The biological activities of (1,3)-(1,6)-{beta}-d-glucan and porous electrospun PLGA membranes containing {beta}-glucan in human dermal fibroblasts and adipose tissue-derived stem cells

Energy Technology Data Exchange (ETDEWEB)

Woo, Yeon I; Park, Bong Joo; Kim, Hye-Lee; Lee, Mi Hee; Kim, Jungsung; Park, Jong-Chul [Department of Medical Engineering, Yonsei University College of Medicine, 134 Shinchon-dong, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yang, Young-Il [Department of Pathology, School of Medicine, Paik Institute for Clinical Research, Inje University, 633-165 Gae-dong, Busan-jin-gu, Busan 614-735 (Korea, Republic of); Kim, Jung Koo [Department of Biomedical Engineering, College of Biomedical Science and Engineering, Inje University, Kimhae 621-749 (Korea, Republic of); Tsubaki, Kazufumi [R and D division, Asahi Denka Co. Ltd, 7-2-35 Higashi-ogu, Arakawa-ku, Tokyo 116-8554 (Japan); Han, Dong-Wook, E-mail: parkjc@yuhs.a [Department of Nanomedical Engineering, College of Nanoscience and Nanotechnology, Pusan National University, geumjeong-gu, Busan 609-735 (Korea, Republic of)

2010-08-01

In this study, we investigated the possible roles of (1,3)-(1,6)-{beta}-d-glucan ({beta}-glucan) and porous electrospun poly-lactide-co-glycolide (PLGA) membranes containing {beta}-glucan for skin wound healing, especially their effect on adult human dermal fibroblast (aHDF) and adipose tissue-derived stem cell (ADSC) activation, proliferation, migration, collagen gel contraction and biological safety tests of the prepared membrane. This study demonstrated that {beta}-glucan and porous PLGA membranes containing {beta}-glucan have enhanced the cellular responses, proliferation and migration, of aHDFs and ADSCs and the result of a collagen gel contraction assay also revealed that collagen gels contract strongly after 4 h post-gelation incubation with {beta}-glucan. Furthermore, we confirmed that porous PLGA membranes containing {beta}-glucan are biologically safe for wound healing study. These results indicate that the porous PLGA membranes containing {beta}-glucan interacted favorably with the membrane and the topical administration of {beta}-glucan was useful in promoting wound healing. Therefore, our study suggests that {beta}-glucan and porous PLGA membranes containing {beta}-glucan may be useful as a material for enhancing wound healing.

Distribution and molecular characterization of β-glucans from hull-less barley bran, shorts and flour.

Science.gov (United States)

Zheng, Xueling; Li, Limin; Wang, Qi

2011-01-01

Six hull-less barley cultivars widely grown in China were roller-milled to produce bran, shorts and flour fractions. The distribution and molecular characteristics of β-glucans from the three roller-milled fractions were investigated. The β-glucan contents in the six hull-less barley cultivars varied from 4.96% to 7.62%. For all the six cultivars, the shorts fraction contained the highest concentration of β-glucan (8.12-13.01%), followed by bran (6.15-7.58%) and flour (2.48-2.95%). Crude β-glucans were prepared from the three roller-milled fractions using aqueous sodium carbonate (pH 10). These preparations contained 45.38-71.41% β-glucan, 10.81-17.26% arabinoxylan, 2.6-9.6% protein, 2.7-9.0% starch, and 5.23-9.68% ash. Purification using α-amylase and β-xylanase in combination with pH adjustment and dialysis produced high purity β-glucan preparations (91-95%). The molecular weight (Mw) of β-glucan preparations from roller-milled fractions ranged from 117,600 to 852,400 g/mol. β-Glucan from flour had higher Mw than those from shorts and bran within the same cultivar, and β-glucan preparations from bran had the lowest Mw.

Isolation of beta-glucan from the cell wall of Saccharomyces cerevisiae.

Science.gov (United States)

Shokri, Hojjatollah; Asadi, Farzad; Khosravi, Ali Reza

2008-03-20

Beta-glucan, one of the major cell wall components of Saccharomyces cerevisiae (S. cerevisiae), has been found to enhance immune functions. At present study, we developed an optimal procedure to extract and purify beta-glucan. At first, yeast cells were grown in sabouraud dextrose agar and then cultured in yeast extract-peptone-glucose (YPG) broth. After incubation, cells were harvested, washed and disrupted by means of sonication method. The obtained cell walls were used to prepare alkali-soluble beta-glucan (glucan-S1). In this regard, 2% sodium hydroxide (NaOH) and 3% acetic acid were used in alkaline-acid extraction, respectively. This preparation contained 2.4% protein. In the next step, DEAE sephacel chromatography was used to remove remaining proteins (glucan-S2). Subsequently this preparation was applied into concanavalin-A sepharose column to remove manann. Finally, beta-glucan free of mannoprotein complexes was prepared (glucan-S3).

Comparison of functional and nutritional characteristics of barley and oat mixed linkage ß-glucans

DEFF Research Database (Denmark)

Mikkelsen, Mette Skau

-functionality relationship of β-glucans, the exact functional principle remain elusive. The overall aim of this project was to provide new knowledge into the relation between β-glucan and health at a molecular level. For the first time two barley and one oat fractions of well-defined and structurally different β...

Beta-glucans and cholesterol

Czech Academy of Sciences Publication Activity Database

Šíma, Petr; Vannucci, Luca; Větvička, V.

2017-01-01

Roč. 41, č. 4 (2017), s. 1799-1808 ISSN 1107-3756 Institutional support: RVO:61388971 Keywords : cholesterol * beta-glucans * diet Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 2.341, year: 2016

Physicochemical properties of beta-glucan in differently processed oat foods influence glycemic response.

Science.gov (United States)

Regand, Alejandra; Tosh, Susan M; Wolever, Thomas M S; Wood, Peter J

2009-10-14

To assess the effect of food processing on the capacity of oat beta-glucan to attenuate postprandial glycemia, isocaloric crisp bread, granola, porridge, and pasta containing 4 g of beta-glucan as well as control products with low beta-glucan content were prepared. The physicochemical properties (viscosity, peak molecular weight (M(p)), and concentration (C)) of beta-glucan in in-vitro-digestion extracts were evaluated, and fasting and postprandial blood glucose concentrations were measured in human subjects. Porridge and granola had the highest efficacy in attenuating the peak blood glucose response (PBGR) because of their high M(p) and viscosity. beta-Glucan depolymerization in bread and pasta reduced beta-glucan bioactivity. Pastas, known to have low glycemic responses, showed the lowest PBGR. The analyses of these products with previously reported data indicated that 73% of the bioactivity in reducing PBGR can be explained by M(p) x C. Characterizing the physicochemical properties of beta-glucan in bioactive foods aids functional food development.

Effects of extrusion variables on the properties of waxy hulless barley extrudates.

Science.gov (United States)

Köksel, Hamit; Ryu, Gy-Hyung; Başman, Arzu; Demiralp, Hande; Ng, Perry K W

2004-02-01

The objective of this research was to investigate the extrudability of waxy hulless barley flour under various extrusion conditions. Waxy hulless barley flour was processed in a laboratory-scale corotating twin-screw extruder with different levels of feed moisture content (22.3, 26.8, and 30.7%) and die temperature (130, 150, and 170 degrees C) to develop a snack food with high beta-glucan content. The effects of extrusion condition variables (screw configuration, moisture, and temperature) on the system variables (pressure and specific mechanical energy), the extrudate physical properties (sectional expansion index, bulk density), starch gelatinization, pasting properties (cold peak viscosity, trough viscosity, and final viscosity), and beta-glucan contents were determined. Results were evaluated by using response surface methodology. Increased extrusion temperature and feed moisture content resulted in decreases in exit die pressure and specific mechanical energy values. For extrudates extruded under low shear screw configuration (LS), increased barrel temperature decreased sectional expansion index (SEI) values at both low and high moisture contents. The feed moisture seems to have an inverse relationship with SEI over the range studied. Bulk density was higher at higher moisture contents, for both low and high barrel temperatures, for samples extruded under high shear screw configuration (HS) and LS. Cold peak viscosities (CV) were observed in all samples. The CV increased with the increase in extrusion temperature and feed moisture content. Although beta-glucan contents of the LS extrudates were comparable to that of barley flour sample, HS samples had generally lower beta-glucan contents. The extrusion cooking technique seems to be promising for the production of snack foods with high beta-glucan content, especially using LS conditions.

Barley β-Glucans-Containing Food Enhances Probiotic Performances of Beneficial Bacteria

Directory of Open Access Journals (Sweden)

Mattia P. Arena

2014-02-01

Full Text Available Currently, the majority of prebiotics in the market are derived from non-digestible oligosaccharides. Very few studies have focused on non-digestible long chain complex polysaccharides in relation to their potential as novel prebiotics. Cereals β-glucans have been investigated for immune-modulating properties and beneficial effects on obesity, cardiovascular diseases, diabetes, and cholesterol levels. Moreover, β-glucans have been reported to be highly fermentable by the intestinal microbiota in the caecum and colon, and can enhance both growth rate and lactic acid production of microbes isolated from the human intestine. In this work, we report the effects of food matrices containing barley β-glucans on growth and probiotic features of four Lactobacillus strains. Such matrices were able to improve the growth rate of the tested bacteria both in unstressed conditions and, importantly, after exposure to in vitro simulation of the digestive tract. Moreover, the effect of β-glucans-containing food on bacterial adhesion to enterocyte-like cells was analyzed and a positive influence on probiotic-enterocyte interaction was observed.

EFFECTS OF BARLEY FLOUR ADDITION AND BAKING TEMPERATURE ON Β-GLUCANS CONTENT AND BISCUITS PROPERTIES

OpenAIRE

Džafić, A; Oručević-Žuljević, Sanja; Spaho, Nermina; Akagić, Asima

2017-01-01

The aim of this study was to investigate opportunities to improve the nutritional value of biscuits. Therefore, the content of β-glucans, physical, chemical and sensory properties of biscuits were determined in relation to a share of added barley flour and a baking temperature. Five different blends of barley and wheat were used for biscuit production: barley/wheat flours in combinations: 0/100; 25/75; 50/50; 75/25 and 100/0 according to the procedure described in AACC method 10-52. The temp...

Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

Energy Technology Data Exchange (ETDEWEB)

Nicholas C Carpita

2009-04-20

Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

Water uptake in barley grain: Physiology; genetics and industrial applications.

Science.gov (United States)

Cu, Suong; Collins, Helen M; Betts, Natalie S; March, Timothy J; Janusz, Agnieszka; Stewart, Doug C; Skadhauge, Birgitte; Eglinton, Jason; Kyriacou, Bianca; Little, Alan; Burton, Rachel A; Fincher, Geoffrey B

2016-01-01

Water uptake by mature barley grains initiates germination and is the first stage in the malting process. Here we have investigated the effects of starchy endosperm cell wall thickness on water uptake, together with the effects of varying amounts of the wall polysaccharide, (1,3;1,4)-β-glucan. In the latter case, we examined mutant barley lines from a mutant library and transgenic barley lines in which the (1,3;1,4)-β-glucan synthase gene, HvCslF6, was down-regulated by RNA interference. Neither cell wall thickness nor the levels of grain (1,3;1,4)-β-glucan were significantly correlated with water uptake but are likely to influence modification during malting. However, when a barley mapping population was phenotyped for rate of water uptake into grain, quantitative trait locus (QTL) analysis identified specific regions of chromosomes 4H, 5H and 7H that accounted for approximately 17%, 18% and 11%, respectively, of the phenotypic variation. These data indicate that variation in water uptake rates by elite malting cultivars of barley is genetically controlled and a number of candidate genes that might control the trait were identified under the QTL. The genomics data raise the possibility that the genetic variation in water uptake rates might be exploited by breeders for the benefit of the malting and brewing industries. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Evaluation of Some Chemical Characteristics of barley Mutants induced by Gamma Irradiation

International Nuclear Information System (INIS)

Abdeldaiem, M.H.; Ali, H.G.M.

2011-01-01

This study aims to evaluate the antioxidant activity of acetonic extract from some barley mutations (P1, P2 and P3 varieties) induced by gamma irradiation as compared with local barley variety (Hordeum vulgare L.) as control. Barley samples were obtained from Plant Breeding Unit, Plant Research Department, Nuclear Research Centre, Atomic Energy Authority, Egypt. The measurements of the antioxidant activity using a radical scavenging capacity against 2,2-diphenyl-1-picrylhydrazyl (DPPH) and ?-carotene bleaching assay were assessed in the barley acetonic extract. Furthermore, amino acids composition of barley mutant samples was determined. The results indicated that the acetonic extract of barley varieties under investigation possess marked antioxidant and anti radical capacities. The data showed that the acetonic extract of barley mutant P1 possessed the higher antioxidant activity as compared with the antioxidant activities of acetonic extract from control and other barley mutant samples. Meanwhile, the flour of barley mutations under investigation contained trace elements of iron, copper and manganese. GC and mass analyses were used to identify the active compound of extract of control and mutant barley samples. The results illustrated that the main components of the control sample of barely extract was pentane, 3 methyl (47.73%) while gamma irradiation caused noticeable change in the relative percentage of some components of acetonic extract from barley mutant samples. Moreover, the results presented that changes were disappeared, and some compounds of the acetonic extract from mutant barley samples were appeared. Furthermore, the results exhibited that barley flour supplemented with wheat flour at 30% level produced acceptable cookies. Accordingly, the phenolic constituents of barley acetonic extract induced by gamma irradiation, especially samples of P1 mutant, may have a future role as ingredients in the development of functional foods.

Isozyme differences in barley mutants

International Nuclear Information System (INIS)

AI-Jibouri, A.A.M.; Dham, K.M.

1990-01-01

Full text: Thirty mutants (M 11 ) of barley (Hordeum vulgare L.) induced by physical and chemical mutagens were analysed for isozyme composition using polyacrylamide gel electrophoresis. Results show that these mutants were different in the isozymes leucine aminopeptidase, esterase and peroxidase. The differences included the number of forms of each enzyme, relative mobility value and their intensity on the gel. Glutamate oxaloacetate transaminase isozyme was found in six molecular forms and these forms were similar in all mutants. (author)

Isozyme differences in barley mutants

Energy Technology Data Exchange (ETDEWEB)

AI-Jibouri, A A.M.; Dham, K M [Department of Botany, Nuclear Research Centre, Baghdad (Iraq)

1990-01-01

Full text: Thirty mutants (M{sub 11}) of barley (Hordeum vulgare L.) induced by physical and chemical mutagens were analysed for isozyme composition using polyacrylamide gel electrophoresis. Results show that these mutants were different in the isozymes leucine aminopeptidase, esterase and peroxidase. The differences included the number of forms of each enzyme, relative mobility value and their intensity on the gel. Glutamate oxaloacetate transaminase isozyme was found in six molecular forms and these forms were similar in all mutants. (author)

Simultaneous intake of beta-glucan and plant stanol esters affects lipid metabolism in slightly hypercholesterolemic subjects.

Science.gov (United States)

Theuwissen, Elke; Mensink, Ronald P

2007-03-01

Intake of food products rich in water-soluble fiber beta-glucan and products enriched with plant stanol esters lower serum cholesterol. Combining 2 functional food ingredients into one food product may achieve additional reductions of serum cholesterol. Our objective was to investigate the effects of a simultaneous intake of beta-glucan plus plant stanol esters on lipid metabolism in mildly hypercholesterolemic volunteers. In a randomized, controlled, 3-period crossover study, 40 mildly hypercholesterolemic men and women received muesli in random order twice a day for 4 wk, which provided, in total, 5 g control fiber from wheat (control muesli), 5 g oat beta-glucan (beta-glucan muesli), or 5 g oat beta-glucan plus 1.5 g plant stanols (combination muesli). beta-Glucan muesli decreased serum LDL cholesterol by 5.0% compared with control muesli (P = 0.013). Combination muesli reduced LDL cholesterol by 9.6% compared with control muesli (P < 0.001), and by 4.4% compared with beta-glucan muesli (P = 0.036). Serum HDL cholesterol and triacylglycerol concentrations did not differ after the 3 treatments. Compared with control muesli, beta-glucan muesli increased bile acid synthesis (P = 0.043) and decreased cholesterol absorption (P = 0.011). Addition of plant stanols did not influence bile acid synthesis but decreased cholesterol absorption (P < 0.001) and raised cholesterol synthesis (P = 0.016) compared with control muesli, and the plant stanols decreased cholesterol absorption compared with beta-glucan muesli (P = 0.004). The combination muesli decreased serum concentrations of sitostanol compared with control muesli (P = 0.010). Plasma concentrations of lipid-soluble antioxidants did not differ after the 3 treatments. beta-Glucan muesli effectively lowered serum LDL cholesterol concentrations. The addition of plant stanol esters to beta-glucan-enriched muesli further lowered serum LDL cholesterol, although effects were slightly less than predicted.

A chemometric evaluation of the underlying physical and chemical patterns that support near infrared spectroscopy of barley seeds as a tool for explorative classification of endosperm genes and gene combinations

DEFF Research Database (Denmark)

Jacobsen, Susanne; Søndergaard, Ib; Møller, Birthe

2005-01-01

Analysis (PCA). Riso mutants R-13, R-29 high (I -> 3, 1 -> 4)-beta-glucan, low starch and R-1508 (high lysine, reduced starch), near isogeneic controls and normal lines and recombinants were studied. Based on proteome analysis results, six antimicrobial proteins were followed during endosperm development...... revealing pleiotropic gene effects in expression timing that supporting the gene classification. To verify that NIR spectroscopy data represents a physio-chemical fingerprint of the barley seed, physical and chemical spectral components were partially separated by Multiple Scatter Correction...... and their genetic classification ability verified. Wavelength bands with known water binding and (I -> 3, 1 -> 4)-beta-glucan assignments were successfully predicted by partial least squares regression giving insight into how NIR-data works in classification. Highly reproducible gene-specific, covariate...

An in vitro assay for (1-->6)-beta-D-glucan synthesis in Saccharomyces cerevisiae.

NARCIS (Netherlands)

Vink, E.; Rodriguez-Suarez, R.J.; Gerard-Vincent, M.; Ribas, J.C.; de Nobel, J.G.; van den Ende, H.; Duran, A.; Klis, F.M.; Bussey, H.

2004-01-01

(1 --> 6)-beta-D-glucan is a key cell wall component of Saccharomyces cerevisiae and Candida albicans. Many genes are known to affect the levels or structure of this glucan, but their roles and a molecular description of the synthesis of (1 --> 6)-beta-D-glucan remain to be established and a method

Beta-glucans in the treatment of diabetes and associated cardiovascular risks

Directory of Open Access Journals (Sweden)

Jiezhong Chen

2008-12-01

Full Text Available Jiezhong Chen1,3, Kenneth Raymond21John Curtin School of Medical Research, Australian National University, Acton, ACT, Australia; 2School of Pharmacy and Applied Science, Faculty of Science, Technology and Engineering, LaTrobe University, Bendigo, Vic, Australia; 3Adjunct Senior Research Fellow, University of Canberra, ACT, AustraliaAbstract: Diabetes mellitus is characterized by high blood glucose level with typical manifestations of thirst, polyuria, polydipsia, and weight loss. It is caused by defects in insulin-mediated signal pathways, resulting in decreased glucose transportation from blood into muscle and fat cells. The major risk is vascular injury leading to heart disease, which is accelerated by increased lipid levels and hypertension. Management of diabetes includes: control of blood glucose level and lipids; and reduction of hypertension. Dietary intake of beta-glucans has been shown to reduce all these risk factors to benefit the treatment of diabetes and associated complications. In addition, beta-glucans also promote wound healing and alleviate ischemic heart injury. However, the mechanisms behind the effect of beta-glucans on diabetes and associated complications need to be further studied using pure beta-glucan.Keywords: diabetes mellitus, hyperglycemia, prevalence, pathogenesis

Beta-glucan ameliorates gamma-rays induced oxidative injury in male Swiss albino rats

International Nuclear Information System (INIS)

Salama, S.F.

2011-01-01

1,3-beta-D-Glucan is a natural polysaccharide derived from the cell walls of bakers yeast Saccharomyces cerevsiae with immunoenhancing and potent antioxidant effects. This study investigated the pathways through which beta-glucan gavage treatment (50mg/kg) exerts its effect on radiation-induced oxidative damage in male rats. Beta-glucan was given orally to male rats; 3 hours post gamma-irradiation at dose 5Gy, for 10 and 20 days post-irradiation level were assayed, being remarkable indicators in cell oxidative stress. Results pointed out that irradiation at 5Gy significantly depressed all blood parameters, such as erythrocytes count (RBCs), hemoglobin content (Hb), hematocrit value (Hct), total leucocytes count and absolute lymphocytes and neutrophils counts, blood glutathione (GSH) level and conversely elevated level of serum ascorbyl radical (AsR), product of lipid peroxidation (MDA melanodialdehyde), triglycerides and cholesterol. Total leucocytes count and absolute lymphocytes and neutrophils counts, RBCs, Hb, Hct, blood GSH and serum MDA of irradiated animals receiving beta-glucan administration were exhibited significant differences compared to the irradiated group. Marrow count and the percentage of viability and spleenocytes viability were also significantly decreased. Beta-glucan treatment accelerates recovery of cell damage induced by ionizing irradiation through its potential immune-enhancing activity and free radical scavenging ability that is partially mediated through stimulation of immunohaematological system thus could play a role in regulating irradiation complications

Winter barley mutants created in the Ukraine

International Nuclear Information System (INIS)

Zayats, O.M.

2001-01-01

Full text: Increasing fodder and protein production is one of the objectives of the development of agriculture in Ukraine. Higher productivity of fodder crops, due to new highly productive varieties, is the means to meet this aim. Winter barley is an important crop for fodder purposes. The climate of the Ukraine is favourable for growing this crop. The areas used for the growth of winter barley are however, small (500,000-550,000 ha) and there is a shortage of good quality varieties. The main aim of the work was therefore to create new varieties of highly productive winter barley, of good quality. The new varieties and mutation lines of winter barley were created under the influence of water solutions of N-nitroso-N-methylurea (NMH - 0,012, 0,005%), N-nitroso-N-ethylurea (NEH - 0,05; 0.025; 0,012%) ethyleneimine (EI - 0,02; 0,01; 0,005%) on winter barley seeds of the varieties of local and foreign selections. On the basis of many years of investigations (1984-94) the following mutations were described: hard-grained, winter-hardiness, earliness, middle-maturity, late-maturity, wide and large leaves, narrow leaves, multinodal, great number of leaves, great number of flowers, strong stem (lodging resistant), tallness, semi-dwarfness, dwarfness, and high productivity. Particularly valuable are mutants with high productivity of green bulk. Their potential yield is 70 t/ha. As a result of the work two varieties of winter barley 'Shyrokolysty' and 'Kormovy' were released into the State register of plant varieties of the Ukraine. The other valuable mutant genotypes are used in cross breeding programmes. (author)

The beta-glucan receptor dectin-1 recognizes specific morphologies of Aspergillus fumigatus.

Directory of Open Access Journals (Sweden)

Chad Steele

2005-12-01

Full Text Available Alveolar macrophages represent a first-line innate host defense mechanism for clearing inhaled Aspergillus fumigatus from the lungs, yet contradictory data exist as to which alveolar macrophage recognition receptor is critical for innate immunity to A. fumigatus. Acknowledging that the A. fumigatus cell wall contains a high beta-1,3-glucan content, we questioned whether the beta-glucan receptor dectin-1 played a role in this recognition process. Monoclonal antibody, soluble receptor, and competitive carbohydrate blockage indicated that the alveolar macrophage inflammatory response, specifically the production of tumor necrosis factor-alpha (TNF-alpha, interleukin-1alpha (IL-1alpha, IL-1beta, IL-6, CXCL2/macrophage inflammatory protein-2 (MIP-2, CCL3/macrophage inflammatory protein-1alpha (MIP-1alpha, granulocyte-colony stimulating factor (G-CSF, and granulocyte monocyte-CSF (GM-CSF, to live A. fumigatus was dependent on recognition via the beta-glucan receptor dectin-1. The inflammatory response was triggered at the highest level by A. fumigatus swollen conidia and early germlings and correlated to the levels of surface-exposed beta glucans, indicating that dectin-1 preferentially recognizes specific morphological forms of A. fumigatus. Intratracheal administration of A. fumigatus conidia to mice in the presence of a soluble dectin-Fc fusion protein reduced both lung proinflammatory cytokine/chemokine levels and cellular recruitment while modestly increasing the A. fumigatus fungal burden, illustrating the importance of beta-glucan-initiated dectin-1 signaling in defense against this pathogen. Collectively, these data show that dectin-1 is centrally required for the generation of alveolar macrophage proinflammatory responses to A. fumigatus and to our knowledge provides the first in vivo evidence for the role of dectin-1 in fungal innate defense.

Viability of bifidobacteria strains in yogurt with added oat beta-glucan and corn starch during cold storage.

Science.gov (United States)

Rosburg, Valerie; Boylston, Terri; White, Pamela

2010-06-01

Probiotics must be consumed at a level of 10(7) CFU/mL for successful colonization of the gut. In yogurts containing beneficial cultures, the survival of probiotic strains can quickly decline below this critical concentration during cold storage. We hypothesized that beta-glucan would increase the viability of bifidobacteria strains in yogurt during cold storage. Yogurts were produced containing 0.44% beta-glucan (concentrated or freeze-dried) extracted from whole oat flour and/or 1.33% modified corn starch, and bifidobacteria (B. breve or B. longum) at a concentration of at least 10(9) CFU/mL. All yogurts were stored at 4 degrees C. Bifidobacteria and yogurt cultures, Streptococcus thermophilus and Lactobacillus delbureckii subsp. bulgaricus, were enumerated from undisturbed aliquots before fermentation, after fermentation, and once a week for 5 wk. S. thermophilus and L. bulgaricus maintained a concentration of at least 10(8) CFU/mL in yogurts containing concentrated or freeze-dried beta-glucan regardless of starch addition, and in the control with no added beta-glucan or starch. Similarly, the probiotic, Bifidobacterium breve, survived above a therapeutic level in all treatments. The addition of beta-glucan prolonged the survival of Bifidobacterium longum at a concentration of at least 10(7) CFU/mL by up to 2 wk on average beyond the control. Further, the inclusion of concentrated beta-glucan in yogurt improved survival of B. longum above 10(7) CFU/mL by 1 wk longer than did freeze-dried beta-glucan. Study results suggest that beta-glucan has a protective effect on bifidobacteria in yogurt when stressed by low-temperature storage.

Impact of flavouring substances on the aggregation behaviour of dissolved barley β-glucans in a model beer.

Science.gov (United States)

Kupetz, M; Sacher, B; Becker, T

2016-06-05

Structural polymers such as cereal β-glucan may cause various processing problems in beverage industry depending on concentration, molar size distribution and agglomeration behaviour. In this context, influences of the beer volatiles dodecanoic acid, octyl butanoate, ethyl decanoate and decyl acetate on molar mass and radii of barley β-glucan were investigated in ethanolic (4% w/w) model solution. After addition of 100mg/l ethyl decanoate and decyl acetate to the β-glucan solution, a wider-ranging molar mass distribution could be observed by means of asymmetric field-flow-fractionation. Due to agglomeration, average molar mass of β-glucan standard (MW=6.8×10(6)g/mol) increased by 2×10(6)g/mol (P<0.05) in solution containing decyl acetate. Furthermore, a significant growth (P<0.05) from 86 to 102 nm in gyration radius was measured. The obtained results elucidate the importance of fatty acid derived flavouring substance composition in beer regarding the aggregation behaviour of β-glucan. Copyright © 2016 Elsevier Ltd. All rights reserved.

High protein mutants of winter fodder barley induced by radiation and chemical mutagens

Energy Technology Data Exchange (ETDEWEB)

Yankulov, M.; Genchev, K.; Nikolov, Kh.

1982-01-01

Several induced mutants of winter fodder barley with higher rpotein content are described. These mutants were produced by treating seeds of cvs. Vogelsaenger Gold, Ager and 468 with gamma-rays, sodium azide and ethyl methanesulfonate (alone and in combinations) and with ethylene and formamide. The gamma-ray induced mutants of winter fodder barley have 1-4% higher protein content. The mutant line 109 has, besides high protein content (17,37%), 5.96 lysine per 100 g protein, but its endosperm is wrinkeled. Mutants produced by chemical mutagens have 6-7% higher protein content than the initial cultivars. All induced mutants have 85-95 cm high stems, i.e. they are by 10-20 cm shorter than the initial cultivars. Some of these mutants are now resistant to the diseases Helminthosporium gramineum and Ustilago nuda. The recommended mutants could be successfully used in breeding programs for producing of higher protein content and quality in winter fodder barley.

High protein mutants of winter fodder barley induced by radiation and chemical mutagens

International Nuclear Information System (INIS)

Yankulov, M.; Genchev, K.; Nikolov, Kh.

1982-01-01

Several induced mutants of winter fodder barley with higher rpotein content are described. These mutants were produced by treating seeds of cvs. Vogelsaenger Gold, Ager and 468 with gamma-rays, sodium azide and ethyl methanesulfonate (alone and in combinations) and with ethylene and formamide. The gamma-ray induced mutants of winter fodder barley have 1-4% higher protein content. The mutant line 109 has, besides high protein content (17,37%), 5.96 lysine per 100 g protein, but its endosperm is wrinkeled. Mutants produced by chemical mutagens have 6-7% higher protein content than the initial cultivars. All induced mutants have 85-95 cm high stems, i.e. they are by 10-20 cm shorter than the initial cultivars. Some of these mutants are now resistant to the diseases Helminthosporium gramineum and Ustilago nuda. The recommended mutants could be successfully used in breeding programs for producing of higher protein content and quality in winter fodder barley

The effect of aerobic exercise and barley β-glucan on blood glucose, body composition and blood pressure of diabetic women

Directory of Open Access Journals (Sweden)

Fatemeh Mokhtari

2018-04-01

Full Text Available Background: The incidence of type 2 diabetes increases with aging, unhealthy diets, obesity and sedentary lifestyles. The aim of this study was to investigate the combinational effect of a 12-week aerobic exercise and barley β-glucan (BBG on blood glucose, body composition and blood pressure in women with type 2 diabetes. Materials and Methods: In this semi-experimental study, 24 women with the mean age of 49 years and a blood glucose level of 110-280 mg/dl were purposefully selected and randomly divided into three groups: a group of aerobic exercise with diet (n=8, b diet group (n=8 c control group (n=8. The diet group consumed one barley bread, containing 4 g of β glucan, each day for 12 weeks. The group of aerobic exercise, who was on diet, participated in a progressive walking program with the intensity of %60-70% of maximal heart rate in addition to diet program (barley bread. Blood glucose, weight, fat percentage, and systolic and diastolic blood pressure levels were measured in pre-and post-training. Results: Results showed a significant decrease in the blood glucose level in the experimental groups compared to the control group, while no major changes were observed in body composition and blood pressure. Conclusion: It seems that the combined program (aerobic training with diet or consumption of β-glucan alone can decrease blood glucose in patients with diabetes.

beta. -1,4-glucan occurring in homogenate of Phaseolus aureus seedlings. Possible nascent stage of cellulose biosynthesis in vivo

Energy Technology Data Exchange (ETDEWEB)

Satoh, S; Matsuda, K; Tamari, K

1976-12-01

A small amount of cytoplasmic ..beta..-1,4-glucan, which might be involved in the synthesis of cellulose in the cell wall, was found in the homogenate prepared from the hypocotyls of seedlings of Phaseolus aureus. Upon hydrolysis by cellulase of the 20,000xg pellet from the cytoplasmic fraction of segments incubated in a (/sup 14/C)-glucose solution, (/sup 14/C)-cellobiose was produced, with specific radioactivities 3 to 10 times greater than those of the cellobiose from cellulose in the cell wall at various incubation periods. The incoporation of radioactivity from (/sup 14/C)-glucose into this cytoplasmic ..beta..-1,4-glucan was therefore faster than that into cellulose constituting the cell wall. Hence, it seemed that the former ..beta..-1,4-glucan could be turned over. To examine whether the cytoplasmic ..beta..-1,4-glucan is carried by some subcellular components, cytoplasmic ..beta..-1,4-glucan in the cell was fractionated by differential centrifugation, two enzyme activities being measured as the markers of subcellular components. The distribution of ..beta..-1,4-glucan was similar to that of UDPG-glucosyl-transferase activity but not to that of IDP-ase activity. The result suggests that the cytoplasmic ..beta..-1,4-glucan has some relation to plasma membranes. Coumarin, known as a specific inhibitor for the biosynthesis of cellulose in plant cells, was shown to inhibit the incorporation of radio-carbon from (/sup 14/C)-glucose into cytoplasmic ..beta..-1,4-glucan to the same extent as that into cellulose in the cell wall of the hypocotyls.

Combined effects of added beta glucan and black tea in breads on starch functionality.

Science.gov (United States)

Jalil, Abbe Maleyki M; Edwards, Christine A; Combet, Emilie; Ibrahim, Muhammad; Garcia, Ada L

2015-03-01

Bread and tea are usually consumed separately, but there may be different food-matrix interactions and changes in starch characteristics when they are combined in bread. This study developed breads (white bread, WF; black tea, BT; beta glucan, βG; beta glucan plus black tea, βGBT) and determined their starch functionalities. Breads were developed using a standard baking recipe and determined their starch characteristics. There was no significant difference in starch hydrolysis between BT and WF but βGBT reduced early (10 min) starch hydrolysis compared with βG. The starch granules in βG and βGBT were elliptical and closely packed together. These results suggest that the addition of beta glucan and black tea to bread preserved the elliptical starch granules and lowered short-term starch hydrolysis.

Re-examination of cellular cyclic beta-1,2-glucans of Rhizobiaceae: distribution of ring sizes and degrees of glycerol-1-phosphate substitution.

Science.gov (United States)

Zevenhuizen, L P; van Veldhuizen, A; Fokkens, R H

1990-04-01

Gel-filtration and thin layer chromatography of low molecular weight carbohydrates from culture filtrates of Agrobacterium radiobacter, Isolate II, have shown, that next to the neutral beta-1,2-glucan fraction a major acidic fraction was present which was found to be glycerophosphorylated cyclic beta-1,2-glucans. Re-examination of cyclic beta-1,2-glucan preparations which had been obtained by extraction of Rhizobium cells with hot phenol-water also showed these acidic modified beta-1,2-glucans to be present. Cyclic beta-1,2-glucans from R. leguminosarum (9 strains) and of R. phaseoli (1 strain) had ring size distribution with degrees of polymerisation (DPs) of 19 and 20 as major ring sizes of which a minor part was glycerophosphorylated; beta-1,2-glucans of R. trifolii (3 strains) had ring sizes with DPs measuring 19-22 as prominent components which were largely unsubstituted, and R. meliloti (7 strains) had beta-1,2-glucans with ring size distributions extending to still higher DPs of 19-25 of which the major part appeared to be glycerophosphorylated.

Dietary (1-->3), (1-->4)-beta-D-glucans from oat activate nuclear factor-kappaB in intestinal leukocytes and enterocytes from mice

NARCIS (Netherlands)

Volman, Julia J.; Mensink, Ronald P.; Ramakers, Julian D.; de Winther, Menno P.; Carlsen, Harald; Blomhoff, Rune; Buurman, Wim A.; Plat, Jogchum

2010-01-01

Dietary components, like beta-glucans, can modulate the intestinal immune response. We previously showed that fecal water enriched with oat beta-glucan stimulated the cytokine-induced immune response of enterocytes. It is, however, unclear whether beta-glucans activate nuclear factor-kappaB

Mutants in the host-pathogen system barley-powdery mildew

International Nuclear Information System (INIS)

Joergensen, J.H.

1989-10-01

Mutation induction was used to analyse the host/pathogen interaction of barley and Erysiphe graminis. By irradiation or chemical mutagens, a number of similar mutations were induced in the ml-o gene (locus) of barley. The mutants had non-specific and durable resistance, which is rather uncommon. Studies revealed, that in spite of their similarity (the same mutated locus, monogenic recessive inheritance), the mutants were not identical and represent unique sources of disease resistant germ plasm. To study more fundamentally the interference of induced mutations in host/pathogen interactions, barley carrying the dominant resistance gene M1-a 12 was irradiated to mutate this gene. Instead of the expected ''monogenic recessive susceptibility'', several different mutational events inside and outside the locus were found to modify the resistance towards a more or less susceptible reaction. A third interesting approach was to induce mutations in the pathogen and thus create new virulence genes. The result, that no true mutation towards virulence was obtained in extremely large populations, deserves attention and further study to be sure about its implication. 13 refs

Gamma-radiation Mutagenesis in Genetically Unstable Barley Mutants. Pt. 2. Comparison of Various Mutants

International Nuclear Information System (INIS)

Balchiuniene, L.

1995-01-01

Spontaneous and gamma-induced mutability was compared in two groups of genetically unstable barley ear structure mutants - tweaky spike (tw) and branched ear (be). Instability in different loci causes different levels of spontaneous and gamma-induced mutability. A high spontaneous level of chlorophyll mutations is peculiar to be-ust mutants. It is suggested that the high level of induced chlorophyll mutations in allelic tw mutants is a result of better surviving of chlorophyll mutation carriers in the genotypical-physiological environment created by mutant tw alleles. (author). 6 refs., 2 tabs

Monitoring total endotoxin and (1 --> 3)-beta-D-glucan at the air exhaust of concentrated animal feeding operations.

Science.gov (United States)

Yang, Xufei; Wang, Xinlei; Zhang, Yuanhui; Lee, Jongmin; Su, Jingwei; Gates, Richard S

2013-10-01

Mitigation of bioaerosol emissions from concentrated animal feeding operations (CAFOs) demands knowledge of bioaerosol concentrations feeding into an end-of-pipe air treatment process. The aim of this preliminary study was to measure total endotoxin and (1 --> 3)-beta-glucan concentrations at the air exhaust of 18 commercial CAFOs and to examine their variability with animal operation type (swine farrowing, swine gestation, swine weaning, swine finishing, manure belt laying hen, and tom turkey) and season (cold, mild, and hot). The measured airborne concentrations of total endotoxin ranged from 98 to 23,157 endotoxin units (EU)/m3, and the airborne concentrations of total (1 --> 3)-beta-D-glucan ranged from 2.4 to 537.9 ng/m3. Animal operation type in this study had a significant effect on airborne concentrations of total endotoxin and (1 --> 3)-beta-D-glucan but no significant effect on their concentrations in total suspended particulate (TSP). Both endotoxin and (1 --> 3)-beta-D-glucan attained their highest airborne concentrations in visited tom turkey buildings. Comparatively, season had no significant effect on airborne concentrations of total endotoxin or (1 --> 3)-beta-D-glucan. Endotoxin and (1 --> 3)-beta-glucan concentrations in TSP dust appeared to increase as the weather became warmer, and this seasonal effect was significant in swine buildings. Elevated indoor temperatures in the hot season were considered to facilitate the growth and propagation of bacteria and fungi, thus leading to higher biocomponent concentrations in TSP.

Beta 1,3/1,6-glucan and vitamin C immunostimulate the non-specific immune response of white shrimp (Litopenaeus vannamei).

Science.gov (United States)

Wu, Yu-Sheng; Liau, Shu-Yu; Huang, Cheng-Ting; Nan, Fan-Hua

2016-10-01

This study mainly evaluated the effects of orally administered beta 1,3/1,6-glucan and vitamin C on the nonspecific immune responses of white shrimp (Litopenaeus vannamei). In this study, we found that the white shrimp oral administration with 1 g/kg of beta 1,3/1,6-glucan effectively enhanced O2(-) production and phenoloxidase and superoxide dismutase activity. Shrimp were oral administration with 0.2 g/kg of vitamin C presented beneficial nonspecific immune responses and enzyme activity and also observed in the beta 1,3/1,6-glucan treatment groups. Consequently, we compared the alterations in the immune activity between the beta 1,3/1,6-glucan and vitamin C groups and the evidence illustrated that combination of beta 1,3/1,6-glucan and vitamin C presented an additive effect on inducing the nonspecific immune responses of white shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.

Characterization of a Thermo-Inducible Chlorophyll-Deficient Mutant in Barley

Directory of Open Access Journals (Sweden)

Rong Wang

2017-11-01

Full Text Available Leaf color is an important trait for not only controlling crop yield but also monitoring plant status under temperature stress. In this study, a thermo-inducible chlorophyll-deficient mutant, named V-V-Y, was identified from a gamma-radiated population of the barley variety Vlamingh. The leaves of the mutant were green under normal growing temperature but turned yellowish under high temperature in the glasshouse experiment. The ratio of chlorophyll a and chlorophyll b in the mutant declined much faster in the first 7–9 days under heat treatment. The leaves of V-V-Y turned yellowish but took longer to senesce under heat stress in the field experiment. Genetic analysis indicated that a single nuclear gene controlled the mutant trait. The mutant gene (vvy was mapped to the long arm of chromosome 4H between SNP markers 1_0269 and 1_1531 with a genetic distance of 2.2 cM and a physical interval of 9.85 Mb. A QTL for grain yield was mapped to the same interval and explained 10.4% of the yield variation with a LOD score of 4. This QTL is coincident with the vvy gene interval that is responsible for the thermo-inducible chlorophyll-deficient trait. Fine mapping, based on the barley reference genome sequence, further narrowed the vvy gene to a physical interval of 0.428 Mb with 11 annotated genes. This is the first report of fine mapping a thermo-inducible chlorophyll-deficient gene in barley.

Radiation induced early maturing mutants in barley

International Nuclear Information System (INIS)

Kumar, R.; Chauhan, S.V.S.; Sharma, R.P.

1978-01-01

In M 2 generation, two early maturing plants were screened from a single spike progeny of a plant obtained from 20 kR of gamma-ray irradiation of a six-rowed barley (Hordeum vulgare L. var. Jyoti). Their true breeding nature was confirmed in M 3 generation. These mutants flower and mature 38 and 22 days earlier than those of control. (auth.)

Effects of in vitro fermentation of barley β-glucan and sugar beet pectin using human fecal inocula on cytokine expression by dendritic cells

NARCIS (Netherlands)

Rosch, Christiane; Taverne, Nico; Venema, Koen; Gruppen, Harry; Wells, Jerry M.; Schols, Henk A.

2017-01-01

Scope: This study simulates the fermentation process of barley β-glucan and sugar beet pectin in the human colon and monitors the degradation products formed. Additionally, immune effects of the degradation products were investigated. Methods and results: Immunostimulatory activity of

High plasma concentration of beta-D-glucan after administration of sizofiran for cervical cancer

Directory of Open Access Journals (Sweden)

Hirokazu Tokuyasu

2010-09-01

Full Text Available Hirokazu Tokuyasu1, Kenichi Takeda1, Yuji Kawasaki1, Yasuto Sakaguchi2, Noritaka Isowa2, Eiji Shimizu3, Yasuto Ueda31Divisions of Respiratory Medicine, 2Thoracic Surgery, Matsue Red Cross Hospital, 200 Horomachi, Matsue, Shimane; 3Division of Medical Oncology and Molecular Respirology, Department of Multidisciplinary Internal Medicine, Faculty of Medicine, Tottori University, Yonago, JapanAbstract: A 69-year-old woman with a history of cervical cancer was admitted to our hospital for further investigation of abnormal shadows on her chest roentgenogram. Histologic examination of transbronchial lung biopsy specimens revealed epithelioid cell granuloma, and Mycobacterium intracellulare was detected in the bronchial lavage fluid. The plasma level of (1→3-beta-D-glucan was very high, and this elevated level was attributed to administration of sizofiran for treatment of cervical cancer 18 years previously. Therefore, in patients with cervical cancer, it is important to confirm whether or not sizofiran has been administered before measuring (1→3-beta-D-glucan levels.Keywords: (1→3-beta-D-glucan, cervical cancer, Mycobacterium intracellulare, sizofiran

A root hairless barley mutant for elucidating genetic of root hairs and phosphorus uptake (Correction in v. 242, 2002, p. 299)

DEFF Research Database (Denmark)

Gahoonia, T.S.; Nielsen, N.E.; Priyavadan, A.J.

2001-01-01

This paper reports a new barley mutant missing root hairs. The mutant was spontaneously discovered among the population of wild type (Pallas, a spring barley cultivar), producing normal, 0.8 mm long root hairs. We have called the mutant bald root barley (brb). Root anatomical studies confirmed...

Oral beta-glucan adjuvant therapy converts nonprotective Th2 response to protective Th1 cell-mediated immune response in mammary tumor-bearing mice.

Directory of Open Access Journals (Sweden)

Gordon D Ross

2007-06-01

Full Text Available Beta (1-3-D-glucans were identified almost 40 years ago as biological response modifiers that stimulated tumor rejection. In vitro studies have shown that beta-glucans bind to a lectin domain within complement receptor type 3 (CR3, or to, more recently described dectin-1 a beta-glucan specific receptor, acting mainly on phagocytic cells. In this study, we assessed the intracellular cytokine profiles of peripheral blood lymphocytes from mice bearing mammary tumors receiving i.v. anti-tumor mAbs combined or not with whole glucan particle suspension given orally (WGP, 400 microg every 24 hours. The proportions of T cells producing IL-4 and IFNgamma were determined by flow cytometry. The proportion of T cells producing IL-4 was significantly higher in tumor-bearing mice not receiving beta-glucan-enhanced therapy. Conversely, T cells from mice undergoing beta-glucan-enhanced therapy showed increased production of the Th1 cytokine IFNgamma. The switch from a Th2 to a Th1 response after WGP therapy was possibly mediated by intestinal mucosal macrophages releasing IL-12.

Differential disease resistance response in the barley necrotic mutant nec1

Directory of Open Access Journals (Sweden)

Kunga Laura

2011-04-01

Full Text Available Abstract Background Although ion fluxes are considered to be an integral part of signal transduction during responses to pathogens, only a few ion channels are known to participate in the plant response to infection. CNGC4 is a disease resistance-related cyclic nucleotide-gated ion channel. Arabidopsis thaliana CNGC4 mutants hlm1 and dnd2 display an impaired hypersensitive response (HR, retarded growth, a constitutively active salicylic acid (SA-mediated pathogenesis-related response and elevated resistance against bacterial pathogens. Barley CNGC4 shares 67% aa identity with AtCNGC4. The barley mutant nec1 comprising of a frame-shift mutation of CNGC4 displays a necrotic phenotype and constitutively over-expresses PR-1, yet it is not known what effect the nec1 mutation has on barley resistance against different types of pathogens. Results nec1 mutant accumulated high amount of SA and hydrogen peroxide compared to parental cv. Parkland. Experiments investigating nec1 disease resistance demonstrated positive effect of nec1 mutation on non-host resistance against Pseudomonas syringae pv. tomato (Pst at high inoculum density, whereas at normal Pst inoculum concentration nec1 resistance did not differ from wt. In contrast to augmented P. syringae resistance, penetration resistance against biotrophic fungus Blumeria graminis f. sp. hordei (Bgh, the causal agent of powdery mildew, was not altered in nec1. The nec1 mutant significantly over-expressed race non-specific Bgh resistance-related genes BI-1 and MLO. Induction of BI-1 and MLO suggested putative involvement of nec1 in race non-specific Bgh resistance, therefore the effect of nec1on mlo-5-mediated Bgh resistance was assessed. The nec1/mlo-5 double mutant was as resistant to Bgh as Nec1/mlo-5 plants, suggesting that nec1 did not impair mlo-5 race non-specific Bgh resistance. Conclusions Together, the results suggest that nec1 mutation alters activation of systemic acquired resistance

Prowashonupana barley dietary fibre reduces body fat and increases insulin sensitivity in Caenorhabditis elegans model

Science.gov (United States)

Gao, Chenfei; King, Michael L.; Fitzpatrick, Zachary L.; Wei, Wenqian; King, Jason F.; Wang, Mingming; Greenway, Frank L.; Finley, John W.; Burton, Jeffrey H.; Johnson, William D.; Keenan, Michael J.; Enright, Frederick M.; Martin, Roy J.; Zheng, Jolene

2016-01-01

Prowashonupana barley (PWB) is high in β-glucan with moderate content of resistant starch. PWB reduced intestinal fat deposition (IFD) in wild type Caenorhabditis elegans (C. elegans, N2), and in sir-2.1 or daf-16 null mutants, and sustained a surrogate marker of lifespan, pharyngeal pumping rate (PPR), in N2, sir-2.1, daf-16, or daf-16/daf-2 mutants. Hyperglycaemia (2% glucose) reversed or reduced the PWB effect on IFD in N2 or daf-16/daf-2 mutants with a sustained PPR. mRNA expression of cpt-1, cpt-2, ckr-1, and gcy-8 were dose-dependently reduced in N2 or daf-16 mutants, elevated in daf-16/daf-2 mutants with reduction in cpt-1, and unchanged in sir-2.1 mutants. mRNA expressions were increased by hyperglycaemia in N2 or daf-16/daf-2 mutants, while reduced in sir-2.1 or daf-16 mutants. The effects of PWB in the C. elegans model appeared to be primarily mediated via sir-2.1, daf-16, and daf-16/daf-2. These data suggest that PWB and β-glucans may benefit hyperglycaemia-impaired lipid metabolism. PMID:27721901

Evaluation of the ability of barley genotypes containing different amounts of ß-glucan to alter growth and disease resistance of rainbow trout Oncorhynchus mykiss.

Science.gov (United States)

A feeding trial was performed to screen three barley genotypes containing different levels of '-glucan for their ability to influence growth, immune function, and disease resistance of rainbow trout. Three experimental diets were prepared by substituting each of three barely genotypes containing dif...

Redox-dependent interaction between thaumatin-like protein and β-glucan influences malting quality of barley.

Science.gov (United States)

Singh, Surinder; Tripathi, Rajiv K; Lemaux, Peggy G; Buchanan, Bob B; Singh, Jaswinder

2017-07-18

Barley is the cornerstone of the malting and brewing industry. It is known that 250 quantitative trait loci (QTLs) of the grain are associated with 19 malting-quality phenotypes. However, only a few of the contributing genetic components have been identified. One of these, on chromosome 4H, contains a major malting QTL, QTL2, located near the telomeric region that accounts, respectively, for 28.9% and 37.6% of the variation in the β-glucan and extract fractions of malt. In the current study, we dissected the QTL2 region using an expression- and microsynteny-based approach. From a set of 22 expressed sequence tags expressed in seeds at the malting stage, we identified a candidate gene, TLP8 ( thaumatin-like protein 8 ), which was differentially expressed and influenced malting quality. Transcript abundance and protein profiles of TLP8 were studied in different malt and feed varieties using quantitative PCR, immunoblotting, and enzyme-linked immunosorbent assay (ELISA). The experiments demonstrated that TLP8 binds to insoluble (1, 3, 1, 4)-β-D glucan in grain extracts, thereby facilitating the removal of this undesirable polysaccharide during malting. Further, the binding of TLP8 to β-glucan was dependent on redox. These findings represent a stride forward in our understanding of the malting process and provide a foundation for future improvements in the final beer-making process.

Serine:glyoxylate aminotransferase mutant of barley

International Nuclear Information System (INIS)

Blackwell, R.; Murray, A.; Joy, K.; Lea, P.

1987-01-01

A photorespiratory mutant of barley (LaPr 85/84), deficient in both of the major peaks of serine:glyoxylate aminotransferase activity detected in the wild type, also lacks serine:pyruvate and asparagine:glyoxylate aminotransferase activities. Genetic analysis of the mutation demonstrated that these three activities are all carried on the same enzyme. The mutant, when placed in air, accumulated a large pool of serine, showed the expected rate (50%) of ammonia release during photorespiration but produced CO 2 at twice the wild type rate when it was fed [ 14 C] glyoxylate. Compared with the wild type, LaPr 85/84 exhibited abnormal transient changes in chlorophyll a fluorescence when the CO 2 concentration of the air was altered, indicating that the rates of the fluorescence quenching mechanisms were affected in vivo by the lack of this enzyme

Oat beta-glucan ameliorates insulin resistance in mice fed on high-fat and high-fructose diet

Directory of Open Access Journals (Sweden)

Jie Zheng

2013-12-01

Full Text Available Methods: This study sought to evaluate the impact of oat beta-glucan on insulin resistance in mice fed on high-fat and high-fructose diet with fructose (10%, w/v added in drinking water for 10 weeks. Results: The results showed that supplementation with oat beta-glucan could significantly reduce the insulin resistance both in low-dose (200 mg/kg−1 body weight and high-dose (500 mg/kg−1 body weight groups, but the high-dose group showed a more significant improvement in insulin resistance (P<0.01 compared with model control (MC group along with significant improvement in hepatic glycogen level, oral glucose, and insulin tolerance. Moreover, hepatic glucokinase activity was markedly enhanced both in low-dose and high-dose groups compared with that of MC group (P<0.05. Conclusion: These results suggested that supplementation of oat beta-glucan alleviated insulin resistance and the effect was dose dependent.

Exercise and Beta-Glucan Consumption (Saccharomyces cerevisiae) Improve the Metabolic Profile and Reduce the Atherogenic Index in Type 2 Diabetic Rats (HFD/STZ).

Science.gov (United States)

Andrade, Eric Francelino; Lima, Andressa Ribeiro Veiga; Nunes, Ingrid Edwiges; Orlando, Débora Ribeiro; Gondim, Paula Novato; Zangeronimo, Márcio Gilberto; Alves, Fernando Henrique Ferrari; Pereira, Luciano José

2016-12-17

Physical activity and the ingestion of dietary fiber are non-drug alternatives commonly used as adjuvants to glycemic control in diabetic individuals. Among these fibers, we can highlight beta-glucans. However, few studies have compared isolated and synergic effects of physical exercise and beta-glucan ingestion, especially in type 2 diabetic rats. Therefore, we evaluated the effects beta-glucan ( Saccharomyces cerevisiae ) consumption, associated or not to exercise, on metabolic parameters of diabetic Wistar rats. The diabetes mellitus (DM) was induced by high-fat diet (HFD) associated with a low dose of streptozotocin (STZ-35 mg/kg). Trained groups were submitted to eight weeks of exercise in aquatic environment. In the last 28 days of experiment, animals received 30 mg/kg/day of beta-glucan by gavage. Isolated use of beta-glucan decreased glucose levels in fasting, Glycated hemoglobin (HbA1c), triglycerides (TAG), total cholesterol (TC), low-density lipoprotein (LDL-C), the atherogenic index of plasma. Exercise alone also decreased blood glucose levels, HbA1c, and renal lesions. An additive effect for reducing the atherogenic index of plasma and renal lesions was observed when both treatments were combined. It was concluded that both beta-glucan and exercise improved metabolic parameters in type 2 (HFD/STZ) diabetic rats.

Gamma-radiation Mutagenesis in Genetically Unstable Barley Mutants. Pt. 1. Chlorophyll Mutations in Allelic tw Mutants and Their Revertants

International Nuclear Information System (INIS)

Vaitkuniene, V.

1995-01-01

Genotypical environment is an essential factor determining the mutability of mutants of the same type. Decreased chlorophyll mutant frequency was a common characteristic of all tested tw type (tw, tw 1 , tw 2 ) mutants induced in barley c. 'Auksiniai II'. The mutability of all the tested revertants was close to that of the initial c. 'Auksiniai II'. (author). 9 refs., 2 tabs

Studies on induced partially resistant mutants of barley against powdery mildew

International Nuclear Information System (INIS)

Roebbelen, G.; Abdel-Hafez, A.G.; Reinhold, M.; Kwon, H.J.; Neuhaus-Steinmetz, J.P.; Heun, M.

1983-01-01

After mutagenic seed treatment of three partially resistant cultivars of spring barley with EMS and NaN 3 , 45 mutants in a first and 16 in a second experiment were selected in the M 2 -M 4 generations. The screening was done alternatively under natural infection in the field or controlled infection with a single pathotype in the greenhouse. These mutants exhibited a higher resistance and a higher susceptibility, respectively, than the initial cultivars Asse, Bomi and Vada. Some mutants expressed their altered resistance behaviour particularly during certain stages of development. High-level resistance was conditioned by mutation in the ml-o locus in three cases. For several Bomi mutants pathotype specificity with and without reversed ranking was proven as well as pathotype non-specificity in comparison with the reaction of the original cultivar. In 14 cases studied the inheritance of the involved mutants was monogenic recessive. The laevigatum locus responsible for the intermediate mildew resistance of Bomi was not affected by the mutations. Detection of groups of allelic mutants showed that there are at least two regions in the barley genome in which mutations for mildew resistance can occur rather frequently. In total, the past ten years of this mutation research have given convincing evidence that the strategies of mutant screening applied have yielded promising new material both for breeding and for progress in basic understanding of host-pathogen interactions. (author)

Radiation induced desynaptic mutants in barley

International Nuclear Information System (INIS)

Srivastava, H.M.

1974-01-01

Spontaneous occurrence of asynapsis and desynapsis has been frequently reported in a number of crop plants (Beadle 1930, 1933; Beasley and Brown 1942; Li et al. 1945; Magoon et al. 1961; Miller 1963) and other angiospermic texa (Calarier 1955; Chennaveraiah and Krisnappa 1968; Ehrenberg 1949; Johnson 1941, 1944; Roy and Jha 1958). However, there are only a few reports of induced asynapsis or desynapsis (Gottschalk and Baquar 1971; Martini and Bozzini 1966). The present paper deals with the morphology and meiotic behavior of gamma-ray induced barley mutants showing high degree of desynapsis resulting in partial to complete sterility. (author)

Antitumour and immunological activity of a beta 1----3/1----6 glucan from Glomerella cingulata.

Science.gov (United States)

Gomaa, K; Kraus, J; Rosskopf, F; Röper, H; Franz, G

1992-01-01

The in vivo antitumour activity of a beta 1----3/1----6 glucan from the fungus Glomerella cingulata was investigated in vivo. The glucan exhibited a strong inhibition of tumour growth of the allogeneic Sarcoma-180 as well as the syngeneic DBA/2-MC.SC-1 fibrosarcoma with inhibition ratios up to 100%. Against the hormone sensitive Noble-Nb-R prostate carcinoma the glucan alone showed a moderate antitumour effect, whereas in combination with diethylstilbestrol an almost complete regression of the tumour could be achieved. It could be demonstrated that a highly ordered structure of the glucan is not essential for the antitumour activity. Since the glucan expressed no direct cytotoxic effects, the immunomodulating activity was investigated in vitro in order to get an indication for a possible mode of action. In the lymphocyte transformation assay the glucan at a dose of 100 micrograms/ml caused a fourfold increase in the proliferation of murine spleen lymphocytes. Moreover, the glucan stimulated the phagocytosis of zymosan by bone marrow macrophages up to 100%. However, the glucan was not able to render macrophages cytotoxic against P-815 mastocytoma cells.

Some quality attributes of low fat ice cream substituted with hulless barley flour and barley ß-glucan.

Science.gov (United States)

Abdel-Haleem, Amal M H; Awad, R A

2015-10-01

The purpose of this paper is to investigate some quality attributes of low fat ice cream (LFIC) substituted with hulless barley flour (HBF) and barley ß-glucan (BBG). The methodology included in this paper is based on adding HBF (1, 2, 3 and 4 %) as a partial substitution of skim milk powder (SMP) and BBG (0.40 %) as a complete substitution of carboxy methyl cellulose (CMC). All mixes and resultant ice cream samples were evaluated for their physicochemical properties as well as the sensory quality attributes.The results indicated that substitution of SMP with HBF significantly increased total solids (TS), fat and crude fiber, while crude protein and ash significantly decreased in ice cream mixes. BBG exhibited the same manner of control. Specific gravity was gradually increased with adding HBFand BBG in the mixes and therefore the overrun percent was significantly changed in the resultant ice cream. Adding HBF in ice cream formula led to significant decrease in acidity with higher freezing point and the product showed higher ability to meltdown. BBG treatment showed the same trend of control. Values of flow time and viscosity significantly increased with increasing HBF in the ice cream mixes, but these values significantly decreased in BBG mix. The time required to freeze ice cream mixes was decreased with increasing the ratio of HBF but, increased in BBG treatment. The substitution of SMP with 1 and 2 % HBF significantly (P ≤ 0.05) enhanced sensory attributes of ice cream samples. While, BBG treatment achieved mild score and acceptability.

Exposure to biohazards in wood dust: bacteria, fungi, endotoxins, and (1-->3)-beta-D-glucans.

Science.gov (United States)

Alwis, K U; Mandryk, J; Hocking, A D

1999-09-01

Personal exposure to fungi, bacteria, endotoxin, and (1-->3)-beta-D-glucan was determined at different woodworking sites--logging sites, sawmills, woodchipping sites, and joineries. Exposure levels to fungi at logging sites and sawmills were in the range of 10(3)-10(4) cfu/m3, at the woodchipping mill, 10(3)-10(5) cfu/m3, and at joineries, 10(2)-10(4) cfu/m3. Although mean endotoxin levels were lower than the suggested threshold value of 20 ng/m3, some personal exposures at sawmills and a joinery exceeded the standard. The geometric mean personal (1-->3)-beta-D-glucan exposure level at the woodchipping mill was 2.32 ng/m3, at sawmills, 1.37 ng/m3, at logging sites, 2.02 ng/m3, and at joineries, 0.43 ng/m3. Highly significant associations were found between mean personal inhalable endotoxin exposures and Gram-negative bacteria levels (p 3)-beta-D-glucan exposures and fungi levels (p = 0.0003). The prevalence of cough, phlegm, chronic bronchitis, nasal symptoms, frequent headaches, and eye and throat irritations was significantly higher among woodworkers than controls. Dose-response relationships were found between personal exposures and work-related symptoms among joinery workers and sawmill and chip mill workers.

Characterization of a new 4BS.7HL wheat–barley translocation line using GISH, FISH, and SSR markers and its effect on the β-glucan content of wheat

Czech Academy of Sciences Publication Activity Database

Cseh, A.; Kruppa, K.; Molnár, I.; Rakszegi, M.; Doležel, Jaroslav; Molnár-Láng, M.

2011-01-01

Roč. 54, č. 10 (2011), s. 795-804 ISSN 0831-2796 Institutional research plan: CEZ:AV0Z50380511 Keywords : wheat–barley chromosome translocation * β-d-glucan * centromere Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.653, year: 2011

Variação no conteúdo de beta-glucanas em cultivares brasileiros de aveia Beta-glucan content variation in brasilian oat cultivars

Directory of Open Access Journals (Sweden)

Roberta M. de SÁ

2000-04-01

Full Text Available Com o crescente interesse em alimentos funcionais e nutracêuticos, a aveia (Avena sativa L. tem se destacado, devido ao seu teor de fibras alimentares e principalmente às beta-glucanas. As (1,3(1,4-beta-D-glucanas, fibras alimentares na maioria solúveis, atuam na redução do colesterol em indivíduos com hipercolesterolemia. Existem estudos para determinar as causas de variação do teor desta fibra em aveia, porém, pouco se sabe sobre a aveia cultivada no Brasil. O objetivo deste trabalho foi verificar se existem diferenças no conteúdo de beta-glucanas entre cultivares brasileiros e se há variação na porcentagem desta fibra devido ao ano de cultivo. Os cultivares IAC7, UFRGS14, UPF16 e UPF17 (3 amostras de cada, e ainda três amostras do cultivar IAC7 para cada ano de cultivo (97 e 98, foram analisados segundo os métodos da AACC (American Association of Cereal Chemists. Os teores médios (peso seco de beta-glucanas foram 6,50% (IAC7, 4,30% (UFRGS14, 3,51% (UPF16 e 3,78% (UPF17, com erro padrão de ±0,084 e coeficiente de variação de 7,89 %. Observou-se efeito significativo dos cultivares (p=0,03 e grande variabilidade entre as amostras (p=0,0001. O cultivar IAC7 apresentou média de beta-glucanas de 5,11% em 97 e 6,50 % em 98 (erro padrão ±0,14; CV=10,53% e observou-se efeito significativo do ano de cultivo.With the increasing interest in functional foods and nutraceuticals, oats (Avena sativa L. have received special attention because of their dietary fiber contents, and specially of their beta-glucans. The mostly soluble dietary fibers (1,3(1,4-beta-D-glucans, reduce serum cholesterol in individuals with hypercholesterolemia. There are studies about the causes of variation in the contents of this fiber in oats, however, very little is known about Brazilian cultivars. The objective of this work was to verify if there were differences in the beta-glucan contents among brazilian cultivars and if there was variation in the

Bioethanol production using genetically modified and mutant wheat and barley straws

Energy Technology Data Exchange (ETDEWEB)

Li, Z. [Washington State Univ., Pullman, WA (US). Dept. of Biological Engineering; East China Univ. of Science and Technology, Shanghai (CN). State Key Laboratory of Bioreactor Engineering; Liu, Y. [Michigan State Univ., East Lansing, MI (US). Biosystems and Agricultural Engineering; Chen, S. [Washington State Univ., Pullman, WA (US). Dept. of Biological Systems Engineering; Zemetra, R.S. [Univ. of Idaho, Moscow, ID (US). Plant, Soil, and Entomological Sciences

2011-01-15

To improve the performance of wheat and barley straws as feedstocks for ethanol biorefining, the genetic modifications of down regulating Cinnamoyl-CoA reductase and low phytic acid mutation have been introduced into wheat and barley respectively. In this study, total 252 straw samples with different genetic background and location were collected from the field experiment based on a randomized complete block design. The fiber analysis (neutral detergent fiber, acid detergent fiber, and acid detergent lignin) indicated that there were no significant differences between modified and wild type straw lines in terms of straw compositions. However, the difference did exist among straw lines on fiber utilization. 16 straw samples were further selected to conduct diluted acid pretreatment, enzymatic hydrolysis and fermentation. The data indicated that the phytic acid mutant and transgenic straws have changed the fiber structure, which significantly influences their hydrolysibility. These results may lead to a possible solution of mutant or genetic modified plant species that is capable to increase the hydrolysibility of biomass without changing their compositions and sacrificing their agronomy performance. (author)

Synthesis of New Hyperbranched α-Glucans from Sucrose by Lactobacillus reuteri 180 Glucansucrase Mutants.

Science.gov (United States)

Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert

2016-01-20

α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088, and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were targeted for mutagenesis both jointly and separately. Analysis of the mutational effects on enzyme function revealed that all D1085 and R1088 mutants catalyzed the synthesis of hyperbranched α-glucans with 15-22% branching (α1→3,6) linkages, compared to 13% in the wild-type GTF180. In addition, besides native (α1→6) and (α1→3) linkages, all of the mutations introduced a small amount of (α1→4) linkages (5% at most) in the polysaccharides produced. We conclude that α-helix 4 residues, especially D1085 and R1088, constituting part of the +2 acceptor binding subsite, are important determinants for the linkage specificity. The new hyperbranched α-glucans provide very interesting structural diversities and may find applications in the food industry.

Inositol phosphates from barley low-phytate grain mutants analysed by metal-dye detection HPLC and NMR

DEFF Research Database (Denmark)

Hatzack, F.; Hübel, F.; Zhang, W.

2001-01-01

Inositolphosphates from barley low-phytate grain mutants and their parent variety were analysed by metal-dye detection HPLC and NMR. Compound assignment was carried out by comparison of retention times using a chemical hydrolysate of phytate [Ins(1,2,3,4,5,6)P(6)] as a reference; Co-inciding rete......Inositolphosphates from barley low-phytate grain mutants and their parent variety were analysed by metal-dye detection HPLC and NMR. Compound assignment was carried out by comparison of retention times using a chemical hydrolysate of phytate [Ins(1,2,3,4,5,6)P(6)] as a reference; Co...

Is auxin involved in the induction of genetic instability in barley homeotic double mutants?

Science.gov (United States)

Šiukšta, Raimondas; Vaitkūnienė, Virginija; Rančelis, Vytautas

2018-02-01

The triggers of genetic instability in barley homeotic double mutants are tweaky spike -type mutations associated with an auxin imbalance in separate spike phytomeres. Barley homeotic tweaky spike;Hooded (tw;Hd) double mutants are characterized by an inherited instability of spike and flower development, which is absent in the single parental constituents. The aim of the present study was to show that the trigger of genetic instability in the double mutants is the tw mutations, which are associated with an auxin imbalance in the developing spikes. Their pleiotropic effects on genes related to spike/flower development may cause the genetic instability of double mutants. The study of four double-mutant groups composed of different mutant alleles showed that the instability arose only if the mutant allele tw was a constituent of the double mutants. Application of auxin inhibitors and 2,4-dichlorophenoxyacetic acid (2,4-D) demonstrated the relationship of the instability of the double mutants and the phenotype of the tw mutants to auxin imbalance. 2,4-D induced phenocopies of the tw mutation in wild-type plants and rescued the phenotypes of three allelic tw mutants. The differential display (dd-PCR) method allowed the identification of several putative candidate genes in tw that may be responsible for the initiation of instability in the double mutants by pleiotropic variations of their expression in the tw mutant associated with auxin imbalance in the developing spikes. The results of the present study linked the genetic instability of homeotic double mutants with an auxin imbalance caused by one of the constituents (tw). The genetic instability of the double mutants in relation to auxin imbalance was studied for the first time. A matrocliny on instability expression was also observed.

Metabolic profiling of lymph from pigs fed with ß-glucan by high-resolution 1H NMR spectroscopy

DEFF Research Database (Denmark)

Larsen, Flemming Hofmann; Jørgensen, Henry Johs. Høgh; Engelsen, Søren Balling

2010-01-01

To gain information about the effect of ingesting different β-glucan sources on intestinal lymph metabolic profile, 10 growing pigs (30-36 kg) were fitted with a catheter in the jejunal lymphatic trunk, and lymph samples collected continuously -1 to 8 h postprandial and again at 24 h after feeding...... a diet containing either 0.4% added yeast or barley β-glucan and compared to a Control diet. The lymph samples were analysed by proton nuclear magnetic resonance (1H NMR) spectroscopy and subsequently subjected to chemometric analysis. The dominant resonances in the 1H NMR spectra of lymph arose...... of increased lymph viscosity induced by barley β-glucan compared to yeast β-glucan were observed...

Dietary beta-1,3 glucan potentiates innate immunity and disease resistance of Asian catfish, Clarias batrachus (L.).

Science.gov (United States)

Kumari, J; Sahoo, P K

2006-02-01

This study investigated the effects of short and prolonged administration of a yeast beta-glucan on non-specific immune parameters, growth rate and the disease resistance of Asian catfish, Clarias batrachus. Fish fed with a basal diet (control) and test diet (basal diet supplemented with 0.1% glucan) for 1, 2 and 3 weeks were assayed for superoxide production, serum myeloperoxidase (MPO) content, natural haemagglutinin level, complement and lysozyme activities. Fish were weighed at weekly intervals and specific growth rate (SGR, % increase in body weight per day) was determined. After each week, fish were challenged with Aeromonas hydrophila to measure the level of protection. Results showed that glucan administration at 0.1% in feed, significantly (Pcomplement activity and SGR were not affected by the dietary supplementation of yeast glucan. As glucan feeding at 0.1% for 1 week is able to enhance the non-specific immunity and disease resistance of catfish efficiently, short-term feeding might be used in farmed catfish diets to enhance disease resistance.

Isolation and characterization of beta-glucan synthase: A potential biochemical regulator of gravistimulated differential cell wall loosening

Science.gov (United States)

Kuzmanoff, K. M.

1984-01-01

In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.

Progress in the evaluation, use in breeding, and genetic analysis of semi-dwarf mutants of barley

International Nuclear Information System (INIS)

Ullrich, S.E.; Muir, C.E.; Washington State Univ., Pullman

1984-01-01

Breeding for reduced height in barley (Hordeum vulgare L.) to primarily reduce lodging susceptibility is ongoing in the Washington State University barley breeding program. Two semi-dwarf winter and spring cultivars have been released and a number of advanced lines are being considered for release. Several semi-dwarf sources are utilized, including those from induced mutants in 'Jotun', 'Piroline' and 'Valticky'. In addition, over 200 putative mutants have been selected in the past four years from M 2 sodium azide-treated populations of local cultivars and advanced lines. These are evaluated in the pedigree breeding program and some have been incorporated into male sterile facilitated recurrent selection populations developed for reduced height. The inheritance of dwarfism in one mutant in the cultivar 'Advance' was determined to be controlled by a single recessive gene. (author)

Research on mutant barley population under biotic and abiotic stress condition

International Nuclear Information System (INIS)

Peskircioglu, H.; Tuyluer, I.; Sagel, Z.; Kunter, B.; Kantoglu, Y.

2009-01-01

Barley is one of the most important cereal with 8,5 million tons production, 3,5 million hectares of sowing area in Turkey which is also one of the gene centres of barley. Barley is grown in every regions of Turkey where climatic conditions are available for the crop. But barley is the predominant crop in the driest land areas throughout the Anatolian plateau. Winters on that plateau are especially severe. Summers are hot and dry with temperatures above 30 degree C. Annual precipitation averages about 300 to 400 millimeters and rains mainly in winter. Because of all of these prerequisite conditions, winter barley dominates in Turkey, which indirectly refers to water economy. According to the above mentioned reasons the objectives of this investigation were: 1) Improvement of drought resistance, loading resistance and high yielding barley varieties by mutation breeding in Central Anatolian Region. 2) Determination and selection of abiotic stress such as salt resistance In our barley mutation breeding programme under Central Anatolian conditions well adapted Tokak 157/37 variety has been used. We applied 250 Gy-300 Gy gamma ray doses . Selection began at M 2 generation. Agronomical characters including earliness, straw length, lodging resistance and disease resistance are monitored in the field and greenhouse. Mutant lines have been tested for salt resistance in the hydrophonic culture which contains 180 mMol and 220 mMol NaCl concentrations. Preliminary yield trial and advanced yield trial are started after M 4 generations. In M 6 generation, we had some desirable lines those are 25-30 days earlier than its parents, so these lines escape from drought period. Some lines that have grown in the hydrophonic cultures, contains 180mMol NaCl still surviving.

BIOCHEMICAL COMPOSITION AND NUTRITIONAL EVALUATION OF BARLEY RIHANE (HORDEUM VULGARE L.).

Science.gov (United States)

Lahouar, Lamia; Ghrairi, Fatma; El Arem, Amira; Medimagh, Sana; El Felah, Mouledi; Salem, Hichem Ben; Achour, Lotfi

2017-01-01

Many experimental studies have suggested an important role for barley Rihane(BR)in the prevention of colon cancer and cardiovascular diseases. The objective of this study was to evaluate the physico-chemical properties and nutritional characterizations of BR compared to other varieties grown in Tunisia (Manel, Roho and Tej). Total, insoluble and soluble dietary fiber(β-glucan), total protein, ash and some minerals of BR and Tunisian barley varieties were determined. The results revealed that BR is good source of dietary fiber mainly β-glucan compared to the other varieties. This variety is a relatively rich source of phosphorous and potassium and it contains many important unsaturated fatty acids. BR has higher nutritional value than other varieties. Barley Rihane has significant nutritional characterizations compared to others Tunisian barleys varieties. Abbreviations: BR, Barley Rihane; LDL, low density lipoprotein; HDL, high density lipoprotein; AOM, azoxymethane; TBV, Tunisian barley varieties; TGW, thousand grain weight; SW, weight specific; TDF, total dietary fiber; IDF, insoluble dietary fiber; SDF, soluble dietary fiber; DM, Dry Matter.

Beta Glucan Production from Two Strains of Agrobacterium sp in Medium Containing of Molases and Uracil Combine

Directory of Open Access Journals (Sweden)

KUSMIATI

2007-04-01

Full Text Available Production of β-glucan by Agrobacterium sp is influenced by the composition of nutrition in the fermentation media. Molases has been used successfully by others in the fermentation media of S. cerevisiae to increase the yield of -glucan, and similarly, uracil has been used in the fermentation media of Agrobacterium sp to increase the yield of -glucan. Investigations to increase the yield of -glucan by two strains of Agrobacterium sp, i.e. A1.5 (reference and B4.4 (local strain, have been carried out by addition of various combination of molases and uracil into fermentation media, i.e. 5%(v/v molase-0,05%(b/v uracil; 5% molase-0,025% uracil; 10% molase-0,05% uracil; and 10% molase-0,025% uracil. The β-1,3-glucan and β-1,2-glucan fractions were separated by extraction method. Beta-glucan concentration was determined as the glucose monomer using the phenol-sulphate spectrophotometric method at 490 nm. The protein content was determined by a modified Lowry-spectrophotometric method at 750 nm. The results showed that all combination of molases and uracil in the fermentation media of Agrobacterium sp A1.5 and B4.4 strains have increased both the dry-weight yield of β-glucan (crude and the β¬glucan content, with the highest was in a medium containing 10% molases-0,025% uracil combination. In the above medium, the A1.5 strain produced the highest β-glucan (7,5% with the lowest protein content ( 8,4% in the β-1,3-glucan fraction, while the β-glucan content in the β-1,2-glucan fraction were all lower than in the control media, while the protein content were all higher than in the control media. In the above media, the B4.4 strain produced the highest β-glucan, 7,2% in the β-1,3-glucan fraction, and 13,1% in β-1,2-glucan fraction, while the lowest protein content ( 8,4% was in the β-1,3-glucan fraction. In conclusion, fermentation media of Agrobacterium sp A1.5 strain or B4.4 strain containing molase and uracil combination have increased both

Two secondary carbohydrate binding sites on the surface of barley alpha-amylase 1 have distinct functions and display synergy in hydrolysis of starch granules.

Science.gov (United States)

Nielsen, Morten M; Bozonnet, Sophie; Seo, Eun-Seong; Mótyán, János A; Andersen, Joakim M; Dilokpimol, Adiphol; Abou Hachem, Maher; Gyémánt, Gyöngyi; Naested, Henrik; Kandra, Lili; Sigurskjold, Bent W; Svensson, Birte

2009-08-18

Some polysaccharide processing enzymes possess secondary carbohydrate binding sites situated on the surface far from the active site. In barley alpha-amylase 1 (AMY1), two such sites, SBS1 and SBS2, are found on the catalytic (beta/alpha)(8)-barrel and the noncatalytic C-terminal domain, respectively. Site-directed mutagenesis of Trp(278) and Trp(279), stacking onto adjacent ligand glucosyl residues at SBS1, and of Tyr(380) and His(395), making numerous ligand contacts at SBS2, suggested that SBS1 and SBS2 act synergistically in degradation of starch granules. While SBS1 makes the major contribution to binding and hydrolysis of starch granules, SBS2 exhibits a higher affinity for the starch mimic beta-cyclodextrin. Compared to that of wild-type AMY1, the K(d) of starch granule binding by the SBS1 W278A, W279A, and W278A/W279A mutants thus increased 15-35 times; furthermore, the k(cat)/K(m) of W278A/W279A was 2%, whereas both affinity and activity for Y380A at SBS2 were 10% of the wild-type values. Dual site double and triple SBS1/SBS2 substitutions eliminated binding to starch granules, and the k(cat)/K(m) of W278A/W279A/Y380A AMY1 was only 0.4% of the wild-type value. Surface plasmon resonance analysis of mutants showed that beta-cyclodextrin binds to SBS2 and SBS1 with K(d,1) and K(d,2) values of 0.07 and 1.40 mM, respectively. A model that accounts for the observed synergy in starch hydrolysis, where SBS1 and SBS2 bind ordered and free alpha-glucan chains, respectively, thus targeting the enzyme to single alpha-glucan chains accessible for hydrolysis, is proposed. SBS1 and SBS2 also influence the kinetics of hydrolysis for amylose and maltooligosaccharides, the degree of multiple attack on amylose, and subsite binding energies.

Variation of root system characters in collection of semi-dwarf spring barley mutants

International Nuclear Information System (INIS)

Nawrot, M.; Zbieszczyk, J.; Maluszynski, M.

2000-01-01

The collection of 371 semi-dwarf mutants, derived from 12 spring barley varieties has been used as material for analysis of root system. The mutants have been obtained after mutagenic treatment with N-methyl-N-nitroso urea (MNH), sodium azide (NaN3), gamma-rays and fast neutrons. The following analysis of root system were performed: seminal root growth of 8-day old seedlings, seminal and adventitious root growth of 6-week old plants and dynamics of root growth during first 6 weeks of plant growth. Seminal root length, root number and the length of the first leaf in barley mutants were investigated with the use of paper rollers. Root system analysis of 6-week old plants was performed on genotypes grown in PVC tubes filled with sand, supplemented with 1 mineral salts of MS medium. The following measurements were made: the length of the longest seminal root and the longest adventitious root, the number of adventitious roots and the number of tillers. Analysis of dynamics of root growth during the first six weeks of vegetation was performed at the end of each 7-day growth period in the PVC tubes filled with sand. Great variability in the seminal root length was found in analysed 8-day old seedling population. Almost half of the analysed mutants showed significant root length reduction, but about ten percent of semi-dwarf mutants developed roots with an increased length in comparison to parents. No significant differences were found between analysed mutants and corresponding parent varieties regarding the number of seminal roots. After six weeks of growth, the selected mutants showed differences in the reduction of root length in comparison to the 8-day old seedlings. The results of root growth dynamics indicated that analysed mutants had different patterns in comparison to the parent variety. Differences in the growth dynamics were also observed among the parent varieties. The observed differences in pattern of root growth between mutants and corresponding parents

Review of human studies investigating the post-prandial blood-glucose lowering ability of oat and barley food products.

Science.gov (United States)

Tosh, S M

2013-04-01

Oat and barley foods have been shown to reduce human glycaemic response, compared to similar wheat foods or a glucose control. The strength of the evidence supporting the hypothesis that the soluble fibre, mixed linkage β-glucan, reduces glycaemic response was evaluated. A search of the literature was conducted to find clinical trials with acute glycaemic response as an end point using oat or barley products. Of the 76 human studies identified, 34 met the inclusion and exclusion criteria. Dose response and ratio of β-glucan to available carbohydrate as predictors of glycaemic response were assessed. Meals provided 0.3-12.1 g oat or barley β-glucan, and reduced glycaemic response by an average of 48 ± 33 mmol · min/l compared to a suitable control. Regression analysis on 119 treatments indicated that change in glycaemic response (expressed as incremental area under the post-prandial blood-glucose curve) was greater for intact grains than for processed foods. For processed foods, glycaemic response was more strongly related to the β-glucan dose alone (r(2)=0.48, Pfoods containing 4 g of β-glucan, the linear model predicted a decrease in glycaemic response of 27 ± 3 mmol · min/l, and 76% of treatments significantly reduced glycaemic response. Thus, intact grains as well as a variety of processed oat and barley foods containing at least 4 g of β-glucan and 30-80 g available carbohydrate can significantly reduce post-prandial blood glucose.

Gamma-radiation Mutagenesis in Genetically Unstable Barley Mutants. Pt. 3. Effects of Aging in Various Genotypes

International Nuclear Information System (INIS)

Balchiuniene, L.

1995-01-01

Gamma-irradiation effect was tested on the grain material of normal-initial barley c. 'Auksiniai II' and allelic mutants tw 1 and tw 2 . Dependence of the aging effects on genotype was obvious, especially in survival test. Differences were observed even on allelic mutants. These observations are important for the preservation strategy of plant genetical resources. (author). 11 refs., 3 tabs

Structural analysis of bioengineered alpha-D-glucan produced by a triple mutant of the glucansucrase GTF180 enzyme from Lactobacillus reuteri strain 180 : Generation of (alpha 1 -> 4) linkages in a native (1 -> 3)(1 -> 6)-alpha-D-glucan

NARCIS (Netherlands)

van Leeuwen, Sander S.; Kralj, Slavko; Gerwig, Gerrit J.; Dijkhuizen, Lubbert; Kamerling, Johannis P.

Site-directed mutagenesis of the glucansucrase gtf180 gene from Lactobacillus reuteri strain 180 was used to transform the active site region. The alpha-D-glucan (mEPS-PNNS) produced by the triple mutant V1027P:S1137N: A1139S differed in structure from that of the wild-type alpha-D-glucan (EPS180).

Cell size and cell number in dwarf mutants of barley (Hordeum vulgare)

International Nuclear Information System (INIS)

Blonstein, A.D.; Gale, M.D.

1984-01-01

Sixteen height mutants, induced by sodium azide treatment of the two-rowed barley variety Proctor, have been used to investigate the relationship between the extent and nature of stem shortening with alterations in cell size and cell number, and the pleiotropic effects of dwarfing genes on vegetative development and agronomic performance. The studies on epidermal cell number and cell length in the developmentally earliest and latest elongated vegetative tissues - the coleoptile and peduncle resprectively - suggest that cell number may be the primary determinant of plant height. One semi-prostrate and one erectoides mutant are used to illustrate different cell number/cell size strategies and their relationships with gibberellin sensitivity, growth rate and lodging resistance are discussed. (author)

Highly productive mutant genotypes in barley - direct use in practice and in successive recombination

International Nuclear Information System (INIS)

Gustafsson, Aa.; Lundqvist, U.

1984-01-01

Three special cases of induced mutations in barley are discussed in this paper. They are denoted here as the Gunilla, the Pallas and the Mari cases, after the three named varieties to which the original mutants gave rise. The original mutants described represent just a small sample of the induced mutants, many of which have been tested in practice and have been further studied in basic genetics and evolutionary research. The three approved varieties have given rise to further recombination families, which also to some extent have been fused. Two of the mutant cases - Pallas and Mari - were directly useful in practice and officially approved. The third case involved a mutant of special appearance - a ''bushy type'' with an intense blue wax coating and with a supreme lodging resistance. The mutant was used in developing the Gunilla variety, which arose by recombination breeding. This variety has been highly satisfactory in further gene recombination work. A similar situation has prevailed with regard to the Pallas and Mari families arising after gene recombination, too. Up to now, the Gunilla, Pallas and Mari families include a long series of released and officially approved varieties. Several of them represent valuable agricultural contributions with wide areas of cultivation. These three mutants - with their recombination families - led to greatly increased straw stiffness and high grain production. Their phenotypic expression often corresponds to a dwarf or semidwarf description. One of the mutants - the Mari genotype - represents a group of genes and alleles which give rise to profound changes in the photoperiod (and partially also in the thermoperiod) behaviour. In fact, often even such small changes have a fundamental influence on adaptation and distribution. Data are presented analysing the property of lodging resistance with the background of plant, tiller and internode structure. A method of partial back-mutation was worked out in separating traits generally

A Multifunctional Bread Rich in Beta Glucans and Low in Starch Improves Metabolic Control in Type 2 Diabetes: A Controlled Trial.

Science.gov (United States)

Tessari, Paolo; Lante, Anna

2017-03-17

Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed 'functional' bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods : Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values ( p = 0.028), and by ~0.6% vs. the control group ( p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes.

A Multifunctional Bread Rich in Beta Glucans and Low in Starch Improves Metabolic Control in Type 2 Diabetes: A Controlled Trial

Science.gov (United States)

Tessari, Paolo; Lante, Anna

2017-01-01

Design: Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed ‘functional’ bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods: Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Results: Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values (p = 0.028), and by ~0.6% vs. the control group (p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. Conclusions: A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes. PMID:28304350

Respiratory health in children, and indoor exposure to (1,3)-beta-D-glucan, EPS mould components and endotoxin

NARCIS (Netherlands)

Tischer, C.; Gehring, U.; Chen, C-M; Kerkhof, M.; Koppelman, G.; Sausenthaler, S.; Herbarth, O.; Schaaf, B.; Lehmann, I.; Kraemer, U.; Berdel, D.; von Berg, A.; Bauer, C. P.; Koletzko, S.; Wichmann, H-E; Brunekreef, B.; Heinrich, J.

For a long time, exposure to mould and dampness-derived microbial components was considered a risk factor for the development of respiratory diseases and symptoms. Some recent studies suggested that early childhood exposure to mould components, such as (1,3)-beta-D-glucan and extracellular

Transcriptome Comparative Profiling of Barley eibi1 Mutant Reveals Pleiotropic Effects of HvABCG31 Gene on Cuticle Biogenesis and Stress Responsive Pathways

Directory of Open Access Journals (Sweden)

Eviatar Nevo

2013-10-01

Full Text Available Wild barley eibi1 mutant with HvABCG31 gene mutation has low capacity to retain leaf water, a phenotype associated with reduced cutin deposition and a thin cuticle. To better understand how such a mutant plant survives, we performed a genome-wide gene expression analysis. The leaf transcriptomes between the near-isogenic lines eibi1 and the wild type were compared using the 22-k Barley1 Affymetrix microarray. We found that the pleiotropic effect of the single gene HvABCG31 mutation was linked to the co-regulation of metabolic processes and stress-related system. The cuticle development involved cytochrome P450 family members and fatty acid metabolism pathways were significantly up-regulated by the HvABCG31 mutation, which might be anticipated to reduce the levels of cutin monomers or wax and display conspicuous cuticle defects. The candidate genes for responses to stress were induced by eibi1 mutant through activating the jasmonate pathway. The down-regulation of co-expressed enzyme genes responsible for DNA methylation and histone deacetylation also suggested that HvABCG31 mutation may affect the epigenetic regulation for barley development. Comparison of transcriptomic profiling of barley under biotic and abiotic stresses revealed that the functions of HvABCG31 gene to high-water loss rate might be different from other osmotic stresses of gene mutations in barley. The transcriptional profiling of the HvABCG31 mutation provided candidate genes for further investigation of the physiological and developmental changes caused by the mutant.

Structural investigations of glucans from cultures of Glomerella cingulata Spaulding & von Schrenck.

Science.gov (United States)

Gomaa, K; Kraus, J; Franz, G; Röper, H

1991-09-18

Methylation analysis, enzymic digestion, n.m.r. spectroscopy, and Smith degradation showed that the major extracellular polysaccharide, isolated from cultures of the fungus Glomerella cingulata, was a (1----3)-beta-D-glucan with side chains of 1-4 (1----3)-linked beta-D-glucose residues attached to position 6. A (1----6)-beta-D-glucan was produced by the fungus in small proportions. Treatment of the (1----3,1----6)-beta-D-glucan (890,315) with greater than 0.05M NaOH at greater than 150 degrees, or Me2SO-H2O with a concentration of dimethyl sulfoxide of greater than 80%, irreversibly destroyed the highly ordered structure responsible for the high viscosity of aqueous solutions. The strong shift of the lambda max of aqueous solutions of Congo Red by the degraded glucan, the fact that the mol. wt. of the original glucan was approximately 4 times higher than that of the degraded polymer, and the suppression of the n.m.r. signals for C-3 indicated that the original glucan had a highly ordered structure, probably built up from single helices.

Diagnostic potential of nested PCR, galactomannan EIA, and beta-D-glucan for invasive aspergillosis in pediatric patients.

Science.gov (United States)

Badiee, Parisa; Alborzi, Abdolvahab; Karimi, Mahammad; Pourabbas, Bahman; Haddadi, Pedram; Mardaneh, Jalal; Moieni, Mahsa

2012-04-13

Limited specific data and investigations are available for invasive aspergillosis (IA) in pediatric patients. We evaluated the diagnostic potential of three noninvasive tests including the Platelia Aspergillus EIA kit for using galactomannan antigen, (1,3)-β-D-glucan Detection Reagent Kit, and nested-PCR for Aspergillus DNA in sera. We evaluated the diagnostic potential of three noninvasive tests including EIA for galactomannan antigen  (Platelia Aspergillus), nested  PCR assay for Aspergillus DNA and test for (1→3)-β-D-glucan (Glucatell assay Kit). All pediatric patients treated at the hematology/oncology unit who were at increased risk of developing invasive aspergillosis were enrolled. Clinical samples were examined for Aspergillus infections by mycological methods. Serial blood samples were collected twice weekly and evaluated by noninvasive tests. We analyzed 230 consecutive blood samples from 62 pediatric patients. The incidence rate of invasive aspergillosis in the patients was found to be 27.4%, and the etiologic agents were Aspergillus flavus, Aspergillus fumigatus, and Aspergillus spp.  The sensitivity, specificity, positive and negative predictive values, and likelihood ratios for positive and negative results of galactomannan in patients with proven and probable IA were 90%, 92%, 81.8%, 96%, 11.25, and 0.1; for beta-D-glucan they were 50%, 46%, 26%, 70.6%, 0.9, 0.9; and for nested-PCR they were 80%, 96.2%, 88.9%, 92.6%, 21, and 0.2, respectively. The conventional methods are not able to detect IA, due to the lack of valid and proper sampling. Galactomannan and nested-PCR tests in serum, with enough accuracy and reliability, can serve as noninvasive methods for the detection of IA in pediatric patients. However, the beta-D-glucan test cannot serve as an efficient diagnostic tool in those with hematologic disorders. 

Post radiation protection and enhancement of DNA repair of beta glucan isolated from Ganoderma lucidum

International Nuclear Information System (INIS)

Pillai, Thulasi G.; Nair, C.K.K.; Uma Devi, P.

2013-01-01

Ganoderma lucidum (Fr) P. Karst, commonly known as Reishi in Japan and Ling Zhi in China, is well known for its medicinal properties. G. lucidum contains a number of components among which the polysaccharides, particularly beta-glucan, and triterpenoids are the major active components. Radioprotective effect of a beta glucan (BG) isolated from the mushroom G. lucidum against radiation induced damage was investigated taking mouse survival and chromosomal aberrations as end points. DNA repair enhancing property of BG was determined by comet assay in human peripheral blood leucocytes. Young Swiss albino mice were exposed to whole body γ-irradiation. For mouse survival study, BG was administered orally 5 min after 8 Gy radiation exposures and at 4 Gy exposure for chromosomal aberrations. BG at 500 ug/kg body wt produced 66% mouse survival at 30 days given post irradiation. In chromosomal aberrations significant reduction in number of aberrant cells and different types of aberrations was observed in BG administered group compared to RT along treated group. For DNA repair, the comet parameters were studied at 2 Gy γ-irradiation with 15 min intervals. The comet parameters were reduced to normal levels after 120 min of exposure. The DNA repairing ability of BG contributes to the post radio protective effect of BG. (author)

Starch and Free Sugars during Kernel Development of Bomi Barley and its High-Lysine Mutant 1508

DEFF Research Database (Denmark)

Kreis, Michael

1978-01-01

At maturity the high-lysine barley (Hordeum vulgare L.) Ris0 mutants 1508, 527 and 29 kernels contained about 20% less starch and twice as much free sugars as the parent varieties Bomi and Carlsberg II. An enhanched effect on starch reduction and free sugar accumulation was observed during kernel...

In vitro incorporation of 14C-hexose-6-phosphat in mannan, β-glucan and glycogen of Candida spec. H and their mutants

International Nuclear Information System (INIS)

Roeber, B.; Reuter, G.

1982-01-01

Mannose-6-P is an activator of 14 C-mannose incorporation from GDP- 14 C-mannose in mono- and oligosaccharides and in mannopolymers of the cell wall proteophosphomannan produced by the food protein yeast Candida spec. H. Moreover, mannose-6-P is a precursor of proteophosphomannan: 14 C-mannose-6-P has been incorporated in absence of GTP. Corresponding behavior shows glucose-6-P by synthesis of β-glucan and glycogen. Mutants of Candida spec. H with different efficiency in the biosynthesis of mannan, β-glucan and glycogen incorporate hexose-6-P in a different extent. (author)

Functional and structural characterization of plastidic starch phosphorylase during barley endosperm development

DEFF Research Database (Denmark)

Cuesta-Seijo, Jose A.; Ruzanski, Christian; Krucewicz, Katarzyna

2017-01-01

The production of starch is essential for human nutrition and represents a major metabolic flux in the biosphere. The biosynthesis of starch in storage organs like barley endosperm operates via two main pathways using different substrates: starch synthases use ADP-glucose to produce amylose......,4-glucans using HvPho1 from G1P as the sole substrate. The structural properties of HvPho1 provide insights into the low affinity of HvPho1 for large polysaccharides like starch or amylopectin. Our results suggest that HvPho1 may play a role during the initiation of starch biosynthesis in barley....... and amylopectin, the two major components of starch, whereas starch phosphorylase (Pho1) uses glucose-1-phosphate (G1P), a precursor for ADP-glucose production, to produce α-1,4 glucans. The significance of the Pho1 pathway in starch biosynthesis has remained unclear. To elucidate the importance of barley Pho1...

Determinação da concentração de beta-glucano em cogumelo Agaricus blazei Murill por método enzimático Determination of beta-glucan concentration in Agaricus blazei Murill mushroom by enzymatic method

Directory of Open Access Journals (Sweden)

Yong K. Park

2003-12-01

Full Text Available Cogumelos comestíveis contêm importantes propriedades funcionais. Em particular, beta-glucanos, homo- e hetero-glucanos com ligações glicosídicas beta(1->3, beta(1->4 e beta(1->6, supostamente responsáveis por algumas propriedades benéficas à saúde humana, como atividade imunomodulatória, antioxidante, antiinflamatória e anticancerígena. Neste trabalho, a quantidade de beta-glucano presente em cogumelo Agaricus blazei Murill, coletados de três diferentes locais, foi analisada utilizando-se método enzimático. As amostras (em base seca foram tratadas com alfa-amilase, protease bacteriana e com glicoamilase fúngica. beta-glucano foi quantificado após hidrólise ácida e determinação da glicose liberada. Foi verificado que amostras de A. blazei Murill cultivadas em estufas apresentaram menor concentração de b-glucano (8,4±0,9 e 7,6±2,8g/100g quando comparado com amostras cultivadas em campo aberto (10,1±2,1g/100g. Observou-se ainda que, mesmo sendo cultivado em condições semelhantes, porém em locais diferentes, as amostras apresentaram diferenças significativas (7,6±2,8 e 8,4±0,9g/100g.Edible mushrooms contains a very interesting functional properties. Among them, the beta-glucans, polysaccharides with beta-1,3; b-1,4 and beta-1,6glucosidic linkages, they are responsible to a series of properties to human health, such as immunomodulatory, antioxidant, antiinflammatory and, antitumoral activities. In the present work, the Agaricus blazei Murill beta-glucan concentrations from three locations, were determined through the enzymatic method. Samples were treated with alpha-amylase, bacterial protease and fungal glucoamylase. beta-glucans were quantified after acid hydrolysis and, the glucose determined for spectrophotometric method. It was verified that samples cultivated inside stoves presented smaller beta-glucan concentration (8.4±0.9 and 7.6±2.8g/100g, when compared with samples cultivated in open field (10.1±2.1g/100

Production of ethanol from winter barley by the EDGE (enhanced dry grind enzymatic process

Directory of Open Access Journals (Sweden)

Kurantz M

2010-04-01

Full Text Available Abstract Background US legislation requires the use of advanced biofuels to be made from non-food feedstocks. However, commercialization of lignocellulosic ethanol technology is more complex than expected and is therefore running behind schedule. This is creating a demand for non-food, but more easily converted, starch-based feedstocks other than corn that can fill the gap until the second generation technologies are commercially viable. Winter barley is such a feedstock but its mash has very high viscosity due to its high content of β-glucans. This fact, along with a lower starch content than corn, makes ethanol production at the commercial scale a real challenge. Results A new fermentation process for ethanol production from Thoroughbred, a winter barley variety with a high starch content, was developed. The new process was designated the EDGE (enhanced dry grind enzymatic process. In this process, in addition to the normal starch-converting enzymes, two accessory enzymes were used to solve the β-glucan problem. First, β-glucanases were used to hydrolyze the β-glucans to oligomeric fractions, thus significantly reducing the viscosity to allow good mixing for the distribution of the yeast and nutrients. Next, β-glucosidase was used to complete the β-glucan hydrolysis and to generate glucose, which was subsequently fermented in order to produce additional ethanol. While β-glucanases have been previously used to improve barley ethanol production by lowering viscosity, this is the first full report on the benefits of adding β-glucosidases to increase the ethanol yield. Conclusions In the EDGE process, 30% of total dry solids could be used to produce 15% v/v ethanol. Under optimum conditions an ethanol yield of 402 L/MT (dry basis or 2.17 gallons/53 lb bushel of barley with 15% moisture was achieved. The distillers dried grains with solubles (DDGS co-product had extremely low β-glucan (below 0.2% making it suitable for use in both ruminant

Evaluation on prebiotic properties of β-glucan and oligo-β-glucan from mushrooms by human fecal microbiota in fecal batch culture

Directory of Open Access Journals (Sweden)

Chiraphon Chaikliang

2015-11-01

Full Text Available Background: β-glucan is dietary fiber, a structural polysaccharide, β-linked linear chains of D-glucose polymers with variable frequency of branches. β-glucan is isolated from different sources such as cell walls of baker’s yeast (Saccharomyces cerevisiae, cereals (oat and barley and various species of mushrooms. Among 8 mushrooms in the study, Schizophylum commune Fr and Auricularia auricula Judae had the highest in β-glucan contents and the cheapest cost of mushroom per content of β-glucan, respectively. Even the function of β-glucan on immune modulation has been known however no report on interaction between β-glucan and human gut microbiota. Gut microbiota is thought to have health effects by interaction with non-digestible component particular fermentable dietary fiber. It is important to correlate the specific groups of the microbial communities associated with β-glucan fermentation and the consequential SCFA profiles. β-glucan from mushroom may has potential prebiotic function similar to those from commercial yeast (Saccharomyces cerevisiae β-glucan. Objective: To evaluate on prebiotic properties of soluble β-glucans and oligo-β-glucans from Schizophylum commune Fr and Auricularia auricula Judae by fecal fermentation in batch culture. Methods: In vitro fecal fermentation in anaerobic batch cultures under simulated conditions similar to human colon with human faecal samples from three donors were performed. Comparison on 3 β-glucans and 2 oligo-β-glucans have been studied. Sample was taken at 0 h, 24 h and 48 h to analyze the numbers of bacterial changes by fluorescent in situ hybridization (FISH technique. Short chain fatty acids (SCFA were analyzed by HPLC. The prebiotic index (PI was calculated according to the change of 5 specific bacterial genus within 48 h fermentation. Results: Soluble β-glucan from Auricularia auricula Judae increased numbers of bifidobacteria and lactobacillus significantly (P<0.05. The PI of

Barley Brassinosteroid Mutants Provide an Insight into Phytohormonal Homeostasis in Plant Reaction to Drought Stress

Czech Academy of Sciences Publication Activity Database

Gruszka, D.; Janeczko, A.; Dziurka, M.; Pociecha, E.; Oklešťková, Jana; Szarejko, I.

2016-01-01

Roč. 7, DEC 2 (2016), č. článku 1824. ISSN 1664-462X R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : abscisic- acid * arabidopsis-thaliana * jasmonic - acid * gibberellin biosynthesis * constitutive activation * abiotic stresses * brassica-napus * rice * responses * tolerance * barley * brassinosteroids * drought * homeostasis * mutants * phytohormones Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.298, year: 2016

Thermoresponsive .beta.-glucan-based polymers for bimodal immunoradiotherapy - Are they able to promote the immune system?

Czech Academy of Sciences Publication Activity Database

Loukotová, Lenka; Kučka, Jan; Rabyk, Mariia; Höcherl, Anita; Venclíková, Kristýna; Janoušková, Olga; Páral, P.; Kolářová, V.; Heizer, T.; Šefc, L.; Štěpánek, Petr; Hrubý, Martin

2017-01-01

Roč. 268, 28 December (2017), s. 78-91 ISSN 0168-3659 R&D Projects: GA ČR(CZ) GA16-02870S; GA ČR(CZ) GA16-03156S; GA MZd(CZ) NV15-25781A; GA MŠk(CZ) 7AMB16FR042 Institutional support: RVO:61389013 Keywords : beta-glucan * polyoxazoline * multimodal cancer therapy Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 7.786, year: 2016

Preparation, characterization, and biological properties of β-glucans

Directory of Open Access Journals (Sweden)

Sandeep Rahar

2011-01-01

Full Text Available β-Glucans are soluble fibers with physiological functions, such as, interference with absorption of sugars and reduction of serum lipid levels. β-glucans are found in different species, such as, Rhynchelytrum repens, Lentinus edodes, Grifola frondosa, Tremella mesenterica, Tremella aurantia, Zea may, Agaricus blazei, Phellinus baummi, Saccharomyces cerevisae (yeast, and Agaricus blazei murell (mushroom. Analysis of the fractions reveals the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of β-glucan in these fractions is confirmed by hydrolyzing the polymers with endo-β-glucanase from Bacillus subtilis, followed by high-performance liquid chromatography (HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues are subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides, with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers is similar (250 kDa to that of the maize coleoptiles β-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes has shown hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 hours. This performance is better than that obtained with pure β-glucan from barley, which decreases blood sugar levels for about four hours. These results suggest that the activity of β-glucans is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.

Characterization of oat beta-glucan and coenzyme Q10-loaded beta-glucan powders generated by the pressurized gas-expanded liquid (PGX) technology.

Science.gov (United States)

Liu, Nian; Couto, Ricardo; Seifried, Bernhard; Moquin, Paul; Delgado, Luis; Temelli, Feral

2018-04-01

The physicochemical properties of the oat beta-glucan powder (BG) and coenzyme Q10 (CoQ10)-loaded BG powder (L-BG) produced by the pressurized gas-expanded liquid (PGX) technology were studied. Helium ion microscope, differential scanning calorimeter, X-ray diffractometer, AutoSorb iQ and rheometer were used to determine the particle morphology, thermal properties, crystallinity, surface area and viscosity, respectively. Both BG (7.7μm) and L-BG (6.1μm) were produced as micrometer-scale particles, while CoQ10 nanoparticles (92nm) were adsorbed on the porous structure of L-BG. CoQ10 was successfully loaded onto BG using the PGX process via adsorptive precipitation mainly in its amorphous form. Viscosity of BG and L-BG solutions (0.15%, 0.2%, 0.3% w/v) displayed Newtonian behavior with increasing shear rate but decreased with temperature. Detailed characterization of the physicochemical properties of combination ingredients like L-BG will lead to the development of novel functional food and natural health product applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

Defects in rhizobial cyclic glucan and lipopolysaccharide synthesis alter legume gene expression during nodule development

DEFF Research Database (Denmark)

D'Antuono, Alejandra L; Ott, Thomas; Krusell, Lene

2008-01-01

cDNA array technology was used to compare transcriptome profiles of Lotus japonicus roots inoculated with a Mesorhizobium loti wild-type and two mutant strains affected in cyclic beta(1-2) glucan synthesis (cgs) and in lipopolysaccharide synthesis (lpsbeta2). Expression of genes associated...... with the development of a fully functional nodule was significantly affected in plants inoculated with the cgs mutant. Array results also revealed that induction of marker genes for nodule development was delayed when plants were inoculated with the lpsbeta2 mutant. Quantitative real-time reverse......-transcriptase polymerase chain reaction was used to quantify gene expression of a subset of genes involved in plant defense response, redox metabolism, or genes that encode for nodulins. The majority of the genes analyzed in this study were more highly expressed in roots inoculated with the wild type compared with those...

Differential effects of lesion mimic mutants in barley on disease development by facultative pathogens

Science.gov (United States)

McGrann, Graham R. D.; Steed, , Andrew; Burt, Christopher; Nicholson, Paul; Brown, James K. M.

2015-01-01

Lesion mimic mutants display spontaneous necrotic spots and chlorotic leaves as a result of mis-regulated cell death programmes. Typically these mutants have increased resistance to biotrophic pathogens but their response to facultative fungi that cause necrotrophic diseases is less well studied. The effect of altered cell death regulation on the development of disease caused by Ramularia collo-cygni, Fusarium culmorum and Oculimacula yallundae was explored using a collection of barley necrotic (nec) lesion mimic mutants. nec8 mutants displayed lower levels of all three diseases compared to nec9 mutants, which had increased R. collo-cygni but decreased F. culmorum disease symptoms. nec1 mutants reduced disease development caused by both R. collo-cygni and F. culmorum. The severity of the nec1-induced lesion mimic phenotype and F. culmorum symptom development was reduced by mutation of the negative cell death regulator MLO. The significant reduction in R. collo-cygni symptoms caused by nec1 was completely abolished in the presence of the mlo-5 allele and both symptoms and fungal biomass were greater than in the wild-type. These results indicate that physiological pathways involved in regulation of cell death interact with one another in their effects on different fungal pathogens. PMID:25873675

Chitosan-guar gum-silver nanoparticles hybrid matrix with immobilized enzymes for fabrication of beta-glucan and glucose sensing photometric flow injection system.

Science.gov (United States)

Bagal-Kestwal, Dipali R; Kestwal, Rakesh Mohan; Hsieh, Wen-Ting; Chiang, Been-Huang

2014-01-01

Simple and fast photometric flow injection analysis system was developed for sensing of β-1,3-glucan from medicinal mushroom Ganoderma lucidum during fermentation. For this purpose, the chitosan-guar gum-silver nanoparticle-beta glucanase (Ch-GG-AgNPs-βG) beads and Ch-GG-AgNPs-GOD (glucose oxidase) beads were prepared. The bead packed mini-columns were then used to assemble a flow injection analysis (FIA) system for the detection of β-(1→3)-d-glucan biomarker or glucose. This colorimetric flow system can detect glucose and glucan with detection limits as low as 50ngmL(-1) and 100ngmL(-1) (S/N=3), respectively. The analysis time of this FIA was approximately 40s, which is faster than the previously reported glucan sensors. The glucose and glucan calibration curves were obtained in the range of 0.25-1.25μgmL(-1) (R(2)=0.988) and 0.2-1.0μgmL(-1)(R(2)=0.979), respectively. The applicability of the nano-bio-composite FIA sensor system for spiked and real β-(1→3)-d-glucan samples were tested, and the accuracy of the results were greater than 95%. Thus, the designed FIA provides a simple, interference free and rapid tool for monitoring glucose and β-glucan content, which can be used for various food samples with a little modification. Copyright © 2013 Elsevier B.V. All rights reserved.

Various roles of beta-glucan in invertebrates

Czech Academy of Sciences Publication Activity Database

Větvička, V.; Šíma, Petr

2017-01-01

Roč. 14, č. 1 (2017), s. 488-493 ISSN 1824-307X Institutional support: RVO:61388971 Keywords : invertebrates * glucan * receptors Subject RIV: EC - Immunology OBOR OECD: Immunology Impact factor: 0.824, year: 2016

Beta-1,3-1,6-glucan modulate the non-specific immune response to enhance the survival in the Vibrio alginolyticus infection of Taiwan abalone (Haliotis diversicolor supertexta).

Science.gov (United States)

Wu, Yu-Sheng; Tseng, Tzu-Yu; Nan, Fan-Hua

2016-07-01

This research aims to investigate the non-specific immune response of Taiwan abalone (Haliotis diversicolor supertexta) which was treated with the beta-1,3-1,6-glucan to be observed in the survival impact after the Vibrio alginolyticus infection. The non-specific immune and physiological response of superoxide anion radical (O2(-)), phenoloxidase (PO), phagocytic index (PI), phagocytic rate (PR) and lucigenin-chemiluminescence for reactive oxygen intermediates (ROIs) were enhanced via in-vitro experiment. In the in-vivo experiment, the observed data presented that the haemolymph lysate supernatant (HLS), superoxide dismutase (SOD), glutamate oxalacetate transaminase (GOT) and glutamate pyruvate transaminase (GPT) were not significant enhanced, but the total haemocyte count (THC), O2(-), PO, phagocytic index (PI), phagocytic ratio (PR) and other parameters of immune were significantly promoted after treated with beta-1,3-1,6-glucan. In the challenge experiment, the survival rates of abalone in the 40 and 80 μl/ml groups of beta-1,3-1,6-glucan were observed from 6.67% up to 33.33% and 36.67% after injection with Vibrio alginolyticus, respectively. Copyright © 2016 Elsevier Ltd. All rights reserved.

The structure of cell wall alpha-glucan from fission yeast

NARCIS (Netherlands)

Grün, Christian H.; Hochstenbach, Frans; Humbel, Bruno M.; Verkleij, Arie J.; Sietsma, J. Hans; Klis, Frans M.; Kamerling, Johannis P.; Vliegenthart, Johannes F. G.

2005-01-01

Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1-->3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the

The structure of cell wall alpha-glucan from fission yeast.

NARCIS (Netherlands)

Grün, C.H.; Hochstenbach, F.; Humbel, B.M.; Verkleij, A.J.; Sietsma, J.H.; Klis, F.M.; Kamerling, J.P.; Vliegenthart, J.F.G.

2005-01-01

Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1rarr3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the

Integration of the sensory experience and post-ingestive measures for understanding food satisfaction. A case study on sucrose replacement by Stevia rebaudiana and addition of beta glucan in fruit drinks

DEFF Research Database (Denmark)

Andersen, Barbara Vad; Mielby, Line H.; Viemose, Ida

2017-01-01

apple-cherry fruit drinks with different levels of beta-glucans and different sweeteners, sucrose or Stevia rebaudiana. The aims were: 1) to study the hedonic sensory experience, 2) to study time and product effects on post-ingestive sensations and satisfaction, and 3) to study main drivers....... Satisfaction with sensory attributes was found to be the main driver of food satisfaction, while post-ingestive sensations drove satisfaction as well. While replacing sucrose with Stevia rebaudiana did not affect the hedonic and post-ingestive sensations, addition of beta glucan resulted in both positive...

Messenger RNAs from the Scutellum and Aleurone of Germinating Barley Encode (1-->3,1-->4)-beta-d-Glucanase, alpha-Amylase and Carboxypeptidase

DEFF Research Database (Denmark)

Mundy, John; Brandt, Anders; Fincher, Geoffrey B

1985-01-01

Polyclonal antibodies raised against barley (1-->3,1-->4)-beta-d-glucanase, alpha-amylase and carboxypeptidase were used to detect precursor polypeptides of these hydrolytic enzymes among the in vitro translation products of mRNA isolated from the scutellum and aleurone of germinating barley....... In the scutellum, mRNA encoding carboxypeptidase appeared to be relatively more abundant than that encoding alpha-amylase or (1-->3,1-->4)-beta-d-glucanase, while in the aleurone alpha-amylase and (1-->3,1-->4)-beta-d-glucanase mRNAs predominated. The apparent molecular weights of the precursors for (1......-->3,1-->4)-beta-d-glucanase, alpha-amylase, and carboxypeptidase were 33,000, 44,000, and 35,000, respectively. In each case these are slightly higher (1,500-5,000) than molecular weights of the mature enzymes. Molecular weights of precursors immunoprecipitated from aleurone and scutellum mRNA translation...

Effects of β-glucan and Vitamin D Supplementation on Inflammatory Parameters in Patients with Diabetic Retinopathy.

Science.gov (United States)

Richter, Josef; Závorková, Martina; Vetvicka, Vaclav; Liehneová, Ivana; Kral, Vlastimil; Rajnohova Dobiasova, Lucie

2018-06-19

The objective of this article is to evaluate the potential effects of beta-glucan and vitamin D supplementation in patients with diabetic retinopathy. We evaluated the levels of several parameters of inflammatory reactions (C-reactive protein [CRP], serum amyloid A [SAA], and interleukin- [IL-] 6), leptin, and vitamin D. Using a 3-month interval, we divided the patients into three groups: (1) supplemented with beta-glucan and vitamin D, (2) supplemented with vitamin D and placebo, and (3) supplemented with vitamin D alone. By this division, we aim not only to observe whether beta-glucan can increase the effects of vitamin D, but also to eliminate the potential effects of placebo. The doses of vitamin D corresponded to phototype, weight, age, and sex of the individual. Fifty-two diabetic retinopathy patients were selected for our study. We found significant vitamin D deficits in all cases, even after three months of supplementation with vitamin D. Significant changes in levels of CRP were observed in the beta-glucan-supplemented group; levels of SAA and IL-6 were not changed. Leptin levels were significantly lowered in the beta-glucan-supplemented group and increased in the other groups. More detailed studies and/or longer supplementation is necessary.

Mapping of barley alpha-amylases and outer subsite mutants reveals dynamic high-affinity subsites and barriers in the long substrate binding cleft

DEFF Research Database (Denmark)

Kandra, L.; Abou Hachem, Maher; Gyemant, G.

2006-01-01

Subsite affinity maps of long substrate binding clefts in barley alpha-amylases, obtained using a series of maltooligosaccharides of degree of polymerization of 3-12, revealed unfavorable binding energies at the internal subsites -3 and -5 and at subsites -8 and +3/+4 defining these subsites...... as binding barriers. Barley a-amylase I mutants Y105A and T212Y at subsite -6 and +4 resulted in release or anchoring of bound substrate, thus modifying the affinities of other high-affinity subsites (-2 and +2) and barriers. The double mutant Y105A-T212Y displayed a hybrid subsite affinity profile......, converting barriers to binding areas. These findings highlight the dynamic binding energy distribution and the versatility of long maltooligosaccharide derivatives in mapping extended binding clefts in a-amylases....

Melatonin enhances cold tolerance in drought-primed wild-type and abscisic acid-deficient mutant barley.

Science.gov (United States)

Li, Xiangnan; Tan, Dun-Xian; Jiang, Dong; Liu, Fulai

2016-10-01

Melatonin is involved in multiple plant developmental processes and various stress responses. To explore the roles of melatonin played as well as its association with abscisic acid (ABA) in a process of drought priming-induced cold tolerance (DPICT), a wild-type barley and its ABA-deficient mutant Az34 counterpart were selected for comparison, in which the effects of melatonin application (either foliarly or rhizospherically) and/or drought priming on the cold tolerance of both types of barleys were systematically investigated. It was demonstrated that the early drought priming induced an increase of endogenous melatonin production, which is not ABA dependent. In addition, exogenously applied melatonin resulted in higher ABA concentration in the drought-primed plants than in the nonprimed plants when exposed to cold stress, indicating that ABA responded in a drought-dependent manner. The interplay of melatonin and ABA leads to plants maintaining better water status. Drought priming-induced melatonin accumulation enhanced the antioxidant capacity in both chloroplasts and mitochondria, which sustained the photosynthetic electron transport in photosynthetic apparatus of the plants under cold stress. These results suggest that the exogenous melatonin application enhances the DPICT by modulating subcellular antioxidant systems and ABA levels in barley. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Accumulation of mixed linkage (1¿3) (1¿4)-ß-D-glucan during grain filling in barley

DEFF Research Database (Denmark)

Seefeldt, Helene Fast; Blennow, Per Gunnar Andreas; Jespersen, Birthe P Møller

2009-01-01

18% BG (w/w) dry matter 30 days after flowering (DAF), seemingly compensating for a decreased synthesis of starch. The spectral information of the barley flour was compared to pure BG spectra and partial least squares regression (PLS) models were constructed for calibration to BG content. Informative...... the normal control Cork were studied. The Cork and lys3a genotypes showed a linear BG accumulation throughout the grain filling to reach a maximum of approximately 6 and 4% BG (w/w) dry matter, respectively. However, lys5f mutant exhibited an exponential increase in BG synthesis to a maximum of approximately...

Supplementation of hydroxypropyl methylcellulose into yeast leavened all-whole grain barley bread potentiates cholesterol-lowering effect.

Science.gov (United States)

Kim, Hyunsook; Turowski, Maciej; Anderson, W H Kerr; Young, Scott A; Kim, Yookyung; Yokoyama, Wallace

2011-07-27

We investigated in Syrian Golden hamsters the biological impact and its underlying mechanism of single whole grain breads supplemented with 2-3% hydroxypropyl methylcellulose (HPMC), a semisynthetic viscous soluble dietary fiber (SDF) as a substitute for gluten. Hamsters were fed high-fat diets supplemented with 48-65% (w/w) differently ground, freeze-dried single grain breads including whole grain wheat, barley, barley supplemented with HPMC, debranned oat, and oat supplemented with HPMC which were compared to a diet containing microcrystalline cellulose (control). All single grain breads significantly lowered plasma LDL-cholesterol concentrations compared to the control. Enrichment with HPMC further lowered plasma and hepatic cholesterol concentrations. Despite the reduced molecular weight of naturally occurring soluble (1--->3),(1--->4)-β-d-glucan (β-glucan) caused by the bread-making process, whole grain barley breads downregulated hepatic expression of CYP7A1 and HMG-CoAR genes that are responsible for bile acid and cholesterol synthesis, suggesting a possible role of bioactive compounds such as short-chain fatty acids and phenolic compounds from barley bread. Barley bread enriched with HPMC downregulated expression of ABCG5 gene. Taken together, it appears that distinctive modulation of synthesis and excretion of hepatic cholesterol and bile acid contributes to the cholesterol-lowering properties of whole grain barley breads and breads enriched with HPMC. These data suggests that alternative whole grain breads supplemented with HPMC may provide consumers with a staple food that can assist in cholesterol management.

Induced mutations for disease resistance in wheat and barley

International Nuclear Information System (INIS)

Hanis, M.; Hanisova, A.; Knytl, V.; Cerny, J.; Benc, S.

1977-01-01

The induction of mutations in cultivars of wheat (Triticum aestivum), barley (Hordeum vulgare), and field beans (Phaseolus vulgaris) has been part of the breeding programme at the Plant Breeding Station at Stupice since 1960. A total of 26 cultivars or selections of winter wheat, 4 cultivars or selections of spring wheat, 2 cultivars of field beans, and 43 selections of spring barley have been treated since 1960. A total of 140 mutant lines of wheat and 37 mutant lines of barley with improved disease resistance of a race-specific type have been obtained. Several mutation programme derived cultivars have been registered in Czechoslovakia (''Diamant'', ''Ametyst'', ''Favorit'', ''Hana'', ''Rapid'', and ''Atlas'' in barley, and ''Alfa'' in field beans), but none of them is a mutation for disease resistance. A series of mutants have been used in crossing programmes. Approaches to improve the efficiency of mutation breeding for disease resistance are suggested. (author)

Mechanistic Study of Utilization of Water-Insoluble Saccharomyces cerevisiae Glucans by Bifidobacterium breve Strain JCM1192.

Science.gov (United States)

Keung, Hoi Yee; Li, Tsz Kai; Sham, Lok To; Cheung, Man Kit; Cheung, Peter Chi Keung; Kwan, Hoi Shan

2017-04-01

Bifidobacteria exert beneficial effects on hosts and are extensively used as probiotics. However, due to the genetic inaccessibility of these bacteria, little is known about their mechanisms of carbohydrate utilization and regulation. Bifidobacterium breve strain JCM1192 can grow on water-insoluble yeast ( Saccharomyces cerevisiae ) cell wall glucans (YCWG), which were recently considered as potential prebiotics. According to the results of 1 H nuclear magnetic resonance (NMR) spectrometry, the YCWG were composed of highly branched (1→3,1→6)-β-glucans and (1→4,1→6)-α-glucans. Although the YCWG were composed of 78.3% β-glucans and 21.7% α-glucans, only α-glucans were consumed by the B. breve strain. The ABC transporter ( malEFG1 ) and pullulanase ( aapA ) genes were transcriptionally upregulated in the metabolism of insoluble yeast glucans, suggesting their potential involvement in the process. A nonsense mutation identified in the gene encoding an ABC transporter ATP-binding protein (MalK) led to growth failure of an ethyl methanesulfonate-generated mutant with yeast glucans. Coculture of the wild-type strain and the mutant showed that this protein was responsible for the import of yeast glucans or their breakdown products, rather than the export of α-glucan-catabolizing enzymes. Further characterization of the carbohydrate utilization of the mutant and three of its revertants indicated that this mutation was pleiotropic: the mutant could not grow with maltose, glycogen, dextrin, raffinose, cellobiose, melibiose, or turanose. We propose that insoluble yeast α-glucans are hydrolyzed by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. IMPORTANCE In general, Bifidobacterium strains are genetically intractable

Fungal beta glucan protects radiation induced DNA damage in human lymphocytes.

Science.gov (United States)

Pillai, Thulasi G; Maurya, Dharmendra K; Salvi, Veena P; Janardhanan, Krishnankutty K; Nair, Cherupally K K

2014-02-01

Ganoderma lucidum (Ling Zhi), a basidiomycete white rot macrofungus has been used extensively for therapeutic use in China, Japan, Korea and other Asian countries for 2,000 years. The present study is an attempt to investigate its DNA protecting property in human lymphocytes. Beta glucan (BG) was isolated by standard procedure and the structure and composition were studied by infrared radiation (IR) and nuclear magnetic resonance (NMR) spectroscopy, gel filtration chromatography and paper chromatography. The radioprotective properties of BG isolated from the macro fungi Ganoderma lucidum was assessed by single cell gel electrophoresis (comet assay). Human lymphocytes were exposed to 0, 1, 2 and 4 Gy gamma radiation in the presence and absence of BG. The comet parameters were reduced by BG. The results indicate that the BG of G. lucidum possessed significant radioprotective activity with DNA repairing ability and antioxidant activity as the suggestive mechanism. The findings suggest the potential use of this mushroom for the prevention of radiation induced cellular damages.

The project of mutation breeding in barley (first report)

International Nuclear Information System (INIS)

2010-01-01

Barley is a second main crop with the production of 7 million tons per year and 3,5 million hectare cultivation area in Turkey. Because of wateer deficiency, cereals cultivated in Central Anatolian region. Barley is well adapted to dry farming system besides it is basic food for animal husbandry and main raw material for brewery industry. the main problems in barley production are drought disease epidemic and increasing salinity gradually. Main purposes of our project is to increase resistance and tolerence to this stress factors. In order to reach to our aim we have been using mutation breeding techniques and conventional breeding methods. This Project has been started with irradiation of barley seeds with different gamma ray doses. After that resistant and tolerant mutant has been selected most of these mutanys have resistance and tolerance to different disease and stress conditions. During the selection procedure, hydroponics and tissue culture techniques have been applied to improve the selection efficiency. Up to now, promising barley mutant lines 71 that have earliness (30 days) than parents and because of that reason that escape from drought period. Disease tests of our mutant lines have been conducted under controlled conditions and tolerant lines have been determined under the high the high epidemic conditions. Salt tolerance studies have been applied under hydroponics conditions and salt tolerant mutant have been determined under 180-200mMolNaCl concentration. All mutant lines are carried out to preliminary yield trials for their evaluation

Extracted oat and barley β-glucans do not affect cholesterol metabolism in young healthy adults

DEFF Research Database (Denmark)

Ibrügger, Sabine; Kristensen, Mette Bredal; Poulsen, Malene Wibe

2013-01-01

for β-glucan functionality. This study investigates the effects of 3 different β-glucan sources, incorporated into a beverage and yogurt, on blood lipids and fecal endpoints. Fourteen participants completed this randomized, crossover, single-blinded study with four 3-wk periods: control and 3.3 g/d oat...

From discovery of high lysine barley endosperm mutants in the 1960-70 ties to new holistic spectral models of the phenome and of pleiotropy in 2008

International Nuclear Information System (INIS)

Munck, L.; Moeller Jespersen, B.

2008-01-01

As documented by eight IAEA/FAO symposia 1968-82 on nutritionally improved seeds, a wide range of high lysine endosperm mutants were isolated in maize, sorghum and barley. These mutants observed by new spectroscopic screening methods can now be exploited to advance basic biological research and theory. Since 1982 effective methods to overview the physiochemical composition of seeds by Near Infrared Spectroscopy evaluated by chemometric data analysis have developed. Spectroscopic analyses by calibration have now substituted for the wet analyses in industry. In genetics there has traditionally been a differentiation between major genes for qualitative and minor 'polygenes' for quantitative traits. This view has been coupled to an incomplete understanding of pleiotropy. It is shown that seed spectra from isogenic barley endosperm mutants represent a coarse-grained physiochemical overview of the phenome that can be classified by chemometrics. Pleiotropy expressed by a gene is quantified as a whole pattern by the gene specific mutant spectrum subtracted by the spectrum of the parent variety. Selection for an improved plumpness (starch) in a breeding material with the lys3.a mutant visualises in spectra the effect of enriching 'minor polygenes' for an increased content of starch in a mutant gene background. Morphological, spectroscopic and chemical analyses suggest that mutant genes have both qualitative and quantitative expressions. They produce qualitative pleiotropic phenomenological patterns that can be observed as more or less severe changes in macro and microstructures of the plant and seed phenotype. Behind are quantitative chemical changes that by spectroscopy and chemometrics can be transferred to qualitative patterns. In fact one major gene for a qualitative trait can act as several apparent minor polygenes for quantitative variables. This explains the reduced need for the previously expected several hundred thousands of genes and gene modifiers down to the

Evidence for novel beta-sheet structures in Iowa mutant beta-amyloid fibrils.

Science.gov (United States)

Tycko, Robert; Sciarretta, Kimberly L; Orgel, Joseph P R O; Meredith, Stephen C

2009-07-07

Asp23-to-Asn mutation within the coding sequence of beta-amyloid, called the Iowa mutation, is associated with early onset, familial Alzheimer's disease and cerebral amyloid angiopathy, in which patients develop neuritic plaques and massive vascular deposition predominantly of the mutant peptide. We examined the mutant peptide, D23N-Abeta40, by electron microscopy, X-ray diffraction, and solid-state NMR spectroscopy. D23N-Abeta40 forms fibrils considerably faster than the wild-type peptide (k = 3.77 x 10(-3) min(-1) and 1.07 x 10(-4) min(-1) for D23N-Abeta40 and the wild-type peptide WT-Abeta40, respectively) and without a lag phase. Electron microscopy shows that D23N-Abeta40 forms fibrils with multiple morphologies. X-ray fiber diffraction shows a cross-beta pattern, with a sharp reflection at 4.7 A and a broad reflection at 9.4 A, which is notably smaller than the value for WT-Abeta40 fibrils (10.4 A). Solid-state NMR measurements indicate molecular level polymorphism of the fibrils, with only a minority of D23N-Abeta40 fibrils containing the in-register, parallel beta-sheet structure commonly found in WT-Abeta40 fibrils and most other amyloid fibrils. Antiparallel beta-sheet structures in the majority of fibrils are indicated by measurements of intermolecular distances through (13)C-(13)C and (15)N-(13)C dipole-dipole couplings. An intriguing possibility exists that there is a relationship between the aberrant structure of D23N-Abeta40 fibrils and the unusual vasculotropic clinical picture in these patients.

Elevated Serum Beta-D-Glucan with Pseudomonas, Aspergillus, and a Partially Acid-Fast Organism in Respiratory Cultures: A Case of Hickam's Dictum Over Occam's Razor.

Science.gov (United States)

Khan, Salman; Hamula, Camille; Rana, Meenakshi; Sullivan, Timothy; Dunn, Dallas; Patel, Pinki; Mishkin, Aaron; Huprikar, Shirish

2017-10-01

We describe a case of a man with ectopic Cushing's syndrome, elevated serum beta-D-glucan, and respiratory cultures with Pseudomonas, Aspergillus, and a partially acid-fast organism. Our case highlights challenges in diagnosis and management of coinfection in an immunocompromised host.

β-1,3-glucan in developing cotton fibers

International Nuclear Information System (INIS)

Maltby, D.; Carpita, N.C.; Montezinos, D.; Kulow, C.; Delmer, D.P.

1979-01-01

Evidence is presented for the existence of a noncellulosic β-1,3-glucan in cotton fibers. The glucan can be isolated as distinct fractions of varying solubility. When fibers are homogenized rigorously in aqueous buffer, part of the total β-1,3-glucan is found as a soluble polymer in homogenates freed of cell walls. The proportion of total β-1,3-glucan which is found as the soluble polymer varies somewhat as a function of fiber age. The insoluble fraction of the BETA-1,3-glucan remains associated with the cell wall fraction. The glucan fraction which can be isolated as a soluble polymer in homogenates freed of cell walls is not associated with membranous material, and we propose that it represents glucan which is also extracellular but not tightly associated with the cell wall. Enzyme digestion studies indicate that all of the cotton fiber glucan is β-linked, and methylation analyses and enzyme studies both show that the predominant linkage in the glucan is 1 → 3. The possibility of some minor branching at C-6 can also be deduced from the methylation analyses. The timing of deposition of the β-1,3-glucan during fiber development coincides closely with the onset of secondary wall cellulose synthesis. Kinetic studies performed with ovules and fibers cultured in vitro show that incorporation of radioactivity from [ 14 C/glucose into β-1,3-glucan is linear with respect to time almost from the start of the labeling period; however, a lag is observed before incorporation into cellulose becomes linear with time, suggesting that these two different glucans are not polymerized directly from the same substrate pool. Pulse-chase experiments indicate that neither the β-1,3-glucan nor cellulose exhibits significant turnover after synthesis

[Cellulose acetate membrane electrophoresis CAE and Raman spectroscopy as a method identification of beta-glucans, used as biologically and therapeutically active biomaterials].

Science.gov (United States)

Pielesz, Anna; Biniaś, Włodzimierz; Paluch, Jadwiga

2012-01-01

The formation of AGEs progressively increases with normal aging, even in the absence of disease (the pathogenesis of diabetes associated vascular disorders and neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease). However, they are formed at accelerated rates in age-related diseases. The polysaccharides might play a role in wound healing, both internally and externally, and also that they could play a role against inflammation and may lead to the production of better medicines to be used as supplements in cancer treatment. The acid hydrolysis was studied with H2SO4 at 80% concentration to determine the most effective procedure for total hydrolysis of beta-glucan. The standard of beta-glucans acid hydrolysate were compared for commercial oat and oatmeal, mushrooms: Pleurotus ostreatus, Fungus and yeast Saccharomyces cerevisiae. The following materials and reagents were used in the examination: reference beta-(1 --> 3)-(1 --> 6)-glucan, oat and oatmeal, mushrooms: Pleurotus ostreatus, Fungus and yeast Saccharomyces cerevisiae. The Raman spectra of the sample solutions (beta-glucan acid hydrolysates) were recorded on a MAGNA-IR 860 with FT-Raman accessory. Sample was irradiated with a 1064 nm line of the T10-8S Nd spectra-physics model: YAG laser and scattered radiation were collected at 180 degrees, using 4 cm(-1) resolution. The polysaccharide was hydrolyzed into component monosaccharides with 80% H2SO4 at 0 degrees C for 30 minutes and monosaccharide derivatives were subjected to electrophoresis, as in a ealier authors study, on a strip of cellulose acetate membrane (CA-SYS-MINI Cellulose Acetate Systems) in 0.2 M Ca(OAc)2 (pH 7.5) at 10 mA, max. 240 V for 1.5 h. The strips were stained with 0.5% toluidine blue in 3% HOAc solution and then rinsed in distilled water and air-dried. A part of the hexoses (for example glucose) are converted, to products such as 5-hydroxymethylfurfural. Various coloured substances, through the Maillard

The characteristics of high-yield genotype of early-mature mutant lines in barley

International Nuclear Information System (INIS)

Chen Xiulan; Han Yuepeng; He Zhentian; Yang Hefeng

2000-01-01

The correlation and genetic parameters of eight agronomic traits of 36 early mature mutant lines induced from barley Sunong 9052 were studied by stepwise regression and path analysis. The results showed that: (1) the growing period of early mutants was shortened 2-13 days from that of their parent and the trait of yield had a great mutation range; (2) the number of grain per panicle significantly correlated with the days from sowing to heading; (3) according to direct path coefficients, the main characters related with individual plant-yield were in order of productive panicle per plant > 1000-grain-weight > number of grain per panicle > fertility, the high-yield genotype had more productive panicle and higher 10000-grain-weight, and to increase the yield in the breeding of early mature mutation was to select the lines with more tillers and productive panicles, higher 1000-grain-weight and lower number of grain per panicle; (4) the higher broad-sense heritability and genetic variation coefficient were found in 1000-grain-weight and the days from sowing to heading

Beta-glucan bath promote wound healing in common carp (Cyprinus carpio L.)

DEFF Research Database (Denmark)

Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht

β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...

β-1,6-glucan synthesis-associated genes are required for proper spore wall formation in Saccharomyces cerevisiae.

Science.gov (United States)

Pan, Hua-Ping; Wang, Ning; Tachikawa, Hiroyuki; Nakanishi, Hideki; Gao, Xiao-Dong

2017-11-01

The yeast spore wall is an excellent model to study the assembly of an extracellular macromolecule structure. In the present study, mutants defective in β-1,6-glucan synthesis, including kre1∆, kre6∆, kre9∆ and big1∆, were sporulated to analyse the effect of β-1,6-glucan defects on the spore wall. Except for kre6∆, these mutant spores were sensitive to treatment with ether, suggesting that the mutations perturb the integrity of the spore wall. Morphologically, the mutant spores were indistinguishable from wild-type spores. They lacked significant sporulation defects partly because the chitosan layer, which covers the glucan layer, compensated for the damage. The proof for this model was obtained from the effect of the additional deletion of CHS3 that resulted in the absence of the chitosan layer. Among the double mutants, the most severe spore wall deficiency was observed in big1∆ spores. The majority of the big1∆chs3∆ mutants failed to form visible spores at a higher temperature. Given that the big1∆ mutation caused a failure to attach a GPI-anchored reporter, Cwp2-GFP, to the spore wall, β-1,6-glucan is involved in tethering of GPI-anchored proteins in the spore wall as well as in the vegetative cell wall. Thus, β-1,6-glucan is required for proper organization of the spore wall. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

The absence of chlorophyll b affects lateral mobility of photosynthetic complexes and lipids in grana membranes of Arabidopsis and barley chlorina mutants.

Science.gov (United States)

Tyutereva, Elena V; Evkaikina, Anastasiia I; Ivanova, Alexandra N; Voitsekhovskaja, Olga V

2017-09-01

The lateral mobility of integral components of thylakoid membranes, such as plastoquinone, xanthophylls, and pigment-protein complexes, is critical for the maintenance of efficient light harvesting, high rates of linear electron transport, and successful repair of damaged photosystem II (PSII). The packaging of the photosynthetic pigment-protein complexes in the membrane depends on their size and stereometric parameters which in turn depend on the composition of the complexes. Chlorophyll b (Chlb) is an important regulator of antenna size and composition. In this study, the lateral mobility (the mobile fraction size) of pigment-protein complexes and lipids in grana membranes was analyzed in chlorina mutants of Arabidopsis and barley lacking Chlb. In the Arabidopsis ch1-3 mutant, diffusion of membrane lipids decreased as compared to wild-type plants, but the diffusion of photosynthetic complexes was not affected. In the barley chlorina f2 3613 mutant, the diffusion of pigment-protein complexes significantly decreased, while the diffusion of lipids increased, as compared to wild-type plants. We propose that the size of the mobile fractions of pigment-protein complexes in grana membranes in vivo is higher than reported previously. The data are discussed in the context of the protein composition of antennae, characteristics of the plastoquinone pool, and production of reactive oxygen species in leaves of chlorina mutants.

Grain Composition and Functional Ingredients of Barley Varieties Created in Latvia

Directory of Open Access Journals (Sweden)

Šterna Vita

2015-09-01

Full Text Available Cereals, including barley, have been recognised as functional foods that provide beneficial effect on the health of the consumer and decrease the risk of various diseases. The aim of investigation was to determine the grain composition of barley varieties and perspective breeding lines bred in Latvia and to evaluate its functional ingredients. The results of analysis showed that protein content among varieties ranged from 106.6-146.8 g·kg-1, total dietary fibre 187.4-208.2 g·kg-1, β-glucans 42.8 g-49.4 g·kg-1, and amount of α-tocopherol 6.03-8.93 mg·kg-1. The sum of essential amino acids in barley grain samples was from 32.90 g·kg-1 to 38.71 g·kg-1. All varieties of hulled and hulless barley grain were found to be sources of protein with high biological value. Comparison of barley varieties bred in Latvia suggests that variety ‘Kornelija’ outperforms others in protein, dietary fibre and micronutrient content.

Metabolite Profiling of Barley Grains Subjected to Water Stress: To Explain the Genotypic Difference in Drought-Induced Impacts on Malting Quality

Directory of Open Access Journals (Sweden)

Xiaojian Wu

2017-09-01

Full Text Available Grain weight and protein content will be reduced and increased, respectively, when barley is subjected to water stress after anthesis, consequently deteriorating the malt quality. However, such adverse impact of water stress differs greatly among barley genotypes. In this study, two Tibetan wild barley accessions and two cultivated varieties differing in water stress tolerance were used to investigate the genotypic difference in metabolic profiles during grain-filling stage under drought condition. Totally, 71 differently accumulated metabolites were identified, including organic acids, amino acids/amines, and sugars/sugar alcohols. Their relative contents were significantly affected by water stress for all genotypes and differed distinctly between the wild and cultivated barleys. The principal component analysis of metabolites indicated that the Tibetan wild barley XZ147 possessed a unique response to water stress. When subjected to water stress, the wild barley XZ147 showed the most increase of β-amylase activity among the four genotypes, as a result of its higher lysine content, less indole-3-acetic acid (IAA biosynthesis, more stable H2O2 homeostasis, and more up-regulation of BMY1 gene. On the other hand, XZ147 had the most reduction of β-glucan content under water stress than the other genotypes, which could be explained by the faster grain filling process and the less expression of β-glucan synthase gene GSL7. All these results indicated a great potential for XZ147 in barley breeding for improving water stress tolerance.

Secretory expression of functional barley limit dextrinase by Pichia pastoris using high cell-density fermentation

DEFF Research Database (Denmark)

Vester-Christensen, Malene Bech; Abou Hachem, Maher; Næsted, Henrik

2010-01-01

biosynthesis by trimming of intermediate branched alpha-glucan structures. Highly active barley LD is obtained by secretory expression during high cell-density fermentation of Pichia pastoris. The LD encoding gene fragment without signal peptide was subcloned in-frame with the Saccharomyces cerevisiae alpha...

Kinetics, improved activity and thermostability of endoglucanase and beta glucosidase from a mutant-derivative of aspergillus niger ms82

International Nuclear Information System (INIS)

Sohail, M.; Ahmad, A.; Khan, S.A.; Uddin, F.

2013-01-01

A mutant MS301 of Aspergillus niger MS82 showed 1.5 to 2.5-fold improved endoglucanase and beta-glucosidase activity when grown on crude lignocellulosic substrates under solid-state and submerged conditions. Indicators of thermal stability of enzymes (Tm and T1/2) showed that the wild type and mutant endoglucanase was more heat-resistant compared to beta-glucosidase. However, mutant and parent enzymes shared almost the same values for melting temperatures and half-lives. Endoglucanase and beta-glucosidase from both the strains showed optimum activity under acidic pH. Energy of activation (Ea) of mutant beta-glucosidase was substantially lower than the parent enzyme while Ea of mutant endoglucanase was slightly less than the parent. The lowered Ea values can be attributed to the improved beta-glucosidase activity of the mutant strain. Moreover, the MS301 enzymes were better in hydrolyzing purified and crude cellulosic materials than the parent MS82. (author)

Breeding of proanthocyanidin free malting barley

International Nuclear Information System (INIS)

Andersen, Anna Maria

1990-01-01

Full text: Haze formation in stored beer is due to colloidal precipitation of proteins with polyphenols of which proanthocyanidins are the most important group. 70-80% of proanthocyanidin in beer are from barley malt. Today breweries attain haze stability by using enzymes, additives or adsorbents. A better solution would be to remove proanthocyanidins. Carlsberg Plant Breeding uses induced mutations to breed proanthocyanidin-free malting barley. After mutagen treatment with sodium azide M1 seeds are planted in the field and M2 seeds are harvested in bulk. A single seed, non-destructive method has been developed to identify mutant kernels lacking proanthocyanidins in the testa. The method involves the inclusion of M2 seeds - 50 at a time - in semisolid clay blocks, whereafter a small part of the endosperm, testa and pericarp are exposed by sanding the seeds. The clay block is then placed in a vanillin-HCI solution so that the uncovered tissues can react with the solution. A red colour will develop in the testa of normal seeds, whereas the testa layers of proanthocyanid-free seeds remain colourless. So far, more than 600 mutants have been induced in over 100 barley varieties, spring as well as winter-types, from barley producing areas around the world. The mutants can be assigned to at least 7 loci, all of which can block the biosynthetic pathway for the proanthocyanidins. Mutants in the ant-18 and ant-19 loci show poor kernel development. Only a few mutants are known in the ant-12, ant-22 and ant-25 loci. Breeding work is focussed on mutants belonging to the ant-13 and ant-17 loci. Whereas the malting quality of ant-17 lines suffer from apparent abnormal enzyme development in the aleurone layer, this defect does not exist in ant-13 lines. Brewing trials with proanthocyanidin-free malt have shown excellent haze stability without changes in beer flavour. Breeding work based on the ant-13 lines led to disease resistant lines with good malting quality, while grain yield

Barley grain for ruminants: A global treasure or tragedy

Directory of Open Access Journals (Sweden)

Nikkhah Akbar

2012-07-01

Full Text Available Abstract Barley grain (Hordeum vulgare L. is characterized by a thick fibrous coat, a high level of ß-glucans and simply-arranged starch granules. World production of barley is about 30 % of that of corn. In comparison with corn, barley has more protein, methionine, lysine, cysteine and tryptophan. For ruminants, barley is the third most readily degradable cereal behind oats and wheat. Due to its more rapid starch fermentation rate compared with corn, barley also provides a more synchronous release of energy and nitrogen, thereby improving microbial nutrient assimilation. As a result, feeding barley can reduce the need for feeding protected protein sources. However, this benefit is only realized if rumen acidity is maintained within an optimal range (e.g., > 5.8 to 6.0; below this range, microbial maintenance requirements and wastage increase. With a low pH, microbial endotoxines cause pro-inflammatory responses that can weaken immunity and shorten animal longevity. Thus, mismanagement in barley processing and feeding may make a tragedy from this treasure or pearl of cereal grains. Steam-rolling of barley may improve feed efficiency and post-rumen starch digestion. However, it is doubtful if such processing can improve milk production and feed intake. Due to the need to process barley less extensively than other cereals (as long as the pericarp is broken, consistent and global standards for feeding and processing barley could be feasibly established. In high-starch diets, barley feeding reduces the need for capacious small intestinal starch assimilation, subsequently reducing hindgut starch use and fecal nutrient loss. With its nutritional exclusivities underlined, barley use will be a factual art that can either matchlessly profit or harm rumen microbes, cattle production, farm economics and the environment.

The experience of induction of mutation on barley in Peru

International Nuclear Information System (INIS)

Romero Loli, M.; Pozo Cardenas, M.; Gomez Pando, L.

1984-01-01

Work on induced mutation of barley was started in 1978 under the Programme of Cereal Improvement. Barley was irradiated with gamma radiation at doses of 12, 15, 18, 21, and 24 Krad. Radiation doses of 18 and 21 Krad gave the highest frequency of albino and cloroticos mutants. Induced mutation is being carried out in different parts of the country to develop mutants having early germination property. These mutants will play an important role in the late cultivation in the mountain areas of Peru

Role of the synthase domain of Ags1p in cell wall alpha-glucan biosynthesis in fission yeast

NARCIS (Netherlands)

Vos, Alina; Dekker, Nick; Distel, Ben; Leunissen, Jack A. M.; Hochstenbach, Frans

2007-01-01

The cell wall is important for maintenance of the structural integrity and morphology of fungal cells. Besides beta-glucan and chitin, alpha-glucan is a major polysaccharide in the cell wall of many fungi. In the fission yeast Schizosaccharomyces pombe, cell wall alpha-glucan is an essential

Variation in the leaf sodium content of the Hordeum vulgare (barley) cultivar Maythorpe and its derived mutant cv. Golden Promise

International Nuclear Information System (INIS)

Forster, B.P.; Pakniyat, H.; Macaulay, M.; Matheson, W.; Phillips, M.S.; Thomas, W.T.B.; Powell, W.

1994-01-01

Tests for shoot and root sodium content were carried out on various barley cultivars (Hordeum vulgare) and experimental lines including wild barley (H. spontaneum) and derivatives. Lines were grown in hydroculture with and without the addition of salt (NaCl), and sodium concentrations in shoots and roots were determined. Variation in shoot sodium content was found between the various lines; in contrast, no significant differences were found between the lines tested for root sodium content. The most significant finding was the variation in shoot sodium content between the two cultivars Golden Promise and Maythorpe. Golden Promise is a direct gamma-ray induced mutant of the cultivar Maythorpe and the reduced shoot sodium content of Golden Promise can be attributed to radiation treatment. (author)

Useful mutations in Iraqi black barley

International Nuclear Information System (INIS)

Ibrahim, I.F.

1989-01-01

Full text: Barley (Hordeum vulgare L.) is an important fodder crop in Iraq, with a cultivated area of about 1 392 375 ha and a total production of about 838500 t. The 2-row black barley ''LBB'' is the most desirable one in semi-arid zone in northern part of Iraq, because of its drought tolerance and high protein content. However, this cultivar is susceptible to powdery mildew, and lodges. Gamma rays and EMS were used to induce mutations in ''LBB'' and its hybrid with A rivat''. Nine mutants with improved lodging were selected during the first six generations. Five mutants INRC-BB-1, INRC-BB-3, INRC-BBR-4A, INRC-HB-552 and INRC-HB-553 were resistant to powdery mildew while 2 mutants INRC-BBH-1 and INRC-HBR-3 were moderately resistant. Two mutants INRC-BB-123 and INRC-HBR-3 were also resistant to drought under 350-400 mm rainfall. Three mutants INRC-BB-1, INRC-HBR-3 and INRC-HBR-88 exceeded their original variety in seed weight per spike and TKW. (author)

Transcriptome assembly and analysis of Tibetan Hulless Barley (Hordeum vulgare L. var. nudum developing grains, with emphasis on quality properties.

Directory of Open Access Journals (Sweden)

Xin Chen

Full Text Available BACKGROUND: Hulless barley is attracting increasing attention due to its unique nutritional value and potential health benefits. However, the molecular biology of the barley grain development and nutrient storage are not well understood. Furthermore, the genetic potential of hulless barley has not been fully tapped for breeding. METHODOLOGY/PRINCIPAL FINDINGS: In the present study, we investigated the transcriptome features during hulless barley grain development. Using Illumina paired-end RNA-Sequencing, we generated two data sets of the developing grain transcriptomes from two hulless barley landraces. A total of 13.1 and 12.9 million paired-end reads with lengths of 90 bp were generated from the two varieties and were assembled to 48,863 and 45,788 unigenes, respectively. A combined dataset of 46,485 All-Unigenes were generated from two transcriptomes with an average length of 542 bp, and 36,278 among were annotated with gene descriptions, conserved protein domains or gene ontology terms. Furthermore, sequences and expression levels of genes related to the biosynthesis of storage reserve compounds (starch, protein, and β-glucan were analyzed, and their temporal and spatial patterns were deduced from the transcriptome data of cultivated barley Morex. CONCLUSIONS/SIGNIFICANCE: We established a sequences and functional annotation integrated database and examined the expression profiles of the developing grains of Tibetan hulless barley. The characterization of genes encoding storage proteins and enzymes of starch synthesis and (1-3;1-4-β-D-glucan synthesis provided an overview of changes in gene expression associated with grain nutrition and health properties. Furthermore, the characterization of these genes provides a gene reservoir, which helps in quality improvement of hulless barley.

A flavonoid mutant of barley (Hordeum vulgare L.) exhibits increased sensitivity to UV-B radiation in the primary leaf

International Nuclear Information System (INIS)

Reuber, S.; Bornman, J.F.; Weissenböck, G.

1996-01-01

The aim of the present investigation was to define the role of soluble flavonoids as UV-B protectants in the primary leaf of barley (Hordeum vulgare L.). For this purpose we used a mutant line (Ant 287) from the Carlsberg collection of proanthocyanidin-free barley containing only 7% of total extractable flavonoids in the primary leaf as compared to the mother variety (Hiege 550/75). Seven-day-old leaves from plants grown under high visible light with or without supplementary UV-B radiation were used for the determination of UV-B sensitivity. UV-B-induced changes were assessed from parameters of chlorophyll fluorescence of photosystem II, including initial and maximum fluorescence, apparent quantum yield, and photochemical and non-photochemical quenching. A quartz fibre-optic microprobe was used to evaluate the amount of potentially harmful UV-B (310 nm radiation) penetrating into the leaf as a direct consequence of flavonoid deficiency. Our data indicate an essential role of flavonoids in UV-B protection of barley primary leaves. In leaves of the mutant line grown under supplementary UV-B, an increase in 310nm radiation in the mesophyll and a strong decrease in the quantum yield of photosynthesis were observed as compared to the corresponding mother variety. Primary leaves of liege responded to supplementary UV-B radiation with a 30% increase in the major flavonoid saponarin and a 500% increase in the minor compound lutonarin. This is assumed to be an efficient protective response since no changes in variable chlorophyll fluorescence were apparent. In addition, a further reduction in UV-B penetration into the mesophyll was recorded in these leaves

Immunostimulatory properties and antitumor activities of glucans (Review)

Czech Academy of Sciences Publication Activity Database

Vannucci, Luca; Křižan, Jiří; Šíma, Petr; Stakheev, Dmitry; Čaja, Fabian; Rajsiglová, Lenka; Horák, Vratislav; Saieh, M.

2013-01-01

Roč. 43, č. 2 (2013), s. 357-364 ISSN 1019-6439 Institutional support: RVO:61388971 ; RVO:67985904 Keywords : beta-glucans * polysaccharides * immunity Subject RIV: EE - Microbiology, Virology; FD - Oncology ; Hematology (UZFG-Y) Impact factor: 2.773, year: 2013

Avaliação dos teores de fibra alimentar e de beta-glicanas em cultivares de aveia (Avena sativa L Evaluation of dietary fiber and beta-glucan levels in oat (Avena sativa L cultivars

Directory of Open Access Journals (Sweden)

Luiz C. GUTKOSKI

1999-12-01

Full Text Available A fibra alimentar é composta por celulose, hemiceluloses, gomas, pectinas e mucilagens sendo classificada em solúvel e insolúvel, quanto a sua solubilidade em água. As beta-glicanas são componentes da fibra alimentar solúvel presentes na aveia e sua importância é devido às propriedades funcionais e aos efeitos hipocolesterolêmicos e hipoglicêmicos apresentados. O presente trabalho tem como objetivo avaliar os teores de fibra alimentar solúvel, insolúvel e total e de beta-glicanas de cultivares de aveia recomendados pela Comissão Brasileira de Pesquisa de Aveia. Grãos de aveia (Avena sativa, L foram descascados, as cariopses moídas e as amostras acondicionadas e armazenadas à temperatura de -20° C. Para a análise de fibra alimentar foi adotada a metodologia da AOAC (1997. Entre os cultivares analisados, UPF 7, UPF 13, UPF 14 e UPF 16 apresentaram os maiores teores de fibra alimentar insolúvel. Os maiores teores de fibra alimentar solúvel foram verificados nos cultivares UFRGS 7, CTC 13, UPF 16 e CTC 2. O cultivar UPF 16 apresentou o maior teor de fibra alimentar total, seguido de UFRGS 7, CTC 13 e UFRGS 18. Para a determinação de beta-glicanas foi adotada a metodologia da AOAC (1997. Os maiores teores de beta-glicanas foram verificados nos cultivares UFRGS 7, UPF 14 e UFRGS 18.The dietary fiber is composed by cellulose, hemi-celluloses, gums, pectins, and mucilages, being classified as soluble or insoluble depending on its solubility in water. Beta-glucans are a fraction of the soluble dietary fiber, being important due to its functional properties and effects in reducing cholesterol and glucose. This work aimed at evaluating the levels of soluble, insoluble, and total dietary fiber, as well as the amount of beta-glucans, present in grains of oat cultivars recommended by the Brazilian Commission for Oat Research. Oat grains were hulled, the caryopses were ground and the samples packaged and stored at temperature of -20º

The Effects of Beta-Glucan Rich Oat Bread on Serum Nitric Oxide and Vascular Endothelial Function in Patients with Hypercholesterolemia

Directory of Open Access Journals (Sweden)

Faezeh Tabesh

2014-01-01

Full Text Available Introduction. Oats are high in soluble fibers and effective in reducing the risk of cardiovascular diseases (CVD. We assessed the effects of beta-glucan from oat bran on serum nitric oxide (NO endothelial function in patients with hypercholesterolemia. Method. Sixty hypercholesterolemic patients were randomly divided to receive an experimental bread rich in beta-glucan from oat bran (intervention or bread rich in wheat fiber (control for four weeks. All subjects had the same diet for two-week baseline period and hypocaloric diet for four weeks of intervention. Serum NO concentration and flow-mediated dilation (FMD were determined before and after the experiment. Results. Mean age of the participants was 51.1 ± 9.3 years and 65% (n=39 were female. After intervention, serum NO concentration increased by 50.2 ± 19.8 μmol/lit in the intervention group (P=0.017, but no change was observed in the control group (17.5 ± 27.5 μmol/lit; P=0.530. No change of FMD was observed in the intervention (0.48 ± 0.78%; P=0.546 or in the control group (0.59 ± 0.92%; P=0.533. Conclusion. Consumption of oat bread for four weeks increases serum NO concentration but has no effect on FMD. Further studies are warranted in this regard.

Structural comparison of arabinoxylans from two barley side-stream fractions.

Science.gov (United States)

Pitkänen, Leena; Tuomainen, Päivi; Virkki, Liisa; Aseyev, Vladimir; Tenkanen, Maija

2008-07-09

The structures of barley ( Hordeum vulgare) arabinoxylans isolated from two industrial side fractions, barley husks (BH) and barley fiber (BF), were characterized. Arabinoxylans were extracted with saturated barium hydroxide after enzymatic pretreatment. Barium hydroxide was selective toward arabinoxylans, and only a minor amount of glucose-containing material was coextracted. Acid methanolysis followed by gas chromatography, 1H NMR spectroscopy, and specific enzymatic treatments followed by anion exchange chromatography with pulse amperometric detection (HPAEC-PAD) revealed that the chemical structure of barley husk arabinoxylan (BHAX) clearly differed from that of barley fiber arabinoxylan (BFAX). BFAX was more branched, containing more beta-D-xylopyranosyl (beta-D-Xylp) residues carrying alpha-L-arabinofuranosyl (alpha-L-Araf) units at both O-2 and O-3 positions. BHAX, on the other hand, contained more 2-O-beta-D-Xyl p-alpha-L-Ara f substituents than BFAX. BHAX and BFAX also differed with respect to the hydrodynamic properties investigated with multidetector size exclusion chromatography. BFAX had a higher weight-average molar mass and larger hydrodynamic volume, the latter indicating less dense conformation than BHAX. Mn, Mw /Mn, Rh, and the Mark-Houwink a value were also determined for both arabinoxylans.

Barley genotypic β-glucan variation combined with enzymatic modifications direct its potential as a natural ingredient in a high fiber extract

DEFF Research Database (Denmark)

Mikkelsen, Mette S.; Meier, Sebastian; Jensen, Morten G.

2017-01-01

-glucan/l, providing European Food Safety Authority (EFSA) and U.S. Food and Drug Administration (FDA) recommended amounts (3 g β-glucan/day) from three portions. TAF extracts of Lys5f and KVL408 grains reached extraordinary high concentrations of 8- 9 g β-glucan/l. The β-glucan molecular mass decreased with enzyme...... robustness in Lys5f  and KVL408 raw materials favor these in a β-glucan rich extract with potential for EFSA and FDA health and Nutrition claims....

Beta-Glucans Improve Growth, Viability and Colonization of Probiotic Microorganisms

Directory of Open Access Journals (Sweden)

Daniela Fiocco

2012-05-01

Full Text Available Probiotics, prebiotics and synbiotics are frequently-used components for the elaboration of functional food. Currently, most of the commercialized probiotics are limited to a few strains of the genera Bifidobacteria, Lactobacillus and Streptococcus, most of which produce exopolysaccharides (EPS. This suggests that the beneficial properties of these microorganisms may be related to the biological activities of these biopolymers. In this work we report that a 2-substituted-(1,3-β-D-glucan of non-dairy bacterial origin has a prebiotic effect on three probiotic strains. Moreover, the presence of this β-D-glucan potentiates in vitro adhesion of the probiotic Lactobacillus plantarum WCFS1 to human intestinal epithelial cells.

Lactose in diet influences the degradation of mixed linked β(1-3;1-4)-D-glucan in the small intestine of pigs

DEFF Research Database (Denmark)

Knudsen, Knud Erik Bach

The objective of the current study was to investigate if lactose in diet would influence the degradation of mixed linked β(1–3;1–4)-D-glucan (β-glucan) in the small intestine. Β-glucan is an important cell wall (dietary fiber, DF) component of the endosperm of barley and oats. The digestibility...... of β-glucan in the small intestine from both cereals is among the highest of all DF components, but in one particular study with oat-based diets it was significantly lower than what was found in other studies. In this study whey protein containing lactose was used as protein supplement. Lactose...... is slowly digestible in the small intestine. To investigate if lactose could be causative for the lower digestibility of β-glucan in the study with whey protein, it was decided to quantify the content of lactose in the diets and to analyze for lactose in digesta samples from the small intestine (the small...

Geophysical and Geotechnical Characterization of Beta-1,3/1,6-glucan Biopolymer treated Soil

Science.gov (United States)

Chang, I.; Cho, G.

2012-12-01

Bacteria or microbes in soil excrete hydrocarbon (e.g. polysaccharide) by-products which are called biopolymers. These biopolymers (or sometime biofilms) recently begun to make a mark on soil erosion control, aggregate stabilization, and drilling enhancement. However, the biological effect on soil behavior (e.g. bio-clogging or bio-cementation) has been poorly understood. In this study, the bio-cementation and bio-clogging effect induced by the existence of β-1,3/1,6-glucan biopolymers in soil were evaluated through a series of geophysical and geotechnical characterization tests in laboratory. According to the experimental test results, as the β-1,3/1,6-glucan content in soil increases, the compressive strength and shear wave velocity increase (i.e., bio-cementation) while the hydraulic conductivity decreases (i.e., bio-clogging) but the electrical conductivity increases due to the high electrical conductivity characteristic of β-1,3/1,6-glucan fibers. Coefficient of consolidation variation with the increases of β-1,3/1,6-glucan content in soil. SEM image of β-1,3/1,6-glucan treated soil. Fibers are form matices with soil particles.

Development of functional spaghetti enriched in bioactive compounds using barley coarse fraction obtained by air classification.

Science.gov (United States)

Verardo, Vito; Gómez-Caravaca, Ana Maria; Messia, Maria Cristina; Marconi, Emanuele; Caboni, Maria Fiorenza

2011-09-14

Barley byproducts obtained by air classification have been used to produce a different barley functional spaghetti, which were compared to different commercial whole semolina samples. Total, insoluble, and soluble fiber and β-glucan contents of the barley spaghetti were found to be greater than those of commercial samples. Furthermore, it was proved that barley spaghetti reached the FDA requirements, which could allow these pastas to deserve the health claims "good source of dietary fiber" and "may reduce the risk of heart disease". When the barley coarse fraction was used, a flavan-3-ols enrichment and an increase of antioxidant activity were reported, while commercial samples showed the absence of flavan-3-ols and a higher presence of phenolic acids and tannins. Whole semolina commercial spaghetti had a significantly higher content of phenolic acids than semolina spaghetti samples. Besides, it was observed that when vital gluten was added to the spaghetti formulation, phenolic compounds were blocked in the gluten network and were partially released during the cooking process.

Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity

Energy Technology Data Exchange (ETDEWEB)

Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon [Konyand Univ., Daejeon (Korea, Republic of); Kim, Jae Hoon; Lee, Ju Woon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2010-07-01

In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-{gamma} and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation {beta}-glucan leads its biological functions to enhance immunomodulating and antitumor activity.

Randomized, double-blind, placebo-controlled, crossover study to evaluate the effects of beta-1,3/1,6 glucan on stress associated with daily lifestyle in healthy subjects

Directory of Open Access Journals (Sweden)

Yoshihiko Ojiri

2015-04-01

Full Text Available Background: Fatigue is attributable to physical and psychological stress. Fatigue is also a common symptom which occurs in both sick and healthy individuals. Although its mechanism of cause is complex, fatigue from stress is known to affect the existing equilibrium of the immune system. However, nutrition, such as beta-1,3/1,6 glucan, has been reported to play an important role in regulating stress and fatigue states, via modulating a weakened immune system. In this study, a popular and healthy beverage in Okinawa, Japan, containing a soluble baker’s yeast in black koji vinegar (Moromisu, was provided to healthy subjects with a non-strenuous daily lifestyle. Results: By performing statistical analysis on the results of the Profile of Mood States (POMS survey, we observed that overall study results (n=14 demonstrated significant differences in fatigue and confusion in the POMS factors. Conclusions: In this study we confirmed that beta-1,3/1,6 glucan improved some of the factors related to stress and fatigue, as indicated by evaluation of POMS survey results.

Screening for spontaneous virulent mutants of barley powdery mildew (Erysiphe graminis DC)

International Nuclear Information System (INIS)

Torp, J.; Jensen, H.P.

1989-01-01

Full text: Seedlings of 4 barley lines possessing resistance genes M1-a6, M1-a12 or M1-g were inoculated with powdery mildew culture CR3, which is a-virulent to the 4 host lines. In total, 50 million conidia were screened for the occurrence of virulent mutants, 43 putative virulent mutants were found. They could be grouped into 5 genotypes according to the virulence spectrum. They might have originated by one of the following events: 1. admixture, 2. physiological events that allow a few conidia to establish colonies in spite of the presence of a functional gene for resistance, 3. mutation in a gene for specificity, 4. deletion or mutation in some kind of suppressing element in which case more than one virulence may be affected. Based upon the virulence spectra, mating type, biochemical tests and analysis of test crosses, 3 of the genotypes were clearly classified as not being of mutational origin. Of the two remaining genotypes one differed in 4 virulences, the other by two virulences and one avirulence. Based upon expectations from the gene-for-gene concept, it is concluded that both were not of mutational origin. If in fact there are derived from a mutation, the concept of gene-for-gene interactions would have to be revised. Assuming that no mutations for virulence were found in this experiment, the spontaneous mutation frequency from avirulence to virulence would be below 2x10 -8 . (author)

Genetic mapping of the barley lodging resistance locus Erectoides-k

DEFF Research Database (Denmark)

Kristensen, Peter Skov; Dockter, Christoph; Lundqvist, Udda

2016-01-01

’ is a semi-dwarf barley cultivar known for its culm stability and resistance to lodging. In total, eight allelic ert-k mutants are known that show different phenotypic strength concerning culm length and spike architecture. They represent alternatives to the widely used, but pleiotropic ‘Green Revolution...... provides a solid foundation for the identification of the underlying mutations causing the ert-k lodging-resistant phenotype. In addition, the linked markers could be used to follow the ert-k mutant genotype in marker-assisted selection of new lodging-resistant barley cultivars....

Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)

OpenAIRE

Jiménez, Natalia Ivonne Vera; Nielsen, Michael Engelbrecht; Lindenstrøm, Thomas

2012-01-01

Immune modulators are compounds capable to interact with the immune system and to modify the host response. This interaction enhances non-specific defense mechanisms, improving health and promoting survival. β-glucans are glucose polysaccharides present in sea weed, bacteria, fungi and cereal but not in animals. β-glucans are commonly used as immune modulators, but the mechanisms through which the modulation is achieved remains to be understood. Wound healing and tissue regeneration are essen...

Structural characterization and evaluation of antioxidant, anticancer and hypoglycemic activity of radiation degraded oat (Avena sativa) β- glucan

Science.gov (United States)

Hussain, Peerzada R.; Rather, Sarver A.; Suradkar, Prashant P.

2018-03-01

Oat β-D-glucan after extraction was degraded at doses of 3, 6, 9, 12 and 15 kGy. The average molecular weight decreased to 45 kDa at dose of 15 kGy from an initial value of 200 kDa in native sample. XRD analysis revealed no significant change in diffraction pattern of irradiated samples when compared with control, except a decrease in intensity of x-ray diffraction. The results of the antioxidant activity revealed decrease in EC50 values and corresponding increase in antioxidant activity of radiation degraded oat β-D-glucan. Results of the anticancer studies indicated that cytotoxicity of gamma irradiated oat β-D-glucan in cancer cell lines was highest against colo-205 and MCF7 cancer cells compared to T47D cell and no cytotoxicity was observed in normal cell lines at all concentrations used. Evaluation of hypoglycemic activity showed highest inhibition in α-glucosidase activity compared to α-amylase activity due to gamma irradiation of oat β-D-glucan. Comparison of the EC50 values of known standards and gamma irradiated oat beta-glucan samples indicates that radiation treatment significantly modified the biological activity of the beta-glucan samples. Therefore, it is suggested that gamma irradiation can be used for producing low molecular weight oat β-D-glucan; which can help in modifying the biological activities.

A screening method for β-glucan hydrolase employing Trypan Blue-coupled β-glucan agar plate and β-glucan zymography.

Science.gov (United States)

Park, Chang-Su; Yang, Hee-Jong; Kim, Dong-Ho; Kang, Dae-Ook; Kim, Min-Soo; Choi, Nack-Shick

2012-06-01

A new screening method for β-(1,3-1,6) glucan hydrolase was developed using a pure β-glucan from Aureobaisidum pullulans by zymography and an LB-agar plate. Paenibacillus sp. was screened as a producer a β-glucan hydrolase on the Trypan Blue-coupled β-glucan LB-agar plate and the activity of the enzyme was analyzed by SDS-β-glucan zymography. The β-glucan was not hydrolyzed by Bacillus spp. strains, which exhibit cellulolytic activity on CMC zymography. The gene, obtaining by shotgun cloning and encoding the β-glucan hydrolase of Paenibacillus sp. was sequenced.

Construction and functional characterization of double and triple mutants of parallel beta-bulge of ubiquitin.

Science.gov (United States)

Sharma, Mrinal; Prabha, C Ratna

2011-12-01

Ubiquitin, a small eukaryotic protein serving as a post-translational modification on many important proteins, plays central role in cellular homeostasis and cell cycle regulation. Ubiquitin features two beta-bulges, the second beta-bulge, located at the C-terminal region of the protein along with type II turn, holds 3 residues Glu64(1), Ser65(2) and Gln2(X). Percent frequency of occurrence of such a sequence in parallel beta-bulge is very low. However, the sequence and structure have been conserved in ubiquitin through out the evolution. Present study involves replacement of residues in unusual beta-bulge of ubiquitin by introducing mutations in combination through site directed mutagenesis, generating double and triple mutants and their functional characterization. Mutant ubiquitins cloned in yeast expression vector YEp96 tested for growth profile, viability assay and heat stress complementation study have revealed significant decrease in growth rate, loss of viability and non-complementation of heat sensitive phenotype with UbE64G-S65D and UbQ2N-E64G-S65D mutations. However, UbQ2N-S65D did not show any negative effects in the above assays. Present results show that, replacement of residues in beta-bulge of ubiquitin exerts severe effects on growth and viability in Saccharomyces cerevisiae due to functional failure of the mutant ubiquitins UbE64G-S65D and UbQ2N-E64G-S65D.

Heredity, physiology and malt quality analysis of albino-lemma barley

International Nuclear Information System (INIS)

Jin Ting; Wu Kuanran; Yang Jianming; Jia Qiaojun; Wang Junmei; Hua Wei; Chen He; Qiao Hailong

2013-01-01

The barley 0601 is a spontaneous albino-lemma mutant from beer barley cultivar Supi3. Genetic control of albino-lemma trait in the mutant 0601 and, the agronomic traits (thousand kernel weight, kernel plumpness), physiological traits (chlorophyll content, proanthocyanidin content) and major malt qualities (diastatic power, malt extract, Kolbach index) were investigated. The results showed that the albino-lemma trait is controlled by one recessive gene, and there were significant differences between the mutant and its wild-type in thousand kernel weight, kernel plumpness, chlorophyll content, diastatic power, and the malt extract, whereas no significant difference in proanthocyanidin content was found. These results provide the basis on mapping and cloning the albino-lemma gene and also provide good material for genetic research. (authors)

Comparative Studies on Callose Formation in Powdery Mildew Compatible and Incompatible Barley

DEFF Research Database (Denmark)

Skou, Jens-Peder; Jørgensen, Jørgen Helms; Lilholt, Ulla

1984-01-01

Callose formation in barley mutants, lines and varieties with different genes for resistance to powdery mildew in seven different loci was compared. Only barley with resistance genes in the ml-o locus showed so early a callose formation passing off at such a high rate that it prevented fungal...... penetration Ml-(La) resistant varieties and near-isogenic lines in 'Manchuria' with resistance genes in 5 other loci showed only a tendency to a larger callose formation than their susceptible counterparts after inoculation with avirulent as well as virulent powdery mildew. The callose formation in ml......-o resistant barley was independent of the powdery mildew culture applied. This supports the hypothesis set forth as to why the ml-o mutants are resistant against all known cultures or races of barley powdery mildew, and why this resistance may be more durable than other powdery mildew resistances...

Factors influencing beta-amylase activity in sorghum malt

CSIR Research Space (South Africa)

Taylor, JRN

1993-09-01

Full Text Available isozyme of pI approximately 4.4-4.5, unlike the many isozymes all of higher pI in barley. However, like barley, sorghum beta-amylase was more temperature-labile than its alpha-amylase. Beta-amylase activity in sorghum malt was increased by germination time...

Characterization and genetic mapping of eceriferum-ym (cer-ym), a cutin deficient barley mutant with impaired leaf water retention capacity.

Science.gov (United States)

Li, Chao; Liu, Cheng; Ma, Xiaoying; Wang, Aidong; Duan, Ruijun; Nawrath, Christiane; Komatsuda, Takao; Chen, Guoxiong

2015-09-01

The cuticle covers the aerial parts of land plants, where it serves many important functions, including water retention. Here, a recessive cuticle mutant, eceriferum-ym (cer-ym), of Hordeum vulgare L. (barley) showed abnormally glossy spikes, sheaths, and leaves. The cer-ym mutant plant detached from its root system was hypersensitive to desiccation treatment compared with wild type plants, and detached leaves of mutant lost 41.8% of their initial weight after 1 h of dehydration under laboratory conditions, while that of the wild type plants lost only 7.1%. Stomata function was not affected by the mutation, but the mutant leaves showed increased cuticular permeability to water, suggesting a defective leaf cuticle, which was confirmed by toluidine blue staining. The mutant leaves showed a substantial reduction in the amounts of the major cutin monomers and a slight increase in the main wax component, suggesting that the enhanced cuticle permeability was a consequence of cutin deficiency. cer-ym was mapped within a 0.8 cM interval between EST marker AK370363 and AK251484, a pericentromeric region on chromosome 4H. The results indicate that the desiccation sensitivity of cer-ym is caused by a defect in leaf cutin, and that cer-ym is located in a chromosome 4H pericentromeric region.

Phenotypic and Physiological Evaluation of Two and Six Rows Barley under Different Environmental Conditions.

Science.gov (United States)

Naser, Mahmoud; Badran, Mohamed; Abouzied, Hanaa; Ali, Heba; Elbasyoni, Ibrahim

2018-05-04

In recent years, barley has attracted more interest as a food and feed source because of its high soluble dietary fiber and β-glucan content compared with other small grains. Twenty-five barley genotypes (20 imported genotypes and five check cultivars) were grown in three environments for two successive seasons: 2015/2016 and 2016/2017. The first environment was in El-Nubaria, Alexandria, Egypt during 2015/2016, while the second and third environments were in El-Bostan, Elbhera, Egypt during 2015/2016 and 2016/2017. The experiments were conducted in a randomized complete block design with the three replicates. The primary objectives of the current study were to evaluate the performance of 20 imported barley genotypes under several environmental conditions. The imported materials were superior to the local commercial cultivars for several traits, including grain yield. Therefore, the superior genotypes will be further evaluated and used in barley breeding programs. Our future work will focus on creating several crosses among the selected superior genotypes to improve yield and other important traits, while applying marker-assisted selection.

Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)

DEFF Research Database (Denmark)

Jiménez, Natalia Ivonne Vera

by hydrogen peroxide. To determine the effect of hydrogen peroxide release in fibroblast proliferation during wound healing, scratch-wounded CCB fibroblasts were stimulated with different doses of hydrogen peroxide and the wound closure was followed by image analysis. Fibroblast stimulation with low doses...... suitable for tissue regeneration or oxidative stress. To conclude, β-glucan treatment enhanced wound closure in carp, probably due to the enhancement of a localized inflammatory response. The wound healing modulatory effect of β-glucan seems to be orchestrated by the immune system, since no direct effect...

Preparation and characteristics of beta-glucan concentrate from brewer's yeast as the additive substance in foods

Directory of Open Access Journals (Sweden)

Ľubomír Mikuš

2013-02-01

Full Text Available Normal 0 21 false false false SK X-NONE X-NONE The brewer¢s yeast was used for preparation of concentrate with content of β-glucan. Hot water extraction (100°C, 5 hours and subsequently an alkaline extraction of sediment using 1 M NaOH at 90°C for 1 hour were used. β-glucan concentrate containing 59,15 % of β-glucan had good functional properties (water binding capacity 13,34 g water/1 g concentrate, fat binding capacity 6,86 g fat/1 g concentrate and indicated biological action too.  At concentration of 2 mg/ml DMSO (dimethylsulfoxid was viability of murine L1210 leukemic cells reduced to 76.15 %. When observing the antioxidant activity it was identified, that the lipid peroxidation in linoleic acid samples was decreased during the presence of β-glucan concentrate. These results and good sensory properties like a bright colour and the pleasant taste and smell indicate, that prepared β-glucan concentrate has a potential to be used to improve the health – beneficial substances in the foods.doi:10.5219/258

A Candida biofilm-induced pathway for matrix glucan delivery: implications for drug resistance.

Directory of Open Access Journals (Sweden)

Heather T Taff

Full Text Available Extracellular polysaccharides are key constituents of the biofilm matrix of many microorganisms. One critical carbohydrate component of Candida albicans biofilms, β-1,3 glucan, has been linked to biofilm protection from antifungal agents. In this study, we identify three glucan modification enzymes that function to deliver glucan from the cell to the extracellular matrix. These enzymes include two predicted glucan transferases and an exo-glucanase, encoded by BGL2, PHR1, and XOG1, respectively. We show that the enzymes are crucial for both delivery of β-1,3 glucan to the biofilm matrix and for accumulation of mature matrix biomass. The enzymes do not appear to impact cell wall glucan content of biofilm cells, nor are they necessary for filamentation or biofilm formation. We demonstrate that mutants lacking these genes exhibit enhanced susceptibility to the commonly used antifungal, fluconazole, during biofilm growth only. Transcriptional analysis and biofilm phenotypes of strains with multiple mutations suggest that these enzymes act in a complementary fashion to distribute matrix downstream of the primary β-1,3 glucan synthase encoded by FKS1. Furthermore, our observations suggest that this matrix delivery pathway works independently from the C. albicans ZAP1 matrix formation regulatory pathway. These glucan modification enzymes appear to play a biofilm-specific role in mediating the delivery and organization of mature biofilm matrix. We propose that the discovery of inhibitors for these enzymes would provide promising anti-biofilm therapeutics.

Demarcation of mutant-carrying regions in barley plants after ethylmethane-sulfonate seed treatment

DEFF Research Database (Denmark)

Jacobsen, P.

1966-01-01

The branching pattern of the barley plant is analyzed and the anatomical structure of the resting barley embryo studied in longitudinal and cross-sections as well as by dissection techniques. The frequency and distribution of ethylmethane-sulfonate induced chloroplast and morphological seedling...

The effects of orally administered Beta-glucan on innate immune responses in humans, a randomized open-label intervention pilot-study.

Directory of Open Access Journals (Sweden)

Jenneke Leentjens

Full Text Available To prevent or combat infection, increasing the effectiveness of the immune response is highly desirable, especially in case of compromised immune system function. However, immunostimulatory therapies are scarce, expensive, and often have unwanted side-effects. β-glucans have been shown to exert immunostimulatory effects in vitro and in vivo in experimental animal models. Oral β-glucan is inexpensive and well-tolerated, and therefore may represent a promising immunostimulatory compound for human use.We performed a randomized open-label intervention pilot-study in 15 healthy male volunteers. Subjects were randomized to either the β -glucan (n = 10 or the control group (n = 5. Subjects in the β-glucan group ingested β-glucan 1000 mg once daily for 7 days. Blood was sampled at various time-points to determine β-glucan serum levels, perform ex vivo stimulation of leukocytes, and analyze microbicidal activity.β-glucan was barely detectable in serum of volunteers at all time-points. Furthermore, neither cytokine production nor microbicidal activity of leukocytes were affected by orally administered β-glucan.The present study does not support the use of oral β-glucan to enhance innate immune responses in humans.ClinicalTrials.gov NCT01727895.

Yield improvement in barley by using gamma-irradiation

International Nuclear Information System (INIS)

Benamer, Ibrahim Mohammed

1990-01-01

Breeding work for barley improvement in Libya is very rare. All varieties grown here are foreign varieties. Yield per hectare is low compared with other countries having similar climatic conditions. Productivity, lodging, disease resistance, drought and salt tolerance are the main characteristics that need to be improved. A mutation breeding programme for barley improvement was initiated at the Tajoura Nuclear Research Centre in 1983-1984. The objectives of this programme are the development of new lines that could be used directly or indirectly in the development of new varieties. The locally adapted barley (Hordeum vulgare L.) variety ''California Mariout'' was used as a parent material. Grains with 14% moisture were exposed to 200 Gy gamma-ray from 60 Co source at the Centre. Three experiments were conducted during 1986-1989. From the first experiment (1986-1987), 62 mutant lines were evaluated. From the second and third experiments (1987-1989), only seven mutant lines were evaluated. In the 1988-1989 experiment, the crop was irrigated and fertilised with 0, 100 and 200 kgN/ha. Lodging score was low in 0 kgN/ha and increased significantly by the increase in N level. None of the mutant lines more lodging resistant than the parent or the control. However, yield differences were significant and the application of 100 kgN/ha increased the grain yield

Effect of Immune-Enhancing Enteral Nutrition Enriched with or without Beta-Glucan on Immunomodulation in Critically Ill Patients

Directory of Open Access Journals (Sweden)

Jae Gil Lee

2016-06-01

Full Text Available We investigated whether high-protein enteral nutrition with immune-modulating nutrients (IMHP enriched with β-glucan stimulates immune function in critically ill patients. In a randomized double-blind placebo-controlled study, 30 patients consumed one of three types of enteral nutrition: a control or IMHP with and without β-glucan. The IMHP with β-glucan group showed increases in natural killer (NK cell activities relative to the baseline, and greater increases were observed in NK cell activities relative to the control group after adjusting for age and gender. The IMHP groups with and without β-glucan had greater increases in serum prealbumin and decreases in high-sensitivity C-reactive protein (hs-CRP than the control group. The control group had a greater decrease in peripheral blood mononuclear cell (PBMC interleukin (IL-12 production than the IMHP with and without β-glucan groups. In all patients, the change (Δ in hs-CRP was correlated with Δ prealbumin and Δ PBMC IL-12, which were correlated with ΔNK cell activity and Δ prealbumin. This study showed beneficial effects of a combination treatment of β-glucan and IMHP on NK cell activity. Additionally, strong correlations among changes in NK cell activity, PBMC IL-12, and hs-CRP suggested that β-glucan could be an attractive candidate for stimulating protective immunity without enhanced inflammation (ClinicalTrials.gov: NCT02569203.

Complementary sample preparation strategies for analysis of cereal β-glucan oxidation products by UPLC-MS/MS

Science.gov (United States)

Boulos, Samy; Nyström, Laura

2017-11-01

The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO•) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO•-attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random HO�

Hypoglycemic activity of polysaccharide fractions containing ß-glucans from extracts of Rhynchelytrum repens (Willd. C.E. Hubb., Poaceae

Directory of Open Access Journals (Sweden)

A.C.C.F.F. De Paula

2005-06-01

Full Text Available ß-Glucans are soluble fibers with physiological functions, such as interference with absorption of sugars and reduction of serum lipid levels. The objective of the present study was to analyze the distribution of ß-glucans in different tissues of the African grass species Rhynchelytrum repens and also to evaluate their hypoglycemic activity. Leaf blades, sheaths, stems, and young leaves of R. repens were submitted to extraction with 4 M KOH. Analysis of the fractions revealed the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of ß-glucan in these fractions was confirmed by hydrolyzing the polymers with endo-ß-glucanase from Bacillus subtilis, followed by HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues were subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers was similar (250 kDa to that of maize coleoptile ß-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes showed hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 h. This performance was better than that obtained with pure ß-glucan from barley, which decreased blood sugar levels for about 4 h. These results suggest that the activity of ß-glucans from R. repens is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.

The Dual Activity Responsible for the Elongation and Branching of β-(1,3-Glucan in the Fungal Cell Wall

Directory of Open Access Journals (Sweden)

Vishukumar Aimanianda

2017-06-01

Full Text Available β-(1,3-Glucan, the major fungal cell wall component, ramifies through β-(1,6-glycosidic linkages, which facilitates its binding with other cell wall components contributing to proper cell wall assembly. Using Saccharomyces cerevisiae as a model, we developed a protocol to quantify β-(1,6-branching on β-(1,3-glucan. Permeabilized S. cerevisiae and radiolabeled substrate UDP-(14Cglucose allowed us to determine branching kinetics. A screening aimed at identifying deletion mutants with reduced branching among them revealed only two, the bgl2Δ and gas1Δ mutants, showing 15% and 70% reductions in the branching, respectively, compared to the wild-type strain. Interestingly, a recombinant Gas1p introduced β-(1,6-branching on the β-(1,3-oligomers following its β-(1,3-elongase activity. Sequential elongation and branching activity of Gas1p occurred on linear β-(1,3-oligomers as well as Bgl2p-catalyzed products [short β-(1,3-oligomers linked by a linear β-(1,6-linkage]. The double S. cerevisiae gas1Δ bgl2Δ mutant showed a drastically sick phenotype. An ScGas1p ortholog, Gel4p from Aspergillus fumigatus, also showed dual β-(1,3-glucan elongating and branching activity. Both ScGas1p and A. fumigatus Gel4p sequences are endowed with a carbohydrate binding module (CBM, CBM43, which was required for the dual β-(1,3-glucan elongating and branching activity. Our report unravels the β-(1,3-glucan branching mechanism, a phenomenon occurring during construction of the cell wall which is essential for fungal life.

An extracellular cell-attached pullulanase confers branched α-glucan utilization in human gut Lactobacillus acidophilus

DEFF Research Database (Denmark)

Møller, Marie Sofie; Goh, Yong Jun; Rasmussen, Kasper Bøwig

2017-01-01

binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here we explore the specificity of a representative of this group of pullulanases, LaPul13_14 and its role in branched α-glucans metabolism in the well characterized Lactobacillus acidophilus...... in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by LaPul13_14 and is abolished in a mutant strain lacking a functional LaPul13_14 gene. Hydrolysis kinetics of recombinant LaPul13_14 confirmed the preference for short branched α-glucan oligomers....... Branched α-1,6-glucans in dietary starch and glycogen are non-degradable by human enzymes and constitute a metabolic resource for the gut microbiota. The role of health-beneficial lactobacilli prevalent in the human small intestine in starch metabolism remains unexplored in contrast to colonic bacterial...

Structural characterization of a mixed-linkage glucan deficient mutant reveals alteration in cellulose microfibril orientation in rice coleoptile mesophyll cell walls

Directory of Open Access Journals (Sweden)

Andreia Michelle Smith-Moritz

2015-08-01

Full Text Available The CELLULOSE SYNTHASE-LIKE F6 (CslF6 gene was previously shown to mediate the biosynthesis of mixed-linkage glucan (MLG, a cell wall polysaccharide that is hypothesized to be a tightly associated with cellulose and also have a role in cell expansion in the primary cell wall of young seedlings in grass species. We have recently shown that loss-of-function cslf6 rice mutants do not accumulate MLG in most vegetative tissues. Despite the absence of a structurally important polymer, MLG, these mutants are unexpectedly viable and only show a moderate growth compromise compared to wild type. Therefore these mutants are ideal biological systems to test the current grass cell wall model. In order to gain a better understanding of the role of MLG in the primary wall, we performed in-depth compositional and structural analyses of the cell walls of three day-old rice seedlings using various biochemical and novel microspectroscopic approaches. We found that cellulose content as well as matrix polysaccharide composition was not significantly altered in the MLG deficient mutant. However, we observed a significant change in cellulose microfibril bundle organization in mesophyll cell walls of the cslf6 mutant. Using synchrotron source Fourier Transform Mid-Infrared Spectromicroscopy for high-resolution imaging, we determined that the bonds associated with cellulose and arabinoxylan, another major component of the primary cell was of grasses, were in a lower energy configuration compared to wild type, suggesting a slightly weaker primary wall in MLG deficient mesophyll cells. Taken together, these results suggest that MLG may influence cellulose deposition in mesophyll cell walls without significantly affecting anisotropic growth thus challenging MLG importance in cell wall expansion.

Dimerization of the Glucan Phosphatase Laforin Requires the Participation of Cysteine 329

Science.gov (United States)

Sánchez-Martín, Pablo; Raththagala, Madushi; Bridges, Travis M.; Husodo, Satrio; Gentry, Matthew S.; Sanz, Pascual; Romá-Mateo, Carlos

2013-01-01

Laforin, encoded by a gene that is mutated in Lafora Disease (LD, OMIM 254780), is a modular protein composed of a carbohydrate-binding module and a dual-specificity phosphatase domain. Laforin is the founding member of the glucan-phosphatase family and regulates the levels of phosphate present in glycogen. Multiple reports have described the capability of laforin to form dimers, although the function of these dimers and their relationship with LD remains unclear. Recent evidence suggests that laforin dimerization depends on redox conditions, suggesting that disulfide bonds are involved in laforin dimerization. Using site-directed mutagenesis we constructed laforin mutants in which individual cysteine residues were replaced by serine and then tested the ability of each protein to dimerize using recombinant protein as well as a mammalian cell culture assay. Laforin-Cys329Ser was the only Cys/Ser mutant unable to form dimers in both assays. We also generated a laforin truncation lacking the last three amino acids, laforin-Cys329X, and this truncation also failed to dimerize. Interestingly, laforin-Cys329Ser and laforin-Cys329X were able to bind glucans, and maintained wild type phosphatase activity against both exogenous and biologically relevant substrates. Furthermore, laforin-Cys329Ser was fully capable of participating in the ubiquitination process driven by a laforin-malin complex. These results suggest that dimerization is not required for laforin phosphatase activity, glucan binding, or for the formation of a functional laforin-malin complex. Cumulatively, these results suggest that cysteine 329 is specifically involved in the dimerization process of laforin. Therefore, the C329S mutant constitutes a valuable tool to analyze the physiological implications of laforin’s oligomerization. PMID:23922729

Capsular glucan and intracellular glycogen of Mycobacterium tuberculosis: biosynthesis and impact on the persistence in mice

DEFF Research Database (Denmark)

Sambou, Tounkang; Dinadayala, Premkumar; Stadthagen, Gustavo

2008-01-01

Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence of these bact......Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence...... of these bacteria, orthologues of the glg genes involved in the biosynthesis of glycogen in Escherichia coli were identified in M. tuberculosis H37Rv and inactivated by allelic replacement. Biochemical analyses of the mutants and complemented strains indicated that the synthesis of glucan and glycogen involves...... the alpha-1,4-glucosyltransferases Rv3032 and GlgA (Rv1212c), the ADP-glucose pyrophosphorylase GlgC (Rv1213) and the branching enzyme GlgB (Rv1326c). Disruption of glgC reduced by half the glucan and glycogen contents of M. tuberculosis, whereas the inactivation of glgA and Rv3032 affected the production...

Fungi, beta-Glucan, and Bacteria in Nasal Lavage of Greenhouse Workers and Their Relation to Occupational Exposure

DEFF Research Database (Denmark)

Madsen, A. M.; Tendal, K.; Thilsing, T.

2013-01-01

occupational exposure to fungi, -glucan, and bacteria and contents of fungi, -glucan, and bacteria in nasal lavage (NAL) of greenhouse workers. We also studied whether contents of microorganisms in NAL were related to gender, time of the work week, and runny nose. NAL samples (n 135) were taken Monday morning....... The ratios of fungi in NAL between Thursday at noon and Monday morning were 14 (median value) for men and 3.5 for women. Gender had no effect on the exposure level but had a significant effect on the content of fungi, -glucan, and bacteria in NAL, with the highest contents in NAL of men. On Thursdays......, the median content of fungi in NAL samples of men without runny noses was 9408 cfu per NAL sample, whereas the same content for women was 595 cfu per NAL sample. Workers with runny noses had fewer fungi in NAL than workers without runny noses. A higher content of -glucan per fungal spore was found in NAL...

Cell wall α-1,3-glucan prevents α-amylase adsorption onto fungal cell in submerged culture of Aspergillus oryzae.

Science.gov (United States)

Zhang, Silai; Sato, Hiroki; Ichinose, Sakurako; Tanaka, Mizuki; Miyazawa, Ken; Yoshimi, Akira; Abe, Keietsu; Shintani, Takahiro; Gomi, Katsuya

2017-07-01

We have previously reported that α-amylase (Taka-amylase A, TAA) activity disappears in the later stage of submerged Aspergillus oryzae culture as a result of TAA adsorption onto the cell wall. Chitin, one of the major components of the cell wall, was identified as a potential factor that facilitates TAA adsorption. However, TAA adsorption only occurred in the later stage of cultivation, although chitin was assumed to be sufficiently abundant in the cell wall regardless of the submerged culture period. This suggested the presence a factor that inhibits TAA adsorption to the cell wall in the early stage of cultivation. In the current study, we identified α-1,3-glucan as a potential inhibiting factor for TAA adsorption. We constructed single, double, and triple disruption mutants of three α-1,3-glucan synthase genes (agsA, agsB, and agsC) in A. oryzae. Growth characteristics and cell wall component analysis of these disruption strains showed that AgsB plays a major role in α-1,3-glucan synthesis. In the ΔagsB mutant, TAA was adsorbed onto the mycelium in all stages of cultivation (early and later), and the ΔagsB mutant cell walls had a significantly high capacity for TAA adsorption. Moreover, the α-1,3-glucan content of the cell wall prepared from the wild-type strain in the later stage of cultivation was markedly reduced compared with that in the early stage. These results suggest that α-1,3-glucan is a potential inhibiting factor for TAA adsorption onto the cell wall component, chitin, in the early stage of submerged culture in A. oryzae. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

A drug-sensitive genetic network masks fungi from the immune system.

Directory of Open Access Journals (Sweden)

Robert T Wheeler

2006-04-01

Full Text Available Fungal pathogens can be recognized by the immune system via their beta-glucan, a potent proinflammatory molecule that is present at high levels but is predominantly buried beneath a mannoprotein coat and invisible to the host. To investigate the nature and significance of "masking" this molecule, we characterized the mechanism of masking and consequences of unmasking for immune recognition. We found that the underlying beta-glucan in the cell wall of Candida albicans is unmasked by subinhibitory doses of the antifungal drug caspofungin, causing the exposed fungi to elicit a stronger immune response. Using a library of bakers' yeast (Saccharomyces cerevisiae mutants, we uncovered a conserved genetic network that is required for concealing beta-glucan from the immune system and limiting the host response. Perturbation of parts of this network in the pathogen C. albicans caused unmasking of its beta-glucan, leading to increased beta-glucan receptor-dependent elicitation of key proinflammatory cytokines from primary mouse macrophages. By creating an anti-inflammatory barrier to mask beta-glucan, opportunistic fungi may promote commensal colonization and have an increased propensity for causing disease. Targeting the widely conserved gene network required for creating and maintaining this barrier may lead to novel broad-spectrum antimycotics.

MN 716: nova cultivar de cevada com estabilidade de produção e qualidade cervejeira Production stability and brewing quality of Barley MN 716

Directory of Open Access Journals (Sweden)

Eduardo Caierão

2006-06-01

Full Text Available A cevada MN 716, lançada em 2004, é uma das cultivares recomendadas para cultivo com maior estabilidade de produção. Nos anos em que participou do ensaio para determinação de seu valor de cultivo e uso, apresentou excelente produtividade de grãos, com média superior a 3.000 kg ha-1, e desempenho equilibrado quanto à qualidade, com destaque para seu teor de beta-glucanas e índice enzimático. A cultivar constitui um avanço do melhoramento desse cereal no Brasil, aliando características de interesse do produtor e da indústria.Barley cultivar MN 716, released in 2004, is one of the most recomended cultivars, for its high stability. In the years that it was included in the agronomic and use value trial, the cultivar MN 716 showed high yield average, exceeding 3,000 kg ha-1, as well as excellent qualitative performance, mainly in relation to beta-glucans and enzyme index. The cultivar is a breeding achievement for this cereal in Brazil, and serves the interests of both producers and industrial sector.

The barley Jip23b gene

DEFF Research Database (Denmark)

Müller-Uri, Frieder; Cameron-Mills, Verena; Mundy, John

2002-01-01

The barley gene (Jip23) encoding a 23,000-Da protein of unknown function was isolated and shown to be induced by jasmonate methyl ester (MeJA) in leaves. 5'upstream Jip23 sequence was isolated and fused to the beta-glucuronidase gene (GUS), and this reporter was introduced by particle bombardment...

Comparative energy content and amino acid digestibility of barley obtained from diverse sources fed to growing pigs

Directory of Open Access Journals (Sweden)

Hong Liang Wang

2017-07-01

Full Text Available Objective Two experiments were conducted to determine the content of digestible energy (DE and metabolizable energy (ME as well as the apparent ileal digestibility (AID and standardized ileal digestibility (SID of crude protein (CP and amino acids (AA in barley grains obtained from Australia, France or Canada. Methods In Exp. 1, 18 growing barrows (Duroc×Landrace×Yorkshire; 31.5±3.2 kg were individually placed in stainless-steel metabolism crates (1.4×0.7×0.6 m and randomly allotted to 1 of 3 test diets. In Exp. 2, eight crossbred pigs (30.9±1.8 kg were allotted to a replicate 3×4 Youden Square designed experiment with three periods and four diets. Two pigs received each diet during each test period. The diets included one nitrogen-free diet and three test diets. Results The relative amounts of gross energy (GE, CP, and all AA in the Canadian barley were higher than those in Australian and French barley while higher concentrations of neutral detergent fiber, acid detergent fiber, total dietary fiber, insoluble dietary fiber and β-glucan as well as lower concentrations of GE and ether extract were observed in the French barley compared with the other two barley sources. The DE and ME as well as the SID of histidine, isoleucine, leucine and phenylalanine in Canadian barley were higher (p<0.05 than those in French barley but did not differ from Australian barley. Conclusion Differences in the chemical composition, energy content and the SID and AID of AA were observed among barley sources obtained from three countries. The feeding value of barley from Canada and Australia was superior to barley obtained from France which is important information in developing feeding systems for growing pigs where imported grains are used.

Transcriptome analysis of trichothecene-induced gene expression in barley.

Science.gov (United States)

Boddu, Jayanand; Cho, Seungho; Muehlbauer, Gary J

2007-11-01

Fusarium head blight, caused primarily by Fusarium graminearum, is a major disease problem on barley (Hordeum vulgare L.). Trichothecene mycotoxins produced by the fungus during infection increase the aggressiveness of the fungus and promote infection in wheat (Triticum aestivum L.). Loss-of-function mutations in the TRI5 gene in F. graminearum result in the inability to synthesize trichothecenes and in reduced virulence on wheat. We examined the impact of pathogen-derived trichothecenes on virulence and the transcriptional differences in barley spikes infected with a trichothecene-producing wild-type strain and a loss-of-function tri5 trichothecene nonproducing mutant. Disease severity, fungal biomass, and floret necrosis and bleaching were reduced in spikes inoculated with the tri5 mutant strain compared with the wild-type strain, indicating that the inability to synthesize trichothecenes results in reduced virulence in barley. We detected 63 transcripts that were induced during trichothecene accumulation, including genes encoding putative trichothecene detoxification and transport proteins, ubiquitination-related proteins, programmed cell death-related proteins, transcription factors, and cytochrome P450s. We also detected 414 gene transcripts that were designated as basal defense response genes largely independent of trichothecene accumulation. Our results show that barley exhibits a specific response to trichothecene accumulation that can be separated from the basal defense response. We propose that barley responds to trichothecene accumulation by inducing at least two general responses. One response is the induction of genes encoding trichothecene detoxification and transport activities that may reduce the impact of trichothecenes. The other response is to induce genes encoding proteins associated with ubiquitination and cell death which may promote successful establishment of the disease.

The spontaneous chlorophyll mutation frequency in barley

DEFF Research Database (Denmark)

Jørgensen, Jørgen Helms; Jensen, Hans Peter

1986-01-01

A total of 1866 barley plants were progeny tested in the greenhouse. Twenty-five plants segregated for newly arisen, spontaneous chlorophyll mutant genes. Among the total of 470,129 seedlings screened there were 79 mutants (1.7 .+-. 0.6 .times. 10-4). The data are added to data from three similar...... materials and the resulting estimate of the chlorophyll mutant frequency is 1.6 .times. 10-4 in about 1.43 million seedlings. The estimate of the chlorophyll mutation rate per generation is close to 67.3 .times. 10-4 per diploid genome or in the order of 6 .times. 10-7 per locus and haploid genome....

Comparative energy content and amino acid digestibility of barley obtained from diverse sources fed to growing pigs.

Science.gov (United States)

Wang, Hong Liang; Shi, Meng; Xu, Xiao; Ma, Xiao Kang; Liu, Ling; Piao, Xiang Shu

2017-07-01

Two experiments were conducted to determine the content of digestible energy (DE) and metabolizable energy (ME) as well as the apparent ileal digestibility (AID) and standardized ileal digestibility (SID) of crude protein (CP) and amino acids (AA) in barley grains obtained from Australia, France or Canada. In Exp. 1, 18 growing barrows (Duroc×Landrace×Yorkshire; 31.5±3.2 kg) were individually placed in stainless-steel metabolism crates (1.4×0.7×0.6 m) and randomly allotted to 1 of 3 test diets. In Exp. 2, eight crossbred pigs (30.9±1.8 kg) were allotted to a replicate 3×4 Youden Square designed experiment with three periods and four diets. Two pigs received each diet during each test period. The diets included one nitrogen-free diet and three test diets. The relative amounts of gross energy (GE), CP, and all AA in the Canadian barley were higher than those in Australian and French barley while higher concentrations of neutral detergent fiber, acid detergent fiber, total dietary fiber, insoluble dietary fiber and β-glucan as well as lower concentrations of GE and ether extract were observed in the French barley compared with the other two barley sources. The DE and ME as well as the SID of histidine, isoleucine, leucine and phenylalanine in Canadian barley were higher (penergy content and the SID and AID of AA were observed among barley sources obtained from three countries. The feeding value of barley from Canada and Australia was superior to barley obtained from France which is important information in developing feeding systems for growing pigs where imported grains are used.

Nitrate ({sup 13}NO{sub 3}{sup -}) flux studies and response to tungstate treatments in wild type barley and in an NR-deficient mutant

Energy Technology Data Exchange (ETDEWEB)

Wieneke, J.

1994-07-01

Hydroponic experiments were conducted with seedlings of barley (Hordeum vulgare L.), comparing the wild type and an NR-deficient mutant (AZ 12/70), to monitor the NO{sub 3}{sup -} influx/efflux relations and the response to tungstate treatment using {sup 13}N-labelling. Upon treatment with the arginyl-residue-binding inhibitor phenylglyoxal both genotypes responded with an immediate depression of NO{sub 3}{sup -} influx. At low external NO{sub 3}{sup -} concentrations efflux was small (5-15% of the influx) and did not differ substantially between the two genotypes. Although the mutant was distinguished from the wild type by a thinner root system and a reduced shoot length, the total N distribution between roots and shoots and the N concentrations in the root and shoot tissues were fairly comparable. Substantially higher extractable NO{sub 3}{sup -} concentration in the shoots (but not roots) of the mutant may indicate that the capacity to reduce NO{sub 3}{sup -} was restricted due to the very low but still detectable NR activity in the root and shoot tissue. Nevertheless, the mutant must have had supplementary means of assimilating considerable amounts of NO{sub 3}{sup -} over the experimental growth period. At the induced stage, both barley genotypes responded to tungstate treatments with a comparable but not complete depression of the NO{sub 3}{sup -} influx. Part of the NO{sub 3}{sup -} influx appears to be independent of the function of NR since an acceleration of the NO{sub 3}{sup -} uptake capacity to almost half the level of the controls occurred in both cultivars upon induction in spite of pretreatment with 150 micromolar WO{sub 4}{sup 2-} in a molybdenum-free solution prior to NO{sub 3}{sup -} induction. However, 600 micromolar tungstate treatment during the induction phase reduced NO{sub 3}{sup -} influx further (below 20%), but the plants of both cultivars were still able to recover almost completely. (author)

Inherited phenotype instability of inflorescence and floral organ development in homeotic barley double mutants and its specific modification by auxin inhibitors and 2,4-D.

Science.gov (United States)

Šiukšta, Raimondas; Vaitkūnienė, Virginija; Kaselytė, Greta; Okockytė, Vaiva; Žukauskaitė, Justina; Žvingila, Donatas; Rančelis, Vytautas

2015-03-01

Barley (Hordeum vulgare) double mutants Hv-Hd/tw2, formed by hybridization, are characterized by inherited phenotypic instability and by several new features, such as bract/leaf-like structures, long naked gaps in the spike, and a wide spectrum of variations in the basic and ectopic flowers, which are absent in single mutants. Several of these features resemble those of mutations in auxin distribution, and thus the aim of this study was to determine whether auxin imbalances are related to phenotypic variations and instability. The effects of auxin inhibitors and 2,4-D (2,4-dichlorophenoxyacetic acid) on variation in basic and ectopic flowers were therefore examined, together with the effects of 2,4-D on spike structure. The character of phenotypic instability and the effects of auxin inhibitors and 2,4-D were compared in callus cultures and intact plants of single homeotic Hv-tw2 and Hv-Hooded/Kap (in the BKn3 gene) mutants and alternative double mutant lines: offspring from individual plants in distal hybrid generations (F9-F10) that all had the same BKn3 allele as determined by DNA sequencing. For intact plants, two auxin inhibitors, 9-hydroxyfluorene-9-carboxylic acid (HFCA) and p-chlorophenoxyisobutyric acid (PCIB), were used. Callus growth and flower/spike structures of the Hv-tw2 mutant differed in their responses to HFCA and PCIB. An increase in normal basic flowers after exposure to auxin inhibitors and a decrease in their frequencies caused by 2,4-D were observed, and there were also modifications in the spectra of ectopic flowers, especially those with sexual organs, but the effects depended on the genotype. Exposure to 2,4-D decreased the frequency of short gaps and lodicule transformations in Hv-tw2 and of long naked gaps in double mutants. The effects of auxin inhibitors and 2,4-D suggest that ectopic auxin maxima or deficiencies arise in various regions of the inflorescence/flower primordia. Based on the phenotypic instability observed, definite

Direct ethanol production from cassava pulp using a surface-engineered yeast strain co-displaying two amylases, two cellulases, and {beta}-glucosidase

Energy Technology Data Exchange (ETDEWEB)

Apiwatanapiwat, Waraporn; Rugthaworn, Prapassorn [Japan International Research Center for Agricultural Sciences (JIRCAS), Tsukuba, Ibaraki (Japan). Post-Harvest Science and Technology Div.; Kasetsart Univ., Bangkok (Thailand). Nanotechnology and Biotechnology Div.; Murata, Yoshinori; Kosugi, Akihiko; Arai, Takamitsu; Mori, Yutaka [Japan International Research Center for Agricultural Sciences (JIRCAS), Tsukuba, Ibaraki (Japan). Post-Harvest Science and Technology Div.; Yamada, Ryosuke; Kondo, Akihiko [Kobe Univ. (Japan). Dept. of Chemical Science and Engineering

2011-04-15

In order to develop a method for producing fuel ethanol from cassava pulp using cell surface engineering (arming) technology, an arming yeast co-displaying {alpha}-amylase ({alpha}-AM), glucoamylase, endoglucanase, cellobiohydrase, and {beta}-glucosidase on the surface of the yeast cells was constructed. The novel yeast strain, possessing the activities of all enzymes, was able to produce ethanol directly from soluble starch, barley {beta}-glucan, and acid-treated Avicel. Cassava is a major crop in Southeast Asia and used mainly for starch production. In the starch manufacturing process, large amounts of solid wastes, called cassava pulp, are produced. The major components of cassava pulp are starch (approximately 60%) and cellulose fiber (approximately 30%). We attempted simultaneous saccharification and ethanol fermentation of cassava pulp with this arming yeast. During fermentation, ethanol concentration increased as the starch and cellulose fiber substrates contained in the cassava pulp decreased. The results clearly showed that the arming yeast was able to produce ethanol directly from cassava pulp without addition of any hydrolytic enzymes. (orig.)

Improvement of quinoa and barley through induced mutations and biotechnology

International Nuclear Information System (INIS)

Siles, A.Z.; Miranda, L.S.

2001-01-01

The main cropping problems in the Bolivian highlands are the long growing period of barley, high degree of environmental influence on the performance of quinoa, and low soil moisture at sowing time, leading to low germination rate and poor stands, and frost or chilling damages. The program aimed to establish protocols for induction of mutations with X rays and chemical mutagens (NaN 3 , MNH, EMS) in quinoa, barley, native forage species and forest plants and to obtain mutant lines, especially in barley and quinoa; and to establish callus regeneration in quinoa and micropropagation of kenua (Polilepis). The project is still in its study stages, hence further evaluations are needed before firm conclusions are drawn. (author)

Developmental delay in a Streptomyces venezuelae glgE null mutant is associated with the accumulation of α-maltose 1-phosphate.

Science.gov (United States)

Miah, Farzana; Bibb, Maureen J; Barclay, J Elaine; Findlay, Kim C; Bornemann, Stephen

2016-07-01

The GlgE pathway is thought to be responsible for the conversion of trehalose into a glycogen-like α-glucan polymer in bacteria. Trehalose is first converted to maltose, which is phosphorylated by maltose kinase Pep2 to give α-maltose 1-phosphate. This is the donor substrate of the maltosyl transferase GlgE that is known to extend α-1,4-linked maltooligosaccharides, which are thought to be branched with α-1,6 linkages. The genome of Streptomyces venezuelae contains all the genes coding for the GlgE pathway enzymes but none of those of related pathways, including glgC and glgA of the glycogen pathway. This provides an opportunity to study the GlgE pathway in isolation. The genes of the GlgE pathway were upregulated at the onset of sporulation, consistent with the known timing of α-glucan deposition. A constructed ΔglgE null mutant strain was viable but showed a delayed developmental phenotype when grown on maltose, giving less cell mass and delayed sporulation. Pre-spore cells and spores of the mutant were frequently double the length of those of the wild-type, implying impaired cross-wall formation, and spores showed reduced tolerance to stress. The mutant accumulated α-maltose 1-phosphate and maltose but no α-glucan. Therefore, the GlgE pathway is necessary and sufficient for polymer biosynthesis. Growth of the ΔglgE mutant on galactose and that of a Δpep2 mutant on maltose were analysed. In both cases, neither accumulation of α-maltose 1-phosphate/α-glucan nor a developmental delay was observed. Thus, high levels of α-maltose 1-phosphate are responsible for the developmental phenotype of the ΔglgE mutant, rather than the lack of α-glucan.

Transglycosylation by barley α-amylase 1

DEFF Research Database (Denmark)

Mótyán, János A.; Fazekas, Erika; Mori, Haruhide

2011-01-01

The transglycosylation activity of barley α-amylase 1 (AMY1) and active site AMY1 subsite mutant enzymes was investigated. We report here the transferase ability of the V47A, V47F, V47D and S48Y single mutants and V47K/S48G and V47G/S48D double mutant AMY1 enzymes in which the replaced amino acids...... play important role in substrate binding at subsites at −3 through −5. Although mutation increases the transglycosylation activity of enzymes, in the presence of acceptors the difference between wild type and mutants is not so significant. Oligomer transfer reactions of AMY1 wild type and its mutants...... as donor. 4-Methylumbelliferyl-α-d-maltoside, -maltotrioside, -maltotetraoside and -maltopentaoside have been synthesized. Products were identified by MALDI-TOF MS. 1H and 13C NMR analyses showed that AMY1 V47F preserved the stereo- and regioselectivity. The produced MU-α-d-MOSs of degree of polymerization...

Early maturing mutations as germplasm stocks for barley breeding

International Nuclear Information System (INIS)

Ukai, Yasuo

1985-01-01

A total of 102 early maturing mutations have been isolated after various treatments of seeds or plants with ionizing radiations or chemicals from a barley cultivar 'Chikurin Ibaraki 1' or its mutants. Fifty of them were evaluated as regards responses to internal physiological factors. The mutants were found to have a mutational alteration in vernalization and/or photoperiodic response. Earliness in a narrow sense was not noticeably changed. The original genotype is a winter and long-day type. By mutation four different degrees of change in vernalization requirement i.e. complete (V 1 ) and incomplete (V 2 ) spring habit and winter habit with reduced requirement to varying degrees (V 3 , V 4 ) have been produced. Photoperiodic response was also changed into at least three types i.e. complete (P 1 ) and incomplete (P 2 ) loss of sensitivity to short photoperiod and a slight reduction in critical daylength for heading. P 1 and P 2 type mutants were all characterized by marked earliness in heading time in field. Thirty seven mutants were located in seven separate loci. Allelism test of the mutated genes to spontaneous ones revealed that the genes carried by P 1 type mutants were all allelic to an earliness gene ea sub(k) on chromosome 5 and the gene involved in P 2 type mutants to ea 7 on chromosome 6. On the contrary, the gene commonly involved in all V 1 type mutants and one V 2 type mutant was not allelic to spring habit gene Sh 2 or Sh 3 . It seemed likely that the gene was not allelic to, either, but closely linked with sh on chromosome 4. The diversity in terms of genetic and physiological properties of the early maturing mutants arising from common ancestry emphasizes the importance of induced mutation in broadening of germplasm of barley breeding. (author)

Cloning and expression of the Aspergillus oryzae glucan 1,3-beta-glucosidase A (exgA) in Pichia pastoris.

Science.gov (United States)

Boonvitthya, Nassapat; Tanapong, Phatrapan; Kanngan, Patcharaporn; Burapatana, Vorakan; Chulalaksananukul, Warawut

2012-10-01

The glucan 1,3-beta-glucosidase A gene (exgA) from Aspergillus oryzae and fused to the Saccharomyces cerevisiae signal peptide (α-factor) was expressed under the control of either a constitutive (GAP) or an inducible (AOX1) promoter in Pichia pastoris. A 1.4-fold higher extracellular enzyme activity (2 U/ml) was obtained using the AOX1 inducible expression system than with the GAP constitutive promoter (1.4 U/ml). The purified recombinant ExgA enzyme, with a yield of 10 mg protein/l culture supernatant, was about 40 kDa by SDS-PAGE analysis with a specific activity of 289 U/mg protein. The enzyme was optimally active at 35 °C and pH 5.0 and displayed a K(M) and V(max) of 0.56 mM and 10,042 μmol/(min mg protein), respectively, with p-nitrophenyl-β-D-glucopyranoside as the substrate. Moreover, it was tolerant to glucose inhibition with a K(i) of 365 mM.

Mutations in Barley Row Type Genes Have Pleiotropic Effects on Shoot Branching.

Directory of Open Access Journals (Sweden)

Corinna Brit Liller

Full Text Available Cereal crop yield is determined by different yield components such as seed weight, seed number per spike and the tiller number and spikes. Negative correlations between these traits are often attributed to resource limitation. However, recent evidence suggests that the same genes or regulatory modules can regulate both inflorescence branching and tillering. It is therefore important to explore the role of genetic correlations between different yield components in small grain cereals. In this work, we studied pleiotropic effects of row type genes on seed size, seed number per spike, thousand grain weight, and tillering in barley to better understand the genetic correlations between individual yield components. Allelic mutants of nine different row type loci (36 mutants, in the original spring barley varieties Barke, Bonus and Foma and introgressed in the spring barley cultivar Bowman, were phenotyped under greenhouse and outdoor conditions. We identified two main mutant groups characterized by their relationships between seed and tillering parameters. The first group comprises all mutants with an increased number of seeds and significant change in tiller number at early development (group 1a or reduced tillering only at full maturity (group 1b. Mutants in the second group are characterized by a reduction in seeds per spike and tiller number, thus exhibiting positive correlations between seed and tiller number. Reduced tillering at full maturity (group 1b is likely due to resource limitations. In contrast, altered tillering at early development (groups 1a and 2 suggests that the same genes or regulatory modules affect inflorescence and shoot branching. Understanding the genetic bases of the trade-offs between these traits is important for the genetic manipulation of individual yield components.

Potential Effects of Nichi Glucan as a Food Supplement for Diabetes Mellitus and Hyperlipidemia: Preliminary Findings from the Study on Three Patients from India

Directory of Open Access Journals (Sweden)

Vidyasagar Devaprasad Dedeepiya

2012-01-01

Full Text Available Beta Glucan food supplements have been reported to be of benefit in diabetes and hyperlipidemia. We report a pilot study of the effects of Nichi Glucan, 1, 3-1, 6 Beta Glucan food supplement, in lowering the blood glucose and lipid levels in three patients with noninsulin-dependent diabetes mellitus (NIDDM from India. These patients had increased blood glucose and lipid levels inspite of routine antidiabetic and lipid level lowering medications. Each of the participants took 1.5 g of Nichi Glucan per day with food for two months along with their routine medications. The relevant parameters to assess glycemic status and lipid levels were calculated at the baseline and at the end of two months. After two months of continuous consumption, in one patient, the HbA1c decreased from 9.1% to 7.8%, and the glycemic target of HbA1c <6.5% laid down by the International Diabetes Federation was reached in two patients. Lipid levels also decreased significantly. Based on our findings, Nichi Glucan food supplement can be considered along with routine medications in patients with Type II diabetes with hyperlipidemia. Further studies are needed to validate the results.

Modification of mutation process in radiated seeds oat (Avena sativa L.) and barley (Hordeum vulgare L.)

International Nuclear Information System (INIS)

Shishlov, M.P.

2007-01-01

The results of a long-term investigations for experimental mutagenesis of oats and barley are reported in the article. It was found the problem of modification of a mutant process to spread spectrum and increase the general induction frequency and display of macro- and micro mutations. Application as modificators of salts the heavy metals, inhibitors of nuclein, protein synthesis and energy returned processes and also doses spectrum and its strength of gamma-radiation and ultrasound allowed to increase the general frequency of mutant induction of barley and oats on 1-2 order. On the base of evaluation of correlative links between the attributes variability in M1 and M2 generations it was formulated a conception of guarantied creation of mutant forms of the grain crops. (authors)

Structure and Composition of Protein Bodies from Wild-Type and High-Lysine Barley Endosperm

DEFF Research Database (Denmark)

Ingversen, J.

1975-01-01

Protein bodies were isolated from 13 and 28 day old endosperms of barley mutant 1508 and its wild type, Bomi barley. The fine structure of the isolated protein bodies was determined by electron microscopy, and the proteins present in the preparations characterized by amino-acid analysis and SDS......-polyacrylamidegel electrophoresis. Sections through pellets of isolated protein bodies from both the mutant and the wild type revealed protein body structures corresponding with those observed in sections through the intact starchy endosperms. The majority of the wild-type protein bodies was homogeneous spheres accompanied...... that the wild-type protein bodies contained large amounts of prolamines (the storage protein group which is soluble in 55 % isopropanol) and some glutelins (the storage proteins soluble in dilute alkali), whereas the mutant protein bodies have glutelin as the major component and little prolamines...

A Reverse-Genetics Mutational Analysis of the Barley HvDWARF Gene Results in Identification of a Series of Alleles and Mutants with Short Stature of Various Degree and Disturbance in BR Biosynthesis Allowing a New Insight into the Process.

Science.gov (United States)

Gruszka, Damian; Gorniak, Malgorzata; Glodowska, Ewelina; Wierus, Ewa; Oklestkova, Jana; Janeczko, Anna; Maluszynski, Miroslaw; Szarejko, Iwona

2016-04-22

Brassinosteroids (BRs) are plant steroid hormones, regulating a broad range of physiological processes. The largest amount of data related with BR biosynthesis has been gathered in Arabidopsis thaliana, however understanding of this process is far less elucidated in monocot crops. Up to now, only four barley genes implicated in BR biosynthesis have been identified. Two of them, HvDWARF and HvBRD, encode BR-6-oxidases catalyzing biosynthesis of castasterone, but their relation is not yet understood. In the present study, the identification of the HvDWARF genomic sequence, its mutational and functional analysis and characterization of new mutants are reported. Various types of mutations located in different positions within functional domains were identified and characterized. Analysis of their impact on phenotype of the mutants was performed. The identified homozygous mutants show reduced height of various degree and disrupted skotomorphogenesis. Mutational analysis of the HvDWARF gene with the "reverse genetics" approach allowed for its detailed functional analysis at the level of protein functional domains. The HvDWARF gene function and mutants' phenotypes were also validated by measurement of endogenous BR concentration. These results allowed a new insight into the BR biosynthesis in barley.

The application of shortened upper leaf mutant in barley breeding

International Nuclear Information System (INIS)

Jin Hua

2004-01-01

The shortened upper leaf mutant was induced from Fuji Nigo by γ-ray irradiation. Fuji Nigo, the mutant, cross-cut F 1 , F 2 and back-cross F 1 , F 2 were used to analyze mutant heredity by comparative study. The yield, chlorophyll content, light intensity, dry matter of mutant were investigated. The results showed that (1) the mutant character was controlled by a couple of nuclear genes which were partial dominance; (2) the transmittance of the mutant colony was better than that of Fuji Nigo and bottom dry matter was much more than that of Fuji Nigo; (3) under the condition of high fertilizer and high plant population , the yield of mutant was higher than that of Fuji Nigo; (4) the content of chlorophyll a in the mutant was higher than that in Fuji Nigo

The Mutation Frequency in Different Spike Categories in Barley

DEFF Research Database (Denmark)

Frydenberg, O.; Doll, Hans; Sandfær, J.

1964-01-01

After gamma irradiation of barley seeds, a comparison has been made between the chlorophyll-mutant frequencies in X1 spikes that had multicellular bud meristems in the seeds at the time of treatment (denoted as pre-formed spikes) and X1 spikes having no recognizable meristems at the time...

Gibberellic acid (GA3) induced changes in proanthocyanidins and malt quality of two- and six-row husked barleys.

Science.gov (United States)

Yadav, S K; Luthra, Y P; Sood, D R; Aggarwal, N K

2000-01-01

Analysis of husked barleys for proanthocyanidins and malt quality attributes has shown that not a single variety is free of proanthocyanidins. The proanthocyanidins in barley grains varied from 3.85 to 4.94 mg/g as catechin equivalent. The concentration of proanthocyanidins decreased, while total soluble sugars, reducing sugars, diastatic power and beta-amylase activity increased during maltings as well as with exogenous gibberellic acid (GA3) application. Alfa 93 (two-row) and RD2560 (six-row) varieties appeared to be superior for malting and brewing purposes on the basis of proanthocyanidins, total phenols, diastatic power and beta-amylase activity. It is suggested that exogenous application of GA3 at 15 ppm may be useful for producing good quality malt from barley grains.

A plasmodesmata-associated beta-1,3-glucanase in Arabidopsis.

Science.gov (United States)

Levy, Amit; Erlanger, Michael; Rosenthal, Michal; Epel, Bernard L

2007-02-01

Plasmodesmal conductivity is regulated in part by callose turnover, which is hypothesized to be determined by beta-1,3-glucan synthase versus glucanase activities. A proteomic analysis of an Arabidopsis thaliana plasmodesmata (Pd)-rich fraction identified a beta-1,3-glucanase as present in this fraction. The protein encoded by the putative plasmodesmal associated protein (ppap) gene, termed AtBG_ppap, had previously been found to be a post-translationally modified glycosylphosphatidylinositol (GPI) lipid-anchored protein. When fused to green fluorescent protein (GFP) and expressed in tobacco (Nicotiana tabacum) or Nicotiana benthamiana epidermal cells, this protein displays fluorescence patterns in the endoplasmic reticulum (ER) membrane system, along the cell periphery and in a punctate pattern that co-localizes with aniline blue-stained callose present around the Pd. Plasma membrane localization was verified by co-localization of AtBG_ppap:GFP together with a plasma membrane marker N-[3-triethylammoniumpropyl]-4-[p-diethylaminophenylhexatrienyl] pyridinium dibromide (FM4-64) in plasmolysed cells. In Arabidopsis T-DNA insertion mutants that do not transcribe AtBG_ppap, functional studies showed that GFP cell-to-cell movement between epidermal cells is reduced, and the conductivity coefficient of Pd is lower. Measurements of callose levels around Pd after wounding revealed that callose accumulation in the mutant plants was higher. Taken together, we suggest that AtBG_ppap is a Pd-associated membrane protein involved in plasmodesmal callose degradation, and functions in the gating of Pd.

Advances in the use of mutation induction for genetic improvement of barley and native grains in Peru

International Nuclear Information System (INIS)

Romero Loli, M.; Luz Gomez, P.; Jorge Jimenez, D.; Agripina Roldan, Ch.

2001-01-01

Barley seeds of two varieties were treated with several doses of gamma rays and sodium azide. Seeds of a quinoa (Chenopodium) variety were treated with three doses of gamma rays. Yield trials were conducted also for doubled haploid lines of barley derived from earlier mutagenic treatments. Some promising new barley mutant lines were identified in the yield trials. The results from the Chenopodium trials facilitate the determination of the optimum dose of gamma rays for the PRQ-22 variety. (author)

Synthesis of New Hyper-Branched α-Glucans from Sucrose by Lactobacillus reuteri 180 Glucansucrase Mutants

NARCIS (Netherlands)

Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert

2016-01-01

α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088 and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were

Sbg1 Is a Novel Regulator for the Localization of the β-Glucan Synthase Bgs1 in Fission Yeast.

Directory of Open Access Journals (Sweden)

Reshma Davidson

Full Text Available Glucan synthases synthesize glucans, complex polysaccharides that are the major components in fungal cell walls and division septa. Studying regulation of glucan synthases is important as they are essential for fungal cell survival and thus popular targets for anti-fungal drugs. Linear 1,3-β-glucan is the main component of primary septum and is synthesized by the conserved β-glucan synthase Bgs1 in fission yeast cytokinesis. It is known that Rho1 GTPase regulates Bgs1 catalytic activity and the F-BAR protein Cdc15 plays a role in Bgs1 delivery to the plasma membrane. Here we characterize a novel protein Sbg1 that is present in a complex with Bgs1 and regulates its protein levels and localization. Sbg1 is essential for contractile-ring constriction and septum formation during cytokinesis. Sbg1 and Bgs1 physically interact and are interdependent for localization to the plasma membrane. Bgs1 is less stable and/or mis-targeted to vacuoles in sbg1 mutants. Moreover, Sbg1 plays an earlier and more important role in Bgs1 trafficking and localization than Cdc15. Together, our data reveal a new mode of regulation for the essential β-glucan synthase Bgs1 by the novel protein Sbg1.

Deletion mutant defines DQ beta variants with DR4 positive DQw3 positive haplotypes

International Nuclear Information System (INIS)

Nepom, B.S.; Kim, S.J.; Nepom, G.T.

1986-01-01

We describe the production of an HLA deletion mutation by radiation mutagenesis of a DR4- and DQw3-homozygous, Dw4- and Dw14-heterozygous cell line designed to analyze polymorphisms associated with DR4 and DQw3. Southern blot analysis confirms a deletion of class I and class II genes on one haplotype. Variation in DQ beta alleles associated with DQw3 was previously described by characteristic RFLP patterns for a DQ beta bene. One pattern, which correlated precisely with A-10-83 monoclonal antibody reactivity (TA10), defined an allele which we call DQ''3.1''. The mutant cell line has lost the polymorphic bands on Southern blots corresponding to the DQ''3.1'' allele, while the intact Dw14 haplotype retains the alternate allele at DQ beta which is DQw-3 positive. TA10-negative. These data demonstrate the segregation of two DQw3 positive DQ beta allelic variants, both associated with DR4, which can be distinguished on the basis of both RFLP and monoclonal antibody reactivity

The β-Ketoacyl-CoA Synthase HvKCS1, Encoded by Cer-zh, Plays a Key Role in Synthesis of Barley Leaf Wax and Germination of Barley Powdery Mildew.

Science.gov (United States)

Li, Chao; Haslam, Tegan M; Krüger, Anna; Schneider, Lizette M; Mishina, Kohei; Samuels, Lacey; Yang, Hongxing; Kunst, Ljerka; Schaffrath, Ulrich; Nawrath, Christiane; Chen, Guoxiong; Komatsuda, Takao; von Wettstein-Knowles, Penny

2018-04-01

The cuticle coats the primary aerial surfaces of land plants. It consists of cutin and waxes, which provide protection against desiccation, pathogens and herbivores. Acyl cuticular waxes are synthesized via elongase complexes that extend fatty acyl precursors up to 38 carbons for downstream modification pathways. The leaves of 21 barley eceriferum (cer) mutants appear to have less or no epicuticular wax crystals, making these mutants excellent tools for identifying elongase and modification pathway biosynthetic genes. Positional cloning of the gene mutated in cer-zh identified an elongase component, β-ketoacyl-CoA synthase (CER-ZH/HvKCS1) that is one of 34 homologous KCSs encoded by the barley genome. The biochemical function of CER-ZH was deduced from wax and cutin analyses and by heterologous expression in yeast. Combined, these experiments revealed that CER-ZH/HvKCS1 has a substrate specificity for C16-C20, especially unsaturated, acyl chains, thus playing a major role in total acyl chain elongation for wax biosynthesis. The contribution of CER-ZH to water barrier properties of the cuticle and its influence on the germination of barley powdery mildew fungus were also assessed.

The enhanced callose deposition in barley with ml-o powdery mildew resistance genes

DEFF Research Database (Denmark)

Skou, Jens-Peder

1985-01-01

Carborundum treatment of barley leaves induced a callose deposition which was detected as diffuse blotches in the epidermal cells of susceptible barleys and as deeply stained tracks along the scratches in barleys with the ml-o powdery mildew resistance gene. Subsequent inoculation with powdery...... mildew resulted in appositions that enlarged inversely to their size in the respective varieties when inoculated without carborundum treatment. Aphids sucking the leaves resulted in rows of callose containing spots along the anticlinal cell walls. The spots were larger in the ml-o mutant than...... in the mother variety. Callose was deposited in connection with the pleiotropic necrotic spotting in barleys with the ml-o gene. Modification of the necrotic spotting by crossing the ml-o gene into other gene backgrounds did not result in any change in the size of appositions upon inoculation with powdery...

Systemic responses of barley to the 3-hydroxy-decanoyl-homoserine lactone producing plant beneficial endophyte Acidovorax radicis N35

Directory of Open Access Journals (Sweden)

Shengcai Han

2016-12-01

Full Text Available Quorum sensing auto-inducers of the N-acyl homoserine lactone (AHL type produced by Gram-negative bacteria have different effects on plants including stimulation on root growth and/or priming or acquirement of systemic resistance in plants. In this communication the influence of AHL production of the plant growth promoting endophytic rhizosphere bacterium Acidovorax radicis N35 on barley seedlings was investigated. A. radicis N35 produces 3-hydroxy-C10-homoserine lactone (3-OH-C10-HSL as the major AHL compound. To study the influence of this QS autoinducer on the interaction with barley, the araI-biosynthesis gene was deleted. The comparison of inoculation effects of the A. radicis N35 wild type and the araI mutant resulted in remarkable differences. While the N35 wild type colonized plant roots effectively in microcolonies, the araI mutant occurred at the root surface as single cells. Furthermore, in a mixed inoculum the wild type was much more prevalent in colonization than the araI mutant documenting that the araI mutation affected root colonization. Nevertheless, a significant plant growth promoting effect could be shown after inoculation of barley with the wild type and the araI mutant in soil after two months cultivation. While A. radicis N35 wild type showed only a very weak induction of early defense responses in plant RNA expression analysis, the araI mutant caused increased expression of flavonoid biosynthesis genes. This was corroborated by the accumulation of several flavonoid compounds such as saponarin and lutonarin in leaves of root inoculated barley seedlings. Thus, although the exact role of the flavonoids in this plant response is not clear yet, it can be concluded, that the synthesis of AHLs by A. radicis has implications on the perception by the host plant barley and thereby contributes to the establishment and function of the bacteria-plant interaction.

A Review of Extraction and Analysis of Bioactives in Oat and Barley and Scope for Use of Novel Food Processing Technologies.

Science.gov (United States)

Gangopadhyay, Nirupama; Hossain, Mohammad B; Rai, Dilip K; Brunton, Nigel P

2015-06-12

Oat and barely are cereal crops mainly used as animal feed and for the purposes of malting and brewing, respectively. Some studies have indicated that consumption of oat and barley rich foods may reduce the risk of some chronic diseases such as coronary heart disease, type II diabetes and cancer. Whilst there is no absolute consensus, some of these benefits may be linked to presence of compounds such as phenolics, vitamin E and β-glucan in these cereals. A number of benefits have also been linked to the lipid component (sterols, fatty acids) and the proteins and bioactive peptides in oats and barley. Since the available evidence is pointing toward the possible health benefits of oat and barley components, a number of authors have examined techniques for recovering them from their native sources. In the present review, we summarise and examine the range of conventional techniques that have been used for the purpose of extraction and detection of these bioactives. In addition, the recent advances in use of novel food processing technologies as a substitute to conventional processes for extraction of bioactives from oats and barley, has been discussed.

A Review of Extraction and Analysis of Bioactives in Oat and Barley and Scope for Use of Novel Food Processing Technologies

Directory of Open Access Journals (Sweden)

Nirupama Gangopadhyay

2015-06-01

Full Text Available Oat and barely are cereal crops mainly used as animal feed and for the purposes of malting and brewing, respectively. Some studies have indicated that consumption of oat and barley rich foods may reduce the risk of some chronic diseases such as coronary heart disease, type II diabetes and cancer. Whilst there is no absolute consensus, some of these benefits may be linked to presence of compounds such as phenolics, vitamin E and β-glucan in these cereals. A number of benefits have also been linked to the lipid component (sterols, fatty acids and the proteins and bioactive peptides in oats and barley. Since the available evidence is pointing toward the possible health benefits of oat and barley components, a number of authors have examined techniques for recovering them from their native sources. In the present review, we summarise and examine the range of conventional techniques that have been used for the purpose of extraction and detection of these bioactives. In addition, the recent advances in use of novel food processing technologies as a substitute to conventional processes for extraction of bioactives from oats and barley, has been discussed.

Biochemical and structural characterization of the glucan and fructan exopolysaccharides synthesized by the Lactobacillus reuteri wild-type strain and by mutant strains

NARCIS (Netherlands)

Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.

1999-01-01

Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and 13C or 1H nuclear magnetic resonance analysis showed that the glucan has a unique

Biochemical and structural characterization of the glucan and fructan exopolysaccharides synthesized by the Lactobacillus reuteri wild-type strain and by mutant strains

NARCIS (Netherlands)

Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.

Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and (13)C or (1)H nuclear magnetic resonance analysis showed that the glucan has a unique

Aggressiveness of powdery mildew on 'ml-o'- resistant barley

International Nuclear Information System (INIS)

Andersen, Lars

1990-01-01

The ml-o genes in barley are important sources in breeding for resistance against the barley powdery mildew fungus (Erysiphe graminis). The resistance mechanism is a rapid formation of a large callose containing cell wall apposition at the site of the pathogen's infection attempt. This reduces the chances of infection to almost nil in all epidermal cells, except in the small subsidiary cells, in which appositions are rarely formed. Small mildew colonies from infections in subsidiary cells may be seen on the otherwise resistant leaf. This is described by the infection type 0/(4). Mildew isolate HL 3 selected by SCHWARZBACH has increased aggressiveness. No ml-o-virulent isolates are known. However, ml-o-resistant varieties when grown extensively in Europe, will introduce field selection for mildew pathotypes with aggressiveness or virulence to ml-o resistance. Studies on increased aggressiveness require new methods. The material comprises two powdery mildew isolates: GE 3 without ml-o aggressiveness and the aggressive HL 3/5; and two near-isogenic barley lines in Carlsberg II: Riso 5678(R) with the recessive mutant resistance gene ml-o5 and Riso 5678(S) with the wild-type gene for susceptibility. Latent period and disease efficiency show no significant differences between the two isolates on the susceptible barley line (S) but the isolates differ from each other on the resistant barley line

Effects of variety, soil type and nitrogen fertilizer supply on the nutritive value of barley for growing pigs

Directory of Open Access Journals (Sweden)

Jarmo Valaja

1997-12-01

Full Text Available The effects of variety, soil type and nitrogen (N fertilizer supply on the nutritive value of barley were studied with chemical analysis, in vitro digestibility and a growth experiment on 240 growing/finishing pigs (live-weight 25-95 kg. Twelve barley batches were formed from three varieties (two-rowed Kustaa and six-rowed Arra and Pokko grown on mould or clay soil and fertilized with either a low or normal level of N (43 or 71 kg N/ha to mould soil and 76.5 or 110 kg N/ha to clay soil. In the growth experiment all the diets contained similar amounts of barley and soya bean meal (845/120 g/kg. Variety Arra contained 21 g/kg more CP than did Pokko or Kustaa. The N fertilizer supply slightly increased the CP content of the barley samples (133 vs. 141 g/kg but decreased the amount of lysine in the protein (31 vs. 29 g/ 160g N. Regression equation showed that CP and β-glucan were positively and neutral detergen fibre content negatively related to the in vitro digestibility of N in barley samples. The content of CP and the in vitro digestibilities of dry matter and N were highest in var. Arra. The daily gain and feed conversion ratio (FCR of the pigs on Arra-based diets was better than that of those on Kustaa or Pokko (P

Oligosaccharide and Substrate Binding in the Starch Debranching Enzyme Barley Limit Dextrinase

DEFF Research Database (Denmark)

Møller, Marie Sofie; Windahl, Michael Skovbo; Sim, Lyann

2015-01-01

Complete hydrolytic degradation of starch requires hydrolysis of both the α-1,4- and α-1,6-glucosidic bonds in amylopectin. Limit dextrinase (LD) is the only endogenous barley enzyme capable of hydrolyzing the α-1,6-glucosidic bond during seed germination, and impaired LD activity inevitably...... reduces the maltose and glucose yields from starch degradation. Crystal structures of barley LD and active-site mutants with natural substrates, products and substrate analogues were sought to better understand the facets of LD-substrate interactions that αconfine high activity of LD to branched...... starch synthesis....

Mutation breeding in malting barley

Energy Technology Data Exchange (ETDEWEB)

Hiraki, Makoto; Sanada, Matsuyoshi

1984-03-01

The released varieties of malting barley through mutation breeding is more than ten in number, including foreign varieties. In Japan four varieties has been released so far. We started mutation breeding in 1956 together with cross breeding that we employed before. Until now, Gamma 4, Amagi Nijo 1 and Fuji Nijo 2 have been produced from the direct use of induced mutations and Nirasaki Nijo 8 from the indirect use of them. Mutation breeding has been used mainly in the partial improvement of agronomic characteristics since the selection for malting quality was very complicated. As the variety bred by induced mutation is usually equivalent to the original variety in malting quality, both this new variety and the original one could be cultivated in the same area without any problem on later malt production. Particularly when one farmer cultivates barley in an extensive acreage, he can harvest at the best time according to the different maturing time of each variety. From these points of view, mutation breeding is an efficient tool in malting barley breeding. Mutagens we have used so far are X-rays, ..gamma..-rays, neutron and chemicals such as dES. From our experience in selection, the low dose of radiation and chemical mutagens are more effective in selection of point mutation than the high dose of radiation which tends to produce many abnormal but few practical mutants. (author).

Biological changes in Barley mutants resistant to powdery mildew disease

International Nuclear Information System (INIS)

Amer, I. M.; Fahim, M. M.; Moustafa, N. A.

2012-12-01

physiological studies showed that all kinds of chlorophyll (a), (b) and (a + b) content in infected plant were decreased while, the carotenes pigment were increased. Infection generally reduced total sugars content of all resistant mutants. Infected resistant mutant showed more phenols content and peroxidase, polyphenoloxidase activities than healthy ones of the mutants. (Author)

Non-enzymatic antioxidant accumulations in BR-deficient and BR-insensitive barley mutants under control and drought conditions.

Science.gov (United States)

Gruszka, Damian; Janeczko, Anna; Dziurka, Michal; Pociecha, Ewa; Fodor, Jozsef

2017-12-07

Drought is one of the most adverse stresses that affect plant growth and yield. Disturbances in metabolic activity resulting from drought cause overproduction of reactive oxygen species. It is postulated that brassinosteroids (BRs) regulate plant tolerance to the stress conditions, but the underlying mechanisms remain largely unknown. An involvement of endogenous BRs in regulation of the antioxidant homeostasis is not fully clarified either. Therefore, the aim of this study was to elucidate the role of endogenous BRs in regulation of non-enzymatic antioxidants in barley (Hordeum vulgare) under control and drought conditions. The plant material included the 'Bowman' cultivar and a group of semi-dwarf near-isogenic lines (NILs), representing mutants deficient in BR biosynthesis or signaling. In general, accumulations of 11 compounds representing various types of non-enzymatic antioxidants were analyzed under both conditions. The analyses of accumulations of reduced and oxidized forms of ascorbate indicated that the BR mutants contain significantly higher contents of dehydroascorbic acid under drought conditions when compared with the 'Bowman' cultivar. The analysis of glutathione accumulation indicated that under the control conditions the BR-insensitive NILs contained significantly lower concentrations of this antioxidant when compared with the rest of genotypes. Therefore, we postulate that BR sensitivity is required for normal accumulation of glutathione. A complete accumulation profile of various tocopherols indicated that functional BR biosynthesis and signaling are required for their normal accumulation under both conditions. Results of this study provided an insight into the role of endogenous BRs in regulation of the non-enzymatic antioxidant homeostasis. © 2017 Scandinavian Plant Physiology Society.

Modification of barley powdery mildew resistance controlled by the gene M1-a212

International Nuclear Information System (INIS)

Torp, J.; Joergensen, J.H.

1989-01-01

Full text: The barley line Sultan 5 carries resistance gene M1-a12. Seeds were treated with EMS or NaN 3 . Among 10381 M 1 -spike progenies inoculated with M1-a12 a-virulent isolates of Erysiphe graminis, 25 segregated for less resistant infection type. Among 10 mutants analyzed, 9 had mutant allels of M1-a12 and one had a recessive mutant gene in a different locus acting as a ''suppressor'' of M1-a12. (author)

Progressive Pearling of Barley Kernel: Chemical Characterization of Pearling Fractions and Effect of Their Inclusion on the Nutritional and Technological Properties of Wheat Bread.

Science.gov (United States)

Blandino, Massimo; Locatelli, Monica; Sovrani, Valentina; Coïsson, Jean Daniel; Rolle, Luca; Travaglia, Fabiano; Giacosa, Simone; Bordiga, Matteo; Scarpino, Valentina; Reyneri, Amedeo; Arlorio, Marco

2015-07-01

Two hulled barley varieties have been sequentially pearled for one to eight cycles, each with 5% removal. The derived fractions were analyzed for their bioactive compound content. The dietary fiber (DF) decreased from the external to the internal layers, whereas β-glucans showed an inverse trend. Deoxynivalenol contamination was concentrated in the outer layers. The total antioxidant activity (TAA) was higher in the 15-25% fractions, which were used to prepare bread. Five mixtures of refined wheat flour, with an increasing replacement of this pearled barley fraction, were compared with a control for the bioactive compound content, as well as for the rheological and physical bread properties. The inclusion of pearled fractions with up to a 10% substitution leads to a clear enhancement of the DF and TAA, with only minor detrimental effects on the physical parameters. Selected byproducts of barley pearling could be proposed as functional ingredients for bakery products rich in DF and TAA.

TILLING in the two-rowed barley cultivar 'Barke' reveals preferred sites of functional diversity in the gene HvHox1

Directory of Open Access Journals (Sweden)

Komatsuda Takao

2009-12-01

Full Text Available Abstract Background The economic importance of cereals such as barley, and the demand for improved yield and quality require a better understanding of the genetic components that modulate biologically and commercially relevant traits. While Arabidopsis thaliana is the premiere model plant system, the spectrum of its traits cannot address all of the fundamental questions of crop plant development. Unlike Arabidopsis, barley is both a crop and a model system for scientific research, and it is increasingly being used for genetic and molecular investigations into the conserved biological processes of cereals. A common challenge in genetic studies in plants with large genomes arises from the very time-consuming work of associating mutant phenotypes with gene sequence information, especially if insertion mutagenesis is not routine, as in barley. Reverse genetics based on chemical mutagenesis represents the best solution to this obstacle. Findings In barley, we generated a new TILLING (Targeting Local Lesions IN Genomes resource comprising 10,279 M2 mutants in the two-rowed malting cultivar 'Barke,' which has been used in the generation of other genomic resources in barley (~150,000 ESTs, DH mapping population. The value of this new resource was tested using selected candidate genes. An average frequency of approximately one mutation per 0.5 Mb was determined by screening ten fragments of six different genes. The ethyl methanesulphonate (EMSmutagenesis efficiency was studied by recording and relating the mutagenesis-dependent effects found in the three mutant generations (M1-M3. A detailed analysis was performed for the homeodomain-leucine-zipper (HD-ZIP gene HvHox1. Thirty-one mutations were identified by screening a 1,270-bp fragment in 7,348 M2 lines. Three of the newly identified mutants exhibited either a six-rowed or an intermedium-spike phenotype, and one mutant displayed a significantly altered spikelet morphology compared to that of the 'Barke

Defining Starch Binding by Glucan Phosphatases

DEFF Research Database (Denmark)

Auger, Kyle; Raththagala, Madushi; Wilkens, Casper

2015-01-01

Starch is a vital energy molecule in plants that has a wide variety of uses in industry, such as feedstock for biomaterial processing and biofuel production. Plants employ a three enzyme cyclic process utilizing kinases, amylases, and phosphatases to degrade starch in a diurnal manner. Starch...... is comprised of the branched glucan amylopectin and the more linear glucan amylose. Our lab has determined the first structures of these glucan phosphatases and we have defined their enzymatic action. Despite this progress, we lacked a means to quickly and efficiently quantify starch binding to glucan...

Boron toxicity tolerance in barley through reduced expression of the multifunctional aquaporin HvNIP2;1.

Science.gov (United States)

Schnurbusch, Thorsten; Hayes, Julie; Hrmova, Maria; Baumann, Ute; Ramesh, Sunita A; Tyerman, Stephen D; Langridge, Peter; Sutton, Tim

2010-08-01

Boron (B) toxicity is a significant limitation to cereal crop production in a number of regions worldwide. Here we describe the cloning of a gene from barley (Hordeum vulgare), underlying the chromosome 6H B toxicity tolerance quantitative trait locus. It is the second B toxicity tolerance gene identified in barley. Previously, we identified the gene Bot1 that functions as an efflux transporter in B toxicity-tolerant barley to move B out of the plant. The gene identified in this work encodes HvNIP2;1, an aquaporin from the nodulin-26-like intrinsic protein (NIP) subfamily that was recently described as a silicon influx transporter in barley and rice (Oryza sativa). Here we show that a rice mutant for this gene also shows reduced B accumulation in leaf blades compared to wild type and that the mutant protein alters growth of yeast (Saccharomyces cerevisiae) under high B. HvNIP2;1 facilitates significant transport of B when expressed in Xenopus oocytes compared to controls and to another NIP (NOD26), and also in yeast plasma membranes that appear to have relatively high B permeability. We propose that tolerance to high soil B is mediated by reduced expression of HvNIP2;1 to limit B uptake, as well as by increased expression of Bot1 to remove B from roots and sensitive tissues. Together with Bot1, the multifunctional aquaporin HvNIP2;1 is an important determinant of B toxicity tolerance in barley.

Reduced viscosity Barley β-Glucan versus placebo: a randomized controlled trial of the effects on insulin sensitivity for individuals at risk for diabetes mellitus

Directory of Open Access Journals (Sweden)

Schmelzer Wade

2011-08-01

Full Text Available Abstract Background Prior studies suggest soluble fibers may favorably affect glucose/insulin metabolism. Methods This prospective, randomized, placebo controlled, double blind, parallel group trial evaluated 50 generally healthy subjects without prior diagnosis of diabetes mellitus (44 completers, who were administered beverages containing placebo (control, lower dose (3 g/d, or higher dose (6 g/d reduced viscosity barley β-glucan (BBG extract. Subjects (68% women mean age 56 years, Body Mass Index (BMI 32 kg/m2 and baseline fasting plasma glucose 102 mg/dl were instructed to follow a weight-maintaining Therapeutic Lifestyle Changes (TLC diet and consumed three 11 oz study beverages daily with meals for 12 weeks. The four primary study endpoint measures were plasma glucose and insulin [each fasting and post-Oral Glucose Tolerance Testing (OGTT]. Results Compared to placebo, administration of 3 g/d BBG over 12 weeks significantly reduced glucose incremental Area Under the Curve (iAUC measures during OGTT and 6 g/d BBG over 12 weeks significantly reduced fasting insulin as well as the related homeostasis model assessment of insulin resistance (HOMA-IR. Beverages were generally well tolerated with no serious adverse experiences and no significant differences between groups for adverse experiences. Per protocol instruction, subjects maintained body weight. Conclusions These findings suggest 6 g/d BBG consumed in a beverage over 12 weeks may improve insulin sensitivity among hyperglycemic individuals with no prior diagnosis of diabetes mellitus, and who experience no change in body weight. Trial Registration ClinicalTrials.gov Identifier: NCT01375803.

Development of mutants of local barley bakur (T. Hordeum vulgare. c v Bakkur L.) with good quantitative and qualitative traits under rainfed condition

International Nuclear Information System (INIS)

Saif, A. A.; Al-Shamiri, A. A.

2012-12-01

Seeds of local barley bakur were exposed to 150 Gy of gamma rays from cobalt 60 source irradiated seeds were planted in rows as M1.From M1 magnetized population plants , the main spike of each plants were collected, threshed and planted head to row method in 2008 winter season as M2. Evaluation of mutants was done for the increase in long spike and level of resistance to loading in compare with mother variety (untreated) resulted in selecting fifty mutated plants. These plants were planted as plant/ row method along with the mother variety and evaluated for grain yield and level of resistance for lodging which consequent y resulted in selecting of twenty four mutant lines which were varied in plant height long spike and yield. These lines were planted in the research farm during 2009 and the research farm during 2009 and 2011 winter season as M4 and M5 for two consecutive season resulted in selecting eight mutant lines which were distinguished of others in respect of level of resistance and increase of yield. These mutant lines were planted in plots in Kawkban and Bani-Mater locations during 2010 and 2011 seasons along with mother variety and improved variety Kawkban-1 which dominated in the region. Data were collected from the trail analyzed them separate y over each location. Results showed that the mutant line Al-e rra-B-008-15 was the best in grain yield and early maturity followed by Al-erra-B-008-20 and Al-erra-B-008-20. In the meantime these mutant line showed resistance to loading compare with other including the mother variety. There fore it can be recommended to register these mutants as a new varieties for Kawkaban Bain-Mater regions as well as for similar areas in the central and northern regions. This research summarizing results obtained from the trail conducted in both research farm and in farmer fields at Kawkaban and Bani-Mater locations. (Author)

Quantitative trait loci associated with the tocochromanol (vitamin E) pathway in barley

Science.gov (United States)

In this study, the Genome-Wide Association Studies approach was used to detect Quantitative Trait Loci associated with tocochromanol concentrations using a panel of 1,466 barley accessions. All major tocochromanol types- alpha-, beta-, delta-, gamma-tocopherol and tocotrienol- were assayed. We found...

Increased enzyme production under liquid culture conditions in the industrial fungus Aspergillus oryzae by disruption of the genes encoding cell wall α-1,3-glucan synthase.

Science.gov (United States)

Miyazawa, Ken; Yoshimi, Akira; Zhang, Silai; Sano, Motoaki; Nakayama, Mayumi; Gomi, Katsuya; Abe, Keietsu

2016-09-01

Under liquid culture conditions, the hyphae of filamentous fungi aggregate to form pellets, which reduces cell density and fermentation productivity. Previously, we found that loss of α-1,3-glucan in the cell wall of the fungus Aspergillus nidulans increased hyphal dispersion. Therefore, here we constructed a mutant of the industrial fungus A. oryzae in which the three genes encoding α-1,3-glucan synthase were disrupted (tripleΔ). Although the hyphae of the tripleΔ mutant were not fully dispersed, the mutant strain did form smaller pellets than the wild-type strain. We next examined enzyme productivity under liquid culture conditions by transforming the cutinase-encoding gene cutL1 into A. oryzae wild-type and the tripleΔ mutant (i.e. wild-type-cutL1, tripleΔ-cutL1). A. oryzae tripleΔ-cutL1 formed smaller hyphal pellets and showed both greater biomass and increased CutL1 productivity compared with wild-type-cutL1, which might be attributable to a decrease in the number of tripleΔ-cutL1 cells under anaerobic conditions.

Identification of a Bacillus subtilis secretion mutant using a beta-galactosidase screening procedure

DEFF Research Database (Denmark)

Jacobs, M F; Borchert, T V; Kontinen, V P

1995-01-01

High-level synthesis of exportable beta-galactosidase (LacZ) fusion proteins in Bacillus subtilis results in a lethal phenotype, and has been suggested as a tool for the selection of secretion mutants. We tested a plasmid-based, inducible lacZ fusion gene system for this purpose, but frequent...... mutations in cis, which reduced expression of the fusion gene, forced abandonment of the induction-selection strategy. Instead, after modification of the indicator plasmid, a screening procedure for increased basal LacZ activity levels was adopted. This led to the identification of a conditional B. subtilis...

Rapid gene isolation in barley and wheat by mutant chromosome sequencing

Czech Academy of Sciences Publication Activity Database

Sanchez-Martin, J.; Steuernagel, B.; Ghosh, S.; Herren, G.; Hurni, S.; Adamski, N.; Vrána, Jan; Kubaláková, Marie; Krattinger, S.G.; Wicker, T.; Doležel, Jaroslav; Keller, B.; Wulff, B. B. H.

2016-01-01

Roč. 17, OCT 31 (2016), č. článku 221. ISSN 1465-6906 R&D Projects: GA ČR GBP501/12/G090; GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : induced mutations * mitotic chromosomes * confers resistance * exome capture * genome * identification * evolution * pathogens * hordeum * MutChromSeq * Gene cloning * Mutational genomics * Chromosome flow sorting * Triticeae * Wheat * Barley Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 11.313, year: 2015

Spatio-temporal profiling and degradation of alpha-amylase isozymes during barley seed germination

DEFF Research Database (Denmark)

Bak-Jensen, K.S.; Laugesen, Sabrina; Østergaard, Ole

2007-01-01

Ten genes from two multigene families encode barley alpha-amylases. To gain insight into the occurrence and fate of individual isoforms during seed germination, the alpha-amylase repertoire was mapped by using a proteomics approach consisting of 2D gel electrophoresis, western blotting, and mass...... increased during germination. Assessing the fragment minimum chain length by peptide mass fingerprinting suggested that alpha-amylase 2 ( gi vertical bar 4699831) initially was cleaved just prior to domain B that protrudes from the (beta alpha)(8)-barrel between beta-strand 3 and alpha-helix 3, followed...... essentially only full-length alpha-amylase forms. While only products of the above three genes appeared by germination also of 15 other barley cultivars, the cultivars had distinct repertoires of charge and molecular mass variant forms. These patterns appeared not to be correlated with malt quality....

Anti-infective properties of the melanin-glucan complex obtained from medicinal tinder bracket mushroom, Fomes fomentarius (L.: Fr.) Fr. (Aphyllophoromycetideae).

Science.gov (United States)

Seniuk, Olga F; Gorovoj, Leontiy F; Beketova, Galina V; Savichuk, Hatalia O; Rytik, Petr G; Kucherov, Igor I; Prilutskay, Alla B; Prilutsky, Alexandr I

2011-01-01

The goal of this investigation was to comparatively study the efficiency of traditionally used anti-infective drugs and biopolymer complexes originated from the medicinal mushroom Fomes fomentarius (L.:Fr.) Fr.: 1) water-soluble melanin-glucan complex (MGC; -80% melanins and -20% beta-glucans) and 2) insoluble chitin-glucan-melanin complex (ChGMC; -70% chitin, -20% beta-glucans, and -10% melanins). Infectious materials (Helicobacter pylori, Candida albicans, and Herpes vulgaris I and HIV-1(zmb) were used in pure cultures of in vitro and in vivo models on experimental animals. Comparison studies of fungal biopolymers and effective modern antifungal, antibacterial, and antiviral drugs were used in in vitro models. The comparative clinical efficiency of ChGMC and of etiotropic pharmaceuticals in models of H. pylori, C. albicans, and H. vulgaris I infection contamination were studied. Using in vitro models, it was established that MGC completely depresses growth of C. albicans. MGC had an antimicrobial effect on H. pylori identical to erythromycin in all concentrations, and had a stronger action on this bacterium than other tested antibiotics. Tested MGC possesses simultaneously weak toxicity and high anti-HIV-1 activity in comparison with zidovudine (Retrovir). The obtained results show that CLUDDT therapy in Wistar rats with the application of ChGMC is, on average, 1.35-1.43 times as effective as a traditional one. Considering the absence of MGC and ChGMC toxic properties on blood cells even in very high concentrations, these complexes may be used as a source of biopolymers for the creation of essentially new agents for wide application in infectious pathology.

Abnormal germling development by brown rust and powdery mildew on cer barley mutants

NARCIS (Netherlands)

Rubiales, D.; Ramirez, M.C.; Carver, T.L.W.; Niks, R.E.

2001-01-01

The barley leaf rust fungus forms appressoria over host leaf stomata and penetrates via the stomatal pore. High levels of avoidance to leaf rust fungi have been described in some wild accessions of Hordeum species where a prominent wax layer on the stomata inhibits triggering of fungal appressorium

Whole Tibetan Hull-Less Barley Exhibit Stronger Effect on Promoting Growth of Genus Bifidobacterium than Refined Barley In Vitro.

Science.gov (United States)

Gong, Lingxiao; Cao, Wenyan; Gao, Jie; Wang, Jing; Zhang, Huijuan; Sun, Baoguo; Yin, Meng

2018-04-01

The gut microbiota has recently become a new route for research at the intersection of diet and human health. The aim of this study was to investigate whether whole Tibetan hull-less barley (WHB) and refined Tibetan hull-less barley (RHB) caused differentiation of the fecal microbiota in vitro. The microbiota-accessible ingredients in the 2 barley samples were studied using an in vitro enzymatic digestion procedure. After in vitro digestion, insoluble dietary fiber, phenolic compounds, proteins, and β-glucans were 93.2%, 103.4%. 18.8%, and 10.2% higher provided by WHB flour as compared with RHB flour based on the same mass amount. However, due to the significantly higher content of insoluble dietary fiber, WHB digesta had lower percentage contents of fast fermentable substrates including dietary fiber and starch as compared with RHB digesta. The results of Next-generation sequencing of the bacterial 16SrRNA gene showed that both WHB and RHB fermentation had significantly promoted the growth of Bifidobacterium and inhibited the growth of pathogenic bacteria such as Dorea, Escherichia, Oscillopira, and Ruminococcus. Moreover, in response to WHB fermentation, the relative abundance of Bifidobacterium increased by 78.5% and 92.8% as compared with RHB and fructo-oligosaccharides (FOs). Both WHB and RHB are good sources of fermentable dietary fiber with the ability to yield high concentration of short chain fatty acids (SCFAs) as compared to FOs. However, the higher fraction of soluble fiber in RHB digesta increase higher amounts of SCFA compared with WHB digesta. Our findings shed light on the complex interactions of whole cereals with gut microbiota and the possible impact on host health. Until now, only few reports have regarded the impact of in vitro digestion in components of whole grain with complex food matrix. Moreover, our findings shed light on the complex interactions of whole cereals with gut microbiota and the possible impact on host health. © 2018

Plants with elevated levels of glucan

Energy Technology Data Exchange (ETDEWEB)

Pauly, Markus; Kraemer, Florian J.; Hake, Sarah

2018-03-20

The present disclosure relates to mutations in licheninase genes encoding polypeptides with decreased licheninase activity, which when expressed in plants results in elevated levels of glucan in the plants. In particular, the disclosure relates to licheninase nucleic acids and polypeptides related to glucan accumulation in plants, plants with reduced expression of a licheninase nucleic acid, and methods related to the generation of plants with increased glucan content in the cell walls of leaf tissue.

Importance of Lipopolysaccharide and Cyclic β-1,2-Glucans in Brucella-Mammalian Infections

Directory of Open Access Journals (Sweden)

Andreas F. Haag

2010-01-01

Full Text Available Brucella species are the causative agents of one of the most prevalent zoonotic diseases: brucellosis. Infections by Brucella species cause major economic losses in agriculture, leading to abortions in infected animals and resulting in a severe, although rarely lethal, debilitating disease in humans. Brucella species persist as intracellular pathogens that manage to effectively evade recognition by the host's immune system. Sugar-modified components in the Brucella cell envelope play an important role in their host interaction. Brucella lipopolysaccharide (LPS, unlike Escherichia coli LPS, does not trigger the host's innate immune system. Brucella produces cyclic β-1,2-glucans, which are important for targeting them to their replicative niche in the endoplasmic reticulum within the host cell. This paper will focus on the role of LPS and cyclic β-1,2-glucans in Brucella-mammalian infections and discuss the use of mutants, within the biosynthesis pathway of these cell envelope structures, in vaccine development.

Development of anti β glucan aptamers for use as radiopharmaceutical in the identification of fungal Infections

Energy Technology Data Exchange (ETDEWEB)

Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R., E-mail: cmsl@cdtn.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEM-MG), Belo Horizonte, MG (Brazil)

2013-07-01

Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with {sup 99}mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)

Development of anti β glucan aptamers for use as radiopharmaceutical in the identification of fungal Infections

International Nuclear Information System (INIS)

Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R.

2013-01-01

Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with 99 mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)

Mutations for chlorophyll deficiency in barley: comparative effects of physical and chemical mutagens

International Nuclear Information System (INIS)

Constantin, M.J.

1975-01-01

The report concerns a comparison of effects from gamma rays, fission neutrons, and ethylmethane sulfonate based on chlorophyll-deficient mutant seedlings. Data from the literature and from the author's research are reviewed, and results are related to the practical application of mutation induction in barley breeding. (BSC) [de

Baker's yeast beta glucan supplementation increases salivary IgA and decreases cold/flu symptomatic days after intense exercise.

Science.gov (United States)

McFarlin, Brian K; Carpenter, Katie C; Davidson, Tiffany; McFarlin, Meredith A

2013-09-01

Strenuous exercise, such as running a marathon, is known to suppress mucosal immunity for up to 24 hr, which can increase the risk of developing an upper respiratory tract infection (URTI) and reduced performance capacity (Allgrove JE, Geneen L, Latif S, Gleeson M. Influence of a fed or fasted state on the s-IgA response to prolonged cycling in active men and women. Int J Sport Nutr Exerc Metab. 2009;19(3):209-221; Barrett B, Locken K, Maberry R, Schwamman J, Brown R, Bobula J, Stauffacher EA. The Wisconsin Upper Respiratory Symptom Survey (WURSS): a new research instrument for assessing the common cold. J Fam Pract. 2002;51(3):265; Carpenter KC, Breslin WL, Davidson T, Adams A, McFarlin BK. Baker's yeast beta glucan supplementation increases monocytes and cytokines post-exercise: implications for infection risk? Br J Nutr. 2012;1-9). While many dietary interventions have been used to combat postexercise immune suppression, most have been ineffective. The key purpose of this study was to determine if baker's yeast β-glucan (BG) could positively affect the immune system of individuals undergoing intense exercise stress using two experiments. In the first (E1; N = 182 men and women), BG was compared to placebo supplementation for the incidence of URTI symptoms for 28 days postmarathon. In the second (E2; N = 60 men and women) changes in salivary immunoglobulin A (IgA) were evaluated after 50-min of strenuous cycling when participants had been supplemented for 10 days with either BG (250 mg/day) or placebo (rice flour). For E1, subjects reported URTI symptoms using a daily health log. For E2, saliva was collected prior to, immediately, and 2-hr postexercise using a salivette. Data for E1 and E2 were analyzed using separate analyses of variance (ANOVAs) with repeated measures (p flu symptom days postmarathon compared to placebo (p = .026). In E2, BG was associated with a 32% increase in salivary IgA (p = .048) at 2 hr after exercise compared to placebo. In summary

Glucan: mechanisms involved in its radioprotective effect

International Nuclear Information System (INIS)

Patchen, M.L.; D'Alesandro, M.M.; Brook, I.; Blakely, W.F.; MacVittie, T.J.

1987-01-01

It has generally been accepted that most biologically derived agents that are radioprotective in the hemopoietic-syndrome dose range (eg, endotoxin, Bacillus Calmette Guerin, Corynebacterium parvum, etc) exert their beneficial properties by enhancing hemopoietic recovery and hence, by regenerating the host's ability to resist life-threatening opportunistic infections. However, using glucan as a hemopoietic stimulant/radioprotectant, we have demonstrated that host resistance to opportunistic infection is enhanced in these mice even prior to the detection of significant hemopoietic regeneration. This early enhanced resistance to microbial invasion in glucan-treated irradiated mice could be correlated with enhanced and/or prolonged macrophage (but not granulocyte) function. These results suggest that early after irradiation glucan may mediate its radioprotection by enhancing resistance to microbial invasion via mechanisms not necessarily predicated on hemopoietic recovery. In addition, preliminary evidence suggests that glucan can also function as an effective free-radical scavenger. Because macrophages have been shown to selectively phagocytize and sequester glucan, the possibility that these specific cells may be protected by virtue of glucan's scavenging ability is also suggested

Boron Toxicity Tolerance in Barley through Reduced Expression of the Multifunctional Aquaporin HvNIP2;11[W

Science.gov (United States)

Schnurbusch, Thorsten; Hayes, Julie; Hrmova, Maria; Baumann, Ute; Ramesh, Sunita A.; Tyerman, Stephen D.; Langridge, Peter; Sutton, Tim

2010-01-01

Boron (B) toxicity is a significant limitation to cereal crop production in a number of regions worldwide. Here we describe the cloning of a gene from barley (Hordeum vulgare), underlying the chromosome 6H B toxicity tolerance quantitative trait locus. It is the second B toxicity tolerance gene identified in barley. Previously, we identified the gene Bot1 that functions as an efflux transporter in B toxicity-tolerant barley to move B out of the plant. The gene identified in this work encodes HvNIP2;1, an aquaporin from the nodulin-26-like intrinsic protein (NIP) subfamily that was recently described as a silicon influx transporter in barley and rice (Oryza sativa). Here we show that a rice mutant for this gene also shows reduced B accumulation in leaf blades compared to wild type and that the mutant protein alters growth of yeast (Saccharomyces cerevisiae) under high B. HvNIP2;1 facilitates significant transport of B when expressed in Xenopus oocytes compared to controls and to another NIP (NOD26), and also in yeast plasma membranes that appear to have relatively high B permeability. We propose that tolerance to high soil B is mediated by reduced expression of HvNIP2;1 to limit B uptake, as well as by increased expression of Bot1 to remove B from roots and sensitive tissues. Together with Bot1, the multifunctional aquaporin HvNIP2;1 is an important determinant of B toxicity tolerance in barley. PMID:20581256

A phase I/II trial of beta-(1,3/(1,6 D-glucan in the treatment of patients with advanced malignancies receiving chemotherapy

Directory of Open Access Journals (Sweden)

Weitberg Alan B

2008-09-01

Full Text Available Abstract β-(1,3/(1,6 D-glucan, a component of the fungal cell wall, has been shown to stimulate the immune system, enhance hematopoiesis, amplify killing of opsonized tumor cells and increase neutrophil chemotaxis and adhesion. In view of these attributes, the β-glucans should be studied for both their therapeutic efficacy in patients with cancer as well as an adjunctive therapy in patients receiving chemotherapy as a maneuver to limit suppression of hematopoiesis. In this study, twenty patients with advanced malignancies receiving chemotherapy were given a β-(1,3/(1,6 D-glucan preparation (MacroForce plus IP6, ImmuDyne, Inc. and monitored for tolerability and effect on hematopoiesis. Our results lead us to conclude that β-glucan is well-tolerated in cancer patients receiving chemotherapy, may have a beneficial effect on hematopoiesis in these patients and should be studied further, especially in patients with chronic lymphocytic leukemia and lymphoma.

Presence of a large β(1-3)glucan linked to chitin at the Saccharomyces cerevisiae mother-bud neck suggests involvement in localized growth control.

Science.gov (United States)

Cabib, Enrico; Blanco, Noelia; Arroyo, Javier

2012-04-01

Previous results suggested that the chitin ring present at the yeast mother-bud neck, which is linked specifically to the nonreducing ends of β(1-3)glucan, may help to suppress cell wall growth at the neck by competing with β(1-6)glucan and thereby with mannoproteins for their attachment to the same sites. Here we explored whether the linkage of chitin to β(1-3)glucan may also prevent the remodeling of this polysaccharide that would be necessary for cell wall growth. By a novel mild procedure, β(1-3)glucan was isolated from cell walls, solubilized by carboxymethylation, and fractionated by size exclusion chromatography, giving rise to a very high-molecular-weight peak and to highly polydisperse material. The latter material, soluble in alkali, may correspond to glucan being remodeled, whereas the large-size fraction would be the final cross-linked structural product. In fact, the β(1-3)glucan of buds, where growth occurs, is solubilized by alkali. A gas1 mutant with an expected defect in glucan elongation showed a large increase in the polydisperse fraction. By a procedure involving sodium hydroxide treatment, carboxymethylation, fractionation by affinity chromatography on wheat germ agglutinin-agarose, and fractionation by size chromatography on Sephacryl columns, it was shown that the β(1-3)glucan attached to chitin consists mostly of high-molecular-weight material. Therefore, it appears that linkage to chitin results in a polysaccharide that cannot be further remodeled and does not contribute to growth at the neck. In the course of these experiments, the new finding was made that part of the chitin forms a noncovalent complex with β(1-3)glucan.

Contribution of glucan-binding protein A to firm and stable biofilm formation by Streptococcus mutans.

Science.gov (United States)

Matsumi, Y; Fujita, K; Takashima, Y; Yanagida, K; Morikawa, Y; Matsumoto-Nakano, M

2015-06-01

Glucan-binding proteins (Gbps) of Streptococcus mutans, a major pathogen of dental caries, mediate the binding of glucans synthesized from sucrose by the action of glucosyltransferases (GTFs) encoded by gtfB, gtfC, and gtfD. Several stress proteins, including DnaK and GroEL encoded by dnaK and groEL, are related to environmental stress tolerance. The contribution of Gbp expression to biofilm formation was analyzed by focusing on the expression levels of genes encoding GTFs and stress proteins. Biofilm-forming assays were performed using GbpA-, GbpB-, and GbpC-deficient mutant strains and the parental strain MT8148. The expression levels of gtfB, gtfC, gtfD, dnaK, and groEL were evaluated by reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Furthermore, the structure of biofilms formed by these Gbp-deficient mutant strains was observed using confocal laser scanning microscopy (CLSM). Biofilm-forming assay findings demonstrated that the amount formed by the GbpA-deficient mutant strain (AD1) was nearly the same as that by the parental strain, while the GbpB- and GbpC-deficient mutant strains produced lower amounts than MT8148. Furthermore, RT-qPCR assay results showed that the expressions of gtfB, dnaK, and groEL in AD1 were elevated compared with MT8148. CLSM also revealed that the structure of biofilm formed by AD1 was prominently different compared with that formed by the parental strain. These results suggest that a defect in GbpA influences the expression of genes controlling biofilm formation, indicating its importance as a protein for firm and stable biofilm formation. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Effect of Barley and Enzyme on Performance, Carcass, Enzyme Activity and Digestion Parameters of Broilers

Directory of Open Access Journals (Sweden)

majid kalantar

2016-04-01

Full Text Available Introduction Corn has been recently used for producing ethanol fuel in the major corn-producing countries such as the US and Brazil. Recent diversion of corn for biofuel production along with the increased world's demand for this feedstuff has resulted in unprecedented rise in feed cost for poultry worldwide. Alternative grains such as wheat and barley can be successfully replaced for corn in poultry diets. These cereal grains can locally grow in many parts of the world as they have remarkably lower water requirement than corn. Wheat and barley are generally used as major sources of energy in poultry diets. Though the major components of these grains are starch and proteins, they have considerable content of non-starch polysaccharides (NSPs, derived from the cell walls (Olukosi et al. 2007; Mirzaie et al. 2012. NSPs are generally considered as anti-nutritional factors (Jamroz et al. 2002. The content and structure of NSP polymers vary between different grains, which consequently affect their nutritive value (Olukosi et al. 2007.Wheat and barley are generally used as major sources of energy in poultry diets. The major components of these grains are starch and proteins, they have considerable content of non-starch polysaccharides (NSPs, derived from the cell walls. NSPs are generally considered as anti-nutritional factors. The content and structure of NSP polymers vary between different grains, which consequently affect their nutritive value. The major part of NSPs in barley comprises polymers of (1→3 (1→4-β- glucans which could impede growth factors and consequently carcass quality through lowering the rate and amount of available nutrients in the mucosal surface of the intestinal. Materials and Methods This experiment was conducted to evaluate the effect of corn and barley based diets supplemented with multi-enzyme on growth, carcass, pancreas enzyme activity and physiological characteristics of broilers. A total number of 375 one day old

Effects of Cerium and Titanium Oxide Nanoparticles in Soil on the Nutrient Composition of Barley (Hordeum vulgare L. Kernels

Directory of Open Access Journals (Sweden)

Filip Pošćić

2016-06-01

Full Text Available The implications of metal nanoparticles (MeNPs are still unknown for many food crops. The purpose of this study was to evaluate the effects of cerium oxide (nCeO2 and titanium oxide (nTiO2 nanoparticles in soil at 0, 500 and 1000 mg·kg−1 on the nutritional parameters of barley (Hordeum vulgare L. kernels. Mineral nutrients, amylose, β-glucans, amino acid and crude protein (CP concentrations were measured in kernels. Whole flour samples were analyzed by ICP-AES/MS, HPLC and Elemental CHNS Analyzer. Results showed that Ce and Ti accumulation under MeNPs treatments did not differ from the control treatment. However, nCeO2 and nTiO2 had an impact on composition and nutritional quality of barley kernels in contrasting ways. Both MeNPs left β-glucans unaffected but reduced amylose content by approximately 21%. Most amino acids and CP increased. Among amino acids, lysine followed by proline saw the largest increase (51% and 37%, respectively. Potassium and S were both negatively impacted by MeNPs, while B was only affected by 500 mg nCeO2·kg−1. On the contrary Zn and Mn concentrations were improved by 500 mg nTiO2·kg−1, and Ca by both nTiO2 treatments. Generally, our findings demonstrated that kernels are negatively affected by nCeO2 while nTiO2 can potentially have beneficial effects. However, both MeNPs have the potential to negatively impact malt and feed production.

Structure, function and protein engineering in starch debranching enzyme systems. Barley limit dextrinase and its endogenous inhibitor

DEFF Research Database (Denmark)

Møller, Marie Sofie

Starch is the most abundant storage carbohydrate in cereal grains. It is composed primarily of amylopectin, a polymer of glucose in which α-1,4-linked glucan chains are branched with α-1,6-bonds. Enzymatic degradation of starch in germinating barley seeds involves an initial solubilisation, mainly...... in a hydrophobic cluster of LDI caused the most dramatic decreases in binding affinity. The LDI-L41G-V42D variant had close to 5×105-fold reduced affinity. The complex formation was independent of ionic strength, which was confirmed by the minor importance of two LDI arginines, Arg34 and Arg38, for the binding...

Effect of gamma irradiation (60CO) on quatitative characters of barley (Hordeum vulgare)

International Nuclear Information System (INIS)

Santana, T.C.; Gonzalez, F.C.

1984-01-01

Seeds od f a barley line were irradiated with doses ranging from O to 64 Kr of gamma radiation for three consecutive generations (R1,R2 and R3). From these, several mutant generations were obtained in the field, planting at a commercial density and without selection. (M.A.C.) [pt

Estimates of selection parameters in protein mutants of spring barley

International Nuclear Information System (INIS)

Gaul, H.; Walther, H.; Seibold, K.H.; Brunner, H.; Mikaelsen, K.

1976-01-01

Detailed studies have been made with induced protein mutants regarding a possible genetic advance in selection including the estimation of the genetic variation and heritability coefficients. Estimates were obtained for protein content and protein yield. The variation of mutant lines in different environments was found to be many times as large as the variation of the line means. The detection of improved protein mutants seems therefore possible only in trials with more than one environment. The heritability of protein content and protein yield was estimated in different sets of environments and was found to be low. However, higher values were found with an increasing number of environments. At least four environments seem to be necessary to obtain reliable heritability estimates. The geneticall component of the variation between lines was significant for protein content in all environmental combinations. For protein yield some environmental combinations only showed significant differences. The expected genetic advance with one selection step was small for both protein traits. Genetically significant differences between protein micromutants give, however, a first indication that selection among protein mutants with small differences seems also possible. (author)

Comparative proteomic analysis of aluminum tolerance in tibetan wild and cultivated barleys.

Directory of Open Access Journals (Sweden)

Huaxin Dai

Full Text Available Aluminum (Al toxicity is a major limiting factor for plant production in acid soils. Wild barley germplasm is rich in genetic diversity and may provide elite genes for crop Al tolerance improvement. The hydroponic-experiments were performed to compare proteomic and transcriptional characteristics of two contrasting Tibetan wild barley genotypes Al- resistant/tolerant XZ16 and Al-sensitive XZ61 as well as Al-resistant cv. Dayton. Results showed that XZ16 had less Al uptake and translocation than XZ61 and Dayton under Al stress. Thirty-five Al-tolerance/resistance-associated proteins were identified and categorized mainly in metabolism, energy, cell growth/division, protein biosynthesis, protein destination/storage, transporter, signal transduction, disease/defense, etc. Among them, 30 were mapped on barley genome, with 16 proteins being exclusively up-regulated by Al stress in XZ16, including 4 proteins (S-adenosylmethionine-synthase 3, ATP synthase beta subunit, triosephosphate isomerase, Bp2A specifically expressed in XZ16 but not Dayton. The findings highlighted the significance of specific-proteins associated with Al tolerance, and verified Tibetan wild barley as a novel genetic resource for Al tolerance.

Relationship between soil cellulolytic activity and suppression of seedling blight of barley in arable soils

DEFF Research Database (Denmark)

Rasmussen, Peter Have; Knudsen, I.; Elmholt, S.

2002-01-01

the Hanes-Wolf transformation of the Michaelis-Menten equation. Soil samples from 6 to 13 cm depth were collected in the early spring as undisturbed blocks from 10 arable soils with different physico-chemical properties and cultivation history. Significant correlations were found between soil suppresiveness......The objective was to investigate the relationship between soil suppression of seedling blight of barley caused by Fusarium culmorum (W.G. Smith) Sacc. and the soil cellulolytic activity of beta-glucosidase, cellobiohydrolase and endocellulase. Disease suppression was investigated in bioassays...... with test soils mixed with sand, and barley seeds inoculated with F. culmorum. After 19 days, disease severity was evaluated on the barley seedlings. Soil cellulolytic activities were measured using 4-methylumbelliferyl-labelled fluorogenic substrates, and were expressed as V-max values obtained by using...

Prebiotic and synbiotic effects on rats fed malted barley with selected bacteria strains

Directory of Open Access Journals (Sweden)

Yadong Zhong

2014-10-01

Full Text Available Background: Butyric acid, one of the key products formed when β-glucans are degraded by the microbiota in the colon, has been proposed to be important for colonic health. Glutamine bound to the fibre may have similar effects once it has been liberated from the fibre in the colon. Both β-glucans and glutamine are found in high amounts in malted barley. Lactobacillus rhamnosus together with malt has been shown to increase the formation of butyric acid further in rats. Objective: To investigate whether Lactobacillus rhamnosus 271, Lactobacillus paracasei 87002, Lactobacillus plantarum HEAL 9 and 19, and Bifidobacterium infantis CURE 21 affect the levels of short-chain fatty acids and glutamine in caecum and portal blood of rats fed barley malt. Design: The experimental diets were fed for 12 days. The daily dose of the probiotic strain was 1×109 colony forming units and the intake of fibre 0.82 g/day. Results: The malt mostly contained insoluble fibre polymers (93%, consisting of glucose and xylose (38–41 g/kg and some arabinose (21 g/kg. The fibre polysaccharides were quite resistant to fermentation in the rats, regardless of whether or not probiotics were added (25–30% were fermented. Caecal and portal levels of acetic acid decreased in the rats after the addition of L. plantarum HEAL 9 and L. rhamnosus 271, and also the levels of butyric acid. Viable counts of Lactobacillus, Bifidobacterium and Enterobacteriaceae were unaffected, while the caecal composition of Lactobacilli was influenced by the type of strain administrated. Portal levels of glutamine were unchanged, but glycine levels increased with L. plantarum HEAL 9 and 19 and phenylalanine with L. rhamnosus 271. Conclusions: Although the probiotic strains survived and reached the caecum, except B. infantis CURE 21, there were no effects on viable counts or in the fermentation of different fibre components, but the formation of some bacterial metabolites decreased. This may be due to

The Barley Magnesium Chelatase 150-kD Subunit Is Not an Abscisic Acid Receptor1[OA

Science.gov (United States)

Müller, André H.; Hansson, Mats

2009-01-01

Magnesium chelatase is the first unique enzyme of the chlorophyll biosynthetic pathway. It is composed of three gene products of which the largest is 150 kD. This protein was recently identified as an abscisic acid receptor in Arabidopsis (Arabidopsis thaliana). We have evaluated whether the barley (Hordeum vulgare) magnesium chelatase large subunit, XanF, could be a receptor for the phytohormone. The study involved analysis of recombinant magnesium chelatase protein as well as several induced chlorophyll-deficient magnesium chelatase mutants with defects identified at the gene and protein levels. Abscisic acid had no effect on magnesium chelatase activity and binding to the barley 150-kD protein could not be shown. Magnesium chelatase mutants showed a wild-type response in respect to postgermination growth and stomatal aperture. Our results question the function of the large magnesium chelatase subunit as an abscisic acid receptor. PMID:19176716

Supplementation of Reduced Gluten Barley Diet with Oral Prolyl Endopeptidase Effectively Abrogates Enteropathy-Associated Changes in Gluten-Sensitive Macaques

Directory of Open Access Journals (Sweden)

Karol Sestak

2016-06-01

Full Text Available Celiac disease (CD is an autoimmune disorder that affects approximately three million people in the United States. Furthermore, non-celiac gluten sensitivity (NCGS affects an estimated additional 6% of the population, e.g., 20 million in the U.S. The only effective treatment of CD and NCGS requires complete removal of gluten sources from the diet. While required adherence to a gluten-free diet (GFD is extremely difficult to accomplish, efforts to develop additional supportive treatments are needed. To facilitate these efforts, we developed a gluten-sensitive (GS rhesus macaque model to study the effects of novel therapies. Recently reported results from phase one of this project suggest that partial improvement—but not remission—of gluten-induced disease can be accomplished by 100-fold reduction of dietary gluten, i.e., 200 ppm—by replacement of conventional dietary sources of gluten with a mutant, reduced gluten (RG barley (lys3a-derived source. The main focus of this (phase two study was to determine if the inflammatory effects of the residual gluten in lys3a mutant barley grain could be further reduced by oral supplementation with a prolylendopeptidase (PE. Results reveal that PE supplementation of RG barley diet induces more complete immunological, histopathological and clinical remission than RG barley diet alone. The combined effects of RG barley diet and PE supplementation resulted in a further decrease of inflammatory mediators IFN-γ and TNF secretion by peripheral lymphocytes, as well as decreased plasma anti-gliadin and anti-intestinal tissue transglutaminase (TG2 antibodies, diminished active caspase production in small intestinal mucosa, and eliminated clinical diarrhea—all comparable with a gluten-free diet induced remission. In summary, the beneficial results of a combined RG barley and PE administration in GS macaques may warrant the investigation of similar synergistic approaches.

6-O-Branched Oligo-β-glucan-Based Antifungal Glycoconjugate Vaccines.

Science.gov (United States)

Liao, Guochao; Zhou, Zhifang; Liao, Jun; Zu, Luning; Wu, Qiuye; Guo, Zhongwu

2016-02-12

With the rapid growth in fungal infections and drug-resistant fungal strains, antifungal vaccines have become an especially attractive strategy to tackle this important health problem. β-Glucans, a class of extracellular carbohydrate antigens abundantly and consistently expressed on fungal cell surfaces, are intriguing epitopes for antifungal vaccine development. β-Glucans have a conserved β-1,3-glucan backbone with sporadic β-1,3- or β-1,6-linked short glucans as branches at the 6-O-positions, and the branches may play a critical role in their immunologic functions. To study the immunologic properties of branched β-glucans and develop β-glucan-based antifungal vaccines, three branched β-glucan oligosaccharides with 6-O-linked β-1,6-tetraglucose, β-1,3-diglucose, and β-1,3-tetraglucose branches on a β-1,3-nonaglucan backbone, which mimic the structural epitopes of natural β-glucans, were synthesized and coupled with keyhole limpet hemocyanin (KLH) to form novel synthetic conjugate vaccines. These glycoconjugates were proved to elicit strong IgG antibody responses in mice. It was also discovered that the number, size, and structure of branches linked to the β-glucan backbone had a significant impact on the immunologic property. Moreover, antibodies induced by the synthetic oligosaccharide-KLH conjugates were able to recognize and bind to natural β-glucans and fungal cells. Most importantly, these conjugates elicited effective protection against systemic Candida albicans infection in mice. Thus, branched oligo-β-glucans were identified as functional epitopes for antifungal vaccine design and the corresponding protein conjugates as promising antifungal vaccine candidates.

(1,3;1,4)-β-Glucan Biosynthesis by the CSLF6 Enzyme: Position and Flexibility of Catalytic Residues Influence Product Fine Structure.

Science.gov (United States)

Dimitroff, George; Little, Alan; Lahnstein, Jelle; Schwerdt, Julian G; Srivastava, Vaibhav; Bulone, Vincent; Burton, Rachel A; Fincher, Geoffrey B

2016-04-05

Cellulose synthase-like F6 (CslF6) genes encode polysaccharide synthases responsible for (1,3;1,4)-β-glucan biosynthesis in cereal grains. However, it is not clear how both (1,3)- and (1,4)-linkages are incorporated into a single polysaccharide chain and how the frequency and arrangement of the two linkage types that define the fine structure of the polysaccharide are controlled. Through transient expression in Nicotiana benthamiana leaves, two CSLF6 orthologs from different cereal species were shown to mediate the synthesis of (1,3;1,4)-β-glucans with very different fine structures. Chimeric cDNA constructs with interchanged sections of the barley and sorghum CslF6 genes were developed to identify regions of the synthase enzyme responsible for these differences. A single amino acid residue upstream of the TED motif in the catalytic region was shown to dramatically change the fine structure of the polysaccharide produced. The structural basis of this effect can be rationalized by reference to a homology model of the enzyme and appears to be related to the position and flexibility of the TED motif in the active site of the enzyme. The region and amino acid residue identified provide opportunities to manipulate the solubility of (1,3;1,4)-β-glucan in grains and vegetative tissues of the grasses and, in particular, to enhance the solubility of dietary fibers that are beneficial to human health.

β-glucan extract from oat bran and its industrial importance

Science.gov (United States)

Ibrahim, M. N. G.; Selezneva, I. S.

2017-09-01

The β-Glucan exhibits a broad spectrum of biological activity, for example it is highly active against many chronic diseases such as diabetes millets, cancer and improper digestion. The β-Glucan is a polysaccharide of D-glucose. It has many different sources of extraction such as yeasts, cereals, fungus and some bacteria. The extraction of the β-Glucan has become so important in our days, because the β-Glucan is a natural substance which can be used in pharmaceutical products for prevention and treatment of many chronic diseases. As well, many food producers have interest to introduce the β-Glucan in many food products, like dairy, meat and bakery products. Taking into consideration the foregoing, we tried to isolate the β-Glucan from oat bran using the acid method of extraction. Some modifications were offered to increase the β-Glucan concentration in the final extract and increase the total extract yield. As a result, the extracts with two different concentrations 72 % and 90 % were obtained with the yields 3.14 % and 4.4 % respectively. It should be noted that the β-Glucan addition into food products can improve their quality and physical properties. Thus, the β-Glucan is now of great importance for maintaining the consumers health by functional food products.

Glucan, Water Dikinase Activity Stimulates Breakdown of Starch Granules by Plastidial β-Amylases1[W][OA

Science.gov (United States)

Edner, Christoph; Li, Jing; Albrecht, Tanja; Mahlow, Sebastian; Hejazi, Mahdi; Hussain, Hasnain; Kaplan, Fatma; Guy, Charles; Smith, Steven M.; Steup, Martin; Ritte, Gerhard

2007-01-01

Glucan phosphorylating enzymes are required for normal mobilization of starch in leaves of Arabidopsis (Arabidopsis thaliana) and potato (Solanum tuberosum), but mechanisms underlying this dependency are unknown. Using two different activity assays, we aimed to identify starch degrading enzymes from Arabidopsis, whose activity is affected by glucan phosphorylation. Breakdown of granular starch by a protein fraction purified from leaf extracts increased approximately 2-fold if the granules were simultaneously phosphorylated by recombinant potato glucan, water dikinase (GWD). Using matrix-assisted laser-desorption ionization mass spectrometry several putative starch-related enzymes were identified in this fraction, among them β-AMYLASE1 (BAM1; At3g23920) and ISOAMYLASE3 (ISA3; At4g09020). Experiments using purified recombinant enzymes showed that BAM1 activity with granules similarly increased under conditions of simultaneous starch phosphorylation. Purified recombinant potato ISA3 (StISA3) did not attack the granular starch significantly with or without glucan phosphorylation. However, starch breakdown by a mixture of BAM1 and StISA3 was 2 times higher than that by BAM1 alone and was further enhanced in the presence of GWD and ATP. Similar to BAM1, maltose release from granular starch by purified recombinant BAM3 (At4g17090), another plastid-localized β-amylase isoform, increased 2- to 3-fold if the granules were simultaneously phosphorylated by GWD. BAM activity in turn strongly stimulated the GWD-catalyzed phosphorylation. The interdependence between the activities of GWD and BAMs offers an explanation for the severe starch excess phenotype of GWD-deficient mutants. PMID:17631522

Improving barley culm robustness for secured crop yield in a changing climate.

Science.gov (United States)

Dockter, Christoph; Hansson, Mats

2015-06-01

The Green Revolution combined advancements in breeding and agricultural practice, and provided food security to millions of people. Daily food supply is still a major issue in many parts of the world and is further challenged by future climate change. Fortunately, life science research is currently making huge progress, and the development of future crop plants will be explored. Today, plant breeding typically follows one gene per trait. However, new scientific achievements have revealed that many of these traits depend on different genes and complex interactions of proteins reacting to various external stimuli. These findings open up new possibilities for breeding where variations in several genes can be combined to enhance productivity and quality. In this review we present an overview of genes determining plant architecture in barley, with a special focus on culm length. Many genes are currently known only through their mutant phenotypes, but emerging genomic sequence information will accelerate their identification. More than 1000 different short-culm barley mutants have been isolated and classified in different phenotypic groups according to culm length and additional pleiotropic characters. Some mutants have been connected to deficiencies in biosynthesis and reception of brassinosteroids and gibberellic acids. Still other mutants are unlikely to be connected to these hormones. The genes and corresponding mutations are of potential interest for development of stiff-straw crop plants tolerant to lodging, which occurs in extreme weather conditions with strong winds and heavy precipitation. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Dawn and Dusk Set States of the Circadian Oscillator in Sprouting Barley (Hordeum vulgare Seedlings.

Directory of Open Access Journals (Sweden)

Weiwei Deng

Full Text Available The plant circadian clock is an internal timekeeper that coordinates biological processes with daily changes in the external environment. The transcript levels of clock genes, which oscillate to control circadian outputs, were examined during early seedling development in barley (Hordeum vulgare, a model for temperate cereal crops. Oscillations of clock gene transcript levels do not occur in barley seedlings grown in darkness or constant light but were observed with day-night cycles. A dark-to-light transition influenced transcript levels of some clock genes but triggered only weak oscillations of gene expression, whereas a light-to-dark transition triggered robust oscillations. Single light pulses of 6, 12 or 18 hours induced robust oscillations. The light-to-dark transition was the primary determinant of the timing of subsequent peaks of clock gene expression. After the light-to-dark transition the timing of peak transcript levels of clock gene also varied depending on the length of the preceding light pulse. Thus, a single photoperiod can trigger initiation of photoperiod-dependent circadian rhythms in barley seedlings. Photoperiod-specific rhythms of clock gene expression were observed in two week old barley plants. Changing the timing of dusk altered clock gene expression patterns within a single day, showing that alteration of circadian oscillator behaviour is amongst the most rapid molecular responses to changing photoperiod in barley. A barley EARLY FLOWERING3 mutant, which exhibits rapid photoperiod-insensitive flowering behaviour, does not establish clock rhythms in response to a single photoperiod. The data presented show that dawn and dusk cues are important signals for setting the state of the circadian oscillator during early development of barley and that the circadian oscillator of barley exhibits photoperiod-dependent oscillation states.

An Extracellular Cell-Attached Pullulanase Confers Branched α-Glucan Utilization in Human Gut Lactobacillus acidophilus.

Science.gov (United States)

Møller, Marie S; Goh, Yong Jun; Rasmussen, Kasper Bøwig; Cypryk, Wojciech; Celebioglu, Hasan Ufuk; Klaenhammer, Todd R; Svensson, Birte; Abou Hachem, Maher

2017-06-15

Of the few predicted extracellular glycan-active enzymes, glycoside hydrolase family 13 subfamily 14 (GH13_14) pullulanases are the most common in human gut lactobacilli. These enzymes share a unique modular organization, not observed in other bacteria, featuring a catalytic module, two starch binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here, we explore the specificity of a representative of this group of pullulanases, Lactobacillus acidophilus Pul13_14 ( La Pul13_14), and its role in branched α-glucan metabolism in the well-characterized Lactobacillus acidophilus NCFM, which is widely used as a probiotic. Growth experiments with L. acidophilus NCFM on starch-derived branched substrates revealed a preference for α-glucans with short branches of about two to three glucosyl moieties over amylopectin with longer branches. Cell-attached debranching activity was measurable in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by La Pul13_14 and is abolished in a mutant strain lacking a functional La Pul13_14 gene. Hydrolysis kinetics of recombinant La Pul13_14 confirmed the preference for short-branched α-glucan oligomers consistent with the growth data. Curiously, this enzyme displayed the highest catalytic efficiency and the lowest K m reported for a pullulanase. Inhibition kinetics revealed mixed inhibition by β-cyclodextrin, suggesting the presence of additional glucan binding sites besides the active site of the enzyme, which may contribute to the unprecedented substrate affinity. The enzyme also displays high thermostability and higher activity in the acidic pH range, reflecting adaptation to the physiologically challenging conditions in the human gut. IMPORTANCE Starch is one of the most abundant glycans in the human diet. Branched α-1,6-glucans in dietary starch and glycogen are nondegradable by human enzymes and constitute a

Functional proteomics of barley and barley chloroplasts – strategies, methods and perspectives

DEFF Research Database (Denmark)

Petersen, Jørgen; Rogowska-Wrzesinska, Adelina; Jensen, Ole Nørregaard

2013-01-01

Barley (Hordeum vulgare) is an important cereal grain that is used in a range of products for animal and human consumption. Crop yield and seed quality has been optimized during decades by plant breeding programs supported by biotechnology and molecular biology techniques. The recently completed...... whole-genome sequencing of barley revealed approximately 26,100 open reading frames, which provides a foundation for detailed molecular studies of barley by functional genomics and proteomics approaches. Such studies will provide further insights into the mechanisms of, for example, drought and stress...... tolerance, micronutrient utilization, and photosynthesis in barley. In the present review we present the current state of proteomics research for investigations of barley chloroplasts, i.e., the organelle that contain the photosynthetic apparatus in the plant. We describe several different proteomics...

Molecular basis of structural makeup of hulless barley in relation to rumen degradation kinetics and intestinal availability in dairy cattle: A novel approach.

Science.gov (United States)

Damiran, D; Yu, P

2011-10-01

To date, no study has been done of molecular structures in relation to nutrient degradation kinetics and intestinal availability in dairy cattle. The objectives of this study were to (1) reveal molecular structures of hulless barley affected by structural alteration using molecular spectroscopy (diffuse reflectance infrared Fourier transform) as a novel approach, and (2) quantify structure features on a molecular basis in relation to digestive kinetics and nutritive value in the rumen and intestine in cattle. The modeled feeds in this study were 4 types of hulless barley (HB) cultivars modified in starch traits: (a) normal starch cultivar, (b) zero-amylose waxy, (c) waxy, and (d) high-amylose. The molecular structural features were determined using diffuse reflectance infrared Fourier transform spectroscopy in the mid-infrared region (ca. 4,000-800 cm(-1)) of the electromagnetic spectrum. The items assessed included infrared intensity attributed to protein amide I (ca. 1,715-1,575 cm(-1)), amide II (ca. 1,575-1,490 cm(-1)), α-helix (ca. 1,648-1,660 cm(-1)), β-sheet (ca. 1,625-1,640 cm(-1)), and their ratio, β-glucan (ca. 1,445-1,400 cm(-1)), total carbohydrates (CHO; ca. 1,188-820 cm(-1)) and their 3 major peaks, structural carbohydrates (ca. 1,277-1,190 cm(-1)), and ratios of amide I to II and amide I to CHO. The results show that (1) the zero-amylose waxy was the greatest in amide I and II peak areas, as well as in the ratio of protein amide I to CHO among HB; (2) α-helix-to-β-sheet ratio differed among HB: the high-amylose was the greatest, the zero-amylose waxy and waxy were the intermediate, and the normal starch was the lowest; (3) HB were similar in β-glucan and CHO molecular structural makeup; (4) altered starch HB cultivars were similar to each other, but were different from the normal starch cultivar in protein molecular makeup; and (5) the rate and extent of rumen degradation of starch and protein were highly related to the molecular structural

Brewing with fractionated barley

NARCIS (Netherlands)

Donkelaar, van L.H.G.

2016-01-01

Brewing with fractionated barley

Beer is a globally consumed beverage, which is produced from malted barley, water, hops and yeast. In recent years, the use of unmalted barley and exogenous enzymes have become more popular because they enable simpler processing and reduced environmental

Variation in storage alpha-glucans of the Porphyridiales (Rhodophyta).

Science.gov (United States)

Shimonaga, Takahiro; Konishi, Mai; Oyama, Yasunori; Fujiwara, Shoko; Satoh, Aya; Fujita, Naoko; Colleoni, Christophe; Buléon, Alain; Putaux, Jean-Luc; Ball, Steven G; Yokoyama, Akiko; Hara, Yoshiaki; Nakamura, Yasunori; Tsuzuki, Mikio

2008-01-01

Storage glucans were analyzed in the Porphyridiales which include the most primitive and phylogenetically diverged species in the Rhodophyta, to understand early evolution of the glucan structure in the Rhodophyta. The storage glucans of both Galdieria sulphuraria and Cyanidium caldarium consisted of glycogen, while those of Rhodosorus marinus, Porphyridium purpureum, P. sordidum and Rhodella violacea could be defined as semi-amylopectin. X-ray diffraction analysis of the glucans demonstrated variation in the crystalline structure: the patterns in P. purpureum and R. violacea were of A- and B-types, respectively, while alpha-glucans of R. marinus and P. sordidum displayed structures with lower crystallinity. Electron microscopic observations indicated that the alpha-glucans of P. sordidum consisted of two kinds of granules; a minor component of more dense granules with crystalline leaflets and a major component of softer ones without crystalline structure. Gel permeation chromatography showed that all the species containing the semi-amylopectin-type glucans also contained amylose, although the relative amounts of this fraction were different depending on the species. Our results are consistent with two distinct evolution scenarios defined either by the independent acquisition of semi-crystalline starch-like structures in the different plant lineages or more probably by the loss of starch and reversion to glycogen synthesis in cyanidian algae growing in hot and acid environments.

Objectives and results of barley breeding in Australia

International Nuclear Information System (INIS)

Sparrow, D.H.B.

1990-01-01

An important current development in Australian barley improvement is the release of semi-dwarf cultivars. These are derived from Abed Deba, Triumph or Aapo which are believed to have an allelic series of mutant genes. A common problem with these genes is their association with relatively late maturity and small grain, limiting current cultivars to rainfall areas above 450mm per annum. The first release 'Skiff' (S.A., N.S.W. 1988) is to be followed by selections from 'Forrest' x 'Aapo' in Western Australia and 'Grimmett' x 'Triumph' in Queensland, whilst 'Triumph' is already being grown in Tasmania. (author)

Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi

Directory of Open Access Journals (Sweden)

Akira Yoshimi

2017-11-01

Full Text Available Although α-1,3-glucan is a major cell wall polysaccharide in filamentous fungi, its biological functions remain unclear, except that it acts as a virulence factor in animal and plant pathogenic fungi: it conceals cell wall β-glucan on the fungal cell surface to circumvent recognition by hosts. However, cell wall α-1,3-glucan is also present in many of non-pathogenic fungi. Recently, the universal function of α-1,3-glucan as an aggregation factor has been demonstrated. Applications of fungi with modified cell wall α-1,3-glucan in the fermentation industry and of in vitro enzymatically-synthesized α-1,3-glucan in bio-plastics have been developed. This review focuses on the recent progress in our understanding of the biological functions and biosynthetic mechanism of cell wall α-1,3-glucan in fungi. We briefly consider the history of studies on α-1,3-glucan, overview its biological functions and biosynthesis, and finally consider the industrial applications of fungi deficient in α-1,3-glucan.

Effects of beta-lactamases and omp mutation on susceptibility to beta-lactam antibiotics in Escherichia coli.

Science.gov (United States)

Hiraoka, M; Okamoto, R; Inoue, M; Mitsuhashi, S

1989-01-01

Four types of beta-lactamases consisting of a penicillinase type I (TEM-1), a penicillinase type II (OXA-1), a cephalosporinase of Citrobacter freundii, and a cephalosporinase of Proteus vulgaris were introduced into Escherichia coli MC4100 and its omp mutants, MH1160 (MC4100 ompR1) and MH760 (MC4100 ompR2), by transformation. Effects of the combination of the omp mutations and these beta-lactamases on the susceptibility of E. coli strains were studied with 15 beta-lactam antibiotics including cephalosporins, cephamycins, penicillins, imipenem, and aztreonam. The ompR1 mutant, MH1160, lacks OmpF and OmpC, and it showed reduced susceptibility to 11 of the 15 beta-lactam agents. The reduction in susceptibility to cefoxitin, moxalactam, and flomoxef was much greater than reduction in susceptibility to the other agents. When the ompR1 mutant produced the cephalosporinase of C. freundii, the susceptibility of the mutant to 12 of the 15 beta-lactam antibiotics decreased. The reduction in susceptibility of MH1160 to 10 of the 12 agents affected by the enzyme was two- to fourfold greater than that observed in MC4100. Such a synergistic effect was also observed with the cephalosporinase of P. vulgaris and ompR1 mutation against six cephalosporins, moxalactam, and aztreonam. Images PMID:2658786

Barley grain constituents, starch composition, and structure affect starch in vitro enzymatic hydrolysis.

Science.gov (United States)

Asare, Eric K; Jaiswal, Sarita; Maley, Jason; Båga, Monica; Sammynaiken, Ramaswami; Rossnagel, Brian G; Chibbar, Ravindra N

2011-05-11

The relationship between starch physical properties and enzymatic hydrolysis was determined using ten different hulless barley genotypes with variable carbohydrate composition. The ten barley genotypes included one normal starch (CDC McGwire), three increased amylose starches (SH99250, SH99073, and SB94893), and six waxy starches (CDC Alamo, CDC Fibar, CDC Candle, Waxy Betzes, CDC Rattan, and SB94912). Total starch concentration positively influenced thousand grain weight (TGW) (r(2) = 0.70, p starch concentration (r(2) = -0.80, p hydrolysis of pure starch (r(2) = -0.67, p starch concentration (r(2) = 0.46, p starch (RS) in meal and pure starch samples. The rate of starch hydrolysis was high in pure starch samples as compared to meal samples. Enzymatic hydrolysis rate both in meal and pure starch samples followed the order waxy > normal > increased amylose. Rapidly digestible starch (RDS) increased with a decrease in amylose concentration. Atomic force microscopy (AFM) analysis revealed a higher polydispersity index of amylose in CDC McGwire and increased amylose genotypes which could contribute to their reduced enzymatic hydrolysis, compared to waxy starch genotypes. Increased β-glucan and dietary fiber concentration also reduced the enzymatic hydrolysis of meal samples. An average linkage cluster analysis dendrogram revealed that variation in amylose concentration significantly (p starch concentration in meal and pure starch samples. RS is also associated with B-type granules (5-15 μm) and the amylopectin F-III (19-36 DP) fraction. In conclusion, the results suggest that barley genotype SH99250 with less decrease in grain weight in comparison to that of other increased amylose genotypes (SH99073 and SH94893) could be a promising genotype to develop cultivars with increased amylose grain starch without compromising grain weight and yield.

Glucan synthesis in the genus Lactobacillus : isolation and characterization of glucansucrase genes, enzymes and glucan products from six different strains

NARCIS (Netherlands)

Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

2004-01-01

Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan

Glucan synthesis in the genus Lactobacillus: Isolation and characterization of glucansucrase genes, enzymes and glucan products from six different strains

NARCIS (Netherlands)

Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

2004-01-01

Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan

An Arabidopsis callose synthase

DEFF Research Database (Denmark)

Ostergaard, Lars; Petersen, Morten; Mattsson, Ole

2002-01-01

in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while...... expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant....

Technical note: In situ ruminal starch disappearance kinetics of hull-less barley, hulled barley, and corn grains.

Science.gov (United States)

Ferreira, G; Yang, Y; Teets, C L; Brooks, W S; Griffey, C A

2018-07-01

The objective of this study was to compare ruminal starch disappearance rates of hull-less barley, hulled barley, and corn grains. Five different genotypes were used for each of the 2 barley types. In addition, each of these genotypes was grown in 2 different locations and years, resulting 10 independent barley samples for each of the 2 barley grain types. Five different genotypes of corn grain were obtained from a commercial seed company. After being ground to pass through a 4-mm screen of a cutter mill, 3.6 g of each grain was placed into a porous bag, which was then incubated in the rumen of 2 ruminally cannulated cows for 0, 4, 8, 12, 24, and 48 h. Corn grains had greater instant ruminal starch disappearances than barley grains (22.4 and 8.2%, respectively). Instant ruminal starch disappearances did not differ between hulled and hull-less barley grains. Ruminal starch fractional disappearance rates were greatest for hulled barley grains, moderate for hull-less barley grains, and lowest for corn grains (15.3, 13.9, and 7.1%/h, respectively). Ruminal starch half-life was shortest for hulled and hull-less barley grains (4.4 h) and longest for corn grains (6.6 h). Ruminal starch half-life did not differ between hulled barley and hull-less barley grains. In conclusion, using a holistic experimental design and statistical analysis, this study showed that starch from hull-less barley grains has a ruminal half-life similar to that of hulled barley grains and shorter than that of corn grains. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii

Directory of Open Access Journals (Sweden)

Sharon Avni

2017-07-01

Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.

Real-time weed detection, decision making and patch spraying in maize, sugarbeet, winter wheat and winter barley

DEFF Research Database (Denmark)

Gerhards, R; Christensen, Svend

2003-01-01

with weed infestation levels higher than the economic weed threshold; a review of such work is provided. This paper presents a system for site-specific weed control in sugarbeet (Beta vulgaris L.), maize (Zea mays L.), winter wheat (Triticum aestivum L.) and winter barley (Hordeum vulgare L.), including...

Nutritional and functional characterization of barley flaxseed based functional dry soup mix.

Science.gov (United States)

Kaur, Sumeet; Das, Madhusweta

2015-09-01

Barley flaxseed based functional dry soup mix (BFSM) was developed from whole barely flour (46.296%), roasted flaxseed powder (23.148%) and the seasoning (30.555%) comprising several flavoring compounds and anticaking agent, using simple processing technique. Developed BFSM was nutritious. On dry matter basis it contained: protein (14.31%), carbohydrate excluding crude fiber (54.70%), fat (8.70%), ash (17.45%) and crude fiber (4.84%). It was low glycemic soup, free of antinutritional risk and had calorific value of 319.77 kcal/100 g (wet or sample basis, sb) estimated from its composition. 100 g (sb) of BFSM contained 4.36 g β-glucans and 8.08 g total lipid of which 25.6% was ω-3 fatty acids. Different extracts of BFSM revealed the presence of total phenols (0.57-1.86 mg gallic acid equivalent/g, sb) with antioxidants equivalence of DPPH (20.69-39.07%) and FRAP (120-331 μm Fe (II)/g, sb).

Drying enhances immunoactivity of spent brewer's yeast cell wall β-D-glucans.

Science.gov (United States)

Liepins, Janis; Kovačova, Elena; Shvirksts, Karlis; Grube, Mara; Rapoport, Alexander; Kogan, Grigorij

2015-07-20

Due to immunological activity, microbial cell wall polysaccharides are defined as 'biological response modifiers' (BRM). Cell walls of spent brewer's yeast also have some BRM activity. However, up to date there is no consensus on the use of spent brewer's yeast D-glucan as specific BRM in humans or animals. The aim of this paper is to demonstrate the potential of spent brewer's yeast β-D-glucans as BRM, and drying as an efficient pretreatment to increase β-D-glucan's immunogenic activity. Our results revealed that drying does not change spent brewer's yeast biomass carbohydrate content as well as the chemical structure of purified β-D-glucan. However, drying increased purified β-D-glucan TNF-α induction activity in the murine macrophage model. We presume drying pretreatment enhances purity of extracted β-D-glucan. This is corroborated with FT-IR analyses of the β-D-glucan spectra. Based on our results, we suggest that dry spent brewer's yeast biomass can be used as a cheap source for high-quality β-D-glucan extraction. Drying in combination with carboxylmethylation (CM), endows spent brewer's yeast β-D-glucan with the immunoactivity similar or exceeding that of a well-characterized fungal BRM pleuran. Copyright © 2015 Elsevier B.V. All rights reserved.

Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity

International Nuclear Information System (INIS)

Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon; Kim, Jae Hoon; Lee, Ju Woon

2010-01-01

In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-γ and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation β-glucan leads its biological functions to enhance immunomodulating and antitumor activity

Disease resistance of pacu Piaractus mesopotamicus (Holmberg, 1887 fed with β-glucan

Directory of Open Access Journals (Sweden)

JD Biller-Takahashi

Full Text Available Effects of β-glucan on innate immune responses and survival were studied in pacu experimentally infected with Aeromonas hydrophila. Fish fed diets containing 0, 0.1% and 1% β-glucan were injected with A. hydrophila. β-glucan enhanced fish survival in both treated groups (26.7% and 21.2% of the control, respectively. Leukocyte respiratory burst and alternative complement pathway activities were elevated after bacterial challenge regardless the β-glucan concentration. Lysozyme activity was higher after infection and showed a gradual increase as β-glucan concentration increased. A significant elevation in WBC count was observed either after bacterial challenge or by influence of β-glucan separately. The same response was observed in the number of thrombocytes, lymphocytes, eosinophils, LG-PAS positive cell and monocytes. It can be concluded that feeding pacu with β-glucan can increase protection against A. hydrophila, due to changes in non-specific immune responses.

Suppressing effects of glucan on micronuclei induced by Co60 in mice

International Nuclear Information System (INIS)

Chorvatovicova, D.

1991-01-01

The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co 60 irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P 3 substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.) [de

Barley germination

DEFF Research Database (Denmark)

Daneri-Castro, Sergio N.; Svensson, Birte; Roberts, Thomas H.

2016-01-01

germination. Lastly, the application of metabolomics to barley grain germination provides essential data on biochemical processes, including insights into the formation of compounds that contribute to malt quality. To maximize the benefits of the 'omics' revolution to the malting industry, there is a need......Germination of barley grain is central to the malting industry and is a valuable model for cereal grain germination. Our current understanding of the complexity of germination at the molecular level is facilitated by access to genomic, transcriptomic, proteomic and metabolomic data. Here we review...... of germination in the context of industrial malting. For transcriptomics, recent advances in sequencing the barley genome allow next-generation sequencing approaches to reveal novel effects of variety and environment on germination. For proteomics, selection of the source tissue(s) and the protein extraction...

Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation

Science.gov (United States)

Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon

2009-07-01

β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.

Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation

International Nuclear Information System (INIS)

Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon

2009-01-01

β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.

Construction of barley consensus map showing chromosomal ...

African Journals Online (AJOL)

In the past, it has been difficult to accurately determine the location of many types of barley molecular markers due to the lack of commonality between international barley linkage maps. In this study, a consensus map of barley was constructed from five different maps (OWB, VxHs, KxM, barley consensus 2 and barley ...

Short Communication

African Journals Online (AJOL)

p4208528

Abstract. Hulless barley contains more digestible nutrients than do whole barleys due to a lower content of indigestible fibre, but also contains a higher concentration of β-glucans. The chemical composition and apparent metabolisable energy (AME) of five cultivars (3, 7, 12, 15 and KC-31) of hulless barley were determined ...

Localization of synthesis of β1,6-glucan in Saccharomyces cerevisiae

NARCIS (Netherlands)

Montijn, R.C.; Vink, E.; Müller, W.H.; Verkleij, A.J.; Ende, H. van den; Henrissat, B.; Klis, F.M.

1999-01-01

β1,6-Glucan is a key component of the yeast cell wall, interconnecting cell wall proteins, β1,3-glucan, and chitin. It has been postulated that the synthesis of β1,6-glucan begins in the endoplasmic reticulum with the formation of protein-bound primer structures and that these primer structures are

Suppressing effects of glucan on micronuclei induced by Co sup 60 in mice

Energy Technology Data Exchange (ETDEWEB)

Chorvatovicova, D. (Slovak Academy of Sciences, Bratislava (Czechoslovakia). Inst. of Ecobiology)

1991-10-01

The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co{sup 60} irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P<0.01) by intravenous application of glucan one hour after irradiation. The most expressive effect was obvious by K{sub 3} substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.).

Association of VPg and eIF4E in the host tropism at the cellular level of Barley yellow mosaic virus and Wheat yellow mosaic virus in the genus Bymovirus.

Science.gov (United States)

Li, Huangai; Shirako, Yukio

2015-02-01

Barley yellow mosaic virus (BaYMV) and Wheat yellow mosaic virus (WYMV) are separate species in the genus Bymovirus with bipartite plus-sense RNA genomes. In fields, BaYMV infects only barley and WYMV infects only wheat. Here, we studied the replicative capability of the two viruses in barley and wheat mesophyll protoplasts. BaYMV replicated in both barley and wheat protoplasts, but WYMV replicated only in wheat protoplasts. The expression of wheat translation initiation factor 4E (eIF4E), a common host factor for potyviruses, from the WYMV genome enabled WYMV replication in barley protoplasts. Replacing the BaYMV VPg gene with that of WYMV abolished BaYMV replication in barley protoplasts, whereas the additional expression of wheat eIF4E from BaYMV genome restored the replication of the BaYMV mutant in barley protoplasts. These results indicate that both VPg and the host eIF4E are involved in the host tropism of BaYMV and WYMV at the replication level. Copyright © 2014 Elsevier Inc. All rights reserved.

Orally delivered β-glucans aggravate dextran sulfate sodium (DSS)-induced intestinal inflammation

NARCIS (Netherlands)

Heinsbroek, Sigrid E. M.; Williams, David L.; Welting, Olaf; Meijer, Sybren L.; Gordon, Siamon; de Jonge, Wouter J.

2015-01-01

β-Glucans have beneficial health effects due to their immune modulatory properties. Oral administration of β-glucans affects tumour growth, microbial infection, sepsis, and wound healing. We hypothesized that pre-treatment with orally delivered soluble and particulate β-glucans could ameliorate the

Approaches to improving the nutritional quality of barley seed proteins

International Nuclear Information System (INIS)

Shewry, P.R.; Bright, S.W.J.; Burgess, S.R.; Miflin, B.J.

1984-01-01

The poor nutritional quality of barley grain is determined by the low level of lysine in the prolamin storage proteins (hordein). These account for between 35 to 50% of the total grain nitrogen, depending on the nutritional status of the plant. There is a reduced proportion of hordein in mutant high lysine lines but these also have reduced synthesis of storage carbohydrates and hence low yields. Three strategies for improvement are discussed. Increases in the lysine content of hordein may be difficult to achieve because of the presence of complex families of structural genes. It would also be necessary to insert a large number of additional lysine residues. Two more promising approaches are to increase the level of expression of genes coding for lysine-rich globulin storage proteins and to increase the pool of free lysine by selecting mutant lines with relaxed feedback regulation of lysine synthesis. (author)

Effects of gamma irradiation on the physical and structural properties of β-glucan

International Nuclear Information System (INIS)

Byun, Eui-Hong; Kim, Jae-Hun; Sung, Nak-Yun; Choi, Jong-il; Lim, Seong-Taek; Kim, Kwang-Hoon; Yook, Hong-Sun; Byun, Myung-Woo; Lee, Ju-Woon

2008-01-01

This study was carried out to evaluate the effect of gamma irradiation on the physical and structural properties of β-glucan. β-Glucan solution (10%, w/v) was exposed to a cobalt-60 source (10, 30, and 50 kGy). Gel permeation chromatography data showed that the average molecular weight of irradiated β-glucan significantly decreased as the irradiation dose increased. In addition, gamma irradiation improved the solubility and decreased the viscosity of β-glucan by the radiolysis of the glycosidic bonds, and this effect was dependent upon the absorbed dose. Fourier transform infrared spectroscopy results showed that the functional groups of β-glucan were not significantly affected by gamma irradiation. Scanning electron microscopy results showed that the irradiated β-glucan was deformed into smaller granules. Therefore, gamma irradiation could be used in commercial processes as an effective method to resolve the physical problems involved in the use of β-glucan with high viscosity and low solubility

Structural Characterization and Antioxidative Activity of Low-Molecular-Weights Beta-1,3-Glucan from the Residue of Extracted Ganoderma lucidum Fruiting Bodies

Directory of Open Access Journals (Sweden)

Pai-Feng Kao

2012-01-01

Full Text Available The major cell wall constituent of Ganoderma lucidum (G. lucidum is β-1,3-glucan. This study examined the polysaccharide from the residues of alkaline-extracted fruiting bodies using high-performance anion-exchange chromatography (HPAEC, and it employed nuclear magnetic resonance (NMR and mass spectrometry (MS to confirm the structures. We have successfully isolated low-molecular-weight β-1,3-glucan (LMG, in high yields, from the waste residue of extracted fruiting bodies of G. lucidum. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyl tetrazolium bromide (MTT assay evaluated the capability of LMG to suppress H2O2-induced cell death in RAW264.7 cells, identifying that LMG protected cells from H2O2-induced damage. LMG treatment decreased H2O2-induced intracellular reactive oxygen species (ROS production. LMG also influenced sphingomyelinase (SMase activity, stimulated by cell death to induce ceramide formation, and then increase cell ROS production. Estimation of the activities of neutral and acid SMases in vitro showed that LMG suppressed the activities of both neutral and acid SMases in a concentration-dependent manner. These results suggest that LMG, a water-soluble β-1,3-glucan recycled from extracted residue of G. lucidum, possesses antioxidant capability against H2O2-induced cell death by attenuating intracellular ROS and inhibiting SMase activity.

Recent insight in α-glucan metabolism in probiotic bacteria

DEFF Research Database (Denmark)

Møller, Marie Sofie; Goh, Yong Jun; Viborg, Alexander Holm

2014-01-01

α-Glucans from bacterial exo-polysaccharides or diet, e.g., resistant starch, legumes and honey are abundant in the human gut and fermentation of resistant fractions of these α-glucans by probiotic lactobacilli and bifidobacteria impacts human health positively. The ability to degrade polymeric α...

β-Glucans: Relationships between Modification, Conformation and Functional Activities

Directory of Open Access Journals (Sweden)

Qiang Wang

2017-02-01

Full Text Available β-glucan is a type of polysaccharide which widely exists in bacteria, fungi, algae, and plants, and has been well known for its biological activities such as enhancing immunity, antitumor, antibacterial, antiviral, and wound healing activities. The conformation of β-glucan plays a crucial role on its biological activities. Therefore, β-glucans obtained from different sources, while sharing the same basic structures, often show different bioactivities. The basic structure and inter-molecular forces of polysaccharides can be changed by modification, which leads to the conformational transformation in solution that can directly affect bioactivity. In this review, we will first determine different ways to modify β-glucan molecules including physical methods, chemical methods, and biological methods, and then reveal the relationship of the flexible helix form of the molecule chain and the helix conformation to their bioactivities. Last, we summarize the scientific challenges to modifying β-glucan’s conformation and functional activity, and discuss its potential future development.

Biased mutagenesis in the N-terminal region by degenerate oligonucleotide gene shuffling enhances secretory expression of barley alpha-amylase 2 in yeast

DEFF Research Database (Denmark)

Fukuda, Kenji; Jensen, Malene Hillerup; Aghajari, Nushin

2005-01-01

Recombinant barley alpha-amylase 1 (rAMY1) and 2 (rAMY2), despite 80% sequence identity, are produced in very different amounts of 1.1 and alpha loop 2 that interacts with domain B (beta-->alpha loop 3) protruding from the catalytic (beta/alpha)(8)-barrel. Most remarkably Pichia pastoris strain G...... residue. Moreover, the G to C substitution for the A42P mutation might have a positive impact on protein translation....

Genetic study on salt tolerance involving mutants of barley

International Nuclear Information System (INIS)

Patil, S.S.; Sharma, R.P.

1990-01-01

Full text: Cultivar 'R-16' was subjected to mutagenesis through gamma irradiation, EMS and their combination treatments. M 6 lines differing in salt tolerance were utilised along with untreated control to generate 8x3 diallel crosses. The magnitude of combining ability variances indicated a relatively prominent role of SCA variance (non additive). The values of GCA effects indicate high breeding value of the mutant M-3 for salt tolerance based on measuring shoot length and root length of 10 day old seedlings. (author)

Study on the immuno stimulation of radiation degraded β-glucan in swiss mice

International Nuclear Information System (INIS)

Nguyen Thanh Long; Le Quang Luan

2015-01-01

The mixtures β-glucan extracted from the yeast cell wall were irradiated under gamma rays from a Co-60 source at doses of 100, 200 and 300 kGy in order to prepare water-soluble β-glucan. Yields of the water soluble β-glucan produced are 25.9, 49.1, 66.71%, and their molecular weights (Mw) are 30.5, 24.9 and 10.8 kDa, respectively. There are no any new peak in the IR spectra of the irradiated β-glucan samples, but the intensity ratio between the peaks at wavenumber of 1156 cm"-"1 (assigned to C-O-C bond) and of 1040 cm"-"1 (assigned to C-C bond) in glycosidic linkages was reduced with irradiation dose. These results revealed that gamma irradiation did not cause any change in the β-glucan structure except the scissions of glycosidic linkages. In this study, immuno stimulation of the irradiated β-glucan was also investigated for the Swiss mice. After 28 days supplying with the irradiated β-glucan, not only cellular indexes (white blood cell, neutrophils and lymphocytes counts), but also humoral immunity indexes (IgA and IgM) of the mice significantly increased and the highest effects was obtained for the mice supplied with the oligo β-glucan prepared by gamma irradiation at 200 kGy. Thus, the water soluble oligo β-glucan with Mw ~ 24.9 kDa prepared by gamma radiation much stimulated the natural immune system (non-specific immunity) in mice including both the cellular and humoral immunities. Particularly, the irradiated β-glucan is a very promising product for preparation of functional foods aiming at cancer prevention. (author)

Fermented Dough Characteristics of Wheat-barley-hemp Composites. Comparison of Two Dosages of Barley and Hemp Wholemeal/Flour

Directory of Open Access Journals (Sweden)

Marie Hrušková

2016-01-01

Full Text Available Wheat flour substitution by barley one led to shortening of fermentation and leavening times (about 14–57% and 35–83%, respectively as well as to lessening of dough volumes (about 25–75%, based on lowered protein quality (Zeleny value. Addition of barley flour affected specific bread volume; diminishing for wheat-barley blends 70:30 and 50:50 reached 30% and 43%, respectively. Volume of bread prepared from wheat-barley blend 70:30 enhanced by dehulled hemp wholemeal was the highest within the tested tri-composites set, achieving 130% of wheat-barley control; other hemp products caused the parameter decrease (from 8 to 33%. Within a group of bakery products containing 50% of barley flour, hulled hemp wholemeal partially supressed negative effect of barley flour – specific bread volumes increased about ca 15%. Commercial fine hemp flour samples demonstrated a reversal influence – its addition resulted into lower buns size than wheat-barley control (about 3–34%. Between wheat flour and both groups of flour tri-composites, PCA confirmed differences in dough and bread technological quality. Specific bread volume could be predicted according to maturograph dough elasticity, dough or bread OTG volumes.

Study on Effect of Immune Stimulation of γ-Ray Irradiated β-Glucan on Tilapia

International Nuclear Information System (INIS)

Nguyen Ngoc Duy; Nguyen Quoc Hien; Dang Van Phu

2013-01-01

Low molecular weight β-glucan (LMWβG) and oligoβ-glucan solution were prepared by the hydrothermal steaming combination with γ-irradiation method. The efficiency of the degradation process was demonstrated by gel permeation chromatography (GPC) analysis of the average molecular weight (Mw) of β-glucan. Results showed that the Mw decreased with increasing steaming time, concentration of H 2 O 2 and doses. For LMWβG, Mw reduces from 296,600 Da to 44,400 Da when concentration of H 2 O 2 raises from 2.5% to 10% and for oligoβ-glucan Mw reduces to 7,100 Da at 16 kGy. Tilapia fish was fed with LMWβ and oligoβ-glucan of 100 ppm for 45 days, was challenged with Strep. Agalactidae bacterial to investigate immune stimulation. The results indicated that oligoβ-glucan has higher immune stimulation effect compared to LMWβG. The effect of oligoβ-glucan various concentrations of 50, 100, and 150 ppm was investigated. Results showed that survival rate was the highest for oligoβ-glucan of 150 ppm. (author)

Molecular size estimation of plasma membrane β-glucan synthase from red beet root

International Nuclear Information System (INIS)

Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.

1986-01-01

Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane

Analysis of drought-tolerant sugar beet (Beta vulgaris L.) mutants induced with gamma radiation using SDS-PAGE and ISSR markers.

Science.gov (United States)

Sen, Ayse; Alikamanoglu, Sema

2012-01-01

Drought is one of the major environmental stresses which greatly affect the plant growth and productivity. In the present study, various doses (0-75Gy) of gamma rays were applied to investigate the effect of radiation on shoot tip explants. It was observed that the regeneration rates and plant fresh weights decreased significantly with an increase in radiation dose. The optimal irradiation doses for mutation induction were determined at 15 and 20Gy. Afterwards, the induction of somatic mutation in sugar beet (Beta vulgaris L.) was investigated by irradiation of shoot tips with 15 and 20Gy gamma rays. Irradiated shoot tips were sub-cultured and M(1)V(1)-M(1)V(3) generations were obtained. Mutants tolerant to drought stress were selected on MS medium, supplemented with 10 and 20gl(-1) PEG6000. Of the M(1)V(3) plantlets, drought-tolerant mutants were selected. Leaf soluble proteins obtained from the control and drought-tolerant mutants were analyzed by SDS-PAGE. A total of 22 protein bands were determined and 2 of them were observed to be drought-tolerant mutants except the control. Polymorphism was also detected among the control and drought-tolerant mutants by DNA fingerprinting using ISSR markers. A total of 106 PCR fragments were amplified with 19 ISSR primers and 91 of them were polymorphic. The dendrograms were separated into two main clusters. First cluster included M8 mutant plant, which was applied 20Gy gamma radiation and regenerated on selective culture media containing 10gl(-1) PEG6000 concentration, and the second cluster was further divided into five sub-clusters. Copyright © 2012 Elsevier B.V. All rights reserved.

Analysis of drought-tolerant sugar beet (Beta vulgaris L.) mutants induced with gamma radiation using SDS-PAGE and ISSR markers

International Nuclear Information System (INIS)

Sen, Ayse; Alikamanoglu, Sema

2012-01-01

Drought is one of the major environmental stresses which greatly affect the plant growth and productivity. In the present study, various doses (0–75 Gy) of gamma rays were applied to investigate the effect of radiation on shoot tip explants. It was observed that the regeneration rates and plant fresh weights decreased significantly with an increase in radiation dose. The optimal irradiation doses for mutation induction were determined at 15 and 20 Gy. Afterwards, the induction of somatic mutation in sugar beet (Beta vulgaris L.) was investigated by irradiation of shoot tips with 15 and 20 Gy gamma rays. Irradiated shoot tips were sub-cultured and M 1 V 1 –M 1 V 3 generations were obtained. Mutants tolerant to drought stress were selected on MS medium, supplemented with 10 and 20 gl −1 PEG6000. Of the M 1 V 3 plantlets, drought-tolerant mutants were selected. Leaf soluble proteins obtained from the control and drought-tolerant mutants were analyzed by SDS-PAGE. A total of 22 protein bands were determined and 2 of them were observed to be drought-tolerant mutants except the control. Polymorphism was also detected among the control and drought-tolerant mutants by DNA fingerprinting using ISSR markers. A total of 106 PCR fragments were amplified with 19 ISSR primers and 91 of them were polymorphic. The dendrograms were separated into two main clusters. First cluster included M8 mutant plant, which was applied 20 Gy gamma radiation and regenerated on selective culture media containing 10 g l −1 PEG6000 concentration, and the second cluster was further divided into five sub-clusters.

Analysis of drought-tolerant sugar beet (Beta vulgaris L.) mutants induced with gamma radiation using SDS-PAGE and ISSR markers

Energy Technology Data Exchange (ETDEWEB)

Sen, Ayse, E-mail: senayse@istanbul.edu.tr [Istanbul University, Faculty of Science, Department of Biology, 34459 Vezneciler, Istanbul (Turkey); Alikamanoglu, Sema [Istanbul University, Faculty of Science, Department of Biology, 34459 Vezneciler, Istanbul (Turkey)

2012-10-15

Drought is one of the major environmental stresses which greatly affect the plant growth and productivity. In the present study, various doses (0-75 Gy) of gamma rays were applied to investigate the effect of radiation on shoot tip explants. It was observed that the regeneration rates and plant fresh weights decreased significantly with an increase in radiation dose. The optimal irradiation doses for mutation induction were determined at 15 and 20 Gy. Afterwards, the induction of somatic mutation in sugar beet (Beta vulgaris L.) was investigated by irradiation of shoot tips with 15 and 20 Gy gamma rays. Irradiated shoot tips were sub-cultured and M{sub 1}V{sub 1}-M{sub 1}V{sub 3} generations were obtained. Mutants tolerant to drought stress were selected on MS medium, supplemented with 10 and 20 gl{sup -1} PEG6000. Of the M{sub 1}V{sub 3} plantlets, drought-tolerant mutants were selected. Leaf soluble proteins obtained from the control and drought-tolerant mutants were analyzed by SDS-PAGE. A total of 22 protein bands were determined and 2 of them were observed to be drought-tolerant mutants except the control. Polymorphism was also detected among the control and drought-tolerant mutants by DNA fingerprinting using ISSR markers. A total of 106 PCR fragments were amplified with 19 ISSR primers and 91 of them were polymorphic. The dendrograms were separated into two main clusters. First cluster included M8 mutant plant, which was applied 20 Gy gamma radiation and regenerated on selective culture media containing 10 g l{sup -1} PEG6000 concentration, and the second cluster was further divided into five sub-clusters.

Scale-up of ethanol production from winter barley by the EDGE (enhanced dry grind enzymatic) process in fermentors up to 300 liters

Science.gov (United States)

A fermentation process, which was designated the EDGE (enhanced dry grind enzymatic) process, has recently been developed for barley ethanol production. In the EDGE process, in addition to the enzymes normally required for starch hydrolysis, commercial Beta-glucanases were used to hydrolyze (1,3)(1,...

Structure and function of α-glucan debranching enzymes

DEFF Research Database (Denmark)

Møller, Marie Sofie; Henriksen, Anette; Svensson, Birte

2016-01-01

α-Glucan debranching enzymes hydrolyse α-1,6-linkages in starch/glycogen, thereby, playing a central role in energy metabolism in all living organisms. They belong to glycoside hydrolase families GH13 and GH57 and several of these enzymes are industrially important. Nine GH13 subfamilies include α......-glucan debranching enzymes; isoamylase and glycogen debranching enzymes (GH13_11); pullulanase type I/limit dextrinase (GH13_12–14); pullulan hydrolase (GH13_20); bifunctional glycogen debranching enzyme (GH13_25); oligo-1 and glucan-1,6-α-glucosidases (GH13_31); pullulanase type II (GH13_39); and α-amylase domains......_39 enzymes could represent a “missing link” between the strictly α-1,6-specific debranching enzymes and the enzymes with dual specificity and α-1,4-linkage preference....

Effect of purified oat β-glucan on fermentation of set-style yogurt mix.

Science.gov (United States)

Singh, Mukti; Kim, Sanghoon; Liu, Sean X

2012-08-01

Effect of oat β-glucan on the fermentation of set-style yogurt was investigated by incorporating 0%, 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% of purified oat β-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of β-glucan however retarded the fermentation process with noticeable difference in the characteristics of the yogurt. Examination of the morphologies of yogurt with and without β-glucan revealed that β-glucan formed aggregates with casein micelle and did not form phase-separated domains. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines, to have added nutritional benefits. Yogurt is known for its beneficial effects on human health and nutrition. Yogurt production and consumption is increasing in the United States every year. However, it is lacking in β-glucans, which are recognized for their nutritional importance as functional bioactive ingredients. The main objective was to develop and characterize low-fat yogurts with added β-glucan. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines for added nutritional benefits, without affecting the characteristics of yogurt significantly. This study will benefit the dairy industry by generating new products offering healthy alternatives. Journal of Food Science © 2012 Institute of Food Technologists® No claim to original US government works.

Hulled and hull-less barley grains with the genetic trait for low-phytic acid increased the apparent total-tract digestibility of phosphorus and calcium in diets for young swine.

Science.gov (United States)

Veum, T L; Raboy, V

2016-03-01

A 35-d experiment was conducted using 63 crossbred pigs (35 barrows and 28 gilts) with an initial average BW of 7.0 kg and age of 28 d to evaluate the efficacy of the low-phytic acid (LPA) genetic trait in hulled or hull-less barley in isocaloric diets. Hulled barleys were the normal barley (NB) cultivar Harrington and the near-isogenic LPA mutant 955 (M955) with P availabilities of 36 and 95%, respectively. Hull-less lines were produced by crossing NB and the LPA mutant 422 line with a hull-less line, producing hull-less NB (HNB) and hull-less mutant 422 (HM422) with P availabilities of 41 and 66%, respectively. Pigs were in individual metabolism cages or pens for Phase 1 (d 0 to 14) and Phase 2 (d 14 to 35). Diets defined as NB, HNB, HM422, or M955 with no added inorganic P (iP) had available P (aP) concentrations of 0.27, 0.28, 0.35, and 0.40% for Phase 1 and 0.15, 0.17, 0.23, and 0.31% for Phase 2, respectively. Only diet M955 was adequate in aP. Therefore, iP was added to the P-deficient diets to make diets NB + iP, HNB + iP, and HM422 + iP with aP equal to that in diet M955. Overall (d 0 to 35), ADG and G:F were greater ( hulled and hull-less barley in isocaloric diets fed to young pigs. Pigs fed the diet with LPA M955 consumed 31% less P and excreted 78% less fecal P and 30% less fecal Ca than pigs fed the diet with NB + iP that was equal to diet M955 in aP. Therefore, LPA barley, especially M955 with 95% aP, will reduce the use of iP in swine diets, reduce P pollution from swine manure, and support the goal of achieving global P sustainability.

Defining carbohydrate binding of glucan phosphatases via Affinity gel electrophoresis

DEFF Research Database (Denmark)

Auger, Kyle; Raththagala, Madushi; Wilkens, Casper

2016-01-01

was to determine a technique to measure carbohydrate binding quickly and efficiently. We established a protocol to reproducibly and quantitatively measure the binding of the enzymes to glucans utilizing Affinity Gel Electrophoresis (AGE). The results show that the various glucan phosphatases possess differing...

Phase behaviour of oat β-glucan/sodium caseinate mixtures varying in molecular weight.

Science.gov (United States)

Agbenorhevi, Jacob K; Kontogiorgos, Vassilis; Kasapis, Stefan

2013-05-01

The isothermal phase behaviour at 5 °C of mixtures of sodium caseinate and oat β-glucan isolates varying in molecular weight (MW) was investigated by means of phase diagram construction, rheometry, fluorescence microscopy and electrophoresis. Phase diagrams indicated that the compatibility of the β-glucan/sodium caseinate system increases as β-glucan MW decreases. Images of mixtures taken at various biopolymer concentrations revealed phase separated domains. Results also revealed that at the state of thermodynamic equilibrium, lower MW samples yielded considerable viscosity in the mixture. At equivalent hydrodynamic volume of β-glucan in the mixtures, samples varying in molecular weight exhibited similar flow behaviour. A deviation dependent on the protein concentration was observed for the high MW sample in the concentrated regime due to the size of β-glucan aggregates formed. Results demonstrate that by controlling the structural features of β-glucan in mixtures with sodium caseinate, informed manipulation of rheological properties in these systems can be achieved. Copyright © 2012 Elsevier Ltd. All rights reserved.

Comparison of Chain-Length Preferences and Glucan Specificities of Isoamylase-Type α-Glucan Debranching Enzymes from Rice, Cyanobacteria, and Bacteria.

Directory of Open Access Journals (Sweden)

Taiki Kobayashi

Full Text Available It has been believed that isoamylase (ISA-type α-glucan debranching enzymes (DBEs play crucial roles not only in α-glucan degradation but also in the biosynthesis by affecting the structure of glucans, although molecular basis on distinct roles of the individual DBEs has not fully understood. In an attempt to relate the roles of DBEs to their chain-length specificities, we analyzed the chain-length distribution of DBE enzymatic reaction products by using purified DBEs from various sources including rice, cyanobacteria, and bacteria. When DBEs were incubated with phytoglycogen, their chain-length specificities were divided into three groups. First, rice endosperm ISA3 (OsISA3 and Eschericia coli GlgX (EcoGlgX almost exclusively debranched chains having degree of polymerization (DP of 3 and 4. Second, OsISA1, Pseudomonas amyloderamosa ISA (PsaISA, and rice pullulanase (OsPUL could debranch a wide range of chains of DP≧3. Third, both cyanobacteria ISAs, Cyanothece ATCC 51142 ISA (CytISA and Synechococcus elongatus PCC7942 ISA (ScoISA, showed the intermediate chain-length preference, because they removed chains of mainly DP3-4 and DP3-6, respectively, while they could also react to chains of DP5-10 and 7-13 to some extent, respectively. In contrast, all these ISAs were reactive to various chains when incubated with amylopectin. In addition to a great variation in chain-length preferences among various ISAs, their activities greatly differed depending on a variety of glucans. Most strikingly, cyannobacteria ISAs could attack branch points of pullulan to a lesser extent although no such activity was found in OsISA1, OsISA3, EcoGlgX, and PsaISA. Thus, the present study shows the high possibility that varied chain-length specificities of ISA-type DBEs among sources and isozymes are responsible for their distinct functions in glucan metabolism.

Main: 1IEW [RPSD[Archive

Lifescience Database Archive (English)

Full Text Available m Vulgare Molecule: Beta-D-Glucan Glucohydrolase Isoenzyme Exo1; Chain: A; Synonym: Beta-D-Glucan Exohydrola...Beta-D-Glucan Glucohydrolase Structure V. 9 1005 2001 2-Domain Fold GB:AAD23382,4566505|EMBL; AF102868; AAD2

From metabolome to phenotype

DEFF Research Database (Denmark)

Khakimov, Bekzod; Rasmussen, Morten Arendt; Kannangara, Rubini Maya

2017-01-01

for ideal vegetable protein production and for augmented β-glucan production. Seeds from three barley lines (Bomi, lys3.a and lys5.f) were sampled eight times during grain filling and analysed for metabolites using gas chromatography-mass spectrometry (GC-MS). The lys3.a mutation disrupts a regulator gene...... their successful application to link genetic and environmental factors with the seed phenotype of unique and agro-economically important barley models for optimal vegetable protein and dietary fibre production......., causing an increase in proteins rich in the essential amino acid lysine, while lys5.f carries a mutation in an ADP-glucose transporter gene leading to a significant increase in production of mixed-linkage β-glucan at the expense of α-glucan. Unique metabolic patterns associated with the tricarboxylic acid...

Radiosensitivities of cultured barley of different type (Hordeum vulgare)

International Nuclear Information System (INIS)

Wang Cailian; Shen Mei; Xu Gang; Zhao Kongnan

1990-01-01

The dormant seeds (with 13% moisture) of 47 barley varieties were irradiated with various doses (0-40 krad) of 137 Cs γ-rays. The radiosensitivities of naked barley was significantly higher than that of hulled barley. The sensitive coefficients of seedling height were 0.04945 and 0.03667 for naked barley and hulled barley, respectively. The radiosensitivity of four-row naked barley was significantly higher than that of two-row hulled barley and six-row hulled barley. 47 varieties studied could be divided into five types with different radiosensitivities, i.e. extreme resistant, resistant, intermediate, sensitive and extreme sensitive. It was also found that the dose-effect curves of cell nucleus volume had a peal at 30 krad

Characterization of ß-Glucans Isolated from Brewer’s Yeast and Dried by Different Methods

Directory of Open Access Journals (Sweden)

Vesna Zechner-Krpan

2010-01-01

Full Text Available Two different procedures have been used for isolation of water-insoluble ß-glucans from brewer’s yeast: alkaline-acidic isolation (AA and alkaline-acidic isolation with mannoprotein removal (AAM. The obtained ß-glucans were then dried by air-drying, lyophilization and combination of sonication and spray-drying. ß-Glucan preparations obtained by AA and AAM isolations had similar values of dry mass, total polysaccharides, proteins and organic elemental microanalysis. The mass fractions of ß-glucan in total polysaccharides were significantly affected by different isolation procedures. Fourier transform infrared (FTIR spectra of all preparations had the appearance typical for (1→3-ß-D-glucan. Lyophilization and especially air-drying caused a higher degree of agglomeration and changes in ß-glucan microstructure. Sonication followed by spray-drying resulted in minimal structural changes and negligible formation of agglomerates.

Reconstitution of normal and hyperactivated forms of casein kinase-2 by variably mutated beta-subunits

DEFF Research Database (Denmark)

Boldyreff, B; Meggio, F; Pinna, L A

1993-01-01

Twenty-one mutants of the noncatalytic beta-subunit of human casein kinase-2 have been created, expressed in Escherichia coli, and purified to homogeneity. They are either modified at the autophosphorylation site (mutants beta delta 1-4 and beta A 5,6) or bear variable deletions in their C...

Main: 1IEX [RPSD[Archive

Lifescience Database Archive (English)

Full Text Available m Vulgare Molecule: Beta-D-Glucan Glucohydrolase Isoenzyme Exo1; Chain: A; Synonym: Beta-D-Glucan Exohydrola...Of A Plant Beta-D-Glucan Glucohydrolase Structure V. 9 1005 2001 2-Domain Fold GB:AAD23382,4566505|EMBL; AF1

Taste-active Components of Beers from Emmer Wheat (Triticum dicoccum Malt

Directory of Open Access Journals (Sweden)

Benedetti P.

2016-06-01

Full Text Available Emmer wheat (EW, Triticum dicoccum grows under adverse climatic and soil conditions in the hilly areas of Italy and other temperate regions. So far, EW has been used for pasta or bakery products. The malt obtained from EW was used to produce a light beer, a double malt beer, and beers with 50% (B50 and 30% (B30 EW malt combined with barley malt. These top-fermented beers showed a sweet, fruity, citrus character. The different sensory impact and chemical composition (betaglucans and flavanoids of the beers was related to the germinative energy of EW and the different proportions of malted EW and barley malt. The light beer combines the moderate alcohol (3% vol. with a good intake of natural antioxidants (total phenolic content, TPC, 85 mg l−1, whereas B50 showed a high TPC (109 mg l−1 and the highest beta-glucan content (27 mg l−1.

Anti-glucan effects of propolis ethanol extract on Lactobacillus acidophillus

Directory of Open Access Journals (Sweden)

Ira Widjiastuti

2017-03-01

Full Text Available Background: In deep dentinal caries cases, bacteria mostly found are Lactobacillus acidophilus classified as gram positive bacteria and as facultative aerobes producing glucosyltransferase (GTF enzyme. GTF enzyme can alter sucrose into glucans. Glucan is sticky and insoluble in water. As a result, GTF enzyme can facilitate plaque formation and microorganism colonization on tooth surface. In addition, Lactobacillus acidophilus also can form acid leading to demineralization of organic and inorganic materials, resulting in dental caries. Multidrug-resistant phenomena, on the other hand, have led to the use of natural resources, one of which is propolis as an antimicrobial material and as a new anti-infective therapeutic strategy. Propolis is a resinous substances collected by worker bees (Apismellifera from barks and leaves of plants. Propolis has a complex chemical composition and biological properties, such as antibacterial, antiviral, antifungal, anti-inflammatory, and antitumor. Purpose: This research aimed to reveal anti-glucan effects of propolis ethanol extract generated from honey bee, Apis mellifera spp on Lactobacillus acidophilus bacteria. Method: Before antiglucan test was conducted, glucan-formation test was performed on Lactobacillus acidophilus bacteria using SDSpage. Meanwhile, anti-glucan adhesion test on Lactobacillus acidophilus bacteria was carried by culturing the bacteria at 37ºC temperature in a jar with 10% CO2. Test tubes were placed at an angle of 30º for 18 hours to review the attachment of bacteria at the glass surfaces. After the incubation, the culture of bacteria was vibrated using a mixer vortex for a few minutes, and then cultured in solid MRS A media. Bacteria grown were measured by using colony counter. Result: The ethanol extract of propolis with a concentration of 1.56% was the lowest concentration inhibiting the attachment of glucan to Lactobacillus acidophilus bacteria. Conclusion: The ethanol extract of

Evolutionary Conserved Function of Barley and Arabidopsis 3-KETOACYL-CoA SYNTHASES in Providing Wax Signals for Germination of Powdery Mildew Fungi1[C][W

Science.gov (United States)

Weidenbach, Denise; Jansen, Marcus; Franke, Rochus B.; Hensel, Goetz; Weissgerber, Wiebke; Ulferts, Sylvia; Jansen, Irina; Schreiber, Lukas; Korzun, Viktor; Pontzen, Rolf; Kumlehn, Jochen; Pillen, Klaus; Schaffrath, Ulrich

2014-01-01

For plant pathogenic fungi, such as powdery mildews, that survive only on a limited number of host plant species, it is a matter of vital importance that their spores sense that they landed on the right spot to initiate germination as quickly as possible. We investigated a barley (Hordeum vulgare) mutant with reduced epicuticular leaf waxes on which spores of adapted and nonadapted powdery mildew fungi showed reduced germination. The barley gene responsible for the mutant wax phenotype was cloned in a forward genetic screen and identified to encode a 3-KETOACYL-CoA SYNTHASE (HvKCS6), a protein participating in fatty acid elongation and required for synthesis of epicuticular waxes. Gas chromatography-mass spectrometry analysis revealed that the mutant has significantly fewer aliphatic wax constituents with a chain length above C-24. Complementation of the mutant restored wild-type wax and overcame germination penalty, indicating that wax constituents less present on the mutant are a crucial clue for spore germination. Investigation of Arabidopsis (Arabidopsis thaliana) transgenic plants with sense silencing of Arabidopsis REQUIRED FOR CUTICULAR WAX PRODUCTION1, the HvKCS6 ortholog, revealed the same germination phenotype against adapted and nonadapted powdery mildew fungi. Our findings hint to an evolutionary conserved mechanism for sensing of plant surfaces among distantly related powdery mildews that is based on KCS6-derived wax components. Perception of such a signal must have been evolved before the monocot-dicot split took place approximately 150 million years ago. PMID:25201879

The effect of yeast β-glucan on the amount of albumin, globulin, urea and total protein of broiler chickens

Directory of Open Access Journals (Sweden)

ali kargarirezapour

2013-08-01

Full Text Available Glucans derived from yeast cell wall are promising alternatives to antibiotics, as they have been shown to improve growth performance and stimulate the immune system of immature broilers. In this study we evaluated the effect of different levels of yeast beta-glucan (YBG on some blood parametrs of broiler chickens. In a factorial experiment based on completely randomized design (the first factor: YBG levels: 0, 0.04 and 0.08% of basal diet and sex as a second factor 144 day old chicks (72 male and 72 female were selected and allocated to different treatments (three replicates of each treatment. The overall experimental period was 34 days. At the end of study, two birds from each pen were randomly selected as a sample. The level of albumin, globulin, urea and total protein was measured on blood samples. Statistical analysis of the results showed that the YBG had no significant effect on albumin, globulin, urea and total protein level. But the amount of plasma albumin and total protein in female chicks was significantly higher than male chicks (p

Isolation and Characterization of Two Cellulose Morphology Mutants of Gluconacetobacter hansenii ATCC23769 Producing Cellulose with Lower Crystallinity

Science.gov (United States)

Deng, Ying; Nagachar, Nivedita; Fang, Lin; Luan, Xin; Catchmark, Jeffrey M.; Tien, Ming; Kao, Teh-hui

2015-01-01

Gluconacetobacter hansenii, a Gram-negative bacterium, produces and secrets highly crystalline cellulose into growth medium, and has long been used as a model system for studying cellulose synthesis in higher plants. Cellulose synthesis involves the formation of β-1,4 glucan chains via the polymerization of glucose units by a multi-enzyme cellulose synthase complex (CSC). These glucan chains assemble into ordered structures including crystalline microfibrils. AcsA is the catalytic subunit of the cellulose synthase enzymes in the CSC, and AcsC is required for the secretion of cellulose. However, little is known about other proteins required for the assembly of crystalline cellulose. To address this question, we visually examined cellulose pellicles formed in growth media of 763 individual colonies of G. hansenii generated via Tn5 transposon insertion mutagenesis, and identified 85 that produced cellulose with altered morphologies. X-ray diffraction analysis of these 85 mutants identified two that produced cellulose with significantly lower crystallinity than wild type. The gene disrupted in one of these two mutants encoded a lysine decarboxylase and that in the other encoded an alanine racemase. Solid-state NMR analysis revealed that cellulose produced by these two mutants contained increased amounts of non-crystalline cellulose and monosaccharides associated with non-cellulosic polysaccharides as compared to the wild type. Monosaccharide analysis detected higher percentages of galactose and mannose in cellulose produced by both mutants. Field emission scanning electron microscopy showed that cellulose produced by the mutants was unevenly distributed, with some regions appearing to contain deposition of non-cellulosic polysaccharides; however, the width of the ribbon was comparable to that of normal cellulose. As both lysine decarboxylase and alanine racemase are required for the integrity of peptidoglycan, we propose a model for the role of peptidoglycan in the

Isolation and characterization of two cellulose morphology mutants of Gluconacetobacter hansenii ATCC23769 producing cellulose with lower crystallinity.

Directory of Open Access Journals (Sweden)

Ying Deng

Full Text Available Gluconacetobacter hansenii, a Gram-negative bacterium, produces and secrets highly crystalline cellulose into growth medium, and has long been used as a model system for studying cellulose synthesis in higher plants. Cellulose synthesis involves the formation of β-1,4 glucan chains via the polymerization of glucose units by a multi-enzyme cellulose synthase complex (CSC. These glucan chains assemble into ordered structures including crystalline microfibrils. AcsA is the catalytic subunit of the cellulose synthase enzymes in the CSC, and AcsC is required for the secretion of cellulose. However, little is known about other proteins required for the assembly of crystalline cellulose. To address this question, we visually examined cellulose pellicles formed in growth media of 763 individual colonies of G. hansenii generated via Tn5 transposon insertion mutagenesis, and identified 85 that produced cellulose with altered morphologies. X-ray diffraction analysis of these 85 mutants identified two that produced cellulose with significantly lower crystallinity than wild type. The gene disrupted in one of these two mutants encoded a lysine decarboxylase and that in the other encoded an alanine racemase. Solid-state NMR analysis revealed that cellulose produced by these two mutants contained increased amounts of non-crystalline cellulose and monosaccharides associated with non-cellulosic polysaccharides as compared to the wild type. Monosaccharide analysis detected higher percentages of galactose and mannose in cellulose produced by both mutants. Field emission scanning electron microscopy showed that cellulose produced by the mutants was unevenly distributed, with some regions appearing to contain deposition of non-cellulosic polysaccharides; however, the width of the ribbon was comparable to that of normal cellulose. As both lysine decarboxylase and alanine racemase are required for the integrity of peptidoglycan, we propose a model for the role of

A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

NARCIS (Netherlands)

Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; Hondel, C.A.M.J.J. van den; Ram, A.F.J.

2008-01-01

To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative a-glucan

Effects of β-glucan on colon anastomotic healing in rats given preoperative irradiation.

Science.gov (United States)

Seker, Ahmet; Deger, Kamuran Cumhur; Bostanci, Erdal Birol; Ozer, Ilter; Dalgic, Tahsin; Bilgihan, Ayse; Akmansu, Muge; Ekinci, Ozgur; Ercin, Ugur; Akoglu, Musa

2014-06-01

Radiation therapy is an essential therapeutic modality in the management of a wide variety of tumors. We aimed to investigate the short-term effects of pelvic irradiation on the healing of colon anastomoses and to determine the potential protective effects of β-glucan in this situation. Sixty Wistar albino rats were randomized into three experimental groups: a control group (n = 20), an irradiation (IR) group (n = 20), and an irradiation+β-glucan (IR+β-glucan) group (n = 20). Only segmental colonic resection and anastomosis were performed on the control group. The IR group underwent the same surgical procedure as the control group 5 days after pelvic irradiation. In the IR+β-glucan group, the same procedure was applied as in the IR group after β-glucan administration. The groups were subdivided into subgroups according to the date of euthanasia (third [n = 10] or seventh [n = 10] postoperative [PO] day), and anastomotic colonic segments were resected to evaluate bursting pressures and biochemical and histopathological parameters. Bursting pressure values were significantly lower in the IR group (p < .001). Malondialdehyde (MDA) levels were significantly higher in the IR group, whereas β-glucan significantly decreased MDA levels on the third PO day (p < .001). Granulation tissue formation scores were significantly lower in the IR+β-glucan group compared with the control group and the IR group (p < .001). The results of this study indicate that irradiation has negative effects on the early healing of colon anastomoses. The administration of β-glucan ameliorates these unfavorable effects by altering bursting pressures and biochemical parameters.

The Effects of Reduced Gluten Barley Diet on Humoral and Cell-Mediated Systemic Immune Responses of Gluten-Sensitive Rhesus Macaques

Directory of Open Access Journals (Sweden)

Karol Sestak

2015-03-01

Full Text Available Celiac disease (CD affects approximately 1% of the general population while an estimated additional 6% suffers from a recently characterized, rapidly emerging, similar disease, referred to as non-celiac gluten sensitivity (NCGS. The only effective treatment of CD and NCGS requires removal of gluten sources from the diet. Since required adherence to a gluten-free diet (GFD is difficult to accomplish, efforts to develop alternative treatments have been intensifying in recent years. In this study, the non-human primate model of CD/NCGS, e.g., gluten-sensitive rhesus macaque, was utilized with the objective to evaluate the treatment potential of reduced gluten cereals using a reduced gluten (RG; 1% of normal gluten barley mutant as a model. Conventional and RG barleys were used for the formulation of experimental chows and fed to gluten-sensitive (GS and control macaques to determine if RG barley causes a remission of dietary gluten-induced clinical and immune responses in GS macaques. The impacts of the RG barley diet were compared with the impacts of the conventional barley-containing chow and the GFD. Although remission of the anti-gliadin antibody (AGA serum responses and an improvement of clinical diarrhea were noted after switching the conventional to the RG barley diet, production of inflammatory cytokines, e.g., interferon-gamma (IFN-γ, tumor necrosis factor (TNF and interleukin-8 (IL-8 by peripheral CD4+ T helper lymphocytes, persisted during the RG chow treatment and were partially abolished only upon re-administration of the GFD. It was concluded that the RG barley diet might be used for the partial improvement of gluten-induced disease but its therapeutic value still requires upgrading—by co-administration of additional treatments.

The effects of reduced gluten barley diet on humoral and cell-mediated systemic immune responses of gluten-sensitive rhesus macaques.

Science.gov (United States)

Sestak, Karol; Thwin, Hazel; Dufour, Jason; Aye, Pyone P; Liu, David X; Moehs, Charles P

2015-03-06

Celiac disease (CD) affects approximately 1% of the general population while an estimated additional 6% suffers from a recently characterized, rapidly emerging, similar disease, referred to as non-celiac gluten sensitivity (NCGS). The only effective treatment of CD and NCGS requires removal of gluten sources from the diet. Since required adherence to a gluten-free diet (GFD) is difficult to accomplish, efforts to develop alternative treatments have been intensifying in recent years. In this study, the non-human primate model of CD/NCGS, e.g., gluten-sensitive rhesus macaque, was utilized with the objective to evaluate the treatment potential of reduced gluten cereals using a reduced gluten (RG; 1% of normal gluten) barley mutant as a model. Conventional and RG barleys were used for the formulation of experimental chows and fed to gluten-sensitive (GS) and control macaques to determine if RG barley causes a remission of dietary gluten-induced clinical and immune responses in GS macaques. The impacts of the RG barley diet were compared with the impacts of the conventional barley-containing chow and the GFD. Although remission of the anti-gliadin antibody (AGA) serum responses and an improvement of clinical diarrhea were noted after switching the conventional to the RG barley diet, production of inflammatory cytokines, e.g., interferon-gamma (IFN-γ), tumor necrosis factor (TNF) and interleukin-8 (IL-8) by peripheral CD4+ T helper lymphocytes, persisted during the RG chow treatment and were partially abolished only upon re-administration of the GFD. It was concluded that the RG barley diet might be used for the partial improvement of gluten-induced disease but its therapeutic value still requires upgrading-by co-administration of additional treatments.

Estimation AMMI stability value as a measure for selection two row barley mutants

International Nuclear Information System (INIS)

Azzo, F. Z.

2012-12-01

A field experiment was carried out at the Tuwaitha research station (the Iraqi Atomic Energy Commission / Ministry of Science and Technology now) to estimate AMMI stability value of 18 mutants two row cultivate over three genetic generations (environments). The results showed that two mutants 91 and 25 was superiority in grain yield character (kg / ha) and the original 4/5 mutations are more stable and this is a good sign about the possibility of using AMMI stability value in estimating stability in the late generations. (Author)

Durable resistance to net blotch and agronomic performance in some barley mutants [Hordeum vulgare L.; Syria

International Nuclear Information System (INIS)

Arabi, M.I.E.

2004-01-01

Seeds from the net blotch (Pyrenophora teres) susceptible cultivar Thibaut were treated by gamma ray radiation and subsequently evaluated for reaction to the pathogen in the M2-M5 generations. Grain yield and agronomic characteristics of putative mutants were compared with Thibaut in two different locations. Genetic variation among some mutant lines/cv Thibaut was estimated using Amplified Fragment Length Polymorphism (AFLP) markers. Sixteen mutant lines and their mother cultivar Thibaut were analyzed with 14 EcoR1-Mse1 primer combinations. A total number of 504 AFLP bands were analyzed for each pair mutant/Thibaut. Narrow genetic variation among all genotypes was detected with an average of genetic similarity of 0.96. Cluster analysis with the entire AFLP data divided all genotypes into two major groups. The resistant mutant lines were grouped in one subcluster with 0.98 similarity index. Some resistant mutant lines to net blotch with good agronomic performances were produced [it

Fungal growth during malting of barley

Directory of Open Access Journals (Sweden)

Kocić-Tanackov Sunčica D.

2005-01-01

Full Text Available Fungi were isolated and identified in two samples of winter two-row barley (SSK3 and SSK6 harvested in 2003, Kragujevac location, during micromalting. Fungi were isolated and identified in barley before the micromalting, after the 1st, 2nd and 3rd day of steeping, the first day and after the germination after kilning and after malt degermination. The total fungi count was followed in both barley samples, during the mentioned phases. The total count of fungi was also determined in the steeping water, and the isolation and identification was performed after the steeping process. Change of the total count of fungi during barley micromalting was exponentional. During barley micromalting nine fungi genera were isolated: Phoma, Alternaria, Fusarium aspergillus, Cladosporium, Geotrichum, Scopulariopsis, Aureobasidium and Mucor. The most frequent genera were: Phoma, Alternaria and Fusarium. In water for steeping, five genera were identified: Geotrichum, Fusarium, Phoma Cladosporium and Mucor. The most frequent genera was Phoma.

β-Glucan as an encapsulating agent: Effect on probiotic survival in simulated gastrointestinal tract.

Science.gov (United States)

Shah, Asima; Gani, Adil; Ahmad, Mudasir; Ashwar, Bilal Ahmad; Masoodi, F A

2016-01-01

Three strains of probiotics Lactobacillus casei, Lactobacillus brevis, and Lactobacillus plantarum were encapsulated in β-glucan matrix using emulsion technique. Further the encapsulated cells were studied for their tolerance in simulated gastrointestinal conditions and its storage stability. The average encapsulation efficiency of β-glucan-probiotic beads was found to be 74.01%. The surface morphology of β-glucan containing bacteria was studied using SEM. The noteworthy absorptions in the FT-IR spectra between 1300-900 cm(-1) and 2918-2925 cm(-1) corresponds to the presence of bacteria into the glucan matrix. Also, the thermal stability of β-glucan was evaluated using Differential Scanning Calorimeter. The efficiency of β-glucan in protecting the surviability of probiotic cells under simulated gastrointestinal conditions was studied. Results revealed significant (p<0.05) improvement to tolerance when the encapsulated cells were subjected to stresses like low pH, heat treatment, simulated intestinal conditions and storage. Copyright © 2015 Elsevier B.V. All rights reserved.

Neutron Diffraction Studies of a Class A beta-Lactamase Toho-1 E166A/R274N/R276N Triple Mutant

International Nuclear Information System (INIS)

Blakeley, Matthew P.; Chen, Yu; Afonine, Pavel

2010-01-01

beta-Lactam antibiotics have been used effectively over several decades against many types of bacterial infectious diseases. However, the most common cause of resistance to the beta-lactam antibiotics is the production of beta-lactamase enzymes that inactivate beta-lactams by rapidly hydrolyzing the amide group of the beta-lactam ring. Specifically, the class A extended-spectrum beta-lactamases (ESBLs) and inhibitor-resistant enzymes arose that were capable of hydrolyzing penicillins and the expanded-spectrum cephalosporins and monobactams in resistant bacteria, which lead to treatment problems in many clinical settings. A more complete understanding of the mechanism of catalysis of these ESBL enzymes will impact current antibiotic drug discovery efforts. Here, we describe the neutron structure of the class A, CTX-M-type ESBL Toho-1 E166A/R274N/R276N triple mutant in its apo form, which is the first reported neutron structure of a beta-lactamase enzyme. This neutron structure clearly reveals the active-site protonation states and hydrogen-bonding network of the apo Toho-1 ESBL prior to substrate binding and subsequent acylation. The protonation states of the active-site residues Ser70, Lys73, Ser130, and Lys234 in this neutron structure are consistent with the prediction of a proton transfer pathway from Lys73 to Ser130 that is likely dependent on the conformation of Lys73, which has been hypothesized to be coupled to the protonation state of Glu166 during the acylation reaction. Thus, this neutron structure is in agreement with a proposed mechanism for acylation that identifies Glu166 as the general base for catalysis.

Revisiting the structure of the anti-neoplastic glucans of Mycobacterium bovis Bacille Calmette-Guerin. Structural analysis of the extracellular and boiling water extract-derived glucans of the vaccine substrains.

Science.gov (United States)

Dinadayala, Premkumar; Lemassu, Anne; Granovski, Pierre; Cérantola, Stéphane; Winter, Nathalie; Daffé, Mamadou

2004-03-26

The attenuated strain of Mycobacterium bovis Bacille Calmette-Guérin (BCG), used worldwide to prevent tuberculosis and leprosy, is also clinically used as an immunotherapeutic agent against superficial bladder cancer. An anti-tumor polysaccharide has been isolated from the boiling water extract of the Tice substrain of BCG and tentatively characterized as consisting primarily of repeating units of 6-linked-glucosyl residues. Mycobacterium tuberculosis and other mycobacterial species produce a glycogen-like alpha-glucan composed of repeating units of 4-linked glucosyl residues substituted at some 6 positions by short oligoglucosyl units that also exhibits an anti-tumor activity. Therefore, the impression prevails that mycobacteria synthesize different types of anti-neoplastic glucans or, alternatively, the BCG substrains are singular in producing a unique type of glucan that may confer to them their immunotherapeutic property. The present study addresses this question through the comparative analysis of alpha-glucans purified from the extracellular materials and boiling water extracts of three vaccine substrains. The polysaccharides were purified, and their structural features were established by mono- and two-dimensional NMR spectroscopy and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry of the enzymatic and chemical degradation products of the purified compounds. The glucans isolated by the two methods from the three substrains of BCG were shown to exhibit identical structural features shared with the glycogen-like alpha-glucan of M. tuberculosis and other mycobacteria. Incidentally, we observed an occasional release of dextrans from Sephadex columns that may explain the reported occurrence of 6-substituted alpha-glucans in mycobacteria.

High-throughput Agrobacterium-mediated barley transformation

Directory of Open Access Journals (Sweden)

Snape John W

2008-09-01

Full Text Available Abstract Background Plant transformation is an invaluable tool for basic plant research, as well as a useful technique for the direct improvement of commercial crops. Barley (Hordeum vulgare is the fourth most abundant cereal crop in the world. It also provides a useful model for the study of wheat, which has a larger and more complex genome. Most existing barley transformation methodologies are either complex or have low ( Results A robust, simple and reproducible barley transformation protocol has been developed that yields average transformation efficiencies of 25%. This protocol is based on the infection of immature barley embryos with Agrobacterium strain AGL1, carrying vectors from the pBract series that contain the hpt gene (conferring hygromycin resistance as a selectable marker. Results of large scale experiments utilising the luc (firefly luciferase gene as a reporter are described. The method presented here has been used to produce hundreds of independent, transgenic plant lines and we show that a large proportion of these lines contain single copies of the luc gene. Conclusion This protocol demonstrates significant improvements in both efficiency and ease of use over existing barley transformation methods. This opens up opportunities for the development of functional genomics resources in barley.

Revisit to Ethiopian traditional barley-based food

Directory of Open Access Journals (Sweden)

Jemal Mohammed

2016-06-01

Full Text Available Barley is the number one food crop in the highland parts of North Eastern Ethiopia produced by subsistence farmers grown as landraces. Barley producers in Ethiopia have given it the name gebs ye ehil nigus, which means barley is the king of crops, due to its suitability for preparing many of the known Ethiopians traditional dishes. Various barley foods and drinks play an important role in the socioeconomic and cultural life of Ethiopians, but detailed descriptions related to their preparation and their socioeconomic and cultural roles are not well-recorded and documented like most of the Ethiopian cultural foods. Foods such as ingera, kita, dabo, kolo, genfo, beso, chuko, shamet, tihlo, kinch, and shorba are the most commonly known traditional Ethiopian barley-based foods. These products are prepared from either roasted whole grain, raw and roasted-milled grain, or cracked grain as main, side, ceremonial, and recuperating dishes. The various barley-based traditional foods have perceived qualities and health benefits by the consumers. For example, genfo is served to breast-feeding mothers with the belief that it enhances breast milk production and serves as a good substitute for breast milk. Beso is claimed to be a remedy for gastritis, while genfo and kinche are used to heal broken bones and fractures. Considering the Western consumers' trend on functional foods and health benefits of barley, Ethiopian traditional barley-based foods are worth studying as functional foods, which can be appealing to Western consumers.

Visual effects of β-­glucans on wound healing in fish

DEFF Research Database (Denmark)

Schmidt, Jacob; Ljungqvist, Martin Georg; Ersbøll, Bjarne Kjær

2011-01-01

Introduction B-glucans are diverse polysaccharides that occur naturally in plants, fungi and bacteria. B-glucans have been shown to have an immunostimulatory effect1. In addition, B-glucans have been found to increase wound tensile strength and collagen synthesis2. This is likely to affect...... the filet quality3. With multispectral imaging we investigate the effect of adding B-glucans to the water during healing of open wounds in fish. Multispectral imaging is used in human diagnostic medicine for evaluating fx proriasis and chronic diabetic wounds, but has not yet been applied to wounds in fish....... Experimental set-up. The fish (common carp, Cyprinus carpio and rainbow trout, Oncorhynchus mykiss) were wounded with a biopsy punch (Miltex, York, USA), thus removing a cylinder of tissue. The resulting wound exposed the muscle. Fish were then kept for 14 days in either pure tap water or tap water...

Molecular Chemical Structure of Barley Proteins Revealed by Ultra-Spatially Resolved Synchrotron Light Sourced FTIR Microspectroscopy: Comparison of Barley Varieties

International Nuclear Information System (INIS)

Yu, P.

2007-01-01

Barley protein structure affects the barley quality, fermentation, and degradation behavior in both humans and animals among other factors such as protein matrix. Publications show various biological differences among barley varieties such as Valier and Harrington, which have significantly different degradation behaviors. The objectives of this study were to reveal the molecular structure of barley protein, comparing various varieties (Dolly, Valier, Harrington, LP955, AC Metcalfe, and Sisler), and quantify protein structure profiles using Gaussian and Lorentzian methods of multi-component peak modeling by using the ultra-spatially resolved synchrotron light sourced Fourier transform infrared microspectroscopy (SFTIRM). The items of the protein molecular structure revealed included protein structure α-helices, β-sheets, and others such as β-turns and random coils. The experiment was performed at the National Synchrotron Light Source in Brookhaven National Laboratory (BNL, US Department of Energy, NY). The results showed that with the SFTIRM, the molecular structure of barley protein could be revealed. Barley protein structures exhibited significant differences among the varieties in terms of proportion and ratio of model-fitted α-helices, β-sheets, and others. By using multi-component peaks modeling at protein amide I region of 1710-1576 cm -1 , the results show that barley protein consisted of approximately 18-34% of α-helices, 14-25% of β-sheets, and 44-69% others. AC Metcalfe, Sisler, and LP955 consisted of higher (P 0.05). The ratio of α-helices to others (0.3 to 1.0, P < 0.05) and that of β-sheets to others (0.2 to 0.8, P < 0.05) were different among the barley varieties. It needs to be pointed out that using a multi-peak modeling for protein structure analysis is only for making relative estimates and not exact determinations and only for the comparison purpose between varieties. The principal component analysis showed that protein amide I Fourier

Two Secondary Carbohydrate Binding Sites on the Surface of Barley alpha-Amylase 1 Have Distinct Functions and Display Synergy in Hydrolysis of Starch Granules

DEFF Research Database (Denmark)

Nielsen, Morten Munch; Bozonnet, Sophie; Seo, Eun-Seong

2009-01-01

Some polysaccharide processing enzymes possess secondary carbohydrate binding sites situated on the surface far from the active site. In barley alpha-amylase 1 (AMY1), two such sites, SBS1 and SBS2, are found on the catalytic (beta/alpha)8-barrel and the noncatalytic C-terminal domain, respective...

Chemical rescue of cleft palate and midline defects in conditional GSK-3beta mice.

Science.gov (United States)

Liu, Karen J; Arron, Joseph R; Stankunas, Kryn; Crabtree, Gerald R; Longaker, Michael T

2007-03-01

Glycogen synthase kinase-3beta (GSK-3beta) has integral roles in a variety of biological processes, including development, diabetes, and the progression of Alzheimer's disease. As such, a thorough understanding of GSK-3beta function will have a broad impact on human biology and therapeutics. Because GSK-3beta interacts with many different pathways, its specific developmental roles remain unclear. We have discovered a genetic requirement for GSK-3beta in midline development. Homozygous null mice display cleft palate, incomplete fusion of the ribs at the midline and bifid sternum as well as delayed sternal ossification. Using a chemically regulated allele of GSK-3beta (ref. 6), we have defined requirements for GSK-3beta activity during discrete temporal windows in palatogenesis and skeletogenesis. The rapamycin-dependent allele of GSK-3beta produces GSK-3beta fused to a tag, FRB* (FKBP/rapamycin binding), resulting in a rapidly destabilized chimaeric protein. In the absence of drug, GSK-3beta(FRB)*(/FRB)* mutants appear phenotypically identical to GSK-3beta-/- mutants. In the presence of drug, GSK-3betaFRB* is rapidly stabilized, restoring protein levels and activity. Using this system, mutant phenotypes were rescued by restoring endogenous GSK-3beta activity during two distinct periods in gestation. This technology provides a powerful tool for defining windows of protein function during development.

Chemical Synthesis of Sulfated Yeast (Saccharomyces cerevisiae) Glucans and Their In Vivo Antioxidant Activity.

Science.gov (United States)

Zhang, Hua; Zhang, Jing; Fan, Ziluan; Zhou, Xintao; Geng, Lin; Wang, Zhenyu; Regenstein, Joe M; Xia, Zhiqiang

2017-07-28

The effects of sulfation of yeast glucans was optimized using response surface methodology. The degree of sulfation was evaluated from 0.11 to 0.75 using ion-chromatography. The structural characteristics of SYG (sulfation of yeast glucans) with a DS = 0.75 were determined using high-performance liquid chromatography/gel-permeation chromatography and finally by Fourier transform infrared spectrometry. The SYG had lower viscosity and greater solubility than the native yeast glucans, suggesting that the conformation of the SYG had significantly changed. The results also showed that SYG had a significantly greater antioxidant activity in vivo compared to native yeast glucans.

SPRING BARLEY BREEDING FOR MALTING QUALITY

Directory of Open Access Journals (Sweden)

Alžbeta Žofajová

2010-05-01

Full Text Available The aim of this contribution is to illustrate the results of spring barley breeding for malting quality and point out an important position of variety in production of  qualitative  raw material for maltinq and beer  industry as well as the system of evaluation the qualitative parameters of breeding materials and adaptation of barley breeding programms to the  new requirements of  malting and beer industry. As an example of the results obtained most recently description is made of the Ezer, Levan, Donaris, Sladar spring barley varieties with very good malting quality and effective resistance to  powdery mildew.  Cultivation of these varieties  and malting barley production with  reduced use  of pesticidies is environmentally friedly alternative. doi:10.5219/50

The adsorption of α-amylase on barley proteins affects the in vitro digestion of starch in barley flour.

Science.gov (United States)

Yu, Wenwen; Zou, Wei; Dhital, Sushil; Wu, Peng; Gidley, Michael J; Fox, Glen P; Gilbert, Robert G

2018-02-15

The conversion of barley starch to sugars is a complex enzymic process. Most previous work concerned the biotechnical aspect of in situ barley enzymes. However, the interactions among the macromolecular substrates and their effects on enzymic catalysis has been little examined. Here, we explore the mechanisms whereby interactions of protein and starch in barley flour affect the kinetics of enzymatic hydrolysis of starch in an in vitro system, using digestion rate data and structural analysis by confocal microscopy. The degradation kinetics of both uncooked barley flour and of purified starches are found to be two-step sequential processes. Barley proteins, especially the water-soluble component, are found to retard the digestion of starch degraded by α-amylase: the enzyme binds with water-insoluble protein and with starch granules, leading to reduced starch hydrolysis. These findings are of potential industrial value in both the brewing and food industries. Copyright © 2017 Elsevier Ltd. All rights reserved.

Experience and conclusions from the work at Risoe on induced mutations for powdery mildew resistance in barley

International Nuclear Information System (INIS)

Joergensen, J.H.

1983-01-01

The paper briefly reviews published results on (1) screening for and identification of powdery mildew resistant mutants of spring barley, (2) localization of the mutant locus, ml-o, to chromosome 4, (3) intra-locus recombination with the ml-o locus, (4) resistance characteristics of the mutants, and (5) pleiotropic effects of the mutant genes. Recent results indicate that ml-o mutant genes confer resistance to the pathogen apparently because of an early, rapid and extensive formation of callose-containing cell wall appositions in the epidermal cells below the infection sites. It is suggested that the ml-o resistance is due to a destruction of a functional wild-type gene regulating the formation of the cell wall appositions. The monogenic but quantitative defence reaction of the host, and the apparently polygenic aggressiveness of the pathogen, support the suggestion that the ml-o resistance is unspecific, i.e. not conforming to the gene-for-gene system. Further, the functional similarity of eleven independently arisen ml-o genes studied, irrespective of their structural differences within the locus, suggests that the eleven genes may be considered only as one source of resistance to powdery mildew. (author)

Aspergillus nidulans cell wall composition and function change in response to hosting several Aspergillus fumigatus UDP-galactopyranose mutase activity mutants.

Directory of Open Access Journals (Sweden)

Md Kausar Alam

Full Text Available Deletion or repression of Aspergillus nidulans ugmA (AnugmA, involved in galactofuranose biosynthesis, impairs growth and increases sensitivity to Caspofungin, a β-1,3-glucan synthesis antagonist. The A. fumigatus UgmA (AfUgmA crystal structure has been determined. From that study, AfUgmA mutants with altered enzyme activity were transformed into AnugmA▵ to assess their effect on growth and wall composition in A. nidulans. The complemented (AnugmA::wild type AfugmA strain had wild type phenotype, indicating these genes had functional homology. Consistent with in vitro studies, AfUgmA residues R182 and R327 were important for its function in vivo, with even conservative amino (RK substitutions producing AnugmA? phenotype strains. Similarly, the conserved AfUgmA loop III histidine (H63 was important for Galf generation: the H63N strain had a partially rescued phenotype compared to AnugmA▵. Collectively, A. nidulans strains that hosted mutated AfUgmA constructs with low enzyme activity showed increased hyphal surface adhesion as assessed by binding fluorescent latex beads. Consistent with previous qPCR results, immunofluorescence and ELISA indicated that AnugmA▵ and AfugmA-mutated A. nidulans strains had increased α-glucan and decreased β-glucan in their cell walls compared to wild type and AfugmA-complemented strains. Like the AnugmA▵ strain, A. nidulans strains containing mutated AfugmA showed increased sensitivity to antifungal drugs, particularly Caspofungin. Reduced β-glucan content was correlated with increased Caspofungin sensitivity. Aspergillus nidulans wall Galf, α-glucan, and β-glucan content was correlated in A. nidulans hyphal walls, suggesting dynamic coordination between cell wall synthesis and cell wall integrity.

Glucan Particles for Macrophage Targeted Delivery of Nanoparticles

Directory of Open Access Journals (Sweden)

Ernesto R. Soto

2012-01-01

Full Text Available Glucan particles (GPs are hollow, porous 2–4 μm microspheres derived from the cell walls of Baker's yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of soluble payloads (DNA, siRNA, protein, and small molecules encapsulated inside the hollow GPs via core polyplex and layer-by-layer (LbL synthetic strategies. In this communication, we report the incorporation of nanoparticles as cores inside GPs (GP-NP or electrostatically bound to the surface of chemically derivatized GPs (NP-GP. GP nanoparticle formulations benefit from the drug encapsulation properties of NPs and the macrophage-targeting properties of GPs. GP nanoparticle formulations were synthesized using fluorescent anionic polystyrene nanoparticles allowing visualization and quantitation of NP binding and encapsulation. Mesoporous silica nanoparticles (MSNs containing the chemotherapeutic doxorubicin (Dox were bound to cationic GPs. Dox-MSN-GPs efficiently delivered Dox into GP phagocytic cells resulting in enhanced Dox-mediated growth arrest.

Roles of Hydroxynitrile Glucosides in Barley

DEFF Research Database (Denmark)

Roelsgaard, Pernille Sølvhøj

on barley (Hordeum vulgare). Barley accumulates five hydroxynitrile glucosides, including one cyanogenic glucoside, in the epidermal cell layer. Cyanogenic glucosides are classically known as hydrogen cyanide-releasing defense compounds which act against generalist insects and herbivores. However...... is proposed. The results obtained in this Ph.D. study provide a unique insight demonstrating that hydroxynitrile glucosides play a far more complex role in barley defense against and susceptibility to Bgh than previously described. Future studies can build on the platforms established in this study to provide...

Polyploidy and chromosomal aberrations induced by mutagens in open flowering sterile mutants of spring barley

Energy Technology Data Exchange (ETDEWEB)

Manzyuk, V T; Kozachenko, M R; Kirichenko, V V

1975-01-01

Two types of aberration in meiosis were observed which induced sterility in chemical and radiational mutations of spring wheat: asynapsis and absence of cytokinesis, and chromosomal aberrations in the form of bridges and fragments. Gamma-mutants have many more chromosomal aberrations in the form of fragments, bridges and cells with micronuclei than do chemical mutants. The percent of tetrads with micronuclei is 1.5-2 times greater than the number of dyads with such nuclei. We obtained an original gamma-mutant exhibiting depolyploidization and polyploidization in the mother cells; we also observed cells possessing chromosomal associations of n, 2n, 4n, 68, 8n and greater.

Structural insights into the {beta}-xylosidase from Trichoderma reesei

Energy Technology Data Exchange (ETDEWEB)

Rojas, Adriana L.; Fischer, Hannes; Polikarpov, Igor [Sao Paulo Univ. (USP), Sao Carlos, SP (Brazil). Inst. de Fisica; Eneiskaya, Elena V.; Kulminskaya, Anna A.; Shabalin, Konstantin A.; Neustroev, Kirill N.; Golubev, Alexander M. [Petersburg Nuclear Physics Inst., Moskow (Russian Federation); Craievich, Aldo Felix [Sao Paulo Univ. (USP), SP (Brazil). Inst. de Fisica

2005-07-01

Xylan is a major structural polysaccharide in plant cells, and is the second most abundant polysaccharide in nature, accounting for approximately one-third of all renewable organic carbon on earth. Xylan together with cellulose (1,4-{beta}-glucan) and lignin (a complex polyphenolic compound) make up the major polymeric constituents of plant cell walls, recently, there was a significant industrial interest in Xylan and its hydrolytic enzymatic complex, as a supplement in animal feed, for the manufacture of bread, food and drinks, textiles, bleaching of cellulose pulp, ethanol and xylitol production. (author)

Structure elucidation and immunomodulatory activity of a beta glucan from the fruiting bodies of Ganoderma sinense.

Directory of Open Access Journals (Sweden)

Xiao-Qiang Han

Full Text Available A polysaccharide named GSP-2 with a molecular size of 32 kDa was isolated from the fruiting bodies of Ganoderma sinense. Its structure was well elucidated, by a combined utilization of chemical and spectroscopic techniques, to be a β-glucan with a backbone of (1→4- and (1→6-Glcp, bearing terminal- and (1→3-Glcp side-chains at O-3 position of (1→6-Glcp. Immunological assay exhibited that GSP-2 significantly induced the proliferation of BALB/c mice splenocytes with target on only B cells, and enhanced the production of several cytokines in human peripheral blood mononuclear cells and derived dendritic cells. Besides, the fluorescent labeled GSP-2 was phagocytosed by the RAW 264.7 cells and induced the nitric oxide secretion from the cells.

Effects of β-Glucan on the Release of Nitric Oxide by Macrophages Stimulated with Lipopolysaccharide

Directory of Open Access Journals (Sweden)

E. Y. Choi

2016-11-01

Full Text Available This research analyzed the effect of β-glucan that is expected to alleviate the production of the inflammatory mediator in macrophagocytes, which are processed by the lipopolysaccharide (LPS of Escherichia. The incubated layer was used for a nitric oxide (NO analysis. The DNA-binding activation of the small unit of nuclear factor-κB was measured using the enzyme-linked immunosorbent assay-based kit. In the RAW264.7 cells that were vitalized by Escherichia coli (E. coli LPS, the β-glucan inhibited both the combatant and rendering phases of the inducible NO synthase (iNOS-derived NO. β-Glucan increased the expression of the heme oxygenase-1 (HO-1 in the cells that were stimulated by E. coli LPS, and the HO-1 activation was inhibited by the tin protoporphyrin IX (SnPP. This shows that the NO production induced by LPS is related to the inhibition effect of β-glucan. The phosphorylation of c-Jun N-terminal kinases (JNK and the p38 induced by the LPS were not influenced by the β-glucan, and the inhibitory κB-α (IκB-α decomposition was not influenced either. Instead, β-glucan remarkably inhibited the phosphorylation of the signal transducer and activator of transcription-1 (STAT1 that was induced by the E. coli LPS. Overall, the β-glucan inhibited the production of NO in macrophagocytes that was vitalized by the E .coli LPS through the HO-1 induction and the STAT1 pathways inhibition in this research. As the host immune response control by β-glucan weakens the progress of the inflammatory disease, β-glucan can be used as an effective immunomodulator.

The Genetic Architecture of Barley Plant Stature

Science.gov (United States)

Alqudah, Ahmad M.; Koppolu, Ravi; Wolde, Gizaw M.; Graner, Andreas; Schnurbusch, Thorsten

2016-01-01

Plant stature in temperate cereals is predominantly controlled by tillering and plant height as complex agronomic traits, representing important determinants of grain yield. This study was designed to reveal the genetic basis of tillering at five developmental stages and plant height at harvest in 218 worldwide spring barley (Hordeum vulgare L.) accessions under greenhouse conditions. The accessions were structured based on row-type classes [two- vs. six-rowed] and photoperiod response [photoperiod-sensitive (Ppd-H1) vs. reduced photoperiod sensitivity (ppd-H1)]. Phenotypic analyses of both factors revealed profound between group effects on tiller development. To further verify the row-type effect on the studied traits, Six-rowed spike 1 (vrs1) mutants and their two-rowed progenitors were examined for tiller number per plant and plant height. Here, wild-type (Vrs1) plants were significantly taller and had more tillers than mutants suggesting a negative pleiotropic effect of this row-type locus on both traits. Our genome-wide association scans further revealed highly significant associations, thereby establishing a link between the genetic control of row-type, heading time, tillering, and plant height. We further show that associations for tillering and plant height are co-localized with chromosomal segments harboring known plant stature-related phytohormone and sugar-related genes. This work demonstrates the feasibility of the GWAS approach for identifying putative candidate genes for improving plant architecture. PMID:27446200

The Importance of Barley Varieties in terms of Production, Marketing and Processing

Directory of Open Access Journals (Sweden)

Rahmi Taşcı

2017-08-01

Full Text Available In this study, it is aimed to investigate the criteria affecting the marketing of barley in the stages of barley production, marketing and processing in Konya province. In the study; survey results were used which get from mixed feed (37 items and malt factory (1 item, traders (50 items purchasing and selling barley, and agricultural enterprises (107 items including barley production in agricultural activities operating in Konya province. It was determined that barley varieties were not an important criterion in the selling price, while the hectoliter and other plant species do not mix into barley are the main criteria considered by agricultural enterprises to affect the sale of barley. The most important criteria that traders keep in mind when buying barley is hectoliter of barley, which is followed by moisture, colour and foreign matter confusion rate of barley. The most important criteria that factories take into consideration when purchasing barley is determined as the moisture content of the barley, followed by the hectoliter of barley and the rate of foreign matter contamination. For the malt industry; Barley variety is a very important factor in the purchase criteria, followed by barley humidity and colour.

Amylolytic strains of Lactobacillus plantarum isolated from barley ...

African Journals Online (AJOL)

... naturally present in barley, and produced cell-bound and cell-free α-amylase at alkaline conditions. The two strains may be developed into starter cultures to facilitate the germination of barley and produce malt with a higher fermentable sugar content. Key words: Lactobacillus plantarum, starch hydrolysis, barley, malting ...

Implementation of biochemical screening to improve baking quality of barley

DEFF Research Database (Denmark)

Vincze, Éva; Dionisio, Giuseppe; Aaslo, Per

2011-01-01

Barley (Hordeum vulgare) has the potential to offer considerable human nutritional benefits, especially as supplement to wheat-based breads. Under current commercial baking conditions it is not possible to introduce more that 20% barley flour to the wheat bread without negative impact on the phys......Barley (Hordeum vulgare) has the potential to offer considerable human nutritional benefits, especially as supplement to wheat-based breads. Under current commercial baking conditions it is not possible to introduce more that 20% barley flour to the wheat bread without negative impact...... on the physical chemical properties of the bread products due to the poor baking properties of barley flour. As a consequence, the nutritional advantages of barley are not fully exploited. The inferior leavening and baking properties of barley can, in part, be attributed to the physical properties of the storage...... proteins. Changing the storage protein composition can lessen this problem. Our working hypothesis was that exploiting the substantial genetic variation within the gene pool for storage proteins could enable improving the baking qualities of barley flour. We characterised forty-nine barley cultivars...

In vitro selection of resistance in haemophilus influenzae by 4 quinolones and 5 beta-lactams.

Science.gov (United States)

Clark, Catherine; Kosowska, Klaudia; Bozdogan, Bülent; Credito, Kim; Dewasse, Bonifacio; McGhee, Pamela; Jacobs, Michael R; Appelbaum, Peter C

2004-05-01

We tested abilities of ciprofloxacin, levofloxacin, gatifloxacin, moxifloxacin, amoxicillin, amoxicillin/clavulanate, cefixime, cefpodoxime, and cefdinir to select resistant mutants in 5 beta-lactamase positive and 5 beta-lactamase negative Haemophilus influenzae strains by single and multistep methodology. In multistep tests, amoxicillin, amoxicillin/clavulanate and cefpodoxime exposure did not cause >4-fold minimum inhibitory concentration (MIC) increase after 50 days. One mutant selected by cefdinir had one amino acid substitution (Gly490Glu) in PBP3 and became resistant to cefdinir. Cefixime exposure caused 8-fold MIC-increase in 1 strain with TEM but the mutant remained cefixime susceptible and had no alteration in PBP3 or TEM. Among 10 strains tested, ciprofloxacin, moxifloxacin, gatifloxacin, levofloxacin caused >4-fold MIC increase in 6, 6, 5, and 2 strain, respectively. Despite the increases in quinolone MICs, none of the mutants became resistant to quinolones by established criteria. Quinolone selected mutants had quindone resistance-determining region (QRDR) alterations in GyrA, GyrB, ParC, ParE. Four quinolone mutants had no QRDR alterations. Among beta-lactams cefdinir and cefixime selected one mutant each with higher MICs however amoxicillin, amoxicillin/clavulanate, and cefpodoxime exposure did not select resistant mutants.

Modulation of the immune response of porcine neutrophils by different β-glucan preparations

DEFF Research Database (Denmark)

Juul-Madsen, Helle Risdahl; Norup, Liselotte Rothmann; Lærke, Helle Nygaard

2010-01-01

β-glucans of bacterial and fungal origin are known immuno-modulators, but data in the literature also indicate that lichen and cereal-derived β-glucans may have immuno-modulatory functions. The aim of the current study was to test the effect of different sources of β-glucans on neutrophils in an ex......-vivo whole blood stimulation assay. Whole blood samples were either treated with curdlan, a linear β-(1 → 3)-D-glucan from the non-pathogenic Alcaligenes faecalis, lichenan, a mixed linked β-(1 → 3),(1 → 4)-D-glucan from Islandic moss (Cetraria islandica) or zymosan, prepared from yeast cell walls and being...... expression of Toll-like Receptor (TLR) 2 and 4, but not significantly on the signal regulatory protein SIRPα after a stimulation either alone or in combination with LPS. Thus, branching may appear to be important for the different effect, but an effect of impurities in the Zymosan preparation cannot be ruled...

Barley yellow dwarf virus in barley crops in Tunisia: prevalence and molecular characterization

OpenAIRE

Asma NAJAR; Imen HAMDI; Arvind VARSANI

2017-01-01

A field survey was conducted in Tunisia in the North-Eastern regions (Bizerte, CapBon and Zaghouan), the North-Western region (Kef) and the Central-Eastern region (Kairouan) during the 2011/2012 growing season, in order to determine the incidence and the geographic distribution of Barley yellow dwarf virus (BYDVs) in barley fields. Tissue blot immunoassays (TBIA) showed that BYDV was most common in Zaghouan (incidence 14%), Cap Bon (14%) and Bizerte (35%), in randomly collected samples from t...

Enhanced quantitative resistance against fungal disease by combinatorial expression of different barley antifungal proteins in transgenic tobacco

DEFF Research Database (Denmark)

Jach, G; Görnhardt, B; Mundy, J

1995-01-01

cDNAs encoding three proteins from barley (Hordeum vulgare), a class-II chitinase (CHI), a class-II beta-1,3-glucanase (GLU) and a Type-I ribosome-inactivating protein (RIP) were expressed in tobacco plants under the control of the CaMV 35S-promoter. High-level expression of the transferred genes...... was detected in the transgenic plants by Northern and Western blot analysis. The leader peptides in CHI and GLU led to accumulation of these proteins in the intercellular space of tobacco leaves. RIP, which is naturally deposited in the cytosol of barley endosperm cells, was expressed either in its original...... cytosolic form or fused to a plant secretion peptide (spRIP). Fungal infection assays revealed that expression of the individual genes in each case resulted in an increased protection against the soilborne fungal pathogen Rhizoctonia solani, which infects a range of plant species including tobacco...

Βeta-glucans promote wound healing in common carp (Cyprinus carpio L.)

DEFF Research Database (Denmark)

Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht

β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...

Structure Elucidation and Immunomodulatory Activity of A Beta Glucan from the Fruiting Bodies of Ganoderma sinense

Science.gov (United States)

Yue, Rui-Qi; Dong, Cai-Xia; Chan, Chung-Lap; Ko, Chun-Hay; Cheung, Wing-Shing; Luo, Ke-Wang; Dai, Hui; Wong, Chun-Kwok; Leung, Ping-Chung; Han, Quan-Bin

2014-01-01

A polysaccharide named GSP-2 with a molecular size of 32 kDa was isolated from the fruiting bodies of Ganoderma sinense. Its structure was well elucidated, by a combined utilization of chemical and spectroscopic techniques, to be a β-glucan with a backbone of (1→4)– and (1→6)–Glcp, bearing terminal- and (1→3)–Glcp side-chains at O-3 position of (1→6)–Glcp. Immunological assay exhibited that GSP-2 significantly induced the proliferation of BALB/c mice splenocytes with target on only B cells, and enhanced the production of several cytokines in human peripheral blood mononuclear cells and derived dendritic cells. Besides, the fluorescent labeled GSP-2 was phagocytosed by the RAW 264.7 cells and induced the nitric oxide secretion from the cells. PMID:25014571

THE EFFECT OF BETA GLUCAN OF SACCHAROMYCES CEREVISAE ON THE INCREASE OF THE NUMBER OF BRAIN CELLS IN SUBSTANTIA NIGRA BRAIN OF PARKINSON’S WISTAR STRAIN RAT (RATTUS NORVEGICUS MODEL INDUCED WITH ROTENONE

Directory of Open Access Journals (Sweden)

Masruroh Rahayu

2015-01-01

Full Text Available ackground and aims. One of many neurodegenerative diseases afflicting the elderly is Parkinson. Beta glucan from Saccharomyces cerevisae is very potential to be used as a regenerative therapy of Parkinson's disease. Beta glucan can increase the mobilization of hematopoietic stem cells (HSCs from the bone marrow into the damaged tissues. Hematopoietic stem cells (HSCs which have been mobilized can regenerate and differentiate into brain cells so that the symptoms of Parkinson would be reduced. This research aims to find out the effects of the addition of Saccharomyces cerevisae toward the number of brain cells in substantia nigra Parkinson’s rat model. Method. The research was experimental in vivo using the draft of randomized post test only controlled group design. There were five groups that become the sample in this research with 5 rats for each group, i.e. negative control group, positive control group, Treatment Group 1, 2 and 3 (Rotenone + Saccharomyces cerevisae 18 mg/kgBB, 36 mg/kgBB, 72 mg/kgBBfor 4 weeks. Variable measured in this study was the number of brain cells in substantia nigra. The results of this study showed that Treatment Group 3 (72 mg/kgBB was a group with the largest number of brain cells than the other treatment groups. Statistical data obtained showed that the average number of brain cells in negative control group was 192.00 cells; positive control amounted to 116.80 cells; Treatment 1 amounted to 135.40 cells; Treatment 2 amounted to 140.80 cells; and Treatment 3 amounted to 161.80 cells. Result. The result of ANOVA test showed a significant difference between groups (p< 0.05, while the correlation test result indicated a strong correlation between the dose of Saccharomyces cerevisae and the number of substantia nigra of rat’s brain cells (r = 0,818. Conclusion. From this research, it can be concluded that the addition of Saccharomyces cerevisae with a dose of 18mg/kgBB, 36mg/kgBBdan 72 mg/kgBB is able to increase

Effect of phytase supplementation to barley-canola meal and barley-soybean meal diets on phosphorus and calcium balance in growing pigs

NARCIS (Netherlands)

Sauer, W.C.; Cervantes, M.; He, J.M.M.; Schulze, H.

2003-01-01

Two metabolism experiments were carried out, to determine the effect of microbial phytase addition to barley-canola meal and barley-soybean meal diets on P and Ca balance in growing. pigs; In experiment 1, six barrows (29.6kg: initial LW) were fed a barley-canola meal diet, without or. with phytase

Lipid and sugar profiles of various barley cultivars (Hordeum vulgare

Directory of Open Access Journals (Sweden)

Pastor Kristian A.

2015-01-01

Full Text Available The lipid components and soluble sugars in flour samples of different cultivars of barley (Hordeum vulgare, involving winter malting barley, winter forage barley, spring barley, and hulless barley, were identified. Fatty acids were extracted from flour samples with n-hexane, and derivatized into volatile methyl esters, using TMSH (trimethylsulfonium hydroxide in methanol. Soluble sugars were extracted from defatted and dried samples of barley flour with 96% ethanol, and further derivatized into the corresponding trimethylsilyl (TMS oximes, using hydroxylamine hydrochloride solution and BSTFA (N,O-bis-(trimethylsilyl-trifluoroacetamide. The hexane and alcoholic extracts of barley cultivars were analyzed by GC-MS system. Lipid and sugar compositions were very similar in all barley cultivars. Therefore, multivariate analysis was applied to numerical values of automatically integrated areas of the identified fatty acid methyl esters and TMS oximes of soluble sugars. The application of hierarchical cluster analysis showed a great similarity between the investigated flour samples of barley cultivars, according to their fatty acid content (0.96. Also, significant, but somewhat less similarity was observed regarding the content of soluble sugars (0.70. These preliminary results indicate the possibility of distinguishing flour made of barley, regardless of the variety, from flours made of other cereal species, just by the analysis of the contents of fatty acids and soluble sugars.[Projekat Ministarstva nauke Republike Srbije, br. TR 31066

Normal aging modulates the neurotoxicity of mutant huntingtin.

Directory of Open Access Journals (Sweden)

Elsa Diguet

Full Text Available Aging likely plays a role in neurodegenerative disorders. In Huntington's disease (HD, a disorder caused by an abnormal expansion of a polyglutamine tract in the protein huntingtin (Htt, the role of aging is unclear. For a given tract length, the probability of disease onset increases with age. There are mainly two hypotheses that could explain adult onset in HD: Either mutant Htt progressively produces cumulative defects over time or "normal" aging renders neurons more vulnerable to mutant Htt toxicity. In the present study, we directly explored whether aging affected the toxicity of mutant Htt in vivo. We studied the impact of aging on the effects produced by overexpression of an N-terminal fragment of mutant Htt, of wild-type Htt or of a beta-Galactosidase (beta-Gal reporter gene in the rat striatum. Stereotaxic injections of lentiviral vectors were performed simultaneously in young (3 week and old (15 month rats. Histological evaluation at different time points after infection demonstrated that the expression of mutant Htt led to pathological changes that were more severe in old rats, including an increase in the number of small Htt-containing aggregates in the neuropil, a greater loss of DARPP-32 immunoreactivity and striatal neurons as assessed by unbiased stereological counts.The present results support the hypothesis that "normal" aging is involved in HD pathogenesis, and suggest that age-related cellular defects might constitute potential therapeutic targets for HD.

Intestinal microbiota and immune related genes in sea cucumber (Apostichopus japonicus) response to dietary β-glucan supplementation

International Nuclear Information System (INIS)

Yang, Gang; Xu, Zhenjiang; Tian, Xiangli; Dong, Shuanglin; Peng, Mo

2015-01-01

β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber

Intestinal microbiota and immune related genes in sea cucumber (Apostichopus japonicus) response to dietary β-glucan supplementation

Energy Technology Data Exchange (ETDEWEB)

Yang, Gang [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Xu, Zhenjiang [Biofrontiers Institute, University of Colorado, Boulder, CO (United States); Tian, Xiangli, E-mail: xianglitian@ouc.edu.cn [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Dong, Shuanglin [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Peng, Mo [School of Animal Science and Technology, Jiangxi Agricultural University (China)

2015-02-27

β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber.

Protein and Carbohydrate Accumulation in Normal and High-Lysine Barley in Spike Culture

DEFF Research Database (Denmark)

Mather, D.E; Giese, Nanna Henriette

1984-01-01

Spikes of barley cv. Bomi and high-lysine mutants Riso 1508 and Riso 56 were cultured on liquid media at varying N and sucrose levels. Bomi accumulated N in response to increasing N levels in the medium and a higher level was reached than in spikes of intact plants. The distribution of N in salt......-soluble, hordein, and non-protein N fractions appeared to be normal. Endosperm dry weight and starch were lower than in intact plants and declined at higher N levels. A linear relationship was observed between starch content and the concentration of sucrose in the endosperm water. Uptake of culture medium...

Barley (Hordeum vulgare) circadian clock genes can respond rapidly to temperature in an EARLY FLOWERING 3-dependent manner

Science.gov (United States)

Ford, Brett; Deng, Weiwei; Clausen, Jenni; Oliver, Sandra; Boden, Scott; Hemming, Megan; Trevaskis, Ben

2016-01-01

An increase in global temperatures will impact future crop yields. In the cereal crops wheat and barley, high temperatures accelerate reproductive development, reducing the number of grains per plant and final grain yield. Despite this relationship between temperature and cereal yield, it is not clear what genes and molecular pathways mediate the developmental response to increased temperatures. The plant circadian clock can respond to changes in temperature and is important for photoperiod-dependent flowering, and so is a potential mechanism controlling temperature responses in cereal crops. This study examines the relationship between temperature, the circadian clock, and the expression of flowering-time genes in barley (Hordeum vulgare), a crop model for temperate cereals. Transcript levels of barley core circadian clock genes were assayed over a range of temperatures. Transcript levels of core clock genes CCA1, GI, PRR59, PRR73, PRR95, and LUX are increased at higher temperatures. CCA1 and PRR73 respond rapidly to a decrease in temperature whereas GI and PRR59 respond rapidly to an increase in temperature. The response of GI and the PRR genes to changes in temperature is lost in the elf3 mutant indicating that their response to temperature may be dependent on a functional ELF3 gene. PMID:27580625

β-Glucan production of Saccharomyces cerevisiae in medium with different nitrogen sources in air-lift fermentor

Directory of Open Access Journals (Sweden)

AHMAD THONTOWI

2007-10-01

Full Text Available β-Glucan is one of the most abundant polysaccharides in yeast Saccharomyces cerevisiae cell wall. The aim of this research is to explore an alternative nitrogen sources for β-glucan production. S. cerevisiae were grown in fermentation medium with different nitrogen sources. Peptone 2%, glutamic acid 0,5%, urea 0,2%, and diammonium hydrogen phosphate (DAHP 0,02% were used for nitrogen source in the medium. A two liter air-lift fermentor was used in the fermentation process for 84 hours (T = 300C, pH 7, and 1.5 vvm for the aeration. During the fermentation, optical density, extraction of β-glucan, glucose and protein in hydrolisate cultured were determined. β-glucan production level is similar with the growth rate of yeast and followed by decreasing glucose and protein content in hydrolysis cultured. The highest and lowest β-glucan content were obtained from peptone (933.33 mg/L and glutamic acid (633.33 mg/L as a nitrogen source in cells cultured after fermentation completed respectively. Yeast cells cultured with urea and DAHP as a nitrogen source give the same content of β-glucan about 733.33 mg/L. β-glucan concentration produced in medium with urea was a higher than that produced using glutamic acid and DAHP as a nitrogen source. The result indicated that urea can be used as an alternative nitrogen source for the production of β-glucan. Urea is easily available and cheaper than peptone, glutamic acid and DAHP.

β-Glucan Size Controls Dectin-1-Mediated Immune Responses in Human Dendritic Cells by Regulating IL-1β Production

Directory of Open Access Journals (Sweden)

Matthew J. Elder

2017-07-01

Full Text Available Dectin-1/CLEC7A is a pattern recognition receptor that recognizes β-1,3 glucans, and its stimulation initiates signaling events characterized by the production of inflammatory cytokines from human dendritic cells (DCs required for antifungal immunity. β-glucans differ greatly in size, structure, and ability to activate effector immune responses from DC; as such, small particulate β-glucans are thought to be poor activators of innate immunity. We show that β-glucan particle size is a critical factor contributing to the secretion of cytokines from human DC; large β-glucan-stimulated DC generate significantly more IL-1β, IL-6, and IL-23 compared to those stimulated with the smaller β-glucans. In marked contrast, the secretion of TSLP and CCL22 were found to be insensitive to β-glucan particle size. Furthermore, we show that the capacity to induce phagocytosis, and the relative IL-1β production determined by β-glucan size, regulates the composition of the cytokine milieu generated from DC. This suggests that β-glucan particle size is critically important in orchestrating the nature of the immune response to fungi.

Brucella cyclic β-1,2-glucan plays a critical role in the induction of splenomegaly in mice.

Directory of Open Access Journals (Sweden)

Mara S Roset

Full Text Available Brucella, the etiological agent of animal and human brucellosis, is a bacterium with the capacity to modulate the inflammatory response. Cyclic β-1,2-glucan (CβG is a virulence factor key for the pathogenesis of Brucella as it is involved in the intracellular life cycle of the bacteria. Using comparative studies with different CβG mutants of Brucella, cgs (CβG synthase, cgt (CβG transporter and cgm (CβG modifier, we have identified different roles for this polysaccharide in Brucella. While anionic CβG is required for bacterial growth in low osmolarity conditions, the sole requirement for a successful Brucella interaction with mammalian host is its transport to periplasmic space. Our results uncover a new role for CβG in promoting splenomegaly in mice. We showed that CβG-dependent spleen inflammation is the consequence of massive cell recruitment (monocytes, dendritics cells and neutrophils due to the induction of pro-inflammatory cytokines such as IL-12 and TNF-α and also that the reduced splenomegaly response observed with the cgs mutant is not the consequence of changes in expression levels of the characterized Brucella PAMPs LPS, flagellin or OMP16/19. Complementation of cgs mutant with purified CβG increased significantly spleen inflammation response suggesting a direct role for this polysaccharide.

Novel structural features in Candida albicans hyphal glucan provide a basis for differential innate immune recognition of hyphae versus yeast.

Science.gov (United States)

Lowman, Douglas W; Greene, Rachel R; Bearden, Daniel W; Kruppa, Michael D; Pottier, Max; Monteiro, Mario A; Soldatov, Dmitriy V; Ensley, Harry E; Cheng, Shih-Chin; Netea, Mihai G; Williams, David L

2014-02-07

The innate immune system differentially recognizes Candida albicans yeast and hyphae. It is not clear how the innate immune system effectively discriminates between yeast and hyphal forms of C. albicans. Glucans are major components of the fungal cell wall and key fungal pathogen-associated molecular patterns. C. albicans yeast glucan has been characterized; however, little is known about glucan structure in C. albicans hyphae. Using an extraction procedure that minimizes degradation of the native structure, we extracted glucans from C. albicans hyphal cell walls. (1)H NMR data analysis revealed that, when compared with reference (1→3,1→6) β-linked glucans and C. albicans yeast glucan, hyphal glucan has a unique cyclical or "closed chain" structure that is not found in yeast glucan. GC/MS analyses showed a high abundance of 3- and 6-linked glucose units when compared with yeast β-glucan. In addition to the expected (1→3), (1→6), and 3,6 linkages, we also identified a 2,3 linkage that has not been reported previously in C. albicans. Hyphal glucan induced robust immune responses in human peripheral blood mononuclear cells and macrophages via a Dectin-1-dependent mechanism. In contrast, C. albicans yeast glucan was a much less potent stimulus. We also demonstrated the capacity of C. albicans hyphal glucan, but not yeast glucan, to induce IL-1β processing and secretion. This finding provides important evidence for understanding the immune discrimination between colonization and invasion at the mucosal level. When taken together, these data provide a structural basis for differential innate immune recognition of C. albicans yeast versus hyphae.

Characterization of Resistance to Cephus cinctus (Hymenoptera: Cephidae) in Barley Germplasm.

Science.gov (United States)

Varella, Andrea C; Talbert, Luther E; Achhami, Buddhi B; Blake, Nancy K; Hofland, Megan L; Sherman, Jamie D; Lamb, Peggy F; Reddy, Gadi V P; Weaver, David K

2018-04-02

Most barley cultivars have some degree of resistance to the wheat stem sawfly (WSS), Cephus cinctus Norton (Hymenoptera: Cephidae). Damage caused by WSS is currently observed in fields of barley grown in the Northern Great Plains, but the impact of WSS damage among cultivars due to genetic differences within the barley germplasm is not known. Specifically, little is known about the mechanisms underlying WSS resistance in barley. We characterized WSS resistance in a subset of the spring barley CAP (Coordinated Agricultural Project) germplasm panel containing 193 current and historically important breeding lines from six North American breeding programs. Panel lines were grown in WSS infested fields for two consecutive years. Lines were characterized for stem solidness, stem cutting, WSS infestation (antixenosis), larval mortality (antibiosis), and parasitism (indirect plant defense). Variation in resistance to WSS in barley was compared to observations made for solid-stemmed resistant and hollow-stemmed susceptible wheat lines. Results indicate that both antibiosis and antixenosis are involved in the resistance of barley to the WSS, but antibiosis seems to be more prevalent. Almost all of the barley lines had greater larval mortality than the hollow-stemmed wheat lines, and only a few barley lines had mortality as low as that observed in the solid-stemmed wheat line. Since barley lines lack solid stems, it is apparent that barley has a different form of antibiosis. Our results provide information for use of barley in rotation to control the WSS and may provide a basis for identification of new approaches for improving WSS resistance in wheat.

Studies on Trans-Resveratrol/Carboxymethylated (1,3/1,6-β-d-Glucan Association for Aerosol Pharmaceutical Applications

Directory of Open Access Journals (Sweden)

Antonio Francioso

2017-05-01

Full Text Available A resveratrol/carboxymethylated glucan (CM-glucan combination is known to inhibit rhinovirus replication and expression of inflammatory mediators in nasal epithelia. The aim of this study was to develop an aerosol formulation containing an association of the two molecules which could reach the lower respiratory tract. Mass median aerodynamic diameter (MMAD of a resveratrol/CM-glucan combination was lower than that shown by resveratrol or CM-glucan alone (2.83 versus 3.28 and 2.96 µm, respectively. The resveratrol/CM-glucan association results in the finest and most monodispersed particles in comparison to the two single components. The association also evidenced lower values for all particle size distribution parameters, suggesting that the pharmacological synergy observed in previous studies may be accompanied by a pharmaceutical one. Moreover, we showed that the CM-glucan matrix did not exert an inhibitory effect on resveratrol nebulization, demonstrating the good suitability of these two molecules in association for simultaneous aerosol volatilization.

Evaluation of correlation between glucan conversion and degree of delignification depending on pretreatment strategies using Jabon Merah.

Science.gov (United States)

Jang, Soo-Kyeong; Jeong, Hanseob; Kim, Ho-Yong; Choi, June-Ho; Kim, Jong-Hwa; Koo, Bon-Wook; Choi, In-Gyu

2017-07-01

The main purpose of this study was to investigate the glucan conversion rate after enzymatic hydrolysis depending on the treatment methods and conditions with changes in the chemical composition of treated solid fraction of Jabon Merah. The glucan conversion rate (17.4%) was not significantly improved after liquid hot water treatment (1st step) even though most of the hemicellulose was dissolved into liquid hydrolysate. Subsequently, dilute acid, organosolv, and peracetic acid treatment (2nd step) was conducted under various conditions to enhance glucan conversion. Among the 2nd step treatment, the glucan conversion rate of organosolv (max. 46.0%) and peracetic acid treatment (max. 65.9%) was increased remarkably through decomposition of acid-insoluble lignin (AIL). Finally, the glucan conversion rate and AIL content were highly correlated, which was revealed by the R-squared value (0.84), but inhibitory factors including cellulose crystallinity must be considered for advanced glucan conversion from highly recalcitrant biomasses, such as Jabon Merah. Copyright © 2017 Elsevier Ltd. All rights reserved.

Simultaneous Detection of Barley Virus Diseases in Korea

Directory of Open Access Journals (Sweden)

Bong-Choon Lee

2017-12-01

Full Text Available Barley mild mosaic virus (BaMMV, Barley yellow mosaic virus (BaYMV and Barley yellow dwarf virus (BYDV have been identified as an important causative agents for an economically important disease of winter barley in Korea. In this study, a multiplex reverse transcription polymerase chain reaction (mRT-PCR method was used for the simultaneous detection. Three sets of virus-specific primers targeted to the capsid protein coding genes of BaMMV, BaYMV and BYDV were used to amplify fragments that were 594 bp, 461 bp, and 290 bp, respectively. Several sets of primers for each target virus were evaluated for their sensitivity and specificity by multiplex RT-PCR. The optimum primer concentrations and RT-PCR conditions were determined for the multiplex RT-PCR. The mRT-PCR assay was found to be a better and rapid virus diagnostic tool of specific barley diseases and potential for investigating the epidemiology of these viral diseases.

Hyperactivity and learning deficits in transgenic mice bearing a human mutant thyroid hormone beta1 receptor gene.

Science.gov (United States)

McDonald, M P; Wong, R; Goldstein, G; Weintraub, B; Cheng, S Y; Crawley, J N

1998-01-01

Resistance to thyroid hormone (RTH) is a human syndrome mapped to the thyroid receptor beta (TRbeta) gene on chromosome 3, representing a mutation of the ligand-binding domain of the TRbeta gene. The syndrome is characterized by reduced tissue responsiveness to thyroid hormone and elevated serum levels of thyroid hormones. A common behavioral phenotype associated with RTH is attention deficit hyperactivity disorder (ADHD). To test the hypothesis that RTH produces attention deficits and/or hyperactivity, transgenic mice expressing a mutant TRbeta gene were generated. The present experiment tested RTH transgenic mice from the PV kindred on behavioral tasks relevant to the primary features of ADHD: hyperactivity, sustained attention (vigilance), learning, and impulsivity. Male transgenic mice showed elevated locomotor activity in an open field compared to male wild-type littermate controls. Both male and female transgenic mice exhibited impaired learning of an autoshaping task, compared to wild-type controls. On a vigilance task in an operant chamber, there were no differences between transgenics and controls on the proportion of hits, response latency, or duration of stimulus tolerated. On an operant go/no-go task measuring sustained attention and impulsivity, there were no differences between controls and transgenics. These results indicate that transgenic mice bearing a mutant human TRbeta gene demonstrate several behavioral characteristics of ADHD and may serve a valuable heuristic role in elucidating possible candidate genes in converging pathways for other causes of ADHD.

Sprouted barley for dairy cows: Nutritional composition and digestibility

Science.gov (United States)

A 4-unit dual-flow continuous culture fermentor system was used to assess the effect of supplementing 7-d sprouted barley or barley grain with an haylage or pasture diet on nutrient digestibility and methane output. Barley grain was sprouted in climate controlled growth chambers, to be used as part ...

COMPARISON OF THE FROST RESISTANCE OF BARLEY ...

African Journals Online (AJOL)

Preferred Customer

immediate recovery of the photosynthetic quantum yield after freezing. Landraces which showed the highest cold tolerance were found to acclimatize best. Key words/phrases: Barley, chlorophyll fluorescence, cold acclimation, Ethiopia, frost tolerance. INTRODUCTION. Barley (Hordeum vulgare L.) is a traditional crop.

The breeding of new malting barley variety 'Yangpi No.2'

International Nuclear Information System (INIS)

Chen Xiulan; He Zhentian; Han Yuepeng; Wang Jinrong; Yang Hefeng

2005-01-01

'Yangpi No.2' barley pasted the examination of Jiangsu province in 2002, is the new spring two-rowed malting barley variety selected by which irradiation mutated the early-maturing of barley. The yield capacity of 'Yangpi No.2' barley is about 6750 kg/hm 2 , it had the characters of early-maturing, good agronomic characters, strong anti-adversity, high quality, and adapted well to everywhere in Jiangsu province. (authors)

A change in radioresistance of barley under chronic irradiation

International Nuclear Information System (INIS)

Kal'chenko, V.A.; Shevchenko, V.A.; Fedotov, I.S.

1981-01-01

Mutation process and radioresistance of barley growing in an area with increased radiation background (beta radiation doss -0.6 R/day) have been analyzed. Experimental material is given with 250 kindred families where aberration level of chromosomes was analyzed in mitosis and meiosis during 4 years. It is shown that the first generations (M 1 -M 2 ) in experimental material demonstrate an increased level of structural mutations of chromosomes, while the subsequent generations (M 3 -M 4 ) demonstrate the level reduced to control. A higher radioresistance is observed in M 5 plants of chronically irradiated version as compared to nonirradiated version. It is suggested that increase in radioresistance results from the stimulation of repair systems with low doses of chronic irradiation as well as from the selection of a more radioresistant forms out of the population [ru

Growth and biomass production with enhanced {beta}-glucan and dietary fibre contents of Ganoderma australe ATHUM 4345 in a batch-stirred tank bioreactor

Energy Technology Data Exchange (ETDEWEB)

Papaspyridi, Lefki-Maria; Christakopoulos, Paul [BIOtechMASS Unit, Biotechnology Laboratory, School of Chemical Engineering, National Technical University of Athens, Athens (Greece); Katapodis, Petros [BIOtechMASS Unit, Biotechnology Laboratory, School of Chemical Engineering, National Technical University of Athens, Athens (Greece); Biotechnology Laboratory, Department of Biological Applications and Technologies, University of Ioannina, Ioannina (Greece); Gonou-Zagou, Zacharoula; Kapsanaki-Gotsi, Evangelia [Department of Ecology and Systematics, Faculty of Biology, National and Kapodistrian University of Athens, Athens (Greece)

2011-02-15

In this study we maximized biomass production by the basidiomycete Ganoderma australe ATHUM 4345, a species of pharmaceutical interest as it is a valuable source of nutraceuticals, including dietary fibers and glucans. We used the Biolog FF MicroPlate to screen 95 different carbon sources for growth monitoring. The pattern of substrate catabolism forms a substrate assimilation fingerprint, which is useful in selecting components for media optimization of maximum biomass production. Response surface methodology, based on the central composite design was applied to explore the optimum concentrations of carbon and nitrogen sources of culture medium in shake flask cultures. When the improved culture medium was tested in a 20-L stirred tank bioreactor, using 13.7 g/L glucose and 30.0 g/L yeast extract, high biomass yields (10.1{+-}0.4 g/L) and productivity of 0.09 g L{sup -1} h{sup -1} were obtained. The yield coefficients for total glucan and dietary fibers on biomass formed were 94.82{+-}6 and 341.15{+-}12.3 mg/g mycelium dry weight, respectively. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Water-soluble low-molecular-weight -(1, 3–1, 6 D-Glucan inhibit cedar pollinosis

Directory of Open Access Journals (Sweden)

Tomoko Jippo

2015-02-01

Full Text Available Background: The incidence of allergic diseases such as allergic rhinitis, atopic dermatitis, asthma, and food allergies has increased in several countries. Mast cells have critical roles in various biologic processes related to allergic diseases. Mast cells express the high-affinity receptor for immunoglobulin (Ig E on their surface. The interaction of multivalent antigens with surface-bound IgE causes the secretion of granule-stored mediators, as well as the de novosynthesis of cytokines. Those mediators and cytokines proceed the allergic diseases. We investigated the effects of water-soluble, low-molecular-weight -(1, 3–1, 6 D-glucan isolated from Aureobasidium pullulans 1A1 strain black yeast (LMW--glucan on mast cell-mediated anaphylactic reactions. We reported that LMW--glucan dose-dependently inhibited the degranulation of mast cells. Furthermore, we found that orally administered LMW--glucan inhibited the IgE-mediated passive cutaneous anaphylaxis (PCA reaction in mice. Here, we examined if LMW--glucan had effects on Japanese cedar pollinosis. Findings: In a clinical study, a randomized, single-blind, placebo-controlled, parallel group study in 65 subjects (aged 2262 was performed. This study was undertaken 3 weeks before and until the end of the cedar pollen season. During the study, all subjects consumed one bottle of placebo or LMW--glucan daily and all subjects were required to record allergic symptoms in a diary. The LMW--glucan group had a significantly lower prevalence of sneezing, nose-blowing, tears, and hindrance to the activities of daily living than the placebo group. Conclusions: These results suggested that LMW--glucan could be an effective treatment for allergic diseases

Extremely thermophilic microorganisms for biomass conversion: status and prospects.

Science.gov (United States)

Blumer-Schuette, Sara E; Kataeva, Irina; Westpheling, Janet; Adams, Michael Ww; Kelly, Robert M

2008-06-01

Many microorganisms that grow at elevated temperatures are able to utilize a variety of carbohydrates pertinent to the conversion of lignocellulosic biomass to bioenergy. The range of substrates utilized depends on growth temperature optimum and biotope. Hyperthermophilic marine archaea (T(opt)>or=80 degrees C) utilize alpha- and beta-linked glucans, such as starch, barley glucan, laminarin, and chitin, while hyperthermophilic marine bacteria (T(opt)>or=80 degrees C) utilize the same glucans as well as hemicellulose, such as xylans and mannans. However, none of these organisms are able to efficiently utilize crystalline cellulose. Among the thermophiles, this ability is limited to a few terrestrial bacteria with upper temperature limits for growth near 75 degrees C. Deconstruction of crystalline cellulose by these extreme thermophiles is achieved by 'free' primary cellulases, which are distinct from those typically associated with large multi-enzyme complexes known as cellulosomes. These primary cellulases also differ from the endoglucanases (referred to here as 'secondary cellulases') reported from marine hyperthermophiles that show only weak activity toward cellulose. Many extremely thermophilic enzymes implicated in the deconstruction of lignocellulose can be identified in genome sequences, and many more promising biocatalysts probably remain annotated as 'hypothetical proteins'. Characterization of these enzymes will require intensive effort but is likely to generate new opportunities for the use of renewable resources as biofuels.

Concentrated oat β-glucan, a fermentable fiber, lowers serum cholesterol in hypercholesterolemic adults in a randomized controlled trial

Directory of Open Access Journals (Sweden)

Fulcher R Gary

2007-03-01

Full Text Available Abstract Background Soluble fibers lower serum lipids, but are difficult to incorporate into products acceptable to consumers. We investigated the physiological effects of a concentrated oat β-glucan on cardiovascular disease (CVD endpoints in human subjects. We also compared the fermentability of concentrated oat β-glucan with inulin and guar gum in a model intestinal fermentation system. Methods Seventy-five hypercholesterolemic men and women were randomly assigned to one of two treatments: 6 grams/day concentrated oat β-glucan or 6 grams/day dextrose (control. Fasting blood samples were collected at baseline, week 3, and week 6 and analyzed for total cholesterol, HDL cholesterol, LDL cholesterol, triglycerides, glucose, insulin, homocysteine and C-reactive protein (CRP. To estimate colonic fermentability, 0.5 g concentrated oat β-glucan was incubated in a batch model intestinal fermentation system, using human fecal inoculum to provide representative microflora. Fecal donors were not involved with the β-glucan feeding trial. Inulin and guar gum were also incubated in separate serum bottles for comparison. Results Oat β-glucan produced significant reduction from baseline in total cholesterol (-0.3 ± 0.1 mmol/L and LDL cholesterol (-0.3 ± 0.1 mmol/L, and the reduction in LDL cholesterol were significantly greater than in the control group (p = 0.03. Concentrated oat β-glucan was a fermentable fiber and produced total SCFA and acetate concentrations similar to inulin and guar gum. Concentrated oat β-glucan produced the highest concentrations of butyrate at 4, 8, and 12 hours. Conclusion Six grams concentrated oat β-glucan per day for six weeks significantly reduced total and LDL cholesterol in subjects with elevated cholesterol, and the LDL cholesterol reduction was greater than the change in the control group. Based on a model intestinal fermentation, this oat β-glucan was fermentable, producing higher amounts of butyrate than other

The Role of Yeast Beta Glucan on Blood Coagulation in Streptozotocin-Induced Diabetes and Irradiated Rats

International Nuclear Information System (INIS)

El-Kashoury, M.M.A.; Abdel Fattah, S.M.; Ramadan, L.A.; El-Denshary, E.S.

2016-01-01

Clotting abnormalities are observed after exposure to ionizing radiation as well as in diabetes melittus. The objective of this study is to elucidate the role of yeast beta glucan (YBG) in the modulation of some biochemical variations observed in γ-irradiated, diabetic and diabeticγγ-irradiated rats. Gamma-irradiation was performed through the whole body exposure of rats to 6 Gy administered in four fractions of 1.5 Gy two times per week for two weeks. Diabetes was induced by a single intraperitoneal injection of streptozotocin (55 mg/kg body weight). YBG was given orally to male albino rats (1 g/kg body weight) for two weeks post irradiation and/or induction of diabetes. Animals were divided into 4 main groups: 1- control, 2- γ-irradiated, 3- diabetic and 4- diabetic-γ-irradiated rats. Each group was subdivided into 2 subgroups (a) untreated and (b) treated. The 3rd and 14th day, after the last dose of radiation in the irradiated groups and after the induction of diabetes in diabetic groups, were chosen to evaluate the effect of oral YBG in irradiated and/or diabetic rats. The results revealed that the body weight decreased significantly in irradiated, diabetic and diabetic–irradiated rats. The loss of weight was accompanied by a reduction in the pancreas weight. Glucose concentration was significantly increased in diabetic group at the two time intervals. It is worth noting that, radiation ameliorated blood glucose level in diabetic-γ-irradiated group. Radiation exposure and/or diabetes caused an oxidative stress manifested by a significant increase of malondialdhyde (MDA) accompanied by a significant decrease in glutathione (GSH) level. This oxidative stress caused disturbances in the measured clotting parameters by enhancing platelet aggregation (PA) induced by arachidonic acid and increased thrombin level as concluded from the significant shortening of prothrombin time (PT) and activated partial thromboplastin time (APTT). Also, exposure to radiation

Oligosaccharide binding to barley alpha-amylase 1

DEFF Research Database (Denmark)

Robert, X.; Haser, R.; Mori, H.

2005-01-01

Enzymatic subsite mapping earlier predicted 10 binding subsites in the active site substrate binding cleft of barley alpha-amylase isozymes. The three-dimensional structures of the oligosaccharide complexes with barley alpha-amylase isozyme 1 (AMY1) described here give for the first time a thorough...... in barley alpha-amylase isozyme 2 (AMY2), and the sugar binding modes are compared between the two isozymes. The "sugar tongs" surface binding site discovered in the AMY1-thio-DP4 complex is confirmed in the present work. A site that putatively serves as an entrance for the substrate to the active site...

Barley HvPAPhy_a as transgene provides high and stable phytase activities in mature barley straw and in grains

DEFF Research Database (Denmark)

Holme, Inger; Dionisio, Giuseppe; Madsen, Claus Krogh

2017-01-01

The phytase purple acid phosphatase (HvPAPhy_a) expressed during barley seed development was evaluated as transgene for overexpression in barley. The phytase was expressed constitutively driven by the cauliflower mosaic virus 35S-promoter, and the phytase activity was measured in the mature grains......, the green leaves and in the dry mature vegetative plant parts left after harvest of the grains. The T2-generation of HvPAPhy_a transformed barley showed phytase activity increases up to 19-fold (29 000 phytase units (FTU) per kg in mature grains). Moreover, also in green leaves and mature dry straw, phytase...... activities were increased significantly by 110-fold (52 000 FTU/kg) and 57-fold (51 000 FTU/kg), respectively. The HvPAPhy_a-transformed barley plants with high phytase activities possess triple potential utilities for the improvement of phosphate bioavailability. First of all, the utilization of the mature...

An ATP-binding cassette subfamily G full transporter is essential for the retention of leaf water in both wild barley and rice.

Science.gov (United States)

Chen, Guoxiong; Komatsuda, Takao; Ma, Jian Feng; Nawrath, Christiane; Pourkheirandish, Mohammad; Tagiri, Akemi; Hu, Yin-Gang; Sameri, Mohammad; Li, Xinrong; Zhao, Xin; Liu, Yubing; Li, Chao; Ma, Xiaoying; Wang, Aidong; Nair, Sudha; Wang, Ning; Miyao, Akio; Sakuma, Shun; Yamaji, Naoki; Zheng, Xiuting; Nevo, Eviatar

2011-07-26

Land plants have developed a cuticle preventing uncontrolled water loss. Here we report that an ATP-binding cassette (ABC) subfamily G (ABCG) full transporter is required for leaf water conservation in both wild barley and rice. A spontaneous mutation, eibi1.b, in wild barley has a low capacity to retain leaf water, a phenotype associated with reduced cutin deposition and a thin cuticle. Map-based cloning revealed that Eibi1 encodes an HvABCG31 full transporter. The gene was highly expressed in the elongation zone of a growing leaf (the site of cutin synthesis), and its gene product also was localized in developing, but not in mature tissue. A de novo wild barley mutant named "eibi1.c," along with two transposon insertion lines of rice mutated in the ortholog of HvABCG31 also were unable to restrict water loss from detached leaves. HvABCG31 is hypothesized to function as a transporter involved in cutin formation. Homologs of HvABCG31 were found in green algae, moss, and lycopods, indicating that this full transporter is highly conserved in the evolution of land plants.

Specific binding of a fungal glucan phytoalexin elicitor to membrane fractions from soybean Glycine max

International Nuclear Information System (INIS)

Schmidt, W.E.; Ebel, J.

1987-01-01

Treatment of soybean tissues with elicitors results in the production of phytoalexins, one of a number of inducible plant defense reactions against microbial infections. The present study uses a β-1,3-[ 3 H] glucan elicitor fraction from Phytophthora megasperma f.sp. glycinea, a fungal pathogen of soybean, to identify putative elicitor targets in soybean tissues. Use of the radiolabeled elicitor disclosed saturable high-affinity elicitor binding site(s) in membrane fractions of soybean roots. Highest binding activity is associated with a plasma membrane-enriched fraction. The apparent K/sub d/ value for β-glucan elicitor binding is ≅ 0.2 x 10 -6 M and the maximum number of binding sites is 0.5 pmol per mg of protein. Competition studies the [ 3 H]glucan elicitor and a number of polysaccharides demonstrate that only polysaccharides of a branched β-glucan type effectively displace the radiolabeled ligand from membrane binding. Differential displacing activity of the glucans on P. megasperma elicitor binding corresponds closely to their respective ability to elicit phytoalexin production in a cotyledon bioassay

Utilization of Mutagenic Treatments for Improving Barley Disease Resistance to Powdery Mildew

International Nuclear Information System (INIS)

Amer, M.; Fahim, M.M.; Moustafa, N.A.

2008-01-01

This program aims to improve barley (Hordeum vulgar L.) resistance to powdery mildew (Erysiphe graminis f. sp. hordi) using mutation induction technique via physical and chemical mutagens. Grains of two local cultivars were treated with gamma rays (150, 250 GY) at a dose rate of 9.02 Rad/ Sec alone or with the concentrations of chemical mutagens, i.e.,EMS (4 and 8 mM), MH (10 and 20 mM) for two hours. After mass selection for the resistance in M2, the two cultivars were varied in their responses to the fifteen treatments. In M3 generation, the frequencies of plant resistance were increased at 20 mM of MH, 8 mM of EMS or 250 GY with either of them for the cultivar G124. However, the same trend was also found at 10 mM of MH, 250GY alone and with 4 or 8 mM EMS for cultivar G125. Moreover, eight mutants were selected from the progenies of M4 plants and evaluated in M5 generation. These mutants are characterized by highly disease resistance and high yield components, one of them has been characterized by non crytics and awnless .The desirable mutants should go to further evaluation for grain yield and grain quality in subsequent generations. (author)

Structural lability of Barley stripe mosaic virus virions.

Directory of Open Access Journals (Sweden)

Valentin V Makarov

Full Text Available Virions of Barley stripe mosaic virus (BSMV were neglected for more than thirty years after their basic properties were determined. In this paper, the physicochemical characteristics of BSMV virions and virion-derived viral capsid protein (CP were analyzed, namely, the absorption and intrinsic fluorescence spectra, circular dichroism spectra, differential scanning calorimetry curves, and size distributions by dynamic laser light scattering. The structural properties of BSMV virions proved to be intermediate between those of Tobacco mosaic virus (TMV, a well-characterized virus with rigid rod-shaped virions, and flexuous filamentous plant viruses. The BSMV virions were found to be considerably more labile than expected from their rod-like morphology and a distant sequence relation of the BSMV and TMV CPs. The circular dichroism spectra of BSMV CP subunits incorporated into the virions, but not subunits of free CP, demonstrated a significant proportion of beta-structure elements, which were proposed to be localized mostly in the protein regions exposed on the virion outer surface. These beta-structure elements likely formed during virion assembly can comprise the N- and C-terminal protein regions unstructured in the non-virion CP and can mediate inter-subunit interactions. Based on computer-assisted structure modeling, a model for BSMV CP subunit structural fold compliant with the available experimental data was proposed.

Endoproteolytic activity assay in malting barley

Directory of Open Access Journals (Sweden)

Blanca Gómez Guerrero

2013-12-01

Full Text Available Hydrolysis of barley proteins into peptides and amino acids is one of the most important processes during barley germination.The degradation of the endosperm stored proteins facilitates water and enzyme movements, enhances modification, liberates starch granules and increases soluble amino nitrogen. Protease activity is the result of the activities of a mixture of exo- and endo-proteases. The barley proteins are initially solubilized by endo-proteases and the further by exo-proteases. Four classes of endo-proteases have been described: serine-proteases, cysteine-proteases, aspartic-proteases and metallo-proteases. The objective of this work was to develop a rapid and colorimetric enzymatic assay to determine the endo-proteolytic activity of the four endo-protease classes using two different substrates: azo-gelatin and azo-casein. Optimum conditions for the assays such as: pH,reaction time and temperature and absorbance scale were determined. Azo-gelatin presented several difficulties in standardizing an “in solution” assay. On the other hand, azo-casein allowed standardization of the assay for the four enzyme classes to produce consistent results. The endo-proteoteolytic method developed was applied to determine the endo-protease activity in barley, malt and wort.

A food additive with prebiotic properties of an α-d-glucan from lactobacillus plantarum DM5.

Science.gov (United States)

Das, Deeplina; Baruah, Rwivoo; Goyal, Arun

2014-08-01

An α-d-glucan produced by Lactobacillus plantarum DM5 was explored for in vitro prebiotic activities. Glucan-DM5 demonstrated 21.6% solubility, 316.9% water holding capacity, 86.2% flocculation activity, 71.4% emulsification activity and a degradation temperature (Td) of 292.2°C. Glucan-DM5 exhibited lowest digestibility of 0.54% by artificial gastric juice, 0.21% by intestinal fluid and 0.32% by α-amylase whereas the standard prebiotic inulin, showed 25.23%, 5.97% and 19.13%, hydrolysis, respectively. Prebiotic activity assay of glucan-DM5 displayed increased growth of probiotic bacteria such as Bifidobacterium infantis and Lactobacillus acidophilus, but did not support the growth of non-probiotic bacteria such as Escherichia coli and Enterobacter aerogenes. The overall findings indicated that glucan from L. plantarum DM5 can serve as a potential prebiotic additive for food products. Copyright © 2014 Elsevier B.V. All rights reserved.

Long-lived effects of administering β-glucans

NARCIS (Netherlands)

Petit, Jules; Wiegertjes, Geert F.

2016-01-01

Over the past decades, it has become evident that immune-modulation of fish with β-glucans, using injection, dietary or even immersion routes of administration, has stimulating but presumed short-lived effects on both intestinal and systemic immunity and can increase protection against a

Effect of purified oat ß-glucan on fermentation of set-style yogurt mix

Science.gov (United States)

Effect of ß-glucan on the fermentation of set-style yogurt was investigated by incorporating 0, 0.1, 0.2, 0.3, 0.4, and 0.5% of ß-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of ß-gluca...

Dietary β-glucan enhances the contents of complement component 3 and factor B in eggs of zebrafish.

Science.gov (United States)

Jiang, Chengyan; Wang, Peng; Li, Mengyang; Liu, Shousheng; Zhang, Shicui

2016-12-01

β-glucan has been shown to increase non-specific immunity and resistance against infections or pathogenic bacteria in several fish species, but no information is available regarding its trans-generational effects to date. Here we clearly demonstrated that β-glucan enhanced the contents of immune-relevant molecules C3 and Bf in eggs of zebrafish, and the embryos derived from β-1,3 glucan-treated zebrafish were more resistant to bacterial challenge than control embryos. Moreover, the transferred C3 and Bf were directly associated with the antimicrobial defense of early embryos. In addition, feeding female zebrafish with β-glucan had little detrimental effects on the number of spawned eggs and their embryonic development. Collectively, these data show for the first time that β-glucan can be safely used to promote the non-specific immunity in offspring of fishes. Copyright © 2016 Elsevier Ltd. All rights reserved.

Conserved Transcriptional Regulatory Programs Underlying Rice and Barley Germination

Science.gov (United States)

Lin, Li; Tian, Shulan; Kaeppler, Shawn; Liu, Zongrang; An, Yong-Qiang (Charles)

2014-01-01

Germination is a biological process important to plant development and agricultural production. Barley and rice diverged 50 million years ago, but share a similar germination process. To gain insight into the conservation of their underlying gene regulatory programs, we compared transcriptomes of barley and rice at start, middle and end points of germination, and revealed that germination regulated barley and rice genes (BRs) diverged significantly in expression patterns and/or protein sequences. However, BRs with higher protein sequence similarity tended to have more conserved expression patterns. We identified and characterized 316 sets of conserved barley and rice genes (cBRs) with high similarity in both protein sequences and expression patterns, and provided a comprehensive depiction of the transcriptional regulatory program conserved in barley and rice germination at gene, pathway and systems levels. The cBRs encoded proteins involved in a variety of biological pathways and had a wide range of expression patterns. The cBRs encoding key regulatory components in signaling pathways often had diverse expression patterns. Early germination up-regulation of cell wall metabolic pathway and peroxidases, and late germination up-regulation of chromatin structure and remodeling pathways were conserved in both barley and rice. Protein sequence and expression pattern of a gene change quickly if it is not subjected to a functional constraint. Preserving germination-regulated expression patterns and protein sequences of those cBRs for 50 million years strongly suggests that the cBRs are functionally significant and equivalent in germination, and contribute to the ancient characteristics of germination preserved in barley and rice. The functional significance and equivalence of the cBR genes predicted here can serve as a foundation to further characterize their biological functions and facilitate bridging rice and barley germination research with greater confidence. PMID

Characterization of volatile aroma compounds in different brewing barley cultivars.

Science.gov (United States)

Dong, Liang; Hou, Yingmin; Li, Feng; Piao, Yongzhe; Zhang, Xiao; Zhang, Xiaoyu; Li, Cheng; Zhao, Changxin

2015-03-30

Beer is a popular alcoholic malt beverage resulting from fermentation of the aqueous extract of malted barley with hops. The aroma of brewing barley impacts the flavor of beer indirectly, because some flavor compounds or their precursors in beer come from the barley. The objectives of this research were to study volatile profiles and to characterize odor-active compounds of brewing barley in order to determine the variability of the aroma composition among different brewing barley cultivars. Forty-one volatiles comprising aldehydes, ketones, alcohols, organic acids, aromatic compounds and furans were identified using solid phase microextraction combined with gas chromatography/mass spectrometry, among which aldehydes, alcohols and ketones were quantitatively in greatest abundance. Quantitative measurements performed by means of solvent extraction and calculation of odor activity values revealed that acetaldehyde, 2-methylpropanal, 3-methylbutanal, 2-methylbutanal, hexanal, heptanal, octanal, nonanal, 3-methyl-1-butanol, cyclopentanol, 2,3-butanedione, 2,3-pentanedione, 2-heptanone, acetic acid, ethyl acetate, 2-pentylfuran and benzeneacetaldehyde, whose concentrations exceeded their odor thresholds, could be considered as odor-active compounds of brewing barley. Principal component analysis was employed to evaluate the differences among cultivars. The results demonstrated that the volatile profile based on the concentrations of aroma compounds enabled good differentiation of most barley cultivars. © 2014 Society of Chemical Industry.

γ-ray radiation decontamination of barley plant powder

International Nuclear Information System (INIS)

Zhao Xiaojun; Fu Junjie; Wang Zhiping; Zhang Guobin

2007-01-01

Radiation decontamination of barley plant powder by 60 Co γ-rays and the effect on its components were studied. Results showed that irradiation was very effective in killing the microorganisms in barley plant powder. The irradiation did not cause obvious changes of the major components of protein, total sugar, free amino acid, crude fiber, but 35% loss of vitamin E was observed after 10kGy irradiation. It is suggested that 7.5-10kGy irradiation is good enough for decontamination of the barley plant powder. (authors)

Mutational analysis of target enzyme recognition of the beta-trefoil fold barley alpha-amylase/subtilisin inhibitor

DEFF Research Database (Denmark)

Bønsager, Birgit Christine; Nielsen, Per K.; Abou Hachem, Maher

2005-01-01

The barley alpha-amylase/subtilisin inhibitor ( BASI) inhibits alpha-amylase 2 (AMY2) with subnanomolar affinity. The contribution of selected side chains of BASI to this high affinity is discerned in this study, and binding to other targets is investigated. Seven BASI residues along the AMY2-BASI...... interface and four residues in the putative protease-binding loop on the opposite side of the inhibitor were mutated. A total of 15 variants were compared with the wild type by monitoring the alpha-amylase and protease inhibitory activities using Blue Starch and azoalbumin, respectively, and the kinetics...

Substitution of wheat dried distillers grains with solubles for barley grain or barley silage in feedlot cattle diets: intake, digestibility, and ruminal fermentation.

Science.gov (United States)

Li, Y L; McAllister, T A; Beauchemin, K A; He, M L; McKinnon, J J; Yang, W Z

2011-08-01

The objective of this study was to evaluate the effects of substituting wheat dried distillers grains with solubles (DDGS) for barley grain and barley silage on intake, digestibility, and ruminal fermentation in feedlot beef cattle. Eight ruminally cannulated Angus heifers (initial BW 455 ± 10.8 kg) were assigned to a replicated 4 × 4 Latin square design with 4 treatments: control, low (25%), medium (30%), and high (35%) wheat DDGS (DM basis). The diets consisted of barley silage, barley concentrate, and wheat DDGS in ratios of 15:85:0 (CON), 10:65:25 (25DDGS), 5:65:30 (30DDGS), and 0:65:35 (35DDGS; DM basis), respectively. The diets were formulated such that wheat DDGS was substituted for both barley grain and barley silage to evaluate whether wheat DDGS can be fed as a source of both energy (grain) and fiber in feedlot finishing diets. Intakes (kg/d) of DM and OM were not different, whereas those of CP, NDF, ADF, and ether extract (EE) were greater (P Ruminal pH and total VFA concentrations were not different (P > 0.15) between 25DDGS and CON diets. Replacing barley silage with increasing amounts of wheat DDGS (i.e., from 25DDGS to 35DDGS) linearly reduced (P ruminal pH tended (P=0.10) to linearly decrease, and ruminal pH status decreased with longer (P=0.04) duration of pH 0.19) ruminal VFA and NH(3)-N concentrations. Results indicated that wheat DDGS can be effectively used to replace both barley grain and silage at a moderate amount to meet energy and fiber requirements of finishing cattle. However, when silage content of the diet is low (ruminal pH status even though the rapidly fermentable starch content of the diet is considerably reduced. © 2011 American Society of Animal Science. All rights reserved.

Extracellular cell wall β(1,3)glucan is required to couple septation to actomyosin ring contraction

Science.gov (United States)

Muñoz, Javier; Cortés, Juan Carlos G.; Sipiczki, Matthias; Ramos, Mariona; Clemente-Ramos, José Angel; Moreno, M. Belén; Martins, Ivone M.; Pérez, Pilar

2013-01-01

Cytokinesis has been extensively studied in different models, but the role of the extracellular cell wall is less understood. Here we studied this process in fission yeast. The essential protein Bgs4 synthesizes the main cell wall β(1,3)glucan. We show that Bgs4-derived β(1,3)glucan is required for correct and stable actomyosin ring positioning in the cell middle, before the start of septum formation and anchorage to the cell wall. Consequently, β(1,3)glucan loss generated ring sliding, oblique positioned rings and septa, misdirected septum synthesis indicative of relaxed rings, and uncoupling between a fast ring and membrane ingression and slow septum synthesis, suggesting that cytokinesis can progress with defective septum pushing and/or ring pulling forces. Moreover, Bgs4-derived β(1,3)glucan is essential for secondary septum formation and correct primary septum completion. Therefore, our results show that extracellular β(1,3)glucan is required for cytokinesis to connect the cell wall with the plasma membrane and for contractile ring function, as proposed for the equivalent extracellular matrix in animal cells. PMID:24165938

Arabidopsis thaliana AMY3 Is a Unique Redox-regulated Chloroplastic α-Amylase

DEFF Research Database (Denmark)

Seung, David; Thalmann, Matthias; Sparla, Francesca

2013-01-01

α-Amylases are glucan hydrolases that cleave α-1,4-glucosidic bonds in starch. In vascular plants, α-amylases can be classified into three subfamilies. Arabidopsis has one member of each subfamily. Among them, only AtAMY3 is localized in the chloroplast. We expressed and purified AtAMY3 from...... to be dependent on a conserved aspartic acid residue (Asp666), identified as the catalytic nucleophile in other plant α-amylases such as the barley AMY1. AtAMY3 released small linear and branched glucans from Arabidopsis starch granules, and the proportion of branched glucans increased after the predigestion...

Effect of pH and Recombinant Barley (Hordeum vulgare L.) Endoprotease B2 on Degradation of Proteins in Soaked Barley

DEFF Research Database (Denmark)

Christensen, Jesper Bjerg; Dionisio, Giuseppe; Poulsen, Hanne Damgaard

2014-01-01

.3. Solubilized and degraded proteins evaluated by biuret, SDS-PAGE, and differential proteomics revealed that pH 4.3 had the greatest impact on both solubilization and degradation. In order to boost proteolysis, the recombinant barley endoprotease B2 (rec-HvEP-B2) was included after 8 h using the pH 4.3 regime......Nonfermented soaking of barley feedstuff has been established as an in vitro procedure prior to the feeding of pigs as it can increase protein digestibility. In the current study, two feed cultivars of barley (Finlissa and Zephyr) were soaked in vitro either nonbuffered or buffered at pH 3.6 and 4....... Proteolysis evaluated by SDS-PAGE and differential proteomics confirmed a powerful effect of adding rec-HvEP-B2 to the soaked barley, regardless of the genotype. Our study addresses the use of rec-HvEP-B2 as an effective feed enzyme protease. HvEP-B2 has the potential to increase the digestibility of protein...

Fiber and nonstarch polysaccharide content and variation in common crops used in broiler diets.

Science.gov (United States)

Knudsen, Knud Erik Bach

2014-09-01

The current paper reviews content and variation in fiber and nonstarch polysaccharides (NSP) of common crops used in broiler diets. The cereal grain is a complex structure, and its cell walls (CW) differ in their composition and hence properties. Arabinoxylan (AX), mixed linkage (1→3; 1→4)-β-glucan (β-glucan), cellulose, and the noncarbohydrate component lignin are the predominant polymers in cereals. They occur in different proportions depending on the species and tissue type. Rye, triticale, wheat, corn, and sorghum are all rich in AX, whereas barley and oats contain a high level of β-glucan. The AX from rye, wheat, and triticale and β-glucan from barley and oats are to a large extent soluble, whereas the solubility of AX found in corn and sorghum is lower than the other cereals. The ratio of arabinose to xylose gives a crude indication of the AX structure, which varies between the endosperm, the aleurone and the outer grain layers as well as between the same tissues from different grains. Varietal differences in AX structure of the endosperm are also identified. From the analysis of the released oligomers after hydrolysis with a specific (1→3,1→4)-β-d-glucan hydrolase, it is found that the ratio of trisaccharides (degree of polymerization 3) and tetrasaccharides (degree of polymerization 4) varies depending on the source, being higher in barley than in oats but lower than in wheat. The molecular weight of β-glucan is higher than that of AX, and both polymers contribute to the viscosity of the extract. However, because AX molecules are more resistant to degradation than β-glucan, the use of AX rich grains in broiler diets is usually more problematic than those containing high concentrations of β-glucan. The cereal coproducts (brans and hulls) are concentrated sources of cellulose, lignin, and insoluble AX, but β-glucan can also be present mainly in rye and wheat brans. The CW composition of seeds and grains of protein crops and feedstuffs are

Beta1 integrins regulate chondrocyte rotation, G1 progression, and cytokinesis

DEFF Research Database (Denmark)

Aszodi, Attila; Hunziker, Ernst B; Brakebusch, Cord

2003-01-01

Beta1 integrins are highly expressed on chondrocytes, where they mediate adhesion to cartilage matrix proteins. To assess the functions of beta1 integrin during skeletogenesis, we inactivated the beta1 integrin gene in chondrocytes. We show here that these mutant mice develop a chondrodysplasia...... of various severity. beta1-deficient chondrocytes had an abnormal shape and failed to arrange into columns in the growth plate. This is caused by a lack of motility, which is in turn caused by a loss of adhesion to collagen type II, reduced binding to and impaired spreading on fibronectin, and an abnormal F......-actin organization. In addition, mutant chondrocytes show decreased proliferation caused by a defect in G1/S transition and cytokinesis. The G1/S defect is, at least partially, caused by overexpression of Fgfr3, nuclear translocation of Stat1/Stat5a, and up-regulation of the cell cycle inhibitors p16 and p21...

Synthetic alleles at position 121 define a functional domain of human interleukin-1 beta.

Science.gov (United States)

Ambrosetti, D C; Palla, E; Mirtella, A; Galeotti, C; Solito, E; Navarra, P; Parente, L; Melli, M

1996-06-01

The non-conservative substitution of the tyrosine residue at position 121 of human interleukin-1 beta (IL-1 beta) generates protein mutants showing strong reduction of the capacity to induce (a) prostaglandin E2 (PGE2) release from fibroblasts and smooth muscle cells, (b) murine T-cells proliferation and (c) activation of interleukin-6 (IL-6) gene expression. It is generally accepted that these functions are mediated by the type-I interleukin-1 receptor (IL-1RI). However, the mutant proteins maintain the binding affinity to the types-I and II IL-1 receptors, which is the same as the control IL-1 beta, suggesting that this amino acid substitution does not alter the structure of the molecule, except locally. Thus we have identified a new functional site of IL-1 beta different from the known receptor binding region, responsible for fundamental IL-1 beta functions. Moreover, we show that the same mutants maintain at least two hypothalamic functions, that is, the in vitro short-term PGE2 release from rat hypothalamus and the induction of fever in rabbits. This result suggests that there is yet another site of the molecule responsible for the hypothalamic functions, implying that multiple active sites on the IL-1 beta molecule, possibly binding to more than one receptor chain, trigger different signals.

Barley starch bioengineering for high phosphate and amylose

DEFF Research Database (Denmark)

Blennow, Per Gunnar Andreas; Carciofi, Massimiliano; Shaik, Shahnoor Sultana

2011-01-01

Starch is a biological polymer that can be industrially produced in massive amounts in a very pure form. Cereals is the main source for starch production and any improvement of the starch fraction can have a tremendous impact in food and feed applications. Barley ranks number four among cereal...... crops and barley is a genetically very well characterized. Aiming at producing new starch qualities in the cereal system, we used RNAi and overexpression strategies to produce pure amylose and high-phosphate starch, respectively, using the barley kernel as a polymer factory. By simultaneous silencing...... of the three genes encoding the starch-branching enzymes SBEI, SBEIIa, and SBEIIb using a triple RNAi chimeric hairpin construct we generated a virtually amylopectin-free barley. The grains of the transgenic lines were shrunken and had a yield of around 80% of the control line. The starch granules were...

CISH has no non-redundant functions in glucose homeostasis or beta cell proliferation during pregnancy in mice.

Science.gov (United States)

Jiao, Yang; Rieck, Sebastian; Le Lay, John; Kaestner, Klaus H

2013-11-01

Increased beta cell proliferation during pregnancy is mediated by the Janus kinase 2/signal transducer and activator of transcription 5 (JAK2/STAT5) signalling pathway in response to increased lactogen levels. Activation of the pathway leads to transcriptional upregulation of Cish (encoding cytokine-inducible SH2 domain-containing protein), a member of the suppressor of cytokine signalling (SOCS) family of genes, forming a negative-feedback loop. Here, we examined whether conditional gene ablation of Cish in the pancreas improves beta cell proliferation and beta cell function during pregnancy in mice. We derived mice with a novel, conditional loxP allele for Cish. Pancreas-specific ablation of Cish was achieved by crossing Cish (loxP/loxP) mice with Pdx1-Cre (Early) mice. Beta cell proliferation was quantified by BrdU labelling. Glucose homeostasis was examined with glucose tolerance tests and determination of plasma insulin levels. The expression of other Socs genes and target genes of p-STAT5 related to beta cell function and beta cell proliferation was determined by quantitative PCR. There was no difference in beta cell proliferation or glucose homeostasis between the Cish mutant group and the control group. The p-STAT5 protein level was the same in Cish mutant and control mice. Socs2 gene expression was higher in Cish mutant than control mice at pregnancy day 9.5. The expression of other Socs genes was the same between control and mutant mice. Our results show that CISH has no non-redundant functions in beta cell proliferation or glucose homeostasis during pregnancy in mice. Socs2 might compensate for the loss of Cish during pregnancy.

A high throughput colorimetric assay of β-1,3-D-glucans by Congo red dye.

Science.gov (United States)

Semedo, Magda C; Karmali, Amin; Fonseca, Luís

2015-02-01

Mushroom strains contain complex nutritional biomolecules with a wide spectrum of therapeutic and prophylactic properties. Among these compounds, β-d-glucans play an important role in immuno-modulating and anti-tumor activities. The present work involves a novel colorimetric assay method for β-1,3-d-glucans with a triple helix tertiary structure by using Congo red. The specific interaction that occurs between Congo red and β-1,3-d-glucan was detected by bathochromic shift from 488 to 516 nm (>20 nm) in UV-Vis spectrophotometer. A micro- and high throughput method based on a 96-well microtiter plate was devised which presents several advantages over the published methods since it requires only 1.51 μg of polysaccharides in samples, greater sensitivity, speed, assay of many samples and very cheap. β-D-Glucans of several mushrooms (i.e., Coriolus versicolor, Ganoderma lucidum, Pleurotus ostreatus, Ganoderma carnosum, Hericium erinaceus, Lentinula edodes, Inonotus obliquus, Auricularia auricular, Polyporus umbellatus, Cordyseps sinensis, Agaricus blazei, Poria cocos) were isolated by using a sequence of several extractions with cold and boiling water, acidic and alkaline conditions and quantified by this microtiter plate method. FTIR spectroscopy was used to study the structural features of β-1,3-D-glucans in these mushroom samples as well as the specific interaction of these polysaccharides with Congo red. The effect of NaOH on triple helix conformation of β-1,3-D-glucans was investigated in several mushroom species. Copyright © 2014 Elsevier B.V. All rights reserved.

β-1,3-Glucan, Which Can Be Targeted by Drugs, Forms a Trabecular Scaffold in the Oocyst Walls of Toxoplasma and Eimeria

Science.gov (United States)

Bushkin, G. Guy; Motari, Edwin; Magnelli, Paula; Gubbels, Marc-Jan; Dubey, Jitender P.; Miska, Katarzyna B.; Bullitt, Esther; Costello, Catherine E.; Robbins, Phillips W.; Samuelson, John

2012-01-01

ABSTRACT The walls of infectious pathogens, which are essential for transmission, pathogenesis, and diagnosis, contain sugar polymers that are defining structural features, e.g., β-1,3-glucan and chitin in fungi, chitin in Entamoeba cysts, β-1,3-GalNAc in Giardia cysts, and peptidoglycans in bacteria. The goal here was to determine in which of three walled forms of Toxoplasma gondii (oocyst, sporocyst, or tissue cyst) is β-1,3-glucan, the product of glucan synthases and glucan hydrolases predicted by whole-genome sequences of the parasite. The three most important discoveries were as follows. (i) β-1,3-glucan is present in oocyst walls of Toxoplasma and Eimeria (a chicken parasite that is a model for intestinal stages of Toxoplasma) but is absent from sporocyst and tissue cyst walls. (ii) Fibrils of β-1,3-glucan are part of a trabecular scaffold in the inner layer of the oocyst wall, which also includes a glucan hydrolase that has a novel glucan-binding domain. (iii) Echinocandins, which target the glucan synthase and kill fungi, arrest development of the Eimeria oocyst wall and prevent release of the parasites into the intestinal lumen. In summary, β-1,3-glucan, which can be targeted by drugs, is an important component of oocyst walls of Toxoplasma but is not a component of sporocyst and tissue cyst walls. PMID:23015739

Including indigestible carbohydrates in the evening meal of healthy subjects improves glucose tolerance, lowers inflammatory markers, and increases satiety after a subsequent standardized breakfast

DEFF Research Database (Denmark)

Nilsson, A.C.; Ostman, E.M.; Holst, Jens Juul

2008-01-01

Low-glycemic index (GI) foods and foods rich in whole grain are associated with reduced risk of type 2 diabetes and cardiovascular disease. We studied the effect of cereal-based bread evening meals (50 g available starch), varying in GI and content of indigestible carbohydrates, on glucose...... tolerance and related variables after a subsequent standardized breakfast in healthy subjects (n = 15). At breakfast, blood was sampled for 3 h for analysis of blood glucose, serum insulin, serum FFA, serum triacylglycerides, plasma glucagon, plasma gastric-inhibitory peptide, plasma glucagon-like peptide-1...... based bread (ordinary, high-amylose- or beta-glucan-rich genotypes) or an evening meal with white wheat flour bread (WWB) enriched with a mixture of barley fiber and resistant starch improved glucose tolerance at the subsequent breakfast compared with unsupplemented WWB (P

Molecular characterization and genetic diversity analysis β-glucan content variability in grain of oat (Avena sativa L.

Directory of Open Access Journals (Sweden)

Đukić Nevena H.

2014-01-01

Full Text Available In grain of ten genetically divergent oat cultivars (Merkur, Minor Abed, Flaming-Kurz, Nuptiele, Prode, Pellerva, Emperor, Astor, Osmo, Simo the variability β-glucan content were investigated. The different value of content of β-glucan was found. Among analyzed oat cultivars, the highest β- glucan contents had Pellerva (6.597%, while the least had Simo (2.971%. The contents of β-glucans were determined by ICC standard Method No 168. The value of β-glucans varied and indicated the differences and similarities between analysed cultivars. The degree of cultivar similarity was determined by dendrogram on which was discriminated two clusters of similar cultivars toward to contents of β-glucan . Within cluster 1, a small group of oats, are five cultivars with small distance (Merkur, Minor Abed, Flamings-Kurz, Nuptiele and Prode. The highest similarity in the range of 88 or the least distance in the range of 12. Within cluster 2 was four oat cultivars (Emperor, Astor, Osmo, Pellerva in which the least differences was between Emperor and Astor with average distance in range 27. Cluster 1 and cluster 2 differed with an average distance of 63. The cultivar Simo expressed the greatest distance to all analysed oat cultivars grouped in two clusters. [Projekat Ministarstva nauke Republike Srbije, br. TR 31092

Anti-tumor effects of (1→3)-β-d-glucan from Saccharomyces cerevisiae in S180 tumor-bearing mice.

Science.gov (United States)

Mo, Li; Chen, Yafei; Li, Wenjian; Guo, Shuai; Wang, Xuzhao; An, Hailong; Zhan, Yong

2017-02-01

(1→3)-β-d-Glucan from Saccharomyces cerevisiae is a typical polysaccharide with various biological effects and is considered a candidate for the prevention and treatment of cancer in vitro. Research into the function of (1→3)-β-d-glucan in tumor-bearing animals in vivo, however, is limited. Here, we investigated the effects of (1→3)-β-d-glucan from S. cerevisiae on S180 tumor-bearing mice and on the immunity of the tumor-bearing host. The molecular mechanisms underlying the observed effects were investigated. (1→3)-β-d-Glucan was shown to exert anti-tumor effects without toxicity in normal mouse cells. The volume and weight of S180 tumors decreased dramatically following treatment with (1→3)-β-d-glucan, and treatment with the polysaccharide was furthermore shown to increase the tumor inhibition rate in a dose-dependent manner. Spleen index, T lymphocyte subsets (CD 4 and CD 8 ), as well as interleukins (IL)-2, (IL-2, IL-6), and tumor necrosis factor-α were assayed to detect the immunoregulatory and anti-tumor effects after (1→3)-β-d-glucan intragastrical administration. (1→3)-β-d-Glucan was shown to significantly potentiate the mouse immune responses by, among other effects, decreasing the ratio of CD 4 to CD 8 . The expression levels of IL-2, IL-6, and TNF-α were also significantly increased by (1→3)-β-d-glucan. These results suggest that (1→3)-β-d-glucan enhances the host's immune function during the tumor inhibition process. S180 tumor cells treated with (1→3)-β-d-glucan also exhibited significant apoptotic characteristics. (1→3)-β-d-glucan increased the ratio of Bax to Bcl-2 at the translation level by up-regulating Bax expression and down-regulating Bcl-2 expression, resulting in the initiation of cell apoptosis in S180 tumor-bearing mice. Taken together, these results indicate that the anti-tumor effects exerted by (1→3)-β-d-glucan may be attributed to the polysaccharide's immunostimulating properties and apoptosis

Improvement of the nutritional quality of barley and spring wheat: A review of the FAO/SIDA/SAREC project

International Nuclear Information System (INIS)

Hayes, I.D.

1984-01-01

The main aim of the joint FAO/SIDA/SAREC project was to develop new varieties of barley and spring wheat adapted to conditions in developing countries and with increased protein and lysine contents of the grain. Six premier research institutes in Egypt, Ethiopia, India, Iran, Pakistan and Turkey co-operated in the project under the technical leadership of Svaloev AB, formerly the Swedish Seed Association, during the period 1974 to 1981. Barley lines having grain with high protein and high lysine contents derived from Hiproly, Risoe 1508 and B1 were used as donors and backcrossed at Svaloev into adapted breeding material provided by breeders in the participating countries. Backcrosses and other progenies selected for homozygosity of the lysine genes on the basis of their protein content and dye-binding capacity (DBC) were distributed to the participants who continued selection in their own environments. A similar programme was initiated for wheat, based largely on Atlas 66, Nap Hal and Rageni as donors of high protein and lysine, but the expression of high lysine was very weakly inherited and selection was abandoned in 1978. It has proved extremely difficult, and so far impossible, to find high yielding lines with desirable agronomic characters combined with increased protein and lysine contents. Evidence of positive improvement in protein production per unit area was obtained in both wheat and barley in India. Under the aegis of the project over 14,000 lines of wheat and nearly 21,000 lines of barley, which included around 6,000 mutant progenies, were screened for protein content and DBC values at Svaloev, but no new prospective donors were identified that were superior to those already available. Conclusions are drawn concerning the benefit of the project and suggestions are made for further action. (author)

Lysine metabolism in antisense C-hordein barley grains

DEFF Research Database (Denmark)

Schmidt, Daiana; Rizzi, Vanessa; Gaziola, Salete A

2015-01-01

The grain proteins of barley are deficient in lysine and threonine due to their low concentrations in the major storage protein class, the hordeins, especially in the C-hordein subgroup. Previously produced antisense C-hordein transgenic barley lines have an improved amino acid composition, with ...

In Vitro Biochemical Characterization of All Barley Endosperm Starch Synthases

Directory of Open Access Journals (Sweden)

Jose Antonio Cuesta-Seijo

2016-01-01

Full Text Available Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs. While the overall starch synthase (SS reaction is known, the functional differences between the five SS classes are poorly understood. Much of our knowledge comes from analyzing mutant plants with altered SS activities, but the resulting data are often difficult to interpret as a result of pleitropic effects, competition between enzymes, overlaps in enzyme activity and disruption of multi-enzyme complexes. Here we provide a detailed biochemical study of the activity of all five classes of SSs in barley endosperm. Each enzyme was produced recombinantly in E. coli and the properties and modes of action in vitro were studied in isolation from other SSs and other substrate modifying activities. Our results define the mode of action of each SS class in unprecedented detail; we analyze their substrate selection, temperature dependence and stability, substrate affinity and temporal abundance during barley development. Our results are at variance with some generally accepted ideas about starch biosynthesis and might lead to the reinterpretation of results obtained in planta. In particular, they indicate that granule bound SS is capable of processive action even in the absence of a starch matrix, that SSI has no elongation limit, and that SSIV, believed to be critical for the initiation of starch granules, has maltoligosaccharides and not polysaccharides as its preferred substrates.

Fusarium infection and trichothecenes in barley and its comparison with wheat

NARCIS (Netherlands)

Janssen, Esmee; Liu, C.; Fels, van der H.J.

2018-01-01

Barley is a small-grain cereal that can be infected by Fusarium spp. resulting in reduced quality and safety of harvested barley (products). Barley and other small-grain cereals are commonly studied together for Fusarium infection and related mycotoxin contamination, since the infection and its

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Characterization of the dextran-binding domain in the glucan-binding protein C of Streptococcus mutans.

Science.gov (United States)

Takashima, Y; Fujita, K; Ardin, A C; Nagayama, K; Nomura, R; Nakano, K; Matsumoto-Nakano, M

2015-10-01

Streptococcus mutans produces multiple glucan-binding proteins (Gbps), among which GbpC encoded by the gbpC gene is known to be a cell-surface-associated protein involved in dextran-induced aggregation. The purpose of the present study was to characterize the dextran-binding domain of GbpC using bioinformatics analysis and molecular techniques. Bioinformatics analysis specified five possible regions containing molecular binding sites termed GB1 through GB5. Next, truncated recombinant GbpC (rGbpC) encoding each region was produced using a protein expression vector and five deletion mutant strains were generated, termed CDGB1 through CDGB5 respectively. The dextran-binding rates of truncated rGbpC that included the GB1, GB3, GB4 and GB5 regions in the upstream sequences were higher than that of the construct containing GB2 in the downstream region. In addition, the rates of dextran-binding for strains CDGB4 and CD1, which was entire gbpC deletion mutant, were significantly lower than for the other strains, while those of all other deletion mutants were quite similar to that of the parental strain MT8148. Biofilm structures formed by CDGB4 and CD1 were not as pronounced as that of MT8148, while those formed by other strains had greater density as compared to that of CD1. Our results suggest that the dextran-binding domain may be located in the GB4 region in the interior of the gbpC gene. Bioinformatics analysis is useful for determination of functional domains in many bacterial species. © 2015 The Society for Applied Microbiology.

SPRING BARLEY BREEDING FOR MALTING QUALITY

OpenAIRE

Alžbeta Žofajová; Jozef Gubiš; Ľudovít Sleziak; Klára Križanová; Vratislav Psota

2010-01-01

The aim of this contribution is to illustrate the results of spring barley breeding for malting quality and point out an important position of variety in production of  qualitative  raw material for maltinq and beer  industry as well as the system of evaluation the qualitative parameters of breeding materials and adaptation of barley breeding programms to the  new requirements of  malting and beer industry. As an example of the results obtained most recently descripti...

High beta-Lactamase Levels Change the Pharmacodynamics of beta-Lactam Antibiotics in Pseudomonas aeruginosa Biofilms

DEFF Research Database (Denmark)

Wang, Hengzhuang; Ciofu, Oana; Yang, Liang

2013-01-01

the role of beta-lactamase in the pharmacokinetics (PK) and pharmacodynamics (PD) of ceftazidime and imipenem on P. aeruginosa biofilms. P. aeruginosa PAO1 and its corresponding beta-lactamase-overproducing mutant, PA Delta DDh2Dh3, were used in this study. Biofilms of these two strains in flow chambers......, microtiter plates, and on alginate beads were treated with different concentrations of ceftazidime and imipenem. The kinetics of antibiotics on the biofilms was investigated in vitro by time-kill methods. Time-dependent killing of ceftazidime was observed in PAO1 biofilms, but concentration-dependent killing...... activity of ceftazidime was observed for beta-lactamase-overproducing biofilms of P. aeruginosa in all three models. Ceftazidime showed time-dependent killing on planktonic PAO1 and PA Delta DDh2Dh3. This difference is probably due to the special distribution and accumulation in the biofilm matrix of beta...

7 CFR 801.3 - Tolerances for barley pearlers.

Science.gov (United States)

2010-01-01

... 7 Agriculture 7 2010-01-01 2010-01-01 false Tolerances for barley pearlers. 801.3 Section 801.3 Agriculture Regulations of the Department of Agriculture (Continued) GRAIN INSPECTION, PACKERS AND STOCKYARD... FOR GRAIN INSPECTION EQUIPMENT § 801.3 Tolerances for barley pearlers. The maintenance tolerances for...

NONSPECIFIC IMMUNE RESPONSE AND RESISTANCE OF Litopenaeus vannamei FED WITH NUCLEOTIDE, β-GLUCAN, AND PROTAGEN DIETS

Directory of Open Access Journals (Sweden)

Henky Manoppo

2010-06-01

Full Text Available The objective of this research was to evaluate the nonspecific immune response and resistance of Litopenaeus vannamei fed with nucleotide, β–glucan, and protagen diets. Shrimp juveniles with an average weight of 5.39±0.56 g were reared in glass aquaria at a density of 15 shrimps/aquarium. Shrimps were fed three times a day for four weeks at a feeding rate of 3%/bw/day. Treatment diets consisted of A: basal diet (without immunostimulant, B: β–glucan, C: protagen, and D: nucleotide, each with three replicates. At the end of feeding period, the shrimps were intramuscularly injected with Vibrio harveyi 0.1 x 106 cfu.shrimp-1. Total haemocyte count (THC of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p=0.01, but not different compared to shrimp fed with protagen-diet. PO activity also increased significantly in shrimp fed with nucleotide-diet (p=0.02. β–glucan diet could also increase THC and PO activity, but compared to the control, the increase was not significantly different. Overall, PO activity of shrimp fed with nucleotide, β–glucan, and protagen diets was high (>0.35. Oral administration of nucleotide, β–glucan, and protagen for four consecutive weeks significantly increased resistance of shrimp to disease (<0.01 where the highest resistance rate was observed on shrimp fed with nucleotide-diet. Growth of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p<0.01, as well as to β–glucan, and protagen-treated shrimp. As a conclusion, supplementation of nucleotide into shrimp pellet enhanced nonspecific immune response and growth performance better than β-glucan, and protagen.

PHYSIOLOGICAL AND AGROECOLOGICAL ASPECTS OF CADMIUM INTERACTIONS WITH BARLEY PLANTS: AN OVERVIEW

Directory of Open Access Journals (Sweden)

A VASSILEV

2003-07-01

Full Text Available This work is a review of author’s previous publications, unpublished results as well as available literature on barley responses to Cd contamination. The physiological backgrounds of the acute Cd toxicity in barley plants are briefly described. Some data characterizing the chronic Cd toxicity in barley have been also provided in relation to its possible use for seed production and Cd phytoextraction on Cd-contaminated agricultural soils. Information about the main physiological factors limiting growth of Cd-exposed barley plants and grain yield, seedling quality as well as Cd phytoextraction capacity of barley grown in Cd-contaminated soils is presented.

Characteristics of alpha/beta interferon induction after infection of murine fibroblasts with wild-type and mutant alphaviruses

International Nuclear Information System (INIS)

Burke, Crystal W.; Gardner, Christina L.; Steffan, Joshua J.; Ryman, Kate D.; Klimstra, William B.

2009-01-01

We examined the characteristics of interferon alpha/beta (IFN-α/β) induction after alphavirus or control Sendai virus (SeV) infection of murine fibroblasts (MEFs). As expected, SeV infection of wild-type (wt) MEFs resulted in strong dimerization of IRF3 and the production of high levels of IFN-α/β. In contrast, infection of MEFs with multiple alphaviruses failed to elicit detectable IFN-α/β. In more detailed studies, Sindbis virus (SINV) infection caused dimerization and nuclear migration of IRF3, but minimal IFN-β promoter activity, although surprisingly, the infected cells were competent for IFN production by other stimuli early after infection. A SINV mutant defective in host macromolecular synthesis shutoff induced IFN-α/β in the MEF cultures dependent upon the activities of the TBK1 IRF3 activating kinase and host pattern recognition receptors (PRRs) PKR and MDA5 but not RIG-I. These results suggest that wild-type alphaviruses antagonize IFN induction after IRF3 activation but also may avoid detection by host PRRs early after infection.

Impaired insulin secretion and glucose intolerance in synaptotagmin-7 null mutant mice

DEFF Research Database (Denmark)

Gustavsson, Natalia; Lao, Ye; Maximov, Anton

2008-01-01

and insulin release. Here, we show that synaptotagmin-7 is required for the maintenance of systemic glucose tolerance and glucose-stimulated insulin secretion. Mutant mice have normal insulin sensitivity, insulin production, islet architecture and ultrastructural organization, and metabolic and calcium...... secretion in pancreatic beta-cells. Of these other synaptotagmins, synaptotagmin-7 is one of the most abundant and is present in pancreatic beta-cells. To determine whether synaptotagmin-7 regulates Ca(2+)-dependent insulin secretion, we analyzed synaptotagmin-7 null mutant mice for glucose tolerance...... responses but exhibit impaired glucose-induced insulin secretion, indicating a calcium-sensing defect during insulin-containing secretory granule exocytosis. Taken together, our findings show that synaptotagmin-7 functions as a positive regulator of insulin secretion and may serve as a calcium sensor...

Spring Barley Yield Parameters after Lignite, Sodium Humate and Nitrogen Utilization

Directory of Open Access Journals (Sweden)

Kováčik Peter

2016-10-01

Full Text Available The existence of a small number of publications dealing with the impact of solid sodium humate and lignite on the quantity and quality of grown crops was the reason for establishing the field experiment. The objective of this experiment was to detect the impact of solid lignite and solid sodium humate on the quantity and quality of spring barley yield. These substances were applied into the soil either independently or along with nitrogen fertiliser. The next objective was to determine the impact of foliar application of sodium humate water solution applied either independently or along with nitrogen fertiliser on the quality and quantity of spring barley yield. The achieved results showed that the autumn application of solid lignite and the presowing application of solid sodium humate into the soil tended to decrease the yield of both grain and straw of spring barley, crude protein content in grain, proportion of the first-class grains and volume weight of grain, whereas the impact of humate was more negative. Lignite and sodium humate in the solid form should be used along with nitrogen fertiliser. The application of sodium humate in liquid form during the growth season of barley tended to increase the yield of both grain and straw. The joint application of nitrogen and liquid sodium humate during the growth season of barley increased the grain yield of barley significantly. A lower dose of nitrogen, applied during the growth season of barley (growth season BBCH 23, increased the grain yield of barley considerably more than a higher N dose, applied into the soil before barley sowing.

Mutant INS-gene induced diabetes of youth: proinsulin cysteine residues impose dominant-negative inhibition on wild-type proinsulin transport.

Directory of Open Access Journals (Sweden)

Ming Liu

2010-10-01

Full Text Available Recently, a syndrome of Mutant INS-gene-induced Diabetes of Youth (MIDY, derived from one of 26 distinct mutations has been identified as a cause of insulin-deficient diabetes, resulting from expression of a misfolded mutant proinsulin protein in the endoplasmic reticulum (ER of insulin-producing pancreatic beta cells. Genetic deletion of one, two, or even three alleles encoding insulin in mice does not necessarily lead to diabetes. Yet MIDY patients are INS-gene heterozygotes; inheritance of even one MIDY allele, causes diabetes. Although a favored explanation for the onset of diabetes is that insurmountable ER stress and ER stress response from the mutant proinsulin causes a net loss of beta cells, in this report we present three surprising and interlinked discoveries. First, in the presence of MIDY mutants, an increased fraction of wild-type proinsulin becomes recruited into nonnative disulfide-linked protein complexes. Second, regardless of whether MIDY mutations result in the loss, or creation, of an extra unpaired cysteine within proinsulin, Cys residues in the mutant protein are nevertheless essential in causing intracellular entrapment of co-expressed wild-type proinsulin, blocking insulin production. Third, while each of the MIDY mutants induces ER stress and ER stress response; ER stress and ER stress response alone appear insufficient to account for blockade of wild-type proinsulin. While there is general agreement that ultimately, as diabetes progresses, a significant loss of beta cell mass occurs, the early events described herein precede cell death and loss of beta cell mass. We conclude that the molecular pathogenesis of MIDY is initiated by perturbation of the disulfide-coupled folding pathway of wild-type proinsulin.

The perspective crops for the bioregenerative human life support systems

Science.gov (United States)