrome (MeS risk factors. We further evaluated BMI cut-off points with and without waist circumference (WC as a cofactor of risk and compared the differences. This study is part of the largest surveillance programs conducted in Shiraz, Iran, termed the Shiraz Heart study. Our study sample included subjects between the ages of 20 to 65 years old. After excluding pregnant women, those with missing data and those with comorbid disease, a total of 12283 made up the study population. The participants underwent a series of tests and evaluations by trained professionals in accordance with WHO recommendations. Hypertension, abnormal fasting blood sugar (FBS, triglyceride (TG and high density lipoprotein cholesterol (HDL (in the context of the definition of metabolic syndrome were prevalent among 32.4%, 27.6%, 42.1 and 44.2% of our participants, respectively. Women displayed higher rates of overall obesity compared to men (based on the definition by the WHO as higher than 30 kg/m2. Regarding MeS, 38.9% of our population had the all symptoms of MeS which was more prevalent among women (41.5% vs. 36%. When excluding WC in the definition of MeS, results showed that males tend to show a higher rate of metabolic risk factors (19.2% vs. 15.6%. Results of multivariate analysis showed that parallel to an increase in BMI, the odds ratio (OR for acquiring each component of the metabolic syndrome increased (OR = 1.178; CI: 1.166-1.190. By excluding WC, the previous OR decreased (OR = 1.105; CI: 1.093-1.118. Receiver Operating Characteristic (ROC curve analysis showed that the optimum BMI cut-off point for predicting metabolic syndrome was 26.1 kg/m2 and 26.2 kg/m2 [Accuracy (Acc = 69% and 61%, respectively] for males and females, respectively. The overall BMI cut-off for both sexes was 26.2 kg/m2 (Acc = 65% with sensitivity and
Hsu, Chun-Hsien; Lin, Jiunn-Diann; Hsieh, Chang-Hsun; Lau, Shu Chuen; Chiang, Wei-Yong; Chen, Yen-Lin; Pei, Dee; Chang, Jin-Biou
2014-03-01
Obesity is a major public health problem, and measuring adiposity accurately and predicting its future comorbidities are important issues. Therefore, we hypothesized that 4 adiposity measurements, body mass index (BMI), waist circumference (WC), waist-to-height ratio, and body fat percentage, have different physiological meanings and distinct associations with adverse health consequences. This study aimed to investigate the relationship of these 4 measurements with metabolic syndrome (MetS) components and identify the most associated factor for MetS occurrence in older, non-medicated men. Cross-sectional data from 3004 men, all 65 years of age and older, were analyzed. The correlation and association between adiposity measurements and MetS components were evaluated by Pearson correlation and multiple linear regression. Based on multivariate logistic regression, BMI and WC were significantly associated with MetS and were selected to build a combined model of receiver operating characteristic curves to increase the diagnosis accuracy for MetS. The results show that BMI is independently associated with systolic and diastolic blood pressure; WC and body fat percentage are associated with fasting plasma glucose and log transformation of triglyceride; BMI and WC are negatively associated with high-density lipoprotein cholesterol (HDL-C); and WC is a better discriminate for MetS than BMI, although the combined model (WC + BMI) is not significantly better than WC alone. Based on these results, we conclude that the 4 adiposity measurements have different clinical implications. Thus, in older men, BMI is an important determinant for blood pressure and HDL-C. Waist circumference is associated with the risk of fasting plasma glucose, HDL-C, triglyceride, and MetS occurrence. The combined model did not increase the diagnosis accuracy. Copyright © 2014 Elsevier Inc. All rights reserved.
Meta-analysis of genome-wide linkage studies in BMI and obesity.
Saunders, Catherine L; Chiodini, Benedetta D; Sham, Pak; Lewis, Cathryn M; Abkevich, Victor; Adeyemo, Adebowale A; de Andrade, Mariza; Arya, Rector; Berenson, Gerald S; Blangero, John; Boehnke, Michael; Borecki, Ingrid B; Chagnon, Yvon C; Chen, Wei; Comuzzie, Anthony G; Deng, Hong-Wen; Duggirala, Ravindranath; Feitosa, Mary F; Froguel, Philippe; Hanson, Robert L; Hebebrand, Johannes; Huezo-Dias, Patricia; Kissebah, Ahmed H; Li, Weidong; Luke, Amy; Martin, Lisa J; Nash, Matthew; Ohman, Miina; Palmer, Lyle J; Peltonen, Leena; Perola, Markus; Price, R Arlen; Redline, Susan; Srinivasan, Sathanur R; Stern, Michael P; Stone, Steven; Stringham, Heather; Turner, Stephen; Wijmenga, Cisca; Collier, David A
2007-09-01
The objective was to provide an overall assessment of genetic linkage data of BMI and BMI-defined obesity using a nonparametric genome scan meta-analysis. We identified 37 published studies containing data on over 31,000 individuals from more than >10,000 families and obtained genome-wide logarithm of the odds (LOD) scores, non-parametric linkage (NPL) scores, or maximum likelihood scores (MLS). BMI was analyzed in a pooled set of all studies, as a subgroup of 10 studies that used BMI-defined obesity, and for subgroups ascertained through type 2 diabetes, hypertension, or subjects of European ancestry. Bins at chromosome 13q13.2- q33.1, 12q23-q24.3 achieved suggestive evidence of linkage to BMI in the pooled analysis and samples ascertained for hypertension. Nominal evidence of linkage to these regions and suggestive evidence for 11q13.3-22.3 were also observed for BMI-defined obesity. The FTO obesity gene locus at 16q12.2 also showed nominal evidence for linkage. However, overall distribution of summed rank p values <0.05 is not different from that expected by chance. The strongest evidence was obtained in the families ascertained for hypertension at 9q31.1-qter and 12p11.21-q23 (p < 0.01). Despite having substantial statistical power, we did not unequivocally implicate specific loci for BMI or obesity. This may be because genes influencing adiposity are of very small effect, with substantial genetic heterogeneity and variable dependence on environmental factors. However, the observation that the FTO gene maps to one of the highest ranking bins for obesity is interesting and, while not a validation of this approach, indicates that other potential loci identified in this study should be investigated further.
Grijalva‐Eternod, Carlos; Cortina‐Borja, Mario; Williams, Jane; Fewtrell, Mary; Wells, Jonathan
2016-01-01
ABSTRACT Objectives This study sets out to investigate the intergenerational associations between the body mass index (BMI) of parents and the body composition of their offspring. Methods The cross‐sectional data were analyzed for 511 parent–offspring trios from London and south‐east England. The offspring were aged 5–21 years. Parental BMI was obtained by recall and offspring fat mass and lean mass were obtained using the four‐component model. Multivariable regression analysis, with multiple imputation for missing paternal values was used. Sensitivity analyses for levels of non‐paternity were conducted. Results A positive association was seen between parental BMI and offspring BMI, fat mass index (FMI), and lean mass index (LMI). The mother's BMI was positively associated with the BMI, FMI, and LMI z‐scores of both daughters and sons and of a similar magnitude for both sexes. The father's BMI showed similar associations to the mother's BMI, with his son's BMI, FMI, and LMI z‐scores, but no association with his daughter. Sensitivity tests for non‐paternity showed that maternal coefficients remained greater than paternal coefficients throughout but there was no statistical difference at greater levels of non‐paternity. Conclusions We found variable associations between parental BMI and offspring body composition. Associations were generally stronger for maternal than paternal BMI, and paternal associations appeared to differ between sons and daughters. In this cohort, the mother's BMI was statistically significantly associated with her child's body composition but the father's BMI was only associated with the body composition of his sons. Am. J. Hum. Biol. 28:524–533, 2016. © 2016 The Authors American Journal of Human Biology Published by Wiley Periodicals, Inc. PMID:26848813
Vissers, Pauline A J; Thong, Melissa S Y; Pouwer, Frans; Creemers, Geert-Jan; Slooter, Gerrit D; van de Poll-Franse, Lonneke V
2016-06-01
This study aimed to assess the longitudinal association between lifestyle factors, body mass index (BMI), and health-related quality of life (HRQoL) among colorectal cancer patients with (CRCDM+) and without diabetes (CRCDM-). Data from a longitudinal study among CRC patients diagnosed between 2000 and 2009 were used. Clinical characteristics were retrieved from the Netherlands Cancer Registry and questionnaires were sent in 2010, 2011, and 2012 using the Patient Reported Outcomes Following Initial Treatment and Long term Evaluation of Survivorship (PROFILES) registry. Lifestyle (including moderate-to-vigorous physical activity (MVPA), smoking and alcohol use), BMI, diabetes status, and HRQoL were assessed in the questionnaire. One thousand seven hundred thirty-nine (49 %) patients responded to ≥2 questionnaires, of whom 126 CRCDM+ and 789 CRCDM- patients were included. CRCDM+ patients had a higher BMI (29.1 ± 4.2 vs. 26.4 ± 3.7 kg/m(2)), whereas the number of alcohol users was lower (50 vs. 70 %, p value lifestyle factors and BMI which were all significant predictors of HRQoL. Additional adjustment for comorbidity further attenuated the main effect of DM on HRQoL. Diabetes was not independently associated with HRQoL but deteriorated HRQoL among CRCDM+ patients seem to be explained by an unhealthier lifestyle and other comorbid conditions. Moreover, residual confounding cannot be ruled out.
p21/Cyclin E pathway modulates anticlastogenic function of Bmi-1 in cancer cells
Deng, Wen; Zhou, Yuan; Tiwari, Agnes FY; Su, Hang; Yang, Jie; Zhu, Dandan; Lau, Victoria Ming Yi; Hau, Pok Man; Yip, Yim Ling; Cheung, Annie LM; Guan, Xin-Yuan; Tsao, Sai Wah
2015-01-01
Apart from regulating stem cell self-renewal, embryonic development and proliferation, Bmi-1 has been recently reported to be critical in the maintenance of genome integrity. In searching for novel mechanisms underlying the anticlastogenic function of Bmi-1, we observed, for the first time, that Bmi-1 positively regulates p21 expression. We extended the finding that Bmi-1 deficiency induced chromosome breaks in multiple cancer cell models. Interestingly, we further demonstrated that knockdown of cyclin E or ectopic overexpression of p21 rescued Bmi-1 deficiency-induced chromosome breaks. We therefore conclude that p21/cyclin E pathway is crucial in modulating the anticlastogenic function of Bmi-1. As it is well established that the overexpression of cyclin E potently induces genome instability and p21 suppresses the function of cyclin E, the novel and important implication from our findings is that Bmi-1 plays an important role in limiting genomic instability in cylin E-overexpressing cancer cells by positive regulation of p21. PMID:25131797
Pre-pregnancy BMI-specific optimal gestational weight gain for women in Japan
Directory of Open Access Journals (Sweden)
Naho Morisaki
2017-09-01
Full Text Available Background: The Institute of Medicine (IOM guidelines are the most widely used guidelines on gestational weight gain; however, accumulation of evidence that body composition in Asians differs from other races has brought concern regarding whether their direct application is appropriate. We aimed to study to what extent optimal gestational weight gain among women in Japan differs by pre-pregnancy body mass index (BMI and to compare estimated optimal gestational weight gain to current Japanese and Institute of Medicine (IOM recommendations. Methods: We retrospectively studied 104,070 singleton pregnancies among nulliparous women in 2005–2011 using the Japanese national perinatal network database. In five pre-pregnancy BMI sub-groups (17.0–18.4, 18.5–19.9, 20–22.9, 23–24.9, and 25–27.4 kg/m2, we estimated the association of the rate of gestational weight gain with pregnancy outcomes (fetal growth, preterm delivery, and delivery complications using multivariate regression. Results: Weight gain rate associated with the lowest risk of adverse outcomes decreased with increasing BMI (12.2 kg, 10.9 kg, 9.9 kg, 7.7 kg, and 4.3 kg/40 weeks for the five BMI categories as described above, respectively. Current Japanese guidelines were lower than optimal gains, with the lowest risk of adverse outcomes for women with BMI below 18.5 kg/m2, and current IOM recommendations were higher than optimal gains for women with BMI over 23 kg/m2. Conclusion: Optimal weight gain during pregnancy varies largely by pre-pregnancy BMI, and defining those with BMI over 23 kg/m2 as overweight, as proposed by the World Health Organization, may be useful when applying current IOM recommendations to Japanese guidelines.
Pre-pregnancy BMI-specific optimal gestational weight gain for women in Japan.
Morisaki, Naho; Nagata, Chie; Jwa, Seung Chik; Sago, Haruhiko; Saito, Shigeru; Oken, Emily; Fujiwara, Takeo
2017-10-01
The Institute of Medicine (IOM) guidelines are the most widely used guidelines on gestational weight gain; however, accumulation of evidence that body composition in Asians differs from other races has brought concern regarding whether their direct application is appropriate. We aimed to study to what extent optimal gestational weight gain among women in Japan differs by pre-pregnancy body mass index (BMI) and to compare estimated optimal gestational weight gain to current Japanese and Institute of Medicine (IOM) recommendations. We retrospectively studied 104,070 singleton pregnancies among nulliparous women in 2005-2011 using the Japanese national perinatal network database. In five pre-pregnancy BMI sub-groups (17.0-18.4, 18.5-19.9, 20-22.9, 23-24.9, and 25-27.4 kg/m 2 ), we estimated the association of the rate of gestational weight gain with pregnancy outcomes (fetal growth, preterm delivery, and delivery complications) using multivariate regression. Weight gain rate associated with the lowest risk of adverse outcomes decreased with increasing BMI (12.2 kg, 10.9 kg, 9.9 kg, 7.7 kg, and 4.3 kg/40 weeks) for the five BMI categories as described above, respectively. Current Japanese guidelines were lower than optimal gains, with the lowest risk of adverse outcomes for women with BMI below 18.5 kg/m 2 , and current IOM recommendations were higher than optimal gains for women with BMI over 23 kg/m 2 . Optimal weight gain during pregnancy varies largely by pre-pregnancy BMI, and defining those with BMI over 23 kg/m 2 as overweight, as proposed by the World Health Organization, may be useful when applying current IOM recommendations to Japanese guidelines. Copyright © 2017 The Authors. Production and hosting by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Linong Ji
Full Text Available Differences exist between treatment recommendations regarding the choice of metformin as first-line therapy for type 2 diabetes patients according to body mass index (BMI. This study compared the efficacy of metformin monotherapy among normal-weight, overweight, and obese patients with newly diagnosed type 2 diabetes.In this prospective, multicenter, open-label study in China, patients aged 23-77 years were enrolled 1∶1:1 according to baseline BMI: normal-weight (BMI 18.5-23.9 kg/m(2; n = 125; overweight (BMI 24.0-27.9 kg/m(2; n = 122 or obese (BMI ≥28 kg/m(2; n = 124. Extended-release metformin was administered for 16 weeks (500 mg/day, up-titrated weekly to a maximum 2,000 mg/day. The primary efficacy endpoint was the effect of baseline BMI on glycemic control with metformin monotherapy, measured as the change from baseline in glycosylated hemoglobin (HbA1c at week 16 compared among BMI groups using ANCOVA. Other endpoints included comparisons of metformin's effects on fasting plasma glucose (FPG, lipid levels and body weight.Mean HbA1c decreases at week 16, adjusted for baseline values, were -1.84%, -1.78% and -1.78% in normal-weight, overweight and obese patients, (P = 0.664; body weight decreased by 2.4%, 3.9% and 3.5%, respectively. FPG levels decreased similarly over time in all BMI groups (P = 0.461 and changes from baseline in high-density lipoprotein cholesterol (HDL-C and low-density lipoprotein cholesterol (LDL-C did not differ significantly among BMI groups at week 16 (P = 0.143 and 0.451, respectively.Baseline BMI had no impact on glycemic control, weight change or other efficacy measures with metformin monotherapy. These data suggest that normal-weight type 2 diabetes patients would derive the same benefits from first-line treatment with metformin as overweight and obese patients, and are not at increased risk of excess weight loss.ClinicalTrials.gov NCT00778622.
Correlation of Index Finger Length (2D with Height, Weight and BMI in Adult Bangladeshi Male
Directory of Open Access Journals (Sweden)
Karim Rezwan Hasan
2017-05-01
Full Text Available Background: Human hand is one of the most versatile parts of the human body which plays an important role in modern medical science and evolutionary biology. By virtue of evolution and genetic arrangements, digital lengths vary from person to person according to age, sex, races, occupation or even environmental influences. It has been found that the digital lengths and their ratios are not same in different sexes and even in both hands of same individual. Specially, index to ring digit lengths and their ratios which already have been proved to represent sexual dimorphism may differ in both hands of an individual and show positive correlations with other morphological attributes like height, weight and BMI. Objectives: To analyze the variation of index finger (2D length and its correlation with height, weight and BMI in adult Bangladeshi male. Materials and Methods: This cross-sectional analytical study was conducted in the department of Anatomy, Dhaka Medical College, Dhaka from July 2012 to June 2013 on 100 male MBBS students (20−25 years of age. With the help of digital vernier caliper measurements of index finger length (2D was recorded. Height and weight were measured by the stadiometer and weighing scale respectively. BMI was calculated from height and weight. Pearson’s correlation analysis was done to find out the correlation of index finger length with height, weight and BMI. Results: Significant correlation has been found between the lengths of index fingers (2D and height (p0.05. Conclusion: In this study, we found variation in index finger lengths of both hands of Bangladeshi male subjects, which needs further study and comparison.
John Komlos; Marek Brabec
2010-01-01
The trend in the BMI values of the US population has not been estimated accurately because time series data are unavailable and because the focus has been on calculating period effects. In contrast to the prevailing strategies, we estimate the trend and rate of change of BMI values by birth cohorts stratified by gender and ethnicity born 1882-1986. We use loess additive regression models to estimate age and trend effects of BMI values of US-born black and white adults measured between 1959 an...
BMI and body fat mass is inversely associated with vitamin D levels in older individuals
Araghi, S.O.; Dijk, van S.C.; Ham, A.C.; Brouwer, E.M.; Enneman, A.W.; Sohl, E.; Swart, K.M.A.; Zwaluw, van der N.L.; Wijngaarden, van J.P.; Dhonukshe-Rutten, R.A.M.; Groot, de C.P.G.M.
2015-01-01
Objectives: To assess the association between obesity (measured by Body Mass Index (BMI) and fat percentage) and serum 25(OH)D levels in older persons. Design: Cross-sectional analysis of data from ‘the B-PROOF study’ (B-vitamins for the Prevention Of Osteoporotic Fractures). Participants: 2842
Physical Activity, BMI, and Blood Pressure in US Youth: NHANES 2003-2006.
Betz, Heather Hayes; Eisenmann, Joey C; Laurson, Kelly R; DuBose, Katrina D; Reeves, Mathew J; Carlson, Joseph J; Pfeiffer, Karin A
2018-03-15
The objective of this study was to examine the independent and combined association of physical activity and body mass index (BMI) with blood pressure in youth. Youth aged 8-18 years from the 2003-2006 National Health and Nutrition Examination Survey (NHANES) with BMI, blood pressure, and physical activity (accelerometer) were included in the analyses. A total of 2585 subjects (1303 males; 47% of all 8- to 18-year-olds) met these criteria. Obese youth had a systolic blood pressure that was 8 mm Hg higher than normal weight youth. A significant interaction between BMI and physical activity on blood pressure was found (P < .001), and group differences among the BMI/activity groups showed that the 3 obese groups and the overweight/least active group had significantly higher systolic blood pressure than the normal weight/active group across all analyses. The overweight/least active and normal weight/least active groups had significantly higher diastolic blood pressure than the normal weight/active group as well. This study showed a significant independent and combined association of BMI and physical activity with blood pressure in youth. Interventions need to focus on the reduction of fatness/BMI as a way to reduce the cardiovascular risk in youth.
Assessing the genetic overlap between BMI and cognitive function
Marioni, R E; Yang, J; Dykiert, D; Mõttus, R; Campbell, A; Ibrahim-Verbaas, Carla A; Bressler, Jan; Debette, Stephanie; Schuur, Maaike; Smith, Albert V; Davies, Gail; Bennett, David A; Deary, Ian J; Ikram, M Arfan; Launer, Lenore J; Fitzpatrick, Annette L; Seshadri, Sudha; van Duijn, Cornelia M; Mosely Jr, Thomas H; Davies, G; Hayward, C; Porteous, D J; Visscher, P M; Deary, I J
2016-01-01
Obesity and low cognitive function are associated with multiple adverse health outcomes across the life course. They have a small phenotypic correlation (r=−0.11; high body mass index (BMI)−low cognitive function), but whether they have a shared genetic aetiology is unknown. We investigated the phenotypic and genetic correlations between the traits using data from 6815 unrelated, genotyped members of Generation Scotland, an ethnically homogeneous cohort from five sites across Scotland. Genetic correlations were estimated using the following: same-sample bivariate genome-wide complex trait analysis (GCTA)–GREML; independent samples bivariate GCTA–GREML using Generation Scotland for cognitive data and four other samples (n=20 806) for BMI; and bivariate LDSC analysis using the largest genome-wide association study (GWAS) summary data on cognitive function (n=48 462) and BMI (n=339 224) to date. The GWAS summary data were also used to create polygenic scores for the two traits, with within- and cross-trait prediction taking place in the independent Generation Scotland cohort. A large genetic correlation of −0.51 (s.e. 0.15) was observed using the same-sample GCTA–GREML approach compared with −0.10 (s.e. 0.08) from the independent-samples GCTA–GREML approach and −0.22 (s.e. 0.03) from the bivariate LDSC analysis. A genetic profile score using cognition-specific genetic variants accounts for 0.08% (P=0.020) of the variance in BMI and a genetic profile score using BMI-specific variants accounts for 0.42% (P=1.9 × 10−7) of the variance in cognitive function. Seven common genetic variants are significantly associated with both traits at Pcognitive function. PMID:26857597
van Dongen, Jenny; Willemsen, Gonneke; Heijmans, Bastiaan T.; Neuteboom, Jacoline; Kluft, Cornelis; Jansen, Rick; Penninx, Brenda W.J.; Slagboom, P. Eline; de Geus, Eco J.C.; Boomsma, Dorret I.
2015-01-01
Background BMI discordant monozygotic (MZ) twins allows an examination of the causes and consequences of adiposity in a genetically controlled design. Few studies have examined longitudinal BMI discordance in MZ pairs. Objectives To study the development over time of BMI discordance in adolescent and adult MZ twin pairs, and to examine lifestyle, metabolic, inflammatory, and gene expression differences associated with concurrent and long-term BMI discordance in MZ pairs. Subjects/Methods BMI data from 2775 MZ twin pairs, collected in eight longitudinal surveys and a biobank project between 1991 and 2011, were analyzed to characterize longitudinal discordance. Lifestyle characteristics were compared within discordant pairs (ΔBMI ≥ 3 kg/m2) and biomarkers (lipids, glucose, insulin, CRP, fibrinogen, IL-6, TNF-α and sIL-6R and liver enzymes AST, ALT and GGT) and gene expression were compared in peripheral blood from discordant pairs who participated in the NTR biobank project. Results The prevalence of discordance ranged from 3.2% in 1991 (mean age=17, SD=2.4) to 17.4% (N=202 pairs) in 2009 (mean age=35, SD=15), and was 16.5% (N=174) among pairs participating in the biobank project (mean age=35, SD=12). Of 699 MZ with BMI data from 3-5 time points, 17 pairs (2.4%) were long-term discordant (at all available time points; mean follow-up range=6.4 years). Concurrently discordant pairs showed significant differences in self-ratings of which twin eats most (p=2.3×10−13), but not in leisure time exercise activity (p=0.28) and smoking (p>0.05). Ten out of 14 biomarkers showed significantly more unfavorable levels in the heavier of twin of the discordant pairs (p-values BMI discordance is uncommon in adolescent identical pairs but increases with higher pair-mean of BMI at older ages, although long-term BMI discordance is rare. In discordant pairs, the heavier twin had a more unfavorable blood biomarker profile than the genetically matched leaner twin, in support of
Skrzek, A; Kozieł, S; Ignasiak, Z
2014-06-01
The aim of this paper is to establish the optimal values of the body mass index (BMI) which would indicate the most favourable preservation of the bone mineral density in postmenopausal women. The material consists of the data of 369 healthy women aged between 40 and 88 years (mean age 67.84, SD=6.70) inhabitants of Wrocław, which were followed up between 2001 and 2006. The absolute measure of bone mineral density (BMD) of the femoral neck was assessed using dual energy X-ray absorptiometry (DEXA), expressed in g/(100mm(2)) and was transformed to T-score values. According to the value of BMI, the women were divided into eight groups, the reference group with value between 18.0 and 21.9kg/m(2) and seven other groups beginning with the value 22.0 with a 2-point interval. Postmenopausal status was defined according to the occurrence of menstruation within the last 360 days. The women with osteopenia and osteoporosis were pooled together and comprised the risk group, whereas the other women comprised the normal group (T-score values above -1.0). The adjusted odds ratio showed the highest value for intervals between 24.0 and 25.9 units of BMI, and the lowest value for interval 26.0-27.9 units of BMI. The Youden index showed the lowest value in the 26.0-27.9BMI kg/m(2) interval. For our sample the optimal value of BMI, with the lowest risk of osteopenia and/or osteoporosis was the value of 26.9kg/m(2). A further increase of BMI does not result in a favourable effect on the bones, it rather intensifies negative phenomena in the body resulting in the onset of many diseases. Copyright © 2014. Published by Elsevier GmbH.
Expression and clinicopathological significance of Mel-18 and Bmi-1 mRNA in gastric carcinoma.
Lu, You-Wei; Li, Jin; Guo, Wei-Jian
2010-11-08
The Polycomb group (PcG) genes are a class of regulators responsible for maintaining homeotic gene expression throughout cell division. PcG expression is deregulated in some types of human cancer. Both Bmi-1 and Mel-18 are of the key PcG proteins. We investigate the expression and clinicopathological roles of Mel-18 and Bmi-1 mRNA in gastric cancer. The expression of Mel-18 and Bmi-1 in a series of 71 gastric cancer tissues and paired normal mucosal tissues distant from the tumorous lesion was assayed by quantitative real time RT-PCR. The correlation between Mel-18 and Bmi-1 mRNA expression, and between Mel-18 or Bmi-1 mRNA level and clinicopathological characteristics were analyzed. Expression of Mel-18 and Bmi-1 genes was variably detected, but overexpression of Bmi-1 mRNA and decreased expression of Mel-18 mRNA were the most frequent alteration. In addition, the expression of Bmi-1 and Mel-18 mRNA inversely correlates in gastric tumors. Moreover, a significant positive correlation between Bmi-1 overexpression and tumor size, depth of invasion, or lymph node metastasis, and a significant negative correlation between Mel-18 low-expression with lymph node metastasis or the clinical stage were observed. Our data suggest that Mel-18 and Bmi-1 may play crucial but opposite roles in gastric cancer. Decreased Mel-18 and increased Bmi-1 mRNA expression was associated with the carcinogenesis and progression of gastric cancer. It is possible to list Bmi-1 and Mel-18 as biomarkers for predicting the prognosis of gastric cancer.
Directory of Open Access Journals (Sweden)
Angela D. Liese
2017-09-01
Full Text Available Low-income areas in which residents have poor access to healthy foods have been referred to as “food deserts.” It is thought that improving food access may help curb the obesity epidemic. Little is known about where residents of food deserts shop and if shopping habits are associated with body mass index (BMI. We evaluated the association of food shopping and acquisition (e.g., obtaining food from church, food pantries, etc. with BMI among 459 residents of low-income communities from two South Carolina counties, 81% of whom lived in United States Department of Agriculture-designated food deserts. Participants were interviewed about food shopping and acquisition and perceptions of their food environment, and weight and height were measured. Distances to food retail outlets were determined. Multivariable linear regression analysis was employed. Our study sample comprising largely African-American women had an average BMI of 32.5 kg/m2. The vast majority of study participants shopped at supermarkets (61% or supercenters/warehouse clubs (27%. Shopping at a supercenter or warehouse club as one’s primary store was significantly associated with a 2.6 kg/m2 higher BMI compared to shopping at a supermarket, independent of demographics, socioeconomics, physical activity, and all other food shopping/acquisition behaviors. Persons who reported shopping at a small grocery store or a convenience or dollar store as their tertiary store had a 2.6 kg/m2 lower BMI. Respondents who perceived lack of access to adequate food shopping in their neighborhoods as a problem had higher BMI. Living in a food desert census tract was not significantly associated with BMI. Other shopping attributes, including distance to utilized and nearest grocery stores, were not independently associated with BMI. These findings call into question the idea that poor spatial access to grocery stores is a key underlying factor affecting the obesity epidemic. Future research should
Liese, Angela D.; Ma, Xiaonan; Hutto, Brent; Sharpe, Patricia A.; Bell, Bethany A.; Wilcox, Sara
2017-01-01
Low-income areas in which residents have poor access to healthy foods have been referred to as “food deserts.” It is thought that improving food access may help curb the obesity epidemic. Little is known about where residents of food deserts shop and if shopping habits are associated with body mass index (BMI). We evaluated the association of food shopping and acquisition (e.g., obtaining food from church, food pantries, etc.) with BMI among 459 residents of low-income communities from two South Carolina counties, 81% of whom lived in United States Department of Agriculture-designated food deserts. Participants were interviewed about food shopping and acquisition and perceptions of their food environment, and weight and height were measured. Distances to food retail outlets were determined. Multivariable linear regression analysis was employed. Our study sample comprising largely African-American women had an average BMI of 32.5 kg/m2. The vast majority of study participants shopped at supermarkets (61%) or supercenters/warehouse clubs (27%). Shopping at a supercenter or warehouse club as one’s primary store was significantly associated with a 2.6 kg/m2 higher BMI compared to shopping at a supermarket, independent of demographics, socioeconomics, physical activity, and all other food shopping/acquisition behaviors. Persons who reported shopping at a small grocery store or a convenience or dollar store as their tertiary store had a 2.6 kg/m2 lower BMI. Respondents who perceived lack of access to adequate food shopping in their neighborhoods as a problem had higher BMI. Living in a food desert census tract was not significantly associated with BMI. Other shopping attributes, including distance to utilized and nearest grocery stores, were not independently associated with BMI. These findings call into question the idea that poor spatial access to grocery stores is a key underlying factor affecting the obesity epidemic. Future research should consider assessing
Liese, Angela D; Ma, Xiaonan; Hutto, Brent; Sharpe, Patricia A; Bell, Bethany A; Wilcox, Sara
2017-09-16
Low-income areas in which residents have poor access to healthy foods have been referred to as "food deserts." It is thought that improving food access may help curb the obesity epidemic. Little is known about where residents of food deserts shop and if shopping habits are associated with body mass index (BMI). We evaluated the association of food shopping and acquisition (e.g., obtaining food from church, food pantries, etc.) with BMI among 459 residents of low-income communities from two South Carolina counties, 81% of whom lived in United States Department of Agriculture-designated food deserts. Participants were interviewed about food shopping and acquisition and perceptions of their food environment, and weight and height were measured. Distances to food retail outlets were determined. Multivariable linear regression analysis was employed. Our study sample comprising largely African-American women had an average BMI of 32.5 kg/m². The vast majority of study participants shopped at supermarkets (61%) or supercenters/warehouse clubs (27%). Shopping at a supercenter or warehouse club as one's primary store was significantly associated with a 2.6 kg/m² higher BMI compared to shopping at a supermarket, independent of demographics, socioeconomics, physical activity, and all other food shopping/acquisition behaviors. Persons who reported shopping at a small grocery store or a convenience or dollar store as their tertiary store had a 2.6 kg/m² lower BMI. Respondents who perceived lack of access to adequate food shopping in their neighborhoods as a problem had higher BMI. Living in a food desert census tract was not significantly associated with BMI. Other shopping attributes, including distance to utilized and nearest grocery stores, were not independently associated with BMI. These findings call into question the idea that poor spatial access to grocery stores is a key underlying factor affecting the obesity epidemic. Future research should consider assessing
Tittlbach, Susanne A; Jekauc, Darko; Schmidt, Steffen C E; Woll, Alexander; Bös, Klaus
2017-09-01
This study's aims were to describe the development of physical activity, physical fitness (PF), subjective (physical complaints (PC)) and objective (Body mass index (BMI)) health measures and to examine the relationship between the development trajectories. In addition, the study also aimed to assess the influence of sociodemographic determinants (age, sex, socioeconomic status (SES)) in German adults over a period of 18 years. The longitudinal study population comprises of 721 men and women, aged 33-76 years over the study period. There was self-report of physical activity and PC and testing of physical fitness and BMI in each study year (1992, 1997, 2002 and 2010). Latent growth curve models were used to analyse the development. Physical activity slightly increased while fitness, PC and BMI worsened over the course of 18 years. Sex, age and SES play important roles concerning physical activity, fitness and health. Several integrative associations could be detected between physical activity, fitness, PC and BMI as well as their trajectories. In particular, high initial levels of physical activity and fitness protect from high PC and BMI.The slope of physical activity was not significantly associated with slopes of fitness, PC and BMI. However, increase of fitness resulted in decrease of PC. A general positive development regarding the amount of physical activity could be detected. However, if it is only an unsystematic increase of physical activity, this is not in itself enough to achieve health benefits. The strengthening of fitness should be focused when increasing physical activity, since only then a health benefit is possible.
Kent, Lillian M; Worsley, Anthony
2009-04-01
To examine the effect of Seventh-day Adventist (SDA) membership on 'immunity' to the secular effects of changes in BMI. Three independent, cross-sectional, screening surveys conducted by Sydney Adventist Hospital in 1976, 1986 and 1988 and a survey conducted among residents of Melbourne in 2006. Two hundred and fifty-two SDA and 464 non-SDA in 1976; 166 SDA and 291 non-SDA in 1986; 120 SDA and 300-non SDA in 1988; and 251 SDA and 294 non-SDA in 2006. Height and weight measured by hospital staff in 1976, 1986 and 1988; self-reported by respondents in 2006. The mean BMI of non-SDA men increased between 1986 and 2006 (P < 0.001) but did not change for SDA men or non-SDA women. Despite small increases in SDA women's mean BMI (P = 0.030) between 1988 and 2006, this was no different to that of SDA men and non-SDA women in 2006. The diet and eating patterns of SDA men and women were more 'prudent' than those of non-SDA men and women, including more fruit, vegetables, grains, nuts and legumes, and less alcohol, meat, sweetened drinks and coffee. Many of these factors were found to be predictors of lower BMI. The 'prudent' dietary and lifestyle prescriptions of SDA men appear to have 'immunised' them to the secular effects of changes that occurred among non-SDA men's BMI. The dietary and lifestyle trends of SDA women did not reflect the increase in their BMI observed in 2006.
2-Year BMI Changes of Children Referred for Multidisciplinary Weight Management
Directory of Open Access Journals (Sweden)
Jennifer K. Cheng
2014-01-01
Full Text Available Objective. To examine body mass index (BMI changes among pediatric multidisciplinary weight management participants and nonparticipants. Design. In this retrospective database analysis, we used multivariable mixed effect models to compare 2-year BMI z-score trajectories among 583 eligible overweight or obese children referred to the One Step Ahead program at the Boston Children’s Primary Care Center between 2003 and 2009. Results. Of the referred children, 338 (58% attended the program; 245 (42% did not participate and were instead followed by their primary care providers within the group practice. The mean BMI z-score of program participants decreased modestly over a 2-year period and was lower than that of nonparticipants. The group-level difference in the rate of change in BMI z-score between participants and nonparticipants was statistically significant for 0–6 months (P=0.001 and 19–24 months (P=0.008; it was marginally significant for 13–18 months (P=0.051 after referral. Younger participants (<5 years had better outcomes across all time periods examined. Conclusion. Children attending a multidisciplinary program experienced greater BMI z-score reductions compared with usual primary care in a real world practice; younger participants had significantly better outcomes. Future research should consider early intervention and cost-effectiveness analyses.
Fitness differences according to BMI categories: a new point of view.
Lovecchio, Nicola; Zago, Matteo
2018-03-06
Many studies have reported negative association between fitness level and BMI categories but the lack of body weight correction and and the systematic use of physical endurance test made these differences controversial. Thus, the aim of this study was the assessment of physical fitness level associated to BMI using alternative tests. BMI was calculated as body mass/stature2 while fitness level was assessed using field test. In particular, Sit and Reach (SAR), Standing Broad Jump (SBJ), Shuttle Run Test 5mx 10 (SHR), Sit ups (SUP), Bent arm hang (BAH) were assessed in 2545 students. Subsequently, normal weight/overweight/obesity/underweight/thinness students were classified according to the cut-off points defined in literature and then the relative fitness results. The performances in SBJ showed very low differences between BMI categories such as for SUP test. The effects size in SHR were low or close to moderate while in BAH thin students revealed high performance than normal/overweight peers. In SAR test no clear trends in the BMI categories were observed. All test (exluding BAH) were similar for normal, overweight and thin students. This finding can be useful to teachers to encourage over/under-weighted students to adopt active life style because they are close to normal weight counterparts.
Antoniou, Evangelia E; Bongers, Peggy; Jansen, Anita
2017-08-01
Obesity and depression have important health implications. Although there is knowledge about the moderators of the depression-obesity association, our understanding of the potential behavioral and cognitive mediators that may explain the relationship between depression and obesity, is scarcely researched. The aim of this study is to investigate the mediating role of emotional eating and dichotomous thinking in the depression-obesity relationship. Data on 205 individuals from a community-based study conducted at Maastricht University, Netherlands were used. Self-reported data on depression, emotional eating and dichotomous thinking were collected and BMI scores were calculated in a cross-sectional research design. Correlations between variables were calculated. The primary analysis tested the hypothesis that depression has an effect on BMI through dichotomous thinking and emotional eating. A two-mediator model was used to predict the direct and indirect effects of emotional eating and dichotomous thinking on the depression-BMI relationship. Depression was positively correlated with BMI (r=0.21, p=0.005), emotional eating (r=0.38, pemotional eating were positively correlated with BMI (r=0.35, pemotional eating (Z=3.92 pemotional eating and dichotomous thinking might be useful in guiding assessment and treatment protocols for weight management. The present study adds to the existing literature on the role of dysfunctional cognitions and emotions on eating behavior, and particularly to the factors that may impede people's ability to control their eating. Copyright © 2017 Elsevier Ltd. All rights reserved.
BMI and Body Fat Mass Is Inversely Associated with Vitamin D Levels in Older Individuals
Oliai Araghi, S.; van Dijk, S. C.; Ham, A. C.; Brouwer-Brolsma, E. M.; Enneman, A. W.; Sohl, E.; Swart, K. M. A.; van der Zwaluw, N. L.; van Wijngaarden, J. P.; Dhonukshe-Rutten, R. A. M.; van Schoor, N. M.; Zillikens, M. C.; Lips, P.; de Groot, L.; Uitterlinden, A. G.; van der Velde, N.
2015-01-01
To assess the association between obesity (measured by Body Mass Index (BMI) and fat percentage) and serum 25(OH)D levels in older persons. Cross-sectional analysis of data from 'the B-PROOF study' (B-vitamins for the Prevention Of Osteoporotic Fractures). 2842 participants aged 65 years and older.
Sijtsma, Anna; Bocca, Gianni; L'abée, Carianne; Liem, Eryn T; Sauer, Pieter J J; Corpeleijn, Eva
Objective: To assess whether waist-to-height-ratio (WHtR) is a better estimate of body fat percentage (BF %) and a better indicator of cardiometabolic risk factors than BMI or waist circumference (WC) in young children. Methods: WHtR, WC and BMI were measured by trained staff according to
BMI and obesity incidence in relation to food patterns of Polish older people
DEFF Research Database (Denmark)
Wadolowska, L.; Danowska-Oziewicz, M.; Niedzwiedzka, E.
2006-01-01
BMI differentiation and obesity incidence in relation to food patterns of Polish older people were analysed. The research included 422 people aged 65+ years. 21 food patterns were separated by the factor analysis. On the basis of the self-reported body mass and height, the BMI and percentages...... of overweight or obese people were calculated. The increase of the BMI and overweight and obesity incidence for both sexes was unequivocally connected with eating rye. The increase of the BMI and overweight and obesity incidence depended among women on consuming pork meat and alcoholic beverages. For men...
Meta-analysis of genome-wide linkage studies in BMI and obesity
Saunders, Catherine L.; Chiodini, Benedetta D.; Sham, Pak; Lewis, Cathryn M.; Abkevich, Victor; Adeyemo, Adebowale A.; de Andrade, Mariza; Arya, Rector; Berenson, Gerald S.; Blangero, John; Boehnke, Michael; Borecki, Ingrid B.; Chagnon, Yvon C.; Chen, Wei; Comuzzie, Anthony G.; Deng, Hong-Wen; Duggirala, Ravindranath; Feitosa, Mary F.; Froguel, Philippe; Hanson, Robert L.; Hebebrand, Johannes; Huezo-Dias, Patricia; Kissebah, Ahmed H.; Li, Weidong; Luke, Amy; Martin, Lisa J.; Nash, Matthew; Ohman, Muena; Palmer, Lyle J.; Peltonen, Leena; Perola, Markus; Price, R. Arlen; Redline, Susan; Srinivasan, Sathanur R.; Stern, Michael P.; Stone, Steven; Stringham, Heather; Turner, Stephen; Wijmenga, Cisca; Collier, David A.
Objective: The objective was to provide an overall assessment of genetic linkage data of BMI and BMI-defined obesity using a nonparametric genome scan meta-analysis. Research Methods and Procedures: We identified 37 published studies containing data on over 31,000 individuals from more than >10,000
Cardiorespiratory fitness, BMI, and risk of hypertension: the HYPGENE study.
Rankinen, Tuomo; Church, Timothy S; Rice, Treva; Bouchard, Claude; Blair, Steven N
2007-10-01
Cardiorespiratory fitness and regular physical activity are inversely associated with the risk of hypertension, and exercise training has been shown to lower elevated blood pressure (BP). Genetic factors contribute significantly to the interindividual differences in endurance training-induced changes in BP. However, similar data on the genotype-by-fitness interactions on the risk of hypertension are scarce. In 2000, we started a systematic collection of blood samples from all consenting subjects of the Aerobics Center Longitudinal Study (ACLS) with a goal to generate a resource for studies addressing genotype-by-fitness interaction effects on various health-related end points. Here, we introduce the rationale and design of the first study based on the ACLS genetics resource focusing on hypertension as the health outcome (HYPGENE study), and we report the associations of cardiorespiratory fitness and body mass index (BMI) with the risk of hypertension. All HYPGENE subjects (N = 1234) were healthy and normotensive at their first clinic visit. Cases (N = 629) developed hypertension during the follow-up period (mean 8.7 yr), whereas controls (N = 605) remained normotensive (mean follow-up 10.1 yr). Cardiorespiratory fitness was the strongest predictor of the hypertension risk, with each maximal metabolic equivalent unit being associated with a 19% lower risk (95% confidence interval [95% CI], 12-24%). Each baseline BMI unit was associated with a 9% higher hypertension risk (95% CI, 4-13%). However, the association of BMI was greatly attenuated (odds ratio 1.04 [95% CI, 0.99-1.09]) when fitness also was included in the model. The HYPGENE study will provide an excellent resource to address hypotheses regarding the genetic basis of hypertension while taking cardiorespiratory fitness level into account.
Desirable factors for maintaining normal BMI of urban affluent women of Delhi.
Gupta, Anu Taneja; Siddhu, Anupa
2015-01-01
The study aimed to identify desirable social, familial, reproductive, dietary, and lifestyle factors for maintaining normal body mass index (BMI) of urban affluent women (25-45 years) in Delhi, India. A total of 387 urban affluent women with at least one living child participated in this cross-sectional study conducted from March 2008 to April 2010. Women were classified into four BMI categories on the basis of World Health Organization (WHO; 2004) classification for Asians. Significant factors for maintaining normal BMI were: Younger age, less parity, nuclear family, normal weight status of parents, postpartum weight gain between 2 and 3 kg, regularity in taking meals, fixed meal size, self-perceived normal weight, and shorter sitting time and television viewing time. Multivariate regression analysis identified five determining factors for maintaining BMI, which are normal weight of father, self-perceived normal weight, fixed meal size, sitting time less than 6 h/day, and television viewing time less than 1 h/day. By small lifestyle modifications, normal BMI can be maintained.
Ng, Tiffany; McMahan, Shari; Mouttapa, Michele; Tanjasiri, Sora Park; Beam, William
2009-01-01
Background: The World Health Organization released lower Body Mass Index (BMI) cutoff points for Asian individuals to account for increased body fat percentage (BF%) and risk of obesity-related conditions at a lower body mass index. Purpose: This preliminary study: (1) explores the impact of utilizing Asian BMI standards (compared to universal…
Risk of a venous thromboembolic episode due to caesarean section and BMI
DEFF Research Database (Denmark)
Colmorn, Lotte Berdiin; Ladelund, S; Rasmussen, S
2014-01-01
BMI significantly influences the risk of venous thromboembolism after emergency caesarean delivery compared with vaginal delivery.......BMI significantly influences the risk of venous thromboembolism after emergency caesarean delivery compared with vaginal delivery....
BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.
Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B
2015-01-01
BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.
Increased genetic variance of BMI with a higher prevalence of obesity
DEFF Research Database (Denmark)
Rokholm, Benjamin; Silventoinen, Karri; Ängquist, Lars
2011-01-01
populations. Several recent studies suggest that the genetic effects on adiposity may be stronger when combined with presumed risk factors for obesity. We tested the hypothesis that a higher prevalence of obesity and overweight and a higher BMI mean is associated with a larger genetic variation in BMI....
Nilsen, Bente B; Yngve, Agneta; Werner, Bo
2018-02-06
This study investigated whether substantial body mass index (BMI) reductions in Swedish schoolchildren aged seven years to 19 years, caused by disease, healthy or unhealthy behaviour, had any impact on their final height. We used height and weight data on 6572 subjects from two nationally representative longitudinal samples of Swedish children born in 1973 and 1981. These provided information on their final height and any BMI reduction episodes. Of the 6572 subjects (50.9% boys), among individuals with information on final height, 1118 had a BMI reduction of 5% and BMI reduction of 10% or more. On a group level, there was no statistically significant difference in the final height of individuals with BMI reductions of 10% or more and those without. The findings were independent of age and the subject's BMI at the start of the reduction episode. However, there were a number of cases where a substantial BMI reduction probably had an impact on the subject's final height. Our study found no evidence that a substantial BMI reduction had any impact on final height on a group level, but further analyses of specific case studies are necessary to determine whether substantial BMI reduction might have an impact on final height. ©2018 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.
Wick, K; Hölling, H; Schlack, R; Bormann, B; Brix, C; Sowa, M; Strauss, B; Berger, U
2011-06-01
The decision to measure or to ask about data concerning height and weight in order to calculate body mass index (BMI) has an influence on the economy and validity of the measurements. Although self-reported information is less expensive, this information may possibly have a bias on the determined prevalences of different weight groups. Using representative data from the KiGGS study with a comparison of directly measured and self-reported BMI data, Kurth and Ellert (2010) developed two correction formulas for prevalences resulting from self-reported information. The aim of the study was to examine the practicability of the proposed correction formulas on our own data concerning self-reported BMI data of 11- to 13-year-old girls (n=1,271) and to assess the plausibility of the corrected measurements. As a result, the prevalences of our own data changed in the expected direction both for underweight and for overweight. Both formulas were found to be practicable, the consideration of the subjective weight status (formula 2) resulted in a greater change in prevalences compared to the first correction formula.
The relation of weight suppression and BMI to bulimic symptoms.
Butryn, Meghan L; Juarascio, Adrienne; Lowe, Michael R
2011-11-01
High levels of weight suppression have been associated with greater binge eating and weight gain as well as poorer treatment outcome in bulimia nervosa. This study examined the relationship between weight suppression and bulimia nervosa symptoms and explored how weight suppression might interact with body mass index (BMI) in accounting for level of symptomatology at presentation for treatment. Participants were 64 women with threshold or sub-threshold bulimia nervosa. A clinical interview assessed binge eating and purging. Weight suppression and the interaction between BMI and weight suppression predicted frequency of binge eating such that participants with low BMI and high weight suppression engaged in the most binge eating. High levels of weight suppression also predicted more frequent purging. Additional research is warranted to examine mediators of these relationships. Copyright © 2010 Wiley Periodicals, Inc.
Scaling of adult body weight to height across sex and race/ethnic groups: relevance to BMI.
Heymsfield, Steven B; Peterson, Courtney M; Thomas, Diana M; Heo, Moonseong; Schuna, John M; Hong, Sangmo; Choi, Woong
2014-12-01
Body mass index (BMI) is formulated on the assumption that body weight (BW) scales to height with a power of 2 (BW∝height(2)), independent of sex and race-ethnicity. Powers differing from 2 are observed in studies of selected samples, thus raising the question if BMI is a generalizable metric that makes BW independent of height across populations. The objectives were to test the hypothesis that adult BW scales to height with a power of 2 independent of sex and race-ethnicity and to advance an understanding of BMI as a measure of shape by extending allometric analyses to waist circumference (WC). We conducted cross-sectional subject evaluations, including body composition, from the NHANES and the Korean NHANES (KNHANES). Variations of the allometric model (Y = αX(β)) were used to establish height scaling powers (β ± SE) across non-Hispanic white and black, Mexican American, and Korean men and women. Exploratory analyses in population samples established age and adiposity as important independent determinants of height scaling powers (i.e., β). After age and adiposity in the next series of analyses were controlled for, BW scaling powers were nonsignificantly different between race/ethnic groups within each sex group; WC findings were similar in women, whereas small but significant between-race differences were observed in the men. Sex differences in β values were nonsignificant except for BW in non-Hispanic blacks and WC in Koreans (P ethnic groups, an observation that makes BMI a generalizable height-independent measure of shape across most populations. WC also follows generalizable scaling rules, a finding that has implications for defining body shape in populations who differ in stature. © 2014 American Society for Nutrition.
Relation between BMI and diabetes mellitus and its complications among US older adults.
Gray, Natallia; Picone, Gabriel; Sloan, Frank; Yashkin, Arseniy
2015-01-01
This study examined relations between elevated body mass index (BMI) and time to diagnosis with type 2 diabetes mellitus and its complications among older adults in the United States. Data came from the Medicare Current Beneficiary Survey, 1991-2010. A Cox proportional hazard model was used to assess relations between excess BMI at the first Medicare Current Beneficiary Survey interview and time to diabetes mellitus diagnosis, complications, and insulin dependence among Medicare beneficiaries, older than 65 years of age with no prior diabetes mellitus diagnosis, and who were not enrolled in Medicare Advantage (N = 14,657). Among individuals diagnosed as having diabetes mellitus, elevated BMIs were associated with a progressively higher risk of complications from diabetes mellitus. For women with a BMI ≥40, the risk of insulin dependence (hazard ratio [HR] 3.57; 95% confidence interval [CI] 2.36-5.39) was twice that for women with 25 ≤ BMI diabetes mellitus. For men, the increased risk of these complications occurred at higher BMI levels than in women. Ocular complications occurred at higher BMI levels than other complication types in both men and women.
No seasonality of birth in BMI at 7 years of age
DEFF Research Database (Denmark)
Jensen, Camilla Bjørn; Sørensen, Thorkild I.A.; Heitmann, Berit
2016-01-01
Seasonal variation in birth weight was found in a previous Danish study. In the present study we investigated if the seasonality in birth weight tracked into BMI at 7 years of age, but found no seasonality of birth in either BMI, overweight, or obesity. © 2016 Elsevier Ireland Ltd...
Codispoti, Bruna; Rinaldo, Nicola; Chiarella, Emanuela; Lupia, Michela; Spoleti, Cristina Barbara; Marafioti, Maria Grazia; Aloisio, Annamaria; Scicchitano, Stefania; Giordano, Marco; Nappo, Giovanna; Lucchino, Valeria; Moore, Malcolm A S; Zhou, Pengbo; Mesuraca, Maria; Bond, Heather Mandy; Morrone, Giovanni
2017-07-04
Transplantation of hematopoietic stem cells (HSCs) is a well-established therapeutic approach for numerous disorders. HSCs are typically derived from bone marrow or peripheral blood after cytokine-induced mobilization. Umbilical cord blood (CB) represents an appealing alternative HSC source, but the small amounts of the individual CB units have limited its applications. The availability of strategies for safe ex vivo expansion of CB-derived HSCs (CB-HSCs) may allow to extend the use of these cells in adult patients and to avoid the risk of insufficient engraftment or delayed hematopoietic recovery.Here we describe a system for the ex vivo expansion of CB-HSCs based on their transient exposure to a recombinant TAT-BMI-1 chimeric protein. BMI-1 belongs to the Polycomb family of epigenetic modifiers and is recognized as a central regulator of HSC self-renewal. Recombinant TAT-BMI-1 produced in bacteria was able to enter the target cells via the HIV TAT-derived protein transduction peptide covalently attached to BMI-1, and conserved its biological activity. Treatment of CB-CD34+ cells for 3 days with repeated addition of 10 nM purified TAT-BMI-1 significantly enhanced total cell expansion as well as that of primitive hematopoietic progenitors in culture. Importantly, TAT-BMI-1-treated CB-CD34+ cells displayed a consistently higher rate of multi-lineage long-term repopulating activity in primary and secondary xenotransplants in immunocompromised mice. Thus, recombinant TAT-BMI-1 may represent a novel, effective reagent for ex vivo expansion of CB-HSC for therapeutic purposes.
Tambelli, Renata; Cerniglia, Luca; Cimino, Silvia; Ballarotto, Giulia; Paciello, Marinella; Lubrano, Carla; Marchitelli, Serena; Gnessi, Lucio; Lenzi, Andrea
2017-04-26
The present study aimed to assess the psychological profiles of adult male and female obese patients, as well as to verify the possible influence of their psychopathological risk and impulsivity on their body mass index (BMI) and perceived quality of life. A total of 64 obese subjects accessing a center for care of their obesity were assessed through anthropometric and psychometric measurements. All anthropometric measures in men were higher than in women, while in turn, women showed higher psychopathological symptoms. Furthermore, the symptoms of somatization and psychoticism were predictors for a higher BMI in men, but there was no effect of psychopathological symptoms on the perceived quality of life (QoL) of male subjects. Moreover, in women, somatization and attentional impulsivity were predictors for a higher BMI, whereas no correlation was found between their psychopathological risk and perceived QoL. The results of regression analysis underlined that somatization is a "core" psychopathological symptom in obese subjects regardless of their sex, which is a potential predictor for a higher BMI. The psychological difficulties of the subjects had no effect on their perceived QoL, suggesting that they find it difficult to reflect on the impact that obesity has on their life.
Effect of body weight and BMI on the efficacy of levonorgestrel emergency contraception.
Kapp, Nathalie; Abitbol, Jean Louis; Mathé, Henri; Scherrer, Bruno; Guillard, Hélène; Gainer, Erin; Ulmann, André
2015-02-01
To further evaluate the effect of weight and body mass index (BMI) on the efficacy of levonorgestrel emergency contraception. Data from two large, multicenter, randomized controlled trials designed to assess emergency contraceptive efficacy were pooled to evaluate the effect of weight and BMI on pregnancy rates among women who received levonorgestrel. Descriptive methods (comparison of means and distributions according to pregnancy status and pregnancy rates across weight and BMI categories) as well as cubic spline modeling were used to describe the relationship between pregnancy risk and weight/BMI. The analysis population comprised 1731 women, among whom 38 pregnancies were reported. Women for whom levonorgestrel was not effective in preventing pregnancy had a significantly higher mean body weight and BMI than women who did not become pregnant (76.7 vs. 66.4 kg, p85 kg groups, respectively. Statistical modeling demonstrated a steep increase in pregnancy risk starting from a weight near 70-75 kg to reach a risk of pregnancy of 6% or greater around 80 kg. Similar results were obtained for statistical modeling of BMI as well as when the two studies were analyzed individually. All analyses showed a significant drop in the efficacy of levonorgestrel emergency contraception with increasing body weight, with pregnancy risk in the higher weight categories similar to expected rates in the absence of contraception. Like body weight, increasing BMI was highly correlated with increased pregnancy risk. Copyright © 2015 Elsevier Inc. All rights reserved.
BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.
Directory of Open Access Journals (Sweden)
Mehdi Hayat Shahi
Full Text Available BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA. Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17 expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.
Are associations between electronic media use and BMI different across levels of physical activity?
DEFF Research Database (Denmark)
Melkevik, Ole; Haug, Ellen; Rasmussen, Mette
2015-01-01
and girls who did not comply with physical activity guidelines. Among physically active adolescents, EM was found to be significantly associated with BMI or odds for overweight among girls, but not among boys. CONCLUSION: While the usage of EM appear to be inconsequential for BMI and the risk of overweight...... among physically active boys, we find evidence indicating that EM use is associated with BMI and risk for overweight among girls, including those who report complying with MVPA guidelines.......BACKGROUND: The use of electronic media has been found to be a risk factor for higher BMI and for being overweight. Physical activity has been found to be associated with lower BMI and lower risk for being overweight. Little is known about whether the associations between physical activity...
The association of plasma cysteine and gamma-glutamyltransferase with BMI and obesity.
LENUS (Irish Health Repository)
Elshorbagy, Amany K
2009-07-01
We recently reported a strong positive association of plasma total cysteine (tCys) with fat mass in over 5,000 subjects. As gamma-glutamyltransferase (GGT) enzyme increases cysteine availability by catalyzing glutathione breakdown and is positively associated with BMI and adiposity, we hypothesized that GGT might explain the association of tCys with adiposity. To study whether the associations of tCys and serum GGT with BMI and obesity were interrelated we conducted a cross-sectional study using data from 1,550 subjects recruited from nine European countries in the COMAC project. Multiple linear and logistic regression models and concentration-response curves were used. In age and sex-adjusted analyses, tCys showed strong positive associations with BMI (partial r = 0.19, P < 0.001), and obesity (odds ratio (OR) for 4th vs. 1st tCys quartile: 2.8; 95% confidence interval: 1.6-5.0, P < 0.001), both of which remained robust after adjustment for GGT and other metabolic and lifestyle confounders. Serum GGT was also a positive predictor of BMI (partial r = 0.17, P < 0.001) and obesity (OR for 4th vs. 1st GGT quartile: 4.8; 95% confidence interval: 2.5-9.2, P < 0.001), independent of tCys. However, the associations of GGT with BMI and obesity were weakened by adjustment for obesity-related factors such as serum lipids and blood pressure. These results indicate that tCys is a strong positive predictor of BMI and obesity, independent of GGT and other obesity-related factors. We also suggest that the association of serum GGT with BMI and obesity is unrelated to the role of GGT in cysteine turnover. The potential link between cysteine and fat metabolism should be further evaluated.
Difficulty buying food, BMI, and eating habits in young children.
Fuller, Anne; Maguire, Jonathon L; Carsley, Sarah; Chen, Yang; Lebovic, Gerald; Omand, Jessica; Parkin, Patricia; Birken, Catherine S
2018-01-22
To determine whether parent report of difficulty buying food was associated with child body mass index (BMI) z-score or with eating habits in young children. This was a cross-sectional study in primary care offices in Toronto, Ontario. Subjects were children aged 1-5 years and their caregivers, recruited through the TARGet Kids! Research Network from July 2008 to August 2011. Regression models were developed to test the association between parent report of difficulty buying food because of cost and the following outcomes: child BMI z-score, parent's report of child's intake of fruit and vegetables, fruit juice and sweetened beverages, and fast food. Confounders included child's age, sex, birth weight, maternal BMI, education, ethnicity, immigration status, and neighbourhood income. The study sample consisted of 3333 children. Data on difficulty buying food were available for 3099 children, and 431 of these (13.9%) were from households reporting difficulty buying food. There was no association with child BMI z-score (p = 0.86). Children from households reporting difficulty buying food (compared with never having difficulty buying food) had increased odds of consuming three or fewer servings of fruits and vegetables per day (odds ratio [OR]: 1.31, 95% confidence interval [CI]: 1.03-1.69), more than one serving of fruit juice/sweetened beverage per day (OR: 1.60, 95% CI: 1.28-2.00), and, among children 1-2 years old, one or more servings of fast food per week (OR: 2.91, 95% CI: 1.67-5.08). Parental report of difficulty buying food is associated with less optimal eating habits in children but not with BMI z-score.
Waist circumference, BMI, and lung function in 8-year-old children : The PIAMA birth cohort study
Bekkers, Marga B. M.; Wijga, Alet H.; de Jongste, Johan C.; Kerkhof, Marjan; Postma, Dirkje; Gehring, Ulrike; Smit, Henriette A.; Brunekreef, Bert
Background Body mass index (BMI) and waist circumference (WC) may be associated with lung function in children, as observed in adults. Methods Height, weight, waist circumference, and lung function (FVC and FEV1) were measured during a medical examination in 1,058 eight-year-old children
Directory of Open Access Journals (Sweden)
Shoukri Mohammed
2010-05-01
Full Text Available Abstract Background The prevalence of obesity and overweight is increasing globally. Frequently coexisting with under-nutrition in developing countries, obesity is a major contributor to chronic disease, and will become a serious healthcare burden especially in countries with a larger percentage of youthful population. 35% of the population of Saudi Arabia are under the age of 16, and adult dietary preferences are often established during early childhood years. Our objective was to examine the dietary habits in relation to body-mass-index (BMI and waist circumference (W_C, together with exercise and sleep patterns in a cohort of male and female Saudi school children, in order to ascertain whether dietary patterns are associated with obesity phenotypes in this population. Methods 5033 boys and 4400 girls aged 10 to 19 years old participated in a designed Food Frequency Questionnaire. BMI and W_C measurements were obtained and correlated with dietary intake. Results The overall prevalence of overweight and obesity was 12.2% and 27.0% respectively, with boys having higher obesity rates than girls (P ≤ 0.001. W_C and BMI was positively correlated with sugar-sweetened carbonated beverage (SSCB intake in boys only. The association between male BMI and SSCB consumption was significant in a multivariate regression model (P Conclusions A higher intake of SSCB is associated with poor dietary choices. Male SSCB intake correlates with a higher W_C and BMI. Limiting exposure to SSCB could therefore have a large public health impact.
Metabolic health across the BMI spectrum in HIV-infected and HIV-uninfected men.
Lake, Jordan E; Li, Xiuhong; Palella, Frank J; Erlandson, Kristine M; Wiley, Dorothy; Kingsley, Lawrence; Jacobson, Lisa P; Brown, Todd T
2018-01-02
In the general population, metabolic health often declines as BMI increases. However, some obese individuals maintain metabolic health. HIV and antiretroviral therapy have been associated with metabolic disturbances. We hypothesized that HIV-infected (HIV) men on suppressive antiretroviral therapy experience less metabolic health than HIV-uninfected (HIV) men across all BMI categories. In a cross-sectional analysis of 1018 HIV and 1092 HIV men enrolled in the multicenter AIDS cohort study, Poisson regression with robust variance determined associations between HIV serostatus and metabolic health prevalence (defined as meeting ≤2 of 5 National Cholesterol Education Program Adult Treatment Panel III metabolic syndrome criteria), adjusting for age, race, BMI category, smoking, and hepatitis C virus infection status. HIV men were younger (54 vs. 59 years) and had lower median BMI (25 vs. 27 kg/m). Nonobese HIV men had lower metabolic health prevalence than HIV men (BMI ≤25 kg/m: 80 vs. 94%, P BMI 25-29 kg/m: 64 vs. 71%, P = 0.05), but metabolic health prevalence among obese men did not differ by HIV serostatus (BMI 30-34 kg/m: 35 vs. 39%, P = 0.48; BMI ≥35 kg/m: 27 vs. 25%, P = 0.79). In the adjusted model, nonobese HIV men were less likely to demonstrate metabolic health than nonobese HIV men. Among HIV men, per year darunavir, zidovudine, and stavudine use were associated with lower metabolic health likelihood. Metabolically healthy obesity prevalence does not differ by HIV serostatus. However, among nonobese men, HIV infection is associated with lower metabolic health prevalence, with associations between lack of metabolic health and darunavir and thymidine analog nucleoside reverse transcriptase inhibitor exposure observed.
BMI and waist circumference as indicators of health among Samoan women.
Novotny, Rachel; Nabokov, Vanessa; Derauf, Christopher; Grove, John; Vijayadeva, Vinutha
2007-08-01
High rates of obesity and chronic disease make establishment of effective indicators of risk for chronic disease important. The objective was to examine adequacy of anthropometric cut-off points as indicators of risk for chronic disease among Samoan women in Hawaii. A cross-sectional survey of 55 Samoan women 18 to 28 years of age that included blood lipids, cholesterol, and glucose (including after a 2-hour oral glucose test); anthropometry (weight, height, waist circumference); and DXA of body composition. Using the Centers for Disease Control and Prevention (CDC)/World Health Organization (WHO) cut-off points for BMI, 22% of women were overweight and 58% were obese. Cholesterol, lipid, and glucose values were all linearly related to DXA body fat, BMI, and waist circumference. BMI and waist circumference at WHO/NIH cut-off points predicted levels of blood lipids and glucose that indicate elevated risk for disease. WHO/NIH cut-off points for BMI and waist circumference reflect risk indicators of chronic disease among young Samoan women in Hawaii.
Folkvord, Frans; Anschütz, Doeschka J; Buijzen, Moniek
2016-02-09
Previous studies have focused on the acute effects of food advertisements on the caloric intake of children; however, the long-term effects of this food cue reactivity on weight gain have not been examined. The main aim of this study was to explore if reactivity to food cues in an advertisement was associated with weight status two years later. Children wo had previously taken part in an experiment investigating the impact of advergames on food intake had their height and weight re-measured two years later, for assessment of body mass index (BMI). A within-subject design was used to test the associations between food choices and BMI over time. In the previous experiment, children played an advergame that promoted energy-dense snacks, fruit, or nonfood products, or did not play an advergame (control condition). After playing the game, the free intake of energy-dense snacks and fruits was measured. Children who ate more apple after playing an advergame promoting energy-dense snacks had a lower BMI two years later. Consumption of energy-dense snacks after playing an advergame promoting energy-dense snacks was not associated with BMI two years later. In other condition, no association was found between food intake and BMI after two years . The findings suggest that coping with environmental cues that trigger unhealthy eating behavior is associated with the body mass index of young children two years later. This might imply that learning to respond to food cues by choosing healthy options might prevent children from excessive weight gain. This trial was registered at as ISRCTN17013832 .
Kosti, Rena I; Panagiotakos, Demosthenes B; Zampelas, Antonis; Mihas, Costas; Alevizos, Alevizos; Leonard, Clare; Tountas, Yannis; Mariolis, Anargiros
2008-10-01
To evaluate whether consumption of breakfast cereals is associated with BMI in a sample of Greek adolescents. A cross-sectional health and nutrition survey. During 2004-5, 2008 schoolchildren aged 12-17 years were selected from twelve schools located in Vyronas region (Athens metropolitan area). Height and weight were measured and BMI was calculated. A semiquantitative FFQ was applied and multiple logistic regression analysis was used. Overall, 4.7% of boys and 1.7% of girls were obese, whereas 19.4% of boys and 13.2% of girls were overweight. Only 20.7% of boys and 15.5% of girls reported that they consume cereals as a first choice for breakfast. Consumption of breakfast cereals was associated with lower BMI in boys (P=0.08) and girls(P=0.019), irrespective of age and physical activity status. More prominent results were observed for daily cereal consumption or for more than two daily servings of cereals consumed for breakfast. Consumption of pre-sweetened breakfast cereals was associated with lower BMI compared with non-pre-sweetened or no intake of cereals, in both genders (PConsumption of breakfast cereals was associated with 33% (95% CI 14%, 48%) lower likelihood of overweight/obesity, irrespective of age, sex and physical activity status. Consumption of breakfast cereals was associated with lower BMI levels and a lower likelihood of overweight/obesity in both genders; thus a solid basis for public health professionals could be built when issuing advice on weight management.
Faeh, David; Staub, Kaspar; Rühli, Frank J; et al
2017-01-01
Abstract Background: Underweight, overweight, and obesity in childhood and adolescence are associated with adverse health consequences throughout the life-course. Our aim was to estimate worldwide trends in mean body-mass index (BMI) and a comprehensive set of BMI categories that cover underweight to obesity in children and adolescents, and to compare trends with those of adults. Methods: We pooled 2416 population-based studies with measurements of height and weight on 128·9 million p...
DEFF Research Database (Denmark)
Kirkegaard, Helene; Nøhr, Ellen A; Rasmussen, Kathleen M
2015-01-01
BACKGROUND: Studies suggest that gestational weight gain (GWG) and breastfeeding behavior may influence long-term maternal abdominal fat mass. However, this could be confounded by abdominal fat mass before pregnancy because it is unknown whether abdominal fat mass, independently of body size......, affects GWG and breastfeeding behavior. OBJECTIVE: We investigated how maternal prepregnancy fat distribution, described by waist circumference (WC) and body mass index (BMI), is associated with GWG and breastfeeding behavior. DESIGN: We analyzed 1371 live births to 1024 women after enrollment...... in the Coronary Artery Risk Development in Young Adults study (1985-1996). For each birth, maternal prepregnancy BMI and WC were measured at year 0 (baseline), 2, 5, or 7 examinations. Recalled GWG and breastfeeding behavior were collected at years 7 and 10. GWG was analyzed by using linear regression...
Palo Verde Unit 3 BMI nozzle modification
International Nuclear Information System (INIS)
Waskey, D.
2015-01-01
The 61 BMI (Bottom Mount Instrumentation) nozzles of the unit 3 of the Palo Verde plant have been examined through ASME Code Case N722. The nozzle 3 was the only one with leakage noted. The ultrasound testing results are characteristic of PWSCC (Primary Water Stress Corrosion Cracking). The initiation likely occurred at a weld defect which was exposed to the primary water environment resulting in PWSCC. All other nozzles (60) showed no unacceptable indications. Concerning nozzle 3 one crack in J-groove weld connected large defect to primary water. An environmental model has been used to simulate and optimize the repair. The AREVA crew was on site 18 days after contract award and the job was completed in 12 days, 30 hours ahead of baseline schedule. This series of slides describes the examination of the BMI nozzles, the repair steps, and alternative design concepts
Xu, Fan; Li, Xiao; Liu, Lanfang; Xiao, Xu; Zhang, Li; Zhang, Shenglin; Lin, Pingping; Wang, Xiaojie; Wang, Yongwei; Li, Qingshan
2017-09-01
The protective effects and mechanisms of esculetin on doxorubicin (DOX)-induced injury of H9c2 cells were investigated. H9c2 cells were cultured and the logarithmic growth phase of the cells was divided into a control group, a DOX group and an esculetin + DOX group. Cell viability was detected by MTT assay. Annexin V-PI (AV-PI) double staining flow cytometry was carried out to detect cell apoptosis. Intracellular reactive oxygen species (ROS) were detected by flow cytometry. Transmission electron microscope (TEM) was used to evaluate cell ultrastructure. Cleaved caspase-3, cleaved PARP, Bcl-2, Bid and Bmi-1 proteins levels were investigated by western blot analysis. Bmi-1 siRNA was used to detect the role of Bmi-1 in the protective effects of esculetin against DOX-induced toxicity in H9c2 cells. The MTT and AV-PI double staining results showed that esculetin significantly increased H9c2 cell viability. Compared with the control group, the levels of cleaved caspase-3, cleaved PARP, Bid and ROS levels were significantly decreased, but the expression of Bcl-2 and Bmi-1 were significantly increased in the esculetin + DOX group. TEM showed that the cell structure of the mitochondria was protected by esculetin. The results of Bmi-1 siRNA showed that esculetin could protect DOX-induced cardiotoxicity by modulating Bmi-1 expression. Esculetin can protect DOX-induced cardiotoxicity and the effects may be attributable to modulation of Bmi-1 expression, provoking intracellular ROS accumulation, protecting the structure of mitochondria and reducing cell apoptosis.
Khanna, Rahul; Kavookjian, Jan; Scott, Virginia Ginger; Kamal, Khalid M; Miller, Lesley-Ann N; Neal, William A
2009-06-01
Over the past few decades, childhood obesity has become a major public health issue in the United States. Numerous public and professional organizations recommend that physicians periodically screen for obesity in children and adolescents using the body mass index (BMI). However, studies have shown that physicians infrequently measure BMI in children and adolescents. The purpose of this study was to use the theory of reasoned action (TRA) to explain physicians' intentions to measure BMI in children and adolescents. The study objectives were to (1) determine if attitude and subjective norm predict physicians' intention to measure BMI in children and adolescents; (2) determine if family physicians and pediatricians differ in terms of theoretical factors; and (3) assess differences in behavioral beliefs, outcome evaluations, normative beliefs, and motivation to comply among physicians based on their level of intention to measure BMI. A cross-sectional mailed survey of 2590 physicians (family physicians and pediatricians) practicing in 4 states was conducted. A self-administered questionnaire was designed that included items related to the TRA constructs. The association between the theoretical constructs was examined using correlation and regression analyses. Student's t test was used to determine differences between family physicians and pediatricians on theoretical constructs and to compare the underlying beliefs of nonintenders with intenders. The usable response rate was 22.8%. Less than half (44%) of the physicians strongly intended to measure BMI in children and adolescents. Together, the TRA constructs attitude and subjective norm explained up to 49.9% of the variance in intention. Pediatricians had a significantly (P<.01) higher intention to measure BMI as compared to family physicians. There were significant (P<.01) behavioral and normative belief differences between physicians who intend and those who do not intend to measure BMI. The TRA is a useful model
Prognostic Significance of BMI-1 But Not MEL-18 Expression in Pulmonary Squamous Cell Carcinoma.
Abe, Sosei; Yamashita, Shin-Ichi; Miyahara, S O; Wakahara, Junichi; Yamamoto, Leona; Mori, Ryo; Imamura, Naoko; Yoshida, Yasuhiro; Waseda, Ryuichi; Hiratsuka, Masafumi; Shiraishi, Takeshi; Nabeshima, Kazuki; Iwasaki, Akinori
2017-04-01
We investigated the possibility of BMI-1 and MEL-18 to predict survival in patients with pulmonary squamous cell carcinoma. One hundred and ninety-nine patients underwent surgery in our Institute between 1995 and 2005. We used immunohistochemical (IHC) analysis to determine the expressions of BMI-1 and MEL-18 and compared them with clinicopathological factors and survival. Forty-one of 199 cases (21%) were BMI-1-positive. No correlation was found between BMI-1 and MEL-18 expression by IHC and clinicopathological factors. Five-year overall survival in the BMI-1-positive group (66.8%), but not MEL-18, was significantly better than that in the negative group (45.5%, p=0.04). In multivariate analysis, positive BMI-1 was a better prognostic factor of overall survival (hazard ratio (HR)=0.561, 95% confidence interval (CI)=0.271-1.16, p=0.12). BMI-1 expression, but not MEL-18, is associated with a favorable prognosis and is a possible prognostic factor of pulmonary squamous cell carcinoma. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Brouwer-Brolsma, E M; Sluik, D; Singh-Povel, C M; Feskens, E J M
2018-05-01
Previous studies have suggested weight-regulatory properties for several dairy nutrients, but population-based studies on dairy and body weight are inconclusive. We explored cross-sectional associations between dairy consumption and indicators of overweight. We included 114,682 Dutch adults, aged ≥18 years. Dairy consumption was quantified by a food frequency questionnaire. Abdominal overweight was defined as waist circumference (WC) ≥88 cm (women) or ≥102 cm (men) (n = 37,391), overweight as BMI ≥25-30 kg/m 2 (n = 44,772) and obesity as BMI ≥30 kg/m 2 (n = 15,339). Associations were quantified by logistic (abdominal overweight, no/yes), multinomial logistic (BMI-defined overweight and obesity) and linear regression analyses (continuous measures of WC and BMI), and they were adjusted for relevant covariates. Total dairy showed a positive association with abdominal overweight (OR Q1 ref vs. Q5: 1.09; 95% CI: 1.04-1.14) and with BMI-defined overweight (OR Q5 1.13; 95% CI: 1.08-1.18) and obesity (OR Q5 1.09; 95% CI: 1.02-1.16). Skimmed, semi-skimmed and non-fermented dairy also showed positive associations with overweight categories. Full-fat dairy showed an inverse association with overweight and obesity (OR Q5 for obesity: 0.78; 95% CI: 0.73-0.83). Moreover, inverse associations were observed for yoghurt and custard and positive associations for milk, buttermilk, flavoured yoghurt drinks, cheese and cheese snacks. Fermented dairy, curd cheese and Dutch cheese did not show a consistent association with overweight categories. Total, skimmed, semi-skimmed and non-fermented dairy; milk; buttermilk; flavoured yoghurt drinks; total cheese and cheese snacks showed a positive association with overweight categories, whereas full-fat dairy, custard and yoghurt showed an inverse association with overweight categories. Copyright © 2018 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human
Christensen, Vibeke T; Carpiano, Richard M
2014-07-01
Research on social class differences in obesity and weight-related outcomes has highlighted the need to consider how such class differences reflect the unequally distributed constellations of economic, cultural, and social resources that enable and constrain health-related habits and practices or health lifestyles. Motivated by this need, the present study applies a theoretical perspective that integrates Cockerham's (2005) health lifestyles theory with Bourdieu's (1984) theoretical scholarship on social class, lifestyles, and the body to analyzing class-based differences in body mass index (BMI) among adult female respondents of a 2007 Danish national survey (n = 1376). We test hypotheses concerning how respective levels of economic, cultural, and social capital that constitute women's social class membership are associated with BMI directly and via their influence on respondent's dietary-related values, preferences, behaviors, and exercise activities. Our analyses indicate that cultural and economic capital were both directly associated with BMI. Mediation analyses revealed that greater cultural and social capital were linked to higher BMI via interest in cooking; while all three forms of capital were associated with lower BMI via greater frequency of exercise. These findings provide evidence for the many-and sometimes contradictory-ways that social class can influence body weight. Identifying such patterns can inform the design of more effective population health interventions. Copyright © 2014 Elsevier Ltd. All rights reserved.
Predictors of Success in Bariatric Surgery: the Role of BMI and Pre-operative Comorbidities.
da Cruz, Magda Rosa Ramos; Branco-Filho, Alcides José; Zaparolli, Marília Rizzon; Wagner, Nathalia Farinha; de Paula Pinto, José Simão; Campos, Antônio Carlos Ligocki; Taconeli, Cesar Augusto
2017-11-10
This is a retrospective review of 204 patients who underwent bariatric surgery. The impact of weight regain (WR), pre-operative comorbidities and BMI values on the recurrence of comorbidities was evaluated, and an equation was elaborated to estimate BMI at 5 years of bariatric surgery. Pre-operative data, after 1 year and after 5 years, was collected from the medical records. Descriptive analyses and bivariate hypothesis tests were performed first, and then, a generalised linear regression model with Tweedie distribution was adjusted. The hit rate and the Kendall coefficient of concordance (Kendall's W) of the equation were calculated. At the end, the Mann-Whitney test was performed between the BMI, WR and the presence of comorbidities, after a post-operative period of 5 years. The adjustment of the model resulted in an equation that estimates the mean value of BMI 5 years after surgery. The hit rate was 82.35% and the value of Kendall's W was 0.85 for the equation. It was found that patients with comorbidities presented a higher median WR (10.13%) and a higher mean BMI (30.09 kg/m 2 ) 5 years after the surgery. It is concluded that the equation is useful for estimating the mean BMI at 5 years of surgery and that patients with low pre-operative HDL and folic acid levels, with depression and/or anxiety and a higher BMI, have a higher BMI at 5 years of surgery and higher incidence of comorbid return and dissatisfaction with post-operative results.
International Nuclear Information System (INIS)
Zafar, S.; Haq, I.U.; Butt, A.R.; Shafiq, F.; Huda, G.; Mirza, G.; Rehman, A.U.
2007-01-01
To assess the correlation of endoscopic severity of Gastroesophageal Reflux Disease (GERD) with Body Mass Index (BMI). This study was conducted on 203 patients, who presented with upper GI symptoms. Patients who fulfilled the symptom criteria were referred for endoscopy. Classification of GERD was done according to LA Grading classification system. Body mass index (BMI) was calculated as Body Weight (BW) in kilograms (kg) divided by the square of the body height (BH) in meter (m2). Patient data was analyzed using SPSS 12 software. Statistical evaluation was done using non-parametric Wilcoxon's-sign Rank test. P-value <0.05 was considered to be statistically significant. Distribution of GERD was as follows: GERD-A subjects 65 (32%), GERD B subjects 72 (35.4%), GERD-C subjects 23 (11.3%), GERD-D subjects 10 (4.92%), while Non-Erosive Reflux Disease (NERD) was present in 33 subjects (16.2%). Mean BMI was 27+5.02SD (range of 18.2-38.3). BMI of patients having NERD was in normal range but patients who were having advanced disease i.e. Grade C-D were in obese range of BMI, while those who were having LA grade A-B were in overweight BMI range. When regrouped as mild GERD (grade A-B) and NERD versus severe GERD (grade C-D), there was a strong significant correlation between severity of GERD and BMI, as detected by Wilcoxon's signed Rank test (p=0.001). Higher BMI seems to be associated with higher degree of endoscopic GERD severity. (author)
Body mass index (BMI) in the Saudi population of Gassim.
Soyannwo, M A; Kurashi, N Y; Gadallah, M; Hams, J; el-Essawi, O; Khan, N A; Singh, R G; Alamri, A; Beyari, T H
1998-01-01
In a total cross-sectional population survey of the Faizia East Primary Health District of Buraidah, Gassim region of Saudi Arabia, 6,044 (2727 male and 3317 females) subjects out of a de facto population of 7695 got their BMI computed because infants and restless or bedridden subjects could not be examined. Mean (+/- SD) and percentiles (25th & 75th) were calculated in the conventional 5-year age cohorts as well as in functional age groups, namely, 0-5, 6-12, 13-49, 50-69 and 70+ years. 5th, 10th, 25th, 50th, 75th, 90th and 95th percentiles were computed only for the functional age groups. In general, the trend was for BMI to increase with age in both genders but the curve pattern showed some plateauing from about the age of 50 with slight decline in later life. Females had significantly higher indices than males, this becoming quite prominent from the 10-14 year age cohort. This difference persisted irrespective of the types of age grouping or residential location. Overall means (+/- SD) were 20.14 +/- 5.98 vs 22.22 +/- 7.21 for males and females respectively; df: 5771; p = 0.0000; 95% CI: -2.43, -1.735. Subjects in the urban living environment had significant higher indices than their rural counterpart: (21.666.92 vs 20.446.33: df: 5771; P = 0.0000; 95% CI: 1.595, -0.840). From the age of 15 about one quarter of females are overweight (BMI at the 75th percentile > 25) and from 30 years the same proportion are frankly obese (BMI > 30). Both systolic and diastolic blood pressure were significantly positively correlated with BMI in both genders: male SBP: r = 0.22, P r = 0.21, P r = 0.18, P < 0.00001.
Maternal BMI at the start of pregnancy and offspring epigenome-wide DNA methylation
DEFF Research Database (Denmark)
Sharp, Gemma C; Salas, Lucas A; Monnereau, Claire
2017-01-01
-analysed the association between pre-pregnancy maternal BMI and methylation at over 450,000 sites in newborn blood DNA, across 19 cohorts (9,340 mother-newborn pairs). We attempted to infer causality by comparing the effects of maternal versus paternal BMI and incorporating genetic variation. In four additional cohorts (1......,817 mother-child pairs), we meta-analysed the association between maternal BMI at the start of pregnancy and blood methylation in adolescents. In newborns, maternal BMI was associated with small (.... Adjustment for estimated cell proportions greatly attenuated the number of significant CpGs to 104, including 86 sites common to the unadjusted model. At 72/86 sites, the direction of the association was the same in newborns and adolescents, suggesting persistence of signals. However, we found evidence...
Insulin sensitivity is reduced in children with high body-fat regardless of BMI
DEFF Research Database (Denmark)
Fairchild, Timothy J; Klakk, Heidi; Heidemann, Malene
2018-01-01
BF% was measured by dual-energy X-ray absorptiometry (DXA). Fasting plasma glucose and insulin concentrations were measured and the homoeostatic model assessment of insulin resistance (HOMA-IR) used to assess insulin sensitivity. RESULTS: Approximately 8% of children classified as normal weight...... by BMI had high BF% (NW + Adipose). Children with high BF% had significantly higher insulin (NW + adipose: 32.3%; OW/OB + Adipose: 52.2%) and HOMA-IR scores (NW + Adipose: 32.3%; OW/OB + Adipose: 55.3%) than children classified as NW without high BF% (reference group; NW + NonAdipose). Adjusting for CRF...
Lower C-reactive protein and IL-6 associated with vegetarian diets are mediated by BMI.
Jaceldo-Siegl, K; Haddad, E; Knutsen, S; Fan, J; Lloren, J; Bellinger, D; Fraser, G E
2018-03-13
The mechanism by which vegetarian diets are associated with less inflammation is not clear. We investigated the role of BMI as a mediator in the relationship between vegetarian diet and concentrations of C-reactive protein (CRP), and the cytokines IL-6, IL-10 and TNF-α. We used data from participants of the Adventist Health Study 2 (AHS-2) Calibration (n = 893) and Biological Manifestations of Religion (n = 478) sub-studies. Vegetarian diet variations were determined based on reported intake of animal products assessed by FFQ. Combining all participants, the proportion of non-vegetarians (NVs), partial vegetarians (PVs), lacto-ovo vegetarians (LOVs), and strict vegetarians (SVs) was 44%, 16%, 31%, and 9%, respectively. NV and PV participants were older than other dietary groups, and non-vegetarians had the highest BMI. Mediation analyses supported the mediating effect of BMI in associations of vegetarian diet with CRP (p vegetarian diet and the biomarkers IL-10 and TNF-α. A direct pathway was significant only in the association between strict vegetarians and CRP (p = 0.017). The lower CRP and IL-6 concentrations among vegetarians may be mediated by BMI. Copyright © 2018 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier B.V. All rights reserved.
Smoking and BMI as a risk factor of cardiovascular disease at a doctors in Tuzla canton
Directory of Open Access Journals (Sweden)
Merisa Imamović Kuluglić
2012-09-01
Full Text Available Introduction: Cardiovascular diseases are becoming the leading social and medical problem of civilization, given the trend indicates an increase of morbidity, disability and mortality from this diseases. The aim ofour study was to determine the frequency of smoking and increased BMI, as a risk factor for cardiovascular disease in doctors in the Tuzla Canton and correlate values of BMI by the doctor smokers and nonsmokers.Methods: The study was conducted in 13 medical centers in the area of Tuzla canton in the second quarter of 2009. Two groups were formed by randomization of 150 doctors non-smokers and 150 doctors smokersfrom a total of 366 doctors of both sexes, age over 25 years. The study involved doctors who smoke tobacco 5 or more years. The methods of anthropometric measurements and questionnaires were used in study.Results: The results showed that the total number of doctors surveyed, 44.81% were smokers, with more women smokers (28.7% than men (21.3% smokers (p=0.011. We found that there is a signifi cant statistical difference between subjects with BMI higher than 25 and subjects with normal weight, in the group of smokers (p = 0.0001.Conclusion: It can be concluded that the frequency of smoking in the total number of surveyed doctors, is signifi cant. The increased value of BMI (over 25 is present in large number of subjects (with the larger percentage subjects of smokers.
Albrecht, Sandra S; Mayer-Davis, Elizabeth; Popkin, Barry M
2017-07-01
For the same body mass index (BMI) level, waist circumference (WC) is higher in more recent years. How this impacts diabetes and prediabetes prevalence in the United States and for different race/ethnic groups is unknown. We examined prevalence differences in diabetes and prediabetes by BMI over time, investigated whether estimates were attenuated after adjusting for waist circumference, and evaluated implications of these patterns on race/ethnic disparities in glycemic outcomes. Data came from 12 614 participants aged 20 to 74 years from the National Health and Nutrition Examination Surveys (1988-1994 and 2007-2012). We estimated prevalence differences in diabetes and prediabetes by BMI over time in multivariable models. Relevant interactions evaluated race/ethnic differences. Among normal, overweight, and class I obese individuals, there were no significant differences in diabetes prevalence over time. However, among individuals with class II/III obesity, diabetes prevalence rose 7.6 percentage points in 2007-2012 vs 1988-1994. This estimate was partly attenuated after adjustment for mean waist circumference but not mean BMI. For prediabetes, prevalence was 10 to 13 percentage points higher over time at lower BMI values, with minimal attenuation after adjustment for WC. All patterns held within race/ethnic groups. Diabetes disparities among blacks and Mexican Americans relative to whites remained in both periods, regardless of BMI, and persisted after adjustment for WC. Diabetes prevalence rose over time among individuals with class II/III obesity and may be partly due to increasing waist circumference. Anthropometric measures did not appear to account for temporal increases in prediabetes, nor did they attenuate race/ethnic disparities in diabetes. Reasons underlying these trends require further investigation. Copyright © 2017 John Wiley & Sons, Ltd.
Hodgkinson, Emma L; Smith, Debbie M; Hare, Dougal J; Wittkowski, Anja
2017-02-01
Weight-related stereotypes may have a detrimental impact on interactions between midwives and pregnant women with a body mass index (BMI) outside the recommended range of 18-30kg/m 2 . This paper explores the reciprocal construal of midwives and pregnant women with a raised BMI and considers the clinical implications of these constructs. Ten pregnant women with a BMI≥30kg/m 2 and 11 midwives and from an inner city maternity service were recruited. Participants provided information that allowed for the creation of a repertory grid; generating psychological constructs (perceptions or attitudes) identifying similarities and differences between pregnant women and midwives across a BMI range. Midwives were extremely conscious of being perceived as judgemental. They construed all pregnant women as anxious and vulnerable, but attributed characteristics such as "less health-conscious" and "complacent" to those with a raised BMI. The ideal pregnant woman and ideal midwife were typically construed as more likely to have a BMI of 18-30kg/m 2 . Pregnant women with a BMI≤18kg/m 2 were construed as lacking warmth. While midwives differentiated between the elements based on role, the pregnant women construed the elements according to their BMI. Similarly, they construed those with a BMI≤18kg/m 2 as having an undesirable personality, and acknowledged weight-related stereotypes for those with a raised BMI. It is possible these constructs impact on the way midwives care for and interact with women. Midwives may be supported through reflective clinical supervision and communication skills training to reduce the perceptions of stigma experienced by women with a raised BMI. It may be beneficial to involve pregnant women with a raised BMI in service development to ensure services meet their needs. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Cox Bianca
2011-07-01
Full Text Available Abstract Background Parental reports are often used in large-scale surveys to assess children's body mass index (BMI. Therefore, it is important to know to what extent these parental reports are valid and whether it makes a difference if the parents measured their children's weight and height at home or whether they simply estimated these values. The aim of this study is to compare the validity of parent-reported height, weight and BMI values of preschool children (3-7 y-old, when measured at home or estimated by parents without actual measurement. Methods The subjects were 297 Belgian preschool children (52.9% male. Participation rate was 73%. A questionnaire including questions about height and weight of the children was completed by the parents. Nurses measured height and weight following standardised procedures. International age- and sex-specific BMI cut-off values were employed to determine categories of weight status and obesity. Results On the group level, no important differences in accuracy of reported height, weight and BMI were identified between parent-measured or estimated values. However, for all 3 parameters, the correlations between parental reports and nurse measurements were higher in the group of children whose body dimensions were measured by the parents. Sensitivity for underweight and overweight/obesity were respectively 73% and 47% when parents measured their child's height and weight, and 55% and 47% when parents estimated values without measurement. Specificity for underweight and overweight/obesity were respectively 82% and 97% when parents measured the children, and 75% and 93% with parent estimations. Conclusions Diagnostic measures were more accurate when parents measured their child's weight and height at home than when those dimensions were based on parental judgements. When parent-reported data on an individual level is used, the accuracy could be improved by encouraging the parents to measure weight and height
Anderson, Lisa M; Reilly, Erin E; Schaumberg, Katherine; Dmochowski, Sasha; Anderson, Drew A
2016-03-01
Mindful eating and intuitive eating are promoted as means to circumvent potentially maladaptive dietary restraint while maintaining a healthy weight. Although theoretically related, no studies have examined the correlations between intuitive eating, mindful eating, and restraint in the same sample. This study sought to examine these constructs and their correlations with body mass index (BMI), eating-disordered behaviors, and meal consumption in a college sample. Participants (N = 125) completed a laboratory taste-test meal and measures of each eating-related construct using the EDDS, IES, MEQ, and TFEQ-Restraint Subscale. Mindful eating, intuitive eating, and restraint were not strongly correlated. Hierarchical multiple regression analyses indicated that restraint and intuitive eating accounted for significant variance in disordered eating and BMI. Elevated restraint was associated with increased BMI and disordered eating; elevated intuitive eating was associated with decreased BMI and disordered eating. Mindful eating did not correlate with any outcome variables. Follow-up analyses suggested that specific intuitive eating subscales accounted for unique variance in the relation between intuitive eating and disordered eating. Intuitive eating was the only construct that was significantly associated with meal consumption. Intuitive eating and restraint appear to be only weakly correlated, and each is differentially associated with meal consumption. Mindful eating does not appear to relate to outcome variables.
Directory of Open Access Journals (Sweden)
Maike Wolters
Full Text Available The recent obesity epidemic in children also showed an increase in the prevalence of hypertension. As blood pressure (BP is associated with (long-chain polyunsaturated fatty acids (LC PUFA, genetic variation in desaturase enzymes being involved in the synthesis of LC PUFA may be associated with BP. This study aimed to investigate the direct effects (independent of mediating variables and indirect effects (mediated through intermediate variables of a common variant in the FADS1 gene, rs174546, known to affect delta-5 desaturase (D5D activity on PUFA level, body mass index (BMI and BP.A subsample of the IDEFICS (Identification and prevention of dietary- and lifestyle-induced health effects in children and infants baseline survey including 520 children aged 2 to <10 years from six European countries was included. The association between rs174546 (T
Work-family life courses and BMI trajectories in three British birth cohorts.
Lacey, R E; Sacker, A; Bell, S; Kumari, M; Worts, D; McDonough, P; Kuh, D; McMunn, A
2017-02-01
Combining work and family responsibilities has previously been associated with improved health in mid-life, yet little is known about how these associations change over time (both biographical and historical) and whether this extends to body mass index (BMI) trajectories for British men and women. The purpose of this study was to investigate relationships between work-family life courses and BMI trajectories across adulthood (16-42 years) for men and women in three British birth cohorts. Multiply imputed data from three nationally representative British birth cohorts were used-the MRC National Survey of Health and Development (NSHD; 1946 birth cohort, n=3012), the National Child Development Study (NCDS; 1958 birth cohort, n=9614) and the British Cohort Study (BCS; 1970 birth cohort, n=8140). A typology of work-family life course types was developed using multi-channel sequence analysis, linking annual information on work, partnerships and parenthood from 16 to 42 years. Work-family life courses were related to BMI trajectories using multi-level growth models. Analyses adjusted for indicators of prior health, birthweight, child BMI, educational attainment and socioeconomic position across the life course, and were stratified by gender and cohort. Work-family life courses characterised by earlier transitions to parenthood and weaker long-term links to employment were associated with greater increases in BMI across adulthood. Some of these differences, particularly for work-family groups, which are becoming increasingly non-normative, became more pronounced across cohorts (for example, increases in BMI between 16 and 42 years in long-term homemaking women: NSHD: 4.35 kg m -2 , 95% confidence interval (CI): 3.44, 5.26; NCDS: 5.53 kg m - 2 , 95% CI: 5.18, 5.88; BCS: 6.69 kg m - 2 , 95% CI: 6.36, 7.02). Becoming a parent earlier and weaker long-term ties to employment are associated with greater increases in BMI across adulthood in British men and women.
Collison, Kate S; Zaidi, Marya Z; Subhani, Shazia N; Al-Rubeaan, Khalid; Shoukri, Mohammed; Al-Mohanna, Futwan A
2010-05-09
The prevalence of obesity and overweight is increasing globally. Frequently coexisting with under-nutrition in developing countries, obesity is a major contributor to chronic disease, and will become a serious healthcare burden especially in countries with a larger percentage of youthful population. 35% of the population of Saudi Arabia are under the age of 16, and adult dietary preferences are often established during early childhood years. Our objective was to examine the dietary habits in relation to body-mass-index (BMI) and waist circumference (W_C), together with exercise and sleep patterns in a cohort of male and female Saudi school children, in order to ascertain whether dietary patterns are associated with obesity phenotypes in this population. 5033 boys and 4400 girls aged 10 to 19 years old participated in a designed Food Frequency Questionnaire. BMI and W_C measurements were obtained and correlated with dietary intake. The overall prevalence of overweight and obesity was 12.2% and 27.0% respectively, with boys having higher obesity rates than girls (P sweetened carbonated beverage (SSCB) intake in boys only. The association between male BMI and SSCB consumption was significant in a multivariate regression model (P sweetened hot beverages were higher in older versus younger children (P < 0.001). BMI and W_C were negatively correlated with hours of night-time sleep and exercise in boys, but only with night time sleep in girls, who also showed the lowest frequency of exercise. A higher intake of SSCB is associated with poor dietary choices. Male SSCB intake correlates with a higher W_C and BMI. Limiting exposure to SSCB could therefore have a large public health impact.
Directory of Open Access Journals (Sweden)
Vito De Feo
2017-05-01
Full Text Available Brain-machine interfaces (BMIs promise to improve the quality of life of patients suffering from sensory and motor disabilities by creating a direct communication channel between the brain and the external world. Yet, their performance is currently limited by the relatively small amount of information that can be decoded from neural activity recorded form the brain. We have recently proposed that such decoding performance may be improved when using state-dependent decoding algorithms that predict and discount the large component of the trial-to-trial variability of neural activity which is due to the dependence of neural responses on the network's current internal state. Here we tested this idea by using a bidirectional BMI to investigate the gain in performance arising from using a state-dependent decoding algorithm. This BMI, implemented in anesthetized rats, controlled the movement of a dynamical system using neural activity decoded from motor cortex and fed back to the brain the dynamical system's position by electrically microstimulating somatosensory cortex. We found that using state-dependent algorithms that tracked the dynamics of ongoing activity led to an increase in the amount of information extracted form neural activity by 22%, with a consequently increase in all of the indices measuring the BMI's performance in controlling the dynamical system. This suggests that state-dependent decoding algorithms may be used to enhance BMIs at moderate computational cost.
De Feo, Vito; Boi, Fabio; Safaai, Houman; Onken, Arno; Panzeri, Stefano; Vato, Alessandro
2017-01-01
Brain-machine interfaces (BMIs) promise to improve the quality of life of patients suffering from sensory and motor disabilities by creating a direct communication channel between the brain and the external world. Yet, their performance is currently limited by the relatively small amount of information that can be decoded from neural activity recorded form the brain. We have recently proposed that such decoding performance may be improved when using state-dependent decoding algorithms that predict and discount the large component of the trial-to-trial variability of neural activity which is due to the dependence of neural responses on the network's current internal state. Here we tested this idea by using a bidirectional BMI to investigate the gain in performance arising from using a state-dependent decoding algorithm. This BMI, implemented in anesthetized rats, controlled the movement of a dynamical system using neural activity decoded from motor cortex and fed back to the brain the dynamical system's position by electrically microstimulating somatosensory cortex. We found that using state-dependent algorithms that tracked the dynamics of ongoing activity led to an increase in the amount of information extracted form neural activity by 22%, with a consequently increase in all of the indices measuring the BMI's performance in controlling the dynamical system. This suggests that state-dependent decoding algorithms may be used to enhance BMIs at moderate computational cost.
Directory of Open Access Journals (Sweden)
Natalia Liszewska
2018-01-01
Full Text Available Objective: Parental practices that aim at increasing children's physical activity were found to be related to children's physical activity. So far, however, the association between these two sets of variables was studied without considering the moderating role of children's BMI z-score, which may determine the effectiveness of parental practices. The present study aims at filling this void.Design: Longitudinal data were collected among 879 dyads of children (6–11 years old and their parents. Seven parental physical activity practices were assessed at baseline. Physical activity, body mass, and height (measured among children were assessed twice (at baseline and 7-month follow-up. Body mass and height were measured objectively. Seven moderation analyses were conducted.Results: Six parental practices emerged to predict physical activity of children: collaborative social control, overall support, stimulation to be active, general encouragement for physical activity, positive social control, and modeling. Children's BMI z-score moderated three associations. The relationships between parental positive social control, overall parental support, and general parental encouragement for physical activity (at baseline, and children's physical activity (at follow-up were significant only among children with low and medium BMI z-score. In turn, collaborative social control and modeling predicted children's physical activity at the follow-up regardless child's BMI z-score.Conclusions: Parental positive social control or overall parental support may be ineffective in children with higher body mass who are in need to increase their physical activity.
Directory of Open Access Journals (Sweden)
Weiguo eSong
2015-04-01
Full Text Available Currently little is known about how a mechanically coupled BMI system’s actions are integrated into ongoing body dynamics. We tested a locomotor task augmented with a BMI system driving a robot mechanically interacting with a rat under three conditions: control locomotion (BL, ‘simple elastic load’ (E and ‘BMI with elastic load’ (BMI/E. The effect of the BMI was to allow compensation of the elastic load as a function of the neural drive. Neurons recorded here were close to one another in cortex, all within a 200 micron diameter horizontal distance of one another. The interactions of these close assemblies of neurons may differ from those among neurons at longer distances in BMI tasks and thus are important to explore. A point process generalized linear model (GLM, was used to examine connectivity at two different binning timescales (1ms vs. 10ms. We used GLM models to fit non-Poisson neural dynamics solely using other neurons’ prior neural activity as covariates. Models at different timescales were compared based on Kolmogorov-Smirnov (KS goodness-of-fit and parsimony. About 15% of cells with non-Poisson firing were well fitted with the neuron-to-neuron models alone. More such cells were fitted at the 1ms binning than 10ms. Positive connection parameters (‘excitation’ ~70% exceeded negative parameters (‘inhibition’ ~30%. Significant connectivity changes in the GLM determined networks of well-fitted neurons occurred between the conditions. However, a common core of connections comprising at least ~15% of connections persisted between any two of the three conditions. Significantly almost twice as many connections were in common between the two load conditions (~27%, compared to between either load condition and the baseline. This local point process GLM identified neural correlation structure and the changes seen across task conditions in the rats in this neural subset may be intrinsic to cortex or due to feedback and input
Monge-Pereira, E; Casatorres Perez-Higueras, I; Fernandez-Gonzalez, P; Ibanez-Pereda, J; Serrano, J I; Molina-Rueda, F
2017-04-16
In the last years, new technologies such as the brain-machine interfaces (BMI) have been incorporated in the rehabilitation process of subjects with stroke. These systems are able to detect motion intention, analyzing the cortical signals using different techniques such as the electroencephalography (EEG). This information could guide different interfaces such as robotic devices, electrical stimulation or virtual reality. A 40 years-old man with stroke with two months from the injury participated in this study. We used a BMI based on EEG. The subject's motion intention was analyzed calculating the event-related desynchronization. The upper limb motor function was evaluated with the Fugl-Meyer Assessment and the participant's satisfaction was evaluated using the QUEST 2.0. The intervention using a physical therapist as an interface was carried out without difficulty. The BMI systems detect cortical changes in a subacute stroke subject. These changes are coherent with the evolution observed using the Fugl-Meyer Assessment.
Energy Technology Data Exchange (ETDEWEB)
Chang, Xiao [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Sun, Yong [Department of Burn and Plastic Surgery, Huai’an First People’s Hospital, Nanjing Medical University, Huai’an 223300 (China); Han, Siqi [Department of Medical Oncology, Jinling Hospital, Nanjing 210002 (China); Zhu, Wei [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Zhang, Haiping, E-mail: zhanghaiping_2000@163.com [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Lian, Shi, E-mail: lianshi_2020@163.com [Department of Dermatology and Venereal Disease, Capital Medical University, Beijing 100069 (China)
2015-01-02
Highlights: • First reported deregulation of miR-203 and up-regulation of BMI1 in metastatic melanoma. • miR-203 decreased BMI1 expression by directly binding to 3′UTR. • Further found miR-203 overexpression suppressed cell invasion and stemness. • Re-expression of BMI1 rescued miR-203-mediated suppression. • miR-203-BMI1 axis may be potential therapeutic targets of melanoma metastasis. - Abstract: Metastasis is the major problem in malignant melanoma, posing a therapeutic challenge to clinicians. The investigation of the underlying mechanism driving this progress remains a large unmet need. In this study, we revealed a miR-203-BMI1 axis that regulated melanoma metastasis. We found significantly deregulation of miR-203 and up-regulation of BMI1 in melanoma, particularly in metastatic melanoma. An inverse correlation between the levels of miR-203 and BMI1 was further observed in melanoma tissues and cell lines. We also identified BMI1 as a downstream target gene of miR-203, which bound to the 3′UTR of BMI1. Overexpression of miR-203 was associated with decreased BMI1 expression and impaired cell invasion and tumor sphere formation activities. Re-expression of BMI1 markedly rescued miR-203-mediated suppression of these events. Taken together, our results demonstrated that miR-203 regulated melanoma invasive and proliferative abilities in part by targeting BMI1, providing new insights into potential mechanisms of melanoma metastasis.
Prediction of BMI at age 11 in a longitudinal sample of the Ulm Birth Cohort Study.
Directory of Open Access Journals (Sweden)
Hanna Christiansen
Full Text Available Obesity is one of the greatest public health challenges in the world with childhood prevalence rates between 20-26% and numerous associated health risks. The aim of the current study was to analyze the 11-year follow-up data of the Ulm Birth Cohort Study (UBCS, to identify whether abnormal eating behavior patterns, especially restrained eating, predict body mass index (BMI at 11 years of age and to explore other factors known to be longitudinally associated with it. Of the original UBCS, n = 422 children (~ 40% of the original sample and their parents participated in the 11-year follow-up. BMI at age 8 and 11 as well as information on restrained eating, psychological problems, depressive symptoms, lifestyle, and IQ at age 8 were assessed. Partial Least Squares Structural Equation Modeling (PLS-SEM was used to predict children's BMI scores at age 11. PLS-SEM explained 68% of the variance of BMI at age 11, with BMI at age 8 being the most important predictor. Restrained eating, via BMI at age 8 as well as parental BMI, had further weak associations with BMI at age 11; no other predictor was statistically significant. Since established overweight at age 8 already predicts BMI scores at age 11 longitudinally, obesity interventions should be implemented in early childhood.
Directory of Open Access Journals (Sweden)
Christine Mayer
Full Text Available Facial markers of body composition are frequently studied in evolutionary psychology and are important in computational and forensic face recognition. We assessed the association of body mass index (BMI and waist-to-hip ratio (WHR with facial shape and texture (color pattern in a sample of young Middle European women by a combination of geometric morphometrics and image analysis. Faces of women with high BMI had a wider and rounder facial outline relative to the size of the eyes and lips, and relatively lower eyebrows. Furthermore, women with high BMI had a brighter and more reddish skin color than women with lower BMI. The same facial features were associated with WHR, even though BMI and WHR were only moderately correlated. Yet BMI was better predictable than WHR from facial attributes. After leave-one-out cross-validation, we were able to predict 25% of variation in BMI and 10% of variation in WHR by facial shape. Facial texture predicted only about 3-10% of variation in BMI and WHR. This indicates that facial shape primarily reflects total fat proportion, rather than the distribution of fat within the body. The association of reddish facial texture in high-BMI women may be mediated by increased blood pressure and superficial blood flow as well as diet. Our study elucidates how geometric morphometric image analysis serves to quantify the effect of biological factors such as BMI and WHR to facial shape and color, which in turn contributes to social perception.
Oud, Lavi
2013-10-01
Conflicting findings were reported on the body mass index (BMI)-based prognosis of critically patients. Errors in source weight and height data can confound BMI group allocation. The aim of the present work was to examine investigators' reporting on the methods of height and weight acquisition (HWA). PubMed and Embase databases were searched for studies describing BMI group-based risk of death in critically ill patients. Eligible studies were examined for reporting on (1) the use of measured and/or estimated HWA, (2) details of measuring devices, (3) device accuracy, and (4) methods of adjustment for acute and chronic fluid-related weight changes. Thirty studies met the eligibility criteria, including 159,565 patients. No data were provided in 13 studies (52% of reported patients) on whether estimates or measurements were used for HWA. Measured HWA was used exclusively in 6 studies (3% of patients), and an unspecified combination of estimated and/or measured HWA was reported for the remainder. Only 1 study reported the specific devices used. None of the studies provided data on the bias and precision of measuring devices. Adjustment for chronic and/or acute fluid-related weight changes was addressed in 2 studies for each. These findings demonstrate the prevalent risk for BMI group misallocation in the reviewed studies, which may confound BMI-based prognosis, raising concerns about the validity of reported BMI-related prognostic impact. Copyright © 2013 Elsevier Inc. All rights reserved.
Adult BMI and Access to Built Environment Resources in a High-Poverty, Urban Geography.
Tung, Elizabeth L; Peek, Monica E; Makelarski, Jennifer A; Escamilla, Veronica; Lindau, Stacy T
2016-11-01
The purpose of this study is to examine the relationship between BMI and access to built environment resources in a high-poverty, urban geography. Participants (aged ≥35 years) were surveyed between November 2012 and July 2013 to examine access to common health-enabling resources (grocers, outpatient providers, pharmacies, places of worship, and physical activity resources). Survey data were linked to a contemporaneous census of built resources. Associations between BMI and access to resources (potential and realized) were examined using independent t-tests and multiple linear regression. Data analysis was conducted in 2014-2015. Median age was 53.8 years (N=267, 62% cooperation rate). Obesity (BMI ≥30) prevalence was 54.9%. BMI was not associated with potential access to resources located nearest to home. Nearly all participants (98.1%) bypassed at least one nearby resource type; half bypassed nearby grocers (realized access >1 mile from home). Bypassing grocers was associated with a higher BMI (p=0.03). Each additional mile traveled from home to a grocer was associated with a 0.9-higher BMI (95% CI=0.4, 1.3). Quality and affordability were common reasons for bypassing resources. Despite potential access to grocers in a high-poverty, urban region, half of participants bypassed nearby grocers to access food. Bypassing grocers was associated with a higher BMI. Copyright © 2016 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.
Van Allen, Jason; Kuhl, Elizabeth S; Filigno, Stephanie S; Clifford, Lisa M; Connor, Jared M; Stark, Lori J
2014-10-01
To examine whether changes in parent motivation over the course of a pediatric obesity intervention are significantly associated with long-term changes in treatment outcomes. Study hypotheses were tested with a secondary data analysis of a randomized controlled trial (N = 42). Study analyses tested whether baseline to posttreatment change in total score for a self-report parent motivation measure (Parent Motivation Inventory [PMI]) was significantly associated with baseline to 6-month follow-up changes in body mass index z-score (zBMI), dietary variables, and physical activity. Increases in PMI were significantly associated with decreased zBMI, decreased consumption of sugar-sweetened beverages and sweets, and increased consumption of artificially sweetened beverages. Given that increases in parent motivation were associated with some treatment benefits, future research should evaluate the impact of directly assessing and targeting parent motivation on weight outcomes for preschoolers participating in a weight management program. © The Author 2014. Published by Oxford University Press on behalf of the Society of Pediatric Psychology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Grasso, Alessandro; Malfatti, Federica; Andraghetti, Gabriella; Marenco, Simona; Mazzucchelli, Chiara; Labanca, Sara; Cordera, Renzo; Testa, Roberto; Picciotto, Antonino
2015-01-01
Objective. To investigate the relationship between insulin resistance and viral load decay in nondiabetic and noncirrhotic genotype 1 chronic HCV patients during peginterferon and ribavirin treatment and the possible influence of BMI and leptin as metabolic confounders. Methods. 75 consecutive noncirrhotic, nonobese, and nondiabetic patients with genotype 1 chronic hepatitis C treated with peginterferon alpha 2a plus ribavirin were evaluated. HOMA-IR, serum leptin, and BMI were measured in all patients at baseline and at weeks 12 and 48, whereas viral load was measured at the same time points and then 24 weeks after the end of treatment. Results. HOMA-IR was significantly associated with both BMI and leptin at baseline. During peginterferon plus ribavirin treatment, there was a significant reduction of HOMA-IR at weeks 12 and 48 from baseline (P = 0.033 and 0.048, resp.) in patients who achieved an early viral load decay (EVR), a trend not observed in patients who not achieved EVR. No variations during treatment were observed regarding BMI and leptin irrespective of EVR. Conclusion. The early reduction of HOMA-IR but not of BMI and leptin during antiviral treatment in noncirrhotic, chronic hepatitis C genotype 1 patients who achieved EVR suggests a viral genesis of insulin resistance in patients with nonmetabolic phenotype.
Directory of Open Access Journals (Sweden)
Alessandro Grasso
2015-01-01
Full Text Available Objective. To investigate the relationship between insulin resistance and viral load decay in nondiabetic and noncirrhotic genotype 1 chronic HCV patients during peginterferon and ribavirin treatment and the possible influence of BMI and leptin as metabolic confounders. Methods. 75 consecutive noncirrhotic, nonobese, and nondiabetic patients with genotype 1 chronic hepatitis C treated with peginterferon alpha 2a plus ribavirin were evaluated. HOMA-IR, serum leptin, and BMI were measured in all patients at baseline and at weeks 12 and 48, whereas viral load was measured at the same time points and then 24 weeks after the end of treatment. Results. HOMA-IR was significantly associated with both BMI and leptin at baseline. During peginterferon plus ribavirin treatment, there was a significant reduction of HOMA-IR at weeks 12 and 48 from baseline (P=0.033 and 0.048, resp. in patients who achieved an early viral load decay (EVR, a trend not observed in patients who not achieved EVR. No variations during treatment were observed regarding BMI and leptin irrespective of EVR. Conclusion. The early reduction of HOMA-IR but not of BMI and leptin during antiviral treatment in noncirrhotic, chronic hepatitis C genotype 1 patients who achieved EVR suggests a viral genesis of insulin resistance in patients with nonmetabolic phenotype.
Directory of Open Access Journals (Sweden)
Benjamin Chih Chiang Lam
Full Text Available Excess adiposity is associated with cardiovascular disease (CVD risk factors such as hypertension, diabetes mellitus and dyslipidemia. Amongst the various measures of adiposity, the best one to help predict these risk factors remains contentious. A novel index of adiposity, the Body Adiposity Index (BAI was proposed in 2011, and has not been extensively studied in all populations. Therefore, the purpose of this study is to compare the relationship between Body Mass Index (BMI, Waist Circumference (WC, Waist-to-Hip Ratio (WHR, Waist-to-Height Ratio (WHtR, Body Adiposity Index (BAI and CVD risk factors in the local adult population.This is a cross sectional study involving 1,891 subjects (Chinese 59.1% Malay 22.2%, Indian 18.7%, aged 21-74 years, based on an employee health screening (2012 undertaken at a hospital in Singapore. Anthropometric indices and CVD risk factor variables were measured, and Spearman correlation, Receiver Operating Characteristic (ROC curves and multiple logistic regressions were used. BAI consistently had the lower correlation, area under ROC and odd ratio values when compared with BMI, WC and WHtR, although differences were often small with overlapping 95% confidence intervals. After adjusting for BMI, BAI did not further increase the odds of CVD risk factors, unlike WC and WHtR (for all except hypertension and low high density lipoprotein cholesterol. When subjects with the various CVD risk factors were grouped according to established cut-offs, a BMI of ≥23.0 kg/m2 and/or WHtR ≥0.5 identified the highest proportion for all the CVD risk factors in both genders, even higher than a combination of BMI and WC.BAI may function as a measure of overall adiposity but it is unlikely to be better than BMI. A combination of BMI and WHtR could have the best clinical utility in identifying patients with CVD risk factors in an adult population in Singapore.
Is there an association between food portion size and BMI among British adolescents?
Albar, Salwa A; Alwan, Nisreen A; Evans, Charlotte E L; Cade, Janet E
2014-09-14
The prevalence of obesity has increased simultaneously with the increase in the consumption of large food portion sizes (FPS). Studies investigating this association among adolescents are limited; fewer have addressed energy-dense foods as a potential risk factor. In the present study, the association between the portion size of the most energy-dense foods and BMI was investigated. A representative sample of 636 British adolescents (11-18 years) was used from the 2008-2011 UK National Diet and Nutrition Survey. FPS were estimated for the most energy-dense foods (those containing above 10·5 kJ/g (2·5 kcal/g)). Regression models with BMI as the outcome variable were adjusted for age, sex and misreporting energy intake (EI). A positive association was observed between total EI and BMI. For each 418 kJ (100 kcal) increase in EI, BMI increased by 0·19 kg/m2 (95 % CI 0·10, 0·28; Pportion sizes of a limited number of high-energy-dense foods (high-fibre breakfast cereals, cream and high-energy soft drinks (carbonated)) were found to be positively associated with a higher BMI among all adolescents after adjusting for misreporting. When eliminating the effect of under-reporting, larger portion sizes of a number of high-energy-dense foods (biscuits, cheese, cream and cakes) were found to be positively associated with BMI among normal reporters. The portion sizes of only high-fibre breakfast cereals and high-energy soft drinks (carbonated) were found to be positively associated with BMI among under-reporters. These findings emphasise the importance of considering under-reporting when analysing adolescents' dietary intake data. Also, there is a need to address adolescents' awareness of portion sizes of energy-dense foods to improve their food choice and future health outcomes.
Jang, Myoungock; Grey, Margaret; Sadler, Lois; Jeon, Sangchoon; Nam, Soohyun; Song, Hee-Jung; Whittemore, Robin
2017-08-03
To describe obesity-risk behaviours (diet, physical activity and sedentary behaviour) and examine the relationships of the obesity-risk behaviours with body mass index (BMI) in school-aged Korean American children. Korean American children have a risk of becoming overweight or obese and developing obesity-related complications; however, there is limited research about obesity-risk behaviours in Korean American children. A cross-sectional study. Obesity-risk behaviours of children were assessed with well-validated self-report questionnaires (i.e., Elementary-level School-based Nutrition Monitoring Questionnaire) from children and their mothers. Height and weight of children were measured. Data were analysed with bivariate and multivariate analyses using mixed effects models to incorporate the correlation within siblings. A total of 170 Korean American children (mean age 10.9 [2.0] years; 52.4% girls; mean BMI 19.3 [3.2]; 28.7% ≥85 percentiles) participated in the study. Only 38.3% of Korean American children met established recommendations of five fruits/vegetables per day; 56.5% met recommendations for more than 3 days per week of vigorous physical activity; and 40.8% met recommendations for obesity in Korean American children and initiate clinical interventions to improve obesity-risk behaviours, especially sedentary behaviour, in Korean American children. Clinical assessment and management of the risk of developing overweight and obesity as well as obesity-related behaviours are important to improve obesity-related complications in overall Korean Americans. © 2017 John Wiley & Sons Ltd.
Martín, Vicente; Dávila Batista, Verónica; Castilla, Jesús; Godoy i García, Pere; Delgado Rodríguez, Miguel; Soldevila, Núria; Molina, Antonio J.; Fernandez Villa, Tania; Astray, Jenaro; Castro, Andy; Gonzalez-Candelas, Fernando; Mayoral, José María; Quintana, José María; Domínguez García, Àngela; Trilla García, Antoni
2016-01-01
Background Obesity is a world-wide epidemic whose prevalence is underestimated by BMI measurements, but CUN-BAE (Clínica Universidad de Navarra - Body Adiposity Estimator) estimates the percentage of body fat (BF) while incorporating information on sex and age, thus giving a better match. Our aim is to compare the BMI and CUN-BAE in determining the population attributable fraction (AFp) for obesity as a cause of chronic diseases. Methods We calculated the Pearson correlation coefficient betwe...
Development and evaluation of aerogel-filled BMI sandwich panels for thermal barrier applications
Directory of Open Access Journals (Sweden)
A. Dineshkumar
2016-07-01
Full Text Available This study details a fabrication methodology envisaged to manufacture Glass/BMI honeycomb core aerogel-filled sandwich panels. Silica aerogel granules are used as core fillers to provide thermal insulation properties with little weight increase. Experimental heat transfer studies are conducted on these panels to study the temperature distribution between their two surfaces. Numerical studies are also carried out to validate the results. Despite exhibiting good thermal shielding capabilities, the Glass/BMI sandwich panels are found to oxidise at 180 ºC if exposed directly to heat. In order to increase the temperature bearing capacity and the operating temperature range for these panels, a way of coating them from outside with high temperature spray paint was tried. With a silicone-based coating, the temperature sustainability of these sandwich panels is found to increase to 350 ºC. This proved the effectiveness of the formed manufacturing process, selected high temperature coating, the coating method as well as the envisaged sandwich panel concept.
Keskin, Mehmet Zeynel; Budak, Salih; Aksoy, Evrim Emre; Yücel, Cem; Karamazak, Serkan; Ilbey, Yusuf Ozlem; Kozacıoğlu, Zafer
2017-10-03
To evaluate the effects of body mass index (BMI) ratio on semen parameters and serum reproductive hormones. The data of 454 patients who prsented to male infertility clinics in our hospital between 2014 and 2015 were analyzed retrospectively. Weight, height, serum hormone levels and semen analysis results of the patients were obtained. BMI values were calculated by using the weight and height values of the patients and they were classified as group 1 for BMI values ≤ 25 kg/m2, as group 2 for BMI values 25-30 kg/m2 and as group 3 for BMI values ≥ 30 kg/m2. The mean values of BMI, semen volume, concentration, total motility, progressive motility, total progressive motile sperm count (TPMSC), normal morphology according to Kruger, head abnormality, neck abnormality, tail abnormality, FSH, LH, prolactin, T/E2, total testosterone and estradiol parameters of the patients were considered. Patients were divided according to BMI values in Group 1 (n = 165), Group 2 (n = 222) and Group 3 (n = 56). There was no statistically significant difference in terms of all variables between the groups. We analyzed the relationship between BMI level and semen parameters and reproductive hormones, demonstrating no relationship between BMI and semen parameters. In our study, BMI does not affect semen parameters although it shows negative correlation with prolactin and testosterone levels.
Directory of Open Access Journals (Sweden)
Mushtaq Muhammad Umair
2012-03-01
Full Text Available Abstract Background Child growth is internationally recognized as an important indicator of nutritional status and health in populations. This study was aimed to compare age- and gender-specific height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children. Methods A population-based study was conducted with a multistage cluster sample of 1860 children aged five to twelve years in Lahore, Pakistan. Smoothed height, weight and BMI percentile curves were obtained and comparison was made with the World Health Organization 2007 (WHO and United States' Centers for Disease Control and Prevention 2000 (USCDC references. Over- and under-nutrition were defined according to the WHO and USCDC references, and the International Obesity Task Force (IOTF cut-offs. Simple descriptive statistics were used and statistical significance was considered at P Results Height, weight and BMI percentiles increased with age among both boys and girls, and both had approximately the same height and a lower weight and BMI as compared to the WHO and USCDC references. Mean differences from zero for height-, weight- and BMI-for-age z score values relative to the WHO and USCDC references were significant (P Conclusion Pakistani school-aged children significantly differed from the WHO and USCDC references. However, z score means relative to the WHO reference were closer to zero and the present study as compared to the USCDC reference. Overweight and obesity were significantly higher while underweight and thinness/wasting were significantly lower relative to the WHO reference as compared to the USCDC reference and the IOTF cut-offs. New growth charts for Pakistani children based on a nationally representative sample should be developed. Nevertheless, shifting to use of the 2007 WHO child growth reference might have important implications for child health programs and primary care pediatric clinics.
Directory of Open Access Journals (Sweden)
Wendy Van Lippevelde
Full Text Available To investigate associations of family-related factors with children's breakfast consumption and BMI-z-score and to examine whether children's breakfast consumption mediates associations between family-related factors and children's BMI-z-score.Ten- to twelve-year-old children (n = 6374; mean age = 11.6 ± 0.7 years, 53.2% girls, mean BMI-z-score = 0.4 ± 1.2 and one of their parents (n = 6374; mean age = 41.4 ± 5.3 years, 82.7% female, mean BMI = 24.5 ± 4.2 kg/m(2 were recruited from schools in eight European countries (Belgium, Greece, Hungary, the Netherlands, Norway, Slovenia, Spain, and Switzerland. The children self-reported their breakfast frequency per week. The body weight and height of the children were objectively measured. The parents responded to items on family factors related to breakfast (automaticity, availability, encouragement, paying attention, permissiveness, negotiating, communicating health beliefs, parental self-efficacy to address children's nagging, praising, and family breakfast frequency. Mediation analyses were performed using multi-level regression analyses (child-school-country.Three of the eleven family-related variables were significantly associated with children's BMI-z-score. The family breakfast frequency was negatively associated with the BMI-z-score; permissiveness concerning skipping breakfast and negotiating about breakfast were positively associated with the BMI-z-score. Children's breakfast consumption was found to be a mediator of the two associations. All family-related variables except for negotiating, praising and communicating health beliefs, were significantly associated with children's breakfast consumption.Future breakfast promotion and obesity prevention interventions should focus on family-related factors including the physical home environment and parenting practices. Nevertheless, more longitudinal research and intervention studies to support these findings between family-related factors and
Big drinkers: how BMI, gender and rules of thumb influence the free pouring of wine.
Smarandescu, Laura; Walker, Doug; Wansink, Brian
2014-11-01
This research examines free pouring behavior and provides an account of how Body Mass Index (BMI) and gender might lead to the overpouring, and consequently the overconsumption of wine. An observational study with young adults investigated how BMI and gender affect free-pouring of wine over a variety of pouring scenarios, and how rules-of-thumb in pouring affect the quantities of alcohol poured by men and women across BMI categories. For men, the amount poured was positively related to BMI. However, BMI did not affect pours by women. The use of the "half glass" rule-of-thumb in pouring reduced the volume of wine poured by over 20% for both men and women. Importantly, this rule-of-thumb substantially attenuated the pours by men at high BMI levels. Increasing awareness of pouring biases represents an early and effective step toward curbing alcohol consumption among men, and especially those who are overweight. Additionally, using a simple "half glass" rule-of-thumb may be an effective way to curb overpouring, despite non-standard glass sizes. Copyright © 2014. Published by Elsevier B.V.
Kohlsdorf, Katja; Nunziata, Adriana; Funcke, Jan-Bernd; Brandt, Stephanie; von Schnurbein, Julia; Vollbach, Heike; Lennerz, Belinda; Fritsch, Maria; Greber-Platzer, Susanne; Fröhlich-Reiterer, Elke; Luedeke, Manuel; Borck, Guntram; Debatin, Klaus-Michael; Fischer-Posovszky, Pamela; Wabitsch, Martin
2018-02-27
To evaluate whether early childhood body mass index (BMI) is an appropriate indicator for monogenic obesity. A cohort of n = 21 children living in Germany or Austria with monogenic obesity due to congenital leptin deficiency (group LEP, n = 6), leptin receptor deficiency (group LEPR, n = 6) and primarily heterozygous MC4 receptor deficiency (group MC4R, n = 9) was analyzed. A control group (CTRL) was defined that consisted of n = 22 obese adolescents with no mutation in the above mentioned genes. Early childhood (0-5 years) BMI trajectories were compared between the groups at selected time points. The LEP and LEPR group showed a tremendous increase in BMI during the first 2 years of life with all patients displaying a BMI >27 kg/m 2 (27.2-38.4 kg/m 2 ) and %BMI P95 (percentage of the 95th percentile BMI for age and sex) >140% (144.8-198.6%) at the age of 2 years and a BMI > 33 kg/m 2 (33.3-45.9 kg/m 2 ) and %BMI P95 > 184% (184.1-212.6%) at the age of 5 years. The MC4R and CTRL groups had a later onset of obesity with significantly lower BMI values at both time points (p BMI trajectories in this pediatric cohort with monogenic obesity we suggest that BMI values >27.0 kg/m 2 or %BMI P95 > 140% at the age of 2 years and BMI values >33.0 kg/m 2 or %BMI P95 > 184% at the age of 5 years may be useful cut points to identify children who should undergo genetic screening for monogenic obesity due to functionally relevant mutations in the leptin gene or leptin receptor gene.
Hawkes, Colin P; Zemel, Babette S; Kiely, Mairead; Irvine, Alan D; Kenny, Louise C; O'B Hourihane, Jonathan; Murray, Deirdre M
2016-01-01
Although early infant growth has implications for future health, body composition reference data in infancy are limited. The aim of this study was to describe reference data for fat mass (FM) and fat-free mass (FFM) corrected for length (L) within the first 3 months and to evaluate if these measures predict the body mass index (BMI) at 2 years. Term infants had air displacement plethysmography performed at birth (n = 1,063) and approximately 2 months later (n = 922, between 49 and 86 days). Age- and sex-specific reference data were generated for FM, FFM, FM/L 3 and FFM/L 2 and compared with BMI at 2 years. FM/L 3 and FFM/L 2 were the optimal indices independent of length. In the first 3 months, mean FM/L 3 increased (males, from 2.7 to 5.9 kg/m 3 ; females, from 3.2 to 6.1 kg/m 3 ), whereas FFM/L 2 remained relatively stable (males, from 11.8 to 12.7 kg/m 2 ; females, from 12.8 to 12.1 kg/m 2 ). The odds of a BMI Z-score ≥2 at 2 years increased with increasing FM (OR 2.7, 95% CI 1.97-3.7) and weight (OR 2.27, 95% CI 1.64-3.13) Z-scores at 2 months. FM/L 3 and FFM/L 2 provide length-independent measures of FM and FFM in infancy. During the first 3 months, there is an increase in FM/L 3 , but not in FFM/L 2 . The weight Z-score at 2 months is as good at predicting BMI at 2 years as body composition parameters. © 2016 S. Karger AG, Basel.
Huotari, P; Heikinaro-Johansson, P; Watt, A; Jaakkola, T
2018-03-01
The aim of this study was to examine the secular trends in fundamental movement skills (FMS) among 15- to 16-year-old adolescents at 2 assessment points scheduled in 2003 and 2010 and to investigate the associations between FMS, physical activity (PA), and body mass index (BMI). In 2003, self-reported PA, weight and height, and objective FMS scores were collected from 2390 students, and in 2010, similar data were generated from a second sample of 1346 students. FMS were assessed during both assessment phases using 3 identical objective FMS tests that were figure 8 dribbling, jumping laterally, and coordination track tests. This study indicated that the sum index of FMS did not change among the boys and the girls between 2 data collection points. However, findings demonstrated a secular decline in coordination test scores in both gender groups between 2 measurement points but an improvement in girls' object control skills between 2003 and 2010. The results also showed that FMS had a significant main effect on BMI in both gender groups, whereas the main effect of PA on BMI was not significant for either gender group. Results also demonstrated that there was no significant interaction effect between FMS and PA on BMI in either of the girls' or the boys' groups. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Mehmet Zeynel Keskin
2017-10-01
Full Text Available Aim: To evaluate the effects of body mass index (BMI ratio on semen parameters and serum reproductive hormones. Materials and methods: The data of 454 patients who prsented to male infertility clinics in our hospital between 2014 and 2015 were analyzed retrospectively. Weight, height, serum hormone levels and semen analysis results of the patients were obtained. BMI values were calculated by using the weight and height values of the patients and they were classified as group 1 for BMI values ≤ 25 kg/m2, as group 2 for BMI values 25-30 kg/m2 and as group 3 for BMI values ≥ 30 kg/m2. Results: The mean values of BMI, semen volume, concentration, total motility, progressive motility, total progressive motile sperm count (TPMSC, normal morphology according to Kruger, head abnormality, neck abnormality, tail abnormality, FSH, LH, prolactin, T/E2, total testosterone and estradiol parameters of the patients were considered. Patients were divided according to BMI values in Group 1 (n = 165, Group 2 (n = 222 and Group 3 (n = 56. There was no statistically significant difference in terms of all variables between the groups. Conclusions: We analyzed the relationship between BMI level and semen parameters and reproductive hormones, demonstrating no relationship between BMI and semen parameters. In our study, BMI does not affect semen parameters although it shows negative correlation with prolactin and testosterone levels.
Reas, Deborah L; Wisting, Line; Kapstad, Hilde; Lask, Bryan
2012-01-01
Nibbling has been defined by the Eating Disorder Examination (EDE 16.0) as eating in an unplanned and repetitious manner between meals and snacks without an accompanying sense of loss of control. We investigated the nature and frequency of nibbling in young women. Fifty-eight university women aged 19-41 years with an average BMI of 22.8 (4.8) were administered the EDE-interview. Only 9% of women reported no nibbling during the preceding 28 days, 14% nibbled on 1-5 days; 40% on 6-12 days; 21% on 13-15 days and 17% nibbled on 16-28 days. Nibbling was not significantly related to BMI, frequency of meals, binge eating, dietary restraint, or shape, eating, or weight concerns. Significant inverse relationships were found between nibbling and food avoidance (-.27, p=.03) and sensitivity to weight gain (-.26; p=.04). Nibbling occurred frequently among young women but did not appear to have significant consequences for BMI, the overall pattern or eating, shape or weight concerns, or for any measured pathological eating behaviors. Copyright © 2011 Elsevier Ltd. All rights reserved.
Ibe, Yoko; Miyakawa, Happei; Fuse-Nagase, Yasuko; Hirose, Ayumi Sugawara; Hirasawa, Reiko; Yachi, Yoko; Fujihara, Kazuya; Kobayashi, Kazuto; Shimano, Hitoshi; Sone, Hirohito
2016-09-01
Epidemiological longitudinal investigations of the association between not eating three meals regularly and changes in BMI and weight are scarce. The aim of this study was to investigate whether or not regularly eating three meals was associated with changes in BMI and weight in young Japanese men and women. Study participants were 1241 men and 897 women aged 19.0±1.2 and 18.8±0.8years, respectively, who underwent health checkups at a university in Japan in 2001 as the baseline and subsequently in 2003. Weight and height were measured at baseline and 2years later. Whether an individual ate three meals regularly was determined by a self-report questionnaire in 2001. During the 2-year follow-up, the BMI gain was 0.347 for men and 0.067 for women. In the logistic regression analysis, for men, eating three meals irregularly was significantly associated with a 4% BMI gain (OR 1.60, CI 1.11-2.30), 6% BMI gain (OR 1.72, CI 1.12-2.63), 4kg weight gain (OR 2.01, CI 1.29-3.13), 6kg weight gain (OR 1.86, CI 1.02-3.37), and incidence of obesity (BMI ≧ 25)(OR 2.96, CI 1.22-7.17). For women, eating three meals irregularly was significantly associated with a 4% BMI loss (OR 1.99, CI 1.01-3.94), 6% BMI loss (OR 2.79, CI 1.29-6.03), 4kg weight loss (OR 3.85, CI 1.62-9.12), 6kg weight loss (OR 7.65, CI 2.06-28.46), and the incidence of underweight (OR 3.95, CI 1.32-11.89). The current results suggested that eating three meals irregularly was associated with subsequent BMI and weight gains for men and subsequent BMI and weight losses for women; both groups were around 20years of age. Self-reported eating behavior in this study might be used to screen and evaluate young Japanese men and women at high risk for changes in BMI and weight in a practical clinical setting. Copyright © 2016 Elsevier Inc. All rights reserved.
Jin, Jianliang; Lv, Xianhui; Chen, Lulu; Zhang, Wei; Li, Jinbo; Wang, Qian; Wang, Rong; Lu, Xiang; Miao, Dengshun
2014-01-01
To determine whether Bmi-1 deficiency could lead to renal tubulointerstitial injury by mitochondrial dysfunction and increased oxidative stress in the kidney, 3-week-old Bmi-1-/- mice were treated with the antioxidant N-acetylcysteine (NAC, 1 mg mL−1) in their drinking water, or pyrro-quinoline quinone (PQQ, 4 mg kg−1 diet) in their diet for 2 weeks, and their renal phenotypes were compared with vehicle-treated Bmi1-/- and wild-type mice. Bmi-1 was knocked down in human renal proximal tubular epithelial (HK2) cells which were treated with 1 mm NAC for 72 or 96 h, and their phenotypes were compared with control cells. Five-week-old vehicle-treated Bmi-1-/- mice displayed renal interstitial fibrosis, tubular atrophy, and severe renal function impairment with decreased renal cell proliferation, increased renal cell apoptosis and senescence, and inflammatory cell infiltration. Impaired mitochondrial structure, decreased mitochondrial numbers, and increased oxidative stress occurred in Bmi-1-/- mice; subsequently, this caused DNA damage, the activation of TGF-β1/Smad signaling, and the imbalance between extracellular matrix synthesis and degradation. Oxidative stress-induced epithelial-to-mesenchymal transition of renal tubular epithelial cells was enhanced in Bmi-1 knocked down HK2 cells. All phenotypic alterations caused by Bmi-1 deficiency were ameliorated by antioxidant treatment. These findings indicate that Bmi-1 plays a critical role in protection from renal tubulointerstitial injury by maintaining redox balance and will be a novel therapeutic target for preventing renal tubulointerstitial injury. PMID:24915841
Does BMI influence hospital stay and morbidity after fast-track hip and knee arthroplasty?
DEFF Research Database (Denmark)
Husted, Henrik; Jørgensen, Christoffer C; Gromov, Kirill
2016-01-01
Background and purpose - Body mass index (BMI) outside the normal range possibly affects the perioperative morbidity and mortality following total hip arthroplasty (THA) and total knee arthroplasty (TKA) in traditional care programs. We determined perioperative morbidity and mortality in such pat......Background and purpose - Body mass index (BMI) outside the normal range possibly affects the perioperative morbidity and mortality following total hip arthroplasty (THA) and total knee arthroplasty (TKA) in traditional care programs. We determined perioperative morbidity and mortality...... in such patients who were operated with the fast-track methodology and compared the levels with those in patients with normal BMI. Patients and methods - This was a prospective observational study involving 13,730 procedures (7,194 THA and 6,536 TKA operations) performed in a standardized fast-track setting....... Complete 90-day follow-up was achieved using national registries and review of medical records. Patients were grouped according to BMI as being underweight, of normal weight, overweight, obese, very obese, and morbidly obese. Results - Median length of stay (LOS) was 2 (IQR: 2-3) days in all BMI groups. 30...
Programs of Active Aging – A Relation between BMI and Triglycerides
Samuel Honório; Marco Batista; Júlio Martins; João Cardoso; Miguel Dias; Bruno Ferreira
2014-01-01
Objective: To enhance the importance of physical activity programs for elderly and their influence on BMI and triglycerides. Methods: The sample consisted of 91 elderly individuals, 63 females and 28 males aged between 65 and 78 years of age. All seniors practice water activities, including swimming and gymnastics. Were analyzed with respect to two aspects: BMI, Triglycerides and practice time, seniors who were physically active at least 2 months, and seniors who maintained habits of physical...
Mehnati, Parinaz; Alizadeh, Hamed; Hoda, Haleh
2016-01-01
Mammographic density determined according paranchymal patterns is a risk factor for breast cancer and its relationships with body and other breast characteristics of women is important. The purpose of the present study was to correlate breast parenchymal patterns and mammography abnormality findings with women's BMI, compressed breast thickness (CBT) and age in Tabriz city, Iran. From 1,100 mammograms interpreted by radiologists, breast parenchymal was classified into four categories from Types 1 (mostly fatty) through 4 (mostly fibroglandular tissue). Age, BMI, and CBT were recorded and their relation with risk for the development of breast abnormalities in mammograms was analyzed. In women with a mean age of 45.8±8.63 years 17.7% were in the high density group (Type 3 and 4). A comparison of four types of breast paranchymal with BMI, CBT and age showed inverse relations to breast density. Abnormal mammographic findings were 25.8% of all reported mammograms with a circular mass (12.7%) as the most common abnormality. About 21% abnormal cases were in less than 40 years. Increasing of BMI had significant relation with breast abnormality but in CBT was not observed. Measurement of women's body characteristics is useful for assistance in mammography diagnosis as well as selection of imaging instrument by high sensitivity for following patient in future. The effects of age, CBT and BMI groups on the breast paranchymal were significant.
Wpływ ilości spożywanych posiłków na wartość wskaźnika BMI = Influence amount of food meals for BMI
Directory of Open Access Journals (Sweden)
Dorota Nalepa
2016-03-01
Wyniki. Ilość dziennie spożywanych posiłków przez respondentów jest różna. Biorąc pod uwagę wiek respondentów, który traktowany jest jako przynależność do jednej z grup, uczących się lub pracujących zauważono że osoby uczące się najczęściej spożywają 4-5 posiłki zadeklarowało tak 40 badanych (58,8%, 3 posiłki spożywa 21 osób (30,9%. Od 6- do 8 posiłków dziennie spożywa 5 osób (7,4% w tej grupie zaś 2osoby zjadają tylko 2 posiłki (2,9%. Wnioski. Na podstawie przeprowadzonych badań własnych sformułowano następujące wnioski: - na regularność spożywania posiłków nie mają wpływu wiek i płeć respondentów, istnieje natomiast istotny związek między miejscem zamieszkania a ilością spożywanych posiłków. - na wartość wskaźnika BMI ma wpływ wiek i płeć respondentów. Osoby uczące się oraz kobiety przywiązują uwagę do swojej wagi i BMI częściej osiąga granice wskazujące na prawidłową masę ciała. - pierwsze śniadania są spożywane przez większość respondentów i nie mają na to wpływu czynniki społeczno - demograficzne takie jak wiek, płeć i miejsce zamieszkania. Słowa kluczowe: otyłość, wskaźnik BMI. Summary The aim of the investigation is to assess the influence of the number of consumed meals upon the BMI. Methods and materials The research was conducted from January to February 2015 in a medical clinic in Lublin. 148 respondents were qualified for the research. The applied method was a diagnostic survey carried out among the respondents, which used: the birth certificate, interview as well as anthropometric measurements, covering the body height and body mass. In this way, the Body Mass Index was determined. Findings The number of meals, consumed daily, varied. Taking into account the age of the respondents, which served to divide the persons into different groups – studying or working ones, it was observed that students
Directory of Open Access Journals (Sweden)
Stephanie Schrempft
Full Text Available The home environment is thought to play a key role in early weight trajectories, although direct evidence is limited. There is general agreement that multiple factors exert small individual effects on weight-related outcomes, so use of composite measures could demonstrate stronger effects. This study therefore examined whether composite measures reflecting the 'obesogenic' home environment are associated with diet, physical activity, TV viewing, and BMI in preschool children.Families from the Gemini cohort (n = 1096 completed a telephone interview (Home Environment Interview; HEI when their children were 4 years old. Diet, physical activity, and TV viewing were reported at interview. Child height and weight measurements were taken by the parents (using standard scales and height charts and reported at interview. Responses to the HEI were standardized and summed to create four composite scores representing the food (sum of 21 variables, activity (sum of 6 variables, media (sum of 5 variables, and overall (food composite/21 + activity composite/6 + media composite/5 home environments. These were categorized into 'obesogenic risk' tertiles.Children in 'higher-risk' food environments consumed less fruit (OR; 95% CI = 0.39; 0.27-0.57 and vegetables (0.47; 0.34-0.64, and more energy-dense snacks (3.48; 2.16-5.62 and sweetened drinks (3.49; 2.10-5.81 than children in 'lower-risk' food environments. Children in 'higher-risk' activity environments were less physically active (0.43; 0.32-0.59 than children in 'lower-risk' activity environments. Children in 'higher-risk' media environments watched more TV (3.51; 2.48-4.96 than children in 'lower-risk' media environments. Neither the individual nor the overall composite measures were associated with BMI.Composite measures of the obesogenic home environment were associated as expected with diet, physical activity, and TV viewing. Associations with BMI were not apparent at this age.
Association of Rotating Night Shift Work with BMI and Abdominal Obesity among Nurses and Midwives.
Peplonska, Beata; Bukowska, Agnieszka; Sobala, Wojciech
2015-01-01
Mounting epidemiological evidence suggests that night shift work may contribute to the etiology of increased body weight. The present study aimed to examine association between rotating night shift work and body mass index (BMI), and abdominal adiposity respectively among nurses and midwives. A cross-sectional study was conducted among 724 female nurses and midwives, aged 40-60 years (354 rotating night shift and 370 daytime workers) in Łódź, Poland, between 2008 and 2011. Information about occupational history and potential confounders was collected during personal interviews. Anthropometric measurements of body weight, height, waist (WC) and hip (HC) circumference were made, and body mass index (BMI), waist to hip ratio (WHR) and waist to height ratio (WHtR) were calculated. GLM regression models and multinomial logit regression models were fitted to explore the association between night shift work and anthropometric parameters, with adjustment for age, body silhouette at age 20, current smoking status, packyears, marital status, and menopausal hormone therapy use. Cumulative night shift work showed significant associations with BMI, WC, HC and WHtR, with BMI increasing by 0.477 kg/m2 per 1000 night duties and by 0.432 kg/m2 per 10000 night shift hours, WC increasing respectively by 1.089 cm and 0.99 cm, and HC by 0.72 cm and WHtR by 0.007 cm for both metrics. Both current and cumulative night work was associated with obesity (BMI≥30kg/m2), with OR=3.9 (95%CI:1.5-9.9), in women reporting eight or more night shifts per month. The results of the study support the previously reported relations between night shift work and development of obesity.
Directory of Open Access Journals (Sweden)
Silje Steinsbekk
2017-11-01
Full Text Available Individuals who are overweight are more likely to underestimate their body size than those who are normal weight, and overweight underestimators are less likely to engage in weight loss efforts. Underestimation of body size might represent a barrier to prevention and treatment of overweight; thus insight in how underestimation of body size develops and tracks through the childhood years is needed. The aim of the present study was therefore to examine stability in children’s underestimation of body size, exploring predictors of underestimation over time. The prospective path from underestimation to BMI was also tested. In a Norwegian cohort of 6 year olds, followed up at ages 8 and 10 (analysis sample: n = 793 body size estimation was captured by the Children’s Body Image Scale, height and weight were measured and BMI calculated. Overall, children were more likely to underestimate than overestimate their body size. Individual stability in underestimation was modest, but significant. Higher BMI predicted future underestimation, even when previous underestimation was adjusted for, but there was no evidence for the opposite direction of influence. Boys were more likely than girls to underestimate their body size at ages 8 and 10 (age 8: 38.0% vs. 24.1%; Age 10: 57.9% vs. 30.8% and showed a steeper increase in underestimation with age compared to girls. In conclusion, the majority of 6, 8, and 10-year olds correctly estimate their body size (prevalence ranging from 40 to 70% depending on age and gender, although a substantial portion perceived themselves to be thinner than they actually were. Higher BMI forecasted future underestimation, but underestimation did not increase the risk for excessive weight gain in middle childhood.
Christine, Paul J; Diez Roux, Ana V; Wing, Jeffrey J; Alazraqui, Marcio; Spinelli, Hugo
2015-04-01
We investigated temporal trends in BMI, and assessed hypothesized predictors of trends including socio-economic position (SEP) and province-level economic development, in Argentina. Using multivariable linear regression, we evaluated cross-sectional patterning and temporal trends in BMI and examined heterogeneity in these associations by SEP and province-level economic development with nationally representative samples from Argentina in 2005 and 2009. We calculated mean annual changes in BMI for men and women to assess secular trends. Women, but not men, exhibited a strong cross-sectional inverse association between SEP and BMI, with the lowest-SEP women having an average BMI 2.55 kg/m(2) greater than the highest-SEP women. Analysis of trends revealed a mean annual increase in BMI of 0.19 kg/m(2) and 0.15 kg/m(2) for women and men, respectively, with slightly greater increases occurring in provinces with greater economic growth. No significant heterogeneity in trends existed by individual SEP. BMI is increasing rapidly over time in Argentina irrespective of various sociodemographic characteristics. Higher BMI remains more common in women of lower SEP compared with those of higher SEP.
Are genes associated with energy metabolism important in asthma and BMI?
Szczepankiewicz, Aleksandra; Breborowicz, Anna; Sobkowiak, Paulina; Popiel, Anna
2009-02-01
Increased serum leptin levels have been observed in asthmatic patients. Leptin, via proliferation and activation of Th2 cells, may induce inflammation in asthma. It has also been demonstrated that leptin mRNA expression and protein levels increase in response to inflammatory stimuli. We hypothesized that polymorphisms in the leptin receptor, leptin and ghrelin genes, may affect their expression and, therefore, be responsible for altered response to increased leptin levels observed in asthma. To our knowledge, there were no studies on a potential role of LEPR, LEP, and GHRL polymorphisms in asthma. We analyzed 129 pediatric patients with asthma and 114 healthy children from the control group ranging from 6 to 18 years of age. The diagnosis of allergic asthma was based on clinical symptoms, the lung function test, and the positive skin prick test and/or increased immunoglobulin E (IgE) levels. Polymorphisms were genotyped by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Statistical analyses were performed with Statistica v.7.1 software (Statistica, StatSoft, Poland; available free at http://www.broad.mit.edu/mpg/haploview/index.php). Linkage disequilibrium analysis was performed with Haploview v.4.0. We observed a statistically significant association of the 3'UTR A/G and the -2549A/G polymorphisms of the leptin gene with asthma. No association with asthma was observed for the K109R and the Q223R polymorphisms of the LEPR gene and the Met72Leu polymorphism of the ghrelin gene. In the analysis of body mass index (BMI) stratified by genotype, we found an association of the -2549A/G LEP, but not of LEPR and GHRL polymorphisms, with higher BMI values in asthmatic patients. We found suggestive evidence for linkage between the two polymorphisms of the LEPR gene (D' = 0.84 CI: 0.71-0.92; r(2) = 0.29) in linkage disequilibrium analysis: The GG haplotype was more frequent in the control healthy group (p = 0.057). No linkage
Coupling of snow and permafrost processes using the Basic Modeling Interface (BMI)
Wang, K.; Overeem, I.; Jafarov, E. E.; Piper, M.; Stewart, S.; Clow, G. D.; Schaefer, K. M.
2017-12-01
We developed a permafrost modeling tool based by implementing the Kudryavtsev empirical permafrost active layer depth model (the so-called "Ku" component). The model is specifically set up to have a basic model interface (BMI), which enhances the potential coupling to other earth surface processes model components. This model is accessible through the Web Modeling Tool in Community Surface Dynamics Modeling System (CSDMS). The Kudryavtsev model has been applied for entire Alaska to model permafrost distribution at high spatial resolution and model predictions have been verified by Circumpolar Active Layer Monitoring (CALM) in-situ observations. The Ku component uses monthly meteorological forcing, including air temperature, snow depth, and snow density, and predicts active layer thickness (ALT) and temperature on the top of permafrost (TTOP), which are important factors in snow-hydrological processes. BMI provides an easy approach to couple the models with each other. Here, we provide a case of coupling the Ku component to snow process components, including the Snow-Degree-Day (SDD) method and Snow-Energy-Balance (SEB) method, which are existing components in the hydrological model TOPOFLOW. The work flow is (1) get variables from meteorology component, set the values to snow process component, and advance the snow process component, (2) get variables from meteorology and snow component, provide these to the Ku component and advance, (3) get variables from snow process component, set the values to meteorology component, and advance the meteorology component. The next phase is to couple the permafrost component with fully BMI-compliant TOPOFLOW hydrological model, which could provide a useful tool to investigate the permafrost hydrological effect.
Coyne, K; Whigham, L D; O'Leary, K; Yaklic, J K; Maxwell, R A; Lindheim, S R
2016-01-01
Data suggest that female obesity impairs uterine receptivity and increases the risk of fetal and neonatal mortality. We analyzed the reproductive outcomes of gestational carriers (GCs) undergoing donated oocytes and assisted reproductive technology according to body mass index (BMI). A retrospective analysis of 163 GCs undergoing 226 in vitro fertilization (IVF) and embryo transfer cycles. GCs undergoing in vitro fertilization and embryo transfer cycles were analyzed and divided according to their BMI (healthy weight: 20-24.9 kg m(-2) (n=77 in 114 cycles); overweight: 25-29.9 kg m(-)(2) (n=55 in 71 cycles); and obese: 30-35 kg m(-)(2) (n=31 in 41 cycles)). All GCs underwent a complete medical evaluation and were cleared for pregnancy before being selected. Overweight and obese GCs also underwent a metabolic screening, including an oral glucose tolerance test and lipid profile. The main outcomes measured were clinical pregnancy and live birth rates, antenatal and neonatal outcomes. Clinical pregnancy and live birth rates were similar despite increasing BMI. There were no statistically significant differences in the implantation rates, clinical pregnancy rates or live birth rates per embryo transfer among patients in the three BMI groups. In the healthy weight, overweight and obese GCs, the clinical pregnancy rates per GC were 72%, 84% and 79%, and per embryo transfer rates were 52%, 49% and 56%, respectively; P=NS. The live birth rates per GC were 70%, 84% and 75%, and per embryo transfer rates were 50%, 49% and 53%, respectively; P=NS. Twin rates were similar between the groups (35%, 31% and 29%, respectively; P=NS). There were no differences in gestational diabetes, preterm admissions or cesarean section rates. Neonatal intensive care unit admissions were similar (11%, 13% and 12%, respectively; P=NS), and no maternal, neonatal or infant mortality occurred. These data show that increasing obesity does not impair the reproductive outcome in GC cycles
Trajectories of BMI from early childhood through early adolescence: SES and psychosocial predictors.
Lane, Sean P; Bluestone, Cheryl; Burke, Christopher T
2013-02-01
This study examined the ways in which body mass index (BMI) percentile - an identified risk factor for overweight and cardiovascular disease in adulthood - develops from birth through early adolescence. In addition, we examined whether psychosocial factors, such as parenting style and maternal depression, mediated the link between socio-economic status (SES) and BMI growth. Design. Data were obtained from phases 1-3 of the National Institute of Child Health and Human Development (NICHD) Study of Early Child Care and Youth Development (SECCYD) - a longitudinal study that followed children from 10 communities in the United States from birth to age 11. We applied growth mixture models to identify distinct subtypes of BMI development. Within these models, we performed between- and within-class mediation analyses to examine whether SES predicted class membership or differences in development within each class via maternal depression and parenting styles. Results identified three prototypic trajectories of BMI percentile growth, elevated, steady increase, and stable. We found evidence for both between- and within-class mediation, suggesting multiple pathways by which SES can affect BMI development. These findings add to the research that suggests that being in a family with a low SES is associated with falling into patterns of development characterized by early and lasting increases in BMI relative to one's peers, and that this association is partly accounted for by maternal depression and parenting styles. What is already known? Past research has found evidence that patterns of childhood overweight are impacted by socioeconomic status through psychosocial factors like parenting and depression. This evidence is often limited to individual points in time where neglectful, permissive, and authoritarian parenting and higher levels of maternal depression are associated with higher levels of overweight status among children from infancy to adolescence. However, little
BMI-Referenzwerte für österreichische Knaben und Mädchen
Directory of Open Access Journals (Sweden)
Mayer M
2015-01-01
Full Text Available BMI-Referenzwerte werden empfohlen zur Diagnose von Untergewicht, Übergewicht und Adipositas. Österreichische BMI-Referenzwerte sind bis dato nicht in ausreichender Qualität verfügbar. Deshalb wurden im Rahmen einer Querschnittsstudie 15.000 Kinder und Jugendliche zwischen 4 und 19 Jahren vermessen und abgewogen. Perzentilenkurven für Knaben und Mädchen wurden mit dem GAMLSS-Modell errechnet. Als Grenzwert für die Einteilung in Untergewicht, Normalgewicht, Übergewicht und Adipositas wurden Perzentilenkurven durch die entsprechenden BMI-Punkte mit 18 Jahren erstellt, welche den WHO-Grenzen von Unter-, Normal- und Übergewicht bzw. Adipositas bei Erwachsenen entsprechen. Unter Anwendung dieser neuen Grenzwerte sind rund 18 % der Knaben und 12 % der Mädchen übergewichtig, weitere 5 % der Knaben und 3 % der Mädchen sind adipös. Übergewicht und Adipositas sind somit bei Kindern und Jugendlichen in Österreich ein nicht zu vernachlässigendes Problem.
Directory of Open Access Journals (Sweden)
Sabra L. Katz-Wise
2014-01-01
Full Text Available Obesity is a key public health issue for US youth. Previous research with primarily white samples of youth has indicated that sexual minority females have higher body mass index (BMI and sexual minority males have lower BMI than their same-gender heterosexual counterparts, with sexual orientation differences in males increasing across adolescence. This research explored whether gender and sexual orientation differences in BMI exist in nonwhite racial/ethnic groups. Using data from Waves I–IV (1995–2009 of the US National Longitudinal Study of Adolescent Health (N = 13,306, ages 11–34 years, we examined associations between sexual orientation and BMI (kg/m2 over time, using longitudinal linear regression models, stratified by gender and race/ethnicity. Data were analyzed in 2013. Among males, heterosexual individuals showed greater one-year BMI gains than gay males across all race/ethnicity groups. Among females, white and Latina bisexual individuals had higher BMI than same-race/ethnicity heterosexual individuals regardless of age; there were no sexual orientation differences in black/African Americans. Sexual orientation disparities in BMI are a public health concern across race/ethnicity groups. Interventions addressing unhealthy weight gain in youth must be relevant for all sexual orientations and race/ethnicities.
Parental Activity as Influence on Childrenˋs BMI Percentiles and Physical Activity
Directory of Open Access Journals (Sweden)
Nanette Erkelenz, Susanne Kobel, Sarah Kettner, Clemens Drenowatz, Jürgen M. Steinacker and the Research Group "Join the Healthy Boat - Primary School"
2014-09-01
Full Text Available Parents play a crucial role in the development of their children’s lifestyle and health behaviour. This study aims to examine associations between parental physical activity (PA and children’s BMI percentiles (BMIPCT, moderate to vigorous PA (MVPA as well as participation in organised sports. Height and body weight was measured in 1615 in German children (7.1 ± 0.6 years, 50.3% male and converted to BMIPCT. Parental BMI was calculated based on self-reported height and body weight. Children’s MVPA and sports participation as well as parental PA were assessed via parental questionnaire. Analysis of covariance (ANCOVA, controlling for age and family income was used to examine the association between parental and children’s PA levels as well as BMIPCT. 39.7% of the parents classified themselves as physically active and 8.3% of children were classified as overweight or obese. Lower BMIPCT were observed with both parents being physically active (44.5 ± 26.3 vs. 50.2 ± 26.9 and 52.0 ± 28.4, respectively. There was no association between parental and children’s PA levels but children with at least one active parent displayed a higher participation in organised sports (102.0 ± 96.6 and 117.7 ± 123.6 vs. 73.7 ± 100.0, respectively. Children of active parents were less likely to be overweight and obese. The lack of association between subjectively assessed parental PA and child MVPA suggests that parental support for PA in children is more important than parents being a role model. More active parents, however, may be more likely to facilitate participation in organised sports. These results underline the importance of the inclusion of parents in health promotion and obesity prevention programmes in children.
DEFF Research Database (Denmark)
Nielsen, Tenna Ruest Haarmark; Fonvig, Cilius Esmann; Dahl, Maria
2018-01-01
Objective The body mass index (BMI) standard deviation score (SDS) may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during......, and 80% improved their lipid concentrations. Conclusion Reductions in the degree of obesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma lipid concentrations. Even in individuals increasing their BMI SDS, body composition...... childhood obesity treatment. Methods 876 children and adolescents (498 girls) with overweight/obesity, median age 11.2 years (range 1.6±21.7), and median BMI SDS 2.8 (range 1.3±5.7) were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0...
Ijarotimi, Oluwole Steve
2010-06-01
Breastfeeding is an unequalled way of providing ideal food for the infants. The benefits of breastfeeding practices to infants and mothers are well documented. However, information on breastfeeding practices and its effect on body mass index (BMI) of mothers are scarce, particularly in Ekiti State of Nigeria. Therefore, the present study is designed to assess breastfeeding practices and its association with BMI of mothers. A descriptive and cross-sectional study was conducted among breastfeeding mothers that attended postnatal clinic of the state specialist hospitals and maternity centers in the study location. The specialist hospital and two-third of the nine maternity centers were purposively selected because of their health facilities and personnel. The mother-child pairs (200 respondents) were randomly selected from the study locations. Information on demographic characteristic, socio-economic parameters, nutritional knowledge of breastfeeding and dietary intakes of mothers were collected using questionnaires. BMI of mothers was determined as described by World Health Organization. Age distribution of mothers was between 25-34 years; and almost half of respondents had good educational background and were engaged in different occupations. The respondent monthly income ranged between = N = 3500 - 26000 ($26.92 - $200); and their dietary intakes varied between starchy and protein-based food. The result also showed that the respondent consumed enough nutrients to meet up the recommended daily allowance for protein, carbohydrate, fat, zinc, magnesium, sodium and phosphorous requirements. The BMI classifications showed that over three-fifth of respondents were normal, while the remaining were underweight (6%) and overweight/obese (26.5%). Also, large proportion of respondents engaged in exclusive breastfeeding and with good knowledge of breastfeeding practices. Statistically, exclusive breastfeeding practices had no correlation between the BMI and frequency of
Kiuru, Eveliina; Kokki, Hannu; Juvonen, Petri; Lintula, Hannu; Paajanen, Hannu; Gissler, Mika; Eskelinen, Matti
2014-01-01
The impact of the age and sex adjusted body mass index (ISO-BMI) in the obese vs. non-obese children and adolescents with cholecystectomy for cholelithias is rarely reported. The national database was searched for cholecystectomies performed in paediatric patients between 1997 and 2011, and the 59 paediatric and adolescent patients having cholecystectomy in the Kuopio University Hospital district were divided in two groups by age and sex adjusted BMI (ISO-BMI) using the cut-off point of overweight (ISO-BMI 25 kg/m(2)) based on the Finnish growth standards. Nationwide a total of 840 cholecystectomies were performed during the 15 years study period in Finland, most of which included females (77%), resulting in a mean of annual frequency of 4.8 (range: 3.9-6.1) procedures/100,000 population. In the study sample, most of the patients with the cholelithiasis were female (50/59, 85%). The gender distribution was equal among the younger patients, but among adolescents 6/52 (12%) of the patients with cholelithiasis were boys and 46/52 (88%) of the patients with cholelithiasis were girls. Obesity did not affect on operative parameters. The median operative time was 70 min (range, 30-155) and 66 min (44-130) in the high ISO-BMI-group. The recovery was similar in the two groups: the median length of hospital stay was 4 days in both groups. The patients in the low ISO-BMI-group vs. high ISO-BMI-group had a trend of higher serum bilirubin (p=0.16) and serum AFOS values (p=0.19). In the histological examination of the gallbladders 19/28 (68%) patients in the low ISO-BMI-group had inflammation vs. 26/31 (84%) patients in the high ISO-BMI-group (p=0.15). Our results between obese and non-obese children and adolescents with cholelithiasis are not statistically significant. The obese adolescents with female gender are in greater risk for cholelithiasis. Copyright © 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Zimmerman, Annie R; Johnson, Laura; Brunstrom, Jeffrey M
2018-03-24
Although regular meal timings are recommended for weight loss, no study has characterised irregularity in the timing of eating occasions or investigated associations with body-mass index (BMI). Here, we characterise "chaotic eating" as the tendency to eat at variable times of day. In two studies, we used a novel measure to explore the relationship between BMI and chaotic eating. In Study 1 (N = 98) we measured BMI and used a self-report measure to assess the usual range of times that meals and snacks are consumed over a seven-day period, as well as meal and snack frequency. A separate meal and snack 'chaotic eating index' was derived from the number of possible thirty-minute snack- or meal-slots, divided by the frequency of these eating events. After adjusting for age, gender, and dietary habits (Three-Factor Eating Questionnaire) we found no relationship between BMI and chaotic eating of meals (β = -0.07, p = 0.73) or snacks (β = -0.10, p = 0.75). In Study 2, we calculated the same chaotic eating index (meals and snacks) using data from the UK National Diet and Nutrition Survey of adults 2000-2001 (seven-day diet diaries; N = 1175). Again, we found little evidence that BMI is associated with chaotic eating of meals (β = 0.16, p = 0.27) or snacks (β = 0.15, p = 0.12). Together, these results suggest that irregular eating timings do not promote weight gain and they challenge guidelines that recommend regularity in meal timings for weight loss. Copyright © 2018. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
You-Peng Chen
Full Text Available BACKGROUND: Environmental alternations leading to fetal programming of cardiovascular diseases in later life have been attributed to maternal factors. However, animal studies showed that paternal obesity may program cardio-metabolic diseases in the offspring. In the current study we tested the hypothesis that paternal BMI may be associated with fetal growth. METHODS AND RESULTS: We analyzed the relationship between paternal body mass index (BMI and birth weight, ultrasound parameters describing the newborn's body shape as well as parameters describing the newborns endocrine system such as cortisol, aldosterone, renin activity and fetal glycated serum protein in a birth cohort of 899 father/mother/child triplets. Since fetal programming is an offspring sex specific process, male and female offspring were analyzed separately. Multivariable regression analyses considering maternal BMI, paternal and maternal age, hypertension during pregnancy, maternal total glycated serum protein, parity and either gestational age (for birth weight or time of ultrasound investigation (for ultrasound parameters as confounding showed that paternal BMI is associated with growth of the male but not female offspring. Paternal BMI correlated with birth parameters of male offspring only: birth weight; biparietal diameter, head circumference; abdominal diameter, abdominal circumference; and pectoral diameter. Cortisol was likewise significantly correlated with paternal BMI in male newborns only. CONCLUSIONS: Paternal BMI affects growth of the male but not female offspring. Paternal BMI may thus represent a risk factor for cardiovascular diseases of male offspring in later life. It remains to be demonstrated whether this is linked to an offspring sex specific paternal programming of cortisol secretion.
Shloim, Netalie; Rudolf, Mary; Feltbower, Richard; Hetherington, Marion
2014-10-01
Maternal body mass index (BMI) is associated with negative body image and restrained eating which are experienced differently across cultures. The present study aimed to: 1) examine if self-esteem, eating behaviours and body satisfaction changed from early pregnancy to 2-6 months after giving birth; 2) explore changes according to country (Israel vs. UK) and BMI; and 3) determine any relationship between these measurements and infant feeding. Participants completed questionnaires assessing self-esteem, body image and eating/feeding behaviours. Multilevel linear modelling was used to account for change and to assess the independent impact of BMI on outcomes. Seventy-three women and infants participated in the study in early pregnancy and again 16 (9) weeks following birth. Women gained 1.5 kg (range -12 + 23) and UK mothers reported significantly greater body dissatisfaction, but self-esteem and eating behaviours remained stable. BMI was the main predictor of self-esteem, eating behaviours and body satisfaction. Mothers' perceptions of infant's eating did not vary according to BMI or country; however, heavier mothers reported feeding their infants according to a schedule. The first months after giving birth are a key time to assess adjustment to motherhood but later assessments are necessary in order to track changes beyond the early period post-pregnancy. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Lorraine T. Dean
2016-01-01
Full Text Available Introduction. High BMI is a risk factor for upper body breast cancer-related lymphedema (BCRL onset. Black cancer survivors are more likely to have high BMI than White cancer survivors. While observational analyses suggest up to 2.2 times increased risk of BCRL onset for Black breast cancer survivors, no studies have explored race or other social factors that may affect BCRL severity, operationalized by interlimb volume difference (ILD. Materials and Methods. ILD was measured by perometry for 296 overweight (25 > BMI 6 months from treatment in the WISER Survivor trial. Multivariable linear regression examined associations between social and physical factors and ILD. Results. Neither Black race (−0.26, p=0.89 nor BMI (0.22, p=0.10 was associated with ILD. Attending college (−4.89, p=0.03 was the strongest factor associated with ILD, followed by having more lymph nodes removed (4.75, p=0.01, >25% BCRL care adherence (4.10, p=0.01, and years since treatment (0.55, p<0.001. Discussion. Neither race nor BMI was associated with ILD among overweight cancer survivors. Education, a proxy for resource level, was the strongest factor associated with greater ILD. Tailoring physical activity and weight loss interventions designed to address BCRL severity by resource rather than race should be considered.
Liu, Gui-Feng; Zhang, Shu-Hua; Li, Xue-Feng; Cao, Li-Yan; Fu, Zhan-Zhao; Yu, Shao-Nan
2017-10-06
We examined the effects of microRNA-132 (miR-132) on Bmi-1 expression and radiosensitivity in HeLa, SiHa, and C33A cervical cancer (CC) cells and 104 CC patients. MiR-132 expression was decreased and Bmi-1 expression was increased in tumor tissues compared to adjacent normal tissues and in radiotherapy-resistant patients compared to radiotherapy-sensitive patients. MiR-132 expression and Bmi-1 mRNA expression were also negatively correlated in tumor tissues. HeLa, SiHa, and C33A cells were divided into blank, miR-132 negative control (NC), miR-132 inhibitor, miR-132 mimics, siBmi-1, and miR-132 inhibitor + siBmi-1 groups, after which expression of miR-132 and Bmi-1, and the interaction between them and cell survival, proliferation, and apoptosis were examined. Bmi-1 was confirmed as a target of miRNA-132. Survival was higher and apoptosis lower in the miR-132 inhibitor group than the blank group after various doses of radiation. By contrast, survival was lower and apoptosis higher in the miRNA-132 mimics and siBmi-1 groups than in the blank group. Moreover, miR-132 expression increased and Bmi-1 mRNA expression decreased in each group at radiation doses of 6 and 8 Gy. Finally, co-administration of radiotherapy and exogenous miR-132 inhibited the growth of HeLa cell transplant-induced tumors in nude mice more effectively than radiotherapy alone. These results suggest overexpression of miR-132 enhances the radiosensitivity of CC cells by down-regulating Bmi-1 and that miR-132 may be a useful new target for the treatment of CC.
Mother's pre-pregnancy BMI is an important determinant of adverse cardiometabolic risk in childhood
Maternal adiposity is associated with poor offspring cardiometabolic health. We aimed to evaluate the relationship of maternal pre-pregnancy body mass index (BMI) on the BMI, body composition and cardiometabolic characteristics of the offspring. Forty offspring of overweight/obese mothers (O-OW) and...
Depression and BMI influences the serum vascular endothelial growth factor level
DEFF Research Database (Denmark)
Elfving, Betina; Buttenschøn, Henriette Nørmølle; Foldager, Leslie
2014-01-01
in serum by immunoassay and independent determinants of the serum VEGF level were assessed by generalized linear models.The main findings were that depression, severity of depression, previous depressive episodes, age and body mass index (BMI) were associated with higher serum VEGF levels. The genetic...... marker rs10434 was significantly associated with depression after correction for multiple testing, but not with the serum VEGF level. Our final model included depression and BMI as predictors of serum VEGF levels. Our study suggests a role for circulating serum VEGF in depression. Furthermore, our data...
The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer
2014-03-01
8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression
Association between Dental Caries and BMI in Children: A Systematic Review and Meta-Analysis.
Chen, Dongru; Zhi, Qinghui; Zhou, Yan; Tao, Ye; Wu, Liping; Lin, Huancai
2018-01-01
Research on the association between dental caries and body mass index (BMI) in children has shown contradictory results; thus we aimed to examine the association between dental caries and the full range of BMI classes among children. We comprehensively searched PubMed, Embase, and the Cochrane Library for studies published prior to March 2017. Articles comparing dental caries among the full range of BMI classes for children below 18 years of both genders were included. Fourteen studies were eligible for this study. Basic information - i.e., first author, published year, study design, country, sample size, age, type of dental caries index and BMI, main results and conclusions, and means and standard deviations of the dental caries indexes used - was pooled. The weighted mean differences and corresponding 95% confidence intervals for dental caries between children with abnormal weight and those with normal weight were analyzed. Generally, no significant differences in caries were found between any abnormal-weight group and the normal-weight group for both primary and permanent teeth. Sensitivity analyses showed that the obese group had more caries than the normal-weight group in their primary teeth. Significantly more caries was found among the overweight and obese children in both primary and permanent teeth in high-income countries, but not in low- and middle-income countries. We recommend that further studies use suitable sample sizes, unify the criteria for BMI categorization and the dental caries index, and investigate the confounding factors that might influence dental caries and BMI. © 2018 S. Karger AG, Basel.
Harskamp-van Ginkel, Margreet W; London, Stephanie J; Magnus, Maria C; Gademan, Maaike G; Vrijkotte, Tanja G
2015-01-01
A causal relationship between maternal obesity and offspring asthma is hypothesized to begin during early development, but no underlying mechanism for the found association is identified. We quantitatively examined mediation by offspring body mass index (BMI) in the association of maternal pre-pregnancy BMI on risk of asthma and wheezing during the first 7-8 years of life in a large Amsterdam born birth cohort. For 3185 mother-child pairs, mothers reported maternal pre-pregnancy BMI and offspring outcomes "ever being diagnosed with asthma" and "wheezing in the past 12 months" on questionnaires. We measured offspring height and weight at age 5-6 years. We performed a multivariate log linear regression comparing outcomes in offspring of mothers with different BMI categories. For each category we quantified and tested mediation by offspring BMI and also investigated interaction by parental asthma. At the age of 7-8 years, 8% of the offspring ever had asthma and 7% had current wheezing. Maternal pre-pregnancy obesity was associated with higher risks of asthma (adjusted RR 2.32 (95% CI: 1.49-3.61) and wheezing (adjusted RR 2.16 (95% CI: 1.28-3.64). Offspring BMI was a mediator in the association between maternal BMI and offspring wheezing, but not for asthma. There was no interaction by parental asthma. Maternal pre-pregnancy obesity was associated with higher risks of offspring asthma and wheezing. The association between maternal obesity and offspring wheezing was both direct and indirect (mediated) through the child's own BMI.
Marek, Ryan J; Ben-Porath, Yossef S; Ashton, Kathleen; Heinberg, Leslie J
2014-04-01
Binge Eating Disorder (BED) is among the most common psychiatric disorders in bariatric surgery candidates. The Minnesota Multiphasic Personality Inventory-2 Restructured Form (MMPI-2-RF) is a broadband, psychological test that includes measures of emotional and behavioral dysfunction, which have been associated with BED behaviors in bariatric surgery candidates; however these studies have lacked appropriate controls. In the current study, we compared MMPI-2-RF scale scores of bariatric surgery patients diagnosed with BED (BED+) with BMI-matched controls without BED (BED-). Three-hundred and seven BED+ participants (72.64% female and 67.87% Caucasian; mean BMI of 51.36 kg/m(2) [SD = 11.94]) were drawn from a large, database (N = 1304). Three-hundred and seven BED- participants were matched on BMI and demographics (72.64% female, 68.63% Caucasian, and mean BMI of 51.30 kg/m(2) [SD = 11.70]). The BED+ group scored significantly higher on measures of Demoralization, Low Positive Emotions, and Dysfunctional Negative Emotions and scored lower on measures of Antisocial Behaviors, reflecting behavioral constraint. Optimal T-Score cutoffs were below the traditional 65 T score for several MMPI-2-RF scales. MMPI-2-RF externalizing measures also added incrementally to differentiating between the groups beyond the Binge Eating Scale (BES). BED+ individuals produced greater elevations on a number of MMPI-2-RF internalizing scales and externalizing scales. Use of the test in conjunction with a clinical interview and other self-report data can further aid the clinician in guiding patients to appropriate treatment to optimize outcome. Copyright © 2013 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Wedin WK
2012-07-01
Full Text Available William K Wedin,1 Lizmer Diaz-Gimenez,1 Antonio J Convit1,21Department of Psychiatry, NYU School of Medicine, New York, NY, USA; 2Nathan Kline Institute, Orangeburg, NY, USAObjective: The aim of this study was to describe the minimum number of anthropometric measures that will optimally predict insulin resistance (IR and to characterize the utility of these measures among obese and nonobese adolescents.Research design and methods: Six anthropometric measures (selected from three categories: central adiposity, weight, and body composition were measured from 1298 adolescents attending two New York City public high schools. Body composition was determined by bioelectric impedance analysis (BIA. The homeostatic model assessment of IR (HOMA-IR, based on fasting glucose and insulin concentrations, was used to estimate IR. Stepwise linear regression analyses were performed to predict HOMA-IR based on the six selected measures, while controlling for age.Results: The stepwise regression retained both waist circumference (WC and percentage of body fat (BF%. Notably, BMI was not retained. WC was a stronger predictor of HOMA-IR than BMI was. A regression model using solely WC performed best among the obese II group, while a model using solely BF% performed best among the lean group. Receiver operator characteristic curves showed the WC and BF% model to be more sensitive in detecting IR than BMI, but with less specificity.Conclusion: WC combined with BF% was the best predictor of HOMA-IR. This finding can be attributed partly to the ability of BF% to model HOMA-IR among leaner participants and to the ability of WC to model HOMA-IR among participants who are more obese. BMI was comparatively weak in predicting IR, suggesting that assessments that are more comprehensive and include body composition analysis could increase detection of IR during adolescence, especially among those who are lean, yet insulin-resistant.Keywords: BMI, bioelectrical impedance
2011-01-01
Background B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) acts as an oncogene in various tumors, and its overexpression correlates with a poor outcome in several human cancers. Ectopic expression of Bmi-1 can induce epithelial-mesenchymal transition (EMT) and enhance the motility and invasiveness of human nasopharyngeal epithelial cells (NPECs), whereas silencing endogenous Bmi-1 expression can reverse EMT and reduce the metastatic potential of nasopharyngeal cancer cells (NPCs). Mouse xenograft studies indicate that coexpression of Bmi-1 and H-Ras in breast cancer cells can induce an aggressive and metastatic phenotype with an unusual occurrence of brain metastasis; although, Bmi-1 overexpression did not result in oncogenic transformation of MCF-10A cells. However, the underlying molecular mechanism of Bmi-1-mediated progression and the metastasis of breast cancer are not fully elucidated at this time. Results Bmi-1 expression is more pronouncedly increased in primary cancer tissues compared to matched adjacent non-cancerous tissues. High Bmi-1 expression is correlated with advanced clinicopathologic classifications (T, N, and M) and clinical stages. Furthermore, a high level of Bmi-1 indicates an unfavorable overall survival and serves as a high risk marker for breast cancer. In addition, inverse transcriptional expression levels of Bmi-1 and E-cadherin are detected between the primary cancer tissues and the matched adjacent non-cancerous tissues. Higher Bmi-1 levels are found in the cancer tissue, whereas the paired adjacent non-cancer tissue shows higher E-cadherin levels. Overexpression of Bmi-1 increases the motility and invasive properties of immortalized human mammary epithelial cells, which is concurrent with the increased expression of mesenchymal markers, the decreased expression of epithelial markers, the stabilization of Snail and the dysregulation of the Akt/GSK3β pathway. Consistent with these observations, the repression of Bmi
Bushe, Chris J; Slooff, Cees J; Haddad, Peter M; Karagianis, Jamie L
2013-04-01
The aim was to explore weight and body mass index (BMI) changes by baseline BMI in patients completing three years of monotherapy with various first- and second-generation antipsychotics in a large cohort in a post hoc analysis of three-year observational data. Data were analyzed by antipsychotic and three baseline BMI bands: underweight/normal weight (BMI 30 kg/m²). Baseline BMI was associated with subsequent weight change irrespective of the antipsychotic given. Specifically, a smaller proportion of patients gained ≥7% baseline bodyweight, and a greater proportion of patients lost ≥7% baseline bodyweight with increasing baseline BMI. For olanzapine (the antipsychotic associated with highest mean weight gain in the total drug cohort), the percentage of patients gaining ≥7% baseline weight was 45% (95% CI: 43-48) in the underweight/normal weight BMI cohort and 20% (95% CI: 15-27) in the obese BMI cohort; 7% (95% CI: 6-8) of the underweight/normal cohort and 19% (95% CI: 13-27) of the obese cohort lost ≥7% baseline weight. BMI has an association with the likelihood of weight gain or loss and should be considered in analyses of antipsychotic weight change.
Programs of Active Aging – A Relation between BMI and Triglycerides
Directory of Open Access Journals (Sweden)
Samuel Honório
2014-03-01
Full Text Available Objective: To enhance the importance of physical activity programs for elderly and their influence on BMI and triglycerides. Methods: The sample consisted of 91 elderly individuals, 63 females and 28 males aged between 65 and 78 years of age. All seniors practice water activities, including swimming and gymnastics. Were analyzed with respect to two aspects: BMI, Triglycerides and practice time, seniors who were physically active at least 2 months, and seniors who maintained habits of physical activity between 2 and 6 months and still accumulated 30 or more minutes of other activities. We have established contingency tables were confronted where the variables described in the analysis. Results: It was found that elderly who maintained physical activity programs were broader outnumbered those who were overweight and obesity rates in Table I of BMI, and lower triglycerides values. Conclusions: We concluded therefore that physical activity programs that contemplate 2 or more hours per week, duly organized and systematized constitute a positive factor in combating inactivity and turn into a more active and cheerful elderly.
BMI, waist circumference at 8 and 12 years of age and FVC and FEV
M.B.M. Bekkers (Marga); A.H. Wijga (Alet); U. Gehring (Ulrike); G.H. Koppelman (Gerard); J.C. de Jongste (Johan); H.A. Smit (Henriëtte); B. Brunekreef (Bert)
2015-01-01
textabstractBackground: In adults, overweight is associated with reduced lung function, in children evidence on this association is conflicting. We examined the association of body mass index (BMI) and waist circumference (WC) at age 12, and of persistently (at ages 8 and 12 years) high BMI and
Alternative methods for measuring obesity in African American women.
Clark, Ashley E; Taylor, Jacquelyn Y; Wu, Chun Yi; Smith, Jennifer A
2013-03-01
The use of body mass index (BMI) may not be the most appropriate measurement tool in determining obesity in diverse populations. We studied a convenience sample of 108 African American (AA) women to determine the best method for measuring obesity in this at-risk population. The purpose of this study was to determine if percent body fat (PBF) and percent body water (PBW) could be used as alternatives to BMI in predicting obesity and risk for hypertension (HTN) among AA women. After accounting for age, BMI, and the use of anti-hypertensive medication, PBF (p = 0.0125) and PBW (p = 0.0297) were significantly associated with systolic blood pressure, while BMI was not. Likewise, PBF (p = 0.0316) was significantly associated with diastolic blood pressure, while PBW and BMI were not. Thus, health care practitioners should consider alternative anthropometric measurements such as PBF when assessing obesity in AA women.
Desirable factors for maintaining normal BMI of urban affluent women of Delhi
Anu Taneja Gupta; Anupa Siddhu
2015-01-01
The study aimed to identify desirable social, familial, reproductive, dietary, and lifestyle factors for maintaining normal body mass index (BMI) of urban affluent women (25-45 years) in Delhi, India. A total of 387 urban affluent women with at least one living child participated in this cross-sectional study conducted from March 2008 to April 2010. Women were classified into four BMI categories on the basis of World Health Organization (WHO; 2004) classification for Asians. Significant facto...
Physical activity, BMI and metabolic risk in Portuguese adolescents
Directory of Open Access Journals (Sweden)
Fernanda Karina dos Santos
2016-03-01
Full Text Available DOI: http://dx.doi.org/10.5007/1980-0037.2016v18n1p103 It has been reported, in the last decades, a significant decrease in physical activity (PA levels, with a consequent increase in obesity and metabolic risk factors among youth. The aims of this study were to describe PA levels, the prevalence of overweight/obesity and metabolic risk factors, and to examine the association between PA and body mass index (BMI with metabolic risk among Portuguese youth. The sample comprises 212 Portuguese adolescents (12-16 years old. Height and weight were measured. PA was estimated with the Bouchard questionnaire (3 days recall, as well as with the use of a pedometer (used for 5 consecutive days. Metabolic risk factors comprised fasting glucose, triglycerides, HDL-cholesterol, systolic blood pressure and waist circumference. Subjects were classified as normal weight, overweight or obese according to BMI; the maturational status was indirectly estimated with the maturity offset procedure. A continuous metabolic risk score was computed (zMR and PA values were divided into tertiles. Qui-square test, t-test and ANOVA were used in statistical analyses. SPSS 18.0 and WinPepi softwares were used and p<0.05. A moderate to high prevalence of overweight/obesity and HDL-cholesterol was found, as well as a high prevalence of high blood pressure and low to moderate PA levels among Portuguese youth. The relationship between BMI and zMR showed that obese adolescents have higher zMR when compared to normal weight or overweight adolescents. This finding suggests that increased levels of PA and reduction in the prevalence of overweight/obesity may have a positive role against the development of metabolic risk factors.
Lee, Myoungsook; Kwon, Dae Young; Kim, Myung-Sunny; Choi, Chong Ran; Park, Mi-Young; Kim, Ae-Jung
2016-02-01
This is the first study to identify common genetic factors associated with the basal metabolic rate (BMR) and body mass index (BMI) in obese Korean women including overweight. This will be a basic study for future research of obese gene-BMR interaction. The experimental design was 2 by 2 with variables of BMR and BMI. A genome-wide association study (GWAS) of single nucleotide polymorphisms (SNPs) was conducted in the overweight and obesity (BMI > 23 kg/m(2)) compared to the normality, and in women with low BMR (BMR. A total of 140 SNPs reached formal genome-wide statistical significance in this study (P BMR (rs10786764; P = 8.0 × 10(-7), rs1040675; 2.3 × 10(-6)) and BMI (rs10786764; P = 2.5 × 10(-5), rs10786764; 6.57 × 10(-5)). The other genes related to BMI (HSD52, TMA16, MARCH1, NRG1, NRXN3, and STK4) yielded P BMR and BMI, including NRG3, OR8U8, BCL2L2-PABPN1, PABPN1, and SLC22A17 were identified in obese Korean women (P BMR- and BMI-related genes using GWAS. Although most of these newly established loci were not previously associated with obesity, they may provide new insights into body weight regulation. Our findings of five common genes associated with BMR and BMI in Koreans will serve as a reference for replication and validation of future studies on the metabolic rate.
Speirs, Katherine E; Liechty, Janet M; Wu, Chi-Fang
2014-12-01
It has been established that the more time mothers spend working outside of the home, the more likely their preschool-aged children are to be overweight. However, the mechanisms explaining this relationship are not well understood. Our objective was to explore child sleep, dietary habits, TV time, and family mealtime routines as mediators of the relationship between maternal employment status (full-time, part-time, and no or minimal employment) and child body mass index (BMI) percentile. Data were drawn from waves 1 and 2 of STRONG Kids, a prospective panel study examining childhood obesity among parent-preschooler dyads (n = 247). Mothers reported their own work hours, their child's hours of nighttime sleep, dietary habits, TV time, and mealtime routines. Trained staff measured child height and weight. Compared to working 0-19 h/week, both full-time (>35 h/week) and part-time (20-34 h/week) employment predicted higher child BMI percentile 1 year later. Hours of child nighttime sleep partially mediated the association between maternal full-time employment and child BMI percentile. Adjusting for individual and family characteristics, children whose mothers were employed full time were less likely to sleep longer hours than children whose mothers were employed 0-19 h/week (b = -0.49, p < 0.04). Shorter child nighttime sleep was associated with higher BMI percentile (b = -7.31, p < 0.001). None of the other mediation pathways tested were significant. These findings add to the growing literature on the importance of adequate sleep for young children's health. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Michaela Loebig
Full Text Available BACKGROUND: This is the first study to experimentally explore the direct relationship between circulating VEGF levels and body mass index (BMI as well as to unravel the role of insulin sensitivity in this context under standardized glucose clamp conditions as the methodical gold-standard. In order to control for known influencing factors such as gender, medication, and arterial hypertension, we examined a highly homogeneous group of young male subjects. Moreover, to encompass also subjects beyond the normal BMI range, low weight and obese participants were additionally included and stress hormones as a main regulator of VEGF were assessed. METHODOLOGY/PRINCIPAL FINDINGS: Under euglycemic clamp conditions, VEGF was measured in 15 normal weight (BMI 20-25 kg/m(2, 15 low weight (BMI30 kg/m(2 male subjects aged 18-30 years and the insulin sensitivity index (ISI was calculated. Since stress axis activation promotes VEGF secretion, concentrations of ACTH, cortisol, and catecholamines were monitored. Despite of comparable ACTH (P = 0.145, cortisol (P = 0.840, and norepinephrine (P = 0.065 levels, VEGF concentrations differed significantly between BMI-groups (P = 0.008 with higher concentrations in obese subjects as compared to normal weight (P = 0.061 and low weight subjects (P = 0.002. Pearson's correlation analysis revealed a positive relationship between BMI and VEGF levels (r = 0.407; P = 0.010 but no correlation of VEGF with ISI (r = 0.224; P = 0.175. CONCLUSIONS/SIGNIFICANCE: Our data demonstrate a positive correlation between concentrations of circulating VEGF levels and BMI in healthy male subjects under highly controlled conditions. This relationship which is apparently disconnected from insulin sensitivity may be part of some pathogenetic mechanisms underlying obesity and type 2 diabetes.
Vissers, P.A.J.; Thong, M.S.Y.; Pouwer, F.; Creemers, G.-J.; Slooter, G.D.; van de Poll-Franse, L.V.
2016-01-01
Purpose This study aimed to assess the longitudinal association between lifestyle factors, body mass index (BMI), and health-related quality of life (HRQoL) among colorectal cancer patients with (CRCDM+) and without diabetes (CRCDM−). Methods Data from a longitudinal study among CRC patients
Kenney, E L; Gortmaker, S L; Davison, K K; Bryn Austin, S
2015-09-01
Worse educational outcomes for obese children regardless of academic ability may begin early in the life course. This study tested whether an increase in children's relative weight predicted lower teacher- and child-perceived academic ability even after adjusting for standardized test scores. Three thousand three hundred and sixty-two children participating in the Early Childhood Longitudinal Study-Kindergarten Cohort were studied longitudinally from fifth to eighth grade. Heights, weights, standardized test scores in maths and reading, and teacher and self-ratings of ability in maths and reading were measured at each wave. Longitudinal, within-child linear regression models estimated the impact of a change in body mass index (BMI) z-score on change in normalized teacher and student ratings of ability in reading and maths, adjusting for test score. A change in BMI z-score from fifth to eighth grade was not independently associated with a change in standardized test scores. However, adjusting for standardized test scores, an increasing BMI z-score was associated with significant reductions in teacher's perceptions of girls' ability in reading (-0.12, 95% confidence interval (CI): -0.23, -0.03, P=0.03) and boys' ability in math (-0.30, 95% CI: -0.43, -0.17, Pmaths ability (-0.47, 95% CI: -0.83, -0.11, P=0.01). From fifth to eighth grade, increase in BMI z-score was significantly associated with worsening teacher perceptions of academic ability for both boys and girls, regardless of objectively measured ability (standardized test scores). Future research should examine potential interventions to reduce bias and promote positive school climate.
Durandt, Justin; Green, Mervin; Masimla, Herman; Lambert, Mike
2018-03-01
The purpose of this study was to determine whether there are differences between racial groups for body mass, stature and body mass index (BMI) in South African elite U18 rugby players and whether there were significant changes in these measurements between 2002 and 2012. Self-reported body mass and stature were obtained from U18 players (n = 4007) who attended the national tournament during this period. BMI was calculated for each player.White players were 9.8 kg heavier than black players, who were 2.3 kg heavier than coloured players (P body mass of all groups increased from 2002 to 2012 (P body mass, stature and BMI of elite under-18 rugby players in South Africa were significantly different between racial groups. This has implications for transforming the game to make it representative of the South African population.
BMI, waist circumference at 8 and 12 years of age and FVC and FEV
Bekkers, Marga B.; Wijga, Alet H.; Gehring, Ulrike; Koppelman, Gerard H.; de Jongste, Johan C.; Smit, Henriette A.; Brunekreef, Bert
2015-01-01
Background: In adults, overweight is associated with reduced lung function, in children evidence on this association is conflicting. We examined the association of body mass index (BMI) and waist circumference (WC) at age 12, and of persistently (at ages 8 and 12 years) high BMI and large WC, with
The role of diabetes mellitus and BMI in the surgical treatment of ankle fractures.
Lanzetti, Riccardo Maria; Lupariello, Domenico; Venditto, Teresa; Guzzini, Matteo; Ponzo, Antonio; De Carli, Angelo; Ferretti, Andrea
2018-02-01
Open reduction and internal fixation is the standard treatment for displaced ankle fractures. However, the presence of comorbidities such as diabetes mellitus and body mass index (BMI) are associated with poor bone quality, and these factors may predict the development of postoperative complications. The study aim was to assess the role of diabetes mellitus and BMI in wound healing in patients younger than 65 years who were surgically treated for malleoli fractures. Ninety patients, aged from 18 to 65 years old, with surgically treated ankle fracture, were retrospectively enrolled. Patients were classified in two groups: patient with diabetes and patients without diabetes (insulin-dependent and noninsulin dependent). All patients were assessed for wound complications, Visual Analogue Scale and Foot and Ankle Disability Index (FADI) were assessed for all patients. Logistic regression was used to identify the risk of wound complications after surgery using the following factors as explanatory variables: age, gender, duration of surgery, BMI, hypercholesterolemia, smoking history, diabetes mellitus, and high blood pressure. In total, 38.9% of patients showed wound complications. Of them, 17.1% were nondiabetics and 82.9% were diabetics. We observed a significant association between DM and wound complications after surgery (P = .005). Logistic regression analysis revealed that DM (P BMI (P = .03) were associated with wound complications. The odds of having a postoperative wound complication were increased 0.16 times in the presence of diabetes and 1.14 times for increasing BMI. This study showed that diabetes mellitus and higher BMI delay the wound healing and increase the complication rate in young adult patients with surgically treated bimalleolar fractures. Copyright © 2017 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Heba Ashi
2017-01-01
Full Text Available Objectives. The aim of the study was to evaluate the influence of sweet taste perception on dietary habits in Saudi schoolchildren. In addition, the relationship between dietary habits and both caries and BMI was studied. Methods. A cross-sectional observational study comprising 225 schoolchildren aged 13–15 years from Jeddah, Saudi Arabia, was conducted. The consumption frequency of certain food items was analysed from a beverage and snack questionnaire and a three-day estimated dietary record was obtained. The sweet taste perception level was determined as sweet taste threshold (TT and sweet taste preference (TP. Children were grouped into low, medium, and high, according to their sweet taste perception level. ICDAS and DMFS indices were used for caries registration and anthropometric measurements using BMI were collected. Results. Sweet taste perception was found to be negatively correlated to the number of main meals and positively correlated to both snack and sweet intake occasions. Statistically significant differences were found between the TT and TP groups with regard to the number of main meals and sweet intake (p≤0.01. No significant correlation between the dietary variables and caries or BMI was found. Conclusions. The dietary habits and sweet intake were found to be influenced by the sweet taste perception level, while the relation between the dietary habits and the caries and BMI was found insignificant.
Christensen, Jeanette Reffstrup; Kongstad, Malte Bue; Sjøgaard, Gisela; Søgaard, Karen
2015-12-01
The primary objective of this study was to assess the relationship between sickness presenteeism and body mass index (BMI), cardiorespiratory fitness (CRF), and maximal voluntary contraction (MVC). Female health care workers (n = 139) were analyzed cross-sectional as well as longitudinal after 3 and 12-month follow-up. Sickness presenteeism was assessed as a summed score using validated questions from three questionnaires: Health and Work Performance Questionnaire, Work Ability Index, and Quantity and Quality Method. CRF was assessed by a maximal cycling test and MVC from four muscle groups. Significant relationships were found between sickness presenteeism and BMI as well as MVC both cross-sectional and as changes over 3 months. Participants with BMI more than 30 kg/m had significantly higher sickness presenteeism than those with BMI less than 25 kg/m. This study suggests that actions that decrease BMI and increase MVC decrease the amount of sickness presenteeism.
Mansur, R B; Brietzke, E; McIntyre, R S; Cao, B; Lee, Y; Japiassú, L; Chen, K; Lu, R; Lu, W; Li, T; Xu, G; Lin, K
2017-12-01
To compare brain-derived neurotrophic factor (BDNF) levels between offspring of individuals with bipolar disorders (BD) and healthy controls (HCs) and investigate the effects of BDNF levels and body mass index (BMI) on brain structures. Sixty-seven bipolar offspring and 45 HCs were included (ages 8-28). Structural images were acquired using 3.0 Tesla magnetic resonance imaging. Serum BDNF levels were measured using enzyme-linked immunosorbent assay. Multivariate and univariate analyses of covariance were conducted. Significantly higher BDNF levels were observed among bipolar offspring, relative to HCs (P > 0.025). Offspring status moderated the association between BDNF and BMI (F 1 =4.636, P = 0.034). After adjustment for relevant covariates, there was a trend for a significant interaction of group and BDNF on neuroimaging parameters (Wilks'λ F 56,94 =1.463, P = 0.052), with significant effects on cerebellar white matter and superior and middle frontal regions. Brain volume and BDNF were positively correlated among HCs and negatively correlated among bipolar offspring. Interactions between BDNF and BMI on brain volumes were non-significant among HCs (Wilks'λ F 28,2 =2.229, P = 0.357), but significant among bipolar offspring (Wilks'λ F 28,12 =2.899, P = 0.028). Offspring status and BMI moderate the association between BDNF levels and brain structures among bipolar offspring, underscoring BDNF regulation and overweight/obesity as key moderators of BD pathogenesis. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
DEFF Research Database (Denmark)
Howe, Laura D; Zimmermann, Esther; Weiss, Ram
2014-01-01
BMI growth (7-13 years) using a multilevel model. Early-onset obesity was defined as obesity at examination for national service. OUTCOME MEASUREMENT: We defined metabolic health at the mid-life clinic as non-fasting serum cholesterol fasting glucose ...OBJECTIVE: Some obese individuals have no cardiometabolic abnormalities; they are 'metabolically healthy, but obese' (MHO). Similarly, some non-obese individuals have cardiometabolic abnormalities, that is, 'metabolically at risk, normal weight' (MANW). Previous studies have suggested that early......-onset obesity may be associated with MHO. We aimed to assess whether body mass index (BMI) in childhood and early-onset obesity are associated with MHO. SETTING: General population longitudinal cohort study, Denmark. PARTICIPANTS: From 362 200 young men (mean age 20) examined for Danish national service between...
Comparison of BMI and physical activity between old order Amish children and non-Amish children.
Hairston, Kristen G; Ducharme, Julie L; Treuth, Margarita S; Hsueh, Wen-Chi; Jastreboff, Ania M; Ryan, Kathy A; Shi, Xiaolian; Mitchell, Braxton D; Shuldiner, Alan R; Snitker, Soren
2013-04-01
The Old Order Amish (OOA) is a conservative Christian sect of European origin living in Pennsylvania. Diabetes is rare in adult OOA despite a mean BMI rivaling that in the general U.S. non-Hispanic white population. The current study examines childhood factors that may contribute to the low prevalence of diabetes in the OOA by comparing OOA children aged 8-19 years with National Health and Nutrition Examination Survey (NHANES) data and children from Maryland's Eastern Shore (ES), a nearby, non-Amish, rural community. We hypothesized that pediatric overweight is less common in OOA children, that physical activity (PA) and BMI are inversely correlated, and that OOA children are more physically active than ES children. We obtained anthropometric data in 270 OOA children and 229 ES children (166 non-Hispanic white, 60 non-Hispanic black, 3 Hispanic). PA was measured by hip-worn accelerometers in all ES children and in 198 OOA children. Instrumentation in 43 OOA children was identical to ES children. OOA children were approximately 3.3 times less likely than non-Hispanic white ES children and NHANES estimates to be overweight (BMI ≥85th percentile, Centers for Disease Control and Prevention). Time spent in moderate/vigorous PA (MVPA) was inversely correlated to BMI z-score (r = -0.24, P = 0.0006). PA levels did not differ by ethnicity within the ES group, but OOA children spent an additional 34 min/day in light activity (442 ± 56 vs. 408 ± 75, P = 0.005) and, impressively, an additional 53 min/day in MVPA (106 ± 54 vs. 53 ± 32, P < 0.0001) compared with ES children. In both groups, boys were more active than girls but OOA girls were easily more active than ES boys. We confirmed all three hypotheses. Together with our previous data, the study implies that the OOA tend to gain their excess weight relatively late in life and that OOA children are very physically active, both of which may provide some long-term protection against diabetes.
Wall, Clare R; Stewart, Alistair W; Hancox, Robert J; Murphy, Rinki; Braithwaite, Irene; Beasley, Richard; Mitchell, Edwin A
2018-03-07
Diets which emphasize intakes of plant-based foods are recommended to reduce disease risk and for promoting healthy weight. The aim of this study was to examine the association between fruit, vegetables, pulses and nut intake and body mass index (BMI) across countries in adolescents (13-14 years) and children (6-7 years). Data from the International Study of Asthma and Allergies in Childhood; 77,243 children's parents and 201,871 adolescents was used to examine the association between dietary intake (Food Frequency Questionnaire) and BMI using general linear models, adjusting for country gross national index. Adolescents who consumed fruit, vegetables, pulses and nuts three or more times a week had a lower BMI than the never or occasional group; eating nuts three or more times a week, was associated with a BMI value of 0.274 kg/m² lower than the never group ( p BMI of -0.079 kg/m². In this large global study, an inverse association was observed between BMI and the reported increasing intake of vegetables in 6-7 years old and fruit, vegetables, pulses and nuts in adolescents. This study supports current dietary recommendations which emphasize the consumption of vegetables, nut and pulses, although the effect sizes were small.
The relationship between income, economic freedom, and BMI.
Lawson, R A; Murphy, R H; Williamson, C R
2016-05-01
What explains increases in BMI (and obesity) over time and across countries? Although many microeconomic forces are likely explanations, increasingly scholars are arguing that macroeconomic forces such as market liberalism and globalization are root causes of the obesity epidemic. The purpose of this paper is to examine the impact of economic freedom on obesity conditional on the level of income and other factors. We use an unbalanced pooled cross section of up to 135 countries for 1995 and 2000-2009. Our statistical model specifications include pooled OLS and fixed effects. First, we find that controlling for fixed effects siphons off much of the relationship previously documented between economic freedom and BMI. Second, economic freedom is associated with slightly higher BMIs but only for men in developing nations. Lastly, we show that economic freedom increases life expectancy for both men and women in developing countries. Therefore, policies aimed at reducing obesity that limit economic liberalism may come at the expense of life expectancy in the developing world. Copyright © 2016 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.
Maternal Recreational Exercise during Pregnancy in relation to Children's BMI at 7 Years of Age
DEFF Research Database (Denmark)
Schou Andersen, Camilla; Juhl, Mette; Gamborg, Michael
2012-01-01
was analyzed using multiple linear and logistic regression models. Recreational exercise across pregnancy was inversely related to children's BMI and risk of overweight, but all associations were mainly explained by smoking habits, socioeconomic status, and maternal pre-pregnancy BMI. Additionally, we did......Exposures during fetal life may have long-term health consequences including risk of childhood overweight. We investigated the associations between maternal recreational exercise during early and late pregnancy and the children's body mass index (BMI) and risk of overweight at 7 years. Data on 40......,280 mother-child pairs from the Danish National Birth Cohort was used. Self-reported information about exercise was obtained from telephone interviews around gestational weeks 16 and 30. Children's weight and height were reported in a 7-year follow-up and used to calculate BMI and overweight status. Data...
Kajiume, Teruyuki; Ohno, Norioki; Sera, Yasuhiko; Kawahara, Yumi; Yuge, Louis; Kobayashi, Masao
2009-07-01
The Polycomb-group (PcG) genes regulate global gene expression in many biological processes, including hematopoiesis, by manipulating specific target genes. It is known that various PcG genes regulate self-renewal of hematopoietic stem cells (HSCs). Here we have shown that the reciprocal expression of PcG proteins regulates self-renewal and differentiation of HSCs. We used murine and human bone marrow cells and evaluated the reciprocal expression of PcG proteins on the basis of their respective intranuclear distributions. PcG-gene expression in HSCs was knocked down by small interfering RNAs. The function of each gene in HSCs was analyzed in vitro and in vivo. Cells were either Bmi1-positive or Mel-18-positive. The Bmi1-positive cells contained very little amounts of Mel-18 and vice versa. The bmi1-knockdown marrow cells did not show HSC function, while the mel-18-knockdown marrow cells showed increased stem cell function. Results of the analysis on human cells were similar to those observed in case of murine cells. In a clinical investigation, transplantation using sources with a low Bmi1 to Mel-18 ratio was associated with early hematopoietic recovery. Reciprocal expression of Bmi1 and Mel-18 regulated HSC function. Here, we observed that expression of the PcG genes-bmi1 and mel-18-is correlated with self-renewal and differentiation of HSCs. Thus, it was suggested that the balance between Bmi1 and Mel-18 regulates self-renewal of HSCs.
Directory of Open Access Journals (Sweden)
Mohd Masood
Full Text Available This study explores the relationship between BMI and national-wealth and the cross-level interaction effect of national-wealth and individual household-wealth using multilevel analysis.Data from the World Health Survey conducted in 2002-2004, across 70 low-, middle- and high-income countries was used. Participants aged 18 years and over were selected using multistage, stratified cluster sampling. BMI was used as outcome variable. The potential determinants of individual-level BMI were participants' sex, age, marital-status, education, occupation, household-wealth and location(rural/urban at the individual-level. The country-level factors used were average national income (GNI-PPP and income inequality (Gini-index. A two-level random-intercepts and fixed-slopes model structure with individuals nested within countries was fitted, treating BMI as a continuous outcome.The weighted mean BMI and standard-error of the 206,266 people from 70-countries was 23.90 (4.84. All the low-income countries were below the 25.0 mean BMI level and most of the high-income countries were above. All wealthier quintiles of household-wealth had higher scores in BMI than lowest quintile. Each USD10000 increase in GNI-PPP was associated with a 0.4 unit increase in BMI. The Gini-index was not associated with BMI. All these variables explained 28.1% of country-level, 4.9% of individual-level and 7.7% of total variance in BMI. The cross-level interaction effect between GNI-PPP and household-wealth was significant. BMI increased as the GNI-PPP increased in first four quintiles of household-wealth. However, the BMI of the wealthiest people decreased as the GNI-PPP increased.Both individual-level and country-level factors made an independent contribution to the BMI of the people. Household-wealth and national-income had significant interaction effects.
Reidpath, Daniel D.
2017-01-01
Background This study explores the relationship between BMI and national-wealth and the cross-level interaction effect of national-wealth and individual household-wealth using multilevel analysis. Methods Data from the World Health Survey conducted in 2002–2004, across 70 low-, middle- and high-income countries was used. Participants aged 18 years and over were selected using multistage, stratified cluster sampling. BMI was used as outcome variable. The potential determinants of individual-level BMI were participants’ sex, age, marital-status, education, occupation, household-wealth and location(rural/urban) at the individual-level. The country-level factors used were average national income (GNI-PPP) and income inequality (Gini-index). A two-level random-intercepts and fixed-slopes model structure with individuals nested within countries was fitted, treating BMI as a continuous outcome. Results The weighted mean BMI and standard-error of the 206,266 people from 70-countries was 23.90 (4.84). All the low-income countries were below the 25.0 mean BMI level and most of the high-income countries were above. All wealthier quintiles of household-wealth had higher scores in BMI than lowest quintile. Each USD10000 increase in GNI-PPP was associated with a 0.4 unit increase in BMI. The Gini-index was not associated with BMI. All these variables explained 28.1% of country-level, 4.9% of individual-level and 7.7% of total variance in BMI. The cross-level interaction effect between GNI-PPP and household-wealth was significant. BMI increased as the GNI-PPP increased in first four quintiles of household-wealth. However, the BMI of the wealthiest people decreased as the GNI-PPP increased. Conclusion Both individual-level and country-level factors made an independent contribution to the BMI of the people. Household-wealth and national-income had significant interaction effects. PMID:28662041
Van Lippevelde, Wendy; Te Velde, Saskia J.; Verloigne, Maïté; Van Stralen, Maartje M.; De Bourdeaudhuij, Ilse; Manios, Yannis; Bere, Elling; Vik, Froydis N.; Jan, Nataša; Fernández Alvira, Juan M.; Chinapaw, Mai J. M.; Bringolf-Isler, Bettina; Kovacs, Eva; Brug, Johannes; Maes, Lea
2013-01-01
Objective To investigate associations of family-related factors with children’s breakfast consumption and BMI-z-score and to examine whether children’s breakfast consumption mediates associations between family-related factors and children’s BMI-z-score. Subjects Ten- to twelve-year-old children (n = 6374; mean age = 11.6±0.7 years, 53.2% girls, mean BMI-z-score = 0.4±1.2) and one of their parents (n = 6374; mean age = 41.4±5.3 years, 82.7% female, mean BMI = 24.5±4.2 kg/m2) were recruited from schools in eight European countries (Belgium, Greece, Hungary, the Netherlands, Norway, Slovenia, Spain, and Switzerland). The children self-reported their breakfast frequency per week. The body weight and height of the children were objectively measured. The parents responded to items on family factors related to breakfast (automaticity, availability, encouragement, paying attention, permissiveness, negotiating, communicating health beliefs, parental self-efficacy to address children’s nagging, praising, and family breakfast frequency). Mediation analyses were performed using multi-level regression analyses (child-school-country). Results Three of the eleven family-related variables were significantly associated with children’s BMI-z-score. The family breakfast frequency was negatively associated with the BMI-z-score; permissiveness concerning skipping breakfast and negotiating about breakfast were positively associated with the BMI-z-score. Children’s breakfast consumption was found to be a mediator of the two associations. All family-related variables except for negotiating, praising and communicating health beliefs, were significantly associated with children’s breakfast consumption. Conclusions Future breakfast promotion and obesity prevention interventions should focus on family-related factors including the physical home environment and parenting practices. Nevertheless, more longitudinal research and intervention studies to
Directory of Open Access Journals (Sweden)
Hossein Samim
2016-09-01
Full Text Available Background: Mitral valve prolapse (MVP is a valvular heart disease in which the two valve flaps of the mitral valve do not close equally, and part of the mitral valve slips backward loosely into the left atrium during systole. In general, MVP is associated with low body mass index (BMI, as confirmed by several studies. However, the reason for the higher prevalence of MVP in patients with low BMI remains unknown. Objectives: There is no reliable evidence on the role of genetics or pathophysiological factors in this correlation, and the hypothesis that the size of BMI may lead to MVP or vice versa has not yet been established. Materials and Methods: In this study, all the articles were evaluated in terms of the inclusion criteria. In total, we found 546 articles via PubMed and Google scholar, out of which 30 articles were mainly focusing on MVP, MVR as the major complication of MVP, and BMI, which were included in this systematic review. Results: Among these reviewed studies, patients with MVP had a lower BMI score compared to the subjects without MVP. The low and high BMI score were 28±5 kg/m and 31±6 kg/m, respectively. Conclusions: In the present study, we concluded that low BMI is directly associated with the occurrence of MVP.
Yusuff, Shamila; Davis, Stephani; Flaherty, Kathleen; Huselid, Eric; Patrizii, Michele; Jones, Daniel; Cao, Liangxian; Sydorenko, Nadiya; Moon, Young-Choon; Zhong, Hua; Medina, Daniel J.; Kerrigan, John; Stein, Mark N.; Kim, Isaac Y.; Davis, Thomas W.; DiPaola, Robert S.; Bertino, Joseph R.; Sabaawy, Hatem E.
2016-01-01
Purpose Current prostate cancer (PCa) management calls for identifying novel and more effective therapies. Self-renewing tumor-initiating cells (TICs) hold intrinsic therapy-resistance and account for tumor relapse and progression. As BMI-1 regulates stem cell self-renewal, impairing BMI-1 function for TICs-tailored therapies appears to be a promising approach. Experimental design We have previously developed a combined immunophenotypic and time-of-adherence assay to identify CD49bhiCD29hiCD44hi cells as human prostate TICs. We utilized this assay with patient derived prostate cancer cells and xenograft models to characterize the effects of pharmacological inhibitors of BMI-1. Results We demonstrate that in cell lines and patient-derived TICs, BMI-1 expression is upregulated and associated with stem cell-like traits. From a screened library, we identified a number of post-transcriptional small molecules that target BMI-1 in prostate TICs. Pharmacological inhibition of BMI-1 in patient-derived cells significantly decreased colony formation in vitro and attenuated tumor initiation in vivo, thereby functionally diminishing the frequency of TICs, particularly in cells resistant to proliferation- and androgen receptor (AR)-directed therapies, without toxic effects on normal tissues. Conclusions Our data offer a paradigm for targeting TICs and support the development of BMI-1-targeting therapy for a more effective PCa treatment. PMID:27307599
de Souza, Natalia Cavalheri; de Oliveira, Erick Prado
2013-01-01
Obesity (abdominal adiposity) is a risk factor for cardiovascular diseases and the most used methods to measure the adiposity are body mass index (BMI), waist circumference (WC), and sagittal abdominal diameter (SAD). To correlate BMI, WC, and SAD with biochemical parameters and blood pressure in adults. A non-experimental exploratory/descriptive and cross sectional study was developed and it was assessed 133 subjects (59 men and 74 women) aging between 18 and 87 years. It was registered the patients' weight (kg), height (m), BMI (kg/m(2)), WC (cm) and SAD (cm), and these parameters were correlated with glycemia, triglycerides, total cholesterol, HDL-c, LDL-c and blood pressure. After adjustment for gender and age, it was observed a positive correlation between SAD and systolic arterial blood pressure (r = 0.20), glycemia (r = 0.20), triglycerides (r = 0.32), LDL (r = 0.26), total cholesterol (TC) (r = 0.33), and a negative correlation with HDL-c (r = -0.21) (p correlation between WC and systolic arterial blood pressure (r = 0.14), triglycerides (r = 0.31), total cholesterol (r = 0.21), and a negative correlation with HDL-c (r = -0.24) (p correlation with systolic arterial blood pressure (r = 0.22), total cholesterol (r = 0.20), and triglycerides (r = 0.23) (p correlated with almost all the cardiovascular risk factors analyzed and it might be considered the best predictor of abdominal fat and cardiovascular risk.
Correlation of cephalometric and anthropometric measures with obstructive sleep apnea severity
Borges, Paulo de Tarso M; Filho, Edson Santos Ferreira; Araujo, Telma Maria Evangelista de; Neto, Jose Machado Moita; Borges, Nubia Evangelista de Sa; Neto, Baltasar Melo; Campelo, Viriato; Paschoal, Jorge Rizzato; Li, Li M
2013-01-01
Summary Introduction: Patients with obstructive sleep apnea-hypopnea syndrome (OSAHS) often have associated changes in craniofacial morphology and distribution of body fat, either alone or in combination. Aim: To correlate cephalometric and anthropometric measures with OSAHS severity by using the apnea-hypopnea index (AHI). Method: A retrospective cephalometry study of 93 patients with OSAHS was conducted from July 2010 to July 2012. The following measurements were evaluated: body mass index (BMI), neck circumference (NC), waist circumference (WC), hip circumference (HC), the angles formed by the cranial base and the maxilla (SNA) and the mandible (SNB), the difference between SNA and SNB (ANB), the distance from the mandibular plane to the hyoid bone (MP-H), the space between the base of the tongue and the posterior pharyngeal wall (PAS), and the distance between the posterior nasal spine and the tip of the uvula (PNS-P). Means, standard deviations, and Pearson's correlation coefficients were calculated and analyzed. Results: AHI correlated significantly with BMI (r = 0.207, p = 0.047), NC (r = 0.365, p = 0.000), WC (r = 0.337, p = 0.001), PNS-P (r = 0.282, p = 0.006), and MP-H (r = 0.235, p = 0.023). Conclusion: Anthropometric measurements (BMI, NC, and WC) and cephalometric measurements (MP-H and PNS-P) can be used as predictors of OSAHS severity. PMID:25992029
Keith, Verna M; Nguyen, Ann W; Taylor, Robert Joseph; Mouzon, Dawne M; Chatters, Linda M
2017-05-01
Data from the 2001-2003National Survey of American Life are used to investigate the effects of phenotype on everyday experiences with discrimination among African Americans (N=3343). Latent class analysis is used to identify four classes of discriminatory treatment: 1) low levels of discrimination, 2) disrespect and condescension, 3) character-based discrimination, and 4) high levels of discrimination. We then employ latent class multinomial logistic regression to evaluate the association between skin tone and body weight and these four classes of discrimination. Designating the low level discrimination class as the reference group, findings revealed that respondents with darker skin were more likely to be classified into the disrespect/condescension and the high level microaggression types. BMI was unrelated to the discrimination type, although there was a significant interaction effect between gender and BMI. BMI was strongly and positively associated with membership in the disrespect and condescension type among men but not among women. These findings indicate that skin tone and body weight are two phenotypic characteristics that influence the type and frequency of discrimination experienced by African Americans.
Komlos, John
2006-01-01
Longitudinal height measurements on children and youth are very rare prior to the 20th century, as are BMI values. Growth increments and BMI values were determined among elite (select) Habsburg children and youth in the late 19th century and compared with other extant historical and contemporary data. Archival data on height and weight were collected for approximately 3500 students attending Habsburg Military schools. The students were measured once a year for 4 years. Because of the minimum height requirement, truncated regression was used in order to estimate height trends, but standard procedures were used to determine height increments and BMI values. Heights increased at most 0.9-1.6 cm between the birth cohorts of circa 1870s and 1900. These future officers were about the same size as their counterparts in the USA and France, but smaller than those attending the Royal Military Academy in Sandhurst, England, who were taller and probably the tallest in the world at the time. Height increments were markedly smaller than those experienced by German students in the 18th century after age 15. Central European BMI values were above those obtained in the USA in the 19th century but well below modern values. Although peak height velocity was experienced as early as ages 13 and 14, the height increments were very small compared even to other historical populations. The military academy selected mainly precocious applicants (with probably larger height increments at younger ages and smaller increments at older ages). BMI values in this sample were well below modern standards, but they were unexpectedly as high as those of contemporary US West Point cadets, a well nourished group. There were significant differences in the height of elites in Central Europe in the 19th century, pointing to substantial socio-economic inequality, but at least the elites were as well nourished as the US population.
DEFF Research Database (Denmark)
Shungin, Dmitry; Deng, Wei Q; Varga, Tibor V
2017-01-01
Phenotypic variance heterogeneity across genotypes at a single nucleotide polymorphism (SNP) may reflect underlying gene-environment (G×E) or gene-gene interactions. We modeled variance heterogeneity for blood lipids and BMI in up to 44,211 participants and investigated relationships between...... variance effects (Pv), G×E interaction effects (with smoking and physical activity), and marginal genetic effects (Pm). Correlations between Pv and Pm were stronger for SNPs with established marginal effects (Spearman's ρ = 0.401 for triglycerides, and ρ = 0.236 for BMI) compared to all SNPs. When Pv...... and Pm were compared for all pruned SNPs, only BMI was statistically significant (Spearman's ρ = 0.010). Overall, SNPs with established marginal effects were overrepresented in the nominally significant part of the Pv distribution (Pbinomial BMI had...
Induction of neural stem cell-like cells (NSCLCs) from mouse astrocytes by Bmi1
International Nuclear Information System (INIS)
Moon, Jai-Hee; Yoon, Byung Sun; Kim, Bona; Park, Gyuman; Jung, Hye-Youn; Maeng, Isaac; Jun, Eun Kyoung; Yoo, Seung Jun; Kim, Aeree; Oh, Sejong; Whang, Kwang Youn; Kim, Hyunggee; Kim, Dong-Wook; Kim, Ki Dong; You, Seungkwon
2008-01-01
Recently, Bmi1 was shown to control the proliferation and self-renewal of neural stem cells (NSCs). In this study, we demonstrated the induction of NSC-like cells (NSCLCs) from mouse astrocytes by Bmi1 under NSC culture conditions. These NSCLCs exhibited the morphology and growth properties of NSCs, and expressed NSC marker genes, including nestin, CD133, and Sox2. In vitro differentiation of NSCLCs resulted in differentiated cell populations containing astrocytes, neurons, and oligodendrocytes. Following treatment with histone deacetylase inhibitors (trichostatin A and valproic acid), the potential of NSCLCs for proliferation, dedifferentiation, and self-renewal was significantly inhibited. Our data indicate that multipotent NSCLCs can be generated directly from astrocytes by the addition of Bmi1
Dávila-Batista, V; Carriedo, D; Díez, F; Pueyo Bastida, A; Martínez Durán, B; Martin, V
2018-03-01
The obesity pandemic together with the influenza pandemic could lead to a significant burden of disease. The body mass index (BMI) does not discriminate obesity appropriately. The CUN-BAE has recently been used as an estimate of body fatness for Caucasians, including BMI, gender, and age. The aim of this study is to assess the population attributable fraction of hospital admissions due to influenza, due to the body fatness measured with the BMI, and the CUN-BAE. A multicentre study was conducted using matched case-controls. Cases were hospital admissions with the influenza confirmed by the RT-PCR method between 2009 and 2011. The risk of hospital admission and the population attribuible fraction were calculated using the BMI or the CUN-BAE for each adiposity category in a conditional logical regression analysis adjusted for confounding variables. The analyzes were estimated in the total sample, in unvaccinated people, and those less than 65 years-old. A total of 472 hospitalised cases and 493 controls were included in the study. Compared to normal weight, the aOR of influenza hospital admissions increases with each level of BMI (aOR=1.26; 2.06 and 11.64) and CUN-BAE (aOR=2.78; 4.29; 5.43 and 15.18). The population attributable fraction of influenza admissions using CUN-BAE is 3 times higher than that estimated with BMI (0,72 vs. 0,27), with the differences found being similar the non-vaccinated and under 65 year-olds. The BMI could be underestimating the burden of disease attributable to obesity in individuals hospitalised with influenza. There needs to be an appropriate assessment of the impact of obesity and vaccine recommendation criteria. Copyright © 2017 Sociedad Española de Médicos de Atención Primaria (SEMERGEN). Publicado por Elsevier España, S.L.U. All rights reserved.
Night work and BMI: is it related to on-shift napping?
Silva-Costa, Aline; Griep, Rosane Härter; Rotenberg, Lúcia
2017-11-17
On-shift napping can benefit night workers regarding sleep loss, synchronization of circadian rhythms, and alertness. However, few studies on napping can be found in the literature focused on possible health benefits. This cross-sectional study has investigated the role of on-shift napping on the association between night work and BMI in 409 night-shift nursing professionals. The number of working nights and the years of exposure to night work were significantly associated with increased BMI levels among non-nappers, but not among nappers. Results suggest a benefit of napping for weight gain, thus subsidizing occupational health policies on the regulation of on-shift napping among nursing workers.
DEFF Research Database (Denmark)
Højgaard, Betina; Olsen, Kim Rose; Søgaard, Jes
2009-01-01
circumference (WC) and body mass index (BMI). The analyses show that the combination of BMI and WC does not improve the identification of high-risk individuals compared with the use of WC alone. The health service costs increase by 1.24% in women and 2.08% in men pr. cm increase in WC above the normal range....
DEFF Research Database (Denmark)
Højgaard, Betina; Olsen, Kim Rose; Søgaard, Jes
2009-01-01
circumference (WC) and body mass index (BMI). The analyses show that the combination of BMI and WC does not improve the identification of high-risk individuals compared with the use of WC alone. The health service costs increase by 1.24% in women and 2.08% in men pr. cm increase in WC above the normal range...
Duration of the action of rocuronium in patients with BMI of less than 25: An observational study.
Takahata, Osamu; Takahoko, Ken-Ichi; Sasakawa, Tomoki; Inagaki, Yasuyoshi; Takahoko, Hiroyuki; Kunisawa, Takayuki
2018-05-02
The duration of rocuronium in patients with BMI more than 30 kg m is prolonged. Whether the reverse is true when BMI is less than 18.5 kg m is unclear. The objective of this study was to investigate whether a BMI less than 25 kg m affects the duration of rocuronium in doses adjusted for actual body weight. A prospective, observational, single-centre study. The operating room of a teaching hospital from 1 June 2008 to 30 June 2015. Thirty patients with American Society of Anesthesiologists physical status I or II who were scheduled to undergo elective surgery (BMI rocuronium (D1) was defined as the time from injection of rocuronium 0.6 mg kg to return of first twitch height to 25% of the control. Duration of additional doses (D2) was the time from a supplement of 0.15 mg kg rocuronium to return of first twitch height to 25% of the control. The relationship between D1 or D2 and BMI was examined using linear regression analysis. Linear regression analysis revealed a significant correlation between duration of initial dose and BMI (R = 0.246; P = 0.00531). A significant correlation between the duration of the additional dose and BMI was also found (R = 0.316; P = 0.00122). The lower the BMI, the shorter the duration of rocuronium at initial and additional doses determined by the actual body weight in adult patients with a BMI less than 25 kg m. www.umin.ac.jp/ctr/index/htm with registry number UMIN 00009337 and UMIN 000015407.
Fenske, Nora; Müller, Manfred J.; Plachta-Danielzik, Sandra; Keil, Thomas; Grabenhenrich, Linus; von Kries, Rüdiger
2014-01-01
Background: Children of mothers who smoked during pregnancy have a lower birth weight but have a higher chance to become overweight during childhood. Objectives: We followed children longitudinally to assess the age when higher body mass index (BMI) z-scores became evident in the children of mothers who smoked during pregnancy, and to evaluate the trajectory of changes until adolescence. Methods: We pooled data from two German cohort studies that included repeated anthropometric measurements until 14 years of age and information on smoking during pregnancy and other risk factors for overweight. We used longitudinal quantile regression to estimate age- and sex-specific associations between maternal smoking and the 10th, 25th, 50th, 75th, and 90th quantiles of the BMI z-score distribution in study participants from birth through 14 years of age, adjusted for potential confounders. We used additive mixed models to estimate associations with mean BMI z-scores. Results: Mean and median (50th quantile) BMI z-scores at birth were smaller in the children of mothers who smoked during pregnancy compared with children of nonsmoking mothers, but BMI z-scores were significantly associated with maternal smoking beginning at the age of 4–5 years, and differences increased over time. For example, the difference in the median BMI z-score between the daughters of smokers versus nonsmokers was 0.12 (95% CI: 0.01, 0.21) at 5 years, and 0.30 (95% CI: 0.08, 0.39) at 14 years of age. For lower BMI z-score quantiles, the association with smoking was more pronounced in girls, whereas in boys the association was more pronounced for higher BMI z-score quantiles. Conclusions: A clear difference in BMI z-score (mean and median) between children of smoking and nonsmoking mothers emerged at 4–5 years of age. The shape and size of age-specific effect estimates for maternal smoking during pregnancy varied by age and sex across the BMI z-score distribution. Citation: Riedel C, Fenske N, M
Crispo, Anna; Grimaldi, Maria; D'Aiuto, Massimiliano; Rinaldo, Massimo; Capasso, Immacolata; Amore, Alfonso; D'Aiuto, Giuseppe; Giudice, Aldo; Ciliberto, Gennaro; Montella, Maurizio
2015-02-01
Few studies are available on the potential impact of body weight on breast cancer prognosis in screen-detected patients. Moreover, it is not known whether body mass index (BMI) could have a different prognostic impact in screen-detected versus symptomatic breast cancer patients. To investigate these unsolved issues, we carried out a retrospective study evaluating the effect of BMI on breast cancer prognosis in screen-detected vs symptomatic breast cancer patients. We conducted a follow-up study on 448 women diagnosed with incident, histologically-confirmed breast cancer. Patients were categorized according to their BMI as normal weight, overweight and obese. Disease free survival (DFS), overall survival (OS), and BMI curves were compared according to mode of cancer detection. Among screen-detected patients, higher BMI was associated with a significant lower DFS, whereas no significant difference was observed among symptomatic patients. OS showed similar results. In the multivariate analysis adjusting for age, education, tumor size, nodal status, estrogen receptor (ER), progesterone receptor (PR) and menopausal status, the risk for high level of BMI among screen-detected patients did not reach the statistical significance for either recurrence or survival. Our study highlights the potential impact of high bodyweight in breast cancer prognosis, the findings confirm that obesity plays a role in women breast cancer prognosis independently from diagnosis mode. Copyright © 2014 Elsevier Ltd. All rights reserved.
Svensson, V; Jacobsson, J A; Fredriksson, R; Danielsson, P; Sobko, T; Schiöth, H B; Marcus, C
2011-01-01
To explore the relationship between severity of obesity at age 7 and age 15, age at onset of obesity, and parental body mass index (BMI) in obese children and adolescents. Longitudinal cohort study. Obese children (n = 231) and their parents (n = 462) from the Swedish National Childhood Obesity Centre. Multivariate regression analyses were applied with severity of obesity (BMI standard deviation score (BMI SDS)) and onset of obesity as dependent variables. The effect of parental BMI was evaluated and in the final models adjusted for gender, parental education, age at onset of obesity, severity of obesity at age 7 and obesity treatment. For severity of obesity at age 7, a positive correlation with maternal BMI was indicated (P = 0.05). Severity of obesity at this age also showed a strong negative correlation with the age at onset of obesity. Severity of obesity at age 15 was significantly correlated with both maternal and paternal BMI (P obesity at age 7 and negatively correlated with treatment. Also, a negative correlation was indicated at this age for parental education. No correlation with age at onset was found at age 15. For age at onset of obesity there was no relevant correlation with parental BMI. Children within the highest tertile of the BMI SDS range were more likely to have two obese parents. The impact of parental BMI on the severity of obesity in children is strengthened as the child grows into adolescence, whereas the age at onset is probably of less importance than previously thought. The influence of parental relative weight primarily affects the severity of childhood obesity and not the timing.
Kanemasa, Yusuke; Shimoyama, Tatsu; Sasaki, Yuki; Tamura, Miho; Sawada, Takeshi; Omuro, Yasushi; Hishima, Tsunekazu; Maeda, Yoshiharu
2018-02-01
Studies that have evaluated the prognostic value of body mass index (BMI) in patients with diffuse large B-cell lymphoma have recently been reported. However, the impact of BMI on survival outcomes remains controversial. We retrospectively analyzed the data of 406 diffuse large B-cell lymphoma patients treated with R-CHOP or R-CHOP-like regimens. The number (%) of patients that were categorized into 1 of 4 groups according to BMI were underweight (BMI (BMI (≥25 kg/m 2 ) (5-y OS, 61.5% vs 85.7%; P = .039). In contrast, in young female patients (BMI had significantly better OS than those with a high BMI (5-y OS, 88.6% vs 46.4%; P BMI on OS between young and elderly patients. In this study, we demonstrated that being underweight and obese were independent prognostic factors compared with being normal weight. In female patients, BMI had a different impact on the prognosis of young and elderly patients, whereas in male patients, there was no difference in the effect of BMI on prognosis according to age. Copyright © 2017 John Wiley & Sons, Ltd.
Chaparro, M Pia; Koupil, Ilona; Byberg, Liisa
2017-12-01
To investigate if the association between maternal pre-pregnancy BMI and offspring's body composition in late adolescence and young adulthood varies by offspring birth order and sex. Family cohort study, with data from registers, questionnaires and physical examinations. The main outcome under study was offspring body composition (percentage fat mass (%FM), percentage lean mass (%LM)) measured by dual-energy X-ray absorptiometry. Uppsala, Sweden. Two hundred and twenty-six siblings (first-born v. second-born; average age 19 and 21 years) and their mothers. In multivariable linear regression models, maternal pre-pregnancy BMI was positively associated with daughter's %FM, with stronger estimates for first-born (β=0·97, 95 % CI 0·14, 1·80) v. second-born daughters (β=0·64, 95 % CI 0·08, 1·20). Mother's BMI before her first pregnancy was associated with her second-born daughter's body composition (β=1·05, 95 % CI 0·31, 1·79 (%FM)) Similar results albeit in the opposite direction were observed for %LM. No significant associations were found between pre-pregnancy BMI and %FM (β=0·59, 95 % CI-0·27, 1·44 first-born; β=-0·13, 95 % CI-0·77, 0·52 second-born) or %LM (β=-0·54, 95 % CI-1·37, 0·28 first-born; β=0·11, 95 % CI-0·52, 0·74 second-born) for sons. A higher pre-pregnancy BMI was associated with higher offspring %FM and lower offspring %LM in late adolescence and young adulthood, with stronger associations for first-born daughters. Preventing obesity at the start of women's reproductive life might reduce the risk of obesity in her offspring, particularly for daughters.
Xie, Chunfeng; Jin, Jianliang; Lv, Xianhui; Tao, Jianguo; Wang, Rong; Miao, Dengshun
2015-01-01
To determine whether transplanted amniotic membrane mesenchymal stem cells (AMSCs) ameliorated the premature senescent phenotype of Bmi-1-deficient mice, postnatal 2-day-old Bmi-1−/− mice were injected intraperitoneally with the second-passage AMSCs from amniotic membranes of β-galactosidase (β-gal) transgenic mice or wild-type (WT) mice labeled with DiI. Three reinjections were given, once every seven days. Phenotypes of 5-week-old β-gal+ AMSC-transplanted or 6-week-old DiI+ AMSC-transplanted Bmi-1−/− mice were compared with vehicle-transplanted Bmi-1−/− and WT mice. Vehicle-transplanted Bmi-1−/− mice displayed growth retardation and premature aging with decreased cell proliferation and increased cell apoptosis; a decreased ratio and dysmaturity of lymphocytic series; premature osteoporosis with reduced osteogenesis and increased adipogenesis; redox imbalance and DNA damage in multiple organs. Transplanted AMSCs carried Bmi-1 migrated into multiple organs, proliferated and differentiated into multiple tissue cells, promoted growth and delayed senescence in Bmi-1−/− transplant recipients. The dysmaturity of lymphocytic series were ameliorated, premature osteoporosis were rescued by promoting osteogenesis and inhibiting adipogenesis, the oxidative stress and DNA damage in multiple organs were inhibited by the AMSC transplantation in Bmi-1−/− mice. These findings indicate that AMSC transplantation ameliorated the premature senescent phenotype of Bmi-1-deficient mice and could be a novel therapy to delay aging and prevent aging-associated degenerative diseases. PMID:26370922
Wpływ ilości spożywanych posiłków na wartość wskaźnika BMI = Influence amount of food meals for BMI
Nalepa, Dorota; Weber, Dorota; Rogala, Renata; Charzyńska-Gula, Marianna
2016-01-01
Nalepa, Dorota, Weber, Dorota, Rogala, Renata, Charzyńska-Gula, Marianna. Wpływ ilości spożywanych posiłków na wartość wskaźnika BMI = Influence amount of food meals for BMI. Journal of Education, Health and Sport. 2016;6(3):48-61. eISSN 2391-8306. DOI http://dx.doi.org/10.5281/zenodo.47438 http://ojs.ukw.edu.pl/index.php/johs/article/view/3400 https://pbn.nauka.gov.pl/works/719646 The journal has had 7 points in Ministry of Science and Higher Education parametric evaluation...
Li, Jinbo; Wang, Qian; Yang, Renlei; Zhang, Jiaqi; Li, Xing; Zhou, Xichao; Miao, Dengshun
2017-05-01
Previous studies have shown that estrogen regulates bone homeostasis through regulatory effects on oxidative stress. However, it is unclear how estrogen deficiency triggers reactive oxygen species (ROS) accumulation. Recent studies provide evidence that the B lymphoma Mo-MLV insertion region 1 (BMI-1) plays a critical role in protection against oxidative stress and that this gene is directly regulated by estrogen via estrogen receptor (ER) at the transcriptional level. In this study, ovariectomized mice were given drinking water with/without antioxidant N-acetyl-cysteine (NAC, 1 mg/mL) supplementation, and compared with each other and with sham mice. Results showed that ovariectomy resulted in bone loss with increased osteoclast surface, increased ROS levels, T cell activation, and increased TNF and RANKL levels in serum and in CD4 T cells; NAC supplementation largely prevented these alterations. BMI-1 expression levels were dramatically downregulated in CD4 T cells from ovariectomized mice. We supplemented drinking water to BMI-1-deficient mice with/without NAC and compared them with each other and with wild-type (WT) mice. We found that BMI-1 deficiency mimicked alterations observed in ovariectomy whereas NAC supplementation reversed all alterations induced by BMI-1 deficiency. Because T cells are critical in mediating ovariectomy-induced bone loss, we further assessed whether BMI-1 overexpression in lymphocytes can protect against estrogen deficiency-induced osteoclastogenesis and bone loss by inhibiting oxidative stress, T cell activation, and RANKL production. When WT and Eμ-BMI-1 transgenic mice with BMI-1 specifically overexpressed in lymphocytes were ovariectomized and compared with each other and with WT sham mice, we found that BMI-1 overexpression in lymphocytes clearly reversed all alterations induced by ovariectomy. Results from this study indicate that estrogen deficiency downregulates BMI-1 and subsequently increases ROS, T cell activation, and
Cornelissen, Katri; Bester, Andre; Cairns, Paul; Tovee, Martin; Cornelissen, Piers
2015-01-01
In this cross-sectional study, we investigated the influence of personal BMI on body size estimation in 42 women who have symptoms of anorexia (referred to henceforth as anorexia spectrum disorders, ANSD), and 100 healthy controls. Low BMI control participants over-estimate their size and high BMI controls under-estimate, a pattern which is predicted by a perceptual phenomenon called contraction bias. In addition, control participants' sensitivity to size change declines as their BMI increase...
Mao, Nan; He, Guansheng; Rao, Jinjun; Lv, Lin
2014-06-01
To investigate the effect of silencing Bmi-1 expression in reversing cisplatin resistance in human lung cancer cells and explore the possible mechanisms. Cisplatin-resistant A549/DDP cells with small interference RNA (siRNA)-mediated Bmi-1 expression silencing were examined for cisplatin sensitivity using MTT assay and alterations in cell cycle distribution and apoptosis with flow cytometry, and the changes in cell senescence was assessed using β-galactosidase staining. The protein expressions of Bmi-1, P14(ARF), P16(INK4a), P53, P21, Rb and ubi-H2AK119 in the cells were determined with Western blotting. A549/DDP cells showed significantly higher Bmi-1 expression than A549 cells. After siRNA-mediated Bmi-1 silencing, A549/DDP cells showed significantly enhanced cisplatin sensitivity with an increased IC50 from 40.3±4.1 µmol/L to 18.3±2.8 µmol/L (Pcisplatin possibly by regulating INK4a/ARF/Rb senescence pathway.
Chen, Yi-Lun; Liu, Yao-Chung; Wu, Chia-Hung; Yeh, Chiu-Mei; Chiu, Hsun-I; Lee, Gin-Yi; Lee, Yu-Ting; Hsu, Pei; Lin, Ting-Wei; Gau, Jyh-Pyng; Hsiao, Liang-Tsai; Chiou, Tzeon-Jye; Liu, Jin-Hwang; Liu, Chia-Jen
2018-04-01
Vertebral fractures affect approximately 30% of myeloma patients and lead to a poor impact on survival and life quality. In general, age and body mass index (BMI) are reported to have an important role in vertebral fractures. However, the triangle relationship among age, BMI, and vertebral fractures is still unclear in newly diagnosed multiple myeloma (NDMM) patients. This study recruited consecutive 394 patients with NDMM at Taipei Veterans General Hospital between January 1, 2005 and December 31, 2015. Risk factors for vertebral fractures in NDMM patients were collected and analyzed. The survival curves were demonstrated using Kaplan-Meier estimate. In total, 301 (76.4%) NDMM patients were enrolled in the cohort. In the median follow-up period of 18.0 months, the median survival duration in those with vertebral fractures ≥ 2 was shorter than those with vertebral fracture BMI BMI ≥ 24.0 kg/m 2 (adjusted RR, 2.79; 95% CI, 1.44-5.43). In multivariable logistic regression, BMI BMI ≥ 24.0 kg/m 2 (adjusted OR, 6.05; 95% CI, 2.43-15.08). Among age stratifications, patients with both old age and low BMI were at a greater risk suffering from increased vertebral fractures, especially in patients > 75 years and BMI BMI. Elder patients with low BMI should consider to routinely receive spinal radiographic examinations and regular follow-up. Copyright © 2017 John Wiley & Sons, Ltd.