Diversity of [beta]-globin mutations in Israeli ethnic groups reflects recent historic events
Energy Technology Data Exchange (ETDEWEB)
Filon, D.; Oron, V.; Krichevski, S.; Shaag, A.; Goldfarb, A.; Aker, M.; Rachmilewitz, E.A.; Rund, D.; Oppenheim, A. (Hebrew Univ. Hadassah-Medical School, Jerusalem (Israel)) (and others)
1994-05-01
The authors characterized nearly 500 [beta]-thalassemia genes from the Israeli population representing a variety of ethnic subgroups. They found 28 different mutations in the [beta]-globin gene, including three mutations ([beta][sup S], [beta][sup C], and [beta][sup O-Arab]) causing hemoglobinopathies. Marked genetic heterogeneity was observed in both the Arab (20 mutations) and Jewish (17 mutations) populations. On the other hand, two ethnic isolates - Druze and Samaritans - had a single mutation each. Fifteen of the [beta]-thalassemia alleles are Mediterranean in type, 5 originated in Kurdistan, 2 are of Indian origin, and 2 sporadic alleles came from Europe. Only one mutant allele-nonsense codon 37-appears to be indigenous to Israel. While human habitation in Israel dates back to early prehistory, the present-day spectrum of [beta]-globin mutations can be largely explained by migration events that occurred in the past millennium. 26 refs., 2 figs., 3 tabs.
DEFF Research Database (Denmark)
Lonkar, Pallavi; Kim, Ki-Hyun; Kuan, Jean Y
2009-01-01
Beta-thalassemia is a genetic disorder caused by mutations in the beta-globin gene. Triplex-forming oligonucleotides and triplex-forming peptide nucleic acids (PNAs) have been shown to stimulate recombination in mammalian cells via site-specific binding and creation of altered helical structures...
DEFF Research Database (Denmark)
Chin, Joanna Y; Kuan, Jean Y; Lonkar, Pallavi S
2008-01-01
Splice-site mutations in the beta-globin gene can lead to aberrant transcripts and decreased functional beta-globin, causing beta-thalassemia. Triplex-forming DNA oligonucleotides (TFOs) and peptide nucleic acids (PNAs) have been shown to stimulate recombination in reporter gene loci in mammalian...... DNA fragments, can promote single base-pair modification at the start of the second intron of the beta-globin gene, the site of a common thalassemia-associated mutation. This single base pair change was detected by the restoration of proper splicing of transcripts produced from a green fluorescent...
Rare and unexpected beta thalassemic mutations in Qazvin ...
African Journals Online (AJOL)
About 13 beta-globin mutations encompass 70 - 90% of mutation spectrum in Iran. These mutations are called common beta-globin mutations. The rest are rare or unknown mutations. The objective of this study was to identify and describe rare or unknown beta-globin mutations in Qazvin province. EDTAcontaining venous ...
Rare and unexpected beta thalassemic mutations in Qazvin ...
African Journals Online (AJOL)
STORAGESEVER
2010-01-04
Jan 4, 2010 ... About 13 beta-globin mutations encompass 70 - 90% of mutation spectrum in Iran. These mutations are called common beta-globin mutations. The rest are rare or unknown mutations. The objective of this study was to identify and describe rare or unknown beta-globin mutations in Qazvin province. EDTA-.
International Nuclear Information System (INIS)
Somaya, E.T.; Soliman, M.D
2010-01-01
The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)
Energy Technology Data Exchange (ETDEWEB)
Louie, E.; Dietz, L.; Shafer, F. [Children`s Hosptial, Oakland, CA (United States)] [and others
1994-09-01
A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, which would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.
Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S
2017-12-30
Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.
Tan, Jin Ai Mary Anne; Chin, Pui See; Wong, Yean Ching; Tan, Kim Lian; Chan, Lee Lee; George, Elizabeth
2006-10-01
In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations. DNA from 173 beta-thalassaemia carriers and five beta-thalassaemia major patients from the Malay, Chinese and Indian ethnic groups were first analysed by ARMS and gap-PCR. Ninety-five per cent (174/183) of the 183 beta-globin genes studied were characterised using these two techiques. The remaining nine uncharacterised beta-globin genes (4.9%) were analysed using genomic sequencing of a 904 bp amplified PCR product consisting of the promoter region, exon 1, intervening sequence (IVS) 1, exon 2 and the 5' IVS2 regions of the beta-globin gene. The rare beta-globin mutations detected in the Chinese patients were CD27/28 (+C) and CD43 (GAG-TAG), and -88 (C-T) in an Indian patient. Beta-globin mutations at CD16 (-C), IVS1-1 (G-A), IVS2-1 (G-A), -86 (C-G) and Haemoglobin South Florida (CD1, GTG-ATG) were confirmed in the Malay patients. The seven rare beta-globin mutations and a rare haemoglobin variant confirmed in this study have been described in other populations but have not been previously described in Malaysian beta-thalassemia patients.
Amselem, S; Nunes, V; Vidaud, M; Estivill, X; Wong, C; d'Auriol, L; Vidaud, D; Galibert, F; Baiget, M; Goossens, M
1988-01-01
We have delineated the molecular lesions causing beta-thalassemia in Spain, a country that has witnessed the passage of different Mediterranean populations over the centuries, in order to evaluate the extent of heterogeneity of these mutations and to make possible simplified prenatal diagnosis of the disorder in that country. The use of the polymerase chain-reaction (PCR) technique to preferentially amplify beta-globin DNA sequences that contain the most frequent beta-thalassemia mutations in...
the characterization of exon-1 mutation(s) of beta globin gene in beta thalassemia
International Nuclear Information System (INIS)
Abass, M.M.E.
2004-01-01
β-thalassemia constitutes one of the most serious health problems worldwide, it is the most common chronic hemolytic anemia in egypt. the aim of this work is to study the mutations of exon-1 of β-globin gene in β-thalassaemic children in sharkia governorate. the present study was included 25 healthy children and 50 patients diagnosed as β-thalassemia. this work showed that the thalassaemic patients had significantly decrease in Hb conc . than the control group (p 2 showed a significant increase as compared with the control group
Shishikura, Fumio; Takeuchi, Hiro-aki; Nagai, Takatoshi
2005-11-01
Erythrocytes of the adult axolotl, Ambystoma mexicanum, have multiple hemoglobins. We separated and purified two kinds of hemoglobin, termed major hemoglobin (Hb M) and minor hemoglobin (Hb m), from a five-year-old male by hydrophobic interaction column chromatography on Alkyl Superose. The hemoglobins have two distinct alpha type globin polypeptides (alphaM and alpham) and a common beta globin polypeptide, all of which were purified in FPLC on a reversed-phase column after S-pyridylethylation. The complete amino acid sequences of the three globin chains were determined separately using nucleotide sequencing with the assistance of protein sequencing. The mature globin molecules were composed of 141 amino acid residues for alphaM globin, 143 for alpham globin and 146 for beta globin. Comparing primary structures of the five kinds of axolotl globins, including two previously established alpha type globins from the same species, with other known globins of amphibians and representatives of other vertebrates, we constructed phylogenetic trees for amphibian hemoglobins and tetrapod hemoglobins. The molecular trees indicated that alphaM, alpham, beta and the previously known alpha major globin were adult types of globins and the other known alpha globin was a larval type. The existence of two to four more globins in the axolotl erythrocyte is predicted.
Islam, Md Tarikul; Sarkar, Suprovath Kumar; Sultana, Nusrat; Begum, Mst Noorjahan; Bhuyan, Golam Sarower; Talukder, Shezote; Muraduzzaman, A K M; Alauddin, Md; Islam, Mohammad Sazzadul; Biswas, Pritha Promita; Biswas, Aparna; Qadri, Syeda Kashfi; Shirin, Tahmina; Banu, Bilquis; Sadya, Salma; Hussain, Manzoor; Sarwardi, Golam; Khan, Waqar Ahmed; Mannan, Mohammad Abdul; Shekhar, Hossain Uddin; Chowdhury, Emran Kabir; Sajib, Abu Ashfaqur; Akhteruzzaman, Sharif; Qadri, Syed Saleheen; Qadri, Firdausi; Mannoor, Kaiissar
2018-01-02
Bangladesh lies in the global thalassemia belt, which has a defined mutational hot-spot in the beta-globin gene. The high carrier frequencies of beta-thalassemia trait and hemoglobin E-trait in Bangladesh necessitate a reliable DNA-based carrier screening approach that could supplement the use of hematological and electrophoretic indices to overcome the barriers of carrier screening. With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. Our HRM approach could successfully differentiate ten beta-globin gene mutations, namely c.79G > A, c.92 + 5G > C, c.126_129delCTTT, c.27_28insG, c.46delT, c.47G > A, c.92G > C, c.92 + 130G > C, c.126delC and c.135delC in heterozygous states from the wild type alleles, implying the significance of the approach for carrier screening as the first three of these mutations account for ~85% of total mutant alleles in Bangladesh. Moreover, different combinations of compound heterozygous mutations were found to generate melt curves that were distinct from the wild type alleles and from one another. Based on the findings, sixteen reference samples were run in parallel to 41 unknown specimens to perform direct genotyping of the beta-thalassemia specimens using HRM. The HRM-based genotyping of the unknown specimens showed 100% consistency with the sequencing result. Targeting the mutational hot-spot, the HRM approach could be successfully applied for screening of beta-thalassemia carriers in Bangladesh as well as in other countries of South Asia and Southeast Asia. The approach could be a useful supplement of hematological and
Raftopoulos, H; Ward, M; Bank, A
1998-06-30
Insertion of a normally functioning human beta-globin gene into the hematopoietic stem cells (HSC) of patients with beta-thalassemia may be an effective approach to the therapy of this disorder. Safe, efficient gene transfer and long-term, high-level expression of the transferred human beta-globin gene in animal models are prerequisites for HSC somatic gene therapy. We have recently shown for the first time that, using a modified beta-globin retroviral vector in a mouse transplant model, long-term, high-level expression of a transferred human beta-globin gene is possible. The human beta-globin gene continues to be detected up to eight months post-transplantation of beta-globin-transduced hematopoietic cells into lethally irradiated mice. The transferred human beta-globin gene is detected in three of five mice surviving long-term (> 4 months) transplanted with bone marrow cells transduced with high-titer virus. The unrearranged 5.1 kb human beta-globin gene-containing provirus is seen by Southern blotting in two of these mice. More importantly, long-term expression of the transferred gene is seen in two mice at levels of 5% and 20% that of endogenous murine beta-globin. We document stem cell transduction by showing continued high-level expression of the human beta-globin gene in secondarily transplanted recipient mice. These results provide evidence of HSC transduction with a human beta-globin gene in animals and demonstrate that retroviral-mediated unrearranged human beta-globin gene transfer leads to a high level of human beta-globin gene expression in the long term for the first time. A gene therapy strategy may be a feasible therapeutic approach to the beta-thalassemias if consistent human beta-globin gene transfer and expression into HSC can be achieved.
Long-term transfer and expression of the human beta-globin gene in a mouse transplant model.
Raftopoulos, H; Ward, M; Leboulch, P; Bank, A
1997-11-01
Somatic gene therapy of hemoglobinopathies depends initially on the demonstration of safe, efficient gene transfer and long-term, high-level expression of the transferred human beta-globin gene in animal models. We have used a beta-globin gene/beta-locus control region retroviral vector containing several modifications to optimize gene transfer and expression in a mouse transplant model. In this report we show that transplantation of beta-globin-transduced hematopoietic cells into lethally irradiated mice leads to the continued presence of the gene up to 8 months posttransplantation. The transferred human beta-globin gene is detected in 3 of 5 mice surviving long term (>4 months) transplanted with bone marrow cells transduced with high-titer virus. Southern blotting confirms the presence of the unrearranged 5.1-kb human beta-globin gene-containing provirus in 2 of these mice. In addition, long-term expression of the transferred gene is seen in 2 mice at levels of 5% and 20% that of endogenous murine beta-globin at 6 and 8 months posttransplantation. We further document stem cell transduction by the successful transfer and high-level expression of the human beta-globin gene from mice transduced 9 months earlier into irradiated secondary recipient mice. These results demonstrate high-level, long-term somatic human beta-globin gene transfer into the hematopoietic stem cells of an animal for the first time, and suggest the potential feasibility of a retroviral gene therapy approach to sickle cell disease and the beta thalassemias.
Himelstein, A; Ward, M; Podda, S; de la Flor Weiss, E; Costantini, F; Bank, A
1993-03-01
When the human beta-globin gene is transferred into the bone marrow cells of live mice, its expression is very low. To investigate the reason for this, we transferred the bone marrow of transgenic mice containing and expressing the human beta-globin into irradiated recipients. We demonstrate that long-term high level expression of the human beta-globin gene can be maintained in the marrow and blood of irradiated recipients following transplantation. Although expression decreased over time in most animals because of host marrow reconstitution, the ratio of human beta-globin transgene expression to endogenous mouse beta-globin gene expression in donor-derived erythroid cells remained constant over time. We conclude that there is no inherent limitation to efficient expression of an exogenous human beta-globin gene in mouse bone marrow cells following marrow transplantation.
Nonsense mutations in the human β-globin gene affect mRNA metabolism
International Nuclear Information System (INIS)
Baserga, S.J.; Benz, E.J. Jr.
1988-01-01
A number of premature translation termination mutations (nonsense mutations) have been described in the human α- and β-globin genes. Studies on mRNA isolated from patients with β 0 -thalassemia have shown that for both the β-17 and the β-39 mutations less than normal levels of β-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human β-globin mRNA). In vitro studies using the cloned β-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. The authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human β-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation
A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.
Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza
2014-07-01
In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.
Benz, E J; Berman, B W; Tonkonow, B L; Coupal, E; Coates, T; Boxer, L A; Altman, A; Adams, J G
1981-01-01
Inheritance of the gene for betaE-globin is associated with hypochromia and microcytosis, reminiscent of typical heterozygous beta-thalassemia. Patients with hemoglobin (Hb)E-beta-thalassemia exhibit clinical phenotypes of severe beta-thalassemia, a circumstance not encountered in other compound heterozygous states for structural beta-chain mutations and beta-thalassemia. We have analyzed the kinetics of globin synthesis and the levels of globin messenger (m) RNA accumulation in patients with...
Geographical distribution of β-globin gene mutations in Syria.
Murad, Hossam; Moasses, Faten; Dabboul, Amir; Mukhalalaty, Yasser; Bakoor, Ahmad Omar; Al-Achkar, Walid; Jarjour, Rami A
2018-04-11
Objectives β-Thalassemia disease is caused by mutations in the β-globin gene. This is considered as one of the common genetic disorders in Syria. The aim of this study was to identify the geographical distribution of the β-thalassemia mutations in Syria. Methods β-Globin gene mutations were characterized in 636 affected patients and 94 unrelated carriers using the amplification refractory mutations system-polymerase chain reaction technique and DNA sequencing. Results The study has revealed the presence of 38 β-globin gene mutations responsible for β-thalassemia in Syria. Important differences in regional distribution were observed. IVS-I.110 [G > A] (22.2%), IVS-I.1 [G > A] (17.8%), Cd 39 [C > T] (8.2%), IVS-II.1 [G > A] (7.6%), IVS-I.6 [T > C] (7.1%), Cd 8 [-AA] (6%), Cd 5 [-CT] (5.6%) and IVS-I.5 [G > C] (4.1%) were the eight predominant mutations found in our study. The coastal region had higher relative frequencies (37.9 and 22%) than other regions. A clear drift in the distribution of the third common Cd 39 [C > T] mutation in the northeast region (34.8%) to the northwest region (2.5%) was noted, while the IVS-I.5 [G > C] mutation has the highest prevalence in north regions. The IVS-I.6 [T > C] mutation had a distinct frequency in the middle region. Ten mutations -86 [C > G], -31 [A > G], -29 [A > G], 5'UTR; +22 [G > A], CAP + 1 [A > C], Codon 5/6 [-TG], IVS-I (-3) or codon 29 [C > T], IVS-I.2 [T > A], IVS-I.128 [T > G] and IVS-II.705 [T > G] were found in Syria for the first time. Conclusions These data will significantly facilitate the population screening, genetic counseling and prenatal diagnosis in Syrian population.
Directory of Open Access Journals (Sweden)
Zama Messala Luna da Silveira
2011-01-01
Full Text Available 35 unrelated individuals were studied for characterization as either heterozygous or homozygous for beta-thalassemia. Molecular analysis was done by PCR/RFLP to detect the mutations most commonly associated with beta-thalassemia (β0IVS-I-1, β+IVS-I-6, and β039. In the patients who showed none of these mutations, the beta-globin genes were sequenced. Of the 31 heterozygous patients, 13 (41.9% had the β+IVS-I-6 mutation, 15 (48.4% the β0IVS-I-1 mutation, 2 (6.5% the β+IVS-I-110 mutation and 1 (3.2% the β+IVS-I-5 mutation. IVS-I-6 was detected in the four homozygotes. The mutation in codon 39, often found in previous studies in Brazil, was not detected in the present case. This is the first study aiming at identifying mutations that determine beta-thalassemia in the state of Rio Grande do Norte.
Ekwattanakit, Supachai; Riolueang, Suchada; Viprakasit, Vip
2018-03-01
There are more than 200 known mutations found in patients with β-thalassemia, a possibility to identify an unknown or novel mutation becomes less possible. Here, we report a novel mutation in a patient from Thailand who presented with chronic hemolytic anemia. A comprehensive hematology and DNA analysis was applied in the index patient and her mother. Hematological and hemoglobin analyses were consistent with the clinical diagnosis of Hb E/β 0 -thalassemia. However, we could find only Hb E heterozygous mutation using our common polymerase chain reaction-based mutation detection of the β-globin genes. Furthermore, the molecular analysis demonstrated a novel T-deletion at codon 42 of the second exon of the β-globin gene which we named 'Hb Yala' according to the origin of this index family. This mutation was assumed to generate a truncated β-globin chain terminating at codon 60 with possible unstable variant leading to a 'null' or β 0 -thalassemia. However, the clinical phenotype was surprisingly mild and no other ameliorating genetic factors, including co-inheritance of α-thalassemia and high propensity of Hb F by Xmn I polymorphism, were found. This report has provided evidence that genotype-phenotype correlation in thalassemia syndromes is highly complex and a correct clinical severity classification of thalassemia should be mainly based on clinical evaluation.
Directory of Open Access Journals (Sweden)
Giulia Breveglieri
2015-01-01
Full Text Available Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6 carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a the transgenic integration region is located in mouse chromosome 7; (b the expression of the transgene is tissue specific; (c as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin αmu-globin2/βhu-globin2 and, more importantly, (d the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia.
Mancini, Irene; Lampronti, Ilaria; Salvatori, Francesca; Fabbri, Enrica; Zuccato, Cristina; Cosenza, Lucia C.; Montagner, Giulia; Borgatti, Monica; Altruda, Fiorella; Fagoonee, Sharmila; Carandina, Gianni; Aiello, Vincenzo; Breda, Laura; Rivella, Stefano; Gambari, Roberto
2015-01-01
Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece) are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6) carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a) the transgenic integration region is located in mouse chromosome 7; (b) the expression of the transgene is tissue specific; (c) as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin mu α-globin2/hu β-globin2 and, more importantly, (d) the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia. PMID:26097845
Ali, Nadir; Ayyub, Muhammad; Khan, Saleem Ahmed; Ahmed, Suhaib; Abbas, Kazim; Malik, Hamid Saeed; Tashfeen, Sunila
2015-03-01
Response to hydroxyurea therapy in homozygous or compound heterozygous beta thalassaemia (BT) has been reported as more favourable in the presence of XmnI polymorphism. The prevalence of XmnI polymorphism may vary with BT phenotypes and genotypes, and differs geographically in distribution. Prevalence of XmnI polymorphism is not known in northern Pakistan. To determine the frequency of Gγ-globin promoter -158 (C>T) XmnI polymorphism (XmnI polymorphism) in patients with homozygous or compound heterozygous beta thalassaemia. Polymerase chain reaction (PCR) for common beta thalassaemia mutations and Gγ-globin promoter -158 (C>T) XmnI polymorphism was performed on 107 blood samples of transfusion dependent beta thalassaemia (BT) patients in Pakistan. One hundred samples of unrelated BT traits and 94 samples of healthy subjects as controls were also analysed for BT mutations and XmnI polymorphism. Out of 301 DNA samples, XmnI polymorphism was detected in 71(24%); in normal controls, XmnI polymorphism was detected in 34/94 (36%) subjects; while in homozygous/compound heterozygous BT, it was detected in 14/107(13%) patients (Fisher's exact test, p=.0002). In heterozygous BT group, XmnI polymorphism was detected in 23/100 subjects (Fisher's exact test, p=.03 with normal controls, and p=.049 with homozygous/compound heterozygous BT). The most common BT genotype was Frame Shift (Fr) 8-9/Fr 8-9, and none of the patients with this genotype had XmnI polymorphism. The second most common genotype was IVSI-5/IVSI-5; 4/26 (15%). Cases with this genotype had XmnI polymorphism. XmnI polymorphism in homozygous/compound heterozygous BT group is 13%. The most common genotype associated with XmnI polymorphism was IVSI-5/IVSI-5. Copyright © 2015 King Faisal Specialist Hospital & Research Centre. Published by Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Pirastu, M.; Galanello, R.; Doherty, M.A.; Tuveri, T.; Cao, A.; Kan, Y.W.
1987-01-01
The predominant β-thalassemia in Sardinia is the β 0 type in which no β-globin chains are synthesized in the homozygous state. The authors determined the β-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same β/sup 39(CAG→TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the β-globin gene region
Expression of human gamma-globin genes in human erythroleukemia (K562) cells.
Donovan-Peluso, M; Acuto, S; Swanson, M; Dobkin, C; Bank, A
1987-12-15
K562 cells express embryonic (epsilon) and fetal (gamma) globins and hemoglobins but not adult (beta) globin. To define the cis acting regulatory elements involved in the discrimination between gamma and beta genes, we have constructed chimeric genes composed of portions of gamma and beta and evaluated their expression in stable K562 transfectants. A gamma beta fusion gene containing gamma 5' sequences to the EcoRI site in exon 3 and beta sequences 3' is expressed at 10-40% that of the endogenous gamma level. In 50% of the lines, this fusion gene appropriately increases its expression in response to hemin, an inducer of endogenous globin gene expression in K562 cells. In contrast, a beta gamma fusion gene, containing beta sequences 5' to the EcoRI site in exon 3 and gamma sequences 3', is neither expressed nor correctly initiated. A beta gene containing gamma-intervening sequence (IVS) 2 accumulates an mRNA transcript when analyzed with a 3' beta probe. However, no correctly initiated beta mRNA is observed. A gamma gene with beta-IVS 2 is only inducible in one of six expressing clones. All the results are consistent with the presence of stage-specific trans acting factors in K562 cells that stimulate expression of gamma genes and suggest a significant role for gamma-IVS 2 in gamma gene expression.
M. Sadelain (Michel); C.H.J. Wang (Jason); M. Antoniou (Michael); F.G. Grosveld (Frank); R.C. Mulligan
1995-01-01
textabstractRetrovirus-mediated gene transfer into hematopoietic cells may provide a means of treating both inherited and acquired diseases involving hematopoietic cells. Implementation of this approach for disorders resulting from mutations affecting the beta-globin gene (e.g., beta-thalassemia and
Brain alpha- and beta-globin expression after intracerebral hemorrhage
He, Yangdong; Hua, Ya; Lee, Jin-Yul; Liu, Wenquan; Keep, Richard F; Wang, Michael M.; Xi, Guohua
2010-01-01
Our recent study has demonstrated that hemoglobin (Hb) is present in cerebral neurons and neuronal Hb is inducible after cerebral ischemia. In the present study, we examined the effects of intracerebral hemorrhage (ICH) on the mRNA levels of the α-globin (HbA) and the β-globin (HbB) components of Hb and Hb protein in the brain in vivo and in vitro. In vivo, male Sprague-Dawley rats received either a needle insertion (sham) or an infusion of autologous whole blood into the basal ganglia and we...
Search for antisense copies of beta-globin mRNA in anemic mouse spleen
Directory of Open Access Journals (Sweden)
Taylor John M
2001-03-01
Full Text Available Abstract Background Previous studies by Volloch and coworkers have reported that during the expression of high levels of β-globin mRNA in the spleen of anemic mice, they could also detect small but significant levels of an antisense (AS globin RNA species, which they postulated might have somehow arisen by RNA-directed RNA synthesis. For two reasons we undertook to confirm and possibly extend these studies. First, previous studies in our lab have focussed on what is an unequivocal example of host RNA-directed RNA polymerase activity on the RNA genome of human hepatitis delta virus. Second, if AS globin species do exist they could in turn form double-stranded RNA species which might induce post-transcriptional gene silencing, a phenomenon somehow provoked in eukaryotic cells by AS RNA sequences. Results We reexamined critical aspects of the previous globin studies. We used intraperitoneal injections of phenylhydrazine to induce anemia in mice, as demonstrated by the appearance and ultimate disappearance of splenomegaly. While a 30-fold increase in globin mRNA was detected in the spleen, the relative amount of putative AS RNA could be no more than 0.004%. Conclusions Contrary to earlier reports, induction of a major increase in globin transcripts in the mouse spleen was not associated with a detectable level of antisense RNA to globin mRNA.
Directory of Open Access Journals (Sweden)
R Jha
2014-09-01
Full Text Available Thalassemia is a globin gene disorder that results in a diminished rate of synthesis of one or more of the globin chains. About 1.5% of the global population (80 to 90 million people are carriers of beta Thalassemia. More than 200 mutations are described in beta thalassemia. However not all mutations are common in different ethnic groups. The only effective way to reduce burden of thalassemia is to prevent birth of homozygotes. Diagnosis of beta thalassemia can be done by fetal DNA analysis for molecular defects of beta thalassemia or by fetal blood analysis. Hematopoietic stem cell transplantation is the only available curative approach for Thalassemia. Many patients with thalassemia in underdeveloped nations die in childhood or adolescence. Programs that provide acceptable care, including transfusion of safe blood and supportive therapy including chelation must be established.DOI: http://dx.doi.org/10.3126/jpn.v4i8.11609 Journal of Pathology of Nepal; Vol.4,No. 8 (2014 663-671
High-resolution melting analysis for prenatal diagnosis of beta-thalassemia in northern Thailand.
Charoenkwan, Pimlak; Sirichotiyakul, Supatra; Phusua, Arunee; Suanta, Sudjai; Fanhchaksai, Kanda; Sae-Tung, Rattika; Sanguansermsri, Torpong
2017-12-01
High-resolution melting (HRM) analysis is a rapid mutation analysis which assesses the pattern of reduction of fluorescence signal after subjecting the amplified PCR product with saturated fluorescence dye to an increasing temperature. We used HRM analysis for prenatal diagnosis of beta-thalassemia disease in northern Thailand. Five PCR-HRM protocols were used to detect point mutations in five different segments of the beta-globin gene, and one protocol to detect the 3.4 kb beta-globin deletion. We sought to characterize the mutations in carriers and to enable prenatal diagnosis in 126 couples at risk of having a fetus with beta-thalassemia disease. The protocols identified 18 common mutations causing beta-thalassemia, including the rare codon 132 (A-T) mutation. Each mutation showed a specific HRM pattern and all results were in concordance with those from direct DNA sequencing or gap-PCR methods. In cases of beta-thalassemia disease resulting from homozygosity for a mutation or compound heterozygosity for two mutations on the same amplified segment, the HRM patterns were different to those of a single mutation and were specific for each combination. HRM analysis is a simple and useful method for mutation identification in beta-thalassemia carriers and prenatal diagnosis of beta-thalassemia in northern Thailand.
Hemolytic disease of the newborn caused by a new deletion of the entire beta-globin cluster.
Pirastu, M; Kan, Y W; Lin, C C; Baine, R M; Holbrook, C T
1983-01-01
We describe a new type of gamma delta beta-thalassemia in four generations of a family of Scotch-Irish descent. The proposita presented with hemolytic disease of the newborn, which was characterized by a microcytic anemia. Initial restriction endonuclease analysis of the DNA showed no grossly abnormal patterns, but studies of polymorphic restriction sites and gene dosage revealed an extensive deletion that removed all the beta- and beta-like globin genes from the affected chromosome. In situ ...
Directory of Open Access Journals (Sweden)
Elza Miyuki Kimura
2015-04-01
Full Text Available Background: Brazil has a multiethnic population with a high diversity of hemoglobinopathies. While screenings for beta-globin mutations are far more common, alterations affecting alpha-globin genes are usually more silent and less well known. The aim of this study was to describe the results of a screening program for alpha-globin gene mutations in a representative sample of the Southeastern Brazilian population. Methods: A total of 135,000 individuals, including patients with clinical suspicion of hemoglobinopathies and their family members, randomly chosen individuals submitted to blood tests and blood donors who were abnormal hemoglobin carriers were analyzed. The variants were screened by alkaline and acid electrophoreses, isoelectric focusing and cation-exchange high performance liquid chromatography (HPLC and the abnormal chains were investigated by reverse-phase high performance liquid chromatography (RP-HPLC. Mutations were identified by molecular analyses, and the oxygen affinity, heme-heme cooperativity and Bohr effect of the variants were evaluated by functional tests. Results: Four new and 22 rare variants were detected in 98 families. Some of these variants were found in co-inheritance with other hemoglobinopathies. Of the rare hemoglobins, Hasharon, Stanleyville II and J-Rovigo were the most common, the first two being S-like and associated with alpha-thalassemia. Conclusion: The variability of alpha-globin alterations reflects the high degree of racial miscegenation and an intense internal migratory flow between different Brazilian regions. This diversity highlights the importance of programs for diagnosing hemoglobinopathies and preventing combinations that may lead to important clinical manifestations in multiethnic populations.
Aykut, Ayça; Onay, Hüseyin; Durmaz, Asude; Karaca, Emin; Vergin, Canan; Aydınok, Yeşim; Özkınay, Ferda
2015-07-01
The Agean is one of the regions in Turkey where thalassemias and abnormal hemoglobins (Hbs) are prevalent. Combined heterozygosity of thalassemia mutations with a variety of structural Hb variants lead to an extremely wide spectrum of clinical and hematological phenotypes which is of importance for prenatal diagnosis. One hundred and seventeen patients and carriers diagnosed by hemoglobin electrophoresis (HPLC), at risk for abnormal hemoglobinopathies were screened for mutational analysis of the beta-globin gene. The full coding the 5' UTR, and the 3' UTR sequences of beta-globin gene (GenBank accession no. U01317) were amplified and sequenced. In this study, a total of 118 (12.24%) structural Hb variant alleles were identified in 1341 mutated beta-chain alleles in Medical Genetics Department of Ege University between January 2006 and November 2013. Here, we report the mutation spectrum of abnormal Hbs associated with the beta-globin gene in Aegean region of Turkey. In the present study, the Hb Hinsdale and Hb Andrew-Minneapolis variants are demonstrated for the first time in the Turkish population.
R. Calzolari (Roberta); T. McMorrow (Tara); N. Yannoutsos (Nikos); A. Langeveld (An); F.G. Grosveld (Frank)
1999-01-01
textabstractThe analysis of a number of cases of beta-globin thalassemia and hereditary persistence of fetal hemoglobin (HPFH) due to large deletions in the beta-globin locus has led to the identification of several DNA elements that have been implicated in the switch
Directory of Open Access Journals (Sweden)
Jorge S.B.
2003-01-01
Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.
Modares Sadeghi, Mehran; Shariati, Laleh; Hejazi, Zahra; Shahbazi, Mansoureh; Tabatabaiefar, Mohammad Amin; Khanahmad, Hossein
2018-03-01
β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia. © 2017 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Alexandra Agapidou
2018-01-01
Full Text Available Beta thalassemia dominant results from mutations in the β globin chain gene resulting in the production of elongated, highly unstable beta globin chains. Several such mutations have been described and in a heterozygous state they may confer a phenotype more severe than that of β thalassemia trait and lead to a clinical syndrome of thalassemia intermedia and its associated complications such as extramedullary hemopoiesis, bone disease, endocrinopathies and iron overload even in the absence of transfusion. In this report we present a case of double heterozygocity for HbC and β thalassemia dominant leading to a series of complications that were treated successfully once the correct diagnosis was made.
The entire β-globin gene cluster is deleted in a form of τδβ-thalassemia.
E.R. Fearon; H.H.Jr. Kazazian; P.G. Waber (Pamela); J.I. Lee (Joseph); S.E. Antonarakis; S.H. Orkin (Stuart); E.F. Vanin; P.S. Henthorn; F.G. Grosveld (Frank); A.F. Scott; G.R. Buchanan
1983-01-01
textabstractWe have used restriction endonuclease mapping to study a deletion involving the beta-globin gene cluster in a Mexican-American family with gamma delta beta-thalassemia. Analysis of DNA polymorphisms demonstrated deletion of the beta-globin gene from the affected chromosome. Using a DNA
Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto
2013-01-01
In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011
The role of fetal adrenal hormones in the switch from fetal to adult globin synthesis in the sheep.
Wintour, E M; Smith, M B; Bell, R J; McDougall, J G; Cauchi, M N
1985-01-01
The switch from gamma (fetal) to beta (adult) globin production was studied by the analysis of globin synthesis in chronically cannulated ovine fetuses and newborn lambs. The gamma/alpha globin synthesis ratio decreased from 0.98 +/- 0.11 (S.D.) (n = 4 samples) at 100-120 days of gestation to 0.15 +/- 0.07 (n = 4) in lambs of 150-156 days post-conception, and the beta/alpha synthesis ratio increased from 0.04 +/- 0.06 (n = 4) to 1.13 +/- 0.21 (n = 4) over the same period. In bilaterally adrenalectomized fetuses, which survived in utero until 151-156 days, the gamma/alpha and beta/alpha synthesis ratios were 0.64 +/- 0.14 (n = 3) and 0.25 +/- 0.07 (n = 3) respectively in the 150- to 156-day period. Bilateral adrenalectomy did not affect the time of onset of beta globin synthesis, but significantly decreased the rate. In one bilaterally adrenalectomized fetus the infusion of increasing concentrations of cortisol restored the rate of beta globin synthesis to normal. Treatment of three intact fetuses with 100 micrograms cortisol/h for 3 weeks, from 100 to 121 days, did not affect the timing or rate of switch from gamma to beta globin synthesis. Thus fetal adrenal secretions, probably cortisol, affected the rate of change of gamma to beta globin synthesis but other factors must have been involved in the initiation of the switch.
Position-independent high level expression of the human β-globin gene in transgenic mice.
F.G. Grosveld (Frank); G. Blom van Assendelft (Greet); D.R. Greaves (David); G. Kollias (George)
1987-01-01
textabstractWe have constructed a "minilocus" that contains the 5' and 3' flanking regions of the human beta-globin locus and the beta-globin gene. These regions are characterized by erythroid-specific DNAase I-superhypersensitive sites and are normally located approximately 50 kb 5' and 20 kb 3' of
DEFF Research Database (Denmark)
Leffers, H; Navarro, V M; Nielsen, John E
2006-01-01
Deterioration of reproductive health in human and wildlife species during the past decades has drawn considerable attention to the potential adverse effects of exposure to xenosteroids during sensitive periods of sex development. The hypothalamic-pituitary (HP) unit is a key element in the neuroe......Deterioration of reproductive health in human and wildlife species during the past decades has drawn considerable attention to the potential adverse effects of exposure to xenosteroids during sensitive periods of sex development. The hypothalamic-pituitary (HP) unit is a key element......, we screened for differentially expressed genes at the pituitary and hypothalamus of rats after neonatal exposure to estradiol benzoate. Our analyses identified persistent up-regulation of alpha- and beta-globin mRNAs at the pituitary following neonatal estrogenization. This finding was confirmed...... by combination of RT-PCR analyses and in situ hybridization. Induction of alpha- and beta-globin mRNA expression at the pituitary by neonatal exposure to estrogen was demonstrated as dose-dependent and it was persistently detected up to puberty. In contrast, durable up-regulation of alpha- and beta-globin genes...
International Nuclear Information System (INIS)
EL Serafi, T.I.; Ismail, E.F.; Mahmoud, M.A.; Mohamed, M.A.; Ghattas, M.H.; Badran, D.I.; El Serafi, I.T.; Mohamed, H.S.
2008-01-01
The beta-thalassemias (β- thalassemias) are among the most common autosomal recessive disorders. They have a remarkably high frequency in the Mediterranean region and represent one of the most common genetic diseases in Egypt. In this study, the spectrum of P- thalassemia mutations and genotype-to-phenotype correlations were defined in 32 β- thalassaemic patients (β- thalassemias major and intermedia) with varying disease severity in two cities of the Suez Canal region. Ten different mutations were identified and the most frequent ones were: Isi-6 (T-C) (37.5%), IVSI-110 (G-A) (34.4%) and both IVSI-1 (G-A), IVSII-745 (C-G) and -102 (C-G) (12.5% each). There was a wide spectrum of phenotypic severity in all patients. We studied the Xmnl polymorphism (C/T) in γ- globin gene position -158 of P- thalassemia as a modulating factor of the disease severity. Presence of the polymorphism was found in two patients and this was not sufficient to explain the diversity of the phenotype encountered. Co-inheritance of alpha thalassaemia as a modulating factor was not evident in our patients. In conclusion, we have been unable to find a molecular basis for the benign clinical course in all our patients. Other genetic or acquired factors must be hypothesized which ameliorate the clinical condition.
Beta-globin gene cluster haplotypes of Amerindian populations from the Brazilian Amazon region.
Guerreiro, J F; Figueiredo, M S; Zago, M A
1994-01-01
We have determined the beta-globin cluster haplotypes for 80 Indians from four Brazilian Amazon tribes: Kayapó, Wayampí, Wayana-Apalaí, and Arára. The results are analyzed together with 20 Yanomámi previously studied. From 2 to 4 different haplotypes were identified for each tribe, and 7 of the possible 32 haplotypes were found in a sample of 172 chromosomes for which the beta haplotypes were directly determined or derived from family studies. The haplotype distribution does not differ significantly among the five populations. The two most common haplotypes in all tribes were haplotypes 2 and 6, with average frequencies of 0.843 and 0.122, respectively. The genetic affinities between Brazilian Indians and other human populations were evaluated by estimates of genetic distance based on haplotype data. The lowest values were observed in relation to Asians, especially Chinese, Polynesians, and Micronesians.
Human γ-globin genes silenced independently of other genes in the β-globin locus.
N.O. Dillon (Niall); F.G. Grosveld (Frank)
1991-01-01
textabstractErythropoiesis during human development is characterized by switches in expression of beta-like globin genes during the transition from the embryonic through fetal to adult stages. Activation and high-level expression of the genes is directed by the locus control region (LCR), located 5'
Nuclear topography of beta-like globin gene cluster in IL-3-stimulated human leukemic K-562 cells
Czech Academy of Sciences Publication Activity Database
Galiová-Šustáčková, Gabriela; Bártová, Eva; Kozubek, Stanislav
2004-01-01
Roč. 33, č. 1 (2004), s. 4-14 ISSN 1079-9796 R&D Projects: GA ČR GA301/01/0186; GA AV ČR KSK5052113; GA AV ČR IAA5004306; GA ČR GA202/04/0907; GA MŠk ME 565 Institutional research plan: CEZ:AV0Z5004920 Keywords : beta-like globin gene cluster * K-562 cells * nuclear topography Subject RIV: BO - Biophysics Impact factor: 2.549, year: 2004
Two α1-Globin Gene Point Mutations Causing Severe Hb H Disease.
Jiang, Hua; Huang, Lv-Yin; Zhen, Li; Jiang, Fan; Li, Dong-Zhi
Hb H disease is generally a moderate form of α-thalassemia (α-thal) that rarely requires regular blood transfusions. In this study, two Chinese families with members carrying transfusion-dependent Hb H disease were investigated for rare mutations on the α-globin genes (HBA1, HBA2). In one family, Hb Zürich-Albisrieden [α59(E8)Gly→Arg; HBA1: c.178G>C] in combination with the Southeast Asian (- - SEA ) deletion was the defect responsible for the severe phenotype. In another family, a novel hemoglobin (Hb) variant named Hb Sichuan (HBA1: c.393_394insT), causes α-thal and a severe phenotype when associated with the - - SEA deletion. As these two HBA1 mutations can present as continuous blood transfusion-dependent α-thal, it is important to take this point into account for detecting the carriers, especially in couples in which one partner is already a known α 0 -thal carrier.
Directory of Open Access Journals (Sweden)
Marta Durlak
Full Text Available The identification of drugs capable of reactivating γ-globin to ameliorate β-thalassemia and Sickle Cell anemia is still a challenge, as available γ-globin inducers still have limited clinical indications. High-throughput screenings (HTS aimed to identify new potentially therapeutic drugs require suitable first-step-screening methods combining the possibility to detect variation in the γ/β globin ratio with the robustness of a cell line. We took advantage of a K562 cell line variant expressing β-globin (β-K562 to set up a new multiplexed high-content immunofluorescence assay for the quantification of γ- and β-globin content at single-cell level. The assay was validated by using the known globin inducers hemin, hydroxyurea and butyric acid and further tested in a pilot screening that confirmed HDACs as targets for γ-globin induction (as proved by siRNA-mediated HDAC3 knockdown and by treatment with HDACs inhibitors entinostat and dacinostat and identified Heme-oxygenases as novel candidate targets for γ-globin induction. Indeed, Heme-oxygenase2 siRNA knockdown as well as its inhibition by Tin protoporphyrin-IX (TinPPIX greatly increased γ-globin expression. This result is particularly interesting as several metalloporphyrins have already been developed for clinical uses and could be tested (alone or in combination with other drugs to improve pharmacological γ-globin reactivation for the treatment of β-hemoglobinopathies.
Molecular nature of alpha-globin genes in the Saudi population
Directory of Open Access Journals (Sweden)
J. Francis Borgio
2015-11-01
Full Text Available Alpha-thalassemia (α-thal is a disorder caused by the deletion of single or double α-globin genes, and/or point mutations in the α-globin genes. There are 2 common types of α-globin genes; HBA2 and HBA1. Recently, it has been discovered that the HBA2 gene is replaced by a unique HBA12 gene convert in 5.7% of the Saudi population. The α-globin genes have been emerging as a molecular target for the treatment of β-thalassemia (β-thal. Hence, it is essential to understand the molecular nature of α-globin genes to treat the most prevalent hemoglobin disorders, such as sickle cell disease, α-thal, and β-thal prevalent in the Kingdom of Saudi Arabia. Thirty-two different α-globin genotypes have been observed in the Saudi population. This review outlines the classification of the α-globin genes on the basis of their molecular nature and complex combinations of α-globin genes, and their variants predominant in Saudis.
Chamayou, S; Alecci, C; Ragolia, C; Giambona, A; Siciliano, S; Maggio, A; Fichera, M; Guglielmino, A
2002-05-01
In Italy, the autosomal recessive diseases beta-thalassaemia and sickle cell anaemia are so widespread that in some regions they can be defined as 'social diseases'. In this study, nine clinical applications of preimplantation genetic diagnosis (PGD) were performed for beta-thalassaemia and sickle cell anaemia on seven Sicilian couples and carriers of beta-globin gene mutations. The studied mutations were: Cd39, HbS, IVS1 nt1, IVS1 nt6 and IVS1 nt110. ICSI was performed with partner's sperm on 131 out of 147 retrieved oocytes, and this resulted in 72 zygotes; 32 embryos were successfully biopsied on day 3. The biopsied blastomeres were lysed and the beta-globin alleles amplified by nested PCR. The mutation diagnosis was performed by restriction enzyme digestion and reverse dot-blot. The amplification efficacy was 97.2%. The genotype study of non-transferred and surplus embryos showed that the allele drop-out rate was 8.6%. Seventeen embryos were transferred in utero on day 4. All couples received an embryo transfer; of the four pregnancies obtained, three resulted in live births and one miscarried at 11 weeks. Prenatal diagnosis at the 11th week and miscarriage material analysis confirmed the PGD results. These studies represent the first successful application of PGD for beta-thalassaemia and sickle cell anaemia in Italy.
Energy Technology Data Exchange (ETDEWEB)
Lin, S.D.; Cooper, P.; Fung, J.; Weier, H.U.G.; Rubin, E.M.
2000-03-01
Genetic factors affecting post-natal g-globin expression - a major modifier of the severity of both b-thalassemia and sickle cell anemia, have been difficult to study. This is especially so in mice, an organism lacking a globin gene with an expression pattern equivalent to that of human g-globin. To model the human b-cluster in mice, with the goal of screening for loci affecting human g-globin expression in vivo, we introduced a human b-globin cluster YAC transgene into the genome of FVB mice . The b-cluster contained a Greek hereditary persistence of fetal hemoglobin (HPFH) g allele resulting in postnatal expression of human g-globin in transgenic mice. The level of human g-globin for various F1 hybrids derived from crosses between the FVB transgenics and other inbred mouse strains was assessed. The g-globin level of the C3HeB/FVB transgenic mice was noted to be significantly elevated. To map genes affecting postnatal g-globin expression, a 20 centiMorgan (cM) genome scan of a C3HeB/F VB transgenics [prime] FVB backcross was performed, followed by high-resolution marker analysis of promising loci. From this analysis we mapped a locus within a 2.2 cM interval of mouse chromosome 1 at a LOD score of 4.2 that contributes 10.4% of variation in g-globin expression level. Combining transgenic modeling of the human b-globin gene cluster with quantitative trait analysis, we have identified and mapped a murine locus that impacts on human g-globin expression in vivo.
Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.
2015-01-01
Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726
Fong, Cristian; Lizarralde-Iragorri, María Alejandra; Rojas-Gallardo, Diana; Barreto, Guillermo
2013-12-01
Sickle cell anemia is a genetic disease with high prevalence in people of African descent. There are five typical haplotypes associated with this disease and the haplotypes associated with the beta-globin gene cluster have been used to establish the origin of African-descendant people in America. In this work, we determined the frequency and the origin of haplotypes associated with hemoglobin S in a sample of individuals with sickle cell anemia (HbSS) and sickle cell hemoglobin trait (HbAS) in coastal regions of Colombia. Blood samples from 71 HbAS and 79 HbSS individuals were obtained. Haplotypes were determined based on the presence of variable restriction sites within the β-globin gene cluster. On the Pacific coast of Colombia the most frequent haplotype was Benin, while on the Atlantic coast Bantu was marginally higher than Benin. Eight atypical haplotypes were observed on both coasts, being more diverse in the Atlantic than in the Pacific region. These results suggest a differential settlement of the coasts, dependent on where slaves were brought from, either from the Gulf of Guinea or from Angola, where the haplotype distributions are similar. Atypical haplotypes probably originated from point mutations that lost or gained a restriction site and/or by recombination events.
Kho, S L; Chua, K H; George, E; Tan, J A M A
2013-07-15
Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.
The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran
Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye
2017-01-01
Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378
Meireles, C M; Schneider, M P; Sampaio, M I; Schneider, H; Slightom, J L; Chiu, C H; Neiswanger, K; Gumucio, D L; Czelusniak, J; Goodman, M
1995-01-01
Conclusive evidence was provided that gamma 1, the upstream of the two linked simian gamma-globin loci (5'-gamma 1-gamma 2-3'), is a pseudogene in a major group of New World monkeys. Sequence analysis of PCR-amplified genomic fragments of predicted sizes revealed that all extant genera of the platyrrhine family Atelidae [Lagothrix (woolly monkeys), Brachyteles (woolly spider monkeys), Ateles (spider monkeys), and Alouatta (howler monkeys)] share a large deletion that removed most of exon 2, all of intron 2 and exon 3, and much of the 3' flanking sequence of gamma 1. The fact that two functional gamma-globin genes were not present in early ancestors of the Atelidae (and that gamma 1 was the dispensible gene) suggests that for much or even all of their evolution, platyrrhines have had gamma 2 as the primary fetally expressed gamma-globin gene, in contrast to catarrhines (e.g., humans and chimpanzees) that have gamma 1 as the primary fetally expressed gamma-globin gene. Results from promoter sequences further suggest that all three platyrrhine families (Atelidae, Cebidae, and Pitheciidae) have gamma 2 rather than gamma 1 as their primary fetally expressed gamma-globin gene. The implications of this suggestion were explored in terms of how gene redundancy, regulatory mutations, and distance of each gamma-globin gene from the locus control region were possibly involved in the acquisition and maintenance of fetal, rather than embryonic, expression. Images Fig. 2 PMID:7535927
Genetic recombination as a major cause of mutagenesis in the human globin gene clusters.
Borg, Joseph; Georgitsi, Marianthi; Aleporou-Marinou, Vassiliki; Kollia, Panagoula; Patrinos, George P
2009-12-01
Homologous recombination is a frequent phenomenon in multigene families and as such it occurs several times in both the alpha- and beta-like globin gene families. In numerous occasions, genetic recombination has been previously implicated as a major mechanism that drives mutagenesis in the human globin gene clusters, either in the form of unequal crossover or gene conversion. Unequal crossover results in the increase or decrease of the human globin gene copies, accompanied in the majority of cases with minor phenotypic consequences, while gene conversion contributes either to maintaining sequence homogeneity or generating sequence diversity. The role of genetic recombination, particularly gene conversion in the evolution of the human globin gene families has been discussed elsewhere. Here, we summarize our current knowledge and review existing experimental evidence outlining the role of genetic recombination in the mutagenic process in the human globin gene families.
A phylogenomic profile of globins
Directory of Open Access Journals (Sweden)
Dewilde Sylvia
2006-04-01
Full Text Available Abstract Background Globins occur in all three kingdoms of life: they can be classified into single-domain globins and chimeric globins. The latter comprise the flavohemoglobins with a C-terminal FAD-binding domain and the gene-regulating globin coupled sensors, with variable C-terminal domains. The single-domain globins encompass sequences related to chimeric globins and «truncated» hemoglobins with a 2-over-2 instead of the canonical 3-over-3 α-helical fold. Results A census of globins in 26 archaeal, 245 bacterial and 49 eukaryote genomes was carried out. Only ~25% of archaea have globins, including globin coupled sensors, related single domain globins and 2-over-2 globins. From one to seven globins per genome were found in ~65% of the bacterial genomes: the presence and number of globins are positively correlated with genome size. Globins appear to be mostly absent in Bacteroidetes/Chlorobi, Chlamydia, Lactobacillales, Mollicutes, Rickettsiales, Pastorellales and Spirochaetes. Single domain globins occur in metazoans and flavohemoglobins are found in fungi, diplomonads and mycetozoans. Although red algae have single domain globins, including 2-over-2 globins, the green algae and ciliates have only 2-over-2 globins. Plants have symbiotic and nonsymbiotic single domain hemoglobins and 2-over-2 hemoglobins. Over 90% of eukaryotes have globins: the nematode Caenorhabditis has the most putative globins, ~33. No globins occur in the parasitic, unicellular eukaryotes such as Encephalitozoon, Entamoeba, Plasmodium and Trypanosoma. Conclusion Although Bacteria have all three types of globins, Archaeado not have flavohemoglobins and Eukaryotes lack globin coupled sensors. Since the hemoglobins in organisms other than animals are enzymes or sensors, it is likely that the evolution of an oxygen transport function accompanied the emergence of multicellular animals.
Directory of Open Access Journals (Sweden)
Mir A Hossain
2016-01-01
Full Text Available Reactivation of γ-globin expression has been shown to ameliorate disease phenotypes associated with mutations in the adult β-globin gene, including sickle cell disease. Specific mutations in the promoter of the γ-globin genes are known to prevent repression of the genes in the adult and thus lead to hereditary persistence of fetal hemoglobin. One such hereditary persistence of fetal hemoglobin is associated with a sequence located 567 bp upstream of the Gγ-globin gene which assembles a GATA-containing repressor complex. We generated two synthetic zinc-finger DNA-binding domains (ZF-DBDs targeting this sequence. The -567Gγ ZF-DBDs associated with high affinity and specificity with the target site in the γ-globin gene promoter. We delivered the -567Gγ ZF-DBDs directly to primary erythroid cells. Exposure of these cells to the recombinant -567Gγ ZF-DBDs led to increased expression of the γ-globin gene. Direct protein delivery of ZF-DBDs that compete with transcription regulatory proteins will have broad implications for modulating gene expression in analytical or therapeutic settings.
Genetic disruption of the KLF1 gene to overexpress the γ-globin gene using the CRISPR/Cas9 system.
Shariati, Laleh; Khanahmad, Hossein; Salehi, Mansoor; Hejazi, Zahra; Rahimmanesh, Ilnaz; Tabatabaiefar, Mohammad Amin; Modarressi, Mohammad Hossein
2016-10-01
β-thalassemia comprises a major group of human genetic disorders involving a decrease in or an end to the normal synthesis of the β-globin chains of hemoglobin. KLF1 is a key regulatory molecule involved in the γ- to β-globin gene switching process directly inducing the expression of the β-globin gene and indirectly repressing γ-globin. The present study aimed to investigate the ability of an engineered CRISPR/Cas9 system with respect to disrupting the KLF1 gene to inhibit the γ- to β-hemoglobin switching process in K562 cells. We targeted three sites on the KLF1 gene, two of which are upstream of codon 288 in exon 2 and the other site being in exon 3. The average indel percentage in the cells transfected with CRISPR a, b and c was approximately 24%. Relative quantification was performed for the assessment of γ-globin expression. The levels of γ-globin mRNA on day 5 of differentiation were 8.1-, 7.7- and 1.8-fold in the cells treated with CRISPR/Cas9 a, b and c, respectively,compared to untreated cells. The measurement of HbF expression levels confirmed the same results. The findings obtained in the present study support the induction of an indel mutation in the KLF1 gene leading to a null allele. As a result, the effect of KLF1 on the expression of BCL11A is decreased and its inhibitory effect on γ-globin gene expression is removed. Application of CRISPR technology to induce an indel in the KLF1 gene in adult erythroid progenitors may provide a method for activating fetal hemoglobin expression in individuals with β-thalassemia or sickle cell disease. Copyright © 2016 John Wiley & Sons, Ltd.
Stabilization of beta-catenin induces pancreas tumor formation.
Heiser, Patrick W; Cano, David A; Landsman, Limor; Kim, Grace E; Kench, James G; Klimstra, David S; Taketo, Maketo M; Biankin, Andrew V; Hebrok, Matthias
2008-10-01
beta-Catenin signaling within the canonical Wnt pathway is essential for pancreas development. However, the pathway is normally down-regulated in the adult organ. Increased cytoplasmic and nuclear localization of beta-catenin can be detected in nearly all human solid pseudopapillary neoplasms (SPN), a rare tumor with low malignant potential. Conversely, pancreatic ductal adenocarcinoma (PDA) accounts for the majority of pancreatic tumors and is among the leading causes of cancer death. Whereas activating mutations within beta-catenin and other members of the canonical Wnt pathway are rare, recent reports have implicated Wnt signaling in the development and progression of human PDA. Here, we sought to address the role of beta-catenin signaling in pancreas tumorigenesis. Using Cre/lox technology, we conditionally activated beta-catenin in a subset of murine pancreatic cells in vivo. Activation of beta-catenin results in the formation of large pancreatic tumors at a high frequency in adult mice. These tumors resemble human SPN based on morphologic and immunohistochemical comparisons. Interestingly, stabilization of beta-catenin blocks the formation of pancreatic intraepithelial neoplasia (PanIN) in the presence of an activating mutation in Kras that is known to predispose individuals to PDA. Instead, mice in which beta-catenin and Kras are concurrently activated develop distinct ductal neoplasms that do not resemble PanIN lesions. These results demonstrate that activation of beta-catenin is sufficient to induce pancreas tumorigenesis. Moreover, they indicate that the sequence in which oncogenic mutations are acquired has profound consequences on the phenotype of the resulting tumor.
Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M
2014-05-13
Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.
In silico analysis of single nucleotide polymorphism (SNPs in human β-globin gene.
Directory of Open Access Journals (Sweden)
Mohammed Alanazi
Full Text Available Single amino acid substitutions in the globin chain are the most common forms of genetic variations that produce hemoglobinopathies--the most widespread inherited disorders worldwide. Several hemoglobinopathies result from homozygosity or compound heterozygosity to beta-globin (HBB gene mutations, such as that producing sickle cell hemoglobin (HbS, HbC, HbD and HbE. Several of these mutations are deleterious and result in moderate to severe hemolytic anemia, with associated complications, requiring lifelong care and management. Even though many hemoglobinopathies result from single amino acid changes producing similar structural abnormalities, there are functional differences in the generated variants. Using in silico methods, we examined the genetic variations that can alter the expression and function of the HBB gene. Using a sequence homology-based Sorting Intolerant from Tolerant (SIFT server we have searched for the SNPs, which showed that 200 (80% non-synonymous polymorphism were found to be deleterious. The structure-based method via PolyPhen server indicated that 135 (40% non-synonymous polymorphism may modify protein function and structure. The Pupa Suite software showed that the SNPs will have a phenotypic consequence on the structure and function of the altered protein. Structure analysis was performed on the key mutations that occur in the native protein coded by the HBB gene that causes hemoglobinopathies such as: HbC (E→K, HbD (E→Q, HbE (E→K and HbS (E→V. Atomic Non-Local Environment Assessment (ANOLEA, Yet Another Scientific Artificial Reality Application (YASARA, CHARMM-GUI webserver for macromolecular dynamics and mechanics, and Normal Mode Analysis, Deformation and Refinement (NOMAD-Ref of Gromacs server were used to perform molecular dynamics simulations and energy minimization calculations on β-Chain residue of the HBB gene before and after mutation. Furthermore, in the native and altered protein models, amino acid
International Nuclear Information System (INIS)
Melis, M.; Demopulos, G.; Najfeld, V.; Zhang, J.W.; Brice, M.; Papayannopoulou, T.; Stamatoyannopoulos, G.
1987-01-01
Hybrids formed by fusing mouse erythroleukemia (MEL) cells with human fetal erythroid cells produce human fetal globin, but they switch to adult globin production as culture time advances. To obtain information on the chromosomal assignment of the elements that control γ-to-β switching, the authors analyzed the chromosomal composition of hybrids producing exclusively or predominantly human fetal globin and hybrids producing only adult human globin. No human chromosome was consistently present in hybrids expressing fetal globin and consistently absent in hybrids expressing adult globin. Subcloning experiments demonstrated identical chromosomal compositions in subclones displaying the fetal globin program and those that had switched to expression of the adult globin program. These data indicate that retention of only one human chromosome -- i.e., chromosome 11 -- is sufficient for expression of human fetal globin and the subsequent γ-to-β switch. The results suggest that the γ-to-β switch is controlled either cis to the β-globin locus of by a trans-acting mechanism, the genes of which reside on human chromosome 11
International Nuclear Information System (INIS)
Nandi, A.K.; Roginski, R.S.; Gregg, R.G.; Smithies, O.; Skoultchi, A.I.
1988-01-01
The authors have examined the effect of the site of integration on the expression of cloned genes introduced into cultured erythroid cells. Smithies et al. reported the targeted integration of DNA into the human β-globin locus on chromosome 11 in a mouse erythroleukemia-human cell hybrid. These hybrid cells can undergo erythroid differentiation leading to greatly increased mouse and human β-globin synthesis. By transfection of these hybrid cells with a plasmid carrying a modified human β-globin gene and a foreign gene composed of the coding sequence of the bacterial neomycin-resistance gene linked to simian virus 40 transcription signals (SVneo), cells were obtained in which the two genes are integrated at the β-globin locus on human chromosome 11 or at random sites. When they examined the response of the integrated genes to cell differentation, they found that the genes inserted at the β-globin locus were induced during differentiation, whereas randomly positioned copies were not induced. Even the foreign SVneo gene was inducible when it had been integrated at the β-globin locus. The results show that genes introduced at the β-globin locus acquire some of the regulatory properties of globin genes during erythroid differentiation
Directory of Open Access Journals (Sweden)
Weiqun Lu
2011-01-01
Full Text Available In order to understand the possible role of globin genes in fish salinity adaptation, we report the molecular characterization and expression of all four subunits of haemoglobin, and their response to salinity challenge in flounder. The entire open reading frames of α1-globin and α2-globin genes were 432 and 435 bp long, respectively, whereas the β1-globin and β2-globin genes were both 447 bp. Although the head kidney (pronephros is the predicted major site of haematopoiesis, real-time PCR revealed that expression of α-globin and β-globin in kidney (mesonephros was 1.5 times higher than in head kidney. Notably, the α1-globin and β1-globin mRNA expression was higher than α2-globin and β2-globin in kidney. Expression levels of all four globin subunits were higher in freshwater- (FW- than in seawater- (SW-adapted fish kidney. If globins do play a role in salinity adaptation, this is likely to be more important in combating the hemodilution faced by fish in FW than the dehydration and salt loading which occur in SW.
Babiss, L E; Friedman, J M; Darnell, J E
1986-01-01
In the accompanying paper (Friedman et al., Mol. Cell. Biol. 6:3791-3797, 1986), hepatoma-specific expression of the rat albumin promoter within the adenovirus genome was demonstrated. However, the rate of transcription was very low compared with that of the endogenous chromosomal albumin gene. Here we show that in hepatoma cells the adenovirus E1A enhancer, especially in the presence of E1A protein, greatly stimulates transcription from the albumin promoter but not the mouse beta-globin prom...
A membrane-bound vertebrate globin.
Directory of Open Access Journals (Sweden)
Miriam Blank
Full Text Available The family of vertebrate globins includes hemoglobin, myoglobin, and other O(2-binding proteins of yet unclear functions. Among these, globin X is restricted to fish and amphibians. Zebrafish (Danio rerio globin X is expressed at low levels in neurons of the central nervous system and appears to be associated with the sensory system. The protein harbors a unique N-terminal extension with putative N-myristoylation and S-palmitoylation sites, suggesting membrane-association. Intracellular localization and transport of globin X was studied in 3T3 cells employing green fluorescence protein fusion constructs. Both myristoylation and palmitoylation sites are required for correct targeting and membrane localization of globin X. To the best of our knowledge, this is the first time that a vertebrate globin has been identified as component of the cell membrane. Globin X has a hexacoordinate binding scheme and displays cooperative O(2 binding with a variable affinity (P(50∼1.3-12.5 torr, depending on buffer conditions. A respiratory function of globin X is unlikely, but analogous to some prokaryotic membrane-globins it may either protect the lipids in cell membrane from oxidation or may act as a redox-sensing or signaling protein.
Phenotypic variability of Filipino beta(o)-thalassemia/HbE patients in Indonesia.
Setianingsih, I; Williamson, R; Daud, D; Harahap, A; Marzuki, S; Forrest, S
1999-09-01
Three Indonesian patients with identical genotypes, each compound heterozygotes for Filipino beta(o)-thalassemia/HbE, expressed different clinical severities. One patient has mild disease and is transfusion independent, while the other two are severely affected and transfusion dependent. The size of the Filipino beta(o)-globin gene deletion was confirmed to be 45 kb, resolving conflicting values given in the literature. Neither ameliorating genetic factors such as alpha-globin gene deletions or the XmnI restriction site polymorphism at position -158 upstream of the (G)gamma-globin gene, nor differences in beta-globin gene haplotype, explain the phenotypic variation. These observations have implications for the development of antenatal diagnosis in Indonesia, as at present it is not possible to give an accurate prediction of severity of phenotype for this common genotype. Copyright 1999 Wiley-Liss, Inc.
Synthetic review on the different anthropological aspects of ...
African Journals Online (AJOL)
Hemoglobinopathies are a group of hereditary hemolytic anemia characterized by qualitative (sickle cell disease) or quantitative (thalassemia) defects in the alpha or beta-globin chain synthesis. Homozygotes or compound heterozygotes for the mutated alpha or beta-globin genes can cause severe anemia at an early age.
Fucharoen, Goonnapa; Fucharoen, Supan; Singsanan, Sanita; Sanchaisuriya, Kanokwan
2007-05-01
We describe hematological and molecular characterization of a Thai female who had Southeast Asian ovalocytosis (SAO) associated with beta+-thalassemia trait. The proband had mild microcytosis with Hb 12.9 g/dl, Hct 35.8%, MCV 74.4 fl, MCH 26.8 pg, MCHC 36.0 g/dl, and elevated Hb A2 (5.6%), characteristics of beta-thalassemia trait. Peripheral blood film examination revealed prominent ovalocytosis. However, a one-tube osmotic fragility (OF) test commonly used for thalassemia screening was negative and a normal OF curve was observed. Further polymerase chain reaction (PCR) analyses identified the beta(-28A-G) mutation in the beta-globin gene and a 27 bp deletion in erythrocyte band 3 protein gene, indicating a genetically compound heterozygote. Hematological data of the proband was comparatively presented with those of eight female and 15 male carriers of pure beta-thalassemia with the same mutation. The finding demonstrates that although the association of the SAO and beta-thalassemia does not produce a more severe clinical picture, this could lead to a mis-screening of beta-thalassemia using an OF test as a primary screening test. Additional blood film examination followed by PCR could help in the detection of this unusual genetic interaction in the region. (c) 2006 Wiley-Liss, Inc.
International Nuclear Information System (INIS)
Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru
2004-01-01
The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells
Assessing the relative stabilities of engineered hemoglobins using electrospray mass spectrometry.
Apostol, I
1999-07-15
An ion trap mass spectrometer equipped with an electrospray source was used to examine the relative thermodynamic stabilities of various hemoglobins with respect to both tetramer dissociation and hemin dissociation. The results demonstrated that the stability of hemoglobin molecules can be differentiated by the amount of applied collision-induced dissociation (CID) energy necessary to break up the intact tetramer into its constituent globins. The stability of the intact tetramer was affected by single mutations in the beta-globins. The stabilities of the constituent hologlobins were assessed via trap CID of selected ions. The results demonstrated the importance of the contributions of the hologlobin components to the stability of the intact tetramer. Genetic fusion of two alpha-globins, through the introduction of a single glycine residue between the C-terminus of one alpha-chain and the N-terminus of the second, significantly increased the stability of the hemoglobin pseudo-tetramer. Chemical crosslinking of the beta-globins in addition to genetic fusion of alpha-globins further stabilized the hemoglobin molecule. A dihemoglobin molecule produced by the genetic fusion of two di-alpha-globins with a flexible linker demonstrated a decreased stability relative to the corresponding monohemoglobin. Copyright 1999 Academic Press.
International Nuclear Information System (INIS)
Evans, T.; Reitman, M.; Felsenfeld, G.
1988-01-01
The authors have identified a protein present only in erythroid cells that binds to two adjacent sites within an enhancer region of the chicken β-globin locus. Mutation of the sites, so that binding by the factor can no longer be detected in vitro, leads to a loss of enhancing ability, assayed by transient expression in primary erythrocytes. Binding sites for the erythroid-specific factor (Eryf1) are found within regulatory regions for all chicken globin genes. A strong Eryf1 binding site is also present within the enhancer of at least one human globin gene, and proteins from human erythroid cells (but not HeLa cells) bind to both the chicken and the human sites
Cai, Ren; Li, Liyan; Liang, Xin; Liu, Zhongying; Su, Liu; Li, Wenjun; Zhu, Qiangui; Mo, Qiuhua; Pan, Lizhen; Ouyang, Hong; Huang, Lihua; Xu, Xiangmin
2002-08-01
To investigate the gene frequencies and mutation patterns of alpha thalassemia (alpha-thal) and beta thalassemia (beta-thal) in Liuzhou city of Guangxi Zhuang Autonomous Region. Cluster sampling was used. A total of 1 028 of umbilical blood samples were collected for a prevalence study of alpha-thal and a total of 1 312 healthy young people when receiving pre-marriage consultation were recruited for a beta-thal prevalence survey. Individuals live in city or town area of Liuzhou. A complete blood count as well as hemoglobin electrophoresis analysis were done in all of samples for phenotyping of alpha and beta-thals. Those with Hb Bart's for alpha-thal indicator and those with both microcytosis (MCV /=4.0%) for beta-thal were further studied by DNA analysis. PCR-based methodologies were used to characterize the mutation contributions of alpha and beta-thals. All the subjects were tested for the state of carrying beta-thala alleles for evaluating the situation of the compound heterozygotes of alpha-thal with beta-thal. Of 1 028 random samples of umbilical blood screened, 112 of subjects were defined to be the gene carriers of alpha-thal. The alpha-thal carrier rate was as high as 11.19% including 3 compound heterozygotes. Five well-known types of alpha-thal alleles were detected with gene contributions of 37.4% (--(SEA) deletion), 31.3% (-alpha(3.7) deletion), 17.4% (-alpha(4.2) deletion), 12.1% (alpha(CS)alpha mutation), and 0.9% (alpha(QS)alpha mutation), successively. Of the 1 312 adult specimens studied, 89 with beta-thal including 14 of the compound higher Hb F subjects were detected. All of the 89 phenotypic beta-thal carriers had the mutations in the beta-globin gene, making the overall prevalence 6.78%. The commonly seen three mutations, beta CD41 - 42 (-CTTT) frameshift, beta CD17 (T-A) nonsense mutation and beta-28 (A-G) promoter variation were accounted for 90% of the beta-thal alleles in Liuzhou. Of these beta-thal subjects, 16 (accounting for 18%) were
[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].
Harano, K; Harano, T; Kushida, Y; Ueda, S
1991-08-01
Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.
Ugozzoli, L A; Lowery, J D; Reyes, A A; Lin, C I; Re, A; Locati, F; Galanello, R; Macioni, L; Maggio, A; Giambona, A; Loutradi, A; Boussiou, M; Wallace, R B
1998-11-01
We describe the evaluation of the Bio-Rad BeTha Gene 1 kit (Bio-Rad Laboratories, Hercules, CA), a DNA-probe assay designed for the qualitative determination of the eight most common Mediterranean beta-thalassemia mutations. The kit utilizes the principle of allele-specific oligonucleotide (ASO) hybridization. Following sample preparation and in vitro DNA amplification by the polymerase chain reaction (PCR), an allele-specific detection of the amplified products by a nonradioactive enzymatic assay is performed. Genomic DNA is prepared from an individual's whole blood with a DNA purification matrix. In a second step, the beta-globin gene is amplified in a multiplex PCR reaction containing four 5' biotinylated oligonucleotide primers. In a final step, an aliquot of the PCR reaction is first chemically denatured and then captured in two eight-well strips of a 96-well enzyme-linked immunosorbent assay (ELISA) plate by hybridization to an immobilized ASO probe. Each DNA sequence at each of the eight mutation sites is represented by one normal and one mutant ASO. During this capture/hybridization step, which is performed at 37 degrees C, only perfectly matched PCR products will be captured by an ASO. Subsequently, the allele-specific captured biotin-labeled PCR products are detected by a colorimetric enzymatic reaction. The system permits the detection of 16 beta-thalassemia alleles using a high-throughput format that can be automated easily. A clinical feasibility study was performed to evaluate the functionality (method comparison study, assay validity using samples previously collected and stored at various temperatures for different periods of time, interference on kit performance, and assay validity for prenatal diagnosis) and the usability (ease of use, sample throughput) of the kit. The analysis of 110 samples previously studied with reference methods showed 100% clinical sensitivity and specificity. We demonstrate here that the procedure not only increases the
Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.
2011-01-01
Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418
Fucharoen, Suthat; Inati, Adlette; Siritanaratku, Noppadol; Thein, Swee Lay; Wargin, William C.; Koussa, Suzanne; Taher, Ali; Chaneim, Nattawara; Boosalis, Michael; Berenson, Ronald; Perrine, Susan P.
2014-01-01
β–thalassemia intermedia syndromes (BTI) cause hemolytic anemia, ineffective erythropoiesis, and widespread complications. Higher fetal globin expression within genotypes reduces globin imbalance and ameliorates anemia. Sodium 2,2 dimethylbutyrate (HQK-1001), an orally bioavailable short-chain fatty acid derivative, induces γ-globin expression experimentally and is well-tolerated in normal subjects. Accordingly, a randomized, blinded, placebo-controlled, Phase I/II trial was performed in 21 adult BTI patients (14 with HbE/β0 thalassemia and 7 with β+/β0 thalassemia intermedia, to determine effective doses for fetal globin induction, safety, and tolerability. HQK-1001 or placebo were administered once daily for 8 weeks at four dose levels (10, 20, 30, or 40 mg/kg/day), and subjects were monitored for laboratory and clinical events. Pharmacokinetic profiles demonstrated a t1/2 of 10–12 hours. Adverse events with HQK-1001 treatment were not significantly different from placebo treatment. Median HbF increased with the 20 mg/kg treatment doses above baseline levels by 6.6% and 0.44 g/dL (p <0.01) in 8/9 subjects; total hemoglobin (Hgb) increased by a mean of 1.1 gm/dL in 4/9 subjects. These findings identify a safe oral therapeutic which induces fetal globin in BTI. Further investigation of HQK-1001 with longer dosing to definitively evaluate its hematologic potential appears warranted. PMID:23530969
Insulin inhibits amyloid beta-induced cell death in cultured human brain pericytes
Rensink, Annemieke A M; Otte-Höller, Irene; de Boer, Roelie; Bosch, Remko R; ten Donkelaar, Hans J; de Waal, Robert M W; Verbeek, Marcel M; Kremer, Berry
Amyloid-beta (Abeta) deposition in the cerebral arterial and capillary walls is one of the characteristics of Alzheimer's disease and hereditary cerebral hemorrhage with amyloidosis-Dutch type. In vitro, Abeta1-40, carrying the "Dutch" mutation (DAbeta1-40), induced reproducible degeneration of
Directory of Open Access Journals (Sweden)
Ravindra Kumar
2013-01-01
Full Text Available There are an estimated 45 million carriers of β-thalassemia trait and about 12,000-15,000 infants with β-thalassemia major are born every year in India. The consanguinity rates are higher in India, and thalassemia major constitutes a significant burden on the health care system. In present study, β-thalassemia mutations were characterized in 300 thalassemia cases from 2007 to 2010 using ARMS-PCR and DNA sequencing. The five most common mutations accounted 79.3% of the studied chromosomes that includes IVS1-5(G>C, Cod 41-42(-TCTT, Cod8-9(+G, Cod16(-C and 619bp del. Though IVS1-5(G>C is most common mutation when all the communities were included, the percentage prevalence were calculated on sub caste basis and found that IVS1-5(G>C percentage prevalence varied from 25 to 60 in Aroras & Khatris and Thakur respectively. Interestingly Cod41-42(-TCTT mutation which is the second commonest among the mutations reported was totally absent in Kayasthas and Muslim community. These findings have implications for providing molecular diagnosis, genetic counseling and prenatal diagnosis to high risk couples of β-thalassemia.
Bradykinin stimulation of nitric oxide production is not sufficient for gamma-globin induction
Directory of Open Access Journals (Sweden)
Čokić Vladan P.
2014-01-01
Full Text Available Introduction. Hydroxycarbamide, used in therapy of hemoglobinopathies, enhances nitric oxide (NO production both in primary human umbilical vein endothelial cells (HUVECs and human bone marrow endothelial cell line (TrHBMEC. Moreover, NO increases γ-globin and fetal hemoglobin levels in human erythroid progenitors. Objective. In order to find out whether simple physiologic stimulation of NO production by components of hematopoietic microenvironment can increase γ-globin gene expression, the effects of NO-inducer bradykinin were examined in endothelial cells. Methods. The study was performed in co-cultures of human erythroid progenitors, TrHBMEC and HUVECs by ozone-based chemiluminescent determination of NO and real-time quantitative RT-PCR. Results. In accordance with previous reports, the endogenous factor bradykinin increased endothelial cell production of NO in a dose- and time-dependent manner (0.1-0.6 μM up to 30 minutes. This induction of NO in HUVECs and TrHBMEC by bradykinin was blocked by competitive inhibitors of NO synthase (NOS, demonstrating NOS-dependence. It has been shown that bradykinin significantly reduced endothelial NOS (eNOS mRNA level and eNOS/Я-actin ratio in HUVEC (by twofold. In addition, bradykinin failed to increase γ-globin mRNA expression in erythroid progenitors only, as well as in co-culture studies of erythroid progenitors with TrHBMEC and HUVEC after 24 hours of treatment. Furthermore, bradykinin did not induce γ/β globin ratio in erythroid progenitors in co-cultures with HUVEC. Conclusion. Bradykinin mediated eNOS activation leads to short time and low NO production in endothelial cells, insufficient to induce γ-globin gene expression. These results emphasized the significance of elevated and extended NO production in augmentation of γ-globin gene expression. [Projekat Ministarstva nauke Republike Srbije, br. 175053
Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies
Loucari, Constantinos C.; Patsali, Petros; van Dijk, Thamar B.; Stephanou, Coralea; Papasavva, Panayiota; Zanti, Maria; Kurita, Ryo; Nakamura, Yukio; Christou, Soteroulla; Sitarou, Maria; Philipsen, Sjaak; Lederer, Carsten W.; Kleanthous, Marina
2018-01-01
The β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of induced or exogenous β-like globins. Reversed-phase high-performance liquid chromatography (HPLC) allows versatile and inexpensive globin quantification, but commonly applied protocols suffer from long run times, high sample requirements, or inability to separate murine from human β-globin chains. The latter point is problematic for in vivo studies with gene-addition vectors in murine disease models and mouse/human chimeras. This study demonstrates HPLC-based measurements of globin expression (1) after differentiation of the commonly applied human umbilical cord blood–derived erythroid progenitor-2 cell line, (2) in erythroid progeny of CD34+ cells for the analysis of clustered regularly interspaced short palindromic repeats/Cas9-mediated disruption of the globin regulator BCL11A, and (3) of transgenic mice holding the human β-globin locus. At run times of 8 min for separation of murine and human β-globin chains as well as of human γ-globin chains, and with routine measurement of globin-chain ratios for 12 nL of blood (tested for down to 0.75 nL) or of 300,000 in vitro differentiated cells, the methods presented here and any variant-specific adaptations thereof will greatly facilitate evaluation of novel therapy applications for β-hemoglobinopathies. PMID:29325430
International Nuclear Information System (INIS)
Helder, J.; Deisseroth, A.
1987-01-01
The loss of α-globin gene transcriptional activity rarely occurs as an acquired abnormality during the evolution of myeloproliferative disease or preleukemia. To test whether the mutation responsible for the loss of α-globin gene expression (hemoglobin H disease) in these patients is linked with the α-globin genes on chromosome 16, the authors transferred chromosome 16 from preleukemic patients with acquired hemoglobin H disease to mouse erythroleukemia cells and measured the transcriptional activity of the human α-globin genes. After transfer to mouse erythroleukemia cells, the expression of human α-globin genes from the peripheral blood or marrow cells of preleukemic patients with acquired hemoglobin H disease was similar to that of human α-globin genes transferred to mouse erythroleukemia cells from normal donors. These data showed that factor(s) in the mouse erythroleukemia cell can genetically complement the α-globin gene defect in these preleukemia patients with acquired hemoglobin H disease and suggest that altered expression of a gene in trans to the α-globin gene may be responsible for the acquisition of hemoglobin H disease in these patients
International Nuclear Information System (INIS)
Liebhaber, S.A.; Weiss, I.; Cash, F.E.; Griese, E.U.; Horst, J.; Ayyub, H.; Higgs, D.R.
1990-01-01
Synthesis of normal human hemoglobin A, α 2 β 2 , is based upon balanced expression of genes in the α-globin gene cluster on chromosome 15 and the β-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the β-globin cluster depend on sequences located at a considerable distance 5' to the β-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the α-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with α-thalassemia in whom structurally normal α-globin genes have been inactivated in cis by a discrete de novo 35-kilobase deletion located ∼30 kilobases 5' from the α-globin gene cluster. They conclude that this deletion inactivates expression of the α-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the α-globin genes
A New Intergenic α-Globin Deletion (α-αΔ125) Found in a Kabyle Population.
Singh, Amrathlal Rabbind; Lacan, Philippe; Cadet, Estelle; Bignet, Patricia; Dumesnil, Cécile; Vannier, Jean-Pierre; Joly, Philippe; Rochette, Jacques
2016-01-01
We have identified a deletion of 125 bp (α-α(Δ125)) (NG_000006.1: g.37040_37164del) in the α-globin gene cluster in a Kabyle population. A combination of singlex and multiplex polymerase chain reaction (PCR)-based assays have been used to identify the molecular defect. Sequencing of the abnormal PCR amplification product revealed a novel α1-globin promoter deletion. The endpoints of the deletion were characterized by sequencing the deletion junctions of the mutated allele. The observed deletion was located 378 bp upstream of the α1-globin gene transcription initiation site and leaves the α2 gene intact. In some patients, the α-α(Δ125) deletion was shown to segregate with Hb S (HBB: c.20A>T) and/or Hb C (HBB: c.19G>A) or a β-thalassemic allele. The α-α(Δ125) deletion has no discernible effect on red cell indices when inherited with no other abnormal globin genes. The family study demonstrated that the deletion is heritable. This is the only example of an intergenic α2-α1 non coding DNA deletion, leaving the α2-globin gene and the α1 coding part intact.
Chattong, S; Ruangwattanasuk, O; Yindeedej, W; Setpakdee, A; Manotham, K
2017-07-01
In humans, mutations in the β-globin gene (HBB) have two important clinical manifestations: β-thalassemia and sickle cell disease. The progress in genome editing and stem cell research may be relevant to the treatment of β-globin-related diseases. In this work, we employed zinc-finger nuclease (ZFN)-mediated gene integration of synthetic β-globin cDNA into HBB loci, thus correcting almost all β-globin mutations. The integration was achieved in both HEK 293 cells and isolated dental pulp stem cell (DPSCs). We also showed that DPSCs with an artificial gene knock-in were capable of generating stable six-cell clones and were expandable at least 10 8 -fold; therefore, they may serve as a personalized stem cell factory. In addition, transfection with non-integrated pCAG-hOct4 and culturing in a conditioned medium converted the genome-edited DPSCs to CD34 + HSC-like cells. We believe that this approach may be useful for the treatment of β-globin-related diseases, especially the severe form of β-thalassemia.
Mediterranean anemia; Cooley anemia; Beta thalassemia; Alpha thalassemia ... alpha globin protein are missing or changed (mutated). Beta thalassemia occurs when similar gene defects affect production of ...
Song, Bing; Fan, Yong; He, Wenyin; Zhu, Detu; Niu, Xiaohua; Wang, Ding; Ou, Zhanhui; Luo, Min; Sun, Xiaofang
2015-05-01
The generation of beta-thalassemia (β-Thal) patient-specific induced pluripotent stem cells (iPSCs), subsequent homologous recombination-based gene correction of disease-causing mutations/deletions in the β-globin gene (HBB), and their derived hematopoietic stem cell (HSC) transplantation offers an ideal therapeutic solution for treating this disease. However, the hematopoietic differentiation efficiency of gene-corrected β-Thal iPSCs has not been well evaluated in the previous studies. In this study, we used the latest gene-editing tool, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9), to correct β-Thal iPSCs; gene-corrected cells exhibit normal karyotypes and full pluripotency as human embryonic stem cells (hESCs) showed no off-targeting effects. Then, we evaluated the differentiation efficiency of the gene-corrected β-Thal iPSCs. We found that during hematopoietic differentiation, gene-corrected β-Thal iPSCs showed an increased embryoid body ratio and various hematopoietic progenitor cell percentages. More importantly, the gene-corrected β-Thal iPSC lines restored HBB expression and reduced reactive oxygen species production compared with the uncorrected group. Our study suggested that hematopoietic differentiation efficiency of β-Thal iPSCs was greatly improved once corrected by the CRISPR/Cas9 system, and the information gained from our study would greatly promote the clinical application of β-Thal iPSC-derived HSCs in transplantation.
Renal tubular dysfunction nephrocalcinosis in a patient with BetaThalassemia Minor
International Nuclear Information System (INIS)
Prabahar, M.R.; Jain, M.; Chandrasekaran, V.; Indumathi, E.; Soundrarajan, P.
2008-01-01
Thalassemia is a hereditary anemia resulting from defect in hemoglobinproduction. Beta thalassemia is due to impaired production. Beta thalassemiais due to impaired production of beta globin chains, leading to a relativeexcess of alpha globin chains. The term beta thalassemia minor is used todescribe heterozygotes, who carry one normal beta globin and one betathalassemic allele. The vast majority of these patients are asymptomatic.However, a variety of renal tubular abnormalities including hypercaliuria,hypomagnesemia with renal magnesium wasting, decreased tubular absorption ofphosphorous, hypouricemia with renal uric acid wasting, renal glycosuria andtubular proteinuria have been described even in patients with betathalassemia minor. We here in report a 24-year old patient who was found tohave thalassemia minor and nephrocalcinosis with evidence of renal tubulardysfunction. Investigations revealed normal renal function, hypercalciuria,reduced tubular reabsorption of phosphorous, hypomagnesemia and renalmagnesium wasting. Screening for aminoaciduria was found to be negative. Anacid loading test revealed normal urinary acidification. Ultrasonogram of theabdomen revealed nephrocalcinosis and splenomegaly. Detailed work up foranemia showed normal white cell and platelet count while peripheral smearshowed microcytic hypochromic anemia with few target cells. Hemoglobinelectrophoresis revealed hemoglobin A of 92%, hemoglobin A2 of 6.2% andhemoglobin F of 1.8% consistent with beta thalassemia minor. Her parentalscreening was normal. A diagnosis of beta thalassemia minor with renaltubular dysfunction was made and the patient was started on thiazidediuretics to reduce hypercalciuria and advised regular follow-up. (author)
Studies of globin gene expression in differentiating erythroid cells
International Nuclear Information System (INIS)
Sullivan, T.D.
1985-01-01
The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation
A. Wai (Albert); N. Gillemans (Nynke); S. Raguz-Bolognesi (Selina); S. Pruzina (Sara); G. Zafarana (Gaetano); D.N. Meijer (Dies); F.G. Grosveld (Frank); J.N.J. Philipsen (Sjaak)
2003-01-01
textabstractElements with insulator/border activity have been characterized most extensively in Drosophila melanogaster. In vertebrates, the first example of such an element was provided by a hypersensitive site of the chicken beta-globin locus, cHS4. It has been proposed that the homologous site in
Infusion of Autologous Retrodifferentiated Stem Cells into Patients with Beta-Thalassemia
Directory of Open Access Journals (Sweden)
Ilham Saleh Abuljadayel
2006-01-01
Full Text Available Beta-thalassemia is a genetic, red blood cell disorder affecting the beta-globin chain of the adult hemoglobin gene. This results in excess accumulation of unpaired alpha-chain gene products leading to reduced red blood cell life span and the development of severe anemia. Current treatment of this disease involves regular blood transfusion and adjunct chelation therapy to lower blood transfusion–induced iron overload. Fetal hemoglobin switching agents have been proposed to treat genetic blood disorders, such as sickle cell anemia and beta-thalassemia, in an effort to compensate for the dysfunctional form of the beta-globin chain in adult hemoglobin. The rationale behind this approach is to pair the excess normal alpha-globin chain with the alternative fetal gamma-chain to promote red blood cell survival and ameliorate the anemia. Reprogramming of differentiation in intact, mature, adult white blood cells in response to inclusion of monoclonal antibody CR3/43 has been described. This form of retrograde development has been termed “retrodifferentiation”, with the ability to re-express a variety of stem cell markers in a heterogeneous population of white blood cells. This form of reprogramming, or reontogeny, to a more pluripotent stem cell state ought to recapitulate early hematopoiesis and facilitate expression of a fetal and/or adult program of hemoglobin synthesis or regeneration on infusion and subsequent redifferentiation. Herein, the outcome of infusion of autologous retrodifferentiated stem cells (RSC into 21 patients with beta-thalassemia is described. Over 6 months, Infusion of 3-h autologous RSC subjected to hematopoietic-conducive conditions into patients with beta-thalassemia reduced mean blood transfusion requirement, increased mean fetal hemoglobin synthesis, and significantly lowered mean serum ferritin. This was always accompanied by an increase in mean corpuscular volume (MCV, mean corpuscular hemoglobin (MCH, and mean
Hiraoka, M; Okamoto, R; Inoue, M; Mitsuhashi, S
1989-01-01
Four types of beta-lactamases consisting of a penicillinase type I (TEM-1), a penicillinase type II (OXA-1), a cephalosporinase of Citrobacter freundii, and a cephalosporinase of Proteus vulgaris were introduced into Escherichia coli MC4100 and its omp mutants, MH1160 (MC4100 ompR1) and MH760 (MC4100 ompR2), by transformation. Effects of the combination of the omp mutations and these beta-lactamases on the susceptibility of E. coli strains were studied with 15 beta-lactam antibiotics including cephalosporins, cephamycins, penicillins, imipenem, and aztreonam. The ompR1 mutant, MH1160, lacks OmpF and OmpC, and it showed reduced susceptibility to 11 of the 15 beta-lactam agents. The reduction in susceptibility to cefoxitin, moxalactam, and flomoxef was much greater than reduction in susceptibility to the other agents. When the ompR1 mutant produced the cephalosporinase of C. freundii, the susceptibility of the mutant to 12 of the 15 beta-lactam antibiotics decreased. The reduction in susceptibility of MH1160 to 10 of the 12 agents affected by the enzyme was two- to fourfold greater than that observed in MC4100. Such a synergistic effect was also observed with the cephalosporinase of P. vulgaris and ompR1 mutation against six cephalosporins, moxalactam, and aztreonam. Images PMID:2658786
Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.
Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi
2016-05-17
ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Akinbami, Anthony O; Campbell, Andrew D; Han, Zeqiu J; Luo, Hong-Yuan; Chui, David H K; Steinberg, Martin H
2016-01-01
Hereditary persistence of fetal hemoglobin (HPFH) can be caused by point mutations in the γ-globin gene promoters. We report three rare cases: a child compound heterozygous for Hb S (HBB: c.20A > T) and HPFH with a novel point mutation in the (A)γ-globin gene promoter who had 42.0% Hb S, 17.0% Hb A and 38.0% Hb F; a man with Hb SC (HBB: c.19G > A) disease and a point mutation in the (G)γ-globin gene promoter who had 54.0% Hb S, 18.0% Hb C and 25.0% Hb F; a child heterozygous for Hb S and HPFH due to mutations in both the (A)γ- and (G)γ-globin gene promoters in cis [(G)γ(A)γ(β(+)) HPFH], with 67.0% Hb A, 6.5% Hb S and 25.0% Hb F.
Investigation of benzo(a)pyrene-globin adducts
Energy Technology Data Exchange (ETDEWEB)
Wallin, H; Jeffre, A M; Santella, R M
1987-05-01
The nature of the adducts formed between benzo(a)pyrene (BP) and globin were investigated in animals treated with (/sup 3/H)BP. Modification levels on globin were determined by radioactivity measurements. Since BP tetraols can be released from benzo(a)pyrene diol epoxide modified protein and DNA by acid treatment, globin samples were treated with acid, released tetraols separated by HPLC and quantitated by scintillation counting. In addition, acid released material was measured in competitive enzyme linked immunosorbent assay (ELISA) using antibodies which recognize BP tetraols. Both measurements indicate that only 2% of bound radioactivity could be released as free BP tetraols. These studies indicate that benzo(a)pyrene diol epoxide may not be the major metabolite of BP involved in globin binding. (author). 14 refs.
International Nuclear Information System (INIS)
Chebloune, Y.; Pagnier, J.; Trabuchet, G.; Faure, C.; Verdier, G.; Labie, D.; Nigon, V.
1988-01-01
Haplotype analysis of the β-globin gene cluster shows two regions of DNA characterized by nonrandom association of restriction site polymorphisms. These regions are separated by a variable segment containing the repeated sequences (ATTTT) n and (AT) x T y , which might be involved in recombinational events. Studies of haplotypes linked to the sickle cell gene in Africa provide strong argument for three origins of the mutation: Benin, Senegal, and the Central African Republic. The structure of the variable segment in the three African populations was studied by S1 nuclease mapping of genomic DNA, which allows a comparison of several samples. A 1080-base-pair DNA segment was sequenced for one sample from each population. S1 nuclease mapping confirmed the homogeneity of each population with regard to both (ATTTT) n and (AT) x T y repeats. The authors found three additional structures for (AT) x T y correlating with the geographic origin of the patients. Ten other nucleotide positions, 5' and 3' to the (AT) x T y copies, were found to be variable when compared to homologous sequences from human and monkey DNAs. These results allow us to propose an evolutionary scheme for the polymorphisms in the 5' flanking region of the β-globin gene. The results strongly support the hypothesis of three origins for the sickle mutation in Africa
Tesco, G; Tanzi, R E
2000-01-01
We have previously shown that the endogenous C-terminal fragment of presenilin 1 co-immunoprecipitates with endogenous beta-catenin. Since PS1 has been suggested to be involved in beta-catenin stabilization, we further investigated whether GSK3 beta, responsible for beta-catenin phosphorylation and degradation, is part of the PS1/beta-catenin complex. In naïve H4 and CHO cells, PS1 co-immunoprecipitated with both endogenous beta-catenin and GSK3 beta. In addition, GSK3 beta endogenously binds to the PS1-CTF/NTF complex and beta-catenin in naïve CHO cells. GSK3 beta also co-immunoprecipitated with PS1 full length in CHO cell lines overexpressing PS1 wild type. Given that it has been recently shown that PS1 mutations of aspartate 257 or 385 result in prevention of PS1 endoproteolysis and inhibition of gamma-secretase activity, we also tested whether PS1 endoproteolysis is required for beta-catenin/GSK3 beta/PS1 binding and whether PS1 FAD-linked mutations affect GSK3 beta recruitment in the PS1/beta-catenin complex. GSK3 beta was detected in PS1 immunoprecipitates from H4 cell lines overexpressing PS1 wild type, delta E10, A286E, L246V and in CHO cell lines overexpressing aspartate or M146L mutations. The latter data show that the absence of PS1 endoproteolysis (D257A/D385A and delta E10) or the presence of PS1-FAD mutations does not interfere with beta-catenin/GSK3 beta/PS1 complex formation.
Energy Technology Data Exchange (ETDEWEB)
Brown, C.A.; Mahuran, D.J. (Univ. of Toronto (Canada))
1993-08-01
In vitro mutagenesis and transient expression in COS cells has been used to associate a missense mutation with a clinical or biochemical phenotype. Mutations affecting the [alpha]-subunit of [beta]-hexosaminidase A ([alpha][beta]) (E.C.3.2.1.52) result in Tay-Sachs disease. Because hexosaminidase A is heterodimeric, analysis of [alpha]-chain mutations is not straightforward. The authors examine three approaches utilizing previously identified mutations affecting [alpha]-chain folding. These involve transfection of (1) the [alpha] cDNA alone; (2) a [beta] cDNA construct encoding a [beta]-subunit substituted at a position homologous to that of the [alpha]-subunit, and (3) both [alpha] and [beta] cDNAs. The latter two procedures amplified residual activity levels over that of patient samples, an effect not previously found with mutations affecting an [open quotes]active[close quotes] [alpha]Arg residue. This effect may help to discriminate between protein-folding and active-site mutations. The authors conclude that, with proper controls, the latter method of cotransfection can be used to evaluate the effects and perhaps to predict the clinical course of some [alpha]-chain mutations. Using this technique, they demonstrate that the adult-onset Tay-Sachs mutation, [alpha]Gly[yields]Ser[sup 269], does not directly affect [alpha][beta] dimerization but exerts an indirect effect on the dimer through destabilizing the folded [alpha]-subunit at physiological temperatures. Two other [alpha] mutations linked to more severe phenotypes appear to inhibit the initial folding of the subunit. 36 refs., 2 figs., 5 tabs.
International Nuclear Information System (INIS)
Weber-Benarous, A.; Cone, R.D.; London, I.M.; Mulligan, R.C.
1988-01-01
The authors cloned human β-globin DNA sequences from a genomic library prepared from DNA isolated from the human leukemia cell line K562 and have used the retroviral vector pZip-NeoSV(X)1 to introduce a 3.0-kilobase segment encompassing the globin gene into mouse erythroleukemia cells. Whereas the endogenous K562 β-globin gene is repressed in K562 cells, when introduced into mouse erythroleukemia cells by retroviral-mediated gene transfer, the β-globin gene from K562 cells was transcribed and induced 5-20-fold after treatment of the cells with dimethyl sulfoxide. The transcripts were correctly initiated, and expression and regulation of the K562 gene were identical to the expression of a normal human β-globin gene transferred into mouse erythroleukemia cells in the same way. They have also introduced the normal human β-globin gene into K562 cells using the same retrovirus vector. SP6 analysis of the RNA isolated from the transduced cells showed that the normal β-globin gene was transcribed at a moderately high level, before or after treatment with hemin. Based on these data, they suggest that the lack of expression of the endogenous β-globin gene in K562 cells does not result from an alteration in the gene itself and may not result from a lack of factor(s) necessary for β-lobin gene transcription. Retroviral-mediated transfer of the human β-globin gene may, however, uniquely influence expression of the gene K562 cells
Farashi, Samaneh; Faramarzi Garous, Negin; Ashki, Mehri; Vakili, Shadi; Zeinali, Fatemah; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein
2015-01-01
Hb H (β4) disease is caused by deletion or inactivation of three out of four α-globin genes. A high incidence of Hb H disease has been reported all over the world. There is a wide spectrum of phenotypic presentations, from clinically asymptomatic to having significant hepatosplenomegaly and requiring occasional or even regular blood transfusions, even more severe anemia, Hb Bart's (γ4) hydrops fetalis syndrome that can cause death in the affected fetuses late in gestation. We here present a case who was diagnosed with Hb H disease that represents a new genotype for this hereditary disorder. Hb Dartmouth is a variant caused by a missense mutation at codon 66 of the α2-globin gene (HBA2: c.200T>C), resulting in the substitution of leucine by proline. We here emphasize the importance of this point mutation involving Hb H disease and also the necessity for prenatal diagnosis (PND) for those who carry this point mutation in the heterozygous state.
Chicken globin gene transcription is cell lineage specific during the time of the switch
International Nuclear Information System (INIS)
Lois, R.; Martinson, H.G.
1989-01-01
Posttranscriptional silencing of embryonic globin gene expression occurs during hemoglobin switching in chickens. Here the authors use Percoll density gradients to fractionate the red blood cells of 5-9 day embryos in order to determine the cellular source and the timing of this posttranscriptional process. By means of nuclear run-on transcription in vitro they show that it is within mature primitive cells that production of embryonic globin mRNA is terminated posttranscriptionally. In contrast, young definitive cells produce little (or no) embryonic globin mRNA because of regulation at the transcriptional level. Thus the lineage specificity of embryonic and adult globin gene expression is determined transcriptionally, and the posttranscriptional process described by Landes et al. is a property of the senescing primitive cells, not a mechanism operative in the hemoglobin switch. This conclusion is supported by [ 3 H]leucine incorporation experiments on Percoll-fractionated cells which reveal no posttranscriptional silencing of the embryonic genes during the early stages of the switch. In the course of these studies they have noticed a strong transcriptional pause near the second exon of the globin genes which is induced by 5,6-dichloro-1-β-D-ribofuranosylbenzimidazole (DRB) and which resembles a natural pause near that position
Directory of Open Access Journals (Sweden)
Shuang Liu
Full Text Available Mucolipidosis II and III alpha/beta are autosomal recessive diseases caused by mutations in the GNPTAB gene which encodes the α and β subunits of the N-acetylglucosamine-1-phosphotransferase. Clinically, mucolipidosis II (MLII is characterized by severe developmental delay, coarse facial features, skeletal deformities, and other systemic involvement. In contrast, MLIII alpha/beta is a much milder disorder, the symptoms of which include progressive joint stiffness, short stature, and scoliosis. To study the relationship between the genotypes and phenotypes of the MLII and MLIII alpha/beta patients, we analyzed the GNPTAB gene in 16 Chinese MLII and MLIII alpha/beta patients. We collected and analyzed the patients' available clinical data and all showed clinical features typical of MLII or MLIII alpha/beta. Moreover, the activity of several lysosomal enzymes was measured in the plasma and finally the GNPTAB gene was sequenced. We detected 30 mutant alleles out of 32 alleles in our patients. These include 10 new mutations (c.99delC, c.118-1G>A, c.523_524delAAinsG, c.1212C>G, c.2213C>A, c.2345C>T, c.2356C>T, c.2455G>T, c.2821dupA, and c.3136-2A>G and 5 previously reported mutations (c.1071G>A, c.1090C>T, c.2715+1G>A, c.2550_2554delGAAA, and c.3613C>T. The most frequent mutation was the splicing mutation c.2715+1G>A, which accounted for 28% of the mutations. The majority of the mutations reported in the Chinese patients (57% were located on exon 13 or in its intronic flanking regions.
Mukherjee, M; Hadar, R; Mukherjee, P K; Horwitz, B A
2003-01-01
To clone the beta-tubulins and to induce resistance to benzimidazoles in the biocontrol fungus Trichoderma virens through site-directed mutagenesis. Two beta-tubulin genes have been cloned using PCR amplification followed by the screening of a T. virens cDNA library. The full-length cDNA clones, coding for 445 and 446 amino acids, have been designated as T. virens tub1 and T. virens tub2. A sequence alignment of these two tubulins with tubulins from other filamentous fungi has shown the presence of some unique amino acid sequences not found in those positions in other beta-tubulins. Constitutive expression of the tub2 gene with a histidine to tyrosine substitution at position 6 (known to impart benomyl/methyl benzimadazol-2-yl carbamate resistance in other fungi), under the Pgpd promoter of Aspergillus nidulans, did not impart resistance to benomyl. The homologous expression of tub2 gene with a histidine to tyrosine mutation at position +6, which is known to impart benomyl tolerance in other fungi, does not impart resistance in T. virens. Unlike other Trichoderma spp., T. virens, has been difficult to mutate for benomyl tolerance. The present study, through site-directed mutagenesis, shows that a mutation known to impart benomyl tolerance in T. viride and other fungi does not impart resistance in this fungus. Understanding the mechanisms of this phenomenon will have a profound impact in plant-disease management, as many plant pathogenic fungi develop resistance to this group of fungicides forcing its withdrawal after a short period of use.
Energy Technology Data Exchange (ETDEWEB)
Armel, Thomas Z. [Department of Molecular, Cellular, and Developmental Biology, University of Colorado, Boulder, CO 80309 (United States); Leinwand, Leslie A., E-mail: leslie.leinwand@colorado.edu [Department of Molecular, Cellular, and Developmental Biology, University of Colorado, Boulder, CO 80309 (United States)
2010-01-01
Hypertrophic cardiomyopathy (HCM) is a common, autosomal dominant disorder primarily characterized by left ventricular hypertrophy and is the leading cause of sudden cardiac death in youth. HCM is caused by mutations in several sarcomeric proteins, with mutations in MYH7, encoding {beta}-MyHC, being the most common. While many mutations in the globular head region of the protein have been reported and studied, analysis of HCM-causing mutations in the {beta}-MyHC rod domain has not yet been reported. To address this question, we performed an array of biochemical and biophysical assays to determine how the HCM-causing E1356K mutation affects the structure, stability, and function of the {beta}-MyHC rod. Surprisingly, the E1356K mutation appears to thermodynamically destabilize the protein, rather than alter the charge profile know to be essential for muscle filament assembly. This thermodynamic instability appears to be responsible for the decreased ability of the protein to form filaments and may be responsible for the HCM phenotype seen in patients.
Alaithan, Mousa A.; AbdulAzeez, Sayed; Borgio, J. Francis
2018-01-01
Beta-thalassemia is a genetic disorder that is caused by variations in the beta-hemoglobin (HBB) gene. Saudi Arabia is among the countries most affected by beta-thalassemia, and this is particularly problematic in the Eastern regions. This review article is an attempt to compile all the reported mutations to facilitate further national-level studies to prepare a Saudi repository of HBB gene variations. In Saudi Arabians, IVSI-5 (G>C) and Cd 39 (C>T) are the most prevalent HBB gene variations out of 42 variations. The coinheritance of HBB gene variations with ATRX, HBA1, HBA2, HBA12, AHSP, and KLF1 gene variations were observed to be common in the Saudi population. National surveys on the molecular nature of hemoglobinopathies should be set up through collaborations between research centers from various regions to create a well-documented molecular data bank. This data bank can be used to develop a premarital screening program and lead to the best treatment and prevention strategies for beta-thalassemia. PMID:29619482
Directory of Open Access Journals (Sweden)
Ivan L. Angulo
2009-01-01
Full Text Available A hemoglobina C (Hb C é originária do oeste da África e é detectada por migração lenta na eletroforese alcalina em acetato de celulose. Consiste na mutação do gene da globina beta no códon 6 (GAG-AAG, resultando na substituição do sexto aminoácido da cadeia beta da hemoglobina humana, o ácido glutâmico, pelo aminoácido lisina. A cromatografia de alto desempenho (HPLC separa completamente as frações C e A2, permitindo caracterizar a presença da interação com talassemia beta. Esta entidade (Hb CC, em homozigoze é considerada benigna em relação à doença falciforme, já que a falcização não faz parte de sua fisiopatologia. A raridade do diagnóstico C homozigoto e C talassemia beta nos pacientes portadores de hemoglobinopatias nos alertou para a necessidade de se conhecer melhor e estudar aspectos clínicos e hematológicos dos casos dessa mutação em homozigose e na interação com a talassemia beta no ambulatório de anemias do Centro Regional de Hematologia e Hemoterapia de Ribeirão Preto, SP, Brasil.Hemoglobin C (Hb C originated in the west of Africa and is detected by alkaline electrophoresis by slow migration in cellulose acetate. It consists of a mutation of the beta globin gene in codon 6 (GAG-AAG, resulting in a substitution of glutamic acid, the sixth amino acid of the beta string of the human hemoglobin, for lysine. High performance chromatography (HPLC separates the C and A2 fractions completely, allowing the characterization of the presence of interactions with thalassemia beta. This entity (Hb CC is considered benign in respect to sickle cell disease, as sickle cells are not part of its physiopathology. The rarity of the diagnosis of homozygous C and beta thalassemia in patients with hemoglobinopathies showed the necessity of studying clinical and hematologic aspects of the cases of this mutation in homozygosis carriers and the interaction with beta thalassemia in the anemias clinic of the Regional Blood
Directory of Open Access Journals (Sweden)
Origa Raffaella
2010-05-01
, deletions in the beta globin gene on chromosome 11, leading to reduced (beta+ or absent (beta0 synthesis of the beta chains of hemoglobin (Hb. Transmission is autosomal recessive; however, dominant mutations have also been reported. Diagnosis of thalassemia is based on hematologic and molecular genetic testing. Differential diagnosis is usually straightforward but may include genetic sideroblastic anemias, congenital dyserythropoietic anemias, and other conditions with high levels of HbF (such as juvenile myelomonocytic leukemia and aplastic anemia. Genetic counseling is recommended and prenatal diagnosis may be offered. Treatment of thalassemia major includes regular RBC transfusions, iron chelation and management of secondary complications of iron overload. In some circumstances, spleen removal may be required. Bone marrow transplantation remains the only definitive cure currently available. Individuals with thalassemia intermedia may require splenectomy, folic acid supplementation, treatment of extramedullary erythropoietic masses and leg ulcers, prevention and therapy of thromboembolic events. Prognosis for individuals with beta-thalassemia has improved substantially in the last 20 years following recent medical advances in transfusion, iron chelation and bone marrow transplantation therapy. However, cardiac disease remains the main cause of death in patients with iron overload.
Anaesthesia for a patient with beta thalassaemia major
African Journals Online (AJOL)
Creative Commons License [CC BY-NC-ND 4.0] ... monitoring and management instituted. The first arterial blood ... thalassaemia is a defect of the beta globin chains of the ... Decreased supply due to anaemia, chronic infections and frequent ...
Zhang, Can; Browne, Andrew; Kim, Doo Yeon; Tanzi, Rudolph E
2010-02-01
Alzheimer's disease (AD) is an insidious and progressive disease with a genetically complex and heterogenous etiology. More than 200 fully penetrant mutations in the amyloid beta-protein precursor (APP), presenilin 1 (or PSEN1), and presenilin 2 (PSEN2) have been linked to early-onset familial AD (FAD). 177 PSEN1 FAD mutations have been identified so far and account for more than approximately 80% of all FAD mutations. All PSEN1 FAD mutations can increase the Abeta42:Abeta40 ratio with seemingly different and incompletely understood mechanisms. A recent study has shown that the 286 amino acid N-terminal fragment of APP (N-APP), a proteolytic product of beta-secretase-derived secreted form of APP (sAPPbeta), could bind the death receptor, DR6, and lead to neurodegeneration. Here we asked whether PSEN1 FAD mutations lead to neurodegeneration by modulating sAPPbeta levels. All four different PSEN1 FAD mutations tested (in three mammalian cell lines) did not alter sAPPbeta levels. Therefore PS1 mutations do not appear to contribute to AD pathogenesis via altered production of sAPPbeta.
Current and future alternative therapies for beta-thalassemia major
Directory of Open Access Journals (Sweden)
Edouard de Dreuzy
2016-02-01
Full Text Available Beta-thalassemia is a group of frequent genetic disorders resulting in the synthesis of little or no β-globin chains. Novel approaches are being developed to correct the resulting α/β-globin chain imbalance, in an effort to move beyond the palliative management of this disease and the complications of its treatment (e.g. life-long red blood cell transfusion, iron chelation, splenectomy, which impose high costs on healthcare systems. Three approaches are envisaged: fetal globin gene reactivation by pharmacological compounds injected into patients throughout their lives, allogeneic hematopoietic stem cell transplantation (HSCT, and gene therapy. HSCT is currently the only treatment shown to provide an effective, definitive cure for β-thalassemia. However, this procedure remains risky and histocompatible donors are identified for only a small fraction of patients. New pharmacological compounds are being tested, but none has yet made it into common clinical practice for the treatment of beta-thalassemia major. Gene therapy is in the experimental phase. It is emerging as a powerful approach without the immunological complications of HSCT, but with other possible drawbacks. Rapid progress is being made in this field, and long-term efficacy and safety studies are underway.
Asynchronous DNA replication within the human β-globin gene locus
International Nuclear Information System (INIS)
Epner, E.; Forrester, W.C.; Groudine, M.
1988-01-01
The timing of DNA replication of the human β-globin gene locus has been studied by blot hybridization of newly synthesized BrdUrd-substituted DNA from cells in different stages of the S phase. Using probes that span >120 kilobases across the human β-globin gene locus, the authors show that the majority of this domain replicates in early S phase in the human erythroleukemia cell line K562 and in middle-to-late S phase in the lymphoid cell line Manca. However, in K562 cells three small regions display a strikingly different replication pattern than adjacent sequences. These islands, located in the inter-γ-globin gene region and approximately 20 kilobases 5' to the ε-globin gene and 20 kilobases 3' to the β-globin gene, replicate later and throughout S phase. A similar area is also present in the α-globin gene region in K562 cells. They suggest that these regions may represent sites of termination of replication forks
Lederer, Carsten W; Pavlou, Eleni; Tanteles, George A; Evangelidou, Paola; Sismani, Carolina; Kolnagou, Annita; Sitarou, Maria; Christou, Soteroulla; Hadjigavriel, Michael; Kleanthous, Marina
2017-06-01
Thalassaemia is a potentially lethal inherited anaemia, caused by reduced or absent synthesis of globin chains. Measurement of the minor adult haemoglobin Hb A 2 , combining α- with δ-globin, is critical for the routine diagnosis of carrier status for α- or β-thalassaemia. Here, we aim to characterize a novel δ-globin variant, Hb A 2 Episkopi, in a single family of mixed Lebanese and Cypriot ancestry with mild hypochromic anaemia and otherwise normal globin genotype, which also presents with a coincidental 0.78-Mb sequence duplication on chromosome 1 (1q44) and developmental abnormalities. Analyses included comprehensive haematological analyses, cation-exchange high-performance liquid chromatography (CE-HPLC), cellulose acetate electrophoresis (CAE), Sanger sequencing and structure-based stability predictions for Hb A 2 Episkopi. The GCT > GTT missense mutation, underlying Hb A 2 Episkopi, HBD:c.428C > T, introduces a cd142 codon change in the mature protein, resulting in reduced normal Hb A 2 amounts and a novel, less abundant Hb A 2 variant (HGVS: HBD:p.A143V), detectable as a delayed peak by CE-HPLC. The latter was in line with structure-based stability predictions, which indicated that the substitution of a marginal, non-helical and non-interface residue, five amino acids from the δ-globin chain carboxy-terminus, was moderately destabilizing. Detection of the new variant depends on the diagnostic set-up and had failed by CAE and on an independent CE-HPLC system, which, in unfavourable circumstances, may lead to misdiagnoses of β-thalassaemia as α-thalassaemia. Given the mixed background of the affected family, the ethnic origin of the mutation is unclear, and this study thus suggests awareness for possible detection of Hb A 2 Episkopi in both the Cypriot and the Lebanese populations.
de Fiebre, Nancyellen C; de Fiebre, Christopher M
2005-01-03
The alpha7 subtype of nicotinic acetylcholine receptor (nAChR) has been implicated as a potential site of action for two neurotoxins, ethanol and the Alzheimer's disease related peptide, beta-amyloid. Here, we utilized primary neuronal cultures of cerebral cortex from alpha7 nAChR null mutant mice to examine the role of this receptor in modulating the neurotoxic properties of subchronic, "binge" ethanol and beta-amyloid. Knockout of the alpha7 nAChR gene selectively enhanced ethanol-induced neurotoxicity in a gene dosage-related fashion. Susceptibility of cultures to beta-amyloid induced toxicity, however, was unaffected by alpha7 nAChR gene null mutation. Further, beta-amyloid did not inhibit the binding of the highly alpha7-selective radioligand, [(125)I]alpha-bungarotoxin. On the other hand, in studies in Xenopus oocytes ethanol efficaciously inhibited alpha7 nAChR function. These data suggest that alpha7 nAChRs modulate the neurotoxic effects of binge ethanol, but not the neurotoxicity produced by beta-amyloid. It is hypothesized that inhibition of alpha7 nAChRs by ethanol provides partial protection against the neurotoxic properties of subchronic ethanol.
International Nuclear Information System (INIS)
Caterina, J.J.; Ryan, T.M.; Pawlik, K.M.; Townes, T.M.; Brinster, R.L.; Behringer, R.R.; Palmiter, R.D.
1991-01-01
The human β-globin locus control region (LCR) is essential for high-level expression of human var-epsilon-, γ-, and β-globin genes. Developmentally stable DNase I hypersensitive sites (designated HS) mark sequences within this region that are important for LCR activity. A 1.9-kilobase (kb) fragment containing the 5' HS 2 site enhances human β-globin gene expression 100-fold in transgenic mice and also confers position-independent expression. To further define important sequences within this region, deletion mutations of the 1.9-kb fragment were introduced upstream of the human β-globin gene, and the constructs were tested for activity in transgenic mice. Although enhancer activity was gradually lost with deletion of both 5' and 3' sequences, a 373-base-pair (BP) fragment retained the ability to confer relative position-independent expression. Three prominent DNase I footprints were observed in this region with extracts from the human erythroleukemia cell line K-562, one of which contained duplicated binding sites for transcription factor AP-1 (activator protein 1). When the 1.9-kb fragment containing an 19-bp deletion of the AP-1 binding sites was tested in transgenic mice, enhancer activity decreased 20-fold but position-independent expression was retained
Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells
International Nuclear Information System (INIS)
Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.
1987-01-01
The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes
Genetic relationships among native americans based on beta-globin gene cluster haplotype frequencies
Directory of Open Access Journals (Sweden)
Rita de Cassia Mousinho-Ribeiro
2003-01-01
Full Text Available The distribution of b-globin gene haplotypes was studied in 209 Amerindians from eight tribes of the Brazilian Amazon: Asurini from Xingú, Awá-Guajá, Parakanã, Urubú-Kaapór, Zoé, Kayapó (Xikrin from the Bacajá village, Katuena, and Tiriyó. Nine different haplotypes were found, two of which (n. 11 and 13 had not been previously identified in Brazilian indigenous populations. Haplotype 2 (+ - - - - was the most common in all groups studied, with frequencies varying from 70% to 100%, followed by haplotype 6 (- + + - +, with frequencies between 7% and 18%. The frequency distribution of the b-globin gene haplotypes in the eighteen Brazilian Amerindian populations studied to date is characterized by a reduced number of haplotypes (average of 3.5 and low levels of heterozygosity and intrapopulational differentiation, with a single clearly predominant haplotype in most tribes (haplotype 2. The Parakanã, Urubú-Kaapór, Tiriyó and Xavante tribes constitute exceptions, presenting at least four haplotypes with relatively high frequencies. The closest genetic relationships were observed between the Brazilian and the Colombian Amerindians (Wayuu, Kamsa and Inga, and, to a lesser extent, with the Huichol of Mexico. North-American Amerindians are more differentiated and clearly separated from all other tribes, except the Xavante, from Brazil, and the Mapuche, from Argentina. A restricted pool of ancestral haplotypes may explain the low diversity observed among most present-day Brazilian and Colombian Amerindian groups, while interethnic admixture could be the most important factor to explain the high number of haplotypes and high levels of diversity observed in some South-American and most North-American tribes.
Panja, Amrita; Chowdhury, Prosanto; Chakraborty, Sharmistha; Ghosh, Tapan Kumar; Basu, Anupam
2017-01-01
Thalassemia is a common autosomal recessive blood disorder, which is most prevalent in South East Asian and Mediterranean populations. It is considered as a major health burden in the Indian population. The aims of the present study were to investigate the common, as well as uncommon, mutations responsible for thalassemia in the Bengali population. The Bengali state was divided into four sampling zones. Mutation detection was done using Sanger sequencing of the HBB gene. A total of 14 different mutations were observed, including rare mutations IVS1-130(G>C), IVS1-129(A>C), -90(T>C), CD16(-C), -30(T>C), CD15(-T), and a novel mutation CD53(C>T). The frequencies of IVS1-5(G>C) and CD26(G>A) mutations were higher than other mutations. There were also some silent polymorphisms found in the studied group, CD3(T>C), CD10(C>A), IVSII-16(G>C), IVSII-74(T>G), -42(C>G). The present study is the first attempt to screen for β-thalassemia-causing mutations by direct sequencing in different districts of West Bengal. The information obtained from the present study may be helpful for thalassemia management and prenatal mutation detection.
Lack of chemically induced mutation in repair-deficient mutants of yeast.
Prakash, L
1974-12-01
Two genes, rad6 and rad9, that confer radiation sensitivity in the yeast Saccharomyces cerevisiae also greatly reduce the frequency of chemically-induced reversions of a tester mutant cyc1-131, which is a chain initiation mutant in the structural gene determining iso-1-cytochrome c. Mutations induced by ethyl methanesulfonate (EMS), diethyl sulfate (DES), methyl methanesulfonate (MMS), dimethyl sulfate (DMS), nitroquinoline oxide (NQO), nitrosoguanidine (NTG), nitrogen mustard (HN2), beta-propiolactone, and tritiated uridine, as well as mutations induced by ultraviolet light (UV) and ionizing radiation were greatly diminished in strains homozygous for either the rad6 or rad9 gene. Nitrous acid and nitrosoimidazolidone (NIL), on the other hand, were highly mutagenic in these repair-deficient mutants, and at low doses, these mutagens acted with about the same efficiency as in the normal RAD strain. At high doses of either nitrous acid or NIL, however, reversion frequencies were significantly reduced in the two rad mutants compared to normal strains. Although both rad mutants are immutable to about the same extent, the rad9 strains tend to be less sensitive to the lethal effect of chemical mutagens than rad6 strains. It is concluded that yeast requires a functional repair system for mutation induction by chemical agents.
The role of mutated amyloid beta 1-42 stimulating dendritic cells in a PDAPP transgenic mouse
Directory of Open Access Journals (Sweden)
LI Jia-lin
2012-06-01
Full Text Available Background Amyloid plaque is one of the pathological hallmarks of Alzheimer's disease (AD. Anti-beta-amyloid (Aβ immunotherapy is effective in removing brain Aβ, but has shown to be associated with detrimental effects. To avoid severe adverse effects such as meningoencephalitis induced by amyloid beta vaccine with adjuvant, and take advantage of amyloid beta antibody's therapeutic effect on Alzheimer's disease sufficiently, our group has developed a new Alzheimer vaccine with mutated amyloid beta 1-42 peptide stimulating dendritic cells (DC. Our previous work has confirmed that DC vaccine can induce adequate anti-amyloid beta antibody in PDAPP Tg mice safely and efficiently. The DC vaccine can improve impaired learning and memory in the Alzheimer's animal model, and did not cause microvasculitis, microhemorrhage or meningoencephalitis in the animal model. However, the exact mechanism of immunotherapy which reduces Aβ deposition remains unknown. In this report, we studied the mechanism of the vaccine, thinking that this may have implications for better understanding of the pathogenesis of Alzheimer's disease. Methods A new Alzheimer vaccine with mutated amyloid beta 1-42 peptide stimulating DC which were obtained from C57/B6 mouse bone marrow was developed. Amyloid beta with Freund's adjuvant was inoculated at the same time to act as positive control. After the treatment was done, the samples of brains were collected, fixed, cut. Immunohistochemical staining was performed to observe the expression of the nuclear hormone liver X receptor (LXR, membrane-bound protein tyrosine phosphatase (CD45, the ATP-binding cassette family of active transporters (ABCA1, receptor for advanced glycation end products (RAGE, β-site APP-cleaving enzyme (BACE and Aβ in mouse brain tissue. Semi-quantitative analysis was used to defect CA1, CA2, CA3, DG, Rad in hippocampus region and positive neuron in cortex region. Results Aβ was significantly reduced in the
Hb taradale [beta82(EF6)Lys-->Arg]: a novel mutation at a 2,3-diphosphoglycerate binding site.
Brennan, Stephen O; Sheen, Campbell; Chan, Tim; George, Peter M
2005-01-01
Hb Taradale [beta82(EF6)Lys-->Arg] was initially detected as a split Hb A0 peak on Hb A1c, monitoring. Red cell parameters, hemoglobin (Hb) electrophoresis and stability tests were normal. Mass spectrometry (ms) clearly identified a variant beta chain with a mass increase of 28 Da and peptide mapping located the mutation site to peptide betaT-9. DNA sequencing confirmed the presence of a novel beta82(EF6)Lys-->Arg mutation. This conservative substitution at a 2,3-diphosphoglycerate (2,3-DPG) binding site did not, however, appear to affect the P50 for oxygen binding.
Molecular mechanisms of induced-mutations
International Nuclear Information System (INIS)
Kato, Takeshi
1985-01-01
The outcome of recent studies on mechanisms of induced-mutations is outlined with particular emphasis on the dependence of recA gene function in Escherichia coli. Genes involved in spontaneous mutation and x-ray- and chemical-induced mutation and genes involved in adaptive response are presented. As for SOS mutagenesis, SOS-induced regulation mechanisms and mutagenic routes are described. Furthermore, specificity of mutagens themselves are discussed in relation to mechanisms of base substitution, frameshift, and deletion mutagenesis. (Namekawa, K.)
The effect of HBB:c.*+96T>C (3’UTR +1570 T>C on the mild b-thalassemia intermedia phenotype
Directory of Open Access Journals (Sweden)
Türker Bilgen
2011-09-01
Full Text Available Hemoglobin beta (HBB:c.*+96T>C substitution is very rare among β-globin gene mutations and its clinical significance remains to be clarified. The present study aimed to investigate the role of HBB:c.*+96T>C in the β-thalassemia intermedia phenotype in a Turkish family. The proband and parents were screened for β-globin gene mutations via direct sequencing. Hematological and physical examination results were recorded, and correlated according to genotype. The proband was compound heterozygous for Cod 8 (-AA and HBB:c.*+96T>C, whereas his mother and father were heterozygous for Cod 8 (-AA and HBB:c.*+96T>C, respectively. The father had almost normal hematological findings, whereas the mother had the typical β-thalassemia trait phenotype. The proband was diagnosed as mild β-thalassemia intermedia based on hepatosplenomegaly and hematological findings. To the best of our knowledge this is the first report of HBB:c.*+96T>C mutation in a Turkish family. HBB:c.* 96T>C substitution is a very rare, but clinically relevant β-globin gene mutation. Additionally, we think that if 1 spouse is a carrier for β-globin gene mutation the other should be screened for silent mutations, such as HBB:c.*+96T>C mutation of the β-globin gene, even if she/he does not have any clinical or hematological signs of the β-thalassemia trait phenotype.
Energy Technology Data Exchange (ETDEWEB)
Martinson, J.J.; Clegg, J.B.; Boyce, A.J. [Univ. of Oxford (United Kingdom)
1994-09-01
Analysis of the {alpha}-globin gene complex in Oceania has revealed many different rearrangements which remove one of the adult globin genes. Frequencies of these deletion chromosomes are elevated by malarial resistance conferred by the resulting {alpha}-thalassaemia. One particular deletion chromosome, designated -{alpha}{sup 3.7}III, is found at high levels in Melanesia and Polynesia: RFLP haplotype analysis shows that this deletion is always found on chromosomes bearing the IIIa haplotype and is likely to be the product of one single rearrangement event. A subset of the -{alpha}{sup 3.7}III chromosomes carries a more recent mutation which generates the haemoglobin variant HbJ{sup Tongariki}. We have characterized the allelic variation at the 3{prime}HVR VNTR locus located 6 kb from the globin genes in each of these groups of chromosomes. We have determined the internal structure of these alleles by RFLP mapping of PCR-amplified DNA: within each group, the allelic diversity results from the insertion and/or deletion of small {open_quotes}motifs{close_quotes} of up to 6 adjacent repeats. Mapping of 3{prime}HVR alleles associated with other haplotypes reveals that these are composed of repeat arrays that are substantially different to those derived from IIIa chromosomes, indicating that interchromosomal recombination between heterologous haplotypes does not account for any of the diversity seen to date. We have recently shown that allelic size variation at the two VNTR loci flanking the {alpha}-globin complex is very closely linked to the haplotypes known to be present at this locus. Here we show that, within a haplotype, VNTR alleles are very closely related to each other on the basis of internal structure and demonstrate that intrachromosomal mutation processes involving small numbers of tandem repeats are the main cause of variation at this locus.
Directory of Open Access Journals (Sweden)
Julio A. da Luz
2006-01-01
Full Text Available Hemoglobinopathies are the most common monogenic disorders worldwide; however, they have never been systematically studied from a genetic perspective in Uruguay. In this study, we determined the frequencies of hemoglobin variants in Afro-Uruguayans. A sample of 52 healthy unrelated Afro-Uruguayans from the northern (N = 28 and southern (N = 24 regions of the country was analyzed. Eight individuals (15.4% were heterozygous for -alpha3,7thalassemia; seven of them (29.2% were originally from the southern region, whereas one of them (3.6% was from the northern region; the differences between both regions were statistically significant (p = 0.016 +/-0.003. The only structural mutation detected was betaS, which is typical of African populations. Four individuals (10% were heterozygous for betaS, three of them (13.6% from the South, and one (5.6% from the North. The betaS haplotypes were analyzed in eight individuals: two were homozygous betaS/betaS, two were heterozygous betaS/betathal, and four were heterozygous betaS/betaª. This haplotype distribution (60% Bantu, 20% Benin, and 20% Bantu A2 is in agreement with historical records reporting a predominantly Bantu origin for the enslaved Africans brought to Uruguay. Even though this is a preliminary study, due to the small sample size, our results are suggestive of a relatively high incidence of hemoglobinopathies in the Afro-Uruguayan population.
Walker, Aisha L.; Ofori-Acquah, Solomon
2016-01-01
The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...
A Dual Reporter Mouse Model of the Human β-Globin Locus: Applications and Limitations
P. Papadopoulos (Petros); L. Gutiérrez (Laura); R. van der Linden (Reinier); J. Kong-a-San (John); A. Maas (Alex); D.D. Drabek (Dubravka); G.P. Patrinos (George); J.N.J. Philipsen (Sjaak); F.G. Grosveld (Frank)
2012-01-01
textabstractThe human β-globin locus contains the β-like globin genes (i.e. fetal γ-globin and adult β-globin), which heterotetramerize with α-globin subunits to form fetal or adult hemoglobin. Thalassemia is one of the commonest inherited disorders in the world, which results in quantitative
Smad7 induces tumorigenicity by blocking TGF-beta-induced growth inhibition and apoptosis.
Halder, Sunil K; Beauchamp, R Daniel; Datta, Pran K
2005-07-01
Smad proteins play a key role in the intracellular signaling of the transforming growth factor beta (TGF-beta) superfamily of extracellular polypeptides that initiate signaling to regulate a wide variety of biological processes. The inhibitory Smad, Smad7, has been shown to function as intracellular antagonists of TGF-beta family signaling and is upregulated in several cancers. To determine the effect of Smad7-mediated blockade of TGF-beta signaling, we have stably expressed Smad7 in a TGF-beta-sensitive, well-differentiated, and non-tumorigenic cell line, FET, that was derived from human colon adenocarcinoma. Smad7 inhibits TGF-beta-induced transcriptional responses by blocking complex formation between Smad 2/3 and Smad4. While Smad7 has no effect on TGF-beta-induced activation of p38 MAPK and ERK, it blocks the phosphorylation of Akt by TGF-beta and enhances TGF-beta-induced phosphorylation of c-Jun. FET cells expressing Smad7 show anchorage-independent growth and enhance tumorigenicity in athymic nude mice. Smad7 blocks TGF-beta-induced growth inhibition by preventing TGF-beta-induced G1 arrest. Smad7 inhibits TGF-beta-mediated downregulation of c-Myc, CDK4, and Cyclin D1, and suppresses the expression of p21(Cip1). As a result, Smad7 inhibits TGF-beta-mediated downregulation of Rb phosphorylation. Furthermore, Smad7 inhibits the apoptosis of these cells. Together, Smad7 may increase the tumorigenicity of FET cells by blocking TGF-beta-induced growth inhibition and by inhibiting apoptosis. Thus, this study provides a mechanism by which a portion of human colorectal tumors may become refractory to tumor-suppressive actions of TGF-beta that might result in increased tumorigenicity.
Mutations induced by ultraviolet light
International Nuclear Information System (INIS)
Pfeifer, Gerd P.; You, Young-Hyun; Besaratinia, Ahmad
2005-01-01
The different ultraviolet (UV) wavelength components, UVA (320-400 nm), UVB (280-320 nm), and UVC (200-280 nm), have distinct mutagenic properties. A hallmark of UVC and UVB mutagenesis is the high frequency of transition mutations at dipyrimidine sequences containing cytosine. In human skin cancers, about 35% of all mutations in the p53 gene are transitions at dipyrimidines within the sequence 5'-TCG and 5'-CCG, and these are localized at several mutational hotspots. Since 5'-CG sequences are methylated along the p53 coding sequence in human cells, these mutations may be derived from sunlight-induced pyrimidine dimers forming at sequences that contain 5-methylcytosine. Cyclobutane pyrimidine dimers (CPDs) form preferentially at dipyrimidines containing 5-methylcytosine when cells are irradiated with UVB or sunlight. In order to define the contribution of 5-methylcytosine to sunlight-induced mutations, the lacI and cII transgenes in mouse fibroblasts were used as mutational targets. After 254 nm UVC irradiation, only 6-9% of the base substitutions were at dipyrimidines containing 5-methylcytosine. However, 24-32% of the solar light-induced mutations were at dipyrimidines that contain 5-methylcytosine and most of these mutations were transitions. Thus, CPDs forming preferentially at dipyrimidines with 5-methylcytosine are responsible for a considerable fraction of the mutations induced by sunlight in mammalian cells. Using mouse cell lines harboring photoproduct-specific photolyases and mutational reporter genes, we showed that CPDs (rather than 6-4 photoproducts or other lesions) are responsible for the great majority of UVB-induced mutations. An important component of UVB mutagenesis is the deamination of cytosine and 5-methylcytosine within CPDs. The mutational specificity of long-wave UVA (340-400 nm) is distinct from that of the shorter wavelength UV and is characterized mainly by G to T transversions presumably arising through mechanisms involving oxidized DNA
Method and apparatus for induced nuclear beta decay
International Nuclear Information System (INIS)
Reiss, H.
1986-01-01
This invention relates to a method and apparatus for inducing beta decay transition that are normally inhibited by angular momentum or parity considerations. According to one aspect of this invention a method of inducing nuclear beta decay transition comprises providing a medium which includes atomic nuclei that have forbidden beta decay transition in which the initial and final nuclear states do not have the same intrinsic parity or have total angular momenta which differ by more than one quantum unit of angular momentum, and applying to the medium an electromagnetic field which has an intensity sufficient to provide the angular momentum or intrinsic parity necessary to overcome the forbiddenness of the beta decay transition of the atomic nuclei, thereby to induce the beta decay transitions. According to another aspect of this invention an apparatus for inducing beta decay transition comprises a medium which includes atomic nuclei that have forbidden beta decay transitions in which the initial and final nuclear states do not have the same intrinsic parity or have total angular momenta which differ by more than one quantum unit of angular momentum, field producing means for producing an electromagnetic field in the medium and means for energising the field producing means to establish the field at an intensity sufficient to provide the angular momentum or intrinsic parity necessary to overcome the forbiddenness of the beta decay transitions of the atomic nuclei. The energy released in these induced nuclear transition is useful for the controlled production of power. The induced beta dacay transitions are also useful to reduce the halflives of long-lived fission product wastes from conventional nuclear fission power plants
TGF-beta Sma/Mab signaling mutations uncouple reproductive aging from somatic aging.
Directory of Open Access Journals (Sweden)
Shijing Luo
2009-12-01
Full Text Available Female reproductive cessation is one of the earliest age-related declines humans experience, occurring in mid-adulthood. Similarly, Caenorhabditis elegans' reproductive span is short relative to its total life span, with reproduction ceasing about a third into its 15-20 day adulthood. All of the known mutations and treatments that extend C. elegans' reproductive period also regulate longevity, suggesting that reproductive span is normally linked to life span. C. elegans has two canonical TGF-beta signaling pathways. We recently found that the TGF-beta Dauer pathway regulates longevity through the Insulin/IGF-1 Signaling (IIS pathway; here we show that this pathway has a moderate effect on reproductive span. By contrast, TGF-beta Sma/Mab signaling mutants exhibit a substantially extended reproductive period, more than doubling reproductive span in some cases. Sma/Mab mutations extend reproductive span disproportionately to life span and act independently of known regulators of somatic aging, such as Insulin/IGF-1 Signaling and Dietary Restriction. This is the first discovery of a pathway that regulates reproductive span independently of longevity and the first identification of the TGF-beta Sma/Mab pathway as a regulator of reproductive aging. Our results suggest that longevity and reproductive span regulation can be uncoupled, although they appear to normally be linked through regulatory pathways.
Mutations induced in plant breeding
International Nuclear Information System (INIS)
Barriga B, P.
1984-01-01
The most significant aspects of the use of ionizing radiations in plant breeding are reviewed. Aspects such as basic principles of mutation, expression and selection in obtention of mutants, methods for using induced mutations and sucess achieved with this methodology in plant breeding are reviewed. Results obtained in a program of induced mutation on wheat for high content of protein and lysine at the Universidad Austral de Chile are presented. (Author)
Mutations induced in plant breeding
Energy Technology Data Exchange (ETDEWEB)
Barriga B, P. (Universidad Austral de Chile, Valdivia. Inst. de Produccion y Sanidad Vegetal)
1984-10-01
The most significant aspects of the use of ionizing radiations in plant breeding are reviewed. Aspects such as basic principles of mutation, expression and selection in obtention of mutants, methods for using induced mutations and sucess achieved with this methodology in plant breeding are reviewed. Results obtained in a program of induced mutation on wheat for high content of protein and lysine at the Universidad Austral de Chile are presented.
Directory of Open Access Journals (Sweden)
Gentil Claudino de Galiza Neto
2005-10-01
Full Text Available No presente trabalho abordam-se vários aspectos relacionados à natureza molecular da anemia falciforme (AF, desordem hematológica de caráter hereditário. A descoberta do polimorfismo do DNA no grupamento do gene betaS, originando diferentes haplótipos da doença, permitiu ampliar o conhecimento em torno da heterogeneidade clínica observada nos pacientes falcêmicos nas mais diversas regiões do mundo. Analisaram-se os diferentes haplótipos e seus parâmetros hematológicos, presentes em um grupo de 22 pacientes naturais e procedentes do estado do Ceará. A distribuição das freqüências dos haplótipos encontrados foi de 55,9% para Benin; 41,2% para República Centro-Africana (CAR; e de 2,9% para o haplótipo Senegal. Esses dados, em comparação com os demais estudos realizados no Brasil, mostram associação entre os seus valores para um alfa de 5% (p The present work deals with numerous aspects related to the molecular nature of sickle cell anemia. The discovery of the DNA polymorphism in the betas-globin gene cluster, gave origin to different haplotypes of the disease, making possible to enlarge the knowledge about the clinical heterogenity observed on the patients with sickle cell disease, in the various regions of the world. The different haplotypes and its hematological parameters were analysed in a group of 22 patients born in the State of Ceará, northeast of Brazil. The distribution found in the haplotypes frequency was of 55.9% for the Benin, of 41.2% for the CAR, and of 2.9% for Senegal haplotype. The data, compared to the others works done in Brazil, show relations among their values to alpha of 5% (p < 0,05. The results make possible a full understanding of the pathophisiology of the illness and of its clinical complexity in our State, as well as it allows a better knowledge of the sickle cell disease in our country.
Selma Ünal; Günay Balta; Fatma Gümrük
2014-01-01
Objective: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. Materials and Methods: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6?6.1 years, range: 3-30 years) with beta-thalassemia major (BTM) and 13 beta-thalassemia intermedia (BTI) patients (6 males and 7 females; ...
Directory of Open Access Journals (Sweden)
Claudia R. Bonini-Domingos
2003-06-01
Full Text Available Thalassemias are a heterogeneous group of inherited disorders characterized by a microcytic hypochromic anemia and an imbalance in the synthesis of the globin-chains. Hb C is the second most frequently variant of hemoglobin found in Brazil. The laboratory diagnosis of hemoglobinopathies, including thalassemias, is growing in importance, particularly because of an increasing requirement for neonatal diagnosis of abnormal hemoglobins. Screening tests were carried out using alkaline and acid electrophoresis, globin-chain analysis by cellulose acetate in alkaline pH, isoelectric focusing and HPLC. The molecular characterization was made by PCR-ASO for Hb C and beta thalassemia mutants. Large-scale screening and discriminative methodologies must provide information about the hemoglobin polymorphisms in Brazilian population. HPLC is a powerful tool in these cases. Molecular characterization is important to genetic counseling and clinical management, in particular for the Brazilian population that have an intense racial admixture, with great variability of hemoglobins. In this paper an association between Hb C and beta thalassemia (IVS-II-654 in a black family from Brazil was described.
Energy Technology Data Exchange (ETDEWEB)
Cao, Z.; Petroulakis, E.; Salo, T. [Univ. of Manitoba (Canada)] [and others
1994-09-01
{beta}-Hexosaminidase (Hex A) is a heterodimer of {alpha} and {beta} subunits encoded by the HEXA and HEXB genes, respectively. Mutations in the HEXA gene typically cause Tay-Sachs disease or less severe forms of G{sub M2} gangliosidosis. However, two benign mutations (Arg247Trp and Arg249Trp) in the {alpha}-subunit of Hex A account for Hex A deficiency in {approximately}36% of non-Jewish enzyme-defined Tay-Sachs disease carriers. These mutations do not result in any apparent clinical phenotype in individuals who are genetic compounds with a second disease-causing mutation. We expressed the {alpha}-subunit harboring each of the benign mutations separately to study activity toward the synthetic substrate, 4-MUGS, for comparison to activity from enzymes containing mutations associated with other forms of G{sub M2} gangliosidosis. The C739T (Arg247Trp;benign), C745T (Arg 249Trp; benign), G805A (Gly269Ser; adult-onset), G749A (Gly250Asp; juvenile), and C508T (Arg170Trp; infantile) mutations were introduced into the {alpha}-subunit cDNA. These were transfected alone, or with the {beta}-subunit cDNA, to generate Hex S ({alpha}{alpha}) or Hex A ({alpha}{beta}), respectively. The activities were monitored using 4-MUGS, and the levels of {alpha}-subunit protein were assessed by Western blotting. Repeated experiments show that the benign mutations produce approximately 35% of normal Hex S and 40% of normal Hex A activity. This level is much higher than that of Hex A harbouring the Gly169Ser adult-onset mutation (12%). A sequential decrease in expressed Hex A activity is observed as mutations associated with more severe phenotypes are expressed. The benign mutations also result in lower levels of mature {alpha}-subunit protein compared to normal, and slightly reduced levels of {alpha}-subunit precursor protein. The Hex A deficiency resulting from benign mutations is not as great as that associated with disease-causing mutations.
Energy Technology Data Exchange (ETDEWEB)
Ross, J
1976-09-15
In view of the sensitivity and specificity of the solution hybridization assay for unlabeled globin mRNA a similar technique has been devised to detect radioactive globin mRNA sequences with unlabeled globin cDNA. Several properties of the hybridization reaction are presented since RNA kinetic experiments reported recently depend on the validity of this assay. Data on hybridization analysis of (/sup 3/H)RNA from mouse fetal liver or erythroleukemia cell cytoplasm are presented. These data indicate that the excess cDNA solution assay for radioactive globin mRNA detection is specific for globin mRNA sequences. It can be performed rapidly and is highly reproducible from experiment. It is at least 500-fold less sensitive than the assay for unlabeled globin mRNA, due to the RNAase backgrounds of 0.05 to 0.15 %. However, this limitation has not affected kinetic experiments with non-dividing fetal liver erythroid cells, which synthesize relatively large quantities of globin mRNA.
Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V
2017-07-11
In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing
Spectrin interactions with globin chains in the presence of ...
Indian Academy of Sciences (India)
PRAKASH KUMAR
chains, respectively. The fluorescence-binding data, on the other hand, revealed a larger number of about 80 globin chains binding to spectrin. Cross-linked aggregates of haemoglobin/globin and spectrin have been found under different pathophysiological conditions, e.g. in senescent red blood cells, under oxidative.
Coordinate expression of heme and globin is essential for effective erythropoiesis.
Doty, Raymond T; Phelps, Susan R; Shadle, Christina; Sanchez-Bonilla, Marilyn; Keel, Siobán B; Abkowitz, Janis L
2015-12-01
Erythropoiesis requires rapid and extensive hemoglobin production. Heme activates globin transcription and translation; therefore, heme synthesis must precede globin synthesis. As free heme is a potent inducer of oxidative damage, its levels within cellular compartments require stringent regulation. Mice lacking the heme exporter FLVCR1 have a severe macrocytic anemia; however, the mechanisms that underlie erythropoiesis dysfunction in these animals are unclear. Here, we determined that erythropoiesis failure occurs in these animals at the CFU-E/proerythroblast stage, a point at which the transferrin receptor (CD71) is upregulated, iron is imported, and heme is synthesized--before ample globin is produced. From the CFU-E/proerythroblast (CD71(+) Ter119(-) cells) stage onward, erythroid progenitors exhibited excess heme content, increased cytoplasmic ROS, and increased apoptosis. Reducing heme synthesis in FLVCR1-defient animals via genetic and biochemical approaches improved the anemia, implying that heme excess causes, and is not just associated with, the erythroid marrow failure. Expression of the cell surface FLVCR1 isoform, but not the mitochondrial FLVCR1 isoform, restored normal rbc production, demonstrating that cellular heme export is essential. Together, these studies provide insight into how heme is regulated to allow effective erythropoiesis, show that erythropoiesis fails when heme is excessive, and emphasize the importance of evaluating Ter119(-) erythroid cells when studying erythroid marrow failure in murine models.
Importance of globin gene order for correct developmental expression.
O. Hanscombe (Olivia); D. Whyatt (David); P.J. Fraser (Peter); N. Yannoutsos (Nikos); D.R. Greaves (David); N.O. Dillon (Niall); F.G. Grosveld (Frank)
1991-01-01
textabstractWe have used transgenic mice to study the influence of position of the human globin genes relative to the locus control region (LCR) on their expression pattern during development. The LCR, which is located 5' of the globin gene cluster, is normally required for the activation of all the
Directory of Open Access Journals (Sweden)
Selma Ünal
2014-09-01
Full Text Available OBJECTIVE: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. METHODS: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6±6.1 years, range: 3-30 years with beta-thalassemia major (BTM and 13 beta-thalassemia intermedia (BTI patients (6 males and 7 females; mean age: 19.6±3.5 years, range: 13-26 years were included in the study. The control group comprised 100 healthy blood donors. RESULTS: Neither heterozygous nor homozygous HFE gene C282Y mutation was detected in patients with BTM or BTI, or in control group. CONCLUSION: The C282Y mutation, which is supposed to be responsible for the majority of hereditary hemochromatosis, was not found to have a role in the development of hemochromatosis in beta-thalassemia patients and was not detected in a healthy Turkish population. However, research on larger cohorts of individuals is required in order to determine the exact prevalence of the HFE gene mutation in Turkish populations from diverse ethnic origins and whether it would have an impact on iron loading in thalassemic populations.
Directory of Open Access Journals (Sweden)
Amanda J Grieco
Full Text Available The molecular mechanisms governing γ-globin expression in a subset of fetal hemoglobin (α2γ2: HbF expressing red blood cells (F-cells and the mechanisms underlying the variability of response to hydroxyurea induced γ-globin expression in the treatment of sickle cell disease are not completely understood. Here we analyzed intra-person clonal populations of basophilic erythroblasts (baso-Es derived from bone marrow common myeloid progenitors in serum free cultures and report the level of fetal hemoglobin production in F-cells negatively correlates with expression of BCL11A, KLF1 and TAL1. We then examined the effects of hydroxyurea on these three transcription factors and conclude that a successful induction of γ-globin includes a reduction in BCL11A, KLF1 and TAL1 expression. These data suggests that expression changes in this transcription factor network modulate γ-globin expression in F-cells during steady state erythropoiesis and after induction with hydroxyurea.
Van Doorslaer, Sabine; Cuypers, Bert
2018-02-01
At the start of the twenty-first century, the research into the haem-containing globins got a considerable impetus with the discovery of three new mammalian globins: neuroglobin, cytoglobin and androglobin. Globins are by now found in all kingdoms of life and, in many cases, their functions are still under debate. This revival in globin research increased the demand for adequate physico-chemical research tools to determine the structure-function relationships of these proteins. From early days onwards, electron paramagnetic resonance (EPR) has been used in globin research. In recent decades, the field of EPR has been revolutionised with the introduction of many new pulsed and high-field EPR techniques. In this review, we highlight how EPR has become an essential tool in globin research, and how globins equally provide ideal model systems to push technical developments in EPR.
International Nuclear Information System (INIS)
Reiss, H.R.
1986-01-01
Certain nuclear beta decay transitions normally inhibited by angular momentum or parity considerations can be induced to occur by the application of an electromagnetic field. Such decays can be useful in the controlled production of power, and in fission waste disposal
Induced mutations in sesame breeding
International Nuclear Information System (INIS)
Ashri, A.
2001-01-01
The scope of induced mutations in sesame (Sesamum indicum L.) breeding is reviewed. So far in Egypt, India, Iraq, Rep. of Korea, and Sri Lanka, 14 officially released varieties have been developed through induced mutations: 12 directly and 2 through cross breeding (one using the 'dt45' induced mutant from Israel). For another variety released in China there are no details. The induced mutations approach was adopted primarily in order to obtain genetic variability that was not available in the germplasm collection. The mutagens commonly applied have been gamma rays, EMS and sodium azide. Sesame seeds can withstand high mutagen doses, and there are genotypic differences in sensitivity between varieties. The mutants induced in the above named countries and others include better yield, improved seed retention, determinate habit, modified plant architecture and size, more uniform and shorter maturation period, earliness, resistance to diseases, genic male sterility, seed coat color, higher oil content and modified fatty acids composition. Some of the induced mutants have already given rise to improved varieties, the breeding value of other mutants is now being assessed and still others can serve as useful markers in genetic studies and breeding programmes. (author)
Induced mutation of Dendrobium orchid
International Nuclear Information System (INIS)
Sakinah Ariffin; Mohd Nazir Basiran
2000-01-01
Dendrobiiim orchids serve as the main orchid cut flower export of Malaysia. The wide range of colour and forms presently available in the market are obtained through hybridisation. Induced mutation breeding program was initiated on a commercial variety Dendrobium 'Sonia Kai' to explore the possibilities of obtaining new colour and forms. Matured seeds from self pollination were cultured and irradiated at 35 Gy at the protocorm-like bodies (PLBS) stage. Selection of induced mutations was done after the first flowering of the plants regenerated from the irradiated protocorms. Results showed changes in flower colour, shape and size. Most of these chances are expressed in different combinations in the petals, sepals and lip of the flowers. Thus, resulting. in a very wide spectrum of mutations. Some of these chances are not stable. To date, mutants that showed stable characteristics changes are grouped into 11 categories based on flower colour and form. These results show that the combination of its vitro technique and induced mutation can be applied in orchid breeding to produce new interesting and attractive variety for the market
DEFF Research Database (Denmark)
Erve, J C; Jensen, Ole Nørregaard; Valentine, H S
2000-01-01
residues each. MALDI-TOF MS analysis of two new globin species from DSF-treated rats collected by HPLC revealed increments of 99 Da above the mass of the unmodified chains (beta-2 and beta-3). In a separate experiment, the globin mixture was digested for 2 h with Glu-C and reanalyzed by MALDI-TOF MS....... Results showed a peptide at m/z 2716.3 having a mass 99 Da higher than a known Cys-containing peptide. Subsequently, the Glu-C digest was analyzed using Q-TOF tandem MS, enabling observation of the +4 charge state of the peptide with m/z 2716.3. This peptide was fragmented to produce y-sequence ions...
Molecular analysis of the human β-globin locus activation region
International Nuclear Information System (INIS)
Forrester, W.C.; Novak, U.; Gelinas, R.; Groudine, M.
1989-01-01
Recently, DNA sequences containing four erythroid-specific DNase I hypersensitive sites within 20 kilobases 5' of the human ε-globin gene have been identified as an important cis-acting regulatory element, the locus activation region (LAR). Subfragments of the LAR, containing either all or only the two 5' or two 3' hypersensitive sites were linked to the human β-globin gene and analyzed for their effect on globin gene expression in stably transformed mouse erythroleukemia (MEL) cells. Constructs containing all four of the hypersensitive sites increase β-gobin mRNA levels 8- to 13-fold, while constructs with only the 5' or 3' sites increase globin expression to a lesser extent. No effect was seen when the constructs were assayed in 3T3 fibroblasts. All of the LAR derivatives form hypersensitive sites at the corresponding sequence position in MEL cells prior to and after induction of MEL cell differentiation. However, in 3T3 fibroblasts only the hypersensitive site corresponding to the previously described erythroid-specific -10.9 site was formed
The effect of globin scaffold on osteoblast adhesion and phenotype expression in vitro.
Hamdan, Ahmad A; Loty, Sabine; Isaac, Juliane; Tayot, Jean-Louis; Bouchard, Philippe; Khraisat, Ameen; Bedral, Ariane; Sautier, Jean-Michel
2012-01-01
Different synthetic and natural biomaterials have been used in bone tissue regeneration. However, several limitations are associated with the use of synthetic as well as allogenous or xenogenous natural materials. This study evaluated, in an in vitro model, the behavior of rat osteoblastic cells cultured on a human globin scaffold. Rat osteoblastic cells were isolated from the calvaria of 21-day-old fetal Sprague-Dawley rats. They were then grown in the presence of globin. Real-time polymerase chain reaction (RT-PCR) was performed to study the expression of cyclin D1, integrin Β1, Msx2, Dlx5, Runx2, and osteocalcin on days 1, 5, and 9. Moreover, alkaline phosphatase activity was measured on days 1, 3, 5, and 7. Alizarin red staining was performed on day 9 to observe calcium deposition. Cells were able to adhere, proliferate, and differentiate on globin scaffolds. Moreover, RT-PCR showed that globin may stimulate some key genes of osteoblastic differentiation (Runx2, osteocalcin, Dlx5). Globin had an inhibitory effect on alkaline phosphatase activity. Calcium deposits were seen after 9 days of culture. These results indicate that purified human globin might be a suitable scaffold for bone tissue regeneration.
Opposite responses of rabbit and human globin mRNAs to translational inhibition by cap analogues
International Nuclear Information System (INIS)
Shakin, S.H.; Liebhaber, S.A.
1987-01-01
The translational efficiency of an mRNA may be determined at the step of translational initiation by the efficiency of its interaction with the cap binding protein complex. To further investigate the role of these interactions in translational control, the authors compare in vitro the relative sensitivities of rabbit and human α- and β-globin mRNAs to translational inhibition by cap analogues. They find that rabbit β-globin mRNA is more resistant to translational inhibition by cap analogues than rabbit α-globin mRNA, while in contrast, human β-globin mRNA is more sensitive to cap analogue inhibition than human α- and β-globin mRNAs is unexpected as direct in vivo and in vitro comparisons of polysome profiles reveal parallel translational handling of the α- and β-globin mRNAs from these two species. This discordance between the relative translational sensitivities of these mRNAs to cap analogues and their relative ribosome loading activities suggests that cap-dependent events may not be rate limiting in steady-state globin translation
Hyperthermia-induced alteration of yeast susceptibility to mutation
International Nuclear Information System (INIS)
Mitchel, R.E.J.; Morrison, D.P.
1985-01-01
Diploid yeast (s. cerevisiae) were examined for alterations in susceptibility to induced mutation following hyperthermia treatment. In cells grown at 23 0 C, a non-lethal heat exposure (38 0 C, 30 min) markedly suppressed mutation induced by a subsequent non-killing dose of MNNG of MNU. Mutation by ENU, 8-MOP + UVA, or γ-rays was not affected. An intermediate level of mutation suppression was observed for mutation by 254nm UV or MMS. Mutation by MNNG was not suppressed by the same heat treatment delivered after the mutagen exposure. In a split dose experiment (two MNNG treatments separated by a heat exposure) no suppression of mutation was observed. Treatment with cycloheximide mimicked the effect of heat treatment. These data suggest that mutation induction by MNNG or MNU is protein synthesis dependent, i.e. an error-prone repair system is induced by exposure to MNNG or MNU but not by ENU, 8-MOP+UVA or γ-irradiation. We propose that hyperthermia treatment, by inducing stress protein synthesis at the expense of normal protein synthesis, precludes induction of this error-prone system. Therefore, in heat treated cells, DNA lesions produced by MNNG or MNU exposure must be resolved by an essentially constitutive system which is less error-prone than the inducible one
Assessment of virally vectored autoimmunity as a biocontrol strategy for cane toads.
Directory of Open Access Journals (Sweden)
Jackie A Pallister
Full Text Available BACKGROUND: The cane toad, Bufo (Chaunus marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. METHODOLOGY/PRINCIPAL FINDINGS: The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs, developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin and genetic (adult globin mRNA levels measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. CONCLUSIONS/SIGNIFICANCE: While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach.
Assessment of virally vectored autoimmunity as a biocontrol strategy for cane toads.
Pallister, Jackie A; Halliday, Damien C T; Robinson, Anthony J; Venables, Daryl; Voysey, Rhonda D; Boyle, Donna G; Shanmuganathan, Thayalini; Hardy, Christopher M; Siddon, Nicole A; Hyatt, Alex D
2011-01-25
The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach.
Jakaitiene, Audrone; Avino, Mariano; Guarracino, Mario Rosario
2017-04-01
Against diminishing costs, next-generation sequencing (NGS) still remains expensive for studies with a large number of individuals. As cost saving, sequencing genome of pools containing multiple samples might be used. Currently, there are many software available for the detection of single-nucleotide polymorphisms (SNPs). Sensitivity and specificity depend on the model used and data analyzed, indicating that all software have space for improvement. We use beta-binomial model to detect rare mutations in untagged pooled NGS experiments. We propose a multireference framework for pooled data with ability being specific up to two patients affected by neuromuscular disorders (NMD). We assessed the results comparing with The Genome Analysis Toolkit (GATK), CRISP, SNVer, and FreeBayes. Our results show that the multireference approach applying beta-binomial model is accurate in predicting rare mutations at 0.01 fraction. Finally, we explored the concordance of mutations between the model and software, checking their involvement in any NMD-related gene. We detected seven novel SNPs, for which the functional analysis produced enriched terms related to locomotion and musculature.
Xu, Peng; Tong, Ying; Liu, Xiu-zhen; Wang, Ting-ting; Cheng, Li; Wang, Bo-yu; Lv, Xiang; Huang, Yue; Liu, De-pei
2015-07-09
β-Thalassemia is one of the most common genetic blood diseases and is caused by either point mutations or deletions in the β-globin (HBB) gene. The generation of patient-specific induced pluripotent stem cells (iPSCs) and subsequent correction of the disease-causing mutations may be a potential therapeutic strategy for this disease. Due to the low efficiency of typical homologous recombination, endonucleases, including TALENs and CRISPR/Cas9, have been widely used to enhance the gene correction efficiency in patient-derived iPSCs. Here, we designed TALENs and CRISPR/Cas9 to directly target the intron2 mutation site IVS2-654 in the globin gene. We observed different frequencies of double-strand breaks (DSBs) at IVS2-654 loci using TALENs and CRISPR/Cas9, and TALENs mediated a higher homologous gene targeting efficiency compared to CRISPR/Cas9 when combined with the piggyBac transposon donor. In addition, more obvious off-target events were observed for CRISPR/Cas9 compared to TALENs. Finally, TALENs-corrected iPSC clones were selected for erythroblast differentiation using the OP9 co-culture system and detected relatively higher transcription of HBB than the uncorrected cells. This comparison of using TALENs or CRISPR/Cas9 to correct specific HBB mutations in patient-derived iPSCs will guide future applications of TALENs- or CRISPR/Cas9-based gene therapies in monogenic diseases.
Study of the effect of HFE gene mutations on iron overload in ...
African Journals Online (AJOL)
Manal Michel Wilson
2015-03-04
Mar 4, 2015 ... The Egyptian Journal of Medical Human Genetics www.ejmhg.eg.net ... RDB, a panel of probes (n = 22) using the beta globin strip assay was used ... (20 pmol) of primer R and 5 ll (100 ng) of genomic extracted. DNA.
Exercise- and cold-induced changes in plasma beta-endorphin and beta-lipotropin in men and women.
Viswanathan, M; Van Dijk, J P; Graham, T E; Bonen, A; George, J C
1987-02-01
The plasma beta-endorphin (beta-EP) and beta-lipotropin (beta-LPH) response of men, eumenorrheic women, and amenorrheic women (n = 6) to 1 h of rest or to a bicycle ergometer test [20 min at 30% maximum O2 uptake (VO2max), 20 min at 60% VO2max, and at 90% VO2max to exhaustion] was studied in both normal (22 degrees C) and cold (5 degrees C) environments. beta-EP and beta-LPH was measured by radioimmunoassay in venous samples collected every 20 min during rest or after each exercise bout. Exhaustive exercise at ambient temperature (Ta) 22 degrees C induced significant increases in plasma beta-EP and beta-LPH in all subjects as did work at 60% VO2max in amenorrheic and eumenorrheic women. During work at Ta 5 degrees C, the relative increase in beta-EP and beta-LPH was suppressed in eumenorrheic women and completely prevented in amenorrheic women. Although significant lowering of beta-EP and beta-LPH was observed in men and eumenorrheic women during rest at 5 degrees C, amenorrheic women maintained precold exposure levels. These findings suggest that plasma beta-EP and beta-LPH may reflect a thermoregulatory response to heat load. There appears to be a sexual dimorphism in exercise- and cold-induced release of beta-EP and beta-LPH and amenorrhea may be accompanied by alterations in these responses.
Zhou, Jian-Ying; Yan, Jin-Mei; Li, Jian; Li, Dong-Zhi
2016-06-01
Nondeletional α-thalassemia (α-thal) is the result of point mutations in critical regions of the α-globin genes, affecting mRNA processing, mRNA translation, or α-globin stability. Hb Constant Spring (Hb CS, HBA2: c.427T > C) is the most common nondeletional α-thal that results from a nucleotide substitution at the termination codon of the α2-globin gene. Hb Quong Sze (Hb QS, HBA2: c.377T > C) is another nondeletional α-thal in South China with the missense mutation at codon 125 of the α2-globin gene making this hemoglobin (Hb) variant highly unstable. Although homozygosity for Hb CS (α(CS)α/α(CS)α) or Hb QS (α(QS)α/α(QS)α) has been reported, clinical pictures vary from severe hemolysis that developed early in life to only mild anemia, no clinical phenotypic data of compound heterozygosity for Hb CS/Hb QS (α(CS)α/α(QS)α) has been described. In this report we describe an adult case with such a compound heterozygosity who presented with a mild α-thal.
Distinctive patterns of evolution of the δ-globin gene (HBD in primates.
Directory of Open Access Journals (Sweden)
Ana Moleirinho
Full Text Available In most vertebrates, hemoglobin (Hb is a heterotetramer composed of two dissimilar globin chains, which change during development according to the patterns of expression of α- and β-globin family members. In placental mammals, the β-globin cluster includes three early-expressed genes, ε(HBE-γ(HBG-ψβ(HBBP1, and the late expressed genes, δ (HBD and β (HBB. While HBB encodes the major adult β-globin chain, HBD is weakly expressed or totally silent. Paradoxically, in human populations HBD shows high levels of conservation typical of genes under strong evolutionary constraints, possibly due to a regulatory role in the fetal-to-adult switch unique of Anthropoid primates. In this study, we have performed a comprehensive phylogenetic and comparative analysis of the two adult β-like globin genes in a set of diverse mammalian taxa, focusing on the evolution and functional divergence of HBD in primates. Our analysis revealed that anthropoids are an exception to a general pattern of concerted evolution in placental mammals, showing a high level of sequence conservation at HBD, less frequent and shorter gene conversion events. Moreover, this lineage is unique in the retention of a functional GATA-1 motif, known to be involved in the control of the developmental expression of the β-like globin genes. We further show that not only the mode but also the rate of evolution of the δ-globin gene in higher primates are strictly associated with the fetal/adult β-cluster developmental switch. To gain further insight into the possible functional constraints that have been shaping the evolutionary history of HBD in primates, we calculated dN/dS (ω ratios under alternative models of gene evolution. Although our results indicate that HBD might have experienced different selective pressures throughout primate evolution, as shown by different ω values between apes and Old World Monkeys + New World Monkeys (0.06 versus 0.43, respectively, these estimates
Beta induced Bremsstrahlung dose rate in concrete shielding
International Nuclear Information System (INIS)
Manjunatha, H.C.
2013-01-01
Dosimetric study of beta-induced Bremsstrahlung in concrete is importance in the field of radiation protection. The efficiency, intensity and dose rate of beta induced Bremsstrahlung by 113 pure beta nuclides in concrete shielding is computed. The Bremsstrahlung dosimetric parameters such as the efficiency (yield), Intensity and dose rate of Bremsstrahlung are low for 199 Au and high for 104 Tc in concrete. The efficiency, Intensity and dose rate of Bremsstrahlung increases with maximum energy of beta nuclide (Emax) and modified atomic number (Zmod) of the target. The estimated Bremsstrahlung efficiency, Intensity and dose rate are useful in the calculations photon track-length distributions. These parameters are useful to determine the quality and quantity of the radiation (known as the source term). Precise estimation of this source term is very important in planning of radiation shielding. (author)
VNTR alleles associated with the {alpha}-globin locus are haplotype and population related
Energy Technology Data Exchange (ETDEWEB)
Martinson, J.J.; Clegg, J.B.; Boyce, A.J. [Univ. of Oxford (United Kingdom)
1994-09-01
The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception of closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.
Radiation induced chlorophyll mutations in rice
International Nuclear Information System (INIS)
Bari, G.; Mustafa, G.; Soomro, A.M.; Baloch, A.W.
1985-01-01
Air dried grains of four local varieties of rice were treated with gamma-rays and fast neutrons for determining their mutagenic effectiveness through the occurence of chlorophyll mutations. Fast neutrons were more effective in inducing chlorophyll mutations and the rice variety Basmati 370 produced maximum number of mutations followed by varieties Sonahri Sugdasi, Jajai 77 and Sada Gulab. The highest frequency of chlorophyll mutations was that of albina types followed by striata types. The xantha, viridis and tigrina types of mutations were less frequent. (authors)
International Nuclear Information System (INIS)
Lee, W.R.
1988-01-01
The relative biological effectiveness (RBE) of tritium beta radiation to 60 Co gamma radiation was determined using sex-linked recessive lethals (SLRL) induced in Drosophila melanogaster spermatozoa as the biological effect. The SLRL test, a measure of mutations induced in germ cells transmitted through successive generations, yields a linear dose-response curve in the range used in these experiments. From these ratios of the slopes of the 3 H beta and the 60 Co gamma radiation linear dose response curves, an RBE of 2.7 is observed. When sources of error are considered, this observation suggests that the tritium beta particle is 2.7 ± 0.3 times more effective per unit of energy absorbed in inducing gene mutations transmitted to successive generation than 60 Co gamma radiation. Ion tracks with a high density of ions (high LET) are more efficient than tracks with a low ion density (low LET) in inducing transmissible mutations, suggesting interaction among products of ionization. Molecular analysis of x-ray induced mutations shows that most mutations are deletions ranging from a few base pairs as determined from sequence data to multi locus deletions as determined from complementation tests and Southern blots. 14 refs., 1 fig
A.L.M. Boehmer (Annemie); D.J.J. Halley (Dicky); P.E. de Ruiter (Petra); M.F. Niermeijer (Martinus); S. Andersson (Stefan); F.H. de Jong (Frank); H.H. Bode (Hans); S.L.S. Drop (Stenvert); H. Kayserili (Hülya); M.A. de Vroede; C. Rodrigues (Cidade); B.J. Otten (Barto); B.B. Mendonça (Berenice); H.A. Delemarre-van de Waal (Henriette); C.W. Rouwé (Catrienus); A.O. Brinkmann (Albert); L.A. Sandkuijl (Lodewijk)
1999-01-01
textabstract17Beta-hydroxysteroid dehydrogenase-3 (17betaHSD3) deficiency is an autosomal recessive form of male pseudohermaphroditism caused by mutations in the HSD17B3 gene. In a nationwide study on male pseudohermaphroditism among all pediatric endocrinologists and
In vivo protein-DNA interactions at the β-globin gene locus
International Nuclear Information System (INIS)
Tohru Ikuta; Yuet Wai Kan
1991-01-01
The authors have investigated in vivo protein-DNA interactions in the β-globin gene locus by dimethyl sulfate (DMS) footprinting in K562 cells, which express var-epsilon- and γ-globin but not β-globin. In the locus control region, hypersensitive site 2 (HS-2) exhibited footprints in several putative protein binding motifs. HS-3 was not footprinted. The β promoter was also not footprinted, while extensive footprints were observed in the promoter of the active γ-globin gene. No footprints were seen in the A γ and β3' enhancers. With several motifs, additional protein interactions and alterations in binding patterns occurred with hemin induction. In HeLa cells, some footprints were observed in some of the motifs in HS-2, compatible with the finding that HS-2 has some enhancer function in HeLa cells, albeit much weaker than its activity in K562 cells. No footprint was seen in B lymphocytes. In vivo footprinting is a useful method for studying relevant protein-DNA interactions in erythroid cells
Mazur, G; Braunitzer, G
1984-09-01
The hemoglobins from a lowland tapir (Tapirus terrestris) were analysed and the complete primary structure is described. The globin chains were separated on CM cellulose column in 8M urea and the amino-acid sequences were determined in the liquid phase sequenator. The results show that globin consists of two alpha chains (alpha I and alpha II) and beta major and beta minor components. The alpha chains differ only at one position: alpha I contains aspartic acid and alpha II glycine. The beta chains are heterogeneous: aspartic and glutamic acid were found at position beta 21 and beta 73 of the beta major components and asparagine and serine at position beta 139. In the beta minor components four positions were found with more than one amino acid, namely beta 2, beta 4, beta 6 and beta 56. The sequences are compared with those of man, horse and rhinoceros. Four residues of horse methemoglobin, which are involved in the alpha 1 beta 1 contacts are substituted in tapir hemoglobins. In the alpha chains: alpha 107(G14)Ser----Val, alpha 111-(G18) Val----Leu, alpha 115(GH3) Asn----Asp or Gly; in the beta chains: beta 116(G18) Arg----Gln. The amino acid at beta 2 of the major components is glutamic acid while glutamine and histidine are found in the minor components. Although glutamic acid, a binding site for ATP, does not interact with 2,3-bisphosphoglycerate, glutamine and histidine in the minor components are responsible for the slight effect of 2,3-bisphosphoglycerate on tapir hemoglobin.
Semisynthetic hemoglobin A: Reconstitution of functional tetramer from semisynthetic α-globin
International Nuclear Information System (INIS)
Sahni, G.; Cho, Y.J.; Iyer, K.S.; Khan, S.A.; Seetharam, R.; Acharya, A.S.
1989-01-01
The optimal conditions for the semisynthesis of α-globin through Staphylococcus aureus V8 protease condensation of a synthetic fragment (α 1-30 ) with the complementary apo fragment (α 31-141 ) in the presence of structure-inducing organic cosolvents and the reconstitution of the functional tetramer from semisynthetic α-globin have been investigated. The protease-catalyzed ligation of the complementary apo fragments α 1-30 and α 31-141 proceeds with very high selectivity at pH 6.0 and 4 degree C in the presence of 1-propanol as the organic cosolvent. A 30% 1-propanol solution was optimal for the semisynthetic reaction, and the synthetic reaction attained an equilibrium (approximately 50%) in 72 h. The synthetic reaction proceeds smoothly over a wide pH range (pH 5-8). Besides, the semisynthetic system is flexible, and it also proceeded well if trifluoroethanol or 2-propanol was used instead of 1-propanol. However, glycerol, a versatile organic cosolvent used in all other proteosynthetic reactions reported in the literature, was not very efficient as an organic cosolvent in the present synthetic reaction. The semisynthetic α-globin prepared with 1-propanol as the organic cosolvent has been reconstituted into HbA. The semisynthetic HbA was then purified by CM-cellulose chromatography. The semisynthetic HbA is indistinguishable from native HbA, in terms of its structural and functional properties. The semisynthetic approach provides the flexibility in protein engineering studies for the incorporation of spectroscopic labels ( 13 C- and/or 15 N-labeled amino acids), noncoded amino acids, or unnatural bond functionalities, which at present is not possible with genetic approaches
Enein, Azza Aboul; El Dessouky, Nermine A; Mohamed, Khalda S; Botros, Shahira K A; Abd El Gawad, Mona F; Hamdy, Mona; Dyaa, Nehal
2016-06-15
This study aimed to detect the most common HFE gene mutations (C282Y, H63D, and S56C) in Egyptian beta thalassemia major patients and its relation to their iron status. The study included 50 beta thalassemia major patients and 30 age and sex matched healthy persons as a control group. Serum ferritin, serum iron and TIBC level were measured. Detection of the three HFE gene mutations (C282Y, H63D and S65C) was done by PCR-RFLP analysis. Confirmation of positive cases for the mutations was done by sequencing. Neither homozygote nor carrier status for the C282Y or S65C alleles was found. The H63D heterozygous state was detected in 5/50 (10%) thalassemic patients and in 1/30 (3.3%) controls with no statistically significant difference between patients and control groups (p = 0.22). Significantly higher levels of the serum ferritin and serum iron in patients with this mutation (p = 001). Our results suggest that there is an association between H63D mutation and the severity of iron overload in thalassemic patients.
Characterization of histone H3K27 modifications in the β-globin locus
International Nuclear Information System (INIS)
Kim, Yea Woon; Kim, AeRi
2011-01-01
Research highlights: → The β-globin locus control region is hyperacetylated and monomethylated at histone H3K27. → Highly transcribed globin genes are marked by H3K27ac, but H3K27me2 is remarkable at silent globin genes in erythroid K562 cells. → Association of PRC2 subunits is comparable with H3K27me3 pattern. → Modifications of histone H3K27 are established in an enhancer-dependent manner. -- Abstract: Histone H3K27 is acetylated or methylated in the environment of nuclear chromatin. Here, to characterize the modification pattern of H3K27 in locus control region (LCR) and to understand the correlation of various H3K27 modifications with transcriptional activity of genes, we analyzed the human β-globin locus using the ChIP assay. The LCR of the human β-globin locus was enriched by H3K27ac and H3K27me1 in erythroid K562 cells. The highly transcribed globin genes were hyperacetylated at H3K27, but the repressed globin genes were highly dimethylated at this lysine in these cells. However, in non-erythroid 293FT cells, the β-globin locus was marked by a high level of H3K27me3. EZH2 and SUZ12, subunits of polycomb repressive complex 2, were comparably detected with the H3K27me3 pattern in K562 and 293FT cells. In addition, H3K27ac, H3K27me1 and H3K27me3 were established in an enhancer-dependent manner in a model minichromosomal locus containing an enhancer and its target gene. Taken together, these results show that H3K27 modifications have distinctive correlations with the chromatin state or transcription level of genes and are influenced by an enhancer.
New mutations affecting induced mutagenesis in yeast.
Lawrence, C W; Krauss, B R; Christensen, R B
1985-01-01
Previously isolated mutations in baker's yeast, Saccharomyces cerevisiae, that impair induced mutagenesis were all identified with the aid of tests that either exclusively or predominantly detect base-pair substitutions. To avoid this bias, we have screened 11 366 potentially mutant clones for UV-induced reversion of the frameshift allele, his4-38, and have identified 10 mutants that give much reduced yields of revertants. Complementation and recombination tests show that 6 of these carry mutations at the previously known REV1, REV1 and REV3 loci, while the remaining 4 define 3 new genes, REV4 (2 mutations), REV5 and REV6. The rev4 mutations are readily suppressed in many genetic backgrounds and, like the rev5 mutation, impart only a limited deficiency for induced mutagenesis: it is likely, therefore that the REV4+ and REV5+ gene functions are only remotely concerned with this process. The rev6 mutants have a more general deficiency, however, as well as marked sensitivity to UV and an increased spontaneous mutation rate, properties that suggest the REV6 gene is directly involved in mutation induction. The REV5 gene is located about 1 cM proximal to CYC1 on chromosome X.
Characterization of two Turkish beta-hexosaminidase mutations causing Tay-Sachs disease.
Ozkara, Hatice Asuman; Sandhoff, Konrad
2003-04-01
Two homoallelic mutations have recently been identified in the alpha-subunit of hexosaminidase A (EC 3.2.1.52) causing the infantile form of Tay-Sachs disease in Turkish patients. Both of these mutations, a 12 bp deletion (1096-1107 or 1098-1108 or 1099-1109) in exon 10 and a point mutation (G1362 to A, Gly454 to Asp) in exon 12, are located in the catalytic domain of the hexosaminidase alpha-chain. In order to determine whether these mutations affect the function of the catalytic domain or result in an instable protein, both mutant cDNAs were overexpressed in COS-1 cells. As judged by Western blotting, transfections of wild-type cDNA produced pro-alpha-chain and mature alpha-chain in parallel with a fivefold increase in cellular hexosaminidase activity using the synthetic substrate 4-methylumbelliferyl beta-N-acetylglucosamine 6-sulfate (MUGS). However, both mutants produced only pro-alpha-chains, although no mature form or detectable hexosaminidase activity towards two different synthetic substrates was observed. These data are consistent with the biochemical phenotype of infantile Tay-Sachs disease. We conclude that the overexpressed mutant pro-alpha-chains were misfolded and could not undergo further proteolytic processing to the active form of the enzyme in the lysosome.
Energy Technology Data Exchange (ETDEWEB)
Sasaki, Shigekazu; Nakamura, Hirotoshi; Tagami, Tetsuya; Miyoshi, Yohzi; Nogimori, Tsuyoshi; Mitsuma, Terunori; Imura, Hiroo (Kyoto Univ. School of Medicine, Aichi (Japan))
1993-05-01
Point mutations in the human T[sub 3] receptor-[beta] (TR[beta]) gene causing single amino acid substitutions have been identified in several different kindred with generalized resistance to thyroid hormone. Until now, no study has been reported on the TR gene in cases of pituitary resistance (PRTH). In the present study, the authors analyzed the TR[beta] gene in a 30-yr-old Japanese female with PRTH. She exhibited clinical features of hyperthyroidism, elevated serum thyroid hormone levels accompanied by inappropriately increased secretion of TSH, mildly elevated basal metabolic rate, and increased urinary excretion of hydroxyproline. No pituitary tumor was detected. DNA fragments of exons 3-8 of the geonomic TR[beta] gene were generated by the polymerase chain reaction and analyzed by a single stranded conformation polymorphism method. Exon 7 of the patient's TR[beta] gene showed an abnormal band, suggesting the existence of mutation(s). By subcloning and sequencing the DNA, a point mutation was identified in one allele at nucleotide 1297 (C to T), which altered the 333rd amino acid, arginine, to tryptophan. Neither of her apparently normal parents had any mutations of the TR[beta] gene. In vitro translation products of the mutant TR[beta] gene showed remarkably decreased T[sub 3]-binding activity (K[sub a], 2.1 [times] 10[sup 8] M[sup [minus]1]; normal TR[beta] K[sub a], 1.1 [times] 10[sup 10] M[sup [minus]1]). Since the molecular defect detected in a patient with PRTH is similar to that seen in subjects with generalized resistance to thyroid hormone, both types of the syndrome may represent a continuous spectrum of the same etiological defect with variable tissue resistance to thyroid hormone.
Ellagic acid promotes A{beta}42 fibrillization and inhibits A{beta}42-induced neurotoxicity
Energy Technology Data Exchange (ETDEWEB)
Feng, Ying [Department of Histology and Embryology, College of Basic Medical Science, China Medical University, Shenyang 110001 (China); Tsinghua University School of Medicine, Haidian District, Beijing 100084 (China); Yang, Shi-gao; Du, Xue-ting; Zhang, Xi; Sun, Xiao-xia; Zhao, Min [Tsinghua University School of Medicine, Haidian District, Beijing 100084 (China); Sun, Gui-yuan, E-mail: sungy2004@sohu.com [Department of Histology and Embryology, College of Basic Medical Science, China Medical University, Shenyang 110001 (China); Liu, Rui-tian, E-mail: rtliu@tsinghua.edu.cn [Tsinghua University School of Medicine, Haidian District, Beijing 100084 (China)
2009-12-25
Smaller, soluble oligomers of {beta}-amyloid (A{beta}) play a critical role in the pathogenesis of Alzheimer's disease (AD). Selective inhibition of A{beta} oligomer formation provides an optimum target for AD therapy. Some polyphenols have potent anti-amyloidogenic activities and protect against A{beta} neurotoxicity. Here, we tested the effects of ellagic acid (EA), a polyphenolic compound, on A{beta}42 aggregation and neurotoxicity in vitro. EA promoted A{beta} fibril formation and significant oligomer loss, contrary to previous results that polyphenols inhibited A{beta} aggregation. The results of transmission electron microscopy (TEM) and Western blot displayed more fibrils in A{beta}42 samples co-incubated with EA in earlier phases of aggregation. Consistent with the hypothesis that plaque formation may represent a protective mechanism in which the body sequesters toxic A{beta} aggregates to render them harmless, our MTT results showed that EA could significantly reduce A{beta}42-induced neurotoxicity toward SH-SY5Y cells. Taken together, our results suggest that EA, an active ingredient in many fruits and nuts, may have therapeutic potential in AD.
Boehmer, ALM; Brinkmann, AO; Sandkuijl, LA; Halley, DJJ; Niermeijer, MF; Andersson, S; de Jong, FH; Kayserili, H; de Vroede, MA; Otten, BJ; Rouwe, CW; Mendonca, BB; Rodrigues, C; Bode, HH; de Ruiter, PE; Delemarre-van de Waal, HA; Drop, SLS
1999-01-01
17 beta-Hydroxysteroid dehydrogenase-3 (17 beta HSD3) deficiency is an autosomal recessive form of male pseudohermaphroditism caused by mutations in the HSD17B3 gene. In a nationwide study on male pseudohermaphroditism among all pediatric endocrinologists and clinical geneticists in The Netherlands,
Common Β- Thalassaemia Mutations in
Directory of Open Access Journals (Sweden)
P Azarfam
2005-01-01
Full Text Available Introduction: β –Thalassaemia was first explained by Thomas Cooly as Cooly’s anaemia in 1925. The β- thalassaemias are hereditary autosomal disorders with decreased or absent β-globin chain synthesis. The most common genetic defects in β-thalassaemias are caused by point mutations, micro deletions or insertions within the β-globin gene. Material and Methods: In this research , 142 blood samples (64 from childrens hospital of Tabriz , 15 samples from Shahid Gazi hospital of Tabriz , 18 from Urumia and 45 samples from Aliasghar hospital of Ardebil were taken from thalassaemic patients (who were previously diagnosed .Then 117 non-familial samples were selected . The DNA of the lymphocytes of blood samples was extracted by boiling and Proteinase K- SDS procedure, and mutations were detected by ARMS-PCR methods. Results: From the results obtained, eleven most common mutations,most of which were Mediterranean mutations were detected as follows; IVS-I-110(G-A, IVS-I-1(G-A ،IVS-I-5(G-C ,Frameshift Codon 44 (-C,( codon5(-CT,IVS-1-6(T-C, IVS-I-25(-25bp del ,Frameshift 8.9 (+G ,IVS-II-1(G-A ,Codon 39(C-T, Codon 30(G-C the mutations of the samples were defined. The results showed that Frameshift 8.9 (+G, IVS-I-110 (G-A ,IVS-II-I(G-A, IVS-I-5(G-C, IVS-I-1(G-A , Frameshift Codon 44(-C , codon5(-CT , IVS-1-6(T-C , IVS-I-25(-25bp del with a frequency of 29.9%, 25.47%,17.83%, 7.00%, 6.36% , 6.63% , 3.8% , 2.5% , 0.63% represented the most common mutations in North - west Iran. No mutations in Codon 39(C-T and Codon 30(G-C were detected. Cunclusion: The frequency of the same mutations in patients from North - West of Iran seems to be different as compared to other regions like Turkey, Pakistan, Lebanon and Fars province of Iran. The pattern of mutations in this region is more or less the same as in the Mediterranean region, but different from South west Asia and East Asia.
Magnetoresistive sensor for real-time single nucleotide polymorphism genotyping
DEFF Research Database (Denmark)
Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin
2014-01-01
We demonstrate a magnetoresistive sensor platform that allows for the real-time detection of point mutations in DNA targets. Specifically, we detect point mutations at two sites in the human beta globin gene. For DNA detection, the present sensor technology has a detection limit of about 160p...... of magnetic beads, which enables real-time quantification of the specific binding of magnetic beads to the sensor surface under varying experimental conditions....
Effect of family counsellling on psychological distress among ...
African Journals Online (AJOL)
Background: Sickle Cell Anaemia (SCA) is a haematological disorder of red blood cells, caused by mutation in the beta globin gene. Caring for patients with the disorder poses a significant psychological burden on the sufferers, the caregivers and their families, thereby affecting their quality of life. Family counselling has ...
Immunopurification of the suppressor tRNA dependent rabbit β-globin readthrough protein
International Nuclear Information System (INIS)
Hatfield, D.; Thorgeirsson, S.S.; Copeland, T.D.; Oroszlan, S.; Bustin, M.
1988-01-01
In mammalian cells, the rabbit β-globin readthrough protein is the only known example of a naturally occurring readthrough protein which does not involve a viral system. To provide an efficient means for its isolation, detection, and study, the authors elicited specific antibodies against this unique protein. The 22 amino acid peptide corresponding to the readthrough portion of this protein was synthesized, coupled to keyhole limpet hemocyanin, and injected into sheep. Specific antibodies to the peptide were produced as demonstrated by the enzyme-linked immunosorbent assay technique and by immunoblotting. The antibodies did not react with globin. The rabbit β-globin readthrough protein was separated from globin and other reticulocyte proteins by polyacrylamide gel electrophoresis and visualized by silver staining or by labeling with [ 35 S] methionine. Incorporation of [ 35 S] methionine into the readthrough protein was significantly enhanced upon addition of an opal suppressor tRNA to reticulocyte lysates. Immunoblotting revealed that the readthrough protein also occurs in lysates without added suppressor tRNA. The antibodies were purified on an affi-gel column which had been coupled with the peptide antigen. The readthrough protein was then purified from reticulocytes by immunoaffinity chromatography and by high-performance liquid chromatography. The results provide conclusive evidence that the β-globin readthrough protein is naturally occurring in rabbit reticulocytes
Liebhaber, S A; Cash, F E; Main, D M
1985-01-01
alpha-Globin is encoded by the two adjacent genes, alpha 1 and alpha 2. Although it is clearly established that both alpha-globin genes are expressed, their relative contributions to alpha-globin messenger RNA (mRNA) and protein synthesis are not fully defined. Furthermore, changes that may occur in alpha-globin gene activity secondarily to the loss of function of one or more of these genes (alpha-thalassemia [Thal]) have not been directly investigated. This study further defines the expressi...
Evolutionary constraints and the neutral theory. [mutation-caused nucleotide substitutions in DNA
Jukes, T. H.; Kimura, M.
1984-01-01
The neutral theory of molecular evolution postulates that nucleotide substitutions inherently take place in DNA as a result of point mutations followed by random genetic drift. In the absence of selective constraints, the substitution rate reaches the maximum value set by the mutation rate. The rate in globin pseudogenes is about 5 x 10 to the -9th substitutions per site per year in mammals. Rates slower than this indicate the presence of constraints imposed by negative (natural) selection, which rejects and discards deleterious mutations.
Directory of Open Access Journals (Sweden)
Lesley Tilleman
Full Text Available Globins occur in all kingdoms of life where they fulfill a wide variety of functions. In the past they used to be primarily characterized as oxygen transport/storage proteins, but since the discovery of new members of the globin family like neuroglobin and cytoglobin, more diverse and complex functions have been assigned to this heterogeneous family. Here we propose a function for a membrane-bound globin of C. elegans, GLB-26. This globin was predicted to be myristoylated at its N-terminus, a post-translational modification only recently described in the globin family. In vivo, this globin is found in the membrane of the head mesodermal cell and in the tail stomato-intestinal and anal depressor muscle cells. Since GLB-26 is almost directly oxidized when exposed to oxygen, we postulate a possible function as electron transfer protein. Phenotypical studies show that GLB-26 takes part in regulating the length of the defecation cycle in C. elegans under oxidative stress conditions.
Radiation-induced mutations in mammals
International Nuclear Information System (INIS)
Ehling, U.H.
1993-01-01
The aims of the proposed project are to provide a better basis for extrapolation of animal data to man. Genetic endpoint, strain and species comparisons are made, which will provide critical experimental data regarding strategies in extrapolating laboratory animal data to man. Experiments were conducted to systematically compare the spontaneous and radiation-induced mutation rates for recessive specific-locus, dominant cataract and enzyme activity alleles in the mouse as well as a comparison of the mutation rate in the mouse and hamster for dominant cataract and enzyme activity alleles. The comparison of the radiation-dose response for recessive specific-locus and dominant cataract mutations are extended. Selected mutations are characterized at the genetic, biochemical and molecular levels. (R.P.) 5 refs., 3 tabs
Characterization of carbon ion-induced mutations in Arabidopsis thaliana
International Nuclear Information System (INIS)
Shikazono, N.; Suzuki, C.; Kitamura, S.; Watanabe, H.; Tano, S.; Tanaka, A.
2003-01-01
Full text: Irradiation of Arabidopsis thaliana by carbon ions was carried out to investigate the mutational effect of ion particles in higher plants. The averaged mutation rate of carbon ions was 2.0 X 10 -6 / Gy, which was 18-fold higher than that of electrons. PCR analysis of the carbon ion-induced mutants showed that, out of 28 mutant alleles, 14 had point-like mutations within the gene, while 14 contained large structural alterations. In the case of 12 electron-induced mutants, 9 had point-like mutations within the gene, while 3 contained large structural alterations. These results suggest that carbon ions are more likely to induce large structural alterations compared with electrons. Further sequence analysis revealed that most of the point-like mutations induced by carbon ions were short deletions. In the case of rearrangements, DNA strand breaks were found to be rejoined using, if present, short homologous sequences for both types of radiation. After carbon ion-irradiation, small deletions were frequently observed around the breakpoints, whereas duplications of terminal sequence were found after electron-irradiation. These results suggest that non-homologous end joining (NHEJ) pathway operates after plant cells are exposed to both ion particles and electrons but that different mode of rejoining deals with the broken ends produced by each radiation. From the present results, it seems reasonable to assume that carbon ions could predominantly induce null mutations in Arabidopsis. The fact that the molecular nature of carbon ion-induced mutation was different from that of electrons and that the molecular mechanisms of cells to induce mutations appeared to be also different implicates that ion particle is not only valuable as a new mutagen but also useful as a new tool to study repair mechanisms of certain types of DNA damage
Radiation-induced mutation at minisatellite loci
International Nuclear Information System (INIS)
Dubrova, Y.E.; Nesterov, V.N.; Krouchinsky, N.G.
1997-01-01
We are studying the radiation-induced increase of mutation rate in minisatellite loci in mice and humans. Minisatellite mutations were scored by multilocus DNA fingerprint analysis in the progeny of γ-irradiated and non-irradiated mice. The frequency of mutation in offspring of irradiated males was 1.7 higher that in the control group. Germline mutation at human minisatellite loci was studied among children born in heavily polluted areas of the Mogilev district of Belarus after the Chernobyl accident and in a control population. The frequency of mutation assayed both by DNA fingerprinting and by eight single locus probes was found to be two times higher in the exposed families than in the control group. Furthermore, mutation rate was correlated with the parental radiation dose for chronic exposure 137 Cs, consistent with radiation-induction of germline mutation. The potential use of minisatellites in monitoring germline mutation in humans will be discussed
Mutation Spectrum of β-Thalassemia and Other Hemoglobinopathies in Chittagong, Southeast Bangladesh.
Chatterjee, Tridip; Chakravarty, Amit; Chakravarty, Sudipa; Chowdhury, Mahmood Ahmed; Sultana, Razia
2015-01-01
Thalassemia is one of the most common autosomal recessive blood disorders in the world. It shows a variety of clinical expression, starting from asymptomatic to severe blood transfusion dependence. More than 500 alleles have been characterized in or around the β-globin region. Moreover, most geographical regions have their own characteristics, frequency and availability of these alleles, predominantly circulating within the communities present in that particular region. In this study, we explored the spectrum of β-thalassemia (β-thal) alleles present in Chittagong, Southeast Bangladesh. This study comprises β-thal and Hb E (HBB: c.79 G > A) patients from in and around the area of Chittagong. Not only exploring the complete β-globin mutation spectrum of the area, but we also tried to look at the origin of the mutated alleles. The β-thal mutations of Bangladesh show a relatively wide spectrum of alleles, which further demonstrates the heterogeneity of the disease in this country. Although our study showed that the majority of the mutations have their origin in neighboring countries such as India, countries of Southeast Asia, Pakistan, etc., some unusual alleles do not originate in neighboring countries and put a little more diversity in the overall spectrum of β-thal-specific alleles. Overall, this study demonstrates the mutation spectrum related to β-thal in Chittagong, Southeast Bangladesh.
International Nuclear Information System (INIS)
Kharkwal, M.C.
1998-01-01
A comparative study of frequency and spectrum of chlorophyll mutations induced by two physical (gamma rays, fast neutrons) and two chemical mutagens (NMU, EMS) in relation to the effects in M1 plants and induction of mutations in M2 was made in four chickpea (Cicer arietinum L.) varieties, two desi (G 130 & H 214) one Kabuli (C 104) and one green seeded (L 345). The treatments included three doses each of gamma rays (400, 500 & 600 Gy) and fast neutrons (5, 10 & 15 Gy) and two concentrations with two different durations of two chemical mutagens, NMU [0.01% (20h), & 0.02% (8h)] and EMS [0.1% (20h) & 0.2% (8h)]. The frequencies and spectrum of three different kinds of induced chlorophyll mutations in the order albina (43.5%), chlorina (27.3%) and xantha (24.2%) were recorded. Chemical mutagens were found to be efficient in inducing chlorophyll mutations in chickpea. Highest frequency of mutations was observed in green seeded var. L 345 (83% of M1 families and 19.9/1000 M2 plants). Kabuli var. C 104 was least responsive for chlorophyll mutations
Benzoni, Elena; Giannone, Valentina; Michetti, Laura; Seia, Manuela; Cavalleri, Laura; Curcio, Cristina
Approximately 150 variants described in the HbVar database have been found to be unstable and about 80.0% of these are on the β-globin gene. We describe the case of a 3-year-old child who presented at the emergency room with fever and asthenia. Hematological data suggested severe hemolytic anemia. Sequencing of the β-globin gene revealed the mutation HBB: c.278A>G at codon 92 in a heterozygous state, reported as Hb Mozhaisk in the HbVar database. Other family members did not have Hb Mozhaisk, thus, this variant is due to a de novo mutation. Because of the rarity of this globin variant, we believe it is important to report similar cases, to have a more complete phenotype description of the pathology and define an adequate reproductive risk for couples, considering the dominant inheritance pattern (hence an inheritance risk of 50.0%).
Oxygen binding properties of non-mammalian nerve globins
DEFF Research Database (Denmark)
Hundahl, Christian; Fago, Angela; Dewilde, Sylvia
2006-01-01
Oxygen-binding globins occur in the nervous systems of both invertebrates and vertebrates. While the function of invertebrate nerve haemoglobins as oxygen stores that extend neural excitability under hypoxia has been convincingly demonstrated, the physiological role of vertebrate neuroglobins...... is less well understood. Here we provide a detailed analysis of the oxygenation characteristics of nerve haemoglobins from an annelid (Aphrodite aculeata), a nemertean (Cerebratulus lacteus) and a bivalve (Spisula solidissima) and of neuroglobin from zebrafish (Danio rerio). The functional differences...... have been related to haem coordination: the haem is pentacoordinate (as in human haemoglobin and myoglobin) in A. aculeata and C. lacteus nerve haemoglobins and hexacoordinate in S. solidissima nerve haemoglobin and D. rerio neuroglobin. Whereas pentacoordinate nerve globins lacked Bohr effects at all...
Directory of Open Access Journals (Sweden)
Heesun Shin
Full Text Available BACKGROUND: The molecular profile of circulating blood can reflect physiological and pathological events occurring in other tissues and organs of the body and delivers a comprehensive view of the status of the immune system. Blood has been useful in studying the pathobiology of many diseases. It is accessible and easily collected making it ideally suited to the development of diagnostic biomarker tests. The blood transcriptome has a high complement of globin RNA that could potentially saturate next-generation sequencing platforms, masking lower abundance transcripts. Methods to deplete globin mRNA are available, but their effect has not been comprehensively studied in peripheral whole blood RNA-Seq data. In this study we aimed to assess technical variability associated with globin depletion in addition to assessing general technical variability in RNA-Seq from whole blood derived samples. RESULTS: We compared technical and biological replicates having undergone globin depletion or not and found that the experimental globin depletion protocol employed removed approximately 80% of globin transcripts, improved the correlation of technical replicates, allowed for reliable detection of thousands of additional transcripts and generally increased transcript abundance measures. Differential expression analysis revealed thousands of genes significantly up-regulated as a result of globin depletion. In addition, globin depletion resulted in the down-regulation of genes involved in both iron and zinc metal ion bonding. CONCLUSIONS: Globin depletion appears to meaningfully improve the quality of peripheral whole blood RNA-Seq data, and may improve our ability to detect true biological variation. Some concerns remain, however. Key amongst them the significant reduction in RNA yields following globin depletion. More generally, our investigation of technical and biological variation with and without globin depletion finds that high-throughput sequencing by RNA
[Clinical management of beta-thalassaemia].
Thuret, Isabelle
2014-10-01
Beta-thalassemia syndromes are autosomal recessive disorders related to the inability to produce beta-globin chains. Thalassemia major is by definition a transfusion dependent anemia and iron overload is the leading cause of death and morbidity. Beta-thalassemia is rarely encountered in France where patients mainly originated from Mediterranean countries and South East Asia. Recently, two major advances have substantially improved the disease management: oral iron chelation therapy and the introduction of cardiac MRI for monitoring cardiac iron. Hematopoietic stem cell transplantation remains, in clinical practice, the only curative approach and is proposed to children having an HLA-identical sibling. Diagnosis of thalassemia trait is important in order to propose genetic counseling to couples at risk. Thalassemia intermedia is a clinical entity where anemia is mild or moderate, requiring no or occasional transfusion. Clinical severity increases with age with a more severe anemia, thrombotic complications and extra-medullary hematopoiesis. Iron overload, optimally monitored with liver MRI, occurs in adult patients and is related to increased iron hyper-absorption.
Electron irradiation-induced defects in {beta}-SiC
Energy Technology Data Exchange (ETDEWEB)
Oshima, Ryuichiro [Osaka Prefectural Univ., Sakai (Japan). Reseach Inst. for Advanced Science and Technology
1996-04-01
To add information of point defects in cubic crystal SiC, polycrystal {beta}-SiC on the market was used as sample and irradiated by neutron and electron. In situ observation of neutron and electron irradiation-induced defects in {beta}-SiC were carried out by ultra high-voltage electronic microscope (UHVEM) and ordinary electronic microscope. The obtained results show that the electron irradiation-induced secondary defects are micro defects less than 20 nm at about 1273K, the density of defects is from 2x10{sup 17} to 1x10{sup 18}/cc, the secondary defects may be hole type at high temperature and the preexistant defects control nuclear formation of irradiation-induced defects, effective sink. (S.Y.)
International Nuclear Information System (INIS)
Fossett, N.G.; Byrne, B.J.; Kelley, S.J.; Tucker, A.B.; Arbour-Reily, P.; Lee, W.R.
1994-01-01
Tritium beta radiation ( 3 H β-radiation) in the form of tritiated water was used to induce mutations at the alcohol dehydrogenase (Adh) locus in male Drosophila melanogaster post-meiotic germ cells. All 23 Adh null mutations were large deletions (>20 kb), determined by genetic complementation and Southern blot analyses. 27 Adh null mutations have been induced by 100-kVp X-rays and have been genetically and molecularly characterized. In contrast to 3 H β-radiation, 100-kVp X-rays induced a bimodal distribution of Adh null mutations, intragenic mutations, ≤250 bp, and large deletions, >100 kb. A statistically significant difference was observed between the frequency of large deletions (23/23 or 1.0) induced by 3 H β-radiation and the frequency of large deletions (19/27 or 0.7) induced by 100-kVp X-rays. However, a statistical difference was not observed between the size distribution of the large deletions induced by 3 H β-radiation and X-rays. The relative deletion frequency (RDF) induced by 3 H β-radiation and 100-kVp X-rays was (1.0/0.7=1.4). The relative biological effectiveness (RBE) of these two radiation sources was 1.4, determined from the ratio of the regression coefficients of the respective 3 H β-radiation and X-ray sex-linked recessive lethal (SLRL) dose-response data. The large difference in size between the two classes of X-ray-induced Adh null mutations and the increase in mutation frequency and deletion frequency for 3 H β-radiation with respect to X-rays may indicate that the relative deletion frequency (RDF) is the molecular biological basis for the increase in the RBE for radiation sources with a mean LET value ≤10 keV/μm
GSK-3beta inhibition enhances sorafenib-induced apoptosis in melanoma cell lines.
Panka, David J; Cho, Daniel C; Atkins, Michael B; Mier, James W
2008-01-11
Glycogen synthase kinase-3beta (GSK-3beta) can participate in the induction of apoptosis or, alternatively, provide a survival signal that minimizes cellular injury. We previously demonstrated that the multikinase inhibitor sorafenib induces apoptosis in melanoma cell lines. In this report, we show that sorafenib activates GSK-3beta in multiple subcellular compartments and that this activation undermines the lethality of the drug. Pharmacologic inhibition and/or down-modulation of the kinase enhances sorafenib-induced apoptosis as determined by propidium iodide staining and by assessing the mitochondrial release of apoptosis-inducing factor and Smac/DIABLO. Conversely, the forced expression of a constitutively active form of the enzyme (GSK-3beta(S9A)) protects the cells from the apoptotic effects of the drug. This protective effect is associated with a marked increase in basal levels of Bcl-2, Bcl-x(L), and survivin and a diminution in the degree to which these anti-apoptotic proteins are down-modulated by sorafenib exposure. Sorafenib down-modulates the pro-apoptotic Bcl-2 family member Noxa in cells with high constitutive GSK-3beta activity. Pharmacologic inhibition of GSK-3beta prevents the disappearance of Noxa induced by sorafenib and enhances the down-modulation of Mcl-1. Down-modulation of Noxa largely eliminates the enhancing effect of GSK-3 inhibition on sorafenib-induced apoptosis. These data provide a strong rationale for the use of GSK-3beta inhibitors as adjuncts to sorafenib treatment and suggest that preservation of Noxa may contribute to their efficacy.
Radiation induced mutations for plant selection
International Nuclear Information System (INIS)
Brunner, H.
1994-01-01
The successful use of plant breeding for improving crops requires the existence of genetic variation of useful traits. Unfortunately, the desired variation is often lacking. However, radiation can be used to induce mutations and thereby generate genetic variation from which desired mutants may be selected. Mutation induction has become a proven way of creating variation within a crop variety. It offers the possibility of inducing desired attributes that either cannot be expressed in nature or have been lost during evolution. More than 1700 mutant cultivars of crop plants with significantly improved attributes such as increased yield, improved quality, disease and stress resistance, have been released worldwide in the last thirty years. The Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture has contributed to these achievements through the promotion of research and development in mutation breeding techniques using nuclear and related biotechnological methods and the provision of in plant breeding is then transferred to Member States of the IAEA and the FAO through training in mutation breeding methods and the provision of technical advice. Moreover, radiation treatment services are provided to foster applications of nuclear techniques in crop improvement programmes of member states and more specifically to render direct support to plant breeders by efficient generation of mutations. Plant materials are standardized prior to radiation exposure to warrant reproducibility of the induced effects within practical limits and a radiosensitivity test is implemented to affirm useful doses for applied objectives of a request. This review deals with irradiation methods applied at the IAEA laboratories for the efficient induction of mutations in seeds, vegetative propagules and tissue and cell cultures and the establishment of genetically variable populations upon which selection of desired traits can be based. 3 tabs., 18 refs. (author)
Glycation induces formation of amyloid cross-beta structure in albumin.
Bouma, Barend; Kroon-Batenburg, Loes M J; Wu, Ya-Ping; Brünjes, Bettina; Posthuma, George; Kranenburg, Onno; de Groot, Philip G; Voest, Emile E; Gebbink, Martijn F B G
2003-10-24
Amyloid fibrils are components of proteinaceous plaques that are associated with conformational diseases such as Alzheimer's disease, transmissible spongiform encephalopathies, and familial amyloidosis. Amyloid polypeptides share a specific quarternary structure element known as cross-beta structure. Commonly, fibrillar aggregates are modified by advanced glycation end products (AGE). In addition, AGE formation itself induces protein aggregation. Both amyloid proteins and protein-AGE adducts bind multiligand receptors, such as receptor for AGE, CD36, and scavenger receptors A and B type I, and the serine protease tissue-type plasminogen activator (tPA). Based on these observations, we hypothesized that glycation induces refolding of globular proteins, accompanied by formation of cross-beta structure. Using transmission electron microscopy, we demonstrate here that glycated albumin condensates into fibrous or amorphous aggregates. These aggregates bind to amyloid-specific dyes Congo red and thioflavin T and to tPA. In contrast to globular albumin, glycated albumin contains amino acid residues in beta-sheet conformation, as measured with circular dichroism spectropolarimetry. Moreover, it displays cross-beta structure, as determined with x-ray fiber diffraction. We conclude that glycation induces refolding of initially globular albumin into amyloid fibrils comprising cross-beta structure. This would explain how glycated ligands and amyloid ligands can bind to the same multiligand "cross-beta structure" receptors and to tPA.
International Nuclear Information System (INIS)
Vidaud, M.; Vidaud, D.; Amselem, S.; Rosa, J.; Goossens, M.; Gattoni, R.; Stevenin, J.; Chibani, J.
1989-01-01
The authors have characterized a Mediterranean β-thalassemia allele containing a sequence change at codon 30 that alters both β-globin pre-mRNA splicing and the structure of the homoglobin product. Presumably, this G → C transversion at position -1 of intron 1 reduces severely the utilization of the normal 5' splice site since the level of the Arg → Thr mutant hemoglobin (designated hemoglobin Kairouan) found in the erythrocytes of the patient is very low (2% of total hemoglobin). Since no natural mutations of the guanine located at position -1 of the CAG/GTAAGT consensus sequence had been isolated previously. They investigated the role of this nucleotide in the constitution of an active 5' splice site by studying the splicing of the pre-mRNA in cell-free extracts. They demonstrate that correct splicing of the mutant pre-mRNA is 98% inhibited. Their results provide further insights into the mechanisms of pre-mRNA maturation by revealing that the last residue of the exon plays a role at least equivalent to that of the intron residue at position +5
NickAria, Shiva; Haghpanah, Sezaneh; Ramzi, Mani; Karimi, Mehran
2018-05-10
Globin switching is a significant factor on blood hemoglobin (Hb) level but its molecular mechanisms have not yet been identified, however, several quantitative trait loci (QTL) and polymorphisms involved regions on chromosomes 2p, 6q, 8q and X account for variation in the γ-globin expression level. We studied the effect of interaction between a region on intron six of the TOX gene, chromosome 8q (chr8q) and XmnI locus on the γ-globin promoter, chr11p on γ-globin expression in 150 β-thalassemia intermedia (β-TI) patients, evaluated by statistical interaction analysis. Our results showed a significant interaction between one QTL on intron six of the TOX gene (rs9693712) and XmnI locus that effect γ-globin expression. Interchromosomal interaction mediates through transcriptional machanisms to preserve true genome architectural features, chromosomes localization and DNA bending. This interaction can be a part of the unknown molecular mechanism of globin switching and regulation of gene expression.
R and D activities on radiation induced mutation breeding
International Nuclear Information System (INIS)
Lapade, A.G.; Asencion, A.B.; Santos, I.S.; Grafia, A.O.; Veluz, AM.S.; Barrida, A.C.; Marbella, L.J.
1996-01-01
This paper summarizes the accomplishments, prospects and future plans of mutation breeding for crop improvement at the Philippine Nuclear Research Institute (PNRI). Mutation induction has become a proven way creating variation within a crop variety and inducing desired attributes that cannot be found in nature or have been lost during evolution. Several improved varieties with desirable traits were successfully developed through induced mutation breeding at our research institute. In rice, mutation breeding has resulted in the development of new varieties: (1) PARC 2, (2) Milagrosa mutant, (3) Bengawan mutant and (4) Azmil mutant. Mutation breeding in leguminous crops has led to the induction of an improved L 114 soybean mutant that is shorter that the original variety but yield about 40% more. Several PAEC mungbean varieties characterized with long pods that are non-shattering were also induced. In asexually propagated crops, an increase in yield and chlorophyll mutants were obtained in sweet potatos. Likewise, chlorophyll mutant which look-like 'ornamental bromeliads' and a mutant with reduced spines have been developed in pineapple Queen variety. At present, we have started a new project in mutation breeding in ornamentals. Tissue culture is being utilized in our mutation breeding program. In the near future, radiation induced mutagenesis coupled with in vitro culture techniques on protoplast culture and somatic hybridization will be integrated into our mutation breeding program to facilitate the production of new crop varieties. (author)
Induced mutations for human welfare through agriculture
International Nuclear Information System (INIS)
Patil, S.A.
2009-01-01
Full text: Use of induced mutation for crop improvement started in 1920's. It gained momentum in 1960's when IAEA and FAO started training and guidance and funds were made available for undertaking mutation breeding. IARI established a Gamma Garden and a separate institution was carved by name 'Nuclear Research Laboratory' in 1970's. ICAR Institutes and State Agriculture Universities started using this facility for crop improvement. Similarly, BARC started extending its help for irradiating the seed material specially X-rays and it became one of the major source of generating variability for crop improvement. Induced mutation has resulted in development of more than 3000 varieties of different food, feed, fruit, vegetables and flowers. Apart from direct use of mutants as cultivars, mutants have played a vital role in creating useful variation for application in basic research and gene discovery. It has helped in increasing yield through use of heterosis by inducing male sterility. It has been used for creating useful variation for changing grain composition to improve nutrition and grain quality parameters, for tolerance against abiotic and biotic stresses. Gene sequencing and related technologies have opened up new application of induced mutations. In model organisms induced mutations provide new opportunities for identification of genes/bio-chemical, cellular, developmental or functional pathways. The use of stable isotopes in basic research is of fundamental use in crop improvement. Apart from crop improvement the nuclear technology has been used for numerous other applications in Agriculture such as soil fertility, plant nutrition, use of fertilizer and irrigation, control of insect pest and storage. In recent decades BARC has come in a big way through funding for projects to State Agricultural Universities and ICAR Institutes and has signed MoU's with few of the Agriculture Universities for testing and popularizing their identified field crop varieties in
Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies
Loucari, C.C. (Constantinos C.); Patsali, P. (Petros); T.B. van Dijk (Thamar); Stephanou, C. (Coralea); Papasavva, P. (Panayiota); Zanti, M. (Maria); Kurita, R. (Ryo); Nakamura, Y. (Yukio); S. Christou (Soteroula); Sitarou, M. (Maria); J.N.J. Philipsen (Sjaak); C.W. Lederer (Carsten); M. Kleanthous (Marina)
2018-01-01
textabstractThe β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of
DEFF Research Database (Denmark)
Emanuelli, Brice; Glondu, Murielle; Filloux, Chantal
2004-01-01
insulin signaling is required for the optimal beta-cell function, we assessed the effect of IL-1beta on the insulin pathway in a rat pancreatic beta-cell line. We show that IL-1beta decreases insulin-induced tyrosine phosphorylation of the insulin receptor (IR) and insulin receptor substrate (IRS...
Laboratory investigation of hemoglobinopathies and thalassemias: review and update.
Clarke, G M; Higgins, T N
2000-08-01
Structural hemoglobin (Hb) variants typically are based on a point mutation in a globin gene that produce a single amino acid substitution in a globin chain. Although most are of limited clinical significance, a few important subtypes have been identified with some frequency. Homozygous Hb C and Hb S (sickle cell disease) produce significant clinical manifestations, whereas Hb E and Hb D homozygotes may be mildly symptomatic. Although heterozygotes for these variants are typically asymptomatic, diagnosis may be important for genetic counseling. Thalassemia, in contrast, results from quantitative reductions in globin chain synthesis. Those with diminished beta-globin chains are termed beta-thalassemias, whereas those with decreased alpha-chain production are called alpha-thalassemias. Severity of clinical manifestations in these disorders relates to the amount of globin chain produced and the stability of residual chains present in excess. The thalassemia minor syndromes are characterized clinically by mild anemia with persistent microcytosis. Thalassemia intermedia (i.e., Hb H disease) is typified by a moderate, variably compensated hemolytic anemia that may present with clinical symptoms during a period of physiologic stress such as infection, pregnancy, or surgery. The thalassemia major syndromes produce severe, life-threatening anemia. alpha-Thalassemia major usually is incompatible with extrauterine life; beta-thalassemia major presents in infancy and requires life-long transfusion therapy and/or bone marrow transplantation for successful control of the disease. Double heterozygosity for certain structural variants and/or thalassemia syndromes may also lead to severe clinical disease. Several guidelines have been published that outline the required steps for hemoglobinopathy and thalassemia investigation. The availability of HPLC has streamlined many of these requirements, allowing an efficient stepwise diagnostic strategy for these complex disorders.
Radiation-induced mutations and plant breeding
International Nuclear Information System (INIS)
Naqvi, S.H.M.
1985-01-01
Ionizing radiation could cause genetic changes in an organism and could modify gene linkages. The induction of mutation through radiation is random and the probability of getting the desired genetic change is low but can be increased by manipulating different parameters such as dose rate, physical conditions under which the material has been irradiated, etc. Induced mutations have been used as a supplement to conventional plant breeding, particularly for creating genetic variability for specific characters such as improved plant structure, pest and disease resistance, and desired changes in maturity period; more than 200 varieties of crop plants have been developed by this technique. The Pakistan Atomic Energy Commission has used this technique fruitfully to evolve better germplasm in cotton, rice, chickpea, wheat and mungbean; some of the mutants have become popular commercial varieties. This paper describes some uses of radiation induced mutations and the results achieved in Pakistan so far
Induced mutations - a tool in plant research
International Nuclear Information System (INIS)
1981-01-01
These proceedings include 34 papers and 18 brief descriptions of poster presentations in the following areas as they are affected by induced mutations: advancement of genetics, plant evolution, plant physiology, plant parasites, plant symbioses, in vitro culture, gene ecology and plant breeding. Only a relatively small number of papers are of direct nuclear interest essentially in view of the mutations being induced by ionizing radiations. The papers of nuclear interest have been entered as separate and individual items of input
Energy Technology Data Exchange (ETDEWEB)
Cao, Z.; Chabot, T.; Triggs-Raine, B.L. (Univ. of Manitoba, Winnepeg (Canada)); Natowicz, M.R.; Prence, E.M. (Shriver Center for Mental Retardation, Waltham, MA (United States) Harvard Medical School, Boston, MA (United States)); Kaback, M.M.; Lim-Steele, S.T.; Brown, D. (Children' s Hospital, San Diego, CA (United States) Univ. of California, San Diego, CA (United States))
1993-12-01
Deficient activity of [beta]-hexosaminidase A (Hex A), resulting from mutations in the HEXA gene, typically causes Tay-Sachs disease. However, healthy individuals lacking Hex A activity against synthetic substrates (i.e., individuals who are pseudodeficient) have been described. Recently, an apparently benign C[sub 739]-to-T (Arg247Trp) mutation was found among individuals with Hex A levels indistinguishable from those of carriers of Tay-Sachs disease. This allele, when in compound heterozygosity with a second [open quotes]disease-causing[close quotes] allele, results in Hex A pseudodeficiency. The authors examined the HEXA gene of a healthy 42-year-old who was Hex A deficient but did not have the C[sub 739]-to-T mutation. The HEXA exons were PCR amplified, and the products were analyzed for mutations by using restriction-enzyme digestion or single-strand gel electrophoresis. A G[sub 805]-to-A (Gly269Ser) mutation associated with adult-onset G[sub m2] gangliosidosis was found on one chromosome. A new mutation, C[sub 745]-to-T (Arg 249Trp), was identified on the second chromosome. This mutation was detected in an additional 4/63 (6%) non-Jewish and 0/218 Ashkenazi Jewish enzyme-defined carriers. Although the Arg249Trp change may result in a late-onset form of G[sub M2] gangliosidosis, any phenotype must be very mild. This new mutation and the benign C[sub 739]-to-T mutation together account for [approximately]38% of non-Jewish enzyme-defined carriers. Because carriers of the C[sub 739]-to-T and C[sub 745]-to-T mutations cannot be differentiated from carriers of disease-causing alleles by using the classical biochemical screening approaches, DNA-based analyses for these mutations should be offered for non-Jewish enzyme-defined heterozygotes, before definitive counseling is provided. 46 refs., 5 figs., 2 tabs.
Induced mutations for crop improvement- the generation next
International Nuclear Information System (INIS)
Bhatia, C.R.
2000-01-01
Experiments to use induced mutations for the improvement of crop plants were initiated in the country in mid nineteen fifties. After forty five years and reasonably good success stories, it is no longer an attractive subject for bright young graduate students. The areas of intellectually satisfying, contemporary, plant genetics based on induced mutations that can also bring social and commercial benefits are identified. These are: nodulation mutants in legumes, altering fatty acid composition in oil crops, modification of root characters, altering host-pathogen interactions, flowering time, day length insensitivity and some changes in modulation pattern involve mutations
DNA sequence analysis of X-ray induced Adh null mutations in Drosophila melanogaster
International Nuclear Information System (INIS)
Mahmoud, J.; Fossett, N.G.; Arbour-Reily, P.; McDaniel, M.; Tucker, A.; Chang, S.H.; Lee, W.R.
1991-01-01
The mutational spectrum for 28 X-ray induced mutations and 2 spontaneous mutations, previously determined by genetic and cytogenetic methods, consisted of 20 multilocus deficiencies (19 induced and 1 spontaneous) and 10 intragenic mutations (9 induced and 1 spontaneous). One of the X-ray induced intragenic mutations was lost, and another was determined to be a recombinant with the allele used in the recovery scheme. The DNA sequence of two X-ray induced intragenic mutations has been published. This paper reports the results of DNA sequence analysis of the remaining intragenic mutations and a summary of the X-ray induced mutational spectrum. The combination of DNA sequence analysis with genetic complementation analysis shows a continuous distribution in size of deletions rather than two different types of mutations consisting of deletions and 'point mutations'. Sequencing is shown to be essential for detecting intragenic deletions. Of particular importance for future studies is the observation that all of the intragenic deletions consist of a direct repeat adjacent to the breakpoint with one of the repeats deleted
Induced Mutations in Thai Rice
International Nuclear Information System (INIS)
Klakhaeng, Kanchana
2014-01-01
Rice is the primary source of food for more than half of the world's population. It benefits greatly from technological inputs in the area of breeding such as induced mutation. Induced mutation can produce mutants with significant improvement in plant type, maturity, yields and protein ratio when compared to the parent. These improved traits enable the mutants to fit into farming systems with either shorter or longer growing seasons. Three induced mutant rice varieties, including RD6, RD10 and RD15, are well accepted by farmers and consumers in Thailand. RD6 and RD15 were aromatic, photosensitive varieties which were derived from KDML105 by acute irradiation of 20 and 15 kilorad gamma ray, respectively. After induced mutation, pedigree selection was applied. RD6 showed drought tolerance and also good grain quality including softness and good aroma with a higher average yield than the famous glutinous variety, San-Pah-Tong. Additionally, it was resistant to blast and brown spot diseases with an average yield of 4.19 tons/ha. RD15 showed drought tolerance and resistance to brown spot disease with the highest yield of 3.5 tons/ha. These two mutant varieties are currently the most famous aromatic rice varieties in Thailand. On the other hand, RD10 is a glutinous, photoperiod insensitive rice variety which was derived from RD1 by irradiation of 1 kilorad fast neutrons. RD10 showed good grain quality such as softness and stickiness with the yield of 4.25 tons/ha. As an on-going project, recommended rice varieties were irradiated with electron beam for anaerobic germination ability, submergence tolerance, stagnant-flood tolerance and also internode elongation.
Akt interacts directly with Smad3 to regulate the sensitivity to TGF-beta induced apoptosis.
Conery, Andrew R; Cao, Yanna; Thompson, E Aubrey; Townsend, Courtney M; Ko, Tien C; Luo, Kunxin
2004-04-01
Transforming growth factor beta (TGF-beta) induces both apoptosis and cell-cycle arrest in some cell lines, but only growth arrest in others. It is not clear how this differential response to TGF-beta is specified. Smad proteins are critical mediators of TGF-beta signalling. After stimulation by TGF-beta, Smad2 and Smad3 become phosphorylated by the activated TGF-beta receptor kinases, oligomerize with Smad4, translocate to the nucleus and regulate the expression of TGF-beta target genes. Here we report that the sensitivity to TGF-beta induced apoptosis is regulated by crosstalk between the Akt/PKB serine/threonine kinase and Smad3 through a mechanism that is independent of Akt kinase activity. Akt interacts directly with unphosphorylated Smad3 to sequester it outside the nucleus, preventing its phosphorylation and nuclear translocation. This results in inhibition of Smad3-mediated transcription and apoptosis. Furthermore, the ratio of Smad3 to Akt correlates with the sensitivity of cells to TGF-beta induced apoptosis. Alteration of this ratio changes the apoptotic, but not the growth-inhibitory, responses of cells to TGF-beta. These findings identify an important determinant of sensitivity to TGF-beta-induced apoptosis that involves crosstalk between the TGF-beta and phosphatidylinositol-3-OH kinase (PI(3)K) pathways.
Specificity of mutations induced by carbon ions in budding yeast Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Matuo, Youichirou; Nishijima, Shigehiro; Hase, Yoshihiro; Sakamoto, Ayako; Tanaka, Atsushi; Shimizu, Kikuo
2006-01-01
To investigate the nature of mutations induced by accelerated ions in eukaryotic cells, the effects of carbon-ion irradiation were compared with those of γ-ray irradiation in the budding yeast Saccharomyces cerevisiae. The mutational effect and specificity of carbon-ion beams were studied in the URA3 gene of the yeast. Our experiments showed that the carbon ions generated more than 10 times the number of mutations induced by γ-rays, and that the types of base changes induced by carbon ions include transversions (68.7%), transitions (13.7%) and deletions/insertions (17.6%). The transversions were mainly G:C → T:A, and all the transitions were G:C → A:T. In comparison with the surrounding sequence context of mutational base sites, the C residues in the 5'-AC(A/T)-3' sequence were found to be easily changed. Large deletions and duplications were not observed, whereas ion-induced mutations in Arabidopsis thaliana were mainly short deletions and rearrangements. The remarkable feature of yeast mutations induced by carbon ions was that the mutation sites were localized near the linker regions of nucleosomes, whereas mutations induced by γ-ray irradiation were located uniformly throughout the gene
International Nuclear Information System (INIS)
Kato, T.; Nakano, E.
1981-01-01
The effects of the umuC36 mutation on the induction of base-change and frameshift mutations were studied. An active umuC gene was necessary in either the uvr + or uvr - strains of Escherichia coli K12 for UV- and X-ray-induced mutations to His + , ColE and Spc, which are presumably base-change mutations, but it was not essential for ethyl methanesulphonate or N-methyl-N'-nitro-N-nitrosoguanidine-induced His + mutations. In contrast, only 1 out of 13 trp - frameshift mutations examined was UV reversible, and the process of mutagenesis was umuC + -dependent, whereas a potent frameshift mutagen, ICR191, effectively induced Trp + mutations in most of the strains regardless of the umu + or umuC genetic background. These results suggest that base substitutions are a major mutational type derived from the umuC + -dependent pathway of error-prone repair. (orig.)
Glavac, Damjan; Potocnik, Uros; Podpecnik, Darja; Zizek, Teofil; Smerkolj, Sava; Ravnik-Glavac, Metka
2002-04-01
We have studied 57 different mutations within three beta-globin gene promoter fragments with sizes 52 bp, 77 bp, and 193 bp by fluorescent capillary electrophoresis CE-SSCP analysis. For each mutation and wild type, energetically most-favorable predicted secondary structures were calculated for sense and antisense strands using the MFOLD DNA-folding algorithm in order to investigate if any correlation exists between predicted DNA structures and actual CE migration time shifts. The overall CE-SSCP detection rate was 100% for all mutations in three studied DNA fragments. For shorter 52 bp and 77 bp DNA fragments we obtained a positive correlation between the migration time shifts and difference in free energy values of predicted secondary structures at all temperatures. For longer 193 bp beta-globin gene fragments with 46 mutations MFOLD predicted different secondary structures for 89% of mutated strands at 25 degrees C and 40 degrees C. However, the magnitude of the mobility shifts did not necessarily correlate with their secondary structures and free energy values except for the sense strand at 40 degrees C where this correlation was statistically significant (r = 0.312, p = 0.033). Results of this study provided more direct insight into the mechanism of CE-SSCP and showed that MFOLD prediction could be helpful in making decisions about the running temperatures and in prediction of CE-SSCP data patterns, especially for shorter (50-100 bp) DNA fragments. Copyright 2002 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Supachai Ekwattanakit
2012-01-01
Full Text Available Background and Objectives. To explore the role of cis-regulatory sequences within the β globin gene cluster at chromosome 11 on human γ globin gene expression related to Hb E allele, we analyze baseline hematological data and Hb F values together with β globin haplotypes in homozygous Hb E. Patients and Methods. 80 individuals with molecularly confirmed homozygous Hb E were analyzed for the β globin haplotypes and Xmn I polymorphism using PCR-RFLPs. 74 individuals with complete laboratory data were further studied for association analyses. Results. Eight different β globin haplotypes were found linked to Hb E alleles; three major haplotypes were (a (III, (b (V, and (c (IV accounting for 94% of Hb E chromosomes. A new haplotype (Th-1 was identified and most likely converted from the major ones. The majority of individuals had Hb F < 5%; only 10.8% of homozygous Hb E had high Hb F (average 10.5%, range 5.8–14.3%. No association was found on a specific haplotype or Xmn I in these individuals with high Hb F, measured by alkaline denaturation. Conclusion. The cis-regulation of γ globin gene expression might not be apparent under a milder condition with lesser globin imbalance such as homozygous Hb E.
International Nuclear Information System (INIS)
Hafeez, M.
2007-01-01
To determine the regional and ethnic distribution of beta thalassemia mutation and the effect of consanguinity in patients referred for prenatal diagnosis of beta b-thalassemia and to target the high risk population for screening. A total of 499 couples were referred to Gentec Lab., Lahore, from all over Pakistan for prenatal diagnosis of b-thalassemia. After counseling, chorionic villus sampling was done between 10-16 weeks of gestation. DNA analysis was done by Amplification Refractory Mutation System (ARMS) for type of mutation in the Armed Forces Institute of Pathology, Rawalpindi. Ethnicity, race and consanguineous relationship of parents was determined.b-thalassemia was prevalent in Punjabis (60.7%) followed by Saraikees (25.5%). Castewise it was most frequent in Rajputs followed by Jatts, Arain, Sheikhs and Pathans. 56.7% of the couples were first cousins and 19.8% were relatives. The commonest mutations were Frameshift 8-9 (Fr8-9) 33.5%, Intervening Sequence 1-5 (IVS 1-5) 17.2%, Fr4142 - 8%, IVS 1-1 - 5.2%, Deletion 619 (Del 619) 4.2% and Codon 5 (Cd 5) - 4.2%. In samples sent for analysis, 53.1% turned out to be carriers (trait), 25.3% were diseased (thalassemia major) and 21.6% were normal. P-value of all results was less than 0.001. In this series, the highest frequency was found in Punjabi Rajputs. The commonest mutation was Fr 8-9. Most parents were first cousins. Premarital thalassemia carrier testing can effectively reduce the disease. (author)
Specificity of mutations induced by carbon ions in budding yeast Saccharomyces cerevisiae
Energy Technology Data Exchange (ETDEWEB)
Matuo, Youichirou [Graduate School of Engineering, Osaka University, Yamada-oka 2-1, Suita, Osaka 565-0871 (Japan); Nishijima, Shigehiro [Graduate School of Engineering, Osaka University, Yamada-oka 2-1, Suita, Osaka 565-0871 (Japan); Hase, Yoshihiro [Radiation-Applied Biology Division, Quantum Beam Science Directorate, Japan Atomic Energy Agency (JAEA), Watanuki-machi 1233, Takasaki, Gunma 370-1292 (Japan); Sakamoto, Ayako [Radiation-Applied Biology Division, Quantum Beam Science Directorate, Japan Atomic Energy Agency (JAEA), Watanuki-machi 1233, Takasaki, Gunma 370-1292 (Japan); Tanaka, Atsushi [Radiation-Applied Biology Division, Quantum Beam Science Directorate, Japan Atomic Energy Agency (JAEA), Watanuki-machi 1233, Takasaki, Gunma 370-1292 (Japan); Shimizu, Kikuo [Radioisotope Research Center, Osaka University, Yamada-oka 2-4, Suita, Osaka 565-0871 (Japan)]. E-mail: shimizu@rirc.osaka-u.ac.jp
2006-12-01
To investigate the nature of mutations induced by accelerated ions in eukaryotic cells, the effects of carbon-ion irradiation were compared with those of {gamma}-ray irradiation in the budding yeast Saccharomyces cerevisiae. The mutational effect and specificity of carbon-ion beams were studied in the URA3 gene of the yeast. Our experiments showed that the carbon ions generated more than 10 times the number of mutations induced by {gamma}-rays, and that the types of base changes induced by carbon ions include transversions (68.7%), transitions (13.7%) and deletions/insertions (17.6%). The transversions were mainly G:C {sup {yields}} T:A, and all the transitions were G:C {sup {yields}} A:T. In comparison with the surrounding sequence context of mutational base sites, the C residues in the 5'-AC(A/T)-3' sequence were found to be easily changed. Large deletions and duplications were not observed, whereas ion-induced mutations in Arabidopsis thaliana were mainly short deletions and rearrangements. The remarkable feature of yeast mutations induced by carbon ions was that the mutation sites were localized near the linker regions of nucleosomes, whereas mutations induced by {gamma}-ray irradiation were located uniformly throughout the gene.
Chen, Min; Tan, Arnold S C; Cheah, Felicia S H; Saw, Eugene E L; Chong, Samuel S
2015-12-01
Beta (β)-thalassemia is one of the most common monogenic diseases worldwide. Affected pregnancies can be avoided through preimplantation genetic diagnosis (PGD), which commonly involves customized assays to detect the different combinations of β-globin (HBB) gene mutations present in couples, in conjunction with linkage analysis of flanking microsatellite markers. Currently, the limited number of reported closely linked markers hampers their utility in indirect linkage-based PGD for this disorder. To increase the available markers closely flanking the HBB gene, an in silico search was performed to identify all markers within 1 Mb flanking the HBB gene. Fifteen markers with potentially high polymorphism information content (PIC) and heterozygosity values were selected and optimized into a single-tube pentadecaplex PCR panel. Allele frequencies and polymorphism and heterozygosity indices of each marker were assessed in five populations. A total of 238 alleles were observed from the 15 markers. PIC was >0.7 for all markers, with expected heterozygosity and observed heterozygosity values ranging from 0.74 to 0.90 and 0.72 to 0.88, respectively. Greater than 99% of individuals were heterozygous for at least seven markers, with at least two heterozygous markers on either side of the HBB gene. The pentadecaplex marker assay also performed reliably on single cells either directly or after whole genome amplification, thus validating its use in standalone linkage-based β-thalassemia PGD or in conjunction with HBB mutation detection. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Dufva, Hans Martin; Petersen, Jesper; Stoltenborg, M.
2006-01-01
Allele-specific hybridization to a DNA microarray call be a useful method for genotyping patient DNA. In this article, we demonstrate that 13- to 17-base oligonucleotides tagged with a poly(T)10-poly(C)10 tail (TC tag), but otherwise unmodified, can be crosslinked by UV light irradiation to an ag......Allele-specific hybridization to a DNA microarray call be a useful method for genotyping patient DNA. In this article, we demonstrate that 13- to 17-base oligonucleotides tagged with a poly(T)10-poly(C)10 tail (TC tag), but otherwise unmodified, can be crosslinked by UV light irradiation...... to an agarose film grafted onto unmodified glass. Microarrays of TC-tagged probes immobilized on the agarose film can be used to diagnose Mutations in the human P-globin gene, which encodes the beta-chains in hemoglobin. Although the probes differed widely regarding inciting point temperature (similar to 20...... degrees C), a single stringency wash still gave sufficiently high discrimination signals between perfect match and mismatch probes to allow robust mutation detection. In all, 270 genotypings were performed on patient materials, and no genotype was incorrectly classified. Quality control experiments...
Alkylating agent (MNU)-induced mutation in space environment
Ohnishi, T.; Takahashi, A.; Ohnishi, K.; Takahashi, S.; Masukawa, M.; Sekikawa, K.; Amano, T.; Nakano, T.; Nagaoka, S.
2001-01-01
In recent years, some contradictory data about the effects of microgravity on radiation-induced biological responses in space experiments have been reported. We prepared a damaged template DNA produced with an alkylating agent (N-methyl-N-nitroso urea; MNU) to measure incorrect base-incorporation during DNA replication in microgravity. We examined whether mutation frequency is affected by microgravity during DNA replication for a DNA template damaged by an alkylating agent. Using an in vitro enzymatic reaction system, DNA synthesis by Taq polymerase or polymerase III was done during a US space shuttle mission (Discovery, STS-91). After the flight, DNA replication and mutation frequencies were measured. We found that there was almost no effect of microgravity on DNA replication and mutation frequency. It is suggested that microgravity might not affect at the stage of substrate incorporation in induced-mutation frequency.
Mutation induced with ion beam irradiation in rose
Energy Technology Data Exchange (ETDEWEB)
Yamaguchi, H. E-mail: yhiroya@nias.affrc.go.jp; Nagatomi, S.; Morishita, T.; Degi, K.; Tanaka, A.; Shikazono, N.; Hase, Y
2003-05-01
The effects of mutation induction by ion beam irradiation on axillary buds in rose were investigated. Axillary buds were irradiated with carbon and helium ion beams, and the solid mutants emerged after irradiation by repeated cutting back. In helium ion irradiation, mutations were observed in plants derived from 9 buds among 56 irradiated buds in 'Orange Rosamini' and in plants derived from 10 buds among 61 irradiated buds in 'Red Minimo'. In carbon ion, mutations were observed in plants derived from 12 buds among 88 irradiated buds in 'Orange Rosamini'. Mutations were induced not only in higher doses but also in lower doses, with which physiological effect by irradiation was hardly observed. Irradiation with both ion beams induced mutants in the number of petals, in flower size, in flower shape and in flower color in each cultivar.
Induced mutation in tropical fruit trees
Energy Technology Data Exchange (ETDEWEB)
NONE
2009-05-15
This publication is based on an FAO/IAEA coordinated research project (CRP) and provides insight into the application of induced mutation and in vitro techniques for the improvement of well known fruit trees such as citrus, mango, avocado and papaya, as well as more exotic fruit trees such as litchi, annona, jujube, carambola, pitanga and jaboticaba. The latter are of particular importance due to their adaptation to harsh environments and their high potential as basic food and micronutrient providers for populations in poorer and more remote regions. The findings of the CRP show that application of radiation induced mutation techniques in tropical and subtropical fruit trees can contribute to improving nutritional balance food security, and to enhancing the economic status of growers.
Induced mutation in tropical fruit trees
International Nuclear Information System (INIS)
2009-05-01
This publication is based on an FAO/IAEA coordinated research project (CRP) and provides insight into the application of induced mutation and in vitro techniques for the improvement of well known fruit trees such as citrus, mango, avocado and papaya, as well as more exotic fruit trees such as litchi, annona, jujube, carambola, pitanga and jaboticaba. The latter are of particular importance due to their adaptation to harsh environments and their high potential as basic food and micronutrient providers for populations in poorer and more remote regions. The findings of the CRP show that application of radiation induced mutation techniques in tropical and subtropical fruit trees can contribute to improving nutritional balance food security, and to enhancing the economic status of growers
Energy Technology Data Exchange (ETDEWEB)
Thongkumkoon, P. [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand); Prakrajang, K. [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Faculty of Science, Maejo University, Chiang Mai 50290 (Thailand); Thopan, P.; Yaopromsiri, C. [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Suwannakachorn, D. [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand); Yu, L.D., E-mail: yuld@fnrf.science.cmu.ac.th [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand)
2013-07-15
Highlights: ► Detected X-ray emission from metal, plastic and biological samples. ► Characteristic X-ray emission was detected from metal but not from non-metals. ► Low-energy ion bombarded bacteria held in different sample holders. ► Bacteria held in metal holder had higher mutation rate than in plastic holder. ► Ion-beam-induced X-ray from biological sample is not a basic mutation source. -- Abstract: Low-energy ion beam biotechnology has achieved tremendous successes in inducing crop mutation and gene transfer. However, mechanisms involved in the related processes are not yet well understood. In ion-beam-induced mutation, ion-bombardment-produced X-ray has been proposed to be one of the secondary mutation sources, but the speculation has not yet been experimentally tested. We carried out this investigation to test whether the low-energy ion-beam-produced X-ray was a source of ion-beam-induced mutation. In the investigation, X-ray emission from 29-keV nitrogen- or argon- ion beam bombarded bacterial Escherichia coli (E. coli) cells held in a metal or plastic sample holder was in situ detected using a highly sensitive X-ray detector. The ion beam bombarded bacterial cells held in different material holders were observed for mutation induction. The results led to a conclusion that secondary X-ray emitted from ion-beam-bombarded biological living materials themselves was not a, or at least a negligible, mutational source, but the ion-beam-induced X-ray emission from the metal that made the sample holder could be a source of mutation.
International Nuclear Information System (INIS)
Thongkumkoon, P.; Prakrajang, K.; Thopan, P.; Yaopromsiri, C.; Suwannakachorn, D.; Yu, L.D.
2013-01-01
Highlights: ► Detected X-ray emission from metal, plastic and biological samples. ► Characteristic X-ray emission was detected from metal but not from non-metals. ► Low-energy ion bombarded bacteria held in different sample holders. ► Bacteria held in metal holder had higher mutation rate than in plastic holder. ► Ion-beam-induced X-ray from biological sample is not a basic mutation source. -- Abstract: Low-energy ion beam biotechnology has achieved tremendous successes in inducing crop mutation and gene transfer. However, mechanisms involved in the related processes are not yet well understood. In ion-beam-induced mutation, ion-bombardment-produced X-ray has been proposed to be one of the secondary mutation sources, but the speculation has not yet been experimentally tested. We carried out this investigation to test whether the low-energy ion-beam-produced X-ray was a source of ion-beam-induced mutation. In the investigation, X-ray emission from 29-keV nitrogen- or argon- ion beam bombarded bacterial Escherichia coli (E. coli) cells held in a metal or plastic sample holder was in situ detected using a highly sensitive X-ray detector. The ion beam bombarded bacterial cells held in different material holders were observed for mutation induction. The results led to a conclusion that secondary X-ray emitted from ion-beam-bombarded biological living materials themselves was not a, or at least a negligible, mutational source, but the ion-beam-induced X-ray emission from the metal that made the sample holder could be a source of mutation
Use of γ-ray-induced mutations in the genome era in rice
International Nuclear Information System (INIS)
Kusaba, Makoto
2007-01-01
Ionizing radiation has been used for inducing mutations and improving crops since the discovery by STADLER (1928) that X-rays could induce mutations in barley. At the end of 2004, the whole genome sequence of rice was determined (INTERNATIONAL RICE GENOME SEQUENCING PROJECT, 2005). What can γ-ray-induced mutations contribute now that this has been achieved? One answer could be the elucidation of the functions of the numerous genes revealed by the complete sequence of the rice genome. This includes identification of mutants through reverse genetics and the isolation of genes containing mutations through forward genetics using molecular markers and sequence information. Another answer could be mutation breeding using reverse genetics. But first we must know what kind of DNA lesions are caused by γ-rays. In this article, I describe the production of DNA lesions, and then discuss how γ-ray-induced mutations can contribute to the elucidation of gene function and to mutation breeding. (author)
International Nuclear Information System (INIS)
Selby, P.B.
1979-01-01
This paper describes a large-scale experiment that, by means of breeding tests, confirmed that many dominant skeletal mutations are induced by large-dose radiation exposure. The author also discusses: (1) the major advantages and disadvantages of the skeletal method in improving estimates of genetic hazard to man; (2) future uses of the skeletal method; (3) direct estimation of risk beyond the first generation using the skeletal method; and (4) the possibility of using the skeletal method as a quick and easy screen for chemical mutagens
D'Surney, S. J.; Popp, R. A.
1992-01-01
Oxygen association-dissociation and hemoglobin stability analysis were performed on mouse hemoglobins with amino acid substitutions in an α-globin (α89, His to Leu) and a β-globin (β59, Lys to Ile). The variant α-globin, designated chain 5(m) in the Hba(g2) haplotype, had a high oxygen affinity and was stable. The variant β-globin, (β(s2)) of the Hbb(s2) haplotype, also had an elevated oxygen affinity and in addition was moderately unstable in 19% isopropanol. Hemoglobins from the expected nine (Hba(g2)/Hba(g2);Hbb(s)/Hbb(s) X Hba(a)/Hba(a);Hbb(s2)/Hbb(s2)) F(2) genotypes can be grouped into five classes of P(50) values characterized by strict additivity and dependency on mutant globin gene dosage; physiologically, both globin variants gave indistinguishable effects on oxygen affinity. The hemoglobin of normal mice (Hba(a)/Hba(a);Hbb(s)/Hbb(s)) had a P(50) = 40 mm Hg and the hemoglobin of Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) F(2) mice had a P(50) = 25 mm Hg (human P(50) = 26 mm Hg). Peripheral blood from Hba(g2)/Hba(g2);Hbb(s)/Hbb(s), Hba(a)/Hba(a);Hbb(s2)/Hbb(s2) and Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice exhibited normal hematological values except for a slightly higher hematocrit for Hba(g2)/Hba(g2);Hbb(s)/Hbb(s) and Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice, slightly elevated red cell counts for mice of the three mutant genotypes, and significantly lower values for the mean corpuscular volume and mean corpuscular hemoglobin for Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice. PMID:1427042
beta-Adrenergic and cholinergic receptors in hypertension-induced hypertrophy
International Nuclear Information System (INIS)
Vatner, D.E.; Kirby, D.A.; Homcy, C.J.; Vatner, S.F.
1985-01-01
Perinephritic hypertension was produced in dogs by wrapping one kidney with silk and removing the contralateral kidney 1 week later. Mean arterial pressure rose from 104 +/- 3 to 156 +/- 11 mm Hg, while left ventricular free wall weight, normalized for body weight, was increased by 49%. Muscarinic, cholinergic receptor density measured with [ 3 H]-quinuclidinyl benzilate, fell in hypertensive left ventricles (181 +/- 19 fmol/mg, n = 6; p less than 0.01) as compared with that found in normal left ventricles (272 +/- 16 fmol/mg, n = 8), while receptor affinity was not changed. The beta-adrenergic receptor density, measured by binding studies with [ 3 H]-dihydroalprenolol, rose in the hypertensive left ventricles (108 +/- 10 fmol/mg, n = 7; p less than 0.01) as compared with that found in normal left ventricles (68.6 +/- 5.2 fmol/mg, n = 15), while beta-adrenergic receptor affinity decreased in the hypertensive left ventricles (10.4 +/- 1.2 nM) compared with that found in the normal left ventricles (5.0 +/- 0.7 nM). Plasma norepinephrine levels were similar in the two groups, but myocardial norepinephrine levels were depressed (p less than 0.05) in dogs with hypertension. Moderate left ventricular hypertrophy induced by long-term aortic banding in dogs resulted in elevations in beta-adrenergic receptor density (115 +/- 14 fmol/mg) and decreases in affinity (10.4 +/- 2.2 nM) similar to those observed in the dogs with left ventricular hypertrophy induced by hypertension. Thus, these results suggest that perinephritic hypertension in the dog induces divergent effects on cholinergic and beta-adrenergic receptor density. The increased beta-adrenergic receptor density and decreased affinity may be a characteristic of left ventricular hypertrophy rather than hypertension
Liu, Haiyan; Javaheri, Ali; Godar, Rebecca J; Murphy, John; Ma, Xiucui; Rohatgi, Nidhi; Mahadevan, Jana; Hyrc, Krzysztof; Saftig, Paul; Marshall, Connie; McDaniel, Michael L; Remedi, Maria S; Razani, Babak; Urano, Fumihiko; Diwan, Abhinav
2017-01-01
Obesity-induced diabetes is characterized by hyperglycemia, insulin resistance, and progressive beta cell failure. In islets of mice with obesity-induced diabetes, we observe increased beta cell death and impaired autophagic flux. We hypothesized that intermittent fasting, a clinically sustainable therapeutic strategy, stimulates autophagic flux to ameliorate obesity-induced diabetes. Our data show that despite continued high-fat intake, intermittent fasting restores autophagic flux in islets and improves glucose tolerance by enhancing glucose-stimulated insulin secretion, beta cell survival, and nuclear expression of NEUROG3, a marker of pancreatic regeneration. In contrast, intermittent fasting does not rescue beta-cell death or induce NEUROG3 expression in obese mice with lysosomal dysfunction secondary to deficiency of the lysosomal membrane protein, LAMP2 or haplo-insufficiency of BECN1/Beclin 1, a protein critical for autophagosome formation. Moreover, intermittent fasting is sufficient to provoke beta cell death in nonobese lamp2 null mice, attesting to a critical role for lysosome function in beta cell homeostasis under fasting conditions. Beta cells in intermittently-fasted LAMP2- or BECN1-deficient mice exhibit markers of autophagic failure with accumulation of damaged mitochondria and upregulation of oxidative stress. Thus, intermittent fasting preserves organelle quality via the autophagy-lysosome pathway to enhance beta cell survival and stimulates markers of regeneration in obesity-induced diabetes.
DEFF Research Database (Denmark)
Rai, Taranjit Singh; Ahmad, Shamim; Bahl, Ajay
2009-01-01
The aim of the current study was to determine the frequency of mutations in the beta-myosin heavy chain gene (MYH7) in a cohort of hypertrophic cardiomyopathy (HCM) and dilated cardiomyopathy (DCM) and their families, and to investigate correlations between genotype and phenotype. About 130...... consecutive patients diagnosed with HCM or DCM (69 with HCM and 61 with DCM) attending the cardiology clinic of Post Graduate Institute of Medical Education and Research were screened for mutations in the MYH7 gene. The control group for genetic studies consisted of 100 healthy subjects. We report 14...... mutations in 6 probands (5 probands in HCM and 1 proband in DCM) and their family members. Out of these 6 mutations, 3 are new and are being reported for the first time. One known mutation (p.Gly716Arg) was found to be "de novo" which resulted in severe asymmetric septal hypertrophy (31 mm) and resulted...
Pakdeepak, Kanet; Pata, Supansa; Chiampanichayakul, Sawitree; Kasinrerk, Watchara; Tatu, Thanusak
2016-01-01
Monoclonal antibodies against α-globin containing human Hbs, named AMS-Alpha1 and AMS-Alpha 2, were produced by the hybridoma technique using spleen cells enriched by the newly developed B lymphocyte enrichment protocol. These two monoclonal antibodies were of IgM class, reacting to only intact form of human Hbs A, A2, E, and F, which contain α-globin chain. By the indirect ELISA, the AMS-Alpha1 and AMS-Alpha 2 quantified less amount of α-globin chain containing hemoglobins in HbH disease than the SEA-α thalassemia 1 carriers and normal individuals. It was thus anticipated that these monoclonal antibodies can be used for detecting Hb Bart's hydrops fetalis in which no α-globin chain is produced.
DEFF Research Database (Denmark)
Riess, O; Noerremoelle, A; Weber, B
1992-01-01
The finding of a mutation in the beta subunit of the cyclic GMP (cGMP) phosphodiesterase gene causing retinal degeneration in mice (the Pdeb gene) prompted a search for disease-causing mutations in the human phosphodiesterase gene (PDEB gene) in patients with retinitis pigmentosa. All 22 exons...
Directory of Open Access Journals (Sweden)
Elza M. Kimura
2009-01-01
Full Text Available Hb H Disease is caused by the loss or inactivation of three of the four functional a-globin genes. Patients present chronic hemolytic anemia and splenomegaly. In some cases, occasional blood transfusions are required. Deletions are the main cause of this type of thalassemia (α-thalassemia. We describe here an unusual case of Hb H disease caused by the combination of a common αº deletion [-(α20.5] with a rare point mutation (c.427T > A, thus resulting in an elongated and unstable α-globin variant, Hb Icaria, (X142K, with 31 additional amino-acid residues. Very high levels of Hb H and Hb Bart's were detected in the patient's red blood cells (14.7 and 19.0%, respectively. This is the first description of this infrequent association in the Brazilian population.
Molecular analysis of carbon ion-induced mutations in Arabidopsis thaliana
International Nuclear Information System (INIS)
Shikazono, Naoya; Tanaka, Atsushi; Watanabe, Hiroshi; Tano, Shigemitsu; Yokota, Yukihiko
1998-01-01
In order to elucidate the characteristics of the mutations induced by ion particles at the molecular level in plants, mutated loci in carbon ion-induced mutants of Arabidopsis were investigated by PCR and Southern blot analyses. In the present study, two lines of gl1 mutant and two lines of tt4 mutant were isolated after carbon ion-irradiation. Out of four mutants, one had a deletion, other two contained rearrangements, and one had a point-like mutation. From the present result, it was suggested that ion particles induced different kinds of alterations of the DNA and therefore they could produce various types of mutant alleles in plants. (author)
Liebhaber, S A; Kan, Y W
1981-01-01
The alpha-globin polypeptide is encoded by two adjacent genes, alpha 1 and alpha 2. In the normal diploid state (alpha alpha/alpha alpha) all four alpha-globin genes are expressed. Loss or dysfunction of one or more of these genes leads to deficient alpha-globin production and results in alpha-thalassemia. We present a technique to differentially assess the steady-state levels of the alpha 1- and alpha-2-globin messenger RNA (mRNA) transcripts and thus delineate the relative level of expressi...
ENU-induced phenovariance in mice: inferences from 587 mutations
Directory of Open Access Journals (Sweden)
Arnold Carrie N
2012-10-01
Full Text Available Abstract Background We present a compendium of N-ethyl-N-nitrosourea (ENU-induced mouse mutations, identified in our laboratory over a period of 10 years either on the basis of phenotype or whole genome and/or whole exome sequencing, and archived in the Mutagenetix database. Our purpose is threefold: 1 to formally describe many point mutations, including those that were not previously disclosed in peer-reviewed publications; 2 to assess the characteristics of these mutations; and 3 to estimate the likelihood that a missense mutation induced by ENU will create a detectable phenotype. Findings In the context of an ENU mutagenesis program for C57BL/6J mice, a total of 185 phenotypes were tracked to mutations in 129 genes. In addition, 402 incidental mutations were identified and predicted to affect 390 genes. As previously reported, ENU shows strand asymmetry in its induction of mutations, particularly favoring T to A rather than A to T in the sense strand of coding regions and splice junctions. Some amino acid substitutions are far more likely to be damaging than others, and some are far more likely to be observed. Indeed, from among a total of 494 non-synonymous coding mutations, ENU was observed to create only 114 of the 182 possible amino acid substitutions that single base changes can achieve. Based on differences in overt null allele frequencies observed in phenotypic vs. non-phenotypic mutation sets, we infer that ENU-induced missense mutations create detectable phenotype only about 1 in 4.7 times. While the remaining mutations may not be functionally neutral, they are, on average, beneath the limits of detection of the phenotypic assays we applied. Conclusions Collectively, these mutations add to our understanding of the chemical specificity of ENU, the types of amino acid substitutions it creates, and its efficiency in causing phenovariance. Our data support the validity of computational algorithms for the prediction of damage caused by
Directory of Open Access Journals (Sweden)
G.M. Mokhtar
2018-04-01
Full Text Available Background: Hereditary hemochromatosis is the most frequent cause of primary iron overload that is associated with HFE gene’s mutation especially the C282Y mutation. The interaction between hemoglobin chain synthesis’ disorders and the C282Y mutation may worsen the clinical picture of beta-thalassemia major (β-TM. Aim: To establish the prevalence of the C282Y mutations in Egyptian β-TM patients and to address its adverse effects. Methods: Two-hundred and five β-TM patients were recruited and divided into two groups based on their serum ferritin (SF; group I (N = 125 (SF ≤ 2500 ng/dl and group II (N = 80 (SF > 2500 ng/dl. All patients were subjected to clinical and laboratory assessment with special emphasis on iron overload complications. Genotyping was assessed by polymerase chain reaction for detection of C282Y mutation in HFE gene. Results: The C282Y mutation was not detected in the studied β-TM neither in homozygous nor heterozygous state. There were several iron overload complications including cardiac complication (9.1%, liver disease (36.6%, delayed puberty (56.6%, primary (35.71% and secondary amenorrhea (21.42%, short stature (27.3%, diabetes (3.4%, neutropenia (9.7%, arthralgia (10.2%, gastrointestinal (21.1%, depression (2.9% and others (12.05%. Group I showed a statistically significant lower rate of taking iron-rich diet when compared to group II. Group II showed significant longer mean duration of disease, higher total transfusion rate per life, lower mean HbF% level, higher mean HbA% level, and higher rate of elevated liver enzymes than patients with SF ≤ 2500 ng/dl. Conclusion: The C282Y mutation was not detected in the studied cohort of Egyptian β-TM patients neither in homozygous nor heterozygous state in spite of manifestations of iron overload complications. Keywords: Beta-thalassemia major, Hereditary hemochromatosis, The C282Y mutation, Iron overload complications, Egyptian
Milk bioactive peptides and beta-casomorphins induce mucus release in rat jejunum.
Trompette, Aurélien; Claustre, Jean; Caillon, Fabienne; Jourdan, Gérard; Chayvialle, Jean Alain; Plaisancié, Pascale
2003-11-01
Intestinal mucus is critically involved in the protection of the mucosa. An enzymatic casein hydrolysate and beta-casomorphin-7, a mu-opioid peptide generated in the intestine during bovine casein digestion, markedly induce mucus discharge. Because shorter mu-opioid peptides have been described, the effects of the opioid peptides in casein, beta-casomorphin-7, -6, -4, -4NH2 and -3, and of opioid neuropeptides met-enkephalin, dynorphin A and (D-Ala2,N-Me-Phe4,glycinol5)enkephalin (DAMGO) on intestinal mucus secretion were investigated. The experiments were conducted with isolated perfused rat jejunum. Mucus secretion under the influence of beta-casomorphins and opioid neuropeptides administered intraluminally or intra-arterially was evaluated using an ELISA for rat intestinal mucus. Luminal administration of beta-casomorphin-7 (1.2 x 10(-4) mol/L) provoked a mucus discharge (500% of controls) that was inhibited by naloxone, a specific opiate receptor antagonist. Luminal beta-casomorphin-6, -4 and -4NH2 did not modify basal mucus secretion, whereas intra-arterial administration of beta-casomorphin-4 (1.2 x 10(-6) mol/L) induced a mucus discharge. In contrast, intra-arterial administration of the nonopioid peptide beta-casomorphin-3 did not release mucus. Among the opioid neuropeptides, intra-arterial infusion of Met-enkephalin or dynorphin-A did not provoke mucus secretion. In contrast, beta-endorphin (1.2 x 10(-8) to 1.2 x 10(-6) mol/L) induced a dose-dependent release of mucus (maximal response at 500% of controls). DAMGO (1.2 x 10(-6) mol/L), a mu-receptor agonist, also evoked a potent mucus discharge. Our findings suggest that mu-opioid neuropeptides, as well as beta-casomorphins after absorption, modulate intestinal mucus discharge. Milk opioid-derived peptides may thus be involved in defense against noxious agents and could have dietary and health applications.
Advances and prospects for induced mutation breeding in Helongjiang Province
International Nuclear Information System (INIS)
Sun Guangzu
1995-12-01
Induced mutation breeding employed on soybean, spring wheat, maize, millet, fiber flax, chinese cabbage, kidney been and garlic in Heilongjiang province. Thirty-six new varieties had introduced and released from 1980 to 1994, made up 20.6% of total released varieties for the same period, accumulated cultivated area of 3.746 million hm 2 , and increased the income of formers to US dollar 168 million; 72 mutants having specific and utilizing values and traits have also been bred in the province. Basic research such as radiation breeding in combination with distant hybridization, biotechnology, and application new induced factors, improving selection methods, have been achieved; 91 articles have been published. These researches play an important role for increasing induced mutation breeding. Three items of suggestion to develop induced mutation breeding are made. (1 tab.)
Alcantara, Luiz Carlos; Van Dooren, Sonia; Gonçalves, Marilda Souza; Kashima, Simone; Costa, Maria Cristina Ramos; Santos, Fred Luciano Neves; Bittencourt, Achilea Lisboa; Dourado, Inês; Filho, Antonio Andrade; Covas, Dimas Tadeu; Vandamme, Anne-Mieke; Galvão-Castro, Bernardo
2003-08-01
The city of Salvador, Bahia, Brazil, has sociodemographic characteristics similar to some African cities. Up to now, it has had the highest prevalence of human T-cell lymphotropic virus type I (HTLV-I) infection (1.74%) in the country. To investigate which strains of HTLV-I are circulating in Salvador, we studied isolates from 82 patients infected with HTLV-I: 19 from the general population, 21 from pregnant women, 16 from intravenous drug users, and 26 from patients and their family attending a neurologic clinic. Phylogenetic analysis from part of the LTR fragments showed that most of these isolates belonged to the Transcontinental subgroup of the Cosmopolitan subtype (HTLV-Ia). Only one sample from a pregnant woman was closely related to the Japanese subgroup, suggesting recent introduction of a Japanese HTLV-I lineage into Salvador. betaA-Globin haplotypes were examined in 34 infected individuals and found to be atypical, confirming the racial heterogeneity of this population. A total of 20 chromosomes were characterized as Central African Republic (CAR) haplotype (29.4%), 31 (45.6%) were characterized as Benin (BEN) haplotype, and 17 (25%) were characterized as Senegal (SEN) haplotype. Five patients' genotypes (14.7%) were CAR/CAR; 10 (29,4%), BEN/BEN; 9 (26.5%), CAR/BEN; 2 (5.9%), BEN/SEN; and 7 (20.6%), SEN/SEN. One patient's genotype (2.9%) was CAR/SEN. The betaA-globin haplotype distribution in Salvador is unusual compared with other Brazilian states. Our data support the hypothesis of multiple post-Columbian introductions of African HTLV-Ia strains in Salvador, Bahia, Brazil.
Sox6 directly silences epsilon globin expression in definitive erythropoiesis.
Directory of Open Access Journals (Sweden)
2006-02-01
Full Text Available Sox6 is a member of the Sox transcription factor family that is defined by the conserved high mobility group (HMG DNA binding domain, first described in the testis determining gene, Sry. Previous studies have suggested that Sox6 plays a role in the development of the central nervous system, cartilage, and muscle. In the Sox6-deficient mouse, p100H, epsilony globin is persistently expressed, and increased numbers of nucleated red cells are present in the fetal circulation. Transfection assays in GM979 (erythroleukemic cells define a 36-base pair region of the epsilony proximal promoter that is critical for Sox6 mediated repression. Electrophoretic mobility shift assay (EMSA and chromatin immunoprecipitation (ChIP assays demonstrate that Sox6 acts as a repressor by directly binding to the epsilony promoter. The normal expression of Sox6 in wild-type fetal liver and the ectopic expression of epsilony in p100H homozygous fetal liver demonstrate that Sox6 functions in definitive erythropoiesis. The present study shows that Sox6 is required for silencing of epsilony globin in definitive erythropoiesis and suggests a role for Sox6 in erythroid cell maturation. Thus, Sox6 regulation of epsilony globin might provide a novel therapeutical target in the treatment of hemoglobinopathies such as sickle cell anemia and thalassemia.
Beta-induced fluorescence detection in liquid chromatography
International Nuclear Information System (INIS)
Malcolme-Lawes, D.J.; Massey, S.; Warwick, P.
1981-01-01
A theoretical analysis of beta-induced fluorescence is used to determine the factors which influence the sensitivity of the technique as applied to liquid chromatography. Equations are presented for detector response and for signal-to-noise ratios and the theoretical response for a typical detector is compared with experimentally determined values. (author)
Energy Technology Data Exchange (ETDEWEB)
Hou, Y.; Vavougios, G.; Hinek, A. [Univ. of Toronto (Canada)] [and others
1996-07-01
Substitution mutations adversely affecting the {alpha}-subunit of {beta}-hexosaminidase A ({alpha}{beta}) (EC 3.2.1.52) result in Tay-Sachs disease. The majority affect the initial folding of the pro-{alpha} chain in the endoplasmic reticulum, resulting in its retention and degradation. A much less common occurrence is a mutation that specifically affects an {open_quotes}active-site{close_quotes} residue necessary for substrate binding and/or catalysis. In this case, hexosaminidase A is present in the lysosome, but it lacks all {alpha}-specific activity. This biochemical phenotype is referred to as the {open_quotes}B1-variant form{close_quotes} of Tay-Sachs disease. Kinetic analysis of suspected B1-variant mutations is complex because hexosaminidase A is heterodimeric and both subunits possess similar active sites. In this report, we examine a previously identified B1-variant mutation, {alpha}-Val{sup 192}Leu. Chinese hamster ovary cells were permanently cotransfected with an {alpha}-cDNA-construct encoding the substitution and a mutant {beta}-cDNA ({beta}-Arg{sup 211}Lys), encoding a {beta}-subunit that is inactive but normal in all other respects. We were surprised to find that the Val{sup 192}Leu substitution produced a pro-{alpha} chain that did not form {alpha}-{beta} dimers and was not transported to the lysosome. Finally, we reexamined the hexosaminidase activity and protein levels in the fibroblasts from the original patient. These data were also not consistent with the biochemical phenotype of the B1 variant of Tay-Sachs disease previously reported to be present. Thus, we conclude that the Val{sup 192}Leu substitution does not specifically affect the {alpha}-active site. 23 refs., 4 figs., 2 tabs.
Epoetin beta for the treatment of chemotherapy-induced anemia: an update
Directory of Open Access Journals (Sweden)
Galli L
2015-03-01
Full Text Available Luca Galli,1 Clara Ricci,2 Colin Gerard Egan2 1Oncology Unit 2, University Hospital of Pisa, Pisa, Italy; 2Primula Multimedia SRL, Pisa, Italy Abstract: Epoetin beta belongs to the class of erythropoiesis-stimulating agents (ESAs that are currently available to treat anemic patients receiving chemotherapy. Chemotherapy-induced anemia affects a high percentage of cancer patients and, due to its negative effects on disease outcome and the patient’s quality of life, should be treated when first diagnosed. Initial trials with ESAs have shown efficacy in improving quality of life and reducing the need for blood transfusions in patients with chemotherapy-induced anemia. However, recent meta-analyses have provided conflicting data on the impact of ESAs on survival and tumor progression. Here we provide an overview of these recent data and review the role of epoetin beta in the treatment of chemotherapy-induced anemia over the past 20 years. Keywords: epoetin beta, erythropoietin, chemotherapy, cancer, anemia, treatment
High LET Radiation Can Enhance TGF(Beta) Induced EMT and Cross-Talk with ATM Pathways
Wang, Minli; Hada, Megumi; Huff, Janice; Pluth, Janice M.; Anderson, Janniffer; ONeill, Peter; Cucinotta, Francis A.
2010-01-01
The TGF(Beta) pathway has been shown to regulate or directly interact with the ATM pathway in the response to radiation in mammary epithelial cells. We investigated possible interactions between the TGF(Beta) and ATM pathways following simulated space radiation using hTERT immortalized human esophageal epithelial cells (EPC-hTERT), mink lung epithelial cells (Mv1lu), and several human fibroblast cell lines. TGF(Beta) is a key modulator of the Epithelial-Mesenchymal Transition (EMT), important in cancer progression and metastasis. The implication of EMT by radiation also has several lines of developing evidence, however is poorly understood. The identification of TGF(Beta) induced EMT can be shown in changes to morphology, related gene over expression or down regulation, which can be detected by RT-PCR, and immunostaining and western blotting. In this study, we have observed morphologic and molecular alternations consistent with EMT after Mv1lu cells were treated with TGF(Beta) High LET radiation enhanced TGF(Beta) mediated EMT with a dose as low as 0.1Gy. In order to consider the TGF(Beta) interaction with ATM we used a potent ATM inhibitor Ku55933 and investigated gene expression changes and Smad signaling kinetics. Ku559933 was observed to reverse TGF(Beta) induced EMT, while this was not observed in dual treated cells (radiation+TGF(Beta)). In EPC-hTERT cells, TGF(Beta) alone was not able to induce EMT after 3 days of application. A combined treatment with high LET, however, significantly caused the alteration of EMT markers. To study the function of p53 in the process of EMT, we knocked down P53 through RNA interference. Morphology changes associated with EMT were observed in epithelial cells with silenced p53. Our study indicates: high LET radiation can enhance TGF(Beta) induced EMT; while ATM is triggering the process of TGF(Beta)-induced EMT, p53 might be an essential repressor for EMT phenotypes.
Kiger, Laurent; Tilleman, Lesley; Geuens, Eva; Hoogewijs, David; Lechauve, Christophe; Moens, Luc; Dewilde, Sylvia; Marden, Michael C
2011-01-01
Caenorhabditis elegans globin GLB-26 (expressed from gene T22C1.2) has been studied in comparison with human neuroglobin (Ngb) and cytoglobin (Cygb) for its electron transfer properties. GLB-26 exhibits no reversible binding for O(2) and a relatively low CO affinity compared to myoglobin-like globins. These differences arise from its mechanism of gaseous ligand binding since the heme iron of GLB-26 is strongly hexacoordinated in the absence of external ligands; the replacement of this internal ligand, probably the E7 distal histidine, is required before binding of CO or O(2) as for Ngb and Cygb. Interestingly the ferrous bis-histidyl GLB-26 and Ngb, another strongly hexacoordinated globin, can transfer an electron to cytochrome c (Cyt-c) at a high bimolecular rate, comparable to those of inter-protein electron transfer in mitochondria. In addition, GLB-26 displays an unexpectedly rapid oxidation of the ferrous His-Fe-His complex without O(2) actually binding to the iron atom, since the heme is oxidized by O(2) faster than the time for distal histidine dissociation. These efficient mechanisms for electron transfer could indicate a family of hexacoordinated globin which are functionally different from that of pentacoordinated globins.
Current study on ionizing radiation-induced mitochondial DNA damage and mutations
International Nuclear Information System (INIS)
Zhou Xin; Wang Zhenhua; Zhang Hong
2012-01-01
Current advance in ionizing radiation-induced mitochondrial DNA damage and mutations is reviewed, in addition with the essential differences between mtDNA and nDNA damage and mutations. To extent the knowledge about radiation induced mitochondrial alterations, the researchers in Institute of Modern Physics, Chinese Academy of Sciences developed some technics such as real-time PCR, long-PCR for accurate quantification of radiation induced damage and mutations, and in-depth investigation about the functional changes of mitochondria based on mtDNA damage and mutations were also carried out. In conclusion, the important role of mitochondrial study in radiation biology is underlined, and further study on mitochondrial study associated with late effect and metabolism changes in radiation biology is pointed out. (authors)
International Nuclear Information System (INIS)
Moon, A.M.; Ley, T.J.
1990-01-01
DNA sequences located in a region 6-18 kilobases (kb) upstream from the human ε-globin gene are known as the locus-activating region (LAR) or dominant control region. This region is thought to play a key role in chromatin organization of the β-like globin gene cluster during erythroid development. Since the human β-globin LAR is functional in mice, the authors reasoned that critical LAR sequence elements might be conserved between mice and humans. They therefore cloned murine genomic sequences homologous to one portion of the human LAR. They found that this murine DNA fragment (mouse LAR site II) and sequences homologous to human LAR sites I and III are located upstream from the mouse β-like globin gene cluster and determined that their locations relative to the cluster are similar to that of their human counterparts. The homologous site II sequences are 70% identical between mice and humans over a stretch of ∼800 base pairs. These results suggest that primary structural elements endash and the spatial organization of these elements endash are important for function of the β-globin LAR
Directory of Open Access Journals (Sweden)
Heta Huttunen
2018-04-01
Full Text Available ObjectiveTwo missense mutations in KCNQ1, an imprinted gene that encodes the alpha subunit of the voltage-gated potassium channel Kv7.1, cause autosomal dominant growth hormone deficiency and maternally inherited gingival fibromatosis. We evaluated endocrine features, birth size, and subsequent somatic growth of patients with long QT syndrome 1 (LQT1 due to loss-of-function mutations in KCNQ1.DesignMedical records of 104 patients with LQT1 in a single tertiary care center between 1995 and 2015 were retrospectively reviewed.MethodsClinical and endocrine data of the LQT1 patients were included in the analyses.ResultsAt birth, patients with a maternally inherited mutation (n = 52 were shorter than those with paternal inheritance of the mutation (n = 29 (birth length, −0.70 ± 1.1 SDS vs. −0.2 ± 1.0 SDS, P < 0.05. Further analyses showed, however, that only newborns (n = 19 of mothers who had received beta blockers during pregnancy were shorter and lighter at birth than those with paternal inheritance of the mutation (n = 29 (−0.89 ± 1.0 SDS vs. −0.20 ± 1.0 SDS, P < 0.05; and 3,173 ± 469 vs. 3,515 ± 466 g, P < 0.05. Maternal beta blocker treatment during the pregnancy was also associated with lower cord blood TSH levels (P = 0.011 and significant catch-up growth during the first year of life (Δ0.08 SDS/month, P = 0.004. Later, childhood growth of the patients was unremarkable.ConclusionLoss-of-function mutations in KCNQ1 are not associated with abnormalities in growth, whereas maternal beta blocker use during pregnancy seems to modify prenatal growth of LQT1 patients—a phenomenon followed by catch-up growth after birth.
Energy Technology Data Exchange (ETDEWEB)
Ainsworth, P.J. (Univ. of Western Ontario, Ontario (Canada) Child Health Research Institute, London, Ontario (Canada)); Coulter-Mackie, M.B. (Univ. of Western Ontario, Ontario (Canada) Child Health Research Institute, London, Ontario (Canada) Children' s Psychiatric Research Institute, London, Ontario (Canada))
1992-10-01
The B1 variant form of Tay-Sachs disease is enzymologically unique in that the causative mutation(s) appear to affect the active site in the [alpha] subunit of [beta]-hexosaminidase A without altering its ability to associate with the [beta] subunit. Most previously reported B1 variant mutations were found in exon 5 within codon 178. The coding sequence of the [alpha] subunit gene of a patient with the B1 variant form was examined with a combination of reverse transcription of mRNA to cDNA, PCR, and dideoxy sequencing. A double mutation in exon 6 has been identified: a G[sub 574][yields]C transversion causing a val[sub 192][yields]leu change and a G[sub 598][yields] A transition resulting in a val[sub 200][yields]met alteration. The amplified cDNAs were otherwise normal throughout their sequence. The 574 and 598 alterations have been confirmed by amplification directly from genomic DNA from the patient and her mother. Transient-expression studies of the two exon 6 mutations (singly or together) in COS-1 cells show that the G[sub 574][yields]C change is sufficient to cause the loss of enzyme activity. The biochemical phenotype of the 574 alteration in transfection studies is consistent with that expected for a B1 variant mutation. As such, this mutation differs from previously reported B1 variant mutations, all of which occur in exon 5. 31 refs., 2 figs., 2 tabs.
Bader, Michael; Rauscher, Dankwart; Geibel, Kurt; Angerer, Juergen
1993-03-01
We report the application of proteases for the total hydrolysis of globin with subsequent determination of amino acids. Optimization of the proteolysis was made with respect to enzyme concentration, time of incubation and type of protease. Ethylene oxide modified globin was used to compare the results of the analysis of the N-terminal amino acid valine after enzymatic cleavage to those obtained from the widely used modified Edman procedure. It is shown that the cleavage is of good reproducibility and yields more alkylated amino acid than the Edman procedure.
International symposium on induced mutations in plants (ISIM). Book of abstracts
Energy Technology Data Exchange (ETDEWEB)
NONE
2008-07-01
The year 2008 will mark the 80th anniversary of mutation induction in crop plants. The application of mutation techniques, i.e. gamma rays and other physical and chemical mutagens, has generated a vast amount of genetic variability and has played a significant role in plant breeding and genetic studies. The widespread use of induced mutants in plant breeding programmes throughout the world has led to the official release of more than 2600 mutant crop varieties. A large number of these varieties (including cereals, pulses, oil, root and tuber crops, and ornamentals) have been released in developing countries, resulting in enormous positive economic impacts. The International Symposium on Induced Mutations in Plants (ISIM) will be the eighth in the Joint FAO/IAEA Programme's Symposium series dedicated exclusively to harnessing and disseminating information on current trends in induced mutagenesis in plants, the first of which was held in 1969 and the last in 1995. These previous symposia dealt with themes relating to the development of efficient protocols for induced mutagenesis and their role in the enhancement of quality traits, as well as resistance to biotic and abiotic stresses in crops and the integration of in vitro and molecular genetic techniques in mutation induction. Since 1995, there has been an increased interest within the scientific community, not only in the use of induced mutations for developing improved crop varieties and for the discovery of genes controlling important traits and in the understanding the functions and mechanisms of actions of these genes, but also in deciphering the biological nature of DNA damage, repair and mutagenesis. A symposium that brings together the key players in basic research, as well as in the development and application of technologies relating to the efficient use of induced mutations for crop improvement and empirical genetic studies, is therefore justified and necessary. Topics addressed at the symposium
Induced plasmon mutations affecting the growth habit of peanuts, A. hypogaea L
International Nuclear Information System (INIS)
Levy, A.; Ashri, A.
1978-01-01
The effectiveness of the acridines ethidium bromide (EB) and acriflavine in inducing plasmon mutations was compared with the alkylating agents ethyl methanesulphonate (EMS) and diethyl sulphate and to γ-rays. The growth habit (trailing versus bunch) of peanuts (A. hypogaea), controlled by genic-cytoplasmic interactions, was utilized. Breeding tests distinguishing nuclear from plasmon mutations were developed and are described in detail. Plasmon mutations were induced, but there were differences in mutation yields between the cultivars and the mutagens. (Auth.)
The effect of spermine on spontaneous and UV-induced mutations in Schizosaccharomyces pombe
International Nuclear Information System (INIS)
Prendergast, J.A.; Kamra, O.P.; Nasim, A.
1984-01-01
The effect of different concentrations of spermine on spontaneous and UV-induced mutation in the adenine forward mutation system of Schizosaccharomyces pombe was investigated. The effect of spermine on spontaneous mutation was studied in 5 mutator strains (mut 1-4, mut 1-23, mut 2-9, mut 2-20 and mut 3-21) and on UV-induced mutation in a pigmented adenine-requiring strain and its radiation-sensitive derivative (rad 13). The effect of spermine exposure on mutation induction before and after UV irradiation was also investigated. Spermine increased spontaneous forward mutation in the mut 1-4 strain by 47% and enhanced UV-induced forward mutation 2-fold in the rad 13 and normal pigmented strains. No antimutagenic effect of spermine was seen in any of the strains tested. This is in marked contrast to the antimutagenic effect of spermine observed with bacteria. (Auth.)
Siese, A; Jaros, P P; Willig, A
1999-02-01
In the present study we investigated the interleukin (IL)-1beta and transforming growth factor-beta1 (TGF-beta1)-mediated proliferation, and production of IL-2 and TGF-beta, in the murine T-cell line, EL4.NOB-1. This cell line is resistant to TGF-beta concerning growth arrest but not autoinduction or suppression of IL-1-induced IL-2 production. When cocultured with IL-1beta, TGF-beta showed growth-promoting activity that could be antagonized by adding the phosphatidyl choline-dependent phospholipase C (PC-PLC) inhibitor, D609. Using specific enzyme inhibitors of protein kinases (PK) C and A, mitogen-activated protein kinase (MAPK), phospholipase A2 (PLA2), phosphatidylinositol-dependent (PI)-PLC and PC-PLC, we showed that IL-1beta-induced IL-2 synthesis was dependent on all investigated kinases and phospholipases, except PC-PLC. TGF-beta1 was able to inhibit IL-2 synthesis by the activation of PKA and MAPK. The same kinases are involved in TGF-beta autoinduction that is accompanied by a secretion of the active but not the latent growth factor and is antagonized by IL-1beta. Addition of the PI-PLC inhibitor, ET 18OCH3, or the PLA2 inhibitor (quinacrine) alone, resulted in secretion of latent TGF-beta and, in the case of ET 18OCH3, active TGF-beta. These data implicate a role for PI-PLC and PLA2 in the control of latency and secretion. Analysis of specific tyrosine activity and c-Fos expression showed synergistic but no antagonistic effects. These events are therefore not involved in IL- and TGF-beta-regulated IL-2 and TGF-beta production, but might participate in IL-1/TGF-beta-induced growth promotion.
Abila, B; Wilson, J F; Marshall, R W; Richens, A
1985-10-01
The effects of intravenous propranolol 100 micrograms kg-1, sotalol 500 micrograms kg-1, timolol 7.8 micrograms kg-1, atenolol 125 micrograms kg-1 and placebo on essential, physiological and isoprenaline-induced tremor were studied. These beta-adrenoceptor blocker doses produced equal reduction of standing-induced tachycardia in essential tremor patients. Atenolol produced significantly less reduction of essential and isoprenaline-induced tremor than the non-selective drugs, confirming the importance of beta 2-adrenoceptor blockade in these effects. Propranolol and sotalol produced equal maximal inhibition of isoprenaline-induced tremor but propranolol was significantly more effective in reducing essential tremor. The rate of development of the tremorolytic effect was similar in essential, physiological and isoprenaline-induced tremors but all tremor responses developed significantly more slowly than the heart rate responses. It is proposed that these results indicate that the tremorolytic activity of beta-adrenoceptor blockers in essential, physiological and isoprenaline-induced tremor is exerted via the same beta 2-adrenoceptors located in a deep peripheral compartment which is thought to be in the muscle spindles.
DEFF Research Database (Denmark)
Hansen, L; Arden, K C; Rasmussen, S B
1997-01-01
isoforms of GSK-3alpha and GSK-3beta in 72 NIDDM patients and 12 control subjects. No structural changes were detected apart from a few silent mutations. Mapping of the GSK-3alpha to chromosome 19q13.1-13.2 and the GSK-3beta to chromosome 3q13.3-q21 outside known genetic loci linked to NIDDM further makes...
Adams, J G; Steinberg, M H; Newman, M V; Morrison, W T; Benz, E J; Iyer, R
1981-01-01
Hemoglobin Vicksburg was discovered in a 6-year-old Black boy who had been anemic since infancy. Examination of his hemolysate revealed 87.5% Hb F, 2.4% Hb A2, and 7.6% Hb Vicksburg, which had the electrophoretic and chromatographic properties of Hb A. Structural analysis of Hb Vicksburg demonstrated a deletion of leucine at beta 75(E19), a new variant. Hb Vicksburg was neither unstable nor subject to posttranslational degradation. The alpha/non-alpha biosynthetic ratio was 2.6. Because the proband appeared to be a mixed heterozygote for Hb Vicksburg and beta 0-thalassemia, Hb Vicksburg should have comprised the major portion of the hemolysate. Thus, Hb Vicksburg was synthesized at a rate considerably lower than would be expected on the basis of gene dosage. There was no reason to suspect abnormal translation of beta Vicksburg mRNA; in individuals with Hb St. Antoine (beta 74 and beta 75 deleted), the abnormal hemoglobin comprised 25% of the hemolysate in the simple heterozygote yet was unstable. Deletion of beta 75, therefore, would not in itself appear to lead to diminished synthesis. There was a profound deficit of beta Vicksburg mRNA when measured by liquid hybridization analysis with beta cDNA. The most plausible explanation for the low output of Hb Vicksburg is that a mutation for beta +-thalassemia is present in cis to the structural mutation.
Evolutionary and functional properties of a two-locus β-globin polymorphism in Indian house mice
DEFF Research Database (Denmark)
Runck, Amy M; Weber, Roy E.; Fago, Angela
2010-01-01
exceeded neutral expectations, and reconstructed haplotype networks for both β-globin paralogs revealed extensive allele sharing with several other closely related species of Mus. However, despite this suggestive evidence for balancing selection, O2-equilibrium curves revealed no discernible functional......Electrophoretic surveys of hemoglobin (Hb) polymorphism in house mice from South Asia and the Middle East have revealed that two alternative β-globin haplotypes, Hbbd and Hbbp, are often present at intermediate frequencies in geographically disparate populations. Both haplotypes harbor two......) are distinguished by two amino acid substitutions. To investigate the possible adaptive significance of the Hbbd/Hbbp polymorphism we conducted a population genetic analysis of the duplicated β-globin genes of Indian house mice (Mus castaneus) in conjunction with experimental studies of Hb function in inbred...
[Beta thalassemia major and pregnancy during adolescence: report of two cases].
Trigo, Lucas Augusto Monteiro Castro; Surita, Fernanda Garanhani; Parpinelli, Mary Angela; Pereira, Belmiro Gonçalves; Fertrin, Kleber Yotsumoto; Costa, Maria Laura
2015-06-01
Beta thalassemia major is a rare hereditary blood disease in which impaired synthesis of beta globin chains causes severe anemia. Medical treatment consists of chronic blood transfusions and iron chelation. We describe two cases of adolescents with beta thalassemia major with unplanned pregnancies and late onset of prenatal care. One had worsening of anemia with increased transfusional requirement, fetal growth restriction, and placental senescence. The other was also diagnosed with hypothyroidism and low maternal weight, and was admitted twice during pregnancy due to dengue shock syndrome and influenza H1N1-associated respiratory infection. She also developed fetal growth restriction and underwent vaginal delivery at term complicated by uterine hypotonia. Both patients required blood transfusions after birth and chose medroxyprogesterone as a contraceptive method afterwards. This report highlights the importance of medical advice on contraceptive methods for these women and the role of a specialized prenatal follow-up in association with a hematologist.
Induced mutations for resistance to leaf rust in wheat
International Nuclear Information System (INIS)
Borojevic, K.
1983-01-01
Problems related to the induction of mutations for disease resistance were investigated under several aspects, using the wheat/leaf rust system. Previously selected mutant lines, tested in M 11 and M 13 , were found to differ with regard to infection type and disease severity from the original varieties. To verify the induced-mutation origin, these mutants were examined further using test crosses with carriers of known genes for leaf rust resistance and electrophoresis. A separate experiment to induce mutations for leaf rust resistance in the wheat varieties Sava, Aurora and Siete Cerros, using gamma rays, fast neutrons and EMS, yielded mutants with different disease reaction in the varieties Sava and Aurora at a frequency of about 1x10 - 3 per M 1 plant progenies. (author)
Directory of Open Access Journals (Sweden)
Boman Inger A
2010-02-01
Full Text Available Abstract Background Sheep carcasses with yellow fat are sporadically observed at Norwegian slaughter houses. This phenomenon is known to be inherited as a recessive trait, and is caused by accumulation of carotenoids in adipose tissue. Two enzymes are known to be important in carotenoid degradation in mammals, and are therefore potential candidate genes for this trait. These are beta-carotene 15,15'-monooxygenase 1 (BCMO1 and the beta-carotene oxygenase 2 (BCO2. Results In the present study the coding region of the BCMO1 and the BCO2 gene were sequenced in yellow fat individuals and compared to the corresponding sequences from control animals with white fat. In the yellow fat individuals a nonsense mutation was found in BCO2 nucleotide position 196 (c.196C>T, introducing a stop codon in amino acid position 66. The full length protein consists of 575 amino acids. In spite of a very low frequency of this mutation in the Norwegian AI-ram population, 16 out of 18 yellow fat lambs were found to be homozygous for this mutation. Conclusion In the present study a nonsense mutation (c.196C>T in the beta-carotene oxygenase 2 (BCO2 gene is found to strongly associate with the yellow fat phenotype in sheep. The existence of individuals lacking this mutation, but still demonstrating yellow fat, suggests that additional mutations may cause a similar phenotype in this population. The results demonstrate a quantitatively important role for BCO2 in carotenoid degradation, which might indicate a broad enzyme specificity for carotenoids. Animals homozygous for the mutation are not reported to suffer from any negative health or development traits, pointing towards a minor role of BCO2 in vitamin A formation. Genotyping AI rams for c.196C>T can now be actively used in selection against the yellow fat trait.
Oxidative stress and antioxidant status in beta-thalassemia heterozygotes
Directory of Open Access Journals (Sweden)
Luciana de Souza Ondei
2013-01-01
Full Text Available Background: Several studies have evaluated the oxidant and antioxidant status of thalassemia patients but most focused mainly on the severe and intermediate states of the disease. Moreover, the oxidative status has not been evaluated for the different beta-thalassemia mutations. Objective: To evaluate lipid peroxidation and Trolox equivalent antioxidant capacity in relation to serum iron and ferritin in beta thalassemia resulting from two different mutations (CD39 and IVS-I-110 compared to individuals without beta-thalassemia. Methods: One hundred and thirty subjects were studied, including 49 who were heterozygous for beta-thalassemia and 81 controls. Blood samples were subjected to screening tests for hemoglobin. Allele-specific polymerase chain reaction was used to confirm mutations for beta-thalassemia, an analysis of thiobarbituric acid reactive species was used to determine lipid peroxidation, and Trolox equivalent antioxidant capacity evaluations were performed. The heterozygous beta-thalassemia group was also evaluated for serum iron and ferritin status. Results: Thiobarbituric acid reactive species (486.24 ± 119.64 ng/mL and Trolox equivalent antioxidant capacity values (2.23 ± 0.11 mM/L were higher in beta-thalassemia heterozygotes compared to controls (260.86 ± 92.40 ng/mL and 2.12 ± 0.10 mM/L, respectively; p-value < 0.01. Increased thiobarbituric acid reactive species values were observed in subjects with the CD39 mutation compared with those with the IVS-I-110 mutation (529.94 ± 115.60 ng/mL and 453.39 ± 121.10 ng/mL, respectively; p-value = 0.04. However, average Trolox equivalent antioxidant capacity values were similar for both mutations (2.20 ± 0.08 mM/L and 2.23 ± 0.12 mM/L, respectively; p-value = 0.39. There was no influence of serum iron and ferritin levels on thiobarbituric acid reactive species and Trolox equivalent antioxidant capacity values. Conclusion: This study shows an increase of oxidative stress and
The relative importance of relativistic induced interactions in the beta decay of 170Tm
International Nuclear Information System (INIS)
Bogdan, D.; Cristu, M.I.; Holan, S.; Faessler, A.
1982-09-01
The log ft-values, the spectrum shape functions, and the beta-gamma angular correlation coefficients of the 170 Tm beta decay are computed in the framework of relativistic formfactor formalism using asymmetric rotor model wavefunctions. Main vector and axial vector hadron currents being strongly hindered, the relative importance of induced interaction matrix elements is accurately estimated. Good agreement with experiment is obtained for the beta decay observables when the main induced interaction terms were taken into account. The contribution of the pseudoscalar term was found insignificant. (authors)
Sucrose and IQ induced mutations in rat colon by independent
DEFF Research Database (Denmark)
Hansen, Max; Hald, M. T.; Autrup, H.
2004-01-01
Sucrose-rich diets have repeatedly been observed to have co-carcinogenic actions in colon and liver of rats and to increase the number of 2-amino-3-methylimidazo[4,5-f]quinoline (IQ) induced aberrant crypt foci in rat colon. To investigate a possible interaction between sucrose and IQ...... on the genotoxicity in rat liver and colon, we gave Big Blue rats(TM) a diet containing sucrose (0%, 3.45% or 13.4% w/w) and/or IQ (70 ppm) for a period of 3 weeks. Sucrose and IQ increased the mutation frequency in the colon. The effect of combined treatments with IQ and sucrose on the mutation frequencies...... was additive indicating that sucrose and IQ act independently. This was supported by the mutation spectra where sucrose expands the background mutations in the colon, whereas IQ, in other studies, more specifically has induced G:C --> T:A transversions. In the liver IQ increased the mutation frequency, whereas...
Directory of Open Access Journals (Sweden)
Seonmi Park
2017-04-01
Full Text Available Summary: Sickle cell anemia affects millions of people worldwide and is an emerging global health burden. As part of a large NIH-funded NextGen Consortium, we generated a diverse, comprehensive, and fully characterized library of sickle-cell-disease-specific induced pluripotent stem cells (iPSCs from patients of different ethnicities, β-globin gene (HBB haplotypes, and fetal hemoglobin (HbF levels. iPSCs stand to revolutionize the way we study human development, model disease, and perhaps eventually, treat patients. Here, we describe this unique resource for the study of sickle cell disease, including novel haplotype-specific polymorphisms that affect disease severity, as well as for the development of patient-specific therapeutics for this phenotypically diverse disorder. As a complement to this library, and as proof of principle for future cell- and gene-based therapies, we also designed and employed CRISPR/Cas gene editing tools to correct the sickle hemoglobin (HbS mutation. : In this resource article, Mostoslavsky, Murphy, and colleagues of the NextGen consortium describe a diverse, comprehensive, and characterized library of sickle cell disease-specific induced pluripotent stem cells (iPSCs from patients of different ethnicities, β-globin gene (HBB haplotypes and fetal hemoglobin (HbF levels. This bank is readily available and accessible to all investigators. Keywords: induced pluripotent stem cells, iPSCs, sickle cell disease, disease modeling, directed differentiation, gene correction
Energy Technology Data Exchange (ETDEWEB)
Andarawewa, Kumari L.; Erickson, Anna C.; Chou, William S.; Costes, Sylvain; Gascard, Philippe; Mott, Joni D.; Bissell, Mina J.; Barcellos-Hoff, Mary Helen
2007-04-06
Transforming growth factor {beta}1 (TGF{beta}) is a tumor suppressor during the initial stage of tumorigenesis, but it can switch to a tumor promoter during neoplastic progression. Ionizing radiation (IR), both a carcinogen and a therapeutic agent, induces TGF{beta}, activation in vivo. We now show that IR sensitizes human mammary epithelial cells (HMEC) to undergo TGF{beta}-mediated epithelial to mesenchymal transition (EMT). Non-malignant HMEC (MCF10A, HMT3522 S1 and 184v) were irradiated with 2 Gy shortly after attachment in monolayer culture, or treated with a low concentration of TGF{beta} (0.4 ng/ml), or double-treated. All double-treated (IR+TGF{beta}) HMEC underwent a morphological shift from cuboidal to spindle-shaped. This phenotype was accompanied by decreased expression of epithelial markers E-cadherin, {beta}-catenin and ZO-1, remodeling of the actin cytoskeleton, and increased expression of mesenchymal markers N-cadherin, fibronectin and vimentin. Furthermore, double-treatment increased cell motility, promoted invasion and disrupted acinar morphogenesis of cells subsequently plated in Matrigel{trademark}. Neither radiation nor TGF{beta} alone elicited EMT, even though IR increased chronic TGF{beta} signaling and activity. Gene expression profiling revealed that double treated cells exhibit a specific 10-gene signature associated with Erk/MAPK signaling. We hypothesized that IR-induced MAPK activation primes non-malignant HMEC to undergo TGF{beta}-mediated EMT. Consistent with this, Erk phosphorylation were transiently induced by irradiation, persisted in irradiated cells treated with TGF{beta}, and treatment with U0126, a Mek inhibitor, blocked the EMT phenotype. Together, these data demonstrate that the interactions between radiation-induced signaling pathways elicit heritable phenotypes that could contribute to neoplastic progression.
Mutation breeding in vegetable crops
International Nuclear Information System (INIS)
Yamaguchi, Takashi
1984-01-01
Vegetables breed by seeds and vegetative organs. In main vegetables, the differentiation of clopping types, the adoption of monoculture and year-round production and shipment are carried out, adapting to various socio-economic and cultivation conditions. Protected agriculture has advanced mainly for fruit vegetables, and the seeds for sale have become almost hybrid varieties. Reflecting the situation like this, the demand for breeding is diversified and characteristic, and the case of applying mutation breeding seems to be many. The present status of the mutation breeding of vegetables is not yet well under way, but about 40 raised varieties have been published in the world. The characters introduced by induced mutation and irradiation were compact form, harvesting aptitude, the forms and properties of stems and leaves, anti-lodging property, the size, form and uniformity of fruits, male sterility and so on. The radiation sources used were mostly gamma ray or X-ray, but sometimes, combined irradiation was used. As the results obtained in Japan, burdocks as an example of gamma ray irradiation to seeds, tomatoes as an example of inducing the compound resistance against disease injury and lettuces as an example of internal beta irradiation are reported. (Kako, I.)
Re-analysis of radiation-induced specific locus mutations in the mouse
International Nuclear Information System (INIS)
Abrahamson, S.; Wolff, S.
1976-01-01
It is stated that a re-analysis of published data on mouse mutation rates induced by x-and gamma rays suggests that the kinetics of induction can be analysed by fitting that data to a parabolic curve. This is interpreted to mean that a substantial proportion of the induced mutations results from gross chromosomal changes such as deletions, some of which are one-track and some of which are two-track. This analysis is based on the assumption that the shape of the dose curve, which in the female is concave upward, reflects the manner in which the mutations are induced rather than representing a one-track (linear) curve whose shape has been modified by differential repair. (author)
Agonist-induced desensitization of adenylyl cyclase in Y1 adrenocortical tumor cells
International Nuclear Information System (INIS)
Olson, M.F.; Tsao, J.; Pon, D.J.; Schimmer, B.P.
1991-01-01
Y1 adrenocortical tumor cells (Y1DS) and Y1 mutants resistant to ACTH-induced desensitization of adenylyl cyclase (Y1DR) were transfected with a gene encoding the mouse beta 2-adrenergic receptor (beta 2-AR). Transfectants expressed beta 2-ARs that were able to stimulate adenylyl cyclase activity and steroid biosynthesis. These transfectants were used to explore the basis for the DR mutation in Y1 cells. The authors demonstrate that beta-adrenergic agonists desensitize the adenylyl cyclase system in transfected Y1DS cells whereas transfected Y1DR cells are resistant to desensitization by beta-adrenergic agonists. The fate of the beta 2-ARs during desensitization was evaluated by photoaffinity labelling with [125I]iodocyanopindolol diazerine. Desensitization of Y1DS transfectants was accompanied by a modest loss in receptor density that was insufficient to account for the complete loss of responsiveness to beta-adrenergic agonists. The extent of receptor loss induced by beta-adrenergic agonists in Y1DR transfectants exceeded that in the Y1DS transfectants indicating that the mutation which protects Y1DR cells from agonist-induced desensitization is prior to receptor down-regulation in the desensitization pathway. From these results we infer that ACTH and isoproterenol desensitize adenylyl cyclase by a common pathway and that receptor loss is not a major component of the desensitization process in these cells
Use of induced mutations for potato improvement
International Nuclear Information System (INIS)
Kishore, H.; Das, B.; Subramanyam, K.N.; Chandra, R.; Upadhya, M.D.
1975-01-01
The investigations aim at the utilization of induced mutations for potato improvement. The effect of γ-rays was tested on selfed seeds and hybrid seeds as well as on tubers of several potato varieties. Chemical mutagens have been successfully employed to produce daylength neutral clones. An attempt to induce resistance against Pseudomonas solanacearum did not give conclusive results. Potato improvement in relation of yield and other characters of economic significance like maturity and attributes of tubers has been handicapped by several technical considerations world over. The crux of the problem lies in the narrow genetic base (variability) for potato breeders to work with. The use of mutation breeding, therefore, offers a good tool for this. Improvement by mutation breeding for the quantitative characters besides the resistance to disease and pest has been demonstrated in other crops like white mustard variety Primex (Anderson and Olsson, 1954), barley (Gustafsson, 1965) and peanut (Gregory, 1956). Keeping these in view and the success we had in isolating photoperiod insensitive types (Upadhaya et al, 1973, 1974) study was enlarged to use mutagens to increase as wide a spectrum as possible of the variability for quantative and qualitative characters. (author)
Shiina, T; Kawasaki, A; Nagao, T; Kurose, H
2000-09-15
The beta(1)-adrenergic receptor (beta(1)AR) shows the resistance to agonist-induced internalization. As beta-arrestin is important for internalization, we examine the interaction of beta-arrestin with beta(1)AR with three different methods: intracellular trafficking of beta-arrestin, binding of in vitro translated beta-arrestin to intracellular domains of beta(1)- and beta(2)ARs, and inhibition of betaAR-stimulated adenylyl cyclase activities by beta-arrestin. The green fluorescent protein-tagged beta-arrestin 2 translocates to and stays at the plasma membrane by beta(2)AR stimulation. Although green fluorescent protein-tagged beta-arrestin 2 also translocates to the plasma membrane, it returns to the cytoplasm 10-30 min after beta(1)AR stimulation. The binding of in vitro translated beta-arrestin 1 and beta-arrestin 2 to the third intracellular loop and the carboxyl tail of beta(1)AR is lower than that of beta(2)AR. The fusion protein of beta-arrestin 1 with glutathione S-transferase inhibits the beta(1)- and beta(2)AR-stimulated adenylyl cyclase activities, although inhibition of the beta(1)AR-stimulated activity requires a higher concentration of the fusion protein than that of the beta(2)AR-stimulated activity. These results suggest that weak interaction of beta(1)AR with beta-arrestins explains the resistance to agonist-induced internalization. This is further supported by the finding that beta-arrestin can induce internalization of beta(1)AR when beta-arrestin 1 does not dissociate from beta(1)AR by fusing to the carboxyl tail of beta(1)AR.
Directory of Open Access Journals (Sweden)
Frank Griscelli
2018-05-01
Full Text Available Heterozygous non-synonymous (p.S142F mutation in HNF1A leads to maturity-onset diabetes of the young (MODY type 3, which is a subtype of dominant inherited young-onset non-autoimmune diabetes due to the defect of insulin secretion from pancreatic beta cells. We generated induced pluripotent stem cells (iPSCs from a patient with HNF1A p.S142F mutation. Cells from this patient, which were reprogrammed by non-integrative viral transduction had normal karyotype, harboured the HNF1A p.S142F mutation, expressed pluripotency hallmarks.
Some results on the combined use of induced mutations and heterosis breeding
International Nuclear Information System (INIS)
Stoilov, M.; Daskaloff, S.
1976-01-01
The literature on the combined use of induced mutations and heterosis in cultivated species is reviewed. Data from studies of the general and specific combining ability of induced mutations for gene markers both obtained and used in hybrid seed production, translocation lines for development of seedless fruits, male sterile forms, etc., are supplied. The authors give data from their own experimental material for use of mutant lines in heterosis breeding and hybrid seed production. It is concluded that the combined use of induced mutations and heterosis in both self- and cross-pollinating species is very promising. (author)
Heydari, Nasrin; Shariati, Laleh; Khanahmad, Hossein; Hejazi, Zahra; Shahbazi, Mansoureh; Salehi, Mansoor
2016-01-01
Objective(s): β-thalassemia is one of the most common genetic disorders in the world. As one of the promising treatment strategies, fetal hemoglobin (Hb F) can be induced. The present study was an attempt to reactivate the γ-globin gene by introducing a gene construct containing KLF1 binding sites to the K562 cell line. Materials and Methods: A plasmid containing a 192 bp sequence with two repeats of KLF1 binding sites on β-globin and BCL11A promoters was constructed and used to transfect the K562 cell line. Positive selection was performed under treatment with 150 μg/ml hygromycin B. The remaining cells were expanded and harvested on day 28, and genomic DNA was extracted. The PCR was carried out to verify insertion of DNA fragment to the genome of K562 cells. The cells were differentiated with 15 μg/ml cisplatin. Flowcytometry was performed to identify erythroid differentiation by detection of CD235a+ cells. Real-time RT-PCR was performed to evaluate γ-globin expression in the transfected cells. Results: A 1700 bp fragment was observed on agarose gel as expected and insertion of DNA fragment to the genome of K562 cells was verified. Totally, 84% of cells were differentiated. The transfected cells significantly increased γ-globin expression after differentiation compared to untransfected ones. Conclusion: The findings demonstrate that the spongy effect of KLF1-binding site on BCL11A and β-globin promoters can induce γ-globin expression in K562 cells. This novel strategy can be promising for the treatment of β-thalassemia and sickle cell disease. PMID:27872702
Radiation-induced dominant skeletal mutations in mice
International Nuclear Information System (INIS)
Selby, P.B.
1979-01-01
Skeletons were chosen for the attempt to determine the overall damage by radiation to one body system largely bacause they can be prepared readily for detailed study. Dominant mutations were of special interest because they are the type of mutations that would account for almost all damage induced in the early generations. The male offsprings derived from spermatogonial irradiation were used in the mutation-rate experiment, and the mutation frequency of 1.4% per gamete was found. The general dominant skeletal mutations are 1) the fusions of bones or other changes in individual bones, 2) the gross changes in bone shapes, usually caused by incomplete or too extensive bone growth, or 3) the shifts in the relative positions of bones. The recessive lethality in the period between implantation and birth can be recognized by the expected high death rate of implants in approximately 1/4 of the crosses that are between heterozygotes for a given mutation. The recessive lethal mutations may account for an important fraction of human genetic disorders owing to their dominant deleterious effects which represent only a small fraction, but because of their easy detection, they have been studied more than other dominants. At least 45, or 27%, of 164 dominant visibles in mice, ignoring those concerned with enzyme polymorphisms and immunological traits, appear to be recessive lethals. (Yamashita, S.)
Energy Technology Data Exchange (ETDEWEB)
Petroulakis, E.; Cao, Z.; Salo, T. [Univ. of Manitoba, Winnipeg (Canada)] [and others
1994-09-01
Mutations in the HEXA gene that encodes the {alpha}-subunit of the heterodimeric lysosomal enzyme {beta}-hexosaminidase A, or Hex A ({alpha}{beta}), cause G{sub M2} gangliosidosis, type 1. The infantile form (Tay-Sachs disease) results when there is no residual Hex A activity, while less severe and more variable clinical phenotypes result when residual Hex A activity is present. A non-Jewish male who presented with an acute psychotic episode at age 16 was diagnosed with a subacute encephalopathic form of G{sub M2} gangliosidosis. At age 19, chronic psychosis with intermittent acute exacerbations remains the most disabling symptom in this patient and his affected brother although both exhibit some ataxia and moderately severe dysarthria. We have found a 4 bp insertion (+TATC 1278) associated with infantile Tay-Sachs disease on one allele; no previously identified mutation was found on the second allele. SSCP analysis detected a shift in exon 13 and sequencing revealed a G1422C mutation in the second allele that results in a Trp474Cys substitution. The presence of the mutation was confirmed by the loss of HaeIII and ScrFI sites in exon 13 PCR products from the subjects and their father. The mutation was introduced into the {alpha}-subunit cDNA and Hex S ({alpha}{alpha}) and Hex A ({alpha}{beta}) were transiently expressed in monkey COS-7 cells. The Trp474Cys mutant protein had approximately 5% and 12% of wild-type Hex S and Hex A activity, respectively. Western blot analysis revealed a small amount of residual mature {alpha}-subunit and a normal level of precursor protein. We conclude that the Trp474Cys mutation is the cause of the Hex A deficiency associated with a subacute (juvenile-onset) phenotype in this patient. Like other mutations in exon 13 of HEXA, it appears to affect intracellular processing. Studies of the defect in intracellular processing are in progress.
Genomic mutation study for long-term cells induced by carbon ions
International Nuclear Information System (INIS)
Wang, X.; Furusawa, Y.; Suzuki, M.; Hirayama, R.; Matsumoto, Y.; Qin, Y.
2007-01-01
Complete text of publication follows. Objective: Densely ionizing (high LET) radiation can increase the relative biological effectiveness of cell and tissue. Astronauts in the space exploration have the potential exposure of chronic low-dose radiations in the field of low-flux galactic cosmic rays (GCR) and the subsequent biological effects have become one of the major concerns of space science. Furthermore, Heavy ions also are used new radiation therapy owing increased lethal effectiveness of high LET radiation. During radiation therapy, normal tissues also are exposed to ionizing radiation. Radiation can induce genomic mutation and instability in descendants of irradiated cells. Induction of genomic instability can represent one of the initiating steps leading to malignant transformation. Higher frequencies of mutation can be expected to provide higher rates of carcinogenicity with human exposure. Therefore, the study of radiation induced genomic mutation and instability is relevant to the estimates of the risk of secondary malignancies associated with radiation therapy and the carcinogenic effects of space environmental radiation. The hypoxanthine-guanine phosphoribosyltransferase (hprt) locus has been the most commonly used as a target gene for mutation detection studies. In this study, we investigated the generation expression dependence of mutation induction on HPRT locus in CHO cells irradiated with carbon ions. Methods: Chinese hamster ovary (CHO) cells were irradiated with graded doses of carbon ions (290MeV/u, LET:13kev/um) accelerated with Heavy Ion Medical Accelerator in Chiba (HIMAC) at National Institute of Radiological Sciences(NIRS). The survival effect of cells plated immediately after irradiation was measured with cell colony formation assay. After irradiation, cells were continues reseeding and cultures for lone-term proliferation. Cell samples were collected at 6, 12, 18, 24, 30, 37 and 44 days post irradiation. Mutation induction of cell
International Nuclear Information System (INIS)
Ivanov, E.L.; Kovaltzova, S.V.; Kassinova, G.V.; Gracheva, L.M.; Korolev, V.G.; Zakharov, I.A.
1986-01-01
The authors have studied the molecular nature of ade2 mutations induced by UV light and bifunctional acridine-mustard (BAM) in wild-type (RAD) and in excision-deficient (rad2) strains of the yeast, Saccharomyces cerevisiae. In the RAD strain, UV causes 45% GC → AT transitions among all mutations; in the rad2 strain this value is 77%. BAM was shown to be highly specific for frameshift mutagenesis: 60% frameshifts in the RAD strain, and as many as 84% frameshifts in the rad2 strain were induced. Therefore, the rad2 mutation affects the specificity of UV- and BAM-induced mutagenesis in yeast. Experimental data agree with the view that the majority of mutations in the RAD strain are induced by a prereplicative mechanism, whereas mutations in the rad2 strain are predominantly postreplicative events. (Auth.)
Schank, Jesse R; Liles, L Cameron; Weinshenker, David
2008-06-01
Cocaine is a widely abused psychostimulant that has both rewarding and aversive properties. While the mechanisms underlying cocaine's rewarding effects have been studied extensively, less attention has been paid to the unpleasant behavioral states induced by cocaine, such as anxiety. In this study, we evaluated the performance of dopamine beta-hydroxylase knockout (Dbh -/-) mice, which lack norepinephrine (NE), in the elevated plus maze (EPM) to examine the contribution of noradrenergic signaling to cocaine-induced anxiety. We found that cocaine dose-dependently increased anxiety-like behavior in control (Dbh +/-) mice, as measured by a decrease in open arm exploration. The Dbh -/- mice had normal baseline performance in the EPM but were completely resistant to the anxiogenic effects of cocaine. Cocaine-induced anxiety was also attenuated in Dbh +/- mice following administration of disulfiram, a dopamine beta-hydroxylase (DBH) inhibitor. In experiments using specific adrenergic antagonists, we found that pretreatment with the beta-adrenergic receptor antagonist propranolol blocked cocaine-induced anxiety-like behavior in Dbh +/- and wild-type C57BL6/J mice, while the alpha(1) antagonist prazosin and the alpha(2) antagonist yohimbine had no effect. These results indicate that noradrenergic signaling via beta-adrenergic receptors is required for cocaine-induced anxiety in mice.
DEFF Research Database (Denmark)
Ek, J; Grarup, N; Urhammer, S A
2001-01-01
Mutations in the homeodomain-containing transcription factor hepatocyte nuclear factor-1beta (HNF-1beta) are known to cause a rare subtype of maturity-onset diabetes of the young (MODY5), which is associated with early-onset progressive non-diabetic renal dysfunction. To investigate whether...... mutations in HNF-1 are implicated in the pathogenesis of MODY or late-onset diabetes with and without nephropathy in Danish Caucasians we examined the HNF-1beta (TCF2) and the dimerization cofactor of HNF-1 (DCoH, PCBD) genes for mutations in 11 MODY probands, 28 type 2 diabetic patients with nephropathy...... comprising the DCoH gene revealed a previously described A-->G polymorphism located in the 3' untranslated region, which was not investigated further. In conclusion, mutations in HNF-1beta and DCoH are not a major cause of MODY or late onset type 2 diabetes in Danish Caucasian subjects....
Development of breeding materials in rice by use of induced mutation
International Nuclear Information System (INIS)
Amano, Etsuo
1988-01-01
On this 25th Gamma Field Symposium, it may be worth while to review the world situation of mutation breeding, the possibility expected to mutation methods suggested by the ever progressing genetics in rice plant, and some of the activities in the Institute of Radiation Breeding. By the help of a small computer, the key word search analysis of 'Mutation Breeding Newsletter and Mutation Breeding Review' was tried, and the results are included in this review to see the present status. The studies on artificially induced mutation suggested that the possibility of dominant mutation is less. It might be probable that the inactivation of genes is the mechanism of mutation. Still the possibility of using mutation breeding techniques for many genetic characters was suggested. After the experience for 25 years, detailed genetical and fine structure analyses became important. The studies on the expression of mutant phenotypes including molecular genetics will help to develop radiation breeding into an effective means to enrich the genetic resources for breeding. The situation in the world, the genes reported in rice, the possibility to induce useful mutants against environmental stress, the mutation in the protein content in grains, the mutants of storage carbohydrate, the possibility to widen gene resources and so on are reported. (Kako, I.)
Radiation-induced cell mutations as a function of dose rate
International Nuclear Information System (INIS)
Kiefer, J.
1987-01-01
A brief review of the data in the literature is presented and forms the background of the experimental data given by the author obtained with exponential long-term cultures of V79 hamster cells exposed over a period of up to 35 days to different dose rates of gamma radiation. The experimental results show that at a dose rate of 40 mGy/hour the number of induced mutations is reduced, - which is in agreement with literature data - , but a dose rate of less than 30 mGy/hour makes the induced mutations leap to a value clearly higher than those induced by acute irradiation. As in addition to the mutations recombination is a significant factor of the radiation risk, experiments with a heterozygotic yeast strain have been made, as there is to date no reliable mammalian cell system available for this kind of research. Long-term radiation exposure of the yeast cells over a period of six weeks drastically increased the rate of recombinations, to a value higher by a factor of about 4 than that induced by acute irradiation. (orig.) [de
Glucose-induced lipogenesis in pancreatic beta-cells is dependent on SREBP-1
DEFF Research Database (Denmark)
Sandberg, Maria B; Fridriksson, Jakob; Madsen, Lise
2005-01-01
High concentrations of glucose induce de novo fatty acid synthesis in pancreatic beta-cells and chronic exposure of elevated glucose and fatty acids synergize to induce accumulation of triglycerides, a phenomenon termed glucolipotoxicity. Here we investigate the role of sterol-regulatory element......, de novo fatty acid synthesis and lipid accumulation are induced primarily through sterol-regulatory elements (SREs) and not E-Boxes. Adenoviral expression of a dominant negative SREBP compromises glucose induction of some lipogenic genes and significantly reduces glucose-induction of de novo fatty...... acid synthesis. Thus, we demonstrate for the first time that SREBP activity is necessary for full glucose induction of de novo fatty acid synthesis in pancreatic beta-cells....
Energy Technology Data Exchange (ETDEWEB)
Ebi, Masahide [Department of Gastroenterology and Metabolism, Nagoya City University Graduate School of Medical Sciences, Nagoya (Japan); Kataoka, Hiromi, E-mail: hkataoka@med.nagoya-cu.ac.jp [Department of Gastroenterology and Metabolism, Nagoya City University Graduate School of Medical Sciences, Nagoya (Japan); Shimura, Takaya; Kubota, Eiji; Hirata, Yoshikazu; Mizushima, Takashi; Mizoshita, Tsutomu; Tanaka, Mamoru; Mabuchi, Motoshi; Tsukamoto, Hironobu; Tanida, Satoshi; Kamiya, Takeshi [Department of Gastroenterology and Metabolism, Nagoya City University Graduate School of Medical Sciences, Nagoya (Japan); Higashiyama, Shigeki [Department of Biochemistry and Molecular Genetics, Ehime University Graduate School of Medicine, Ehime (Japan); Joh, Takashi [Department of Gastroenterology and Metabolism, Nagoya City University Graduate School of Medical Sciences, Nagoya (Japan)
2010-11-19
Research highlights: {yields} TGF{beta} induces EGFR transactivation through proHB-EGF shedding by activated ADAM members in gastric cancer cells. {yields} TGF{beta} induces nuclear translocation of HB-EGF-CTF cleaved by ADAM members. {yields} TGF{beta} enhances cell growth by EGFR transactivation and HB-EGF-CTF nuclear translocation and ADAM inhibitors block these effects. {yields} Silencing of ADAM17 also blocks EGFR transactivation, HB-EGF-CTF nuclear translocation and cancer cell growth by TGF{beta}. {yields} ADAM17 may play a crucial role in this TGF{beta}-HB-EGF signal transduction. -- Abstract: Background and aims: Transforming growth factor-beta (TGF{beta}) is known to potently inhibit cell growth. Loss of responsiveness to TGF{beta} inhibition on cell growth is a hallmark of many types of cancer, yet its mechanism is not fully understood. Membrane-anchored heparin-binding EGF-like growth factor (proHB-EGF) ectodomain is cleaved by a disintegrin and metalloproteinase (ADAM) members and is implicated in epidermal growth factor receptor (EGFR) transactivation. Recently, nuclear translocation of the C-terminal fragment (CTF) of pro-HB-EGF was found to induce cell growth. We investigated the association between TGF{beta} and HB-EGF signal transduction via ADAM activation. Materials and methods: The CCK-8 assay in two gastric cancer cell lines was used to determine the effect for cell growth by TGF{beta}. The effect of two ADAM inhibitors was also evaluated. Induction of EGFR phosphorylation by TGF{beta} was analyzed and the effect of the ADAM inhibitors was also examined. Nuclear translocation of HB-EGF-CTF by shedding through ADAM activated by TGF{beta} was also analyzed. EGFR transactivation, HB-EGF-CTF nuclear translocation, and cell growth were examined under the condition of ADAM17 knockdown. Result: TGF{beta}-induced EGFR phosphorylation of which ADAM inhibitors were able to inhibit. TGF{beta} induced shedding of proHB-EGF allowing HB-EGF-CTF to
Modulation of 17{beta}-estradiol-induced responses in fish by cytochrome P4501A1 inducing compounds
Energy Technology Data Exchange (ETDEWEB)
Anderson, M.J.; Hinton, D.E. [Univ. of California, Davis, CA (United States)
1995-12-31
Some compounds which induce cytochrome P4501A1 (CYP1A1) are antiestrogenic in mammalian bioassay, and this effect is linked to aryl hydrocarbon (Ah) receptor. Liver of fish synthesizes estrogen-inducible egg yolk precursor protein vitellogenin (Vg) which is critical for oocyte maturation and ovarian development. To determine if Ah receptor-linked endocrine modulation could occur in fish liver, primary cultures of juvenile rainbow trout (Oncorhynchus mykiss) liver cells were co-administered 17{beta}-estradiol and CYP1A1 inducing compounds. Vitellogenin and albumin, estimated by ELISA measurement of concentration in the media 48 hrs after treatment, formed the basis for the test. Cellular CYP1A1 protein content and catalytic activity was estimated by ELISA and ethoxyresorufin-O-deethylase (EROD) activity assays respectively. Equivalent viability (mitochondrial dehydrogenase activity) and secretary functional capacity (albumin synthesis) were estimated and correlated with other results. In descending order, 2,3,4,7,8 pentachlorodibenzofuran (10{sup {minus}12} to 10{sup {minus}8} M) > 2,3,7,8 tetrachlorodibenzo-p-dioxin {approx_equal} 2,3,7,8 tetrachlorodibenzofuran (10{sup {minus}11} to 10{sup {minus}8} M) > {beta}-naphthoflavone (10{sup {minus}7} to 10{sup {minus}6} M) inhibited Vg synthesis in 17{beta}-estradiol treated liver cells. Potency of inhibition directly related to strength as an inducer of CYP1A1 protein. At 10-8 M, PCB congeners 77, 126, and 156 did not inhibit Vg synthesis and induced no or only moderate CYP1A1 protein. At 10-8 M, PCB congener 114, a weak CYP1A1 inducer, potentiated Vg synthesis relative to cells treated with 17{beta}-estradiol alone. This study increases their understanding of the consequences of hepatic CYP1A1 induction, forewarns of reproductive impairment of sexually maturing fishes exposed to CYP1A1 inducing compounds and argues for further, more detailed in vivo investigation.
Use of induced mutations for cotton breeding in India
International Nuclear Information System (INIS)
Raut, R.N.
1980-01-01
A large number of studies have been reported in recent years on the use of induced mutations in the improvement of food crops and ornamentals. Similar investigations on fibre crops like cotton have, however, been relatively few. The fact that most of the economically useful characters in cotton are under polygenic control appears to be the main limiting factor. Inspite of this there are reports of radiation induced useful mutations used as commercial varieties. As early as 1950 a X-ray induced mutant variety of G. hirsutum cotton Indore-2 was released for commercial cultivation in Madhya Pradesh and covered more than one lac hectares. More recently an early maturing mutant variety MCU-7 was released for cultivation in summer rice fallows of Tamil Nadu and covers nearly 10,000 acres. Other promising mutant strains found suitable b.v large scale trials and recommended for cultivation under specific conditions are Okra leaf mutant, photoinsensitive mutant of MCU-5 (named Rasmi) and Jassid tolerant early maturing mutant 4-1 (Pusa Ageti). In addition improved varieties like Badnaawar-1, Khandwa-2 and M64 have been evolved by utilizing mutant lines in cross breeding. The scope of induced mutation method as a breeding technique for cotton improvement in India is very wide. (author)
Genetic improvement of 'NPq' rice with induced mutations
International Nuclear Information System (INIS)
Ram, Mahabal
1974-01-01
Exposure of the seeds of rice to different doses of gamma-rays increased the total mutation frequency with an increase in the dose rate, and the most economic mutations occurred around 30 kr. Induced mutants with dwarf plant type, early maturity, fine grain, high-yielding ability, and resistance to lodging and major diseases were isolated in the M, and M generations. Genetical studies indicated that height is controlled by 4 pairs of additive genes, grass-clumps by 2 pairs of non-allelic interacting genes (inhibitory), and chlorophyll mutations such as albina by 2 pairs of duplicate genes and xantha by a single gene pair. (author)
Induction of mutation in Aspergillus niger for conversion of cellulose into glucose
Energy Technology Data Exchange (ETDEWEB)
Helmi, S.; Khalil, A.E.; Tahoun, M.K.; Khairy, A.H. [Univ. of Alexandria Research Centre, Alexandria (Egypt)
1991-12-31
Plant wastes are very important part of biomass used and investigated for energy, chemical, and fuel production. Cellulose is the major renewable form of carbohydrate in the world, about 10{sup 11} tons of which is synthesized annually. For general use, it must be hydrolyzed first, either chemically or by cellulases derived from a few specialized microorganisms. Enzymes are acceptable environmentally but expensive to produce. Certainly, induction of mutations and selection of high cellulose microbial strains with significant adaptability to degrade cellulose to glucose is promising solutions. Induction of mutations in other fungi and Aspergillus sp. rather than Aspergillus niger was reported. Aspergillus ustus and Trichoderma harzianum were induced by gamma irradiation indicating mutants that excrete higher cellulose yields, particularly exocellobiohydrolase (Avicelase) than their respective wild types. Mutants from the celluiolytic fungus Penicillium pinophilum were induced by chemical and UV-irradiation. Enhancing the production of endo-1,4-{Beta}-D-glucanase (CMCase) and particularly {Beta}-glucosidase was obtained by gamma irradiation of Altemaria alternate. To overcome the lower activity of {beta}-glucosidase in certain fungi species rather than A. niger, mixed cultures of different species were tried. Thus, Aspergillus phonicis with Trichoderma reesei Rut 30, produced a cellulose complex that improved activity twofold over cellulose from Trichoderma alone.
Directory of Open Access Journals (Sweden)
Najmaddin Saki
2013-09-01
Full Text Available Background: Co-inheritance of hemoglobin gene defects is a rare important status that can lead to double heterozygote or homozygote with significant clinical manifestations. Such conditions can be observed in co-inheritance of alpha-thalassemia with beta-thalassemia or hemoglobinopathy. The aim of this study was to evaluate the prevalence of alpha-thalassemia with beta-thalassemia and hemoglobinopathy co-inheritance in a considerable number of Iranian. Methods: This descriptive study was performed on patients with abnormal hematological findings in favor of alpha-thalassemia, beta-thalassemia or beta-hemoglobinopathies. Patients with low MCV and MCH levels and high HbA2 (>3.5 and those with low MCV and MCH and normal or low HbA2 were candidate for molecular analysis for beta and alpha thalassemia respectively. Abnormal Hb electrophoresis was diagnostic criteria for molecular analysis of beta-hemoglobinopathies. Results: Study revealed that more than half of the patients with alpha-thalassemia affected simultaneously by beta-thalassemia and about thirty percent inherited beta-hemoglobinopathies. Among patients with beta-thalassemia, HbSCd6 (A-T was the most common mutation and in alpha-thalassemic patients α 3.7 was the commonest mutation. Conclusion: Relatively high prevalence of co-inheritance of alfa-thalassemia with beta-thalassemia and hemoglobinopathies reflect the necessity of genetic consulting and molecular analysis in diagnosis of such conditions.
Molecular analysis of formaldehyde-induced mutations in human lymphoblasts and E. coli
International Nuclear Information System (INIS)
Crosby, R.M.; Richardson, K.K.; Craft, T.R.; Benforado, K.B.; Liber, H.L.; Skopek, T.R.
1988-01-01
The molecular nature of formaldehyde (HCHO)-induced mutations was studied in both human lymphoblasts and E. coli. Thirty HPRT - human lymphoblast colonies induced by eight repetitive 150 μM HCHO treatments were characterized by Southern blot analysis. Fourteen of these mutants (47%) had visible deletions of some or all of the X-linked HPRT bands, indicating that HCHO can induce large losses of DNA in human lymphoblasts. In E. coli., DNA alterations induced by HCHO were characterized with use of the xanthine guanine phosphoribosyl transferase (gpt) gene as the genetic target. Exposure of E. coli to 4 mM HCHO for 1 hr induced large insertions (41%), large deletions (18%), and point mutations (41%). Dideoxy DNA sequencing revealed that most of the point mutations were transversions at GC base pairs. In contrast, exposure of E. coli to 40 mM HCHO for 1 hr produced 92% point mutations, 62% of which were transitions at a single AT base pair in the gene. Therefore, HCHO is capable of producing different genetic alterations in E. coli at different concentrations, suggesting fundamental differences in the mutagenic mechanisms operating at the two concentrations used. Naked pSV2gpt plasmid DNA was exposed to 3.3 or 10 mM HCHO and transformed into E. coli. Most of the resulting mutations were frameshifts, again suggesting a different mutagenic mechanism
Yu, Chaowen; Huang, Shuodan; Wang, Ming; Zhang, Juan; Liu, Hao; Yuan, Zhaojian; Wang, Xingbin; He, Xiaoyan; Wang, Jie; Zou, Lin
2017-02-10
Traditional methods for thalassemia screening are time-consuming and easily affected by cell hemolysis or hemoglobin degradation in stored blood samples. Tandem mass spectrometry (MS/MS) proved to be an effective technology for sickle cell disorders (SCD) screening. Here, we developed a novel MS/MS method for β-thalassemia screening from dried blood spots (DBS). Stable isotopic-labeled peptides were used as internal standards for quantification and calculation of the α:β-globin ratios. We used the α:β-globin ratio cutoffs to differentiate between normal individuals and patients with thalassemia. About 781 patients and 300 normal individuals were analyzed. The α:β-globin ratios showed significant difference between normal and β-thalassemia patients (Pthalassemia mutation. In the parallel study, all cases screened for suspected thalassemia from six hundred DBS samples by using this MS/MS method were successfully confirmed by genotyping. The intra-assay and inter-assay CVs of the ratios ranged from 2.4% to 3.9% and 4.7% to 7.1%, and there was no significant sample carryover or matrix effect for this MS/MS method. Combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Traditional methods for thalassemia screening were depending on the structural integrity of tetramers and could be affected by hemolysis and degradation of whole blood samples, especially when stored. We used proteospecific peptides produced by the tryptic digestion of each globin to evaluate the production ratio between α- and β-globin chains, which turned out to be quite stable even when stored for more than two months. Though most of the peptides were specific to α-globin or β-globin, we only chose four most informative peptides and its stable isotopic-labeled peptides as internal standards for analysis, which could obtain a high accuracy. Currently, we are the first to address the
Irradiation-induced mutation experiments with eiploid and tetraploid tomato plants
International Nuclear Information System (INIS)
Boda, J.
1979-01-01
Tomato mutation experiments are described. The tomatoes used in the experiment were the diploid Reziszta and its autotetraploid variety. The experimental plants were exposed to an irradiation of 5000 rsd for 1-2 days, and after transplantation into the gamma field, to chronic irradiation during the whole growing season. The chronic treatment heavily reduced fertility in the generations of tetraploid tomato plants. Recurrent treatment of tetraploid led to further deterioration in fertility. Several berries were formed with few seeds or with no seeds at all. After three irradiations, the chlorophyll mutation frequency increased in the diploid and tetraploid tomato plants. For diploids, treatment applied at the seedling stage gave a lower chlorophyll mutation frequency. With tetraploids the same treatment induced similar chlorophyll mutation frequency. As regards to phenotypic variability of quantitative characteristics in diploid and tetraploid tomatoes, the single and repeated chronic irradiation induced no increase in the variability of properties like flowering time, weight, height etc. (author)
Genetic improvement of Sesamun indicum through induced mutations
International Nuclear Information System (INIS)
Rajput, M.A.; Khan, Z.H.; Jafri, K.A.; Fazal Ali, J.A.
2001-01-01
Pakistan is chronically deficient in the production of edible oils. To enhance local production of edible oils, a mutation breeding project entitled ''Genetic improvement of Sesamum indicum through induced mutations'' was initiated for developing high yielding and widely adapted varieties of sesame. Quite a few mutants having earliness, short stature, semi-indehiscence, compact plant type, heavy bearing and high seed yield have been developed. The true breeding mutant lines developed have exhibited impressive yield potential. (author)
Directory of Open Access Journals (Sweden)
Yali Liu
2017-03-01
Full Text Available Monogenic disorders (MGDs, which are caused by single gene mutations, have a serious effect on human health. Among these, β-thalassemia (β-thal represents one of the most common hereditary hematological diseases caused by mutations in the human hemoglobin β (HBB gene. The technologies of induced pluripotent stem cells (iPSCs and genetic correction provide insights into the treatments for MGDs, including β-thal. However, traditional approaches for correcting mutations have a low efficiency and leave a residual footprint, which leads to some safety concerns in clinical applications. As a proof of concept, we utilized single-strand oligodeoxynucleotides (ssODNs, high-fidelity CRISPR/Cas9 nuclease, and small molecules to achieve a seamless correction of the β-41/42 (TCTT deletion mutation in β thalassemia patient-specific iPSCs with remarkable efficiency. Additionally, off-target analysis and whole-exome sequencing results revealed that corrected cells exhibited a minimal mutational load and no off-target mutagenesis. When differentiated into hematopoietic progenitor cells (HPCs and then further to erythroblasts, the genetically corrected cells expressed normal β-globin transcripts. Our studies provide the most efficient and safe approach for the genetic correction of the β-41/42 (TCTT deletion in iPSCs for further potential cell therapy of β-thal, which represents a potential therapeutic avenue for the gene correction of MGD-associated mutants in patient-specific iPSCs.
p53 gene mutation hotspots in skin cancer and ultraviolet induced mutation
International Nuclear Information System (INIS)
Ikehata, Hironobu
1998-01-01
Presence of certain hotspots is known in the mutation of p53 gene in skin cancer, which are codons 177, 196, 245, 248, 278 and 282 located in the exon 5-8. In these regions, mutations like C to T and CC to TT are frequent and thereby suggest that they are resulted from pyrimidine-dimers produced by ultraviolet light (UV). In cyclobutane pyrimidine dimerization (CPD), conversion of cytosine to thymine by deamination is suggested to be the primary reaction. Although studies using UVC (254 nm) suggesting that the mutation hotspots are low repair efficiency regions could not completely explain the all hotspots, those using UVB and sunlight (UVB and UVA) revealed that CPD was efficiently produced even in such regions as not explained by studies with UVC alone. Therefore, the latter studies are conceivably reasonable since the skin cancer is induced by natural sunlight. Exon 5-8 DNA is completely methylated and the absorption coefficient of 5-methylcytosine is 5-6 times as large as that of cytosine at wavelength around 290 nm. These indicate the importance of UVB in mutation of mammalian cells possessing the ability to methylate DNA. (K.H.)
International Nuclear Information System (INIS)
Friesen, Claudia; Lubatschofski, Annelie; Debatin, Klaus-Michael; Kotzerke, Joerg; Buchmann, Inga; Reske, Sven N.
2003-01-01
Beta-irradiation used for systemic radioimmunotherapy (RIT) is a promising treatment approach for high-risk leukaemia and lymphoma. In bone marrow-selective radioimmunotherapy, beta-irradiation is applied using iodine-131, yttrium-90 or rhenium-188 labelled radioimmunoconjugates. However, the mechanisms by which beta-irradiation induces cell death are not understood at the molecular level. Here, we report that beta-irradiation induced apoptosis and activated apoptosis pathways in leukaemia cells depending on doses, time points and dose rates. After beta-irradiation, upregulation of CD95 ligand and CD95 receptor was detected and activation of caspases resulting in apoptosis was found. These effects were completely blocked by the broad-range caspase inhibitor zVAD-fmk. In addition, irradiation-mediated mitochondrial damage resulted in perturbation of mitochondrial membrane potential, caspase-9 activation and cytochrome c release. Bax, a death-promoting protein, was upregulated and Bcl-x L , a death-inhibiting protein, was downregulated. We also found higher apoptosis rates and earlier activation of apoptosis pathways after gamma-irradiation in comparison to beta-irradiation at the same dose rate. Furthermore, irradiation-resistant cells were cross-resistant to CD95 and CD95-resistant cells were cross-resistant to irradiation, indicating that CD95 and irradiation used, at least in part, identical effector pathways. These findings demonstrate that beta-irradiation induces apoptosis and activates apoptosis pathways in leukaemia cells using both mitochondrial and death receptor pathways. Understanding the timing, sequence and molecular pathways of beta-irradiation-mediated apoptosis may allow rational adjustment of chemo- and radiotherapeutic strategies. (orig.)
Kim, Jaewon; Lee, Jihun; Brych, Stephen R; Logan, Timothy M; Blaber, Michael
2005-02-01
The beta-turn is the most common type of nonrepetitive structure in globular proteins, comprising ~25% of all residues; however, a detailed understanding of effects of specific residues upon beta-turn stability and conformation is lacking. Human acidic fibroblast growth factor (FGF-1) is a member of the beta-trefoil superfold and contains a total of five beta-hairpin structures (antiparallel beta-sheets connected by a reverse turn). beta-Turns related by the characteristic threefold structural symmetry of this superfold exhibit different primary structures, and in some cases, different secondary structures. As such, they represent a useful system with which to study the role that turn sequences play in determining structure, stability, and folding of the protein. Two turns related by the threefold structural symmetry, the beta4/beta5 and beta8/beta9 turns, were subjected to both sequence-swapping and poly-glycine substitution mutations, and the effects upon stability, folding, and structure were investigated. In the wild-type protein these turns are of identical length, but exhibit different conformations. These conformations were observed to be retained during sequence-swapping and glycine substitution mutagenesis. The results indicate that the beta-turn structure at these positions is not determined by the turn sequence. Structural analysis suggests that residues flanking the turn are a primary structural determinant of the conformation within the turn.
Understanding the role of p53 in adaptive response to radiation-induced germline mutations
International Nuclear Information System (INIS)
Langlois, N.L.; Quinn, J.S.; Somers, C.M.; Boreham, D.R.; Mitchel, R.E.J.
2003-01-01
Full text: Radiation-induced adaptive response is now a widely studied area of radiation biology. Studies have demonstrated reduced levels of radiation-induced biological damage when an 'adaptive dose' is given before a higher 'challenge dose' compared to when the challenge dose is given alone. It has been shown in some systems to be a result of inducible cellular repair systems. The adaptive response has been clearly demonstrated in many model systems, however its impact on heritable effects in the mammalian germline has never been studied. Expanded Simple Tandem Repeat (ESTR) loci have been used as markers demonstrating that induced heritable mutations in mice follow a dose-response relationship. Recent data in our laboratory show preliminary evidence of radiation-induced adaptive response suppressing germline mutations at ESTR loci in wild type mice. The frequency of heritable mutations was significantly reduced when a priming dose of 0.1 Gy was given 24 hours prior to a 1 Gy acute challenging dose. We are now conducting a follow-up study to attempt to understand the mechanism of this adaptive response. P53 is known to play a significant role in governing apoptosis, DNA repair and cancer induction. In order to determine what function p53 has in the adaptive response for heritable mutations, we have mated radiation treated Trp53+/- male mice (C57Bl) to untreated, normal females (C57Bl). Using DNA fingerprinting, we are investigating the rate of inherited radiation-induced mutations on pre- and post-meiotic radiation-treated gametocytes by examining mutation frequencies in offspring DNA. If p53 is integral in the mechanism of adaptive response, we should not see an adaptive response in radiation-induced heritable mutations in these mice. This research is significant in that it will provide insight to understanding the mechanism behind radiation-induced adaptive response in the mammalian germline
Two cloned β thalassemia genes are associated with amber mutations at codon 39
Pergolizzi, Robert; Spritz, Richard A.; Spence, Sally; Goossens, Michel; Kan, Yuet Wai; Bank, Arthur
1981-01-01
Two β globin genes from patients with the β+ thalassemia phenotype have been cloned and sequenced. A single nucleotide change from CAG to TAG (an amber mutation) at codon 39 is the only difference from normal in both genes analyzed. The results are consistent with the assumption that both patients are doubly heterozygous for β+ and β° thalassemia, and that we have isolated and analyzed the β° thalassemia gene. Images PMID:6278453
Best practices for transfusion for patients with sickle cell disease
Ted Wun; Kathryn Hassell
2010-01-01
The beta-globin gene mutation in sickle cell anemia results in anemia and repeated bouts of vascular occlusion. The cumulative effect of these vasocclusive events is progressive damage to many organs including the kidneys, lungs, and brain. The transfusion of red blood cells (RBC) can ameliorate many of these complications, but can be associated with both acute and chronic complications, including iron overload. The objective of the Best Practices in Transfusion Medicine for Patients with S...
Directory of Open Access Journals (Sweden)
Eitan Fibach
2017-12-01
Full Text Available Thalassemia (thal is an autosomal recessive, hereditary, chronic hemolytic anemia due to a partial or complete deficiency in the synthesis of α-globin chains (α-thal or β-globin chains (β-thal that compose the major adult hemoglobin (α2β2. It is caused by one or more mutations in the corresponding genes. The unpaired globin chains are unstable; they precipitate intracellularly, resulting in hemolysis, premature destruction of red blood cell [RBC] precursors in the bone marrow, and a short life-span of mature RBCs in the circulation. The state of anemia is treated by frequent RBC transfusions. This therapy results in the accumulation of iron (iron overload, a condition that is exacerbated by the breakdown products of hemoglobin (heme and iron and the increased iron uptake for the chronic accelerated, but ineffective, RBC production. Iron catalyzes the generation of reactive oxygen species, which in excess are toxic, causing damage to vital organs such as the heart and liver and the endocrine system. Herein, we review recent findings regarding the pathophysiology underlying the major symptoms of β-thal and potential therapeutic modalities for the amelioration of its complications, as well as new modalities that may provide a cure for the disease.
Mutation breeding in vegetable crops
Energy Technology Data Exchange (ETDEWEB)
Yamaguchi, Takashi
1984-03-01
Vegetables breed by seeds and vegetative organs. In main vegetables, the differentiation of clopping types, the adoption of monoculture and year-round production and shipment are carried out, adapting to various socio-economic and cultivation conditions. Protected agriculture has advanced mainly for fruit vegetables, and the seeds for sale have become almost hybrid varieties. Reflecting this situation, the demand for breeding is diversified and characteristic. The present status of mutation breeding of vegetables is not yet well under way, but reports of about 40 raised varieties have been published in the world. The characters introduced by induced mutation and irradiation are compact form, harvesting aptitude, the forms and properties of stems and leaves, anti-lodging property, the size, form and uniformity of fruits, male sterility and so on. The radiation sources used were mostly gamma ray or X-ray, but sometimes, combined irradiation was used. Results obtained in Japan include: burdocks as an example to gamma ray irradiation of seeds; tomatoes as an example of inducing compound resistance against disease injury; and lettuce as an example of internal beta irradiation. (Kako, I.).
Rapid screening of β-Globin gene mutations by Real-Time PCR in ...
African Journals Online (AJOL)
Introduction of the real time PCR has made a revolution in the time taken for the PCR reactions. We present a method for the diagnosis of the common mutations of the B-thalassemia in Egyptian children & families. The procedure depends on the real-time PCR using specific fluorescently labeled hybridization probes.
Amyloid-Beta Induced Changes in Vesicular Transport of BDNF in Hippocampal Neurons
Directory of Open Access Journals (Sweden)
Bianca Seifert
2016-01-01
Full Text Available The neurotrophin brain derived neurotrophic factor (BDNF is an important growth factor in the CNS. Deficits in transport of this secretory protein could underlie neurodegenerative diseases. Investigation of disease-related changes in BDNF transport might provide insights into the cellular mechanism underlying, for example, Alzheimer’s disease (AD. To analyze the role of BDNF transport in AD, live cell imaging of fluorescently labeled BDNF was performed in hippocampal neurons of different AD model systems. BDNF and APP colocalized with low incidence in vesicular structures. Anterograde as well as retrograde transport of BDNF vesicles was reduced and these effects were mediated by factors released from hippocampal neurons into the extracellular medium. Transport of BDNF was altered at a very early time point after onset of human APP expression or after acute amyloid-beta(1-42 treatment, while the activity-dependent release of BDNF remained unaffected. Taken together, extracellular cleavage products of APP induced rapid changes in anterograde and retrograde transport of BDNF-containing vesicles while release of BDNF was unaffected by transgenic expression of mutated APP. These early transport deficits might lead to permanently impaired brain functions in the adult brain.
Directory of Open Access Journals (Sweden)
Frank Griscelli
2017-08-01
Full Text Available Heterozygous activating mutation (p.Glu227Lys in KCNJ11 leads to maturity-onset diabetes of the young (MODY type 13, that is a subtype of dominant inherited young-onset non-autoimmune diabetes due to a primary defect in pancreatic beta cells. We generated induced pluripotent stem cells (iPSCs from a patient with KCNJ11p.Glu227Lys mutation who developed MODY at 13 years old. KCNJ11p.Glu227Lys-mutated cells that were reprogrammed by non-integrative viral transduction had normal karyotype, harboured the KCNJ11p.Glu227Lys mutation, expressed pluripotency hallmarks and had the differentiation capacity into the three germ layers.
Directory of Open Access Journals (Sweden)
Xingguo Zhu
Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.
Dominant control region of the human β- like globin gene cluster
Blom van Assendelft, Margaretha van
1989-01-01
The structure and regulation of the human β -like globin gene cluster has been studied extensively. Genetic disorders connected with this gene cluster are responsible for human diseases associated with high levels of morbidity and mortality, such as β-thalassaemia and sickle cell anaemia. The work
International Nuclear Information System (INIS)
Spiegel-Roy, P.; Vardi, Aliza
1990-01-01
Full text: Parthenocarpic tendency is an important prerequisite for successful induction of seedlessness in breeding and especially in mutation breeding. A gene for asynapsis and accompanying seedless fruit has been found by us in inbred progeny of cv. 'Wilking'. Using budwood irradiation by gamma rays, seedless mutants of 'Eureka' and 'Villafranca' lemon (original clone of the latter has 25 seeds) and 'Minneola' tangelo have been obtained. Ovule sterility of the three mutants is nearly complete, with some pollen fertility still remaining. A semi-compact mutant of Shamouti orange has been obtained by irradiation. A programme for inducing seedlessness in easy peeling citrus varieties and selections has been initiated. (author)
International Nuclear Information System (INIS)
Gupta, M.N.
1980-01-01
Research work on improvement of some ornamental plants by induced somatic mutations has been in progress at the National Botanical Research Institute, Lucknow, since 1964. The methods of treatments with gamma rays, detection, isolation and multiplication of induced somatic mutations have been given for Bougainvillea, Chrysanthemum, perennial Portulaca, rose and tuberose. During the last 15 years, a total of 38 new cultivars of different ornamentals evolved by gamna induced somatic mutations have been released. They include Bougainvillea 1; Chrysanthemum 28; perennial portulaca 6; rose 1 and tuberose 2. Descriptions of the original cultivars and their gamma induced mutants are given along with other pertinent details. (author)
LENUS (Irish Health Repository)
Morgan, Stuart A
2009-11-01
Glucocorticoid excess is characterized by increased adiposity, skeletal myopathy, and insulin resistance, but the precise molecular mechanisms are unknown. Within skeletal muscle, 11beta-hydroxysteroid dehydrogenase type 1 (11beta-HSD1) converts cortisone (11-dehydrocorticosterone in rodents) to active cortisol (corticosterone in rodents). We aimed to determine the mechanisms underpinning glucocorticoid-induced insulin resistance in skeletal muscle and indentify how 11beta-HSD1 inhibitors improve insulin sensitivity.
Saccharomyces cerevisiae mutants with enhanced induced mutation and altered mitotic gene conversion.
Ivanov, E L; Kovaltzova, S V; Korolev, V G
1989-08-01
We have developed a method to isolate yeast (Saccharomyces cerevisiae) mutants with enhanced induced mutagenesis based on nitrous acid-induced reversion of the ade2-42 allele. Six mutants have been isolated and designated him (high induced mutagenesis), and 4 of them were studied in more detail. The him mutants displayed enhanced reversion of the ade2-42 allele, either spontaneous or induced by nitrous acid, UV light, and the base analog 6-N-hydroxylaminopurine, but not by gamma-irradiation. It is worth noting that the him mutants turned out not to be sensitive to the lethal effects of the mutagens used. The enhancement in mutation induced by nitrous acid, UV light, and 6-N-hydroxylaminopurine has been confirmed in a forward-mutation assay (induction of mutations in the ADE1, ADE2 genes). The latter agent revealed the most apparent differences between the him mutants and the wild-type strain and was, therefore, chosen for the genetic analysis of mutants, him mutations analyzed behaved as a single Mendelian trait; complementation tests indicated 3 complementation groups (HIM1, HIM2, and HIM3), each containing 1 mutant allele. Uracil-DNA glycosylase activity was determined in crude cell extracts, and no significant differences between the wild-type and him strains were detected. Spontaneous mitotic gene conversion at the ADE2 locus is altered in him1 strains, either increased or decreased, depending on the particular heteroallelic combination. Genetic evidence strongly suggests him mutations to be involved in a process of mismatch correction of molecular heteroduplexes.
GuhaMajumdar, M; Baldwin, S; Sears, B B
2004-02-01
Oenothera plants homozygous for the recessive plastome mutator allele ( pm) show chloroplast DNA (cpDNA) mutation frequencies that are about 1,000-fold higher than spontaneous levels. The pm-encoded gene product has been hypothesized to have a function in cpDNA replication, repair and/or mutation avoidance. Previous chemical mutagenesis experiments with the alkylating agent nitroso-methyl urea (NMU) showed a synergistic effect of NMU on the induction of mutations in the pm line, suggesting an interaction between the pm-encoded gene product and one of the repair systems that corrects alkylation damage. The goal of the experiments described here was to examine whether the pm activity extends to the repair of damage caused by non-alkylating mutagens. To this end, the intercalating mutagen, 9-aminoacridine hydrochloride (9AA) was tested for synergism with the plastome mutator. A statistical analysis of the data reported here indicates that the pm-encoded gene product is not involved in the repair of the 9AA-induced mutations. However, the recovery of chlorotic sectors in plants derived from the mutagenized seeds shows that 9AA can act as a mutagen of the chloroplast genome.
Directory of Open Access Journals (Sweden)
Anongnad Ngamjariyawat
Full Text Available PURPOSE: Transplantation of pancreatic islets to Type 1 diabetes patients is hampered by inflammatory reactions at the transplantation site leading to dysfunction and death of insulin producing beta-cells. Recently we have shown that co-transplantation of neural crest stem cells (NCSCs together with the islet cells improves transplantation outcome. The aim of the present investigation was to describe in vitro interactions between NCSCs and insulin producing beta-TC6 cells that may mediate protection against cytokine-induced beta-cell death. PROCEDURES: Beta-TC6 and NCSC cells were cultured either alone or together, and either with or without cell culture inserts. The cultures were then exposed to the pro-inflammatory cytokines IL-1β and IFN-γ for 48 hours followed by analysis of cell death rates (flow cytometry, nitrite production (Griess reagent, protein localization (immunofluorescence and protein phosphorylation (flow cytometry. RESULTS: We observed that beta-TC6 cells co-cultured with NCSCs were protected against cytokine-induced cell death, but not when separated by cell culture inserts. This occurred in parallel with (i augmented production of nitrite from beta-TC6 cells, indicating that increased cell survival allows a sustained production of nitric oxide; (ii NCSC-derived laminin production; (iii decreased phospho-FAK staining in beta-TC6 cell focal adhesions, and (iv decreased beta-TC6 cell phosphorylation of ERK(T202/Y204, FAK(Y397 and FAK(Y576. Furthermore, co-culture also resulted in cadherin and beta-catenin accumulations at the NCSC/beta-TC6 cell junctions. Finally, the gap junction inhibitor carbenoxolone did not affect cytokine-induced beta-cell death during co-culture with NCSCs. CONCLUSION: In summary, direct contacts, but not soluble factors, promote improved beta-TC6 viability when co-cultured with NCSCs. We hypothesize that cadherin junctions between NCSC and beta-TC6 cells promote powerful signals that maintain beta
X-ray-induced mutations in Escherichia coli K-12 strains with altered DNA polymerase I activities
International Nuclear Information System (INIS)
Nagata, Yuki; Kawata, Masakado; Komura, Jun-ichiro; Ono, Tetsuya; Yamamoto, Kazuo
2003-01-01
Spectra of ionizing radiation mutagenesis were determined by sequencing X-ray-induced endogenous tonB gene mutations in Escherichia coli polA strains. We used two polA alleles, the polA1 mutation, defective for Klenow domain, and the polA107 mutation, defective for flap domain. We demonstrated that irradiation of 75 and 50 Gy X-rays could induce 3.8- and 2.6-fold more of tonB mutation in polA1 and polA107 strains, respectively, than spontaneous level. The radiation induced spectrum of 51 tonB mutations in polA1 and 51 in polA107 indicated that minus frameshift, A:T→T:A transversion and G:C→T:A transversion were the types of mutations increased. Previously, we have reported essentially the same X-ray-induced tonB mutation spectra in the wild-type strain. These results indicate that (1) X-rays can induce minus frameshift, A:T→T:A transversion and G:C→T:A transversion in E. coli and (2) presence or absence of polymerase I (PolI) of E. coli does not have any effects on the process of X-ray mutagenesis
Feeding the world with induced mutations and biotechnology
International Nuclear Information System (INIS)
Mohan Jain, S.
2002-01-01
The paper discussed the following subjects: biotechnology - somaclonal variation, somatic embryogenesis, somatic cell hybridization; induced mutations - in banana, ornamental plants; in vitro mutagenesis; T-DNA insertional mutagenesis. Suggestions for improving biotechnology in the developing countries also presented in the paper
Tõugu, Vello; Karafin, Ann; Zovo, Kairit; Chung, Roger S; Howells, Claire; West, Adrian K; Palumaa, Peep
2009-09-01
Aggregation of amyloid-beta (Abeta) peptides is a central phenomenon in Alzheimer's disease. Zn(II) and Cu(II) have profound effects on Abeta aggregation; however, their impact on amyloidogenesis is unclear. Here we show that Zn(II) and Cu(II) inhibit Abeta(42) fibrillization and initiate formation of non-fibrillar Abeta(42) aggregates, and that the inhibitory effect of Zn(II) (IC(50) = 1.8 micromol/L) is three times stronger than that of Cu(II). Medium and high-affinity metal chelators including metallothioneins prevented metal-induced Abeta(42) aggregation. Moreover, their addition to preformed aggregates initiated fast Abeta(42) fibrillization. Upon prolonged incubation the metal-induced aggregates also transformed spontaneously into fibrils, that appear to represent the most stable state of Abeta(42). H13A and H14A mutations in Abeta(42) reduced the inhibitory effect of metal ions, whereas an H6A mutation had no significant impact. We suggest that metal binding by H13 and H14 prevents the formation of a cross-beta core structure within region 10-23 of the amyloid fibril. Cu(II)-Abeta(42) aggregates were neurotoxic to neurons in vitro only in the presence of ascorbate, whereas monomers and Zn(II)-Abeta(42) aggregates were non-toxic. Disturbed metal homeostasis in the vicinity of zinc-enriched neurons might pre-dispose formation of metal-induced Abeta aggregates, subsequent fibrillization of which can lead to amyloid formation. The molecular background underlying metal-chelating therapies for Alzheimer's disease is discussed in this light.
Induced mutations and marker assisted breeding in soybean
Energy Technology Data Exchange (ETDEWEB)
Chotechuen, Somsong [Prachinburi Rice Research Center, Prachinburi (Thailand); Srisombun, Somsak [Department of Agriculture, Field Crops Research Institute, Bangkok (Thailand); Lamseejan, Siranut [Kasetsart Univ., Department of Applied Radiation and Isotopes, Bangkok (Thailand)
2002-02-01
Soybean is one of the important crops in Thailand. Constraints to soybean production include low yield potential, susceptibility to diseases and insects, and non-adoption of appropriate management practices. Mutation induction has been used to improve soybean yield and resistance to major diseases such as rust, purple seed, crinkle leaf, anthracnose and green seed. This paper reviews previous work and achievements of induced mutations in soybean. Successful examples are the release of a soybean variety, Doi Kham, and the development of a mutant CM 60-10kr-71; both are resistant to rust disease. The paper also gives example of the use of soybean SSR markers to identify QTL associated with pod shattering, and emphasizes the integration of mutation techniques and marker assisted selection for soybean improvement. (author)
Utilization of induced mutations in improving legumes in Egypt
International Nuclear Information System (INIS)
Abo-Hegazi, A. M. T.
1993-01-01
More than one hundred articles published by Egyptian research workers dealing with the improvement of some seed-legumes through radiation, radioisotopes, chemical mutagens and induced mutations are briefly summarized and discussed from the point of view of a mutation breeder working in this field since 1961. Articles on faba bean (Vicia faba L.), soybean (Glycine Max L.), lentils (Lens culinaris), chick-pea (Cicer arietinum L.), lupin (Lupinus termis), peas=pea (Pisum sativum L.), cowpea (Vigna sinensis, savi), and fenugreek-helba (Trigonella foenum gracum L.) are reviewed. A very few number of promising mutations have been induced. However, none of them are utilized neither in conventional breeding programs nor as cultivars. This may be due to the lack of central plans and organization between efforts or research work being carried in various institutions. Joint plants and cooperation between research institutions, not only in Egypt but also among the Arab countries, are required in this field which may help in closing the wide gab between production and consumption os seed legumes. (author)
Hwang, Jae-Ho; Parton, Angela; Czechanski, Anne; Ballatori, Nazzareno; Barnes, David
2008-01-01
The organic solute and steroid transporter (OST/Ost) is a unique membrane transport protein heterodimer composed of subunits designated alpha and beta, that transports conjugated steroids and prostaglandin E2 across the plasma membrane. Ost was first identified in the liver of the cartilaginous fish Leucoraja erinacea, the little skate, and subsequently was found in many other species, including humans and rodents. The present study describes the isolation of a new cell line, LEE-1, derived from an early embryo of L. erinacea, and characterizes the expression of Ost in these cells. The mRNA size and amino acid sequence of Ost-beta in LEE-1 was identical to that previously reported for Ost-beta from skate liver, and the primary structure was identical to that of the spiny dogfish shark (Squalus acanthias) with the exception of a single amino acid. Ost-beta was found both on the plasma membrane and intracellularly in LEE-1 cells, consistent with its localization in other cell types. Interestingly, arachidonic acid, the precursor to eiconsanoids, strongly induced Ost-beta expression in LEE-1 cells and a lipid mixture containing arachidonic acid also induced Ost-alpha. Overall, the present study describes the isolation of a novel marine cell line, and shows that this cell line expresses relatively high levels of Ost when cultured in the presence of arachidonic acid. Although the function of this transport protein in embryo-derived cells is unknown, it may play a role in the disposition of eicosanoids or steroid-derived molecules. PMID:18407792
The ontogeny of seizures induced by leucine-enkephalin and beta-endorphin.
Snead, O C; Stephens, H
1984-06-01
Rats ranging in postnatal age from 6 hours to 28 days were implanted with cortical and depth electrodes as well as an indwelling cannula in the lateral ventricle. We then administered varying amounts of the opiate peptides leucine-enkephalin and beta-endorphin intracerebroventricularly with continuous electroencephalographic monitoring. Leucine-enkephalin produced electrical seizure activity in rats as young as 2 days. beta-Endorphin administration was associated with seizures at the fifth postnatal day, with a high incidence of apnea resulting in death in animals as young as 6 hours. An adult seizure response to beta-endorphin and leucine-enkephalin was seen at 15 and 28 days of age, respectively. Naloxone blocked the seizure produced by these opiate peptides in all age groups. The data indicate that the opiate peptides are potent epileptogenic compounds in developing brain, that seizures induced by leucine-enkephalin differ from those caused by beta-endorphin, and that petit mal-like seizure activity can be an adult response in the rodent.
Panyasai, Sitthichai; Jaiping, Kanokwan; Pornprasert, Sakorn
2015-01-01
We report the molecular and hematological feature of a Thai woman who had clinical diagnosis of β-thalassemia intermedia (β-TI). Hemoglobin (Hb) high performance liquid chromatography (HPLC) analysis identified Hb A (64.4%), Hb F (12.3%) and Hb A2/E (15.9%) with small peaks of Hb Bart's (γ4) and Hb H (β4). She was initially diagnosed as EA Bart's disease, which occurs from combination of Hb H disease and Hb E (HBB: c.79G > A) trait. However, the Hb analysis using capillary electrophoresis (CE) demonstrated no Hb E, 68.5% Hb A, 15.5% Hb F and 16.0% Hb A2. DNA analysis showed a compound heterozygosity for (β(+)) -31 (A > G) (HBB: c.-81A > G) and (β(0)) codon 17 (A > T) (HBB: c.52A > T) mutations and deletional Hb H (- -(SEA)/-α(3.7)). Thus, she was finally diagnosed with a combination of Hb H disease and compound heterozygosity of β(+)/β(0)-thalassemia (β(+)/β(0)-thal). The β-globin mutations could affect not only hematological parameters but also elevate the Hb A2 levels. These effects could not be ameliorated by the coinheritance of Hb H disease. Therefore, a better understanding of the effects of this combination on hematological analysis data will be useful for providing accurate diagnosis, genetic counseling, prevention and control programs of β-thalassemia major (β-TM).
Substrate-induced inactivation of the OXA2 beta-lactamase.
Ledent, P; Frère, J M
1993-01-01
The hydrolysis time courses of 22 beta-lactam antibiotics by the class D OXA2 beta-lactamase were studied. Among these, only three appeared to correspond to the integrated Henri-Michaelis equation. 'Burst' kinetics, implying branched pathways, were observed with most penicillins, cephalosporins and with flomoxef and imipenem. Kinetic parameters characteristic of the different phases of the hydrolysis were determined for some substrates. Mechanisms generally accepted to explain such reversible partial inactivations involving branches at either the free enzyme or the acyl-enzyme were inadequate to explain the enzyme behaviour. The hydrolysis of imipenem was characterized by the occurrence of two 'bursts', and that of nitrocefin by a partial substrate-induced inactivation complicated by a competitive inhibition by the hydrolysis product. PMID:8240304
Male-fertility-restorer mutation induced by x-rays in wheat
International Nuclear Information System (INIS)
Sasaki, Mutsuo; Nakata, Noboru; Yasumuro, Yoshimasa
1982-01-01
Some male-fertility restoring mutants were obtained by X-irradiation (20 or 25 kR, 105.3 R/min) of the air-dried seed of cytoplasmic male-sterile (cms) wheat, (timopheevi)-Bison. These X-ray induced male-fertility restoring mutant (Rfx) lines restored the male fertility of F 1 hybrids with cms (timopheevi)-Bison as female, but their fertility-restoring ability was not superior to that of known restorers such as Gironde, Primepi, and (t)-H30. The Rfx lines were also different from the original (timopheevi)-Bison, in many characters. The study on these multicharacter mutations with 18 morphological and physiological characters of the 7 M 6 line groups derived from the 7M 2 plants, revealed that each M 2 progenitor plant of each M 6 line-group had the mutant genes for almost all these characters, and that the mutation for at least half of all these mutant genes was induced in the original cell of the gamates of each X-irradiated M 1 plant. Considering the multicharacter mutations of the Rfx lines, a backcross method for the mutation breeding of male-fertility restorers in wheat was proposed. (Kaihara, S.)
International Nuclear Information System (INIS)
Fedorova, I.V.; Koval'tsova, S.V.; Ivanov, E.L.
1993-01-01
The authors have studied the effect of five nonallelic hms1-hms5 mutations on the incidence of direct mutations in loci ADE1 and ADE2, induced by UV-radiation, 6-hydroxyl-aminopurine, and nitrosomethylurea. All hms mutants were found to be insensitive to the lethal action of these mutagens. The frequency of UV-induced mutations to adenine dependence was increased in mutants hsm2-1, hsm3-1, hsm5-1, and particularly in hsm1-1, but remained unchanged in hsm4-1 compared to HSM. Mutagenesis induced by 6-hydroxylaminopurine was increased in all mutants studied, particularly in mutant hsm3-1. The authors did not detect any appreciable effect of hsm mutations on mutagenesis induced by nitrosomethylurea. The frequency of spontaneous mitotic conversion to prototrophy was studied in diploids heteroallelic to gene ADE2 and homo- and heterozygous for hsm mutations. Mutation hsm5-1 considerably increased the frequency of conversion for all heteroalleles studied, mutations hsm1-1 and hsm3-1 also considerably increased the conversion frequency, while mutations hsm1-1 and hsm4-1 had little effect on this process. The study of the properties of hsm mutations revealed joint genetic control of spontaneous and induced mutagenesis and recombination in yeast. The possibility that hsm mutations belong to the class of mutations impairing correction of unpaired DNA bases is discussed. 25 refs., 3 figs., 3 tabs
Complement activation by the amyloid proteins A beta peptide and beta 2-microglobulin
DEFF Research Database (Denmark)
Nybo, Mads; Nielsen, E H; Svehag, S E
1999-01-01
component nor heparan sulfate did significantly alter the A beta-induced CA. The results indicate that not only fibrillar A beta but also oligomers of, in particular, beta 2M from patients with dialysis-associated amyloidosis are capable of inducing CA at supra-physiological concentrations....
Measurement of Radon-Induced Backgrounds in the NEXT Double Beta Decay Experiment
Energy Technology Data Exchange (ETDEWEB)
Novella, P.; et al.
2018-04-02
The measurement of the internal 222Rn activity in the NEXT-White detector during the so-called Run-II period with 136Xe-depleted xenon is discussed in detail, together with its implications for double beta decay searches in NEXT. The activity is measured through the alpha production rate induced in the fiducial volume by 222Rn and its alpha-emitting progeny. The specific activity is measured to be $(37.5\\pm 2.3~\\mathrm{(stat.)}\\pm 5.9~\\mathrm{(syst.)})$~mBq/m$^3$. Radon-induced electrons have also been characterized from the decay of the 214Bi daughter ions plating out on the cathode of the time projection chamber. From our studies, we conclude that radon-induced backgrounds are sufficiently low to enable a successful NEXT-100 physics program, as the projected rate contribution should not exceed 0.2~counts/yr in the neutrinoless double beta decay sample.
Directory of Open Access Journals (Sweden)
Pawan Kaler
2010-07-01
Full Text Available We recently reported that colon tumor cells stimulate macrophages to release IL-1beta, which in turn inactivates GSK3beta and enhances Wnt signaling in colon cancer cells, generating a self-amplifying loop that promotes the growth of tumor cells.Here we describe that macrophages protect HCT116 and Hke-3 colon cancer cells from TRAIL-induced apoptosis. Inactivation of IL-1beta by neutralizing IL-1beta antibody, or silencing of IL-1beta in macrophages inhibited their ability to counter TRAIL-induced apoptosis. Accordingly, IL-1beta was sufficient to inhibit TRAIL-induced apoptosis. TRAIL-induced collapse of the mitochondrial membrane potential (Delta psi and activation of caspases were prevented by macrophages or by recombinant IL-1beta. Pharmacological inhibition of IL-1beta release from macrophages by vitamin D(3, a potent chemopreventive agent for colorectal cancer, restored the ability of TRAIL to induce apoptosis of tumor cells cultured with macrophages. Macrophages and IL-1beta failed to inhibit TRAIL-induced apoptosis in HCT116 cells expressing dnIkappaB, dnAKT or dnTCF4, confirming that they oppose TRAIL-induced cell death through induction of Wnt signaling in tumor cells. We showed that macrophages and IL-1beta stabilized Snail in tumor cells in an NF-kappaB/Wnt dependent manner and that Snail deficient tumor cells were not protected from TRAIL-induced apoptosis by macrophages or by IL-1beta, demonstrating a crucial role of Snail in the resistance of tumor cells to TRAIL.We have identified a positive feedback loop between tumor cells and macrophages that propagates the growth and promotes the survival of colon cancer cells: tumor cells stimulate macrophages to secrete IL-1beta, which in turn, promotes Wnt signaling and stabilizes Snail in tumor cells, conferring resistance to TRAIL. Vitamin D(3 halts this amplifying loop by interfering with the release of IL-1beta from macrophages. Accordingly, vitamin D(3 sensitizes tumor cells to TRAIL-induced
Achievements and trends of using induced mutations in crop improvement
International Nuclear Information System (INIS)
Nichterlein, K.; Maluszynski, M.; ); Bohlmann, H.; Nielen, S.; )
2000-01-01
Mutation techniques have been employed for the genetic improvement of crops and ornamentals leading to the official release of more than 2200 improved varieties. Some of them have made a major impact on crop productivity and achieved great economic success. Induced mutations play an important role in plant genome research to understand the function of genes aiming to improve food security and diversity. (author)
Beta-glucan ameliorates gamma-rays induced oxidative injury in male Swiss albino rats
International Nuclear Information System (INIS)
Salama, S.F.
2011-01-01
1,3-beta-D-Glucan is a natural polysaccharide derived from the cell walls of bakers yeast Saccharomyces cerevsiae with immunoenhancing and potent antioxidant effects. This study investigated the pathways through which beta-glucan gavage treatment (50mg/kg) exerts its effect on radiation-induced oxidative damage in male rats. Beta-glucan was given orally to male rats; 3 hours post gamma-irradiation at dose 5Gy, for 10 and 20 days post-irradiation level were assayed, being remarkable indicators in cell oxidative stress. Results pointed out that irradiation at 5Gy significantly depressed all blood parameters, such as erythrocytes count (RBCs), hemoglobin content (Hb), hematocrit value (Hct), total leucocytes count and absolute lymphocytes and neutrophils counts, blood glutathione (GSH) level and conversely elevated level of serum ascorbyl radical (AsR), product of lipid peroxidation (MDA melanodialdehyde), triglycerides and cholesterol. Total leucocytes count and absolute lymphocytes and neutrophils counts, RBCs, Hb, Hct, blood GSH and serum MDA of irradiated animals receiving beta-glucan administration were exhibited significant differences compared to the irradiated group. Marrow count and the percentage of viability and spleenocytes viability were also significantly decreased. Beta-glucan treatment accelerates recovery of cell damage induced by ionizing irradiation through its potential immune-enhancing activity and free radical scavenging ability that is partially mediated through stimulation of immunohaematological system thus could play a role in regulating irradiation complications
Lin, Jianfei; Chen, He; Luo, Ling; Lai, Yongrong; Xie, Wei; Kee, Kehkooi
2015-01-01
To correct a DNA mutation in the human genome for gene therapy, homology-directed repair (HDR) needs to be specific and have the lowest off-target effects to protect the human genome from deleterious mutations. Zinc finger nucleases, transcription activator-like effector nuclease (TALEN) and CRISPR-CAS9 systems have been engineered and used extensively to recognize and modify specific DNA sequences. Although TALEN and CRISPR/CAS9 could induce high levels of HDR in human cells, their genotoxicity was significantly higher. Here, we report the creation of a monomeric endonuclease that can recognize at least 33 bp by fusing the DNA-recognizing domain of TALEN (TALE) to a re-engineered homing endonuclease I-SceI. After sequentially re-engineering I-SceI to recognize 18 bp of the human β-globin sequence, the re-engineered I-SceI induced HDR in human cells. When the re-engineered I-SceI was fused to TALE (TALE-ISVB2), the chimeric endonuclease induced the same HDR rate at the human β-globin gene locus as that induced by TALEN, but significantly reduced genotoxicity. We further demonstrated that TALE-ISVB2 specifically targeted at the β-globin sequence in human hematopoietic stem cells. Therefore, this monomeric endonuclease has the potential to be used in therapeutic gene targeting in human cells. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Role of IL-1 beta and COX2 in silica-induced IL-6 release and loss of pneumocytes in co-cultures.
Herseth, Jan I; Refsnes, Magne; Låg, Marit; Schwarze, Per E
2009-10-01
The pro-inflammatory cytokines IL-1 beta, TNF-alpha and IL-6 are of great importance in the development of silica-induced lung damage and repair. In this study we investigated the role of IL-1 beta, TNF-alpha and COX2 in silica-induced regulation of IL-6 release and pneumocyte loss in various mono- and co-cultures of monocytes, pneumocytes and endothelial cells. All co-cultures with monocytes, and especially cultures including endothelial cells, showed an increase of silica-induced release of IL-6 compared to the respective monocultures. Treatment with the antagonist IL-1 ra strongly decreased IL-1 beta and IL-6 release in contact co-cultures of monocytes and pneumocytes. COX2 up-regulation by silica and IL-1 beta was eliminated by IL-1 ra. Inhibition of COX2 markedly reduced both IL-1 beta and IL-6 release. IL-1 ra was more effective than COX2-inhibition in reduction of IL-6, but not of IL-1 beta. Silica-induced pneumocyte loss was reduced by IL-1 beta, but this effect was not counteracted by the IL-1 receptor antagonist. Our findings suggest that silica-induced IL-6 release from pneumocytes is mainly mediated via IL-1 beta release from the monocytes, via both COX2-dependent and -independent pathways. Notably, COX2-derived mediators seem crucial for a positive feed-back regulation of IL-1 beta release from the monocytes. In contrast to silica-induced IL-6, the reduction in pneumocyte loss by IL-1 beta does not seem to be regulated through an IL-1R1-dependent mechanism.
Effects of beta-blockers and nicardipine on oxotremorine-induced tremor in common marmosets.
Mitsuda, M; Nomoto, M; Iwata, S
1999-10-01
Effects of beta-blockers (propranolol, arotinolol and nipradilol) and a Ca2+ channel blocker (nicardipine) on oxotremorine-induced tremor were studied in common marmosets. Generalized tremor was elicited by an intraperitoneal administration of 0.25 mg/kg oxotremorine. Intensity of the tremor was classified into 7 degrees, and it was evaluated every 10 min. The total intensity of oxotremorine-induced tremor for each drug was expressed as "points", which were the sum of tremor intensity scores evaluated every 10 min up to 190 min following the administration of oxotremorine. Beta-blockers significantly suppressed the tremor. On the other hand, the Ca2+ channel blocker exacerbated the tremor.
Clinical and hematological response to hydroxyurea in a patient with Hb Lepore/beta-thalassemia.
Rigano, P; Manfré, L; La Galla, R; Renda, D; Renda, M C; Calabrese, A; Calzolari, R; Maggio, A
1997-05-01
The possibility of increasing Hb F in vivo using drugs like 5-azacytidine, hydroxyurea, and butyrate has been established. However, in many cases this does not entail an increase in total hemoglobin. We report on a patient with Hb Lepore/beta-thalassemia being treated with hydroxyurea (30 mg/Kg/day) because of the presence of erythroid extramedullary masses with severe neurological abnormalities. During therapy the patient showed a remarkable improvement in neurological signs due to the reduction in extra-medullary masses, a significant increase in both total hemoglobin (from 5.8 to 9.7 g/dl) and Hb F (from 4.9 g/dl to 9.1 g/dl). The marked improvement in hemoglobin level in our patient with Hb Lepore/beta-thalassemia suggests gamma-globin gene activation due to the DNA structure determined by the crossover event.
DEFF Research Database (Denmark)
Jacobsen, M L B; Rønn, S G; Bruun, C
2008-01-01
AIMS/HYPOTHESIS: Chemokines recruit activated immune cells to sites of inflammation and are important mediators of insulitis. Activation of the pro-apoptotic receptor Fas leads to apoptosis-mediated death of the Fas-expressing cell. The pro-inflammatory cytokines IL-1beta and IFN-gamma regulate...... the transcription of genes encoding the Fas receptor and several chemokines. We have previously shown that suppressor of cytokine signalling (SOCS)-3 inhibits IL-1beta- and IFN-gamma-induced nitric oxide production in a beta cell line. The aim of this study was to investigate whether SOCS-3 can influence cytokine......-induced Fas and chemokine expression in beta cells. METHODS: Using a beta cell line with inducible Socs3 expression or primary neonatal rat islet cells transduced with a Socs3-encoding adenovirus, we employed real-time RT-PCR analysis to investigate whether SOCS-3 affects cytokine-induced chemokine and Fas m...
Genetic improvement of black gram using induced mutations
International Nuclear Information System (INIS)
Pawar, S.E.; Manjaya, J.G.; Souframanien, J.; Bhatkar, S.M.
2000-01-01
Induced mutagenesis is an important tool for creating genetic variability in crop plants and has played a significant role in the development of many crop varieties. Genetic improvement of black gram (Vigna mungo L. Hepper) through induced mutations has been in progress at BARC for the past three decades. Mutation studies of genotype EC-168200 have resulted in isolating large number of mutants with distinct morphological characters. TAU-5, an early maturing mutant was identified as a resistant donor for yellow mosaic virus (YMV) disease by the All India Pulse Improvement Project, ICAR, Kanpur. TAU-5 was used in cross breeding with elite cultivars like T-9, TPU-4 and LBG-17. Twelve selections with high yield potential suitable for both kharif and rabi cultivation have been developed. One of the selections TU94-2 has been released for commercial cultivation for southern zone during 1999. The work on the development of YMV resistant genotypes is in progress and will be discussed. (author)
Boltz, Kathryn W; Frasch, Wayne D
2006-09-19
F(1)-ATPase mutations in Escherichia coli that changed the strength of hydrogen bonds between the alpha and beta subunits in a location that links the catalytic site to the interface between the beta catch loop and the gamma subunit were examined. Loss of the ability to form the hydrogen bonds involving alphaS337, betaD301, and alphaD335 lowered the k(cat) of ATPase and decreased its susceptibility to Mg(2+)-ADP-AlF(n) inhibition, while mutations that maintain or strengthen these bonds increased the susceptibility to Mg(2+)-ADP-AlF(n) inhibition and lowered the k(cat) of ATPase. These data suggest that hydrogen bonds connecting alphaS337 to betaD301 and betaR323 and connecting alphaD335 to alphaS337 are important to transition state stabilization and catalytic function that may result from the proper alignment of catalytic site residues betaR182 and alphaR376 through the VISIT sequence (alpha344-348). Mutations betaD301E, betaR323K, and alphaR282Q changed the rate-limiting step of the reaction as determined by an isokinetic plot. Hydrophobic mutations of betaR323 decreased the susceptibility to Mg(2+)-ADP-AlF(n)() inhibition and lowered the number of interactions required in the rate-limiting step yet did not affect the k(cat) of ATPase, suggesting that betaR323 is important to transition state formation. The decreased rate of ATP synthase-dependent growth and decreased level of lactate-dependent quenching observed with alphaD335, betaD301, and alphaE283 mutations suggest that these residues may be important to the formation of an alternative set of hydrogen bonds at the interface of the alpha and beta subunits that permits the release of intersubunit bonds upon the binding of ATP, allowing gamma rotation in the escapement mechanism.
Research highlights on: the use of induced mutations for plant improvement in Malaysia
International Nuclear Information System (INIS)
1998-01-01
Nuclear techniques play an increasingly valuable role in agricultural research and development. The collaborative work of IAEA and FAO has been instrumental to the progress. The nuclear techniques are now used in a wide range of applications including crop improvement. In the initial years, many plant breeders had difficulty in believing that induced mutations through radiation had any relevance to their conventional procedures. But attitudes have greatly changed, in great part due to the Joint Division's programmes. The result was a high number of improved new varieties bred to date with the help of induced mutations, including some in this country. This publication is intended primarily to gather and put in order all information on the research and work on the use of induced mutations for plant breeding in the country. Its main purpose is to see if ensuing research efforts could be better coordinated, focused and enhanced in order to supplement the plant improvement programmes in the country. The task of collating the relevant information was not without difficulty since many of the work had been carried out long time ago; their objectives generally were quite broad; and the results essentially not published, with some exceptions. Section I begins with thefntroduction, giving a brief account of the developments of induced mutations in Malaysia, the facilities available in various institutions and the role played by the National Committee on the Use of Mutations in Plant Breeding. The collaborative efforts of IAEA and IFNCC are also briefly described here, together with all the activates which they had supported in the past. Section 11 briefly describes the induced mutations and how they are produced and utilised in the plant improvement programmes, taking into consideration the safety precautions required, and the requirements of different crop species. Section III describes in greater details all the research that had been carried out in the country. The
BENIGN EPITHELIAL NEOPLASIA ASSOCIATED WITH BETA-HUMAN PAPILLOMA VIRUS
Directory of Open Access Journals (Sweden)
V. A. Molochkov
2014-01-01
Full Text Available Aim: To study an association between acrochordon and human papilloma virus (HPV using quantitative analysis of viral desoxyribonucleic acid (DNA; to detect different phenotypes of beta-HPV. Materials and methods: We examined 52 patients (22 immuno-suppressed patients and 30 immunocompetent subjects in the Dermatovenereology and Dermato-Oncology Department and Chronic Dialysis and Kidney Transplantation Department of the Moscow Regional Research and Clinical Institute (MONIKI. Control group included 49 healthy donors. Burr biopsy samples (micro-samples of acrochordon and intact skin (apper arm were collected in sterile conditions. After sample procession and DNA isolation using DNK-sorb-C kit (Central Research Institute for Epidemiology – CRIE, polymerase chain reaction for HPV was performed with real-time fluorescent hybridization detection. For DNA amplification and detection we used RotorGene 3000 analyzer (Corbett Research, Australia. In the beta-HPV assay, recombinant plasmids were used as positive controls and control human beta-globin gene fragments (CRIE. 4 oligo-nucleotide systems (group-specific primers and probes were used for the detection of beta-HPV DNA. Results: Preliminary data indicated that acrochordons of open and covered skin regions were common in renal transplant recipients. Beta-HPV DNA was more frequent in acrochordons and intact skin (64% and 54% of renal transplant recipients compared to healthy donors (47%. 57% of renal transplant recipients demonstrated mixed infection in acrochordons. Conclusion: HPV DNA was frequently detected in acrochordons and intact skin of renal transplant recipients. In immunocompetent patients prevalence of HPV DNA in acrochordons was significantly higher compared to intact skin.
Radiation induced mutations in Phaseolus vulgaris L
International Nuclear Information System (INIS)
Al-Rubeai, M.A.F.
1982-01-01
A selection of various macro- and micro-mutations was undertaken in the M2 generation of Phaseolus vulgaris cultivars after seed exposure to acute gamma radiation doses of 2.5, 5, 7, 10 and 15 Kr. The chlorophyll mutation was positively correlated with dose. Nevertheless, the highest frequency was at 7 Kr. Several interesting morphological mutants were observed. There were dwarf, stiff stem, shiny small leaf, narrow leaf and green giant mutants. Two selected micromutants were superior in seed yield capacity to their parents. The high yields were related to the high number of pods per plant. In 'The Prince' (seed color: red with beige marbling) several mutants with seeds of black color marbled with beige were selected. These seeds gave M3 segregants exhibiting a range of seed colors including white. Many of these M3 plants were short, early flowering and highly sterile. The work demonstrated that the pigmentation character can readily be changed, and confirmed that the variability induced by radiation can be exploited to obtain desirable mutations. (Author) [pt
International Nuclear Information System (INIS)
Li, Xiaoou; Liu, Lian; Shen, Yongchun; Wang, Tao; Chen, Lei; Xu, Dan; Wen, Fuqiang
2014-01-01
Highlights: • Endogenous miR-26a inhibits TGF-beta 1 induced proliferation of lung fibroblasts. • miR-26a induces G1 arrest through directly targeting 3′-UTR of CCND2. • TGF indispensable receptor, TGF-beta R I, is regulated by miR-26a. • miR-26a acts through inhibiting TGF-beta 2 feedback loop to reduce TGF-beta 1. • Collagen type I and connective tissue growth factor are suppressed by miR-26a. - Abstract: MicroRNA-26a is a newly discovered microRNA that has a strong anti-tumorigenic capacity and is capable of suppressing cell proliferation and activating tumor-specific apoptosis. However, whether miR-26a can inhibit the over-growth of lung fibroblasts remains unclear. The relationship between miR-26a and lung fibrosis was explored in the current study. We first investigated the effect of miR-26a on the proliferative activity of human lung fibroblasts with or without TGF-beta1 treatment. We found that the inhibition of endogenous miR-26a promoted proliferation and restoration of mature miR-26a inhibited the proliferation of human lung fibroblasts. We also examined that miR-26a can block the G1/S phase transition via directly targeting 3′-UTR of CCND2, degrading mRNA and decreasing protein expression of Cyclin D2. Furthermore, we showed that miR-26a mediated a TGF-beta 2-TGF-beta 1 feedback loop and inhibited TGF-beta R I activation. In addition, the overexpression of miR-26a also significantly suppressed the TGF-beta 1-interacting-CTGF–collagen fibrotic pathway. In summary, our studies indicated an essential role of miR-26a in the anti-fibrotic mechanism in TGF-beta1-induced proliferation in human lung fibroblasts, by directly targeting Cyclin D2, regulating TGF-beta R I as well as TGF-beta 2, and suggested the therapeutic potential of miR-26a in ameliorating lung fibrosis
Energy Technology Data Exchange (ETDEWEB)
Li, Xiaoou [Division of Pulmonary Diseases, State Key Laboratory of Biotherapy of China, West China Hospital, West China School of Medicine, Sichuan University, Chengdu, Sichuan (China); Department of Respiratory Medicine, West China Hospital, West China School of Medicine, Sichuan University, Chengdu, Sichuan (China); Liu, Lian [Division of Pulmonary Diseases, State Key Laboratory of Biotherapy of China, West China Hospital, West China School of Medicine, Sichuan University, Chengdu, Sichuan (China); Shen, Yongchun; Wang, Tao; Chen, Lei; Xu, Dan [Division of Pulmonary Diseases, State Key Laboratory of Biotherapy of China, West China Hospital, West China School of Medicine, Sichuan University, Chengdu, Sichuan (China); Department of Respiratory Medicine, West China Hospital, West China School of Medicine, Sichuan University, Chengdu, Sichuan (China); Wen, Fuqiang, E-mail: wenfuqiang.scu@gmail.com [Division of Pulmonary Diseases, State Key Laboratory of Biotherapy of China, West China Hospital, West China School of Medicine, Sichuan University, Chengdu, Sichuan (China); Department of Respiratory Medicine, West China Hospital, West China School of Medicine, Sichuan University, Chengdu, Sichuan (China)
2014-11-28
Highlights: • Endogenous miR-26a inhibits TGF-beta 1 induced proliferation of lung fibroblasts. • miR-26a induces G1 arrest through directly targeting 3′-UTR of CCND2. • TGF indispensable receptor, TGF-beta R I, is regulated by miR-26a. • miR-26a acts through inhibiting TGF-beta 2 feedback loop to reduce TGF-beta 1. • Collagen type I and connective tissue growth factor are suppressed by miR-26a. - Abstract: MicroRNA-26a is a newly discovered microRNA that has a strong anti-tumorigenic capacity and is capable of suppressing cell proliferation and activating tumor-specific apoptosis. However, whether miR-26a can inhibit the over-growth of lung fibroblasts remains unclear. The relationship between miR-26a and lung fibrosis was explored in the current study. We first investigated the effect of miR-26a on the proliferative activity of human lung fibroblasts with or without TGF-beta1 treatment. We found that the inhibition of endogenous miR-26a promoted proliferation and restoration of mature miR-26a inhibited the proliferation of human lung fibroblasts. We also examined that miR-26a can block the G1/S phase transition via directly targeting 3′-UTR of CCND2, degrading mRNA and decreasing protein expression of Cyclin D2. Furthermore, we showed that miR-26a mediated a TGF-beta 2-TGF-beta 1 feedback loop and inhibited TGF-beta R I activation. In addition, the overexpression of miR-26a also significantly suppressed the TGF-beta 1-interacting-CTGF–collagen fibrotic pathway. In summary, our studies indicated an essential role of miR-26a in the anti-fibrotic mechanism in TGF-beta1-induced proliferation in human lung fibroblasts, by directly targeting Cyclin D2, regulating TGF-beta R I as well as TGF-beta 2, and suggested the therapeutic potential of miR-26a in ameliorating lung fibrosis.
Deletion of the Men1 Gene Prevents Streptozotocin-Induced Hyperglycemia in Mice
Directory of Open Access Journals (Sweden)
Yuqing Yang
2010-01-01
Full Text Available Diabetes ultimately results from an inadequate number of functional beta cells in the islets of Langerhans. Enhancing proliferation of functional endogenous beta cells to treat diabetes remains underexplored. Here, we report that excision of the Men1 gene, whose loss-of-function mutation leads to inherited multiple endocrine neoplasia type 1 (MEN1, rendered resistant to streptozotocin-induced hyperglycemia in a tamoxifen-inducible and temporally controlled Men1 excision mouse model as well as in a tissue-specific Men1 excision mouse model. Men1 excision prevented mice from streptozotocin-induced hyperglycemia mainly through increasing the number of functional beta cells. BrdU incorporation by beta cells, islet size, and circulating insulin levels were significantly increased in Men1-excised mice. Membrane localization of glucose transporter 2 was largely preserved in Men1-excised beta cells, but not in Men1-expressing beta cells. Our findings suggest that repression of menin, a protein encoded by the Men1 gene, might be a valuable means to maintain or increase the number of functional endogenous beta cells to prevent or ameliorate diabetes.
Cytosine arabinoside enhancement of gamma irradiation induced mutations in human T-lymphocytes
International Nuclear Information System (INIS)
O'Neill, J.P.; Sullivan, L.M.; Hunter, T.C.; Nicklas, J.A.
1991-01-01
The frequency of 6-thioguanine resistant (TGr) mutants induced in human G0 phase T-lymphocytes by 200 cGy of gamma irradiation is greatly enhanced by incubation with cytosine arabinoside (ara-C) after irradiation. The mutant frequency increased with increasing incubation time in ara-C for up to 2 hr. This mutation induction required a phenotypic expression time of 5-8 days mass culture growth, similar to that found with mutants induced by 300 cGy of irradiation alone. Southern blot analysis of 40 isolated mutant clones revealed 8 independent mutations by T-cell receptor (TCR) gene rearrangement patterns. Four of these eight showed hprt gene structural alterations (0.50). An alternative method to allow phenotypic expression was developed to minimize the isolation of hprt/TCR sibling mutants. The use of in situ expression in the microtiter dish wells resulted in the isolation of 17 independent mutations in 19 mutant clones. Ten of these 17 mutations showed hprt structural alterations (0.59). The high fraction of mutations involving structural alterations detected by Southern blot analysis is consistent with the known induction of chromosome aberrations by irradiation plus ara-C treatment. We propose that both the increase in Mf and the increase in the incidence of hprt gene structural alterations are due to the accumulation of strand breaks in repairing regions of DNA under these conditions of ara-C induced inhibition of repair. We further propose that upon release of the ara-C inhibition, these repairing regions can interact to yield both gene mutations and chromosome aberrations
Cellular repair and its importance for UV-induced mutations
Energy Technology Data Exchange (ETDEWEB)
Slamenova, D [Slovenska Akademia Vied, Bratislava (Czechoslovakia). Vyskumny Ustav Onkologicky
1975-01-01
Current knowledge is briefly surveyed of the mechanism of the biological repair of injuries induced in DNA cells by the action of various factors, mainly ultraviolet radiation. Genetic loci determining the sensitivity of cells to UV radiation are defined and principal reparation processes are explained; excision repair is described more fully. The role of biological repair is discussed in view of UV-induced mutations in DNA cells.
Ponder, Rebecca G; Fonville, Natalie C; Rosenberg, Susan M
2005-09-16
Special mechanisms of mutation are induced in microbes under growth-limiting stress causing genetic instability, including occasional adaptive mutations that may speed evolution. Both the mutation mechanisms and their control by stress have remained elusive. We provide evidence that the molecular basis for stress-induced mutagenesis in an E. coli model is error-prone DNA double-strand break repair (DSBR). I-SceI-endonuclease-induced DSBs strongly activate stress-induced mutations near the DSB, but not globally. The same proteins are required as for cells without induced DSBs: DSBR proteins, DinB-error-prone polymerase, and the RpoS starvation-stress-response regulator. Mutation is promoted by homology between cut and uncut DNA molecules, supporting a homology-mediated DSBR mechanism. DSBs also promote gene amplification. Finally, DSBs activate mutation only during stationary phase/starvation but will during exponential growth if RpoS is expressed. Our findings reveal an RpoS-controlled switch from high-fidelity to mutagenic DSBR under stress. This limits genetic instability both in time and to localized genome regions, potentially important evolutionary strategies.
Evaluation of induced radioactivity in 10 MeV-Electron irradiated spices, (2); [beta]-ray counting
Energy Technology Data Exchange (ETDEWEB)
Katayama, Tadashi; Furuta, Masakazu; Shibata, Setsuko; Matsunami, Tadao; Ito, Norio; Mizohata, Akira; Toratani, Hirokazu (Osaka Prefectural Univ., Sakai (Japan). Research Inst. for Advanced Science and Technology); Takeda, Atsuhiko
1994-02-01
In order to check radioactivity of beta-emmitters produced by ([gamma], n) reactions which could occur at energies up to 10 MeV, black pepper, white pepper, red pepper, ginger and turmeric were irradiated with 10 MeV electron from a linear accelerator to a dose of 100 kGy. Beta-rays were counted using a 2[pi] gas flow counter and a liquid scintillation counter. Any induced radioactivity could not be detected in irradiated samples. When inorganic compounds containing the nuclides in the list were artificially added in the samples and were irradiated, the [beta]-activities were detected. From the amount of observed radioactivities of [beta]-emmitters produced in the compounds as photonuclear products, it is concluded that the induced radioactivity in natural samples by 10 MeV-electron irradiation were far smaller than natural radioactivity from [sup 40]K contained in the samples and, hence, its biological effects should be negligible. (author).
International Nuclear Information System (INIS)
Grosovsky, A.J.; de Boer, J.G.; de Jong, P.J.; Drobetsky, E.A.; Glickman, B.W.
1988-01-01
The relative role of point mutations and large genomic rearrangements in ionizing radiation-induced mutagenesis has been an issue of long-standing interest. Recent studies using Southern blotting analysis permit the partitioning of ionizing radiation-induced mutagenesis in mammalian cells into detectable deletions and major genomic rearrangements and into point mutations. The molecular nature of these point mutations has been left unresolved; they may include base substitutions as well as small deletions, insertions, and frame-shifts below the level of resolution of Southern blotting analysis. In this investigation, we have characterized a collection of ionizing radiation-induced point mutations at the endogenous adenine phosphoribosyltransferase (aprt) locus of Chinese hamster ovary cells at the DNA sequence level. Base substitutions represented approximately equal to 2/3 of the point mutations analyzed. Although the collection of mutants is relatively small, every possible type of base substitution event has been recovered. These mutations are well distributed throughout the coding sequence with only one multiple occurrence. Small deletions represented the remainder of characterized mutants; no insertions have been observed. Sequence-directed mechanisms mediated by direct repeats could account for some of the observed deletions, while others appear to be directly attributable to radiation-induced strand breakage
Induced mutations for improvement of grain legume production II
International Nuclear Information System (INIS)
1982-02-01
Out of 18 papers presented, 15 fall within the INIS subject scope. Other topics covered were: mutagenic efficiency of ethylmethane sulphonate in soybean; induced mutations for rust resistance in soybean; and nitrogen fixation-potentials for improvement in legumes
Induced mutations of rust resistance genes in wheat
International Nuclear Information System (INIS)
McIntosh, R.A.
1983-01-01
Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)
International Nuclear Information System (INIS)
Traut, H.
1979-01-01
When females of Drosophila melanogaster are treated with chemical or physical mutagens, not only in one but also in both of the two homologous X chromosomes of a given oocyte, a recessive sex-linked lethal mutation may be induced. A method is described that discriminates between such single and double mutations. A theory is developed to show how a comparison betweeen the expected and the observer frequency of double mutations yields an indication of the intercellular distribution (random or nonrandom) of recessive lethal mutations induced by mutagenic agents in oocytes and, consequently, of the distribution (homogenous or nonhomogeneous) of those agents. Three agents were tested: FUdR (12.5, 50.0 and 81.0 μg/ml), mitomycin C (130.0 μg/ml) and x rays (2000 R, 150 kV). After FUdR feeding, no increase in the mutation frequency usually observed in D. melanogaster without mutagenic treatment was obtained (u = 0.13%, namely three single mutations among 2332 chromosomes tested). After mitomycin C feeding 104 single and three double mutations were obtained. All of the 50 mutations observed after x irradiation were single mutations. The results obtained in the mitomycin C and radiation experiments favor the assumption of a random intercellular distribution of recessive lethal mutations induced by these two agents in oocytes of D. melanogaster. Reasons are discussed why for other types of mutagenic agents nonrandom distributions may be observed with our technique
Heavy ion induced mutation in arabidopsis
Energy Technology Data Exchange (ETDEWEB)
Tano, Shigemitsu [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment
1997-03-01
Heavy ions, He, C, Ar and Ne were irradiated to the seeds of Arabidopsis thaliana for inducing the new mutants. In the irradiated generation (M{sub 1}), germination and survival rate were observed to estimate the relative biological effectiveness in relation to the LET including the inactivation cross section. Mutation frequencies were compared by using three kinds of genetic loci after irradiation with C ions and electrons. Several interesting new mutants were selected in the selfed progenies of heavy ion irradiated seeds. (author)
Chatterjee, Tridip; Chakravarty, Amit; Chakravarty, Sudipa
2018-05-01
The haematological and clinical response to hydroxyurea was estimated in HbE-beta, beta thalassaemia and sickle cell anaemia patients of Eastern India, with variable clinical severity and transfusion requirement to determine whether hydroxyurea can help these patients to maintain their steady haemoglobin level without blood transfusions. Three hundred patients (189 HbE-beta thalassaemia, 95 beta thalassaemia and 16 other haemoglobinopathies including sickle cell anaemia) were selected for hydroxyurea therapy and were followed up for 48-60 months. Results suggest significant response to hydroxyurea therapy in 19 beta and 99 HbE-beta patients in the transfusion-dependent group (GR-I). All of them became transfusion-independent while on hydroxyurea therapy. The majority of responding patients were IVS1-5(G-C) in one of their alleles in HbE-beta cases (83 out of 119). Though IVS1-5(G-C) was found to be the commonest mutation in our selected patients, the mutational background of the patients does not found to have any significant correlation with the response category towards hydroxyurea as per the results observed in our study. But, the drug works pretty well in most of the transfusion-dependent patients, as these patients were withdrawn from regular blood transfusion. At the same time, partial or no response to the drug hydroxyurea was also recorded in our study.
Kaushik, Mahima; Kukreti, Shrikant
2015-01-01
Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.
Wan, Jun-Hui; Tian, Pei-Ling; Luo, Wei-Hao; Wu, Bing-Yi; Xiong, Fu; Zhou, Wan-Jun; Wei, Xiang-Cai; Xu, Xiang-Min
2012-07-15
Reversed-phase high-performance liquid chromatography (RP-HPLC) of human globin chains is an important tool for detecting thalassemias and hemoglobin variants. The challenges of this method that limit its clinical application are a long analytical time and complex sample preparation. The aim of this study was to establish a simple, rapid and high-resolution RP-HPLC method for the separation of globin chains in human blood. Red blood cells from newborns and adults were diluted in deionized water and injected directly onto a micro-jupiter C18 reversed-phase column (250 mm × 4.6 mm) with UV detection at 280 nm. Under the conditions of varying pH or the HPLC gradient, the globin chains (pre-β, β, δ, α, (G)γ and (A)γ) were denatured and separated from the heme groups in 12 min with a retention time coefficient of variation (CV) ranging from 0.11 to 1.29% and a peak area CV between 0.32% and 4.86%. Significant differences (P<0.05) among three groups (normal, Hb H and β thalassemia) were found in the area ratio of α/pre-β+β applying the rapid elution procedure, while P≥0.05 was obtained between the normal and α thalassemia silent/trait group. Based on the ANOVA results, receiver operating characteristic (ROC) curve analysis of the δ/β and α/pre-β+β area ratios showed a sensitivity of 100.0%, and a specificity of 100.0% for indicating β thalassemia carriers, and a sensitivity of 96.6% and a specificity of 89.6% for the prediction of hemoglobin H (Hb H) disease. The proposed cut-off was 0.026 of δ/β for β thalassemia carriers and 0.626 of α/pre-β+β for Hb H disease. In addition, abnormal hemoglobin hemoglobin E (Hb E) and Hb Westmead (Hb WS) were successfully identified using this RP-HPLC method. Our experience in developing this RP-HPLC method for the rapid separation of human globin chains could be of use for similar work. Copyright © 2012 Elsevier B.V. All rights reserved.
Use of ionizing radiation induced mutation in the genetic development of plants
International Nuclear Information System (INIS)
Barragan, Raul; Rubio, Santiago
1993-01-01
The objective of this article is to present a general focus on the use of induced mutations in the improvement of plants. This article describes some basic aspects that must be well known by the breeder that hopes to incorporate in his programm the technique of induced mutation by radiations. In this paper are included the results of two trials done by the researchers of the department of plant breeding so that it can be used as reference to determinate the importance of this technique
Comparison of different methods for erythroid differentiation in the K562 cell line.
Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein
2016-08-01
To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.
Chu, L Y; Rhoads, R E
1978-06-13
The translation of rabbit globin mRNA in cell-free systems derived from either wheat germ or rabbit reticulocyte was studied in the presence of various analogues of the methylated 5' terminus (cap) as a function of ionic strength. Inhibition by these analogues was strongly enhanced by increasing concentrations of KCl, K(OAc), Na(OAc), or NH4(OAc). At appropriate concentrations of K(OAc), both cell-free systems were equally sensitive to inhibition by m7GTP. At 50 mM K(OAc), the reticulocyte system was not sensitive to m7GMP or m7GTP, but at higher concentrations up to 200 mM K(OAc), both nucleotides caused strong inhibition. The compound in m7G5'ppp5'Am was inhibitory at all concentrations of K(OAc) ranging from 50 to 200 mM, although more strongly so at the higher concentrations. Over the same range of nucleotide concentrations, the compounds GMP, GTP, and G5'ppp5'Am were not inhibitors. The mobility on sodium dodecyl sulfate-polyacrylamide electrophoresis of the translation product was that of globin at all K(OAc) concentrations in the presence of m7GTP. Globin mRNA from which the terminal m7GTP group had been removed by chemical treatment (periodate-cyclohexylamine-alkaline phosphatase) or enzymatic treatment (tobacco acid pyrophosphatase-alkaline phosphatase) was translated less efficiently than untreated globin mRNA at higher K(OAc) concentrations, but retained appreciable activity at low K(OAc) concentrations.
Mutator suppression and escape from replication error-induced extinction in yeast.
Directory of Open Access Journals (Sweden)
Alan J Herr
2011-10-01
Full Text Available Cells rely on a network of conserved pathways to govern DNA replication fidelity. Loss of polymerase proofreading or mismatch repair elevates spontaneous mutation and facilitates cellular adaptation. However, double mutants are inviable, suggesting that extreme mutation rates exceed an error threshold. Here we combine alleles that affect DNA polymerase δ (Pol δ proofreading and mismatch repair to define the maximal error rate in haploid yeast and to characterize genetic suppressors of mutator phenotypes. We show that populations tolerate mutation rates 1,000-fold above wild-type levels but collapse when the rate exceeds 10⁻³ inactivating mutations per gene per cell division. Variants that escape this error-induced extinction (eex rapidly emerge from mutator clones. One-third of the escape mutants result from second-site changes in Pol δ that suppress the proofreading-deficient phenotype, while two-thirds are extragenic. The structural locations of the Pol δ changes suggest multiple antimutator mechanisms. Our studies reveal the transient nature of eukaryotic mutators and show that mutator phenotypes are readily suppressed by genetic adaptation. This has implications for the role of mutator phenotypes in cancer.
Prenatal diagnosis of beta-thalassaemia: experience in a developing country.
Saxena, R; Jain, P K; Thomas, E; Verma, I C
1998-01-01
We present our experience with the amplification refractory mutation system (ARMS) for the prenatal diagnosis of beta-thalassaemia in 415 pregnancies of 360 women. Five mutations of the beta-thalassaemia gene common in Asian Indians accounted for 89.2 per cent and rare mutations for 7.2 per cent of all mutant chromosomes, while 3.3 per cent of chromosomes remained uncharacterized. Identical mutations were present in both parents in 43.2 per cent of cases, due to caste-based marriages in India. A confirmed diagnosis was given in 401 (98.3 per cent) cases, of which a complete diagnosis (whether the fetus was normal, a carrier, or homozygous) was possible in 391 (94.2 per cent) of the cases. In 15 couples, the mutation was identified in only one parent. In nine of these, the identified mutation was not present in the fetus, predicting normal/carrier status, while in five the identified mutation was present in the fetus, suggesting carrier/affected status. The abortion rate was 3.9 per cent. Pitfalls in diagnosis were failure of oligonucleotides to work, maternal contamination, and false paternity. The ARMS provides an inexpensive, robust and non-isotopic method for the prenatal diagnosis of beta-thalassaemia in India. Recommendations are outlined for establishing a prenatal diagnostic service in developing countries.
Wymenga, ANM; van der Graaf, WTA; Hofstra, LS; Spijkervet, FKL; Timens, W; Timmer-Bosscha, H; Sluiter, WJ; van Buuren, AHJAW; Mulder, NH; de Vries, EGE
The purpose of this study was to establish the safety and tolerability of recombinant transforming growth factor-beta 3 (TGF-beta 3; CGP 46614) mouthwashes intended for prevention of chemotherapy-induced mucositis. Local effects were especially analyzed by objective and subjective measurements of
Molecular analysis of radiation-induced mutations in vitro
International Nuclear Information System (INIS)
Kronenberg, A.
1996-01-01
This review will focus on the nature of specific locus mutations detected in mammalian cells exposed in vitro to different types of ionizing radiations. Ionizing radiation has been shown to produce a wide variety of heritable alterations in DNA. These range from single base pair substitutions to stable loss or translocation of large portions of whole chromosomes. Data will be reviewed for certain test systems that reveal different mutation spectra. Techniques for the analysis of molecular alterations include applications of the polymerase chain reaction, some of which may be coupled with DNA sequence analysis, and a variety of hybridization-based techniques. The complexity of large scale rearrangements is approached with cytogenetic techniques including high resolution banding and various applications of the fluorescence in situ hybridization (FISH) technique. Radiation-induced mutant frequencies and mutation spectra are a function of the linkage constraints on the recovery of viable mutants for a given locus and test system. 44 refs
International Nuclear Information System (INIS)
Stewart, H.I.; Rosenbluth, R.E.; Baillie, D.L.
1991-01-01
In this study the utility of 254-nm ultraviolet light (UV) as a magnetic tool in C.elegans is determined. It is demonstrated that irradiation of adult hermaphrodites provides a simple method for the induction of heritable chromosomal rearrangements. A screening protocol was employed that identifies either recessive lethal mutations in the 40 map unit region balanced by the translocation eT1(III;V), or unc-36(III) duplications. Mutations were recovered in 3% of the chromosomes screened after a dose of 120 J/m 2 . This rate resembles that for 1500 R γ-ray-induced mutations selected in a similar manner. The mutations were classified either as lethals [mapping to Linkage Group (LG)III or LGV] or as putative unc-36 duplications. In contrast to the majority of UV-induced mutations analysed in micro-organisms, a large fraction of the C.elegans UV-induced mutations were found to be not simple intragenic lesions, but deficiencies for more than one adjacent gene or more complex events. Preliminary evidence for this conclusion came from the high frequency of mutations that had a dominant effect causing reduced numbers of adult progeny. Subsequently 6 out of 9 analysed LGV mutations were found to be deficiencies. Other specific rearrangements also identified were: one translocation, sT5(II;III), and two unc-36 duplications, sDp8 and sDp9. It was concluded that UV irradiation can easily be used as an additional tool for the analysis of C.elegans chromosomes, and that C.elegans should prove to be a useful organism in which to study the mechanisms whereby UV acts as a mutagen in cells of complex eukaryotes. (author). 46 refs.; 5 figs.; 4 tabs
Yi, Ping; Chen, Zhuqin; Yu, Lili; Zheng, Yingru; Liu, Guodong; Xie, Haichang; Zhou, Yuanguo; Zheng, Xiuhui; Han, Jian; Li, Li
2010-08-01
Analysis of fetal DNA in maternal plasma has recently been introduced for non-invasive prenatal diagnosis. We have now investigated the feasibility of polymerase chain reaction (PCR)/ligase detection reaction (LDR)/capillary electrophoresis for the detection of fetal point mutations, such as the beta-thalassemia mutation, IVS2 654(C --> T), in maternal plasma DNA. The sensitivity of LDR/capillary electrophoresis was examined by quantifying the mutant PCR products in the presence of a vast excess of non-mutant competitor template, a situation that mimics the detection of rare fetal mutations in the presence of excess maternal DNA. PCR/LDR/capillary electrophoresis was applied to detect the mutation, IVS2 654(C --> T), in an experimental model at different sensitivity levels and from 10 maternal plasma samples. Our results demonstrated that this approach to detect a low abundance IVS2 654(C --> T) mutation achieved a sensitivity of approximately 1:10,000. The approach was applied to maternal plasma DNA to detect the paternally inherited fetal IVS2 654(C --> T) mutation, and the results were equivalent to those obtained by PCR/reverse dot blot of amniotic fluid cell DNA. PCR/LDR/capillary electrophoresis has a very high sensitivity that can distinguish low abundance single nucleotide differences and can detect paternally inherited fetal point mutations in maternal plasma.
[Molecular characterization of heterozygous beta-thalassemia in Lanzarote, Spain].
Calvo-Villas, José Manuel; de la Iglesia Iñigo, Silvia; Ropero Gradilla, Paloma; Zapata Ramos, María Francisca; Cuesta Tovar, Jorge; Sicilia Guillén, Francisco
2008-04-05
The aim of this study was to determine the molecular defects of heterozygous beta thalassaemia and to ascertain their distribution in Lanzarote. Molecular characterization was achieved by real time polymerase chain reaction (RT-PCR LightCycler, Roche), PCR-ARMS (PCR-amplification reaction mutations system) and DNA sequencing on an automated DNA sequencer. Two hundred forty-three heterozygous beta thalassaemia carriers were included between July 1991 and February 2007. RT-PCR detected the molecular defect in 81% of the beta thalassaemia chromosomes analyzed [113 codon CD 39 (C --> T); 41 IVS-1-nt-110 (G --> A), 25 IVS 1-nt-1 (G --> A) and 19 IVS 1-nt-6 (T --> C)]. The remaining 12 molecular defects included the deletion 619 bp (7.8%) and the mutations -28 (A --> G), IVS1-nt-2 (T --> G), CD 41/42 (-TTCT), CD 8/9 (+G), CD 51 (-C), CD 22 (G --> T) and CD 24 (T --> A), CD 67 (-TG) and the novel mutation CD 20/21-TGGA. The distribution of the mutations is similar to that found in the Mediterranean area. The increasing migratory flow received in the Canary Islands may explain the emergence of new mutations not reported before in our area.
Current status and outlook perspectives of induced mutations for plant improvement
International Nuclear Information System (INIS)
Liu Luxiang; Guo Huijun; Zhao Linshu; Li Junhui; Gu Jiayu; ZZhao Shirong; Wang Jing
2009-01-01
Since 1928, induced mutations have played a significant role in solving world food and nutritional security problems through mutant germplasm enhancement and new mutant variety development. According to incomplete statistics, up to September 2009, induced mutations have officially released 3088 mutant cultivars in more than 170 crop species by more than 60 countries in the world. China tanks the first in the world, which has have released 802 mutant cultivars in 45 crop species, and takes more than a quarter of the total number of mutant varieties in the FAO/IAEA database. The maximum annually accumulated planting area of the mutant varieties was 9 million hectares, with an additional increase of 1.5 billion kilograms to national output of grain, cotton, oil, being converted to social and economic benefits of more than 2 billion RMB. The recent development and application of accelerator ion beam irradiation, the spaceflight environment and the other new mutation means, as well as the effective use of traditional radiation mutagenesis are becoming more active in crop improvement and new gene discovery. The advent of plant genomics and high throughput DNA techniques, such as TILLING, have opened a new era of molecular mutation breeding, which will overcome the limitations of conventional mutation breeding and play a significant role in solving China and world food security. (authors)
Timing of the uv mutagenesis in yeast: a pedigree analysis of induced recessive mutation
International Nuclear Information System (INIS)
James, A.P.; Kilbey, B.J.
1977-01-01
The mechanism of uv-induced mutation in eukaryotes was studied in individual yeast cells by a procedure that combined pedigree analysis and tetrad analysis. The technique involved the induction of recessive lethals and semilethals in G1 diploid cells. Induced frequencies were 25 and 61% at survival levels of 90 and 77%, respectively. No evidence of gross chromosome aberrations was detected. Recessive mutations that affect only one strand or that affect both strands of the DNA molecule are induced much at random among a population of cells, and both types can occur within the same cell. However, the data confirm that two-strand mutations are in the majority after a low level of irradiation. The simplest explanation involves a mechanism whereby most mutations are fixed in both strands prior to the first round of post-irradiation DNA replication. The recessive mutational consequences of irradiation are exhausted at the conclusion of the first post-irradiation cell division, although dominant-lethal sectoring continues at a high level through the second post-irradiation division. It is concluded that pyrimidine dimers that persist to the second round of DNA replication are rare or ineffective
The timing of UV mutagenesis in yeast: a pedigree analysis of induced recessive mutation.
James, A P; Kilbey, B J
1977-10-01
The mechanism of UV-induced mutation in eukaryotes was studied in individual yeast cells by a procedure that combined pedigree analysis and tetrad analysis. The technique involved the induction of recessive lethals and semilethals in G1 diploid cells. Induced frequencies were 25 and 61 percent at survival levels of 90 and 77 percent, respectively. No evidence of gross chromosome aberrations was detected. Recessive mutations that affect only one strand or that affect both strands of the DNA molecule are induced much at random among a population of cells, and both types can occur within the same cell. However, the data confirm that two-strand mutations are in the majority after a low level of irradiation. The simplest explanation involves a mechanism whereby most mutations are fixed in both strands prior to the first round of post-irradiation DNA replication. The recessive mutational consequences of irradiation are exhausted at the conclusion of the first post-irradiation cell division, although dominant-lethal sectoring continues at a high level through the second post-irradiation division. It is concluded that pyrimidine dimers that persist to the second round of DNA replication are rare or ineffective.
Ancient genes establish stress-induced mutation as a hallmark of cancer.
Cisneros, Luis; Bussey, Kimberly J; Orr, Adam J; Miočević, Milica; Lineweaver, Charles H; Davies, Paul
2017-01-01
Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to
Gamma ray induced somatic mutations in rose
International Nuclear Information System (INIS)
Datta, S.K.
1989-01-01
Budwood of 32 rose cultivars (Rosa spp.) was exposed to 3-4 krad of gamma rays and eyes were grafted on Rosa indica var. odorata root stock. Radiosensitivity with respect to sprouting, survival and plant height, and mutation frequency varied with the cultivar and dose of gamma rays. Somatic mutations in flower colour/shape were detected as chimera in 21 cultivars. The size of the mutant sector varied from a narrow streak on a petal to a whole flower and from a portion of a branch to an entire branch. 14 mutants were detected in M 1 V 1 , four in M 1 V 2 and three in M 1 V 3 . Maximum number of mutations was detected following 3 krad treatment. Eyes from mutant branches were grafted again on root stock and non-chimeric mutants were aimed at by vegetative propagation. Mutants from 11 cultivars only could be isolated in pure form. Isolation of non-chimeric mutants sometimes is difficult due to weak growth of a mutant branch. In such a case, all normal looking branches are removed to force a better growth of the mutant branch. It is advisable to maintain irradiated plants at least for four years with drastic pruning in each year. Nine mutants viz. 'Sharada', 'Sukumari', 'Tangerine Contempo', 'Yellow Contempo', 'Pink Contempo', 'Striped Contempo', 'Twinkle', 'Curio' and 'Light Pink Prize' have already been released as new cultivars for commercialization [ref. MBNL No. 23 and 31] and others are being multiplied and assessed. The mutation spectrum appears to be wider for the cultivars 'Contempo' and 'Imperator'. Pigment composition of the original variety is relevant for the kind of flower colour mutations that can be induced
Plant breeding: Induced mutation technology for crop improvement
International Nuclear Information System (INIS)
Novak, F.J.; Brunner, H.
1992-01-01
Plant breeding requires genetic variation of useful traits for crop improvement, but the desired variation is often lacking. Mutagenic agents, such as radiation and certain chemicals, can be used to induce mutations and generate genetic variations from which desirable mutants may be selected. After a brief summary of the methods currently employed in plant breeding, especially those inducing genetic engineering, this article describes the activities of the Plant Breeding Unit of the IAEA Laboratories at Seibersdorf, summarizing the research and development areas currently being pursued. The banana plant is chosen to exemplify the Laboratories' research
Hamid, Mohammad; Ershadi Oskouei, Sanaz; Shariati, Gholamreza; Babaei, Esmaeil; Galehdari, Hamid; Saberi, Alihossein; Sedaghat, Alireza
2018-04-01
Any mutation in the Krüppel-like factor 1 (KLF1) gene may interfere with its proper related function in the erythropoiesis process and lead to alterations in proper activation of its downstream protein through globin switching, which results in an increase in fetal hemoglobin (HbF). This study aimed to investigate whether KLF1 mutation can associate with high level of HbF in individuals with increased fetal hemoglobin referred for screening of hemoglobinopathies in south of Iran. The human KLF1 gene was amplified via the polymerase chain reaction procedure, and sequencing was used to determine any mutation in these patients. Moreover, XmnI polymorphisms in the position of -158 of γ-globin gene promoter were analyzed in all patients by polymerase chain reaction restriction fragment length polymorphism. Analysis of sequencing revealed a missense mutation in the KLF1 gene, p.Ser102Pro (c.304T>C), which was detectable in 10 of 23 cases with elevated HbF level. This mutation was only detected in individuals who had a HbF level between 3.1% and 25.6%. Statistical analysis showed that the frequency of C allele is significantly correlated with a high level of HbF (PC) in the KLF1 gene in β-thalassemia patients with increased level of fetal hemoglobin. According to statistical results of p.Ser102Pro mutation and XmnI polymorphism, it has been strongly suggested that both polymorphisms have an association with increased HbF samples. These nucleotide changes alone may not be the only elements raising the level of HbF, and other regulatory and modifying factors also play a role in HbF production.
Directory of Open Access Journals (Sweden)
Benedikt B Kaufer
2011-10-01
Full Text Available Telomerase reverse transcriptase (TERT and telomerase RNA (TR represent the enzymatically active components of telomerase. In the complex, TR provides the template for the addition of telomeric repeats to telomeres, a protective structure at the end of linear chromosomes. Human TR with a mutation in the template region has been previously shown to inhibit proliferation of cancer cells in vitro. In this report, we examined the effects of a mutation in the template of a virus encoded TR (vTR on herpesvirus-induced tumorigenesis in vivo. For this purpose, we used the oncogenic avian herpesvirus Marek's disease virus (MDV as a natural virus-host model for lymphomagenesis. We generated recombinant MDV in which the vTR template sequence was mutated from AATCCCAATC to ATATATATAT (vAU5 by two-step Red-mediated mutagenesis. Recombinant viruses harboring the template mutation replicated with kinetics comparable to parental and revertant viruses in vitro. However, mutation of the vTR template sequence completely abrogated virus-induced tumor formation in vivo, although the virus was able to undergo low-level lytic replication. To confirm that the absence of tumors was dependent on the presence of mutant vTR in the telomerase complex, a second mutation was introduced in vAU5 that targeted the P6.1 stem loop, a conserved region essential for vTR-TERT interaction. Absence of vTR-AU5 from the telomerase complex restored virus-induced lymphoma formation. To test if the attenuated vAU5 could be used as an effective vaccine against MDV, we performed vaccination-challenge studies and determined that vaccination with vAU5 completely protected chickens from lethal challenge with highly virulent MDV. Taken together, our results demonstrate 1 that mutation of the vTR template sequence can completely abrogate virus-induced tumorigenesis, likely by the inhibition of cancer cell proliferation, and 2 that this strategy could be used to generate novel vaccine candidates
Belhadj, Sahla; Hentati, Olfa; Hamdaoui, Ghaith; Fakhreddine, Khaskhoussi; Maillard, Elisa; Dal, Stéphanie; Sigrist, Séverine
2018-03-20
Hyperglycemia occurs during diabetes and insulin resistance. It causes oxidative stress by increasing reactive oxygen species (ROS) levels, leading to cellular damage. Polyphenols play a central role in defense against oxidative stress. In our study, we investigated the antioxidant properties of simmondsin, a pure molecule present in jojoba seeds, and of the aqueous extract of jojoba seeds on fructose-induced oxidative stress in RINm5f beta cells. The exposure of RINm5f beta cells to fructose triggered the loss of cell viability (-48%, p jojoba seed extract makes jojoba a powerful agent to prevent the destruction of RINm5f beta cells induced by hyperglycemia.
alpha-Globin genes: thalassemic and structural alterations in a Brazilian population
Directory of Open Access Journals (Sweden)
M.R.S.C. Wenning
2000-09-01
Full Text Available Seven unrelated patients with hemoglobin (Hb H disease and 27 individuals with alpha-chain structural alterations were studied to identify the alpha-globin gene mutations present in the population of Southeast Brazil. The -alpha3.7, --MED and -(alpha20.5 deletions were investigated by PCR, whereas non-deletional alpha-thalassemia (alphaHphalpha, alphaNcoIalpha, aaNcoI, alphaIcalpha and alphaTSaudialpha was screened with restriction enzymes and by nested PCR. Structural alterations were identified by direct DNA sequencing. Of the seven patients with Hb H disease, all of Italian descent, two had the -(alpha20.5/-alpha3.7 genotype, one had the --MED/-alpha3.7 genotype, one had the --MED/alphaHphalpha genotype and three showed interaction of the -alpha3.7 deletion with an unusual, unidentified form of non-deletional alpha-thalassemia [-alpha3.7/(aaT]. Among the 27 patients with structural alterations, 15 (of Italian descent had Hb Hasharon (alpha47Asp->His associated with the -alpha3.7 deletion, 4 (of Italian descent were heterozygous for Hb J-Rovigo (alpha53Ala->Asp, 4 (3 Blacks and 1 Caucasian were heterozygous for Hb Stanleyville-II (alpha78Asn->Lys associated with the alpha+-thalassemia, 1 (Black was heterozygous for Hb G-Pest (alpha74Asp->Asn, 1 (Caucasian was heterozygous for Hb Kurosaki (alpha7Lys->Glu, 1 (Caucasian was heterozygous for Hb Westmead (alpha122His->Gln, and 1 (Caucasian was the carrier of a novel silent variant (Hb Campinas, alpha26Ala->Val. Most of the mutations found reflected the Mediterranean and African origins of the population. Hbs G-Pest and Kurosaki, very rare, and Hb Westmead, common in southern China, were initially described in individuals of ethnic origin differing from those of the carriers reported in the present study and are the first cases to be reported in the Brazilian population.
Maruo, Yoshihiro; Mori, Asami; Morioka, Yoriko; Sawai, Chihiro; Mimura, Yu; Matui, Katsuyuki; Takeuchi, Yoshihiro
2016-01-12
Resistance to thyroid hormone beta (RTHβ) is a rare and usually dominantly inherited syndrome caused by mutations of the thyroid hormone receptor β gene (THRB). In severe cases, it is rarely challenging to control manifestations using daily therapeutic replacement of thyroid hormone. The present case study concerns an 8-year-old Japanese girl with a severe phenotype of RTH (TSH, fT3, and fT4 were 34.0 mU/L, >25.0 pg/mL and, >8.0 ng/dL, respectively), caused by a novel heterozygous frameshift mutation in exon 10 of the thyroid hormone receptor beta gene (THRB), c.1347-1357 del actcttccccc : p.E449DfsX11. RTH was detected at the neonatal screening program. At 4 years of age, the patient continued to suffer from mental retardation, hyperactivity, insomnia, and reduced resting energy expenditure (REE), despite daily thyroxine (L-T4) therapy. Every-other-day high-dose liothyronine (L-T3) therapy improved her symptoms and increased her REE, without thyrotoxicosis. In a case of severe RTH, every-other-day L-T3 administration enhanced REE and psychomotor development, without promoting symptoms of thyrotoxicosis. Every-other-day L-T3 administration may be an effective strategy for the treatment of severe RTH.
Localisation of Neuregulin 1-{beta}3 to different sub-nuclear structures alters gene expression
Energy Technology Data Exchange (ETDEWEB)
Wang, Ming; Trim, Carol M.; Gullick, William J., E-mail: w.j.gullick@kent.ac.uk
2011-02-15
Neuregulins are growth factors that signal via the ErbB3 and ErbB4 receptors. Here we show using immunohistochemistry that they are often expressed in the nucleus of a range of tumour types including soft tissue and breast. The Neuregulin 1 type I-{beta}3 (NRG1-{beta}3) isoform localises to two sub-nuclear compartments in animal cells, nucleoli and spliceosomes. We used NRG1-{beta}3 tagged with photoactivatable GFP and demonstrated that this re-localised from nucleoli to spliceosomes over 90 min. Tyrosine kinase activity was not required for retaining the NRG1-{beta}3 within the nucleus. Mutation of the lysines 14 and 16 or 15 and 16 together prevented nucleolar uptake while four positively charged residues were identified which were required for spliceosome uptake. Molecular modelling suggests that three of these may form a binding site. We showed using a kinome array that NRG1-{beta}3 and a mutant exclusively localising to spliceosomes increased phosphorylation and/or expression of the HER4 and HER2 receptors. Using a transcriptomic analysis the same two constructs induced expression of several messenger RNAs and we confirmed the increased expression at the protein level of the most highly induced, Heat Shock Protein 70B'. These results suggest that Neuregulin activates receptor signalling in spliceosomes leading to altered gene expression.
DEFF Research Database (Denmark)
Petersen, J.; Poulsen, Lena; Petronis, S.
2008-01-01
is called a multi-thermal array washer (MTAW), and it has eight individually controlled heating zones, each of which corresponds to the location of a subarray on a slide. Allele-specific oligonucleotide probes for nine mutations in the beta-globin gene were spotted in eight identical subarrays at positions......DNA microarrays are generally operated at a single condition, which severely limits the freedom of designing probes for allele-specific hybridization assays. Here, we demonstrate a fluidic device for multi-stringency posthybridization washing of microarrays on microscope slides. This device...
Directory of Open Access Journals (Sweden)
Wang Lin
2015-01-01
Full Text Available Ti-5553 alloy is a near-beta titanium alloy with high strength and high fracture toughness. In this paper, the dynamic behaviour and shock-induced martensite phase transformation of Ti-5553 alloy with alpha/beta phases were investigated. Split Hopkinson Pressure Bar was employed to investigate the dynamic properties. Microstructure evolutions were characterized by Scanning Electronic Microscopy and Transmission Electron Microscope. The experimental results have demonstrated that Ti-5553 alloy with alpha/beta phases exhibits various strain rate hardening effects, both failure through adiabatic shear band. Ti-5553 alloy with Widmannstatten microstructure exhibit more obvious strain rate hardening effect, lower critical strain rate for ASB nucleation, compared with the alloy with Bimodal microstructures. Under dynamic compression, shock-induced beta to alpha” martensite transformation occurs.
Fate of induced mutations in higher plants with special emphasis on sexually reproducing species
International Nuclear Information System (INIS)
Cornu, Andre
1978-01-01
A mutation induced in a plant somatic cell has to overcome quite many difficulties before being isolated and utilized as a marker in a mutated line. If induced in a meristem, three conditions must be fulfilled for the mutation to be transmitted to the subsequent generation: it must be compatible with normal cell multiplication, it must be located in a cell mass that will provide an inflorescence, and it must be in the sporogenetic layer (t2). Under these conditions, or if it is induced in a gamete or in a zygote, the mutation enters a first cycle of sexual reproduction. Meiosis and the subsequent haploid phase constitute severe screening steps for many chromosome aberrations. Studies on Petunia performed by means of marker genes show that male and female gametic viabilities are drastically impaired by deletions. However, a deficient chromosome can be transmitted when the losss of information is compensated for by homologous information as, for example, diploid gametes from tetraploids or disomic gametes resulting from non-disjunction. If partial or complete sterility, whether sporo- or gametophytic, is avoided, then the mutation can be transmitted to the next generation in heterozygous state. When becoming homozygous, the mutation may have effects such that its use can be most difficult. This is the case when this mutation causes rather early lethality or severe sterility. Thus, in higher plants, one faces several cases of powerful and efficient selection against mutations. On the basis of experiments carried out on Petunia, the per locus mutation rate of practical interest ranges between I and 5/10000M 1 plants. Practical conclusions are drawn about which organ should be treated, which mutagen at what dose should be used according to the scope of the research undertaken [fr
International Nuclear Information System (INIS)
Klu, G. Y. P.
2000-01-01
Induced mutations have the ability to increase the rate of domestication of the many under exploited species of plants that may be potentially useful as source of food, forage and industrial raw materials. The process of domestication has been conditioned by single or major gene mutations. The role of mutagenesis in speeding up domestication, which is species dependent, is outlined in this paper. A case study of the role of induced mutations in the domestication of winged bean (Psophocarpus tetragonobolus) is also presented (au)
Directory of Open Access Journals (Sweden)
Gene A Morrill
2016-09-01
Full Text Available ABSTRACT: Globins contain one or more cavities that control or affect such functions as ligand movement and ligand binding. Here we report that the extended globin family [cytoglobin (Cygb; neuroglobin (Ngb; myoglobin (Mb; hemoglobin (Hb subunits Hba(α and Hbb(β] contain either a transmembrane (TM helix or pore-lining region as well as internal cavities. Protein motif/domain analyses indicate that Ngb and Hbb each contain 5 cholesterol-binding (CRAC/CARC domains and 1 caveolin binding motif, whereas the Cygb dimer has 6 cholesterol-binding domains but lacks caveolin-binding motifs. Mb and Hba each exhibit 2 cholesterol-binding domains and also lack caveolin-binding motifs. The Hb αβ-tetramer contains 14 cholesterol-binding domains. Computer algorithms indicate that Cygb and Ngb cavities display multiple partitions and C-terminal pore-lining regions, whereas Mb has three major cavities plus a C-terminal pore-lining region. The Hb tetramer exhibits a large internal cavity but the subunits differ in that they contain a C-terminal TM helix (Hba and pore-lining region (Hbb. The cavities include 43 of 190 Cygb residues, 38 of 151 of Ngb residues, 55 of 154 Mb residues and 137 of 688 residues in the Hb tetramer. Each cavity complex includes 6 to 8 residues of the TM helix or pore-lining region and CRAC/CARC domains exist within all cavities. Erythrocyte Hb αβ-tetramers are largely cytosolic but also bind to a membrane anion exchange protein, band 3, which contains a large internal cavity and 12 TM helices (5 being pore-lining regions. The Hba TM helix may be the erythrocyte membrane band 3 attachment site. Band 3 contributes 4 caveolin binding motifs and 10 CRAC/CARC domains. Cholesterol binding may create lipid-disordered phases that alter globin cavities and facilitate ligand movement, permitting ion channel formation and conformational changes that orchestrate anion and ligand (O2, CO2, NO movement within the large internal cavities and
Neutron-induced mutation experiments. Comprehensive report, March 1, 1977-August 31, 1980
International Nuclear Information System (INIS)
Abrahamson, S.
1981-02-01
Neutron-induced X-linked lethal mutations were induced in Drosophila melanogaster oogonia at energies of .43, .66, 2, and 6 MeV. The 37 irradiations were carried out at the RARAF facility at Brookhaven National Laboratory. RBE's (relative to x-ray data similarly collected) were calculated to be .43 MeV to 4.8; .66 MeV to 4.0; 2 MeV to 3.2; and 6 MeV to 2.9. The dose/frequency response curves for all energies best fit a linear rather than a linear-quadratic model following regression analyses. Control data for specific locus mutations (420,000 tests) were gathered. This data, combined with other data (both X-linked lethal and specific locus) has been used to estimate the number of loci on the X-chromosome of Drosophila which can mutate to recessive lethals
Induced mutations in highly heterozygous vegetatively propagated grasses
International Nuclear Information System (INIS)
Powell, J.B.
1976-01-01
Experience with mutation induction of turf and forage grasses indicates that much progress can be achieved by this method. More than 300 mutations have been produced in our laboratory in the cultivars Tifgreen and Tifdwarf bermudagrass (Cynodon sp.). In the Tifway and Tifcote bermudagrasses we have demonstrated similar mutation responses. The first three clones are triploids and Tifcote is a probable tetraploid. No seeds are set on these clones. Two clones of bermudagrass, Coastal and Coastcross-1, occupy millions of hectares in the USA. Both are mutable and are known to be hybrids with 36 chromosomes. Biotypes of dallisgrass (Paspalum dilatatum Poir.) exist with 40 and 50 chromosomes and reproduce as sexual and obligate apomictic forms. Gamma-ray and thermal-neutron treatment of seed of these biotypes produced mutants that maintained the maternal characteristics in subsequent generations. Bahiagrass (Paspalum notatum Fluegge) also has sexual and apomictic biotypes. Some success was indicated for increased seed set by mutagen treatment. Kentucky bluegrass (Poa pratensis L.) is a facultative apomict with varying numbers of chromosomes in different cultivars. Gamma-ray mutagen treatment of rhizomes produced numerous mutations for plant type and disease reaction. Most mutations perpetuate themselves through the seed. The characteristic in common with all these grasses is their heterozygosity, which is maintained by the vegetative propagation or apomictic mode of reproduction. The experience in using ionizing radiation to induce heritable changes in these vegetatively propagated grasses is one of considerable success. Mutation rates in some of these irradiated grasses exceeded 65% and aberrant plants with characteristics previously never observed were found. Numerous hemizygous and heterozygous loci seem to be a sensitive target for mutagens. (author)
Immunodeficiency associated with a nonsense mutation of IKBKB
DEFF Research Database (Denmark)
Nielsen, Christian; Jakobsen, Marianne A; Larsen, Martin Jakob
2014-01-01
We report an infant of consanguineous parents of Turkish decent with a novel immunodeficiency associated with homozygosity for a nonsense mutation of the gene encoding Inhibitor of nuclear factor kappa-B (NF-κB) kinase subunit beta (IKKβ). At five months, she presented with respiratory insufficie......We report an infant of consanguineous parents of Turkish decent with a novel immunodeficiency associated with homozygosity for a nonsense mutation of the gene encoding Inhibitor of nuclear factor kappa-B (NF-κB) kinase subunit beta (IKKβ). At five months, she presented with respiratory...... no explanation before whole exome sequencing revealed a novel mutation abrogating signaling through the canonical NF-κB pathway....
Shchepotina, E G; Vavilin, V A; Goreva, O B; Lyakhovich, V V
2006-06-01
Analysis of variants of exon 7 sequences in cytochrome P450 gene 3A4 in a sample of Caucasoid persons was carried out. The effect of these variants on activity of CYP3A was assessed by the level of cortisol 6beta-hydroxylation. Alleles CYP3A4*5 and *17 were not detected: probably, these mutations are rare and consequently they have little effect on the character of polymorphic distribution of CYP3A4 activity in this population. The incidence of CYP3A4*2 was 5.26%. The 6betaOH-cortisol/cortisol ratio in an individual with CYP3A4*2/*2 genotype was 7.408, which corresponded to "slow metabolizer" phenotype in this sample.
Rice breeding with induced mutations
Energy Technology Data Exchange (ETDEWEB)
1968-06-01
The Joint FAO/IAEA Division of Atomic Energy in Food and Agriculture decided in 1964 to organize a co-ordinated research programme on the use of induced mutations in rice breeding. The programme was organized within the framework of activities of the International Rice Commission. This is a report of the Third Co-ordination Meeting of the participants, which was held in Taipei, 5-9 June 1967. As the projects, which together make up the co-ordinated programme, are at different stages of progress, the report contains a variety of papers including completed studies, field and progress reports, and highlights of the discussions with some additional recommendations prepared by the participants. Refs, figs and tabs.
Imamura, Tetsuya; Ishizuka, Osamu; Ogawa, Teruyuki; Yamagishi, Takahiro; Yokoyama, Hitoshi; Minagawa, Tomonori; Nakazawa, Masaki; Nishizawa, Osamu
2015-01-01
To investigate pathways involving beta-3 adrenergic receptors (ARs) in detrusor overactivity induced by cold stress, we determined if the beta-3 AR agonist CL316243 could modulate the cold stress-induced detrusor overactivity in normal rats. Two days prior to cystometric investigations, the bladders of 10-week-old female Sprague-Dawley rats were cannulated. Cystometric measurements of the unanesthetized, unrestricted rats were taken to estimate baseline values at room temperature (RT, 27 ± 2 °C) for 20 min. They were then intravenously administered vehicle, 0.1, or 1.0 mg/kg CL316243 (n = 6 in each group). Five minutes after the treatments, they were gently and quickly transferred to the low temperature (LT, 4 ± 2 °C) room for 40 min where the cystometric measurements were again made. Afterward, the rats were returned to RT for final cystometric measurements. The cystometric effects of CL316243 were also measured at RT (n = 6 in each group). At RT, both low and high dose of CL316243 decreased basal and micturition pressure while the high dose (1.0 mg/kg) significantly increased voiding interval and bladder capacity. During LT exposure, the high dose of CL316243 partially reduced cold stress-induced detrusor overactivity characterized by increased basal pressure and urinary frequency. The high drug dose also significantly inhibited the decreases of both voiding interval and bladder capacity compared to the vehicle- and low dose (0.1 mg/kg)-treated rats. A high dose of the beta-3 agonist CL316243 could modulate cold stress-induced detrusor overactivity. Therefore, one of the mechanisms in cold stress-induced detrusor overactivity includes a pathway involving beta-3 ARs. © 2014 Wiley Publishing Asia Pty Ltd.
Lack of chemically induced mutation in repair-deficient mutants of yeast
International Nuclear Information System (INIS)
Prakash, L.
1974-01-01
Two genes, rad6 and rad9, that confer radiation sensitivity in the yeast Saccharomyces cerevisiae also greatly reduce the frequency of chemically-induced reversions of a tester mutant cyc1-131, which is a chain initiation mutant in the structural gene determining iso-1-cytochrome c. Mutations induced by ethyl methanesulfonate (EMS), diethyl sulfate (DES), methyl methanesulfonate (MMS), dimethyl sulfate (DMS), nitroquinoline oxide (NQO), nitrosoguanidine (NTG), nitrogen mustard (HN2), β-propiolactone, and tritiated uridine, as well as mutations induced by ultraviolet light (UV) and ionizing radiation were greatly diminished in strains homozygous for either the rad6 or rad9 gene. Nitrous acid and nitrosoimidazolidone (NIL), on the other hand, were highly mutagenic in these repair-deficient mutants, and at low doses, these mutagens acted with about the same efficiency as in the normal RAD strain. At high doses of either nitrous acid or NIL, however, reversion frequencies were significantly reduced in the two rad mutants compared to normal strains. Although both rad mutants are immutable to about the same extent, the rad9 strains tend to be less sensitive to the lethal effect of chemical mutagens than rad6 strains. It is concluded that yeast requires a functional repair system for mutation induction by chemical agents. (auth)
Plant cultivars derived from mutation induction or the use of induced mutants in cross breeding
International Nuclear Information System (INIS)
Micke, A.; Maluszynski, M.; Donini, B.
1985-01-01
Since 1969 we have collected information on cultivated varieties of plants, developed by using induced mutations. Whenever we learn about a cultivar presumably derived from an induced mutant or from use of mutants in crosses. we mail a questionnaire to the breeder. The information gathered in this way is stored in our file on ''Mutant Varieties''. Excerpts are published regularly in the form of a list in the FAO/IAEA Mutation Breeding Newsletter. Our mutant variety list has repeatedly provided a basis for analyses on the value and prospects of mutation breeding
Plant cultivars derived from mutation induction or the use of induced mutants in cross breeding
Energy Technology Data Exchange (ETDEWEB)
Micke, A; Maluszynski, M; Donini, B [Joint FAO/IAEA Division, Plant Breeding and Genetics Section, Vienna (Austria)
1985-05-01
Since 1969 we have collected information on cultivated varieties of plants, developed by using induced mutations. Whenever we learn about a cultivar presumably derived from an induced mutant or from use of mutants in crosses. we mail a questionnaire to the breeder. The information gathered in this way is stored in our file on ''Mutant Varieties''. Excerpts are published regularly in the form of a list in the FAO/IAEA Mutation Breeding Newsletter. Our mutant variety list has repeatedly provided a basis for analyses on the value and prospects of mutation breeding.
The conserved Phe GH5 of importance for hemoglobin intersubunit contact is mutated in gadoid fish
2014-01-01
Background Functionality of the tetrameric hemoglobin molecule seems to be determined by a few amino acids located in key positions. Oxygen binding encompasses structural changes at the interfaces between the α1β2 and α2β1 dimers, but also subunit interactions are important for the oxygen binding affinity and stability. The latter packing contacts include the conserved Arg B12 interacting with Phe GH5, which is replaced by Leu and Tyr in the αA and αD chains, respectively, of birds and reptiles. Results Searching all known hemoglobins from a variety of gnathostome species (jawed vertebrates) revealed the almost invariant Arg B12 coded by the AGG triplet positioned at an exon-intron boundary. Rare substitutions of Arg B12 in the gnathostome β globins were found in pig, tree shrew and scaled reptiles. Phe GH5 is also highly conserved in the β globins, except for the Leu replacement in the β1 globin of five marine gadoid species, gilthead seabream and the Comoran coelacanth, while Cys and Ile were found in burbot and yellow croaker, respectively. Atlantic cod β1 globin showed a Leu/Met polymorphism at position GH5 dominated by the Met variant in northwest-Atlantic populations that was rarely found in northeast-Atlantic cod. Site-specific analyses identified six consensus codons under positive selection, including 122β(GH5), indicating that the amino acid changes identified at this position may offer an adaptive advantage. In fact, computational mutation analysis showed that the replacement of Phe GH5 with Leu or Cys decreased the number of van der Waals contacts essentially in the deoxy form that probably causes a slight increase in the oxygen binding affinity. Conclusions The almost invariant Arg B12 and the AGG codon seem to be important for the packing contacts and pre-mRNA processing, respectively, but the rare mutations identified might be beneficial. The Leu122β1(GH5)Met and Met55β1(D6)Val polymorphisms in Atlantic cod hemoglobin modify the
International Nuclear Information System (INIS)
Aleksandrova, M.V.; Lapidus, I.L.; Aleksandrov, I.D.; Karpovskij, A.L.
1996-01-01
The white locus in D.Melanogaster was selected as a target gene for the study of the mutational spectra of spontaneously arising and radiation-induced gene mutations in a whole organism. Analysis of 6 spontaneous and 73 γ-ray-induced white mutations by a combination of cytological, genetic and molecular techniques revealed that on the chromosomal and genetic levels all spontaneous mutations showed themselves to be point mutants. The share of such mutants among all heritable radiation-induced gene mutations is about 40%, whereas the rest ones are due to exchange breaks (8%) as well as multilocus, single-locus or partial-locus (intragenic) deletions (52%). The DNAs from 4 spontaneous and 17 γ-ray-induced point mutants were analysed by Southern blot-hybridization. The three spontaneous and 7 radiation mutants showed an altered DNA sequence at the left (distal) half of the white gene due to insertion or DNA rearrangement. The rest (58%) of the radiation-induced point mutations did not indicate any alternations in this part of the gene as detected by this technique and probes employed. 15 refs., 3 figs., 1 tab
Structure modeling and mutational analysis of gap junction beta 2 ...
African Journals Online (AJOL)
Yomi
2012-04-03
Apr 3, 2012 ... Three dimensional (3 D) structure is very useful for understanding biological functions. Gap junction beta 2 (GJB2), human gene encoding for gap junction beta 2 protein is involved in ... Research in deafness became real.
Induction of nano pore in Agrobacterial hemoglobin
Directory of Open Access Journals (Sweden)
Mojtaba Tousheh
2014-01-01
Full Text Available Introduction: A variety of oxygen-transport and -binding proteins exist in organisms including bacteria, protozoans, and fungi all have hemoglobin-like proteins. In addition to dealing with transport and sensing of oxygen, they may also deal with NO2, CO2, sulfide compounds, and even O2 scavenging in environments. Also they detoxified chlorinated materials like P450 enzymes and peroxidases and use as a detector of nitrate and hydrogen peroxide. Pore-forming bacterial globins are interested for filtration. Materials and methods: Although there are data for bacterial toxin as a filter, here we used Agrobacterial hem to induce nano pore in the heme structure using point mutation. Results: Investigations showed that three amino acids leucine 76, alanine 83 and histidine 80 are important for pore formation in Agrobacterium hemoglobin. A point mutation on leucine 76 to glycine, histidine 80 to asparagine and alanine 83 to lysine step by step led to create the nano pore 0.7- 0.8 nm in the globin. Discussion and conclusion: These mutations in bacterial hemoglobin increase the stability when mutation is with it’s at pH7. This mutation decreases the aliphatic index however increase the stability index.
DEFF Research Database (Denmark)
Størling, Joachim; Zaitsev, Sergei V; Kapelioukh, Iouri L
2005-01-01
The c-jun N-terminal kinase (JNK) signaling pathway mediates IL-1beta-induced apoptosis in insulin-secreting cells, a mechanism relevant to the destruction of pancreatic beta-cells in type 1 and 2 diabetes. However, the mechanisms that contribute to IL-1beta activation of JNK in beta-cells are la...
DEFF Research Database (Denmark)
Bruun, Christine; Heding, Peter E; Rønn, Sif G
2009-01-01
Tumor necrosis factor-alpha (TNFalpha) is a pro-inflammatory cytokine involved in the pathogenesis of several diseases including type 1 diabetes mellitus (T1DM). TNFalpha in combination with interleukin-1-beta (IL-1beta) and/or interferon-gamma (IFNgamma) induces specific destruction...
Huizing, Marjan; Scher, Charles D; Strovel, Erin; Fitzpatrick, Diana L; Hartnell, Lisa M; Anikster, Yair; Gahl, William A
2002-02-01
Hermansky-Pudlak syndrome (HPS) is an autosomal recessive disease consisting of oculocutaneous albinism and a storage pool deficiency resulting from absent platelet dense bodies. The disorder is genetically heterogeneous. The majority of patients, including members of a large genetic isolate in northwest Puerto Rico, have mutations in HPS1. Another gene, ADTB3A, was shown to cause HPS-2 in two brothers having compound heterozygous mutations that allowed for residual production of the gene product, the beta3A subunit of adaptor complex-3 (AP-3). This heterotetrameric complex serves as a coat protein-mediating formation of intracellular vesicles, e.g. the melanosome and platelet dense body, from membranes of the trans-Golgi network. We determined the genomic organization of the human ADTB3A gene, with intron/exon boundaries, and describe a third patient with beta3A deficiency. This 5-y-old boy has two nonsense mutations, C1578T (R-->X) and G2028T (E-->X), which produce no ADTB3A mRNA and no beta3A protein. The associated mu3 subunit of AP-3 is also entirely absent. In fibroblasts, the cell biologic concomitant of this deficiency is robust and aberrant trafficking through the plasma membrane of LAMP-3, an integral lysosomal membrane protein normally carried directly to the lysosome. The clinical concomitant is a severe, G-CSF-responsive neutropenia in addition to oculocutaneous albinism and platelet storage pool deficiency. Our findings expand the molecular, cellular, and clinical spectrum of HPS-2 and call for an increased index of suspicion for this diagnosis among patients with features of albinism, bleeding, and neutropenia.
Development of radiation-induced mutation techniques and functional genomics studies
International Nuclear Information System (INIS)
Kim, Dong Sub; Kang, Si Yong; Kim, Jin Baek
2012-01-01
This project has been performed to develop plant genetic resources using radiation (gamma-rays, ion-beam, space environments), to conduct functional genomics studies with mutant resources, and to develop new radiation plant breeding techniques using various radiation sources during 3 years. In the first section, we developed flower genetic resources, functional crop resources, and bio-industrial plant resources. In the second section, we cloned several mutated genes and studied mechanisms of gene expression and genetic diversity of mutations induced by gamma-rays. In the third section, we developed new plant breeding techniques using gamma-phytotron, heavy ion-beam, and space environments. Based on these results, a total of 8 cultivars containing Chrysanthemum, Hibiscus, kenaf, rice, and soybean were applied for plant variety protection (PVP) and a total of 4 cultivars were registered for PVP. Also, license agreement for the dwarf type Hibiscus mutant 'Ggoma' was conducted with Supro co. and the manufacturing technology for natural antioxidant pear-grape vinegar was transferred into Enzenic co. Also, 8 gene sequences, such as F3'H and LDOX genes associated with flower color in Chrysanthemum and EPSPS gene from Korean lawn grass, were registered in the database of National Center for Biotechnology Information (NCBI). In the future study, we will develop new radiation mutation breeding techniques through the mutation spectrum induced by various radiation sources, the studies for mechanism of the cellular response to radiation, and the comparative·structural·functional genomics studies for useful traits
Yadav, Rajiv; Lazarus, Monica; Ghanghoria, Pawan; Singh, Mpss; Gupta, Rasik Behari; Kumar, Surendra; Sharma, Ravendra K; Shanmugam, Rajasubramaniam
2016-10-01
The clinical manifestation in sickle cell disease (SCD) patients varies from one individual to another due to factors like the presence of alpha-thalassaemia mutation, foetal haemoglobin, and β-globin gene haplotype. The present study enumerates the clinical profile of sickle cell anaemia patients from Central India. Seven hundred seventy-six SCD patients from Jabalpur and surrounding districts (Madhya Pradesh) in central India were registered with the sickle cell clinic of NIRTH, Jabalpur. The present study reveals recorded signs and symptoms of genetically confirmed sickle cell anaemia (404) and sickle beta thalassaemia (92) patients. Majority of the patients were from scheduled caste communities (47.9%) and Gond tribal community (13.8%). Splenomegaly was the most common clinical manifestation observed (71.4%). Overall, 63.5% patients had a history of blood transfusion. The most frequent signs and symptoms observed were Pallor, Icterus, Joint pain, Fever, and Fatigue. Majority of the patients revealed onset of disease prior to attaining the age of 3 years (sickle cell anaemia 44.3% and sickle beta thalassaemia 35.9%). Mean haemoglobin levels among SCA individuals were marginally higher than SBT patients. On the other hand, mean foetal haemoglobin levels among SBT individuals showed the reverse trend. Notably, the present study reports the first incidence of priapism recorded in Central India. The study revealed a high prevalence of SCD among scheduled caste, backward caste, and tribal communities. Dissemination of study findings, screening, pre-marriage counselling, and pre-natal diagnosis are fundamental to preventing or lowering of birth of sickle cell anaemia children in the affected populations.
Induction of mutation in Trichoderma viride for conversion of natural cellulose into glucose
Energy Technology Data Exchange (ETDEWEB)
Tahoun, M.K.; Khalil, A.I.; Helmi, S.; Khairy, A.H. [Univ. of Alexandria Research Centre, Alexandria (Egypt)
1991-12-31
The production of cellulolytic enzymes from fungi has been extensively studied. Several mutants of Trichoderma reesei were selected. Most of the studies were carried out on T. reesei, T. viride, T. harzianum, Penicillium funiculosum, Altemaria alternata. Aspergillus phoenicis, A. ustus, A. tamarii, A. japonicus, and A. niger. T. koningii is one of the most active producers of the so-called C, factor, which is indispensable for the rapid and extensive attack on crystal-line cellulose. However, Trichodenna is known to excrete only small amounts of {beta}-glucosidase. Therefore, Trichoderma is supplemented with {beta}-glucosidase from Aspergillus to increase the saccharification rate of cellulose to glucose as the main sugar. Induction of mutations in Trichodenna spp. rather than T. viride as a tool for the enhancement of {beta}-glucosidase activity was reported. Unfortunately, T. reesei is a poor producer of {beta}-glucosidase. On the other hand, T. harzianum M{sub 5}, a mutant that was induced by gamma radiation, produced high yields, not only of Avicelase and carboxy methyl cellulose, but also of {beta}-glucosidase, than its respective wild type.
Induced mutation in soybean (Glycine max L.) breeding
International Nuclear Information System (INIS)
Tulmann Neto, A.; Menten, J.O.M.; Ando, A.
1984-01-01
The induced mutation in soybean (Glycine max, L.) breeding is studied. Seed treatment with gamma-rays or methanesulfonic acid ethyl ester (EMs) is used in the following varieties: Parana, Santa Rosa, UFV-1, Foscarin 31 and IAC-8. The study to obtain resistance to the soybean bud blight virus and mutants resistant to rust was done. Early mutants are also researched. (M.A.C.) [pt
Molecular analysis of Hb Q-H disease and Hb Q-Hb E in a Singaporean family.
Tan, J; Tay, J S; Wong, Y C; Kham, S K; Bte Abd Aziz, N; Teo, S H; Wong, H B
1995-01-01
Hb Q (alpha 74Asp-His) results from a mutation in the alpha-gene such that abnormal alpha Q-chains are synthesized. The alpha Q-chains combine with the normal Beta A-chains to form abnormal Hb alpha 2Q beta 2A (Hb Q). Hb Q-H disease is rare, and has been reported only in the Chinese. We report here a Chinese family, were the mother diagnosed with Hb Q-H disease and the father with Hb E heterozygosity and a child with Hb Q-E-thalassemia. Thalassemia screening of the mother's blood revealed a Hb level of 6.8g/dl with low MCV and MCH. Her blood film was indicative of thalassemia. Cellulose acetate electrophoresis showed Hb H and Hb Q with the absence of Hb A. Globin chain biosynthesis was carried out and alpha Q- and beta-chains were detected. Normal alpha- chains were absent. Digestion of the mother's DNA with Bam HI and Bgl II followed by hybridization with the 1.5 kb alpha-Pst probe showed a two alpha-gene deletion on one chromosome and the -alpha Q chain mutant with the -alpha 4.2 defect on the other chromosome. DNA amplification studies indicated the two-gene deletion to be of the -SEA/ defect. The patient was concluded to possess Hb Q-H disease (--SEA/-alpha 4.2Q). Cellulose acetate electrophoresis of the father's blood showed the presence of Hb A, F and E. Molecular analysis of the father's DNA confirmed an intact set of alpha-genes (alpha alpha/alpha alpha). Globin chain biosynthesis of fetal blood of their child showed gamma, beta A, beta E, alpha A and alpha Q-chains. Molecular analysis of the child's DNA showed one alpha-gene deletion, thus giving a genotype of alpha alpha/-alpha 4.2Q beta beta E.
Nagashima, Haruki; Shiraishi, Kumiko; Ohkawa, Saori; Sakamoto, Yuki; Komatsu, Kenshi; Matsuura, Shinya; Tachibana, Akira; Tauchi, Hiroshi
2017-10-19
It is difficult to distinguish radiation-induced events from spontaneous events during induction of stochastic effects, especially in the case of low-dose or low-dose-rate exposures. By using a hypersensitive system for detecting somatic mutations at the HPRT1 locus, we investigated the frequency and spectrum of mutations induced by low-dose X-rays. The mutant frequencies induced by doses of >0.15 Gy were statistically significant when compared with the spontaneous frequency, and a clear dose dependency was also observed for mutant frequencies at doses of >0.15 Gy. In contrast, mutant frequencies at doses of 0.2 Gy. Our observations suggest that there could be a critical dose for mutation induction at between 0.1 Gy and 0.2 Gy, where mutagenic events are induced by multiple DNA double-strand breaks (DSBs). These observations also suggest that low-dose radiation delivered at doses of <0.1 Gy may not result in DSB-induced mutations but may enhance spontaneous mutagenesis events. © The Author 2017. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.
Beta-thalassaemia trait: haematological parameters
International Nuclear Information System (INIS)
Yousafzai, Y.M.; Khan, S.; Raziq, F.
2010-01-01
Thalassaemia syndromes are a group of hereditary disorders characterised by a genetic deficiency in the synthesis of --globin genes. The objective of this study was to determine the haematological features -thalassaemia trait (BTT), and to determine the sensitivity of Mean Corpuscular Volume (MCV), Mean Corpuscular Haemoglobin (MCH) and -thalassaemia trait. Methods: A descriptive study was conducted in Hayatabad Medical Complex, Peshawar from May 2009 to May 2010 with 203 subjects having BTT. Blood samples were collected in EDTA anti-coagulated tubes. RBC indices were taken as part of complete blood count (CBC) by haematology analyser, and Haemoglobin (Hb) electrophoresis was done to determine the HbA2 percentage. The data was collected and analyzed on statistical software for demographic details, RBC indices and HBA2 levels. Results: Out of 203 patients, 92 (45%) were males and 111 (55%) were females. Most patients tested were in the 15-45 year age group. One-hundred-sixty (79%) patients had anaemia. MCV was lower than 76 fl in all the cases. Mean MCV was 59.1 fl. MCH was low, the mean MCH being 19.3 g/dl. MCH <26 gave sensitivity of 99% in detecting BTT. We calculated MI for these cases and found out that it was <12 in 75% of cases and <15 in 197 (97%). Conclusion: Beta-thalassaemia traits present with a microcytic hypochromic blood picture, detected on simple haematology analysers as low MCV and MCH and MI which provide a beta- thalassaemia trait. (author)
Energy Technology Data Exchange (ETDEWEB)
Hartman, P S; De Wilde, D; Dwarakanath, V N [Texas Christian Univ., Fort Worth, TX (United States). Dept. of Biology
1995-06-01
The utility of a new target gene (fem-3) is described for investigating the molecular nature of mutagenesis in the nematode Caenorhabditis elegans. As a principal attribute, this system allows for the selection, maintenance and molecular analysis of any type of mutation that disrupts the gene, including deletions. In this study, 86 mutant strains were isolated, of which 79 proved to have mutations in fem-3. Twenty of these originally tested as homozygous inviable. Homozygous inviability was expected, as Stewart and coworkers had previously observed that, unlike in other organisms, most UV radiation-induced mutations in C. elegans are chromosomal rearrangements of deficiencies (Mutat. Res 249, 37-54, 1991). However, additional data, including Southern blot analyses on 49 of the strains, indicated that most of the UV radiation-induced fem-3 mutations were not deficiencies, as originally inferred from their homozygous inviability. Instead, the lethals were most likely ``coincident mutations`` in linked, essential genes that were concomitantly induced. As such, they were lost owing to genetic recombination during stock maintenance. As in mammalian cells, yeast and bacteria, the frequency of coincident mutations was much higher than would be predicted by chance. (Author).
Yang, Zhantao; Keel, Siobán B; Shimamura, Akiko; Liu, Li; Gerds, Aaron T; Li, Henry Y; Wood, Brent L; Scott, Bart L; Abkowitz, Janis L
2016-05-11
Diamond Blackfan anemia (DBA) and myelodysplastic syndrome (MDS) with isolated del(5q) are severe macrocytic anemias; although both are associated with impaired ribosome assembly, why the anemia occurs is not known. We cultured marrow cells from DBA (n = 3) and del(5q) MDS (n = 6) patients and determined how heme (a toxic chemical) and globin (a protein) are coordinated. We show that globin translation initiates slowly, whereas heme synthesis proceeds normally. This results in insufficient globin protein, excess heme and excess reactive oxygen species in early erythroid precursors, and CFU-E (colony-forming unit-erythroid)/proerythroblast cell death. The cells that can more rapidly and effectively export heme or can slow heme synthesis preferentially survive and appropriately mature. Consistent with these observations, treatment with 10 μM succinylacetone, a specific inhibitor of heme synthesis, improved the erythroid cell output of DBA and del(5q) MDS marrow cultures by 68 to 95% (P = 0.03 to 0.05), whereas the erythroid cell output of concurrent control marrow cultures decreased by 4 to 13%. Our studies demonstrate that erythropoiesis fails when heme exceeds globin. Our data further suggest that therapies that decrease heme synthesis (or facilitate heme export) could improve the red blood cell production of persons with DBA, del(5q) MDS, and perhaps other macrocytic anemias. Copyright © 2016, American Association for the Advancement of Science.
Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S
2012-01-01
Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited
Directory of Open Access Journals (Sweden)
Igor Sobol
2015-03-01
Full Text Available Multiple sclerosis (MS is an immune-mediated inflammatory and neurodegenerative disease of the central nervous system. Interferon (IFN beta is an active ingredient of five out of twelve disease modifying treatments approved for MS. We report a case of IFN-beta-induced cardiac arrhythmia with premature ventricular contractures in a patient recently diagnosed with MS.
Domingues-Hamdi, Elisa; Vasseur, Corinne; Fournier, Jean-Baptiste; Marden, Michael C; Wajcman, Henri; Baudin-Creuza, Véronique
2014-01-01
Alpha-Hemoglobin Stabilizing Protein (AHSP) binds to α-hemoglobin (α-Hb) or α-globin and maintains it in a soluble state until its association with the β-Hb chain partner to form Hb tetramers. AHSP specifically recognizes the G and H helices of α-Hb. To investigate the degree of interaction of the various regions of the α-globin H helix with AHSP, this interface was studied by stepwise elimination of regions of the α-globin H helix: five truncated α-Hbs α-Hb1-138, α-Hb1-134, α-Hb1-126, α-Hb1-123, α-Hb1-117 were co-expressed with AHSP as two glutathione-S-transferase (GST) fusion proteins. SDS-PAGE and Western Blot analysis revealed that the level of expression of each truncated α-Hb was similar to that of the wild type α-Hb except the shortest protein α-Hb1-117 which displayed a decreased expression. While truncated GST-α-Hb1-138 and GST-α-Hb1-134 were normally soluble; the shorter globins GST-α-Hb1-126 and GST-α-Hb1-117 were obtained in very low quantities, and the truncated GST-α-Hb1-123 provided the least material. Absorbance and fluorescence studies of complexes showed that the truncated α-Hb1-134 and shorter forms led to modified absorption spectra together with an increased fluorescence emission. This attests that shortening the H helix leads to a lower affinity of the α-globin for the heme. Upon addition of β-Hb, the increase in fluorescence indicates the replacement of AHSP by β-Hb. The CO binding kinetics of different truncated AHSPWT/α-Hb complexes showed that these Hbs were not functionally normal in terms of the allosteric transition. The N-terminal part of the H helix is primordial for interaction with AHSP and C-terminal part for interaction with heme, both features being required for stability of α-globin chain.
Bayraktaroglu, Taner; Noel, Janet; Mukaddes, Nahit Motavalli; Refetoff, Samuel
2018-01-01
Two members of a Turkish family, a mother and son, had thyroid function tests suggestive of resistance to thyroid hormone (RTH). The clinical presentation was, however, different. The mother (proposita) had palpitation, weakness, tiredness, nervousness, dry mouth and was misdiagnosed as having multinodular toxic goiter which was treated with antithyroid drugs and partial thyroidectomy. Her younger son had attention deficit hyperactivity disorder and primary encopresis, but normal intellectual quotient. Both had elevated serum iodothyronine levels with nonsuppressed thyrotropin. A mutation in one allele of the thyroid hormone receptor beta gene (P453A) was identified, providing a genetic confirmation for the diagnosis of RTH. PMID:18561095
Varley, C L; Royds, J A; Brown, B L; Dobson, P R
2001-01-01
We present evidence here that the proinflammatory cytokine, interleukin-1 beta (IL-1 beta) stimulates a significant increase in protein kinase C (PKC)-epsilon and PKC-delta protein levels and increases PKC-epsilon, but not PKC-delta, transcripts in EL4 thymoma cells. Incubation of EL4 cells with IL-1 beta induced protein synthesis of PKC-epsilon (6-fold increase) by 7 h and had a biphasic effect on PKC-delta levels with peaks at 4 h (2-fold increase) and 24 h (4-fold increase). At the level of mRNA, PKC-epsilon, but not PKC-delta levels, were induced after incubation of EL4 cells with IL-1 beta. The signalling mechanisms utilized by IL-1 beta to induce the synthesis of these PKC isoforms were investigated. Two phosphatidylinositol (PI) 3-kinase-specific inhibitors, wortmannin and LY294002, inhibited IL-1 beta-induced synthesis of PKC-epsilon. However, the PI 3-kinase inhibitors had little effect on the IL-1 beta-induced synthesis of PKC-delta in these cells. Our results indicate that IL-1 beta induced both PKC-delta and PKC-epsilon expression over different time periods. Furthermore, our evidence suggests that IL-1 beta induction of PKC-epsilon, but not PKC-delta, may occur via the PI 3-kinase pathway. Copyright 2001 S. Karger AG, Basel
A radiation-induced compact type Granny Smith apple mutation
International Nuclear Information System (INIS)
Hurter, N.; Van Tonder, M.J.
1982-01-01
More successful compact mutant clones of Granny Smith apple are being sought, for those that have so far arisen naturally have undesirable tree and fruit charateristics. For this purpose, gamma rays from a Cobalt-60 radiation unit were used to induce mutant types artificially. One compact mutation of Granny Smith was produced via re-irradiation
Emets, A I; Baiard, U V; Nyporko, A Iu; Swire-Clark, G A; Blium, Ia B
2009-01-01
The identification of point mutation locations on beta-tubulin molecules of amiprophosmethyl- and trifluralin-resistant Nicotiana plumbaginifolia lines have described in the work. It was shown that in the first case this mutation is connected with the substitution ofserine residue on proline in position 248; in the second case--with the substitution of phenilalanine on serine in position 317 of beta-tubulin amino acid sequence. Three-dimensional models of beta-tubulin molecule from Chlamydomonas with well-known location of mutations conferring dinitroaniline- and phosphorotioamidate resistance (substitution of lysine residue to methionine on position 350), and beta-tubulin from Nicotiana plumbaginifolia have been reconstructed. On the basis of analysis of site of interaction with dinitroanilines and phosphorotioamides on Chlamydomonas beta-tubulin molecule it was concluded that the revealed mutations on Nicotiana plumbaginifolia beta-tubulin affect amino acid residues participating in formation of this site.
Parr, Maria Kristina; Zhao, Piwen; Haupt, Oliver; Ngueu, Sandrine Tchoukouegno; Hengevoss, Jonas; Fritzemeier, Karl Heinrich; Piechotta, Marion; Schlörer, Nils; Muhn, Peter; Zheng, Wen-Ya; Xie, Ming-Yong; Diel, Patrick
2014-09-01
The phytoectysteroid ecdysterone (Ecdy) was reported to stimulate protein synthesis and enhance physical performance. The aim of this study was to investigate underlying molecular mechanisms particularly the role of ER beta (ERβ). In male rats, Ecdy treatment increased muscle fiber size, serum IGF-1 increased, and corticosteron and 17β-estradiol (E2) decreased. In differentiated C2C12 myoblastoma cells, treatment with Ecdy, dihydrotestosterone, IGF-1 but also E2 results in hypertrophy. Hypertrophy induced by E2 and Ecdy could be antagonized with an antiestrogen but not by an antiandrogen. In HEK293 cells transfected with ER alpha (ERα) or ERβ, Ecdy treatment transactivated a reporter gene. To elucidate the role of ERβ in Ecdy-mediated muscle hypertrophy, C2C12 myotubes were treated with ERα (ALPHA) and ERβ (BETA) selective ligands. Ecdy and BETA treatment but not ALPHA induced hypertrophy. The effect of Ecdy, E2, and BETA could be antagonized by an ERβ-selective antagonist (ANTIBETA). In summary, our results indicate that ERβ is involved in the mediation of the anabolic activity of the Ecdy. These findings provide new therapeutic perspectives for the treatment of muscle injuries, sarcopenia, and cachectic disease, but also imply that such a substance could be abused for doping purposes. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Development of radiation-induced mutation techniques and functional genomics studies
Energy Technology Data Exchange (ETDEWEB)
Kim, Dong Sub; Kang, Si Yong; Kim, Jin Baek [KAERI, Daejeon (Korea, Republic of); and others
2012-01-15
This project has been performed to develop plant genetic resources using radiation (gamma-rays, ion-beam, space environments), to conduct functional genomics studies with mutant resources, and to develop new radiation plant breeding techniques using various radiation sources during 3 years. In the first section, we developed flower genetic resources, functional crop resources, and bio-industrial plant resources. In the second section, we cloned several mutated genes and studied mechanisms of gene expression and genetic diversity of mutations induced by gamma-rays. In the third section, we developed new plant breeding techniques using gamma-phytotron, heavy ion-beam, and space environments. Based on these results, a total of 8 cultivars containing Chrysanthemum, Hibiscus, kenaf, rice, and soybean were applied for plant variety protection (PVP) and a total of 4 cultivars were registered for PVP. Also, license agreement for the dwarf type Hibiscus mutant 'Ggoma' was conducted with Supro co. and the manufacturing technology for natural antioxidant pear-grape vinegar was transferred into Enzenic co. Also, 8 gene sequences, such as F3'H and LDOX genes associated with flower color in Chrysanthemum and EPSPS gene from Korean lawn grass, were registered in the database of National Center for Biotechnology Information (NCBI). In the future study, we will develop new radiation mutation breeding techniques through the mutation spectrum induced by various radiation sources, the studies for mechanism of the cellular response to radiation, and the comparative{center_dot}structural{center_dot}functional genomics studies for useful traits.
Gamma radiation-induced heritable mutations at repetitive DNA loci in out-bred mice
International Nuclear Information System (INIS)
Somers, C.M.; Sharma, R.; Quinn, J.S.; Boreham, D.R.
2004-01-01
Recent studies have shown that expanded-simple-tandem-repeat (ESTR) DNA loci are efficient genetic markers for detecting radiation-induced germ line mutations in mice. Dose responses following irradiation, however, have only been characterized in a small number of inbred mouse strains, and no studies have applied Esters to examine potential modifiers of radiation risk, such as adaptive response. We gamma-irradiated groups of male out-bred Swiss-Webster mice with single acute doses of 0.5 and 1.0 Gy, and compared germ line mutation rates at ESTR loci to a sham-irradiated control. To test for evidence of adaptive response we treated a third group with a total dose of 1.1 Gy that was fractionated into a 0.1 Gy adapting dose, followed by a challenge dose of 1.0 Gy 24 h later. Paternal mutation rates were significantly elevated above the control in the 0.5 Gy (2.8-fold) and 1.0 Gy (3.0-fold) groups, but were similar to each other despite the difference in radiation dose. The doubling dose for paternal mutation induction was 0.26 Gy (95% CI = 0.14-0.51 Gy). Males adapted with a 0.1 Gy dose prior to a 1.0 Gy challenge dose had mutation rates that were not significantly elevated above the control, and were 43% reduced compared to those receiving single doses. We conclude that pre-meiotic male germ cells in out-bred Swiss-Webster mice are sensitive to ESTR mutations induced by acute doses of ionizing radiation, but mutation induction may become saturated at a lower dose than in some strains of inbred mice. Reduced mutation rates in the adapted group provide intriguing evidence for suppression of ESTR mutations in the male germline through adaptive response. Repetitive DNA markers may be useful tools for exploration of biological factors affecting the probability of heritable mutations caused by low-dose ionizing radiation exposure. The biological significance of ESTR mutations in terms of radiation risk assessment, however, is still undetermined
Analysis of chlorophyll mutations induced by γ-rays in barley (hordeum vulgare)
International Nuclear Information System (INIS)
Wang Cailian; Shen Mei; Xu Gang; Zhao Kongnan; Chen Qiufang
1991-06-01
Thirty varieties of dormant barley seeds were irradiated with 137 Cs γ-rays. Dose-effect relations of chlorophyll mutation frequency in M 2 seedling and differences resulting from cultured types or radiosensitive types were investigated. Experimental results show that the relations between chlorophyll mutation frequency and doses can be fitted by a linear regression equation Y = A + BX. According to analysis of covariance, there is no considerable difference in various cultured types, but the difference of five different radiosensitive types is remarkable. The sensitive and intermediate types need much lower doses than other types to induce maximum chlorophyll mutation
International Nuclear Information System (INIS)
Yao Suyan; Zhang Chaoyang; Dai Lianlian; Gao Changwen
1991-01-01
Relationship between aneuploidy, dominant lethal mutations and doses in young feral mice induced by low dose γ-rays was examined. The results suggest that the frequencies of aneuploidy of embryos increased at 0.15 Gy, but increases at over 0.50 Gy after irradiation in groups. The frequencies of aneuploidy and dominant lethal mutations increased with increasing doses and fitted linear relationship. This dose-response relationship of trisomic was not significant. The frequency of dominant lethal mutations induced by 60 Co γ irradiation is 5.59%. The effect of dominant lethal mutation is higher than that of the aneuploidy
Energy Technology Data Exchange (ETDEWEB)
Raman, Dayanidhi; Milatovic, Snjezana-Zaja [Department of Cancer Biology, Vanderbilt University, School of Medicine, Nashville, TN 37232 (United States); Milatovic, Dejan [Department of Pediatrics/Pediatric Toxicology, Vanderbilt University, School of Medicine, Nashville, TN 37232 (United States); Splittgerber, Ryan [Department of Cancer Biology, Vanderbilt University, School of Medicine, Nashville, TN 37232 (United States); Fan, Guo-Huang [Department of Neurobiology and Neurotoxicology, Meharry Medical College, Nashville, TN 37221 (United States); Richmond, Ann, E-mail: ann.richmond@vanderbilt.edu [VA Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University, School of Medicine, Nashville, TN 37232 (United States)
2011-11-15
Alzheimer's disease (AD) is characterized by a progressive cognitive decline and accumulation of neurotoxic oligomeric peptides amyloid-{beta} (A{beta}). Although the molecular events are not entirely known, it has become evident that inflammation, environmental and other risk factors may play a causal, disruptive and/or protective role in the development of AD. The present study investigated the ability of the chemokines, macrophage inflammatory protein-2 (MIP-2) and stromal cell-derived factor-1{alpha} (SDF-1{alpha}), the respective ligands for chemokine receptors CXCR2 and CXCR4, to suppress A{beta}-induced neurotoxicity in vitro and in vivo. Pretreatment with MIP-2 or SDF-1{alpha} significantly protected neurons from A{beta}-induced dendritic regression and apoptosis in vitro through activation of Akt, ERK1/2 and maintenance of metalloproteinase ADAM17 especially with SDF-1{alpha}. Intra-cerebroventricular (ICV) injection of A{beta} led to reduction in dendritic length and spine density of pyramidal neurons in the CA1 area of the hippocampus and increased oxidative damage 24 h following the exposure. The A{beta}-induced morphometric changes of neurons and increase in biomarkers of oxidative damage, F{sub 2}-isoprostanes, were significantly inhibited by pretreatment with the chemokines MIP-2 or SDF-1{alpha}. Additionally, MIP-2 or SDF-1{alpha} was able to suppress the aberrant mislocalization of p21-activated kinase (PAK), one of the proteins involved in the maintenance of dendritic spines. Furthermore, MIP-2 also protected neurons against A{beta} neurotoxicity in CXCR2-/- mice, potentially through observed up regulation of CXCR1 mRNA. Understanding the neuroprotective potential of chemokines is crucial in defining the role for their employment during the early stages of neurodegeneration. -- Research highlights: Black-Right-Pointing-Pointer Neuroprotective ability of the chemokines MIP2 and CXCL12 against A{beta} toxicity. Black-Right-Pointing-Pointer MIP
Energy Technology Data Exchange (ETDEWEB)
Grasso, P.; Santa-Coloma, T.A.; Reichert, L.E. Jr. (Department of Biochemistry, Albany Medical College, New York, NY (USA))
1991-06-01
We have previously described FSH receptor-mediated influx of 45Ca++ in cultured Sertoli cells from immature rats and receptor-enriched proteoliposomes via activation of voltage-sensitive and voltage-independent calcium channels. We have further shown that this effect of FSH does not require cholera toxin- or pertussis toxin-sensitive guanine nucleotide binding protein or activation of adenylate cyclase. In the present study, we have identified regions of human FSH-beta-subunit which appear to be involved in mediating calcium influx. We screened 11 overlapping peptide amides representing the entire primary structure of hFSH-beta-subunit for their effects on 45Ca++ flux in FSH receptor-enriched proteoliposomes. hFSH-beta-(1-15) and hFSH-beta-(51-65) induced uptake of 45Ca++ in a concentration-related manner. This effect of hFSH-beta-(1-15) and hFSH-beta-(51-65) was also observed in liposomes lacking incorporated FSH receptor. Reducing membrane fluidity by incubating liposomes (containing no receptor) with hFSH-beta-(1-15) or hFSH-beta-(51-65) at temperatures lower than the transition temperatures of their constituent phospholipids resulted in no significant (P greater than 0.05) difference in 45Ca++ uptake. The effectiveness of the calcium ionophore A23187, however, was abolished. Ruthenium red, a voltage-independent calcium channel antagonist, was able to completely block uptake of 45Ca++ induced by hFSH-beta-(1-15) and hFSH-beta-(51-65) whereas nifedipine, a calcium channel blocker specific for L-type voltage-sensitive calcium channels, was without effect. These results suggest that in addition to its effect on voltage-sensitive calcium channel activity, interaction of FSH with its receptor may induce formation of transmembrane aqueous channels which also facilitate influx of extracellular calcium.
Cunnick, J E; Lysle, D T; Kucinski, B J; Rabin, B S
1990-07-01
Our previous work has demonstrated that presentations of mild foot-shock to Lewis rats induces a suppression of splenic and peripheral blood lymphocyte responses to nonspecific T-cell mitogens. The present study demonstrated that adrenalectomy prevented the shock-induced suppression of the mitogenic response of peripheral blood T-cells but did not attenuate the suppression of splenic T-cells. Conversely, the beta-adrenergic receptor antagonists, propranolol and nadolol, attenuated the shock-induced suppression of splenic T-cells in a dose-dependent manner but did not attenuate suppression of the blood mitogen response. These data indicate that distinct mechanisms mediate the shock-induced suppression of T-cell responsiveness to mitogens in the spleen and the peripheral blood. The results indicate that the peripheral release of catecholamines is responsible for splenic immune suppression and that adrenal hormones, which do not interact with beta-adrenergic receptors, are responsible for shock-induced suppression of blood mitogenic responses.
Induced mutations for improvement of grain legume production
International Nuclear Information System (INIS)
1980-11-01
After an introduction on plant science research in Malaysia concerning crop breeding, 22 research reports are presented, 17 of which are analyzed individually and constitute separate INIS references. The remaining 5 were essentially concerned with only future applications of nuclear technology: a paper by V.L. Chopra (India) on mutation breeding for partial disease resistance of wheat; by H.H. Hoppe (Federal Republic of Germany) on mechanisms of resistance against Uromyces in Phaseolus vulgaris; by I.S. Santos (Philippines) on induction evaluation and utilization of beneficial mutations in the winged bean (Psophocarpus tetragonolobus), where gamma rays and fast neutrons will be used as well as other mutagens; by F. Saccardo (Italy) on breeding for disease resistance in peas and other vegetables (short communication only); and by E. Balazs and I. Sziraki (Hungary) on in vitro studies on virus resistance of legumes, including virus-host interaction studies involving gamma irradiation (short communication only). The conclusions and recommendations of the Regional Seminar on Induced Mutations for the Improvement of Grain Legumes in S.E. Asia 1975 (IAEA-203, 1977) were considered and generally endorsed, with some clarification. Conclusions and recommendations are given on p.121-126
DEFF Research Database (Denmark)
Hokland, M; Heron, I; Berg, K
1982-01-01
Normal human peripheral blood lymphocytes were incubated in the presence of different concentrations of interferon for various incubation periods. Subsequently, the amount of beta 2-Microglobulin and HLA-A, B and C surface antigens was estimated by means of quantitative immunofluorescence (flow...... cytofluorometry) and by a radioimmunoassay for beta 2-Microglobulin. It was found that the amounts of these MHC antigens increased in a dose and time-dependent way after interferon treatment. Furthermore, the influence of different temperatures on this IFN-induced increase in beta 2-Microglobulin was gradually...
A human beta cell line with drug inducible excision of immortalizing transgenes
Benazra, Marion; Lecomte, Marie-José; Colace, Claire; Müller, Andreas; Machado, Cécile; Pechberty, Severine; Bricout-Neveu, Emilie; Grenier-Godard, Maud; Solimena, Michele; Scharfmann, Raphaël; Czernichow, Paul; Ravassard, Philippe
2015-01-01
Objectives Access to immortalized human pancreatic beta cell lines that are phenotypically close to genuine adult beta cells, represent a major tool to better understand human beta cell physiology and develop new therapeutics for Diabetes. Here we derived a new conditionally immortalized human beta cell line, EndoC-βH3 in which immortalizing transgene can be efficiently removed by simple addition of tamoxifen. Methods We used lentiviral mediated gene transfer to stably integrate a tamoxifen inducible form of CRE (CRE-ERT2) into the recently developed conditionally immortalized EndoC βH2 line. The resulting EndoC-βH3 line was characterized before and after tamoxifen treatment for cell proliferation, insulin content and insulin secretion. Results We showed that EndoC-βH3 expressing CRE-ERT2 can be massively amplified in culture. We established an optimized tamoxifen treatment to efficiently excise the immortalizing transgenes resulting in proliferation arrest. In addition, insulin expression raised by 12 fold and insulin content increased by 23 fold reaching 2 μg of insulin per million cells. Such massive increase was accompanied by enhanced insulin secretion upon glucose stimulation. We further observed that tamoxifen treated cells maintained a stable function for 5 weeks in culture. Conclusions EndoC βH3 cell line represents a powerful tool that allows, using a simple and efficient procedure, the massive production of functional non-proliferative human beta cells. Such cells are close to genuine human beta cells and maintain a stable phenotype for 5 weeks in culture. PMID:26909308
Mia, Masum M.; Bank, Ruud A.
2015-01-01
Excessive accumulation of a collagen-rich extracellular matrix (ECM) by myofibroblasts is a characteristic feature of fibrosis, a pathological state leading to serious organ dysfunction. Transforming growth factor beta1 (TGF beta 1) is a strong inducer of myofibroblast formation and subsequent
Steinberg, M H; Coleman, M B; Adams, J G; Hartmann, R C; Saba, H; Anagnou, N P
1986-02-01
A novel deletion of at least 26 kilobase of DNA, including both alpha-globin genes, the psi alpha- and psi zeta-globin genes, but sparing the functional zeta-gene was found in a 10-year-old black boy with HbH disease and sickle cell trait. This particular deletion has not previously been described in blacks. Its existence makes it likely that the absence of Hb Barts hydrops fetalis in blacks is due to the rarity of the chromosome lacking two alpha-globin genes rather than a result of early embryonic death due to the failure to synthesize embryonic hemoglobins because of deletion of functional zeta-globin genes.
Pourfarzad, Farzin; von Lindern, Marieke; Azarkeivan, Azita; Hou, Jun; Kia, Sima Kheradmand; Esteghamat, Fatemehsadat; van Ijcken, Wilfred; Philipsen, Sjaak; Najmabadi, Hossein; Grosveld, Frank
2013-01-01
β-thalassemia is caused by mutations in the β-globin locus resulting in loss of, or reduced, hemoglobin A (adult hemoglobin, HbA, α2β2) production. Hydroxyurea treatment increases fetal γ-globin (fetal hemoglobin, HbF, α2γ2) expression in postnatal life substituting for the missing adult β-globin
Modification of radiation-induced sex-linked recessive lethal mutation frequency by tocopherol
International Nuclear Information System (INIS)
Beckman, C.; Roy, R.M.; Sproule, A.
1982-01-01
The present study evaluates the effect of supplementing culture medium with α-tocopherol acetate on the yield of sex-linked recessive lethal mutants induced by X-irradiation in mature sperm of Drosophila. Although tocopherol treatment of males had no impact on the yield of mutations, a drastic reduction in mutation frequency was observed when irradiated males were mated to females raised and subsequently maintained on tocopherol-enriched diet. (orig./MG)
Mutations induced by the action of metal ions in Pisum
Energy Technology Data Exchange (ETDEWEB)
von Rosen, G
1957-01-01
Simple metal ions may induce both radiomimetic effects and genuine gene mutations of the same type which occurs from ionizing radiation and from treatment with some chemical agencies as e.g., mustard gas. The main material during the experiments has been species of Pisum. The biochemical principle which lies behind these reactions is the complex-forming ability among those reactive bivalent metal elements. The author assumes that interruptions of the chelate formation in the cell synthesis form the real background to the observed activity of the metal ions. The possible role in the evolution of the plant- and animal kingdom and the probable value for plant-breeding of the mutation activity observed are suggested. A new field for mutation experiments may here be opened and the results must hitherto be judged as interesting and promising. 13 references, 7 figures, 4 tables.
Somatic mutation and recombination induced with reactor thermal neutrons in Drosophila melanogaster
International Nuclear Information System (INIS)
Zambrano A, F.; Guzman R, J.; Paredes G, L.; Delfin L, A.
1997-01-01
The SMART test of Drosophila melanogaster was used to quantify the effect over the somatic mutation and recombination induced by thermal and fast neutrons at the TRIGA Mark III reactor of the ININ at the power of 300 k W for times of 30, 60 and 120 minutes with total equivalent doses respectively of 20.8, 41.6 and 83.2 Sv. A linear relation between the radiation equivalent dose and the frequency of the genetic effects such as mutation and recombination was observed. The obtained results allow to conclude that SMART is a sensitive system to the induced damage by neutrons, so this can be used for studying its biological effects. (Author)
Formation of thermally induced aggregates of the soya globulin beta-conglycinin.
Mills, E N; Huang, L; Noel, T R; Gunning, A P; Morris, V J
2001-06-11
The effect of ionic strength (I) on the formation of thermally induced aggregates by the 7S globular storage protein of soya, beta-conglycinin, has been studied using atomic force microscopy. Aggregates were only apparent when I> or =0.1, and had a fibrous appearance, with a height (diameter) of 8-11 nm. At high ionic strength (I=1.0) the aggregates appeared to associate into clumps. When aggregate formation was studied at I=0.2, it was clear that aggregation only began at temperatures above the main thermal transition for the protein at 75 degrees C, as determined by differential scanning calorimetry. This coincided with a small change in secondary structure, as indicated by circular dichroism spectroscopy, suggesting that a degree of unfolding was necessary for aggregation to proceed. Despite prolonged heating the size of the aggregates did not increase indefinitely, suggesting that certain beta-conglycinin isoforms were able to act as chain terminators. At higher protein concentrations (1% w/v) the linear aggregates appeared to form large macroaggregates, which may be the precursors of protein gel formation. The ability of beta-conglycinin to form such distinctive aggregates is discussed in relation to the presence of acidic inserts in certain of the beta-conglycinin subunits, which may play an important role in limiting aggregate length.
Mutation direction by irradiation in rice
International Nuclear Information System (INIS)
Wang Cailian; Chen Qiufang; Jin Wei; Lu Yimei
2001-01-01
The mutation directions of rice were studied. The results indicated that the mutation directions of rice induced by 14 C were invert correlation to their genetic backgrounds of tested rice varieties, i.e. early mature and short stem varieties produced later mature and higher stem mutation; late mature and high stem varieties produced earlier mature and shorter stem mutation; the varieties of middle maturity and height produced both direction mutations of earlier and later maturity or shorter and higher stem. The mutation directions induced by 14 C were also related to treated doses and stages. Frequency of earlier maturity mutation by protons treatment were higher than those induced by other mutagens. Frequency of later maturity by γ-rays were higher than those induced by other mutagens. Frequency of short stem mutation by synchronous irradiation (soft X-rays) were higher than those induced by other mutagens. Frequency of beneficial mutation induced by proton treatment were higher than those induced by γ-rays
International Nuclear Information System (INIS)
Kimura, Hiroshi; Kato, Takesi.
1992-01-01
X-ray-induced mutations were analysed at molecular levels in comparison with spontaneous mutations. Altered sequences were determined tentatively of 30 independent X-ray-induced mutations in a cDNA of the human hprt gene which was integrated into mammalian chromosome as a part of a shuttle vector. Mutations consisted of base substitutions (37 %), frameshifts (27 %), deletions (27 %) and others (10 %). All these mutational events were distributed randomly over the gene without there being hot spots. The spectrum and distribution of X-ray-induced mutations resembled those of spontaneous mutations. Among base substitutions, transversions were predominant and base substitution mutations occurred more at A:T sites than at G:C sites, which is also the case in spontaneous mutations. Most of the frameshift and deletion mutations induced by X-rays, as well as those spontaneously arising, were characterized by the existence of short direct repeats of several identical bases in a row at the sites of the mutations. A slippage misalignment mechanism in replication well accounts for the generation of these classes of mutations. Judging from the data accumulated so far, it can be concluded that X-ray-induced mutations at molecular levels are similar to those spontaneously occurring. (author)
International Nuclear Information System (INIS)
Kitahashi, Tsukasa; Takahashi, Mami; Yamada, Yutaka
2008-01-01
Epidermal growth factor receptor (EGFR) gene alterations have been found in human lung cancers. However, there is no information on the factors inducing EGFR mutations. In rodents, K-ras mutations are frequently found in many lung carcinogenesis models, but hitherto, Egfr mutations have not been reported. Their presence was therefore investigated in representative lung carcinogenesis models with 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK), N-nitrosobis(2-hydroxypropyl)amine (BHP), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MelQx) and ethyl carbamate (urethane), as well as X-ray irradiation. With the chemical carcinogenesis models, no mutations were detected in Egfr, which is in clear contrast to the high rates observed in either codon 12 or 61 of K-ras (21/23 of the lung tumors induced with NNK, 4/5 with MelQx, 1/4 with urethane and 7/18 with BHP). However, in the X-ray-induced lung tumors, Egfr mutations with amino acid substitution were observed in exons 18 and 21 (4/12, 33%), but no activating mutation of K-ras was detected. In addition, one and four silent mutations were identified in K-ras (exon 1) and Egfr (exons 18, 20 and 21), respectively. Most mutations in both Egfr and K-ras were G/C→A/T transitions (7/8, 88% and 31/34, 91%, respectively). Although, the mutational patterns in equivalent human lesions were not completely coincident, this first report of Egfr mutations in an experimental lung tumor model suggests that X-rays or other factors producing oxygen radicals could cause EGFR mutations in some proportion of lung cancers in humans. (author)
DEFF Research Database (Denmark)
Reimers, J I; Andersen, H U; Mauricio, D
1996-01-01
/kg) or vehicle for 5 days. All the strains investigated were susceptible to IL-1 beta-induced changes in body weight, food intake, temperature, and plasma glucagon and corticosterone. However, IL-1 beta induced hyperglycemia and impairment of beta-cell glucose responsiveness in WK/Mol and LS/Mol rats...
Zhao, Wei; Tong, Tong; Wang, Ling; Li, Pei-Pei; Chang, Yan; Zhang, Ling-Ling; Wei, Wei
2011-01-01
Chicken type II collagen (CCII) is a protein extracted from the cartilage of chicken breast and exhibits intriguing possibilities for the treatment of autoimmune diseases by inducing oral tolerance. In this study, we investigated the effects of CCII on inflammatory and immune responses to the mesenteric lymph node lymphocytes (MLNLs) and the mechanisms by which CCII regulates beta2-adrenergic receptor (beta2-AR) signal transduction in collagen-induced arthritis (CIA) rats. The onset of secondary arthritis in rats appeared around day 14 after injection of CCII emulsion. Remarkable secondary inflammatory response and lymphocytes proliferation were observed in CIA rats. The administration of CCII (10, 20, 40μgkg(-1)day(-1), days 15-22) could significantly reduce synovial hyperplasia, lymphatic follicle hyperplasia, inflammatory cells infiltration of MLNLs in CIA rats. CCII (10, 20, 40μgkg(-1)day(-1), days 15-22) restored the previously decreased level of cAMP of MLNLs of CIA rats. Meanwhile, CCII increased total protein expressions of beta2-AR, GRK2 and decreased that of beta-arrestin1, 2 of MLNLs in CIA rats but had an slight effect on GRK3. CCII further increased plasmatic protein expressions of GRK2, G(α)s and decreased that of beta-arrestin1, 2, beta2-AR, and increased membrane protein expressions of beta2-AR, GRK2, G(α)s and decreased that of beta-arrestin1, 2 of MLNLs in CIA rats. These results demonstrate that the mechanisms of CCII on beta2-AR desensitization and beta2-AR-AC-cAMP transmembrane signal transduction of MLNLs play crucial roles in pathogenesis of this disease. Copyright © 2010 Elsevier B.V. All rights reserved.
Induced mutations for quantitative traits in rice
International Nuclear Information System (INIS)
Chakrabarti, B.N.
1974-01-01
The characteristics and frequency of micro-mutations induced in quantitative traits by radiation treatment and the extent of heterozygotic effects of different recessive chlorophyll-mutant-genes on quantitative trait has been presented. Mutagenic treatments increased the variance for quantitative traits in all cases although the magnitude of increase varied depending on the treatment and the selection procedure adopted. The overall superiority of the chlorophyll-mutant heterozygotes over the corresponding wild homozygotes, as noted in consecutive two seasons, was not observed when these were grown at a high level of nitrogen fertiliser. (author)
X-ray scattering signatures of {beta}-thalassemia
Energy Technology Data Exchange (ETDEWEB)
Desouky, Omar S. [Radiation Physics Department, National Center for Radiation Research and Technology (NCRRT) (Egypt); Elshemey, Wael M. [Biophysics Department, Faculty of Science, Cairo University (Egypt)], E-mail: waelelshemey@yahoo.com; Selim, Nabila S. [Radiation Physics Department, National Center for Radiation Research and Technology (NCRRT) (Egypt)
2009-08-11
X-ray scattering from lyophilized proteins or protein-rich samples is characterized by the presence of two characteristic broad peaks at scattering angles equivalent to momentum transfer values of 0.27 and 0.6 nm{sup -1}, respectively. These peaks arise from the interference of coherently scattered photons. Once the conformation of a protein is changed, these two peaks reflect such change with considerable sensitivity. The present work examines the possibility of characterizing the most common cause of hemolytic anaemia in Egypt and many Mediterranean countries; {beta}-thalassemia, from its X-ray scattering profile. This disease emerges from a genetic defect causing reduced rate in the synthesis of one of the globin chains that make up hemoglobin. As a result, structurally abnormal hemoglobin molecules are formed. In order to detect such molecular disorder, hemoglobin samples of {beta}-thalassemia patients are collected, lyophilized and measured using a conventional X-ray diffractometer. Results show significant differences in the X-ray scattering profiles of most of the diseased samples compared to control. The shape of the first scattering peak at 0.27 nm{sup -1}, in addition to the relative intensity of the first to the second scattering peaks, provides the most reliable signs of abnormality in diseased samples. The results are interpreted and confirmed with the aid of Fourier Transform Infrared (FTIR) spectroscopy of normal and thalassemia samples.
Linhart, Igor; Hanzlíková, Iveta; Mráz, Jaroslav; Dušková, Šárka
2017-10-01
3-Nitrobenzanthrone (3-NBA), a potent environmental mutagen and carcinogen, is known to be activated in vivo to 3-benzanthronylnitrenium ion which forms both NH and C2-bound adducts with DNA and also reacts with glutathione giving rise to urinary 3-aminobenzanthron-2-ylmercapturic acid. In this study, acid hydrolysate of globin from rats dosed intraperitoneally with 3-NBA was analysed by HPLC/MS to identify a novel type of cysteine adduct, 3-aminobenzanthron-2-ylcysteine (3-ABA-Cys), confirmed using a synthesised standard. The 3-ABA-Cys levels in globin peaked after single 3-NBA doses of 1 and 2 mg/kg on day 2 to attain 0.25 and 0.49 nmol/g globin, respectively, thereafter declining slowly to 70-80% of their maximum values during 15 days. After dosing rats for three consecutive days with 1 mg 3-NBA/kg a significant cumulation of 3-ABA-Cys in globin was observed. 3-ABA-Cys was also found in the plasma hydrolysate. Herein, after dosing with 1 and 2 mg 3-NBA/kg the adduct levels peaked on day 1 at 0.15 and 0.51 nmol/ml plasma, respectively, thereafter declining rapidly to undetectable levels on day 15. In addition, sulphinamide adducts were also found in the exposed rats, measured indirectly as 3-aminobenzanthrone (3-ABA) split off from globin by mild acid hydrolysis. Levels of both types of adducts in the globin samples parallelled very well with 3-ABA/3-ABA-Cys ratio being around 1:8. In conclusion, 3-ABA-Cys is the first example of arylnitrenium-cysteine adduct in globin representing a new promising class of biomarkers to assess cumulative exposures to aromatic amines, nitroaromatics and heteroaromatic amines.
DEFF Research Database (Denmark)
Kepp, Kasper Planeta
2015-01-01
Fast and accurate computation of protein stability is increasingly important for e.g. protein engineering and protein misfolding diseases, but no consensus methods exist for important proteins such as globins, and performance may depend on the type of structural input given. This paper reports be...
Energy Technology Data Exchange (ETDEWEB)
Cronin, M.A. [LGL Alaska Research Associates Inc., Anchorage, AK (United States); Bickham, J.W. [Texas A and M University, College Station, TX (United States). Dept. of Wildlife and Fisheries Sciences; LGL Ecological Genetics Inc., Bryan, TX (United States)
1998-07-01
The primary environmental impact following an oil spill typically is acute toxicity to fish and wildlife. However, multigenerational effects through toxicant-induced heritable mutations might also occur. Some polycyclic aromatic hydrocarbon (PAH) components of crude oil are potentially mutagenic, although specific components and doses that induce mutations are poorly known. We applied population genetics concepts to assess the extent of mortality and the persistence of deleterious heritable mutations resulting from exposure to potential mutagens, such as crude oil. If lethal mutations are induced, the population will experience some mortality, but the mutations are quickly removed or reduced to low frequency by natural selection. This occurs within one or a few generations when mutations are dominant or partially recessive. Totally recessive alleles persist in low frequency for many generations, but result in relatively little impact on the population, depending on the number of mutated loci. We also applied population genetics concepts to assess the potential for heritable mutations induced by the Exxon Valdez oil spill in Prince William Sound, Alaska, to affect pink salmon populations. We stress that breeding units (e.g., streams with distinct spawning populations of salmon) must be considered individually to assess heritable genetic effects. For several streams impacted by the oil spill, there is inconsistency between observed egg mortality and that expected if lethal heritable mutations had been induced by exposure to crude oil. Observed mortality was either higher or lower than expected depending on the spawning population, year, and cohort considered. Any potential subtle effect of lethal mutations induced by the Exxon Valdez oil spill is overridden by natural environmental variation among spawning areas. We discuss the need to focus on population-level effects in toxicological assessments because fish and wildlife management focuses on populations, not
International Nuclear Information System (INIS)
Dhonukshe, B.L.
1981-01-01
Induced mutation studies were carried with three dwarf wheat varieties viz., ''Sonalika'', ''Chhoti Lerma'' and ''Hira'', considered to be single, double and trible dwarfs, respectively. Gamma-rays were used as a source of irradiation. Frequency of chlorophyll mutations were comparatively low and the spectrum was narrow. Chlorophyll mutations were altogether absent in the variety ''Sonalika''. A very wide spectrum of viable mutations affecting stem, leaf, ear growth habit, maturity and fertility characteristics was observed in the M 2 . The cumulative frequency of all the mutants together was quite high, which varied with the varieties. There were varietal differences in the composition and width of the spectrum induced by gamma-rays. The dwarf mutants having desirable leaf and spike characters were isolated in all the three varieties. (author)
Evidence for novel beta-sheet structures in Iowa mutant beta-amyloid fibrils.
Tycko, Robert; Sciarretta, Kimberly L; Orgel, Joseph P R O; Meredith, Stephen C
2009-07-07
Asp23-to-Asn mutation within the coding sequence of beta-amyloid, called the Iowa mutation, is associated with early onset, familial Alzheimer's disease and cerebral amyloid angiopathy, in which patients develop neuritic plaques and massive vascular deposition predominantly of the mutant peptide. We examined the mutant peptide, D23N-Abeta40, by electron microscopy, X-ray diffraction, and solid-state NMR spectroscopy. D23N-Abeta40 forms fibrils considerably faster than the wild-type peptide (k = 3.77 x 10(-3) min(-1) and 1.07 x 10(-4) min(-1) for D23N-Abeta40 and the wild-type peptide WT-Abeta40, respectively) and without a lag phase. Electron microscopy shows that D23N-Abeta40 forms fibrils with multiple morphologies. X-ray fiber diffraction shows a cross-beta pattern, with a sharp reflection at 4.7 A and a broad reflection at 9.4 A, which is notably smaller than the value for WT-Abeta40 fibrils (10.4 A). Solid-state NMR measurements indicate molecular level polymorphism of the fibrils, with only a minority of D23N-Abeta40 fibrils containing the in-register, parallel beta-sheet structure commonly found in WT-Abeta40 fibrils and most other amyloid fibrils. Antiparallel beta-sheet structures in the majority of fibrils are indicated by measurements of intermolecular distances through (13)C-(13)C and (15)N-(13)C dipole-dipole couplings. An intriguing possibility exists that there is a relationship between the aberrant structure of D23N-Abeta40 fibrils and the unusual vasculotropic clinical picture in these patients.
Ager, D D; Radul, J A
1992-12-01
The purpose of this study was to examine the effect of extremely low frequency (ELF) magnetic fields on the induction of genetic damage. In general, mutational studies involving ELF magnetic fields have proven negative. However, studies examining sister-chromatid exchange and chromosome aberrations have yielded conflicting results. In this study, we have examined whether 60-Hz magnetic fields are capable of inducing mutation or mitotic recombination in the yeast Saccharomyces cerevisiae. In addition we determined whether magnetic fields were capable of altering the genetic response of S. cerevisiae to UV (254 nm). We measured the frequencies of induced mutation, gene conversion and reciprocal mitotic crossing-over for exposures to magnetic fields alone (1 mT) or in combination with various UV exposures (2-50 J/m2). These experiments were performed using a repair-proficient strain (RAD+), as well as a strain of yeast (rad3) which is incapable of excising UV-induced thymine dimers. Magnetic field exposures did not induce mutation, gene conversion or reciprocal mitotic crossing-over in either of these strains, nor did the fields influence the frequencies of UV-induced genetic events.
beta-catenin tyrosine 654 phosphorylation increases Wnt signalling and intestinal tumorigenesis
van Veelen, Wendy; Le, Ngoc H.; Helvensteijn, Werner; Blonden, Lau; Theeuwes, Myrte; Bakker, Elvira R. M.; Franken, Patrick F.; van Gurp, Leon; Meijlink, Frits; van der Valk, Martin A.; Kuipers, Ernst J.; Fodde, Riccardo; Smits, Ron
Objective Deregulation of the Wnt signalling pathway by mutations in the Apc or beta-catenin genes underlies colorectal carcinogenesis. As a result, beta-catenin stabilises, translocates to the nucleus, and activates gene transcription. Intestinal tumours show a heterogeneous pattern of nuclear
beta-catenin tyrosine 654 phosphorylation increases Wnt signalling and intestinal tumorigenesis
van Veelen, W.; Le, N.H.; Helvensteijn, W.; Blonden, L.; Theeuwes, M.; Bakker, E.R.; Franken, P.F.; van Gurp, L.; Meijlink, F.; van der Valk, M.A.; Kuipers, E.J.; Fodde, R.; Smits, R.E.H.M.
2011-01-01
Objective Deregulation of the Wnt signalling pathway by mutations in the Apc or beta-catenin genes underlies colorectal carcinogenesis. As a result, beta-catenin stabilises, translocates to the nucleus, and activates gene transcription. Intestinal tumours show a heterogeneous pattern of nuclear
Gilio, Karen; Munnix, Imke C A; Mangin, Pierre; Cosemans, Judith M E M; Feijge, Marion A H; van der Meijden, Paola E J; Olieslagers, Servé; Chrzanowska-Wodnicka, Magdalena B; Lillian, Rivka; Schoenwaelder, Simone; Koyasu, Shigeo; Sage, Stewart O; Jackson, Shaun P; Heemskerk, Johan W M
2009-12-04
Platelets are activated by adhesion to vascular collagen via the immunoglobulin receptor, glycoprotein VI (GPVI). This causes potent signaling toward activation of phospholipase Cgamma2, which bears similarity to the signaling pathway evoked by T- and B-cell receptors. Phosphoinositide 3-kinase (PI3K) plays an important role in collagen-induced platelet activation, because this activity modulates the autocrine effects of secreted ADP. Here, we identified the PI3K isoforms directly downstream of GPVI in human and mouse platelets and determined their role in GPVI-dependent thrombus formation. The targeting of platelet PI3Kalpha or -beta strongly and selectively suppressed GPVI-induced Ca(2+) mobilization and inositol 1,4,5-triphosphate production, thus demonstrating enhancement of phospholipase Cgamma2 by PI3Kalpha/beta. That PI3Kalpha and -beta have a non-redundant function in GPVI-induced platelet activation and thrombus formation was concluded from measurements of: (i) serine phosphorylation of Akt, (ii) dense granule secretion, (iii) intracellular Ca(2+) increases and surface expression of phosphatidylserine under flow, and (iv) thrombus formation, under conditions where PI3Kalpha/beta was blocked or p85alpha was deficient. In contrast, GPVI-induced platelet activation was insensitive to inhibition or deficiency of PI3Kdelta or -gamma. Furthermore, PI3Kalpha/beta, but not PI3Kgamma, contributed to GPVI-induced Rap1b activation and, surprisingly, also to Rap1b-independent platelet activation via GPVI. Together, these findings demonstrate that both PI3Kalpha and -beta isoforms are required for full GPVI-dependent platelet Ca(2+) signaling and thrombus formation, partly independently of Rap1b. This provides a new mechanistic explanation for the anti-thrombotic effect of PI3K inhibition and makes PI3Kalpha an interesting new target for anti-platelet therapy.
Moon, Dong-Oh; Kim, Mun-Ok; Choi, Yung Hyun; Park, Yung-Min; Kim, Gi-Young
2010-05-01
Curcumin, a major component of turmeric, has been shown to exhibit anti-oxidant and anti-inflammatory activities. The present study was performed to determine whether curcumin is efficacious against both collagen-induced arthritis (CIA) in mice and IL-1beta-induced activation in fibroblast-like synoviocytes (FLSs). DBA/1 mice were immunized with bovine type II collagen (CII) and treated with curcumin every other day for 2weeks after the initial immunization. For arthritis, we evaluated the incidence of disease and used an arthritis index based on paw thickness. In vitro proliferation of CII- or concanavalin A-induced splenic T cells was examined using IFN-gamma production. Pro-inflammatory cytokines TNF-alpha and IL-1beta were examined in the mouse ankle joint and serum IgG1 and IgG2a isotypes were analyzed. The expression levels of prostaglandin E(2) (PGE(2)), cyclooxygenase-2 (COX-2), and matrix metalloproteinases (MMPs) in human FLSs were also determined. The results showed that compared with untreated CIA mice, curcumin-treated mice downregulated clinical arthritis score, the proliferation of splenic T cells, expression levels of TNF-alpha and IL-1beta in the ankle joint, and expression levels of IgG2a in serum. Additionally, by altering nuclear factor (NF)-kappaB transcription activity in FLSs, curcumin inhibited PGE(2) production, COX-2 expression, and MMP secretion. These results suggest that curcumin can effectively suppress inflammatory response by inhibiting pro-inflammatory mediators and regulating humoral and cellular immune responses. Copyright 2010 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Nikhil Moorchung
2013-01-01
Full Text Available Introduction: Hemoglobinopathies constitute entities that are generated by either abnormal hemoglobin or thalassemias. high pressure liquid chromatography (HPLC is one of the best methods for screening and detection of various hemoglobinopathies but it has intrinsic interpretive problems. The study was designed to evaluate the different mutations seen in cases of hemoglobinopathies and compare the same with screening tests. Materials and Methods: 68 patients of hemoglobinopathies were screened by HPLC. Mutation studies in the beta globin gene was performed using the polymerase chain reaction (PCR-based allele-specific Amplification Refractory Mutation System (ARMS. Molecular analysis for the sickle cell mutation was done by standard methods. Results: The IVS 1/5 mutation was the commonest mutation seen and it was seen in 26 (38.23% of the cases. This was followed by the IVS 1/1, codon 41/42, codon 8/9, del 22 mutation, codon 15 mutation and the -619 bp deletion. No mutation was seen in eight cases. There was a 100% concordance between the sickle cell trait as diagnosed by HPLC and genetic testing. Discussion and Conclusion: Our study underlies the importance of molecular testing in all cases of hemoglobinopathies. Although HPLC is a useful screening tool, molecular testing is very useful in accurately diagnosing the mutations. Molecular testing is especially applicable in cases with an abnormal hemoglobin (HbD, HbE and HbS because there may be a concomitant inheritance of a beta thalassemia mutation. Molecular testing is the gold standard when it comes to the diagnosis of hemoglobinopathies.
International Nuclear Information System (INIS)
Kunz, B.A.; Hannan, M.A.; Haynes, R.H.
1980-01-01
Recently, it has been suggested that mitotic recombination is involved in tumor promotion. On this basis, one might expect tumor promoters to be recombinagenic. D7 is a diploid strain of yeast in which both mutation and mitotic recombination can be measured. We have used this strain to assay the known tumor promoters, iodacetate, anthralin, and 12-0-tetradecanoylphorbol-13-acetate, and the cocarcinogen, catechol, for mutagenicity, recombinagenicity, and the ability to enhance ultraviolet light (UV)-induced genetic events. In the absence of preirradiation with UV, iodoacetate was found to be recombinagenic whereas catechol was mutagenic; however, in both cases, the effects were small. Iodoacetate, anthralin, and catechol potentiated UV-induced mitotic crossing-over, aberrant colony formation, and mutation, while catechol also increased UV-induced gene conversion. We were unable to detect any mutagenic or recombinagenic effect of 12-0-tetradecanoyl-phorbol-13-acetate in either whole cells or spheroplasts. Our results do not indicate any consistent correlation between tumor-promoting activity and the ability of an agent to induce mitotic recombination in yeast. However, the ability to potentiate UV-induced mutation and mitotic recombination may reflect the cocarcinogenic activity of certain promoters
Hemochromatosis C282Y gene mutation as a potential susceptibility ...
African Journals Online (AJOL)
G.M. Mokhtar
2017-08-12
Aug 12, 2017 ... Background: Hereditary hemochromatosis is the most frequent cause of primary iron overload that is associated with HFE gene's mutation especially the C282Y mutation. The interaction between hemoglo- bin chain synthesis' disorders and the C282Y mutation may worsen the clinical picture of beta-.
Energy Technology Data Exchange (ETDEWEB)
Jingyong, Zhao; Yongzhong, Xu; Tao, Zhao; Fengmei, Cui; Liuyi, Wang; Qinhua, Lao [Suzhou Univ., Suzhou (China). Radiation Medicine Department
2001-07-01
HPRT gene locus mutation in peripheral blood lymphocytes induced by internal exposure to radionuclides was performed and the relationships between mutation frequency and dose were studied. Rats were injected intravenously with radionuclides, the blood was sampled at different time after injection; HPRT gene locus mutation frequency (GMF) were examined by methods of multi-nucleus cell and Brdurd assay, working out the Dose-response function. GMF rose with the increase of dose and dose-rates and were clearly interrelated. The HPRT gene locus mutation is very sensitive to radiation and may be used as a biological dosimeter.
Iwata, S; Nomoto, M; Fukuda, T
1996-10-01
The effect of nipradilol, a nonselective beta-adrenergic receptor blocker with nitroglycerin-like vasodilating activity, on oxotremorine-induced tremor was studied in mice. General tremor in mice was elicited by 0.5 mg/kg oxotremorine. The tremor was quantified using a capacitance transducer, then analyzed by a signal processor. The strength of the tremor was expressed in "points". The point values of the tremor (mean +/- SE) in control mice for 5 mg/kg (+/-)-propranolol, 2.5 mg/kg arotinolol, 0.5 mg/kg nipradilol, 1.0 mg/kg nipradilol and 2.5 mg/kg nipradilol were 87 +/- 16, 42 +/- 6, 38 +/- 6, 99 +/- 28, 28 +/- 6 and 31 +/- 7, respectively. The strength of the tremor was reduced by all beta-blockers. Although 1.0 mg/kg nipradilol significantly reduced the tremor, further inhibition of the tremor was not obtained with dosages up to 2.5 mg/kg of the drug. In conclusion, nipradilol was effective for suppressing oxotremorine-induced tremor, as were other beta-blockers.
Energy Technology Data Exchange (ETDEWEB)
Singer, Timothy M. [Mutagenesis Section, Environmental and Occupational Toxicology Division, Safe Environments Programme, 0803A, Health Canada, Ottawa, Ont., K1A 0K9 (Canada); Department of Biology, Carleton University, 1125 Colonel By Drive, Ottawa, Ont., K1S 5B6 (Canada); Lambert, Iain B. [Department of Biology, Carleton University, 1125 Colonel By Drive, Ottawa, Ont., K1S 5B6 (Canada); Williams, Andrew [Biostatistics and Epidemiology Division, Safe Environments Programme, 6604B, Health Canada, Ottawa, Ont., K1A 0K9 (Canada); Douglas, George R. [Mutagenesis Section, Environmental and Occupational Toxicology Division, Safe Environments Programme, 0803A, Health Canada, Ottawa, Ont., K1A 0K9 (Canada); Yauk, Carole L. [Mutagenesis Section, Environmental and Occupational Toxicology Division, Safe Environments Programme, 0803A, Health Canada, Ottawa, Ont., K1A 0K9 (Canada)]. E-mail: carole_yauk@hc-sc.gc.ca
2006-06-25
Several rodent assays are capable of monitoring germline mutation. These include traditional assays, such as the dominant lethal (DL) assay, the morphological specific locus (SL) test and the heritable translocation (HT) assay, and two assays that have been developed more recently-the expanded simple tandem repeat (ESTR) and transgenic rodent (TGR) mutation assays. In this paper, we have compiled the limited amount of experimental data that are currently available to make conclusions regarding the comparative ability of the more recently developed assays to detect germline mutations induced by chemical and radiological agents. The data suggest that ESTR and TGR assays are generally comparable with SL in detecting germline mutagenicity induced by alkylating agents and radiation, though TGR offered less sensitivity than ESTR in some cases. The DL and HT assays detect clastogenic events and are most susceptible to mutations arising in post-spermatogonial cells, and they may not provide the best comparisons with TGR and ESTR instability. The measurement of induced ESTR instability represents a relatively sensitive method of identifying agents causing germline mutation in rodents, and may also be useful for bio-monitoring exposed individuals in the human population. Any future use of the TGR and ESTR germline mutation assays in a regulatory testing context will entail more robust and extensive characterization of assay performance. This will require substantially more data, including experiments measuring multiple endpoints, a greatly expanded database of chemical agents and a focus on characterizing stage-specific activity of mutagens in these assays, preferably by sampling epididymal sperm exposed at defined pre-meiotic, meiotic and post-meiotic stages of development.
International Nuclear Information System (INIS)
Singer, Timothy M.; Lambert, Iain B.; Williams, Andrew; Douglas, George R.; Yauk, Carole L.
2006-01-01
Several rodent assays are capable of monitoring germline mutation. These include traditional assays, such as the dominant lethal (DL) assay, the morphological specific locus (SL) test and the heritable translocation (HT) assay, and two assays that have been developed more recently-the expanded simple tandem repeat (ESTR) and transgenic rodent (TGR) mutation assays. In this paper, we have compiled the limited amount of experimental data that are currently available to make conclusions regarding the comparative ability of the more recently developed assays to detect germline mutations induced by chemical and radiological agents. The data suggest that ESTR and TGR assays are generally comparable with SL in detecting germline mutagenicity induced by alkylating agents and radiation, though TGR offered less sensitivity than ESTR in some cases. The DL and HT assays detect clastogenic events and are most susceptible to mutations arising in post-spermatogonial cells, and they may not provide the best comparisons with TGR and ESTR instability. The measurement of induced ESTR instability represents a relatively sensitive method of identifying agents causing germline mutation in rodents, and may also be useful for bio-monitoring exposed individuals in the human population. Any future use of the TGR and ESTR germline mutation assays in a regulatory testing context will entail more robust and extensive characterization of assay performance. This will require substantially more data, including experiments measuring multiple endpoints, a greatly expanded database of chemical agents and a focus on characterizing stage-specific activity of mutagens in these assays, preferably by sampling epididymal sperm exposed at defined pre-meiotic, meiotic and post-meiotic stages of development
Energy Technology Data Exchange (ETDEWEB)
Choi, Cheol-Hee [Research Center for Resistant Cells, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759 (Korea, Republic of); Department of Pharmacology, College of Medicine, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759 (Korea, Republic of); Lee, Byung-Hoon [College of Pharmacy and Multiscreening Center for Drug Development, Seoul National University, Seoul 151-742 (Korea, Republic of); Ahn, Sang-Gun [Department of Pathology, College of Dentistry, Chosun University, Gwangju 501-759 (Korea, Republic of); Oh, Seon-Hee, E-mail: oshccw@hanmail.net [Research Center for Resistant Cells, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759 (Korea, Republic of)
2012-02-24
Highlights: Black-Right-Pointing-Pointer MG132 induces the phosphorylation of GSK3{beta}{sup Ser9} and, to a lesser extent, of GSK3{beta}{sup Thr390}. Black-Right-Pointing-Pointer MG132 induces dephosphorylation of p70S6K{sup Thr389} and phosphorylation of p70S6K{sup Thr421/Ser424}. Black-Right-Pointing-Pointer Inactivation of p38 dephosphorylates GSK3{beta}{sup Ser9} and phosphorylates GSK3{beta}{sup Thr390}. Black-Right-Pointing-Pointer Inactivation of p38 phosphorylates p70S6K{sup Thr389} and increases the phosphorylation of p70S6K{sup Thr421/Ser424}. Black-Right-Pointing-Pointer Inactivation of p38 decreases autophagy and increases apoptosis induced by MG132. -- Abstract: Proteasome inhibition is a promising approach for cancer treatment; however, the underlying mechanisms involved have not been fully elucidated. Here, we show that proteasome inhibition-induced p38 mitogen-activated protein kinase regulates autophagy and apoptosis by modulating the phosphorylation status of glycogen synthase kinase 3{beta} (GSK3{beta}) and 70 kDa ribosomal S6 kinase (p70S6K). The treatment of MDA-MB-231 cells with MG132 induced endoplasmic reticulum stress through the induction of ATF6a, PERK phosphorylation, and CHOP, and apoptosis through the cleavage of Bax and procaspase-3. MG132 caused the phosphorylation of GSK3{beta} at Ser{sup 9} and, to a lesser extent, Thr{sup 390}, the dephosphorylation of p70S6K at Thr{sup 389}, and the phosphorylation of p70S6K at Thr{sup 421} and Ser{sup 424}. The specific p38 inhibitor SB203080 reduced the p-GSK3{beta}{sup Ser9} and autophagy through the phosphorylation of p70S6K{sup Thr389}; however, it augmented the levels of p-ERK, p-GSK3{beta}{sup Thr390}, and p-70S6K{sup Thr421/Ser424} induced by MG132, and increased apoptotic cell death. The GSK inhibitor SB216763, but not lithium, inhibited the MG132-induced phosphorylation of p38, and the downstream signaling pathway was consistent with that in SB203580-treated cells. Taken together, our
Jo, Yunjeong; Han, Sang Uk; Kim, Yoon Jae; Kim, Ju Hyeon; Kim, Shin Tae; Kim, Seong-Jin; Hahm, Ki-Baik
2010-03-01
Loss of transforming growth factor beta1 (TGF-beta1) exhibits a similar pathology to that seen in a subset of individuals infected with Helicobacter pylori, including propagated gastric inflammation, oxidative stress, and autoimmune features. We thus hypothesized that gastric mucosal TGF-beta1 levels could be used to determine the outcome after H. pylori infection. Northern blot for the TGF-beta1 transcript, staining of TGF-beta1 expression, luciferase reporter assay, and enzyme-linked immunosorbent assay for TGF-beta1 levels were performed at different times after H. pylori infection. The TGF-beta1 level was markedly lower in patients with H. pylori-induced gastritis than in patients with a similar degree of gastritis induced by nonsteroidal anti-inflammatory drugs. There was a significant negative correlation between the severity of inflammation and gastric mucosal TGF-beta1 levels. SNU-16 cells showing intact TGF-beta signaling exhibited a marked decrease in TGF-beta1 expression, whereas SNU-638 cells defective in TGF-beta signaling exhibited no such decrease after H. pylori infection. The decreased expressions of TGF-beta1 in SNU-16 cells recovered to normal after 24 hr of H. pylori infection, but lasted very spatial times, suggesting that attenuated expression of TGF-beta1 is a host defense mechanism to avoid attachment of H. pylori. H. pylori infection was associated with depressed gastric mucosal TGF-beta1 for up to 24 hr, but this apparent strategy for rescuing cells from H. pylori attachment exacerbated the gastric inflammation.
International Nuclear Information System (INIS)
Ager, D.D.; Radul, J.A.
1994-01-01
The ability of 60-Hz magnetic fields to induce genetic damage in Saccharomyces cerevisiae was studied. The frequencies of induced mutation, gene conversion, and reciprocal mitotic crossing over were measured for exposures to 1-millitesla magnetic fields alone or in combination with various preliminary exposures to 254-nm ultraviolet light at intensities of 2-50 J/m 2 . These experiments were performed using a repair-proficient strain as well as a strain incapable of excising ultraviolet-induced thymine dimers. Magnetic field exposures did not induce mutation, gene conversion, or reciprocal mitotic crossing over in either of these strains, nor did the fields influence the frequencies of ultraviolet-induced genetic events. 32 refs., 4 tabs
DEFF Research Database (Denmark)
Jacobs, M F; Borchert, T V; Kontinen, V P
1995-01-01
High-level synthesis of exportable beta-galactosidase (LacZ) fusion proteins in Bacillus subtilis results in a lethal phenotype, and has been suggested as a tool for the selection of secretion mutants. We tested a plasmid-based, inducible lacZ fusion gene system for this purpose, but frequent...... mutations in cis, which reduced expression of the fusion gene, forced abandonment of the induction-selection strategy. Instead, after modification of the indicator plasmid, a screening procedure for increased basal LacZ activity levels was adopted. This led to the identification of a conditional B. subtilis...
Mutations in BALB mitochondrial DNA induce CCL20 up-regulation promoting tumorigenic phenotypes
Energy Technology Data Exchange (ETDEWEB)
Sligh, James [Department of Medicine—Dermatology Division, University of Arizona, Tucson, AZ 857 24 (United States); University of Arizona Cancer Center, Tucson, AZ 85724 (United States); Janda, Jaroslav [University of Arizona Cancer Center, Tucson, AZ 85724 (United States); Jandova, Jana, E-mail: jjandova@email.arizona.edu [Department of Medicine—Dermatology Division, University of Arizona, Tucson, AZ 857 24 (United States); University of Arizona Cancer Center, Tucson, AZ 85724 (United States)
2014-11-15
Highlights: • Alterations in mitochondrial DNA are commonly found in various human cancers. • Mutations in BALB mitochondrial DNA induce up-regulation of chemokine CCL20. • Increased growth and motility of mtBALB cells is associated with CCL20 levels. • mtDNA changes in BALB induce in vivo tumor growth through CCL20 up-regulation. • Mutations in mitochondrial DNA play important roles in keratinocyte neoplasia. - Abstract: mtDNA mutations are common in human cancers and are thought to contribute to the process of neoplasia. We examined the role of mtDNA mutations in skin cancer by generating fibroblast cybrids harboring a mutation in the gene encoding the mitochondrial tRNA for arginine. This somatic mutation (9821insA) was previously reported in UV-induced hyperkeratotic skin tumors in hairless mice and confers specific tumorigenic phenotypes to mutant cybrids. Microarray analysis revealed and RT-PCR along with Western blot analysis confirmed the up-regulation of CCL20 and its receptor CCR6 in mtBALB haplotype containing the mt-Tr 9821insA allele compared to wild type mtB6 haplotype. Based on reported role of CCL20 in cancer progression we examined whether the hyper-proliferation and enhanced motility of mtBALB haplotype would be associated with CCL20 levels. Treatment of both genotypes with recombinant CCL20 (rmCCL20) resulted in enhanced growth and motility of mtB6 cybrids. Furthermore, the acquired somatic alteration increased the in vivo tumor growth of mtBALB cybrids through the up-regulation of CCL20 since neutralizing antibody significantly decreased in vivo tumor growth of these cells; and tumors from anti-CCL20 treated mice injected with mtBALB cybrids showed significantly decreased CCL20 levels. When rmCCL20 or mtBALB cybrids were used as chemotactic stimuli, mtB6 cybrids showed increased motility while anti-CCL20 antibody decreased the migration and in vivo tumor growth of mtBALB cybrids. Moreover, the inhibitors of MAPK signaling and NF
Gamma-ray-induced dominant mutations that cause skeletal abnormalities in mice
International Nuclear Information System (INIS)
Selby, P.B.; Selby, P.R.
1977-01-01
Male mice were exposed to 100 R + 500 R γ-rays (60 R/min) with a 24-h fractionation interval. Skeletons of F 1 sons were examined for abnormalities, and, if any were found, the skeletons of their descendants were also examined. Of 2646 sons from treated spermatogonia, 37, or 1.4%, were diagnosed as carriers of autosomal dominant mutations affecting the skeleton, 31 by breeding tests, and six by other criteria for identifying mutations in F 1 's having no progeny. Many mutations caused a large number of anomalies in different regions of the skeleton. Most regions of the skeleton were affected by at least one mutation, and the mutations had incomplete penetrance for some or all of their effects. Three of the mutations affected skeletal size only. If certain assumptions are made, these skeletal data can be used to derive an estimate of induced genetic damage from dominant mutations affecting all parts of the body. When applied to man, the resultant risk estimate is not inconsistent with that made for dominant and irregularly inherited diseases by the BEIR Committee, by use of the doubling-dose method. Since most of the mutations can be characterized as models of irregularly inherited conditions in man, the data directly relate to the controversy over the relative importance of mutation pressure and balanced selection in maintaining man's large burden of irregularly inherited disease. Contrary to a recent hypothesis by H.B. Newcombe that man's large burden of irregularly inherited disease is maintained almost exclusively by balanced selection, these results suggest that at least an important fraction of the irregularly inherited conditions are maintained by mutation pressure. Therefore, this finding does not support the major changes in the estimate of genetic hazard to man that would be required on the basis of Newcombe's hypothesis
LCR/MEL: A versatile system for high-level expression of heterologous proteins in erythroid cells.
M. Needham; C. Gooding; K. Hudson; M. Antoniou (Michael); F.G. Grosveld (Frank); M. Hollis
1992-01-01
textabstractWe have used the human globin locus control region (LCR) to assemble an expression system capable of high-level, integration position-independent expression of heterologous genes and cDNAs in murine erythroleukaemia (MEL) cells. The cDNAs are inserted between the human beta-globin
Adipocytokine concentrations in children with different types of beta-thalassemia.
Enli, Yaşar; Balci, Yasemin I; Gönen, Cafer; Uzun, Ebru; Polat, Aziz
2014-06-01
Beta-thalassemia is an inherited blood disorder. It results from the impaired production of β-globin chains, leading to a relative excess of alpha-globin chains. Clinical severity separates this disease into three main subtypes: β- thalassemia major, β-thalassemia intermedia and β-thalassemia minor, the former two being clinically more significant. Inflammatory processes may play an important role in some of the complications of thalassemia. Adipose tissue is one of the most important endocrine and secretory organs that release adipocytokines like adiponectin, resistin and visfatin. The aim of our study was to analyze adipocytokine concentrations (adiponectin, resistin and visfatin) in different types of β-thalassemia patients and determine any possible correlations with disease severity. We recruited 29 patients who were transfusion-dependent β-thalassemia-major patients, 17 patients with β-thalassemia intermedia, 30 β-thalassemia minor patients. The control group consisted of 30 healthy children. Anthropometric measurements, complete blood count, biochemical parameters, serum concentrations of adiponectin, resistin, visfatin were performed for all subjects. Resistin and visfatin concentrations were significantly higher in β-thalassemia minor patients than in controls. Adiponetin, resistin and visfatin concentrations were significantly higher in both β-thalassemia intermedia and major patients than in controls. The concentrations of adiponectin, resistin and visfatin were significantly higher in both β-thalassemia intermedia and major patients than in β-thalassemia minor patients. There was no significant difference between β-thalassemia intermedia and β-thalassemia major patients for adipocytokines concentrations. We speculate that these adipocytokines may play a role in the development of complications in β-thalassaemia.
International Nuclear Information System (INIS)
Xu Honglan; Cao Yi; Duan Zhikai; Wu Qiqing; Chen Ying; Zhang Shuxian
1998-12-01
The somatic induction frequencies of mutation at the hypoxanthine-guanine phosphoribosyl transferase (HGPRT) locus induced by 60 Co γ-rays and Benzo-a-pyrene (B(a)P), which are representative of hazardous emission and pollutant from nuclear energy cycle and fossil-fuelled energy cycle respectively, were detected by using forward mutation assay and cloning technique in both V 79 Chinese hamster cells and human peripheral blood T-lymphocytes. Resistant mutants were selected with 6-thioguanine (6-TG). Dose-response curves and mathematical expressions were obtained for mutation frequencies and survival following γ-ray and B(a)P(+S 9 ) treatments. The dose ranges for the two mutagens were compared when they induced the same mutation frequencies. In V 79 /HGPRT assay system, when the mutation frequencies were 5∼35 mutants/10 6 cells the response of γ-rays in the dose range from 0.93∼4.96 Gy at dose rate of 1.16 Gy/min is nearly equivalent to that in the B(a)P dose range from 0.52∼4.27 μg/ml. By using cloning technique in T-lymphocytes, when the mutation frequencies were 1∼14 mutants/10 5 cells the response of γ-rays in the dose range from 0.05∼4.77 Gy at dose rate of 1.03 Gy/min is nearly equivalent to that in the B(a)P dose range from 0.15∼7.36 μg/ml. When the survival fraction is 37%, the mutation frequency induced by B(a)P is higher than that induced by 60 Co γ-rays
Analysis of mutations in the human HPRT gene induced by accelerated heavy-ion irradiation
International Nuclear Information System (INIS)
Kagawa, Yasuhiro; Yatagai, Fumio; Hanaoka, Fumio; Suzuki, Masao; Kase, Youko; Kobayashi, Akiko; Hirano, Masahiko; Kato, Takesi; Watanabe, Masami.
1995-01-01
Multiplex PCR analysis of HPRT(-) mutations in human embryo (HE) cells induced by 230 keV/μm carbon-ion irradiation showed no large deletion around the exon regions of the locus gene in contrast to the irradiations at different LETs. To identify these mutations, the sequence alterations in a cDNA of hprt gene were determined for 18 mutant clones in this study. Missing of exon 6 was the most frequent mutational event (10 clones), and missing of both exons 6 and 8 was next most frequent event (6 clones), then base substitutions (2 clones). These characteristics were not seen in a similar analysis of spontaneous mutations, which showed base substitution (5 clones), frameshift (2 clones), missing of both exons 2 and 3 (2 clones), and a single unidentified clone. Direct sequencing and restriction enzyme digestion of the genomic DNA of the mutants which showed missing of exons 6 and 8 in the cDNA, supports the possibility that they were induced by aberrant mRNA splicing. (author)
Chen, Junqin; Fontes, Ghislaine; Saxena, Geetu; Poitout, Vincent; Shalev, Anath
2010-02-01
We have previously shown that lack of thioredoxin-interacting protein (TXNIP) protects against diabetes and glucotoxicity-induced beta-cell apoptosis. Because the role of TXNIP in lipotoxicity is unknown, the goal of the present study was to determine whether TXNIP expression is regulated by fatty acids and whether TXNIP deficiency also protects beta-cells against lipoapoptosis. RESARCH DESIGN AND METHODS: To determine the effects of fatty acids on beta-cell TXNIP expression, INS-1 cells and isolated islets were incubated with/without palmitate and rats underwent cyclic infusions of glucose and/or Intralipid prior to islet isolation and analysis by quantitative real-time RT-PCR and immunoblotting. Using primary wild-type and TXNIP-deficient islets, we then assessed the effects of palmitate on apoptosis (transferase-mediated dUTP nick-end labeling [TUNEL]), mitochondrial death pathway (cytochrome c release), and endoplasmic reticulum (ER) stress (binding protein [BiP], C/EBP homologous protein [CHOP]). Effects of TXNIP deficiency were also tested in the context of staurosporine (mitochondrial damage) or thapsigargin (ER stress). Glucose elicited a dramatic increase in islet TXNIP expression both in vitro and in vivo, whereas fatty acids had no such effect and, when combined with glucose, even abolished the glucose effect. We also found that TXNIP deficiency does not effectively protect against palmitate or thapsigargin-induced beta-cell apoptosis, but specifically prevents staurosporine- or glucose-induced toxicity. Our results demonstrate that unlike glucose, fatty acids do not induce beta-cell expression of proapoptotic TXNIP. They further reveal that TXNIP deficiency specifically inhibits the mitochondrial death pathway underlying beta-cell glucotoxicity, whereas it has very few protective effects against ER stress-mediated lipoapoptosis.
Determination of proteolytic activity using L-[4,5-3H]leucine-labelled globin as a substrate
International Nuclear Information System (INIS)
Maliopoulou, T.B.; Dionyssiou-Asteriou, A.; Loucopoulos, D.
1980-01-01
A simple and sensitive method for the assay of proteolytic enzyme activity is described. This is based on the digestion of L-[4,5- 3 H]leucine globin by proteolytic enzymes and radioactivity measurement of the trichloroacetic acid soluble cleavage products. (Auth.)
Induced Double-Beta Processes in Electron Fluxes as Resonance Reactions in Weak Interaction
International Nuclear Information System (INIS)
Gaponov, Yu.V.
2004-01-01
A theory of induced double-beta processes in electron beams is developed. It is shown that a resonance mechanism of the excitation of the ground state of an intermediate nucleus is realized in them, this mechanism being described in the single-state-dominance approximation, where the process in question is broken down into two stages, the excitation of a dominant state and its decay. This approximation is valid irrespective of the features of this state, both for allowed (for a 1 + state of the intermediate nucleus) and for forbidden transitions. An analysis of the resonance mechanism reveals that its inclusion in double-beta-decay processes requires introducing additional diagrams that describe the gamma decay of virtual intermediate states. The inclusion of such corrections may lead to a decrease in the expected half-life and to a change in the beta spectrum. Effects associated with the interference between the two stages of a double-beta process are estimated, and it is shown that their influence can be significant if the time interval between these stages is less than or on the order of the lifetime of the dominant state
Kinetics of gene and chromosome mutations induced by UV-C in yeast Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Koltovaya, N.; Kokoreva, A.; Senchenko, D.; Shvaneva, N.; Zhuchkina, N.
2017-01-01
The systematic study of the kinetics of UV-induced gene and structural mutations in eukaryotic cells was carried out on the basis of model yeast S. cerevisiae. A variety of genetic assays (all types of base pair substitutions, frameshifts, forward mutations canl, chromosomal and plasmid rearrangements) in haploid strains were used. Yeast cells were treated by UV-C light of fluence of energy up to 200 J/m"2. The kinetics of the induced gene and structural mutations is represented by a linear-quadratic and exponential functions. The slope of curves in log-log plots was not constant, had the value 2-4 and depended on the interval of doses. It was suggested that it is the superposition and dynamics of different pathways form the mutagenic responses of eukaryotic cells to UV-C light that cause the high-order curves. [ru
International Nuclear Information System (INIS)
Ganesan, K.; Javad Hussain, H.S.; Vindhiyavarman, P.
2001-01-01
Castor (Ricinus communis L.) is an important oilseed crop in India. To create variability mutations were induced in two cultivars 'TMV5' (maturing in 130-140 days) and 'CO1' (perennial type). Gamma rays and diethyl sulphate and ethidium bromide were used for seed treatment. Ten doses, from 100 to 1000 Gy were employed. For chemical mutagenesis five concentrations of mutagenes from 10 to 50 mM were tried. No economic mutants could be isolated after treatment with the chemical mutagens. The following economic mutants were identified in the dose 300 Gy of gamma rays. Annual types from perennial CO 1 castor CO 1 is a perennial variety (8-10 years) with bold seeds (100 seed weight 90 g) and high oil content (57%). Twenty-one lines were isolated with annual types (160-180 days) with high yield potential as well as bold seeds and high oil content. These mutants, identified in M 3 generation were bred true in subsequent generations up to M 8 generation. Critical evaluation of the mutants in yield evaluation trials is in progress
International Nuclear Information System (INIS)
Gazlev, A.I.; Podlutskii, A.Ya.; Bradbury, R.
1994-01-01
Endogenous and exogenous factors continually afflict DNA of cells of organisms. A certain amount of the damage is accumulated causing mutations, increasing the risk of malignacies, impairing cell functions, and upsetting the body's homeostasis. The research reported here studies the rates of spontaneous hprt nmutationsand those induced you ggammairradiation in the splenocytes of mice at various ages. The rate of spontaneous and induced hprt gene mutations increases with aging. In gamma irradiated mice the rate of radiation-induced mutations depended on the absorbed dose and age, with the rate 2.3-3.0 fold higher in 104-110 week old mice than in younger pups. 15 refs., 1 tab
International Nuclear Information System (INIS)
Machida, I.; Nakai, S.
1980-01-01
Inductions of reversions of nonsense, missense and frameshift-type mutations were investigated in a diploid cell population of Saccharomyces cerevisiae during commitment to meiosis, by using the medium-transfer technique from sporulation medium to vegetative medium. The yields of spontaneous reverse mutations obtained from the cells that were committed to different stages during meiosis were rather constant irrespective of the alleles tested, although the yields of both intergenic and intragenic recombinations markedly increased. The susceptibilities to UV-induced reverse mutations examined during commitment to meiosis were not changed appreciably. It is concluded that induction of base-change-type mutations in meiosis is not essentially different from that in mitosis. (orig.)
Ivanov, E L; Koval'tsova, S V; Korolev, V G
1987-09-01
We have studied the influence of him1-1, him2-1, him3-1 and himX mutations on induction frequency and specificity of UV-induced adenine-dependent mutations in the yeast Saccharomyces cerevisiae. Him mutations do not render haploid cells more sensitive to the lethal action of UV-light; however, in him strains adenine-dependent mutations (ade1, ade2) were induced more frequently (1.5--2-fold), as compared to the HIM strain. An analysis of the molecular nature of ade2 mutants revealed that him1-1, him2-1 and himX mutations increase specifically the yield of transitions (AT----GC and GC----AT), whereas in the him3-1 strain the yield of transversions was enhanced as well. We suggest him mutations analysed to affect specific repair pathway for mismatch correction.
On the effect of hyperaldosteronism-inducing mutations in Na/K pumps.
Meyer, Dylan J; Gatto, Craig; Artigas, Pablo
2017-11-06
Primary aldosteronism, a condition in which too much aldosterone is produced and that leads to hypertension, is often initiated by an aldosterone-producing adenoma within the zona glomerulosa of the adrenal cortex. Somatic mutations of ATP1A1, encoding the Na/K pump α1 subunit, have been found in these adenomas. It has been proposed that a passive inward current transported by several of these mutant pumps is a "gain-of-function" activity that produces membrane depolarization and concomitant increases in aldosterone production. Here, we investigate whether the inward current through mutant Na/K pumps is large enough to induce depolarization of the cells that harbor them. We first investigate inward currents induced by these mutations in Xenopus Na/K pumps expressed in Xenopus oocytes and find that these inward currents are similar in amplitude to wild-type outward Na/K pump currents. Subsequently, we perform a detailed functional evaluation of the human Na/K pump mutants L104R, delF100-L104, V332G, and EETA963S expressed in Xenopus oocytes. By combining two-electrode voltage clamp with [ 3 H]ouabain binding, we measure the turnover rate of these inward currents and compare it to the turnover rate for outward current through wild-type pumps. We find that the turnover rate of the inward current through two of these mutants (EETA963S and L104R) is too small to induce significant cell depolarization. Electrophysiological characterization of another hyperaldosteronism-inducing mutation, G99R, reveals the absence of inward currents under many different conditions, including in the presence of the regulator FXYD1 as well as with mammalian ionic concentrations and body temperatures. Instead, we observe robust outward currents, but with significantly reduced affinities for intracellular Na + and extracellular K + Collectively, our results point to loss-of-function as the common mechanism for the hyperaldosteronism induced by these Na/K pump mutants. © 2017 Meyer et al.
Tumkosit, Prem; Kuryatov, Alexander; Luo, Jie; Lindstrom, Jon
2006-10-01
Nicotinic acetylcholine receptors (AChRs) containing alpha6 subunits are typically found at aminergic nerve endings where they play important roles in nicotine addiction and Parkinson's disease. alpha6* AChRs usually contain beta3 subunits. beta3 subunits are presumed to assemble only in the accessory subunit position within AChRs where they do not participate in forming acetylcholine binding sites. Assembly of subunits in the accessory position may be a critical final step in assembly of mature AChRs. Human alpha6 AChRs subtypes were permanently transfected into human tsA201 human embryonic kidney (HEK) cell lines. alpha6beta2beta3 and alpha6beta4beta3 cell lines were found to express much larger amounts of AChRs and were more sensitive to nicotine-induced increase in the amount of AChRs than were alpha6beta2 or alpha6beta4 cell lines. The increased sensitivity to nicotine-induced up-regulation was due not to a beta3-induced increase in affinity for nicotine but probably to a direct effect on assembly of AChR subunits. HEK cells express only a small amount of mature alpha6beta2 AChRs, but many of these subunits are on the cell surface. This contrasts with Xenopus laevis oocytes, which express a large amount of incorrectly assembled alpha6beta2 subunits that bind cholinergic ligands but form large amorphous intracellular aggregates. Monoclonal antibodies (mAbs) were made to the alpha6 and beta3 subunits to aid in the characterization of these AChRs. The alpha6 mAbs bind to epitopes C-terminal of the extracellular domain. These data demonstrate that both cell type and the accessory subunit beta3 can play important roles in alpha6* AChR expression, stability, and up-regulation by nicotine.
TRUNCATED OR 2/2 HEMOGLOBINS : A NEW CLASS OF GLOBINS WITH NOVEL STRUCTURE AND FUNCTION
Directory of Open Access Journals (Sweden)
Amit Kumar
2013-06-01
Full Text Available Bright red hemoglobins, the most well-known paradigm in protein science, seem to be ubiquitous in nature. With advances in modern tools and techniques, discovery of new globins at a rapid pace has expanded this family. With every discovery, new insights emerged regarding their novel structure, function and several other characteristics previously not observed for hemoglobins. Even the classical function unanimously assigned to hemoglobins – oxygen transport and storage – needed re-evaluation. The ability of this class of proteins to show responses against various gaseous ligands, even the poisonous ones, indicate that it is obviously as ancient as life. As organisms evolved, hemoglobins also evolved, and accumulated a great degree of diversity in all aspects. The classical globin fold is very unique with 3-on-3 alpha helical bundle as observed in the traditional oxygen-transport hemoglobins like myoglobin, human blood hemoglobin and leghemoglobins in plants. However, a class of the newly discovered hemoglobins, which dominate the superfamily and appears ancient in origin mostly have 2-on-2 fold, commonly termed as “truncated” hemoglobins. These hemoglobins are phylogenetically distinct from their classical counterparts and are often shorter in their polypeptide length by 20-40 residues mainly due to a lack of short A helix, D helix and F helix. However, hemoglobins with 2-on-2 fold were also later found to have polypeptide chain lengths similar in size to classical globins. Disordered pre-F helix region, conserved glycine motifs and other key residues and apolar tunnels through their protein matrix for migration of ligands are some unique characteristics features of these truncated hemoglobins. Some of these are also hexacoordinated at heme iron where an amino acid from within the protein coordinates heme iron in absence of a ligand. These hemoglobins are well known for their high affinity towards ligand and have a diverse mechanism of
The Mutational Robustness of Influenza A Virus.
Directory of Open Access Journals (Sweden)
Elisa Visher
2016-08-01
Full Text Available A virus' mutational robustness is described in terms of the strength and distribution of the mutational fitness effects, or MFE. The distribution of MFE is central to many questions in evolutionary theory and is a key parameter in models of molecular evolution. Here we define the mutational fitness effects in influenza A virus by generating 128 viruses, each with a single nucleotide mutation. In contrast to mutational scanning approaches, this strategy allowed us to unambiguously assign fitness values to individual mutations. The presence of each desired mutation and the absence of additional mutations were verified by next generation sequencing of each stock. A mutation was considered lethal only after we failed to rescue virus in three independent transfections. We measured the fitness of each viable mutant relative to the wild type by quantitative RT-PCR following direct competition on A549 cells. We found that 31.6% of the mutations in the genome-wide dataset were lethal and that the lethal fraction did not differ appreciably between the HA- and NA-encoding segments and the rest of the genome. Of the viable mutants, the fitness mean and standard deviation were 0.80 and 0.22 in the genome-wide dataset and best modeled as a beta distribution. The fitness impact of mutation was marginally lower in the segments coding for HA and NA (0.88 ± 0.16 than in the other 6 segments (0.78 ± 0.24, and their respective beta distributions had slightly different shape parameters. The results for influenza A virus are remarkably similar to our own analysis of CirSeq-derived fitness values from poliovirus and previously published data from other small, single stranded DNA and RNA viruses. These data suggest that genome size, and not nucleic acid type or mode of replication, is the main determinant of viral mutational fitness effects.
Energy Technology Data Exchange (ETDEWEB)
Byun, Hae-Ok; Jung, Hyun-Jung; Seo, Yong-Hak; Lee, Young-Kyoung [Department of Biochemistry and Molecular Biology, Ajou University School of Medicine, Suwon 443-721 (Korea, Republic of); Department of Molecular Science and Technology, The Graduate School, Ajou University, Suwon 443-721 (Korea, Republic of); Hwang, Sung-Chul [Department of Pulmonary and Critical Care Medicine, Ajou University School of Medicine, Suwon 443-721 (Korea, Republic of); Seong Hwang, Eun [Department of Life Science, University of Seoul, Seoul 130-743 (Korea, Republic of); Yoon, Gyesoon, E-mail: ypeace@ajou.ac.kr [Department of Biochemistry and Molecular Biology, Ajou University School of Medicine, Suwon 443-721 (Korea, Republic of); Department of Molecular Science and Technology, The Graduate School, Ajou University, Suwon 443-721 (Korea, Republic of)
2012-09-10
Transforming growth factor {beta}1 (TGF {beta}1) induces Mv1Lu cell senescence by persistently producing mitochondrial reactive oxygen species (ROS) through decreased complex IV activity. Here, we investigated the molecular mechanism underlying the effect of TGF {beta}1 on mitochondrial complex IV activity. TGF {beta}1 progressively phosphorylated the negative regulatory sites of both glycogen synthase kinase 3 (GSK3) {alpha} and {beta}, corresponding well to the intracellular ROS generation profile. Pre-treatment of N-acetyl cysteine, an antioxidant, did not alter this GSK3 phosphorylation (inactivation), whereas pharmacological inhibition of GSK3 by SB415286 significantly increased mitochondrial ROS, implying that GSK3 phosphorylation is an upstream event of the ROS generation. GSK3 inhibition by SB415286 decreased complex IV activity and cellular O{sub 2} consumption rate and eventually induced senescence of Mv1Lu cell. Similar results were obtained with siRNA-mediated knockdown of GSK3. Moreover, we found that GSK3 not only exists in cytosol but also in mitochondria of Mv1Lu cell and the mitochondrial GSK3 binds complex IV subunit 6b which has no electron carrier and is topologically located in the mitochondrial intermembrane space. Involvement of subunit 6b in controlling complex IV activity and overall respiration rate was proved with siRNA-mediated knockdown of subunit 6b. Finally, TGF {beta}1 treatment decreased the binding of the subunit 6b to GSK3 and subunit 6b phosphorylation. Taken together, our results suggest that GSK3 inactivation is importantly involved in TGF {beta}1-induced complex IV defects through decreasing phosphorylation of the subunit 6b, thereby contributing to senescence-associated mitochondrial ROS generation.
Energy Technology Data Exchange (ETDEWEB)
Han Wei [Department of Physics and Materials Science, City University of Hong Kong, Tat Chee Avenue, Kowloon Tong (Hong Kong); Chen Shaopeng [Department of Physics and Materials Science, City University of Hong Kong, Tat Chee Avenue, Kowloon Tong (Hong Kong); Key Laboratory of Ion Beam Bioengineering, Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China); Yu, K.N., E-mail: peter.yu@cityu.edu.hk [Department of Physics and Materials Science, City University of Hong Kong, Tat Chee Avenue, Kowloon Tong (Hong Kong); Wu Lijun [Key Laboratory of Ion Beam Bioengineering, Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China)
2010-02-03
Low-dose {alpha}-particle exposures comprise 55% of the environmental dose to the human population and have been shown to induce bystander responses. Previous studies showed that bystander effect could induce stimulated cell growth or genotoxicity, such as excessive DNA double strand breaks (DSBs), micronuclei (MN), mutation and decreased cell viability, in the bystander cell population. In the present study, the stimulated cell growth, detected with flow cytometry (FCM), and the increased MN and DSB, detected with p53 binding protein 1 (53BP1) immunofluorescence, were observed simultaneously in the bystander cell population, which were co-cultured with cells irradiated by low-dose {alpha}-particles (1-10 cGy) in a mixed system. Further studies indicated that nitric oxide (NO) and transforming growth factor {beta}1 (TGF-{beta}1) played very important roles in mediating cell proliferation and inducing MN and DSB in the bystander population through treatments with NO scavenger and TGF-{beta}1 antibody. Low-concentrations of NO, generated by spermidine, were proved to induce cell proliferation, DSB and MN simultaneously. The proliferation or shortened cell cycle in bystander cells gave them insufficient time to repair DSBs. The increased cell division might increase the probability of carcinogenesis in bystander cells since cell proliferation increased the probability of mutation from the mis-repaired or un-repaired DSBs.
Legault, J; Gaulin, J F; Mounetou, E; Bolduc, S; Lacroix, J; Poyet, P; Gaudreault, R C
2000-02-15
We have previously reported that 4-tert-butyl-[3-(2-chloroethyl)ureido] benzene (4-tBCEU), a potent cytotoxic agent, modulates the synthesis of tubulins, suggesting that its cytotoxicity may be mediated through an antimicrotubule mechanism. Indeed, 4-tBCEU and its 4-iso-propyl (4-isopropyl [3-(2-chloroethyl)ureido] benzene) and 4-sec-butyl (4-sec-butyl [3-(2-chloroethyl)ureido] benzene) homologues induced disruption of the cytoskeleton and arrest of the cell cycle in G2 transition and mitosis. To better understand the mechanisms responsible for microtubule disruption by 1-aryl-3-(2-chloroethyl)ureas (CEU), we first examined their cytotoxicity on Chinese hamster ovary cells resistant to vinblastine and colchicine due to the expression of mutated tubulins (CHO-VV 3-2). These cells showed resistance to CEU, e.g., 4-tBCEU having an IC50 of 21.3+/-1.1 microM as compared with an IC50 of 11.6+/-0.7 microM for wild-type cells, suggesting a direct effect of the drugs on tubulins. Western blot analysis confirmed the disruption of microtubules and evidenced the formation of an additional immunoreactive beta-tubulin with an apparent lower molecular weight on SDS polyacrylamide gel. Incubation of MDA-MB-231 cells with [urea-14C]-4-tBCEU revealed the presence of a radioactive protein that coincided with the additional beta-tubulin band, indicating that CEU could covalently bind to the beta-tubulin. The 4-tBCEU-binding site on beta-tubulin was identified by competition of the CEU with colchicine, vinblastine, and iodoacetamide, a specific alkylating agent of sulfhydryl groups of cysteine residues. Colchicine, but not vinblastine, prevented the formation of the additional beta-tubulin band, suggesting that 4-tBCEU alkylates either Cys239 or Cys354 residues near the colchicine-binding site. To determine the cysteine residue alkylated by 4-tBCEU, we incubated the radiolabeled drug with human neuroblastoma cells (SK-N-SH) that overexpress the betaIII-tubulin, an isoform where Cys239
Dispersive waves induced by self-defocusing temporal solitons in a beta-barium-borate crystal
DEFF Research Database (Denmark)
Zhou, Binbin; Bache, Morten
2015-01-01
We experimentally observe dispersive waves in the anomalous dispersion regime of a beta-barium-borate (BBO) crystal, induced by a self-defocusing few-cycle temporal soliton. Together the soliton and dispersive waves form an energetic octave-spanning supercontinuum. The soliton was excited...
Gajewska, Małgorzata; Motyl, Tomasz
2004-10-01
TGF-beta 1 is an antiproliferative and apoptogenic factor for mammary epithelial cells (MEC) acting in an auto/paracrine manner and thus considered an important local regulator of mammary tissue involution. However, the apoptogenic signaling pathway induced by this cytokine in bovine MEC remains obscure. The present study was focused on identification of molecules involved in apoptogenic signaling of transforming growth factor-beta 1 (TGF-beta 1) in the model of bovine mammary epithelial cell line (BME-UV1). Laser scanning cytometry (LSC), Western blot and electrophoretic mobility shift assay (EMSA) were used for analysis of expression and activity of TGF-beta 1-related signaling molecules. The earliest response occurring within 1-2 h after TGF-beta 1 administration was an induction and activation of R-Smads (Smad2 and Smad3) and Co-Smad (Smad4). An evident formation of Smad-DNA complexes began from 2nd hour after MEC exposure to TGF-beta 1. Similarly to Smads, proteins of AP1 complex: phosphorylated c-Jun and JunD appeared to be early reactive molecules; however, an increase in their expression was detected only in cytosolic fraction. In the next step, an increase of IGF binding protein-3 (IGFBP-3) and IGFBP-4 expression was observed from 6th hour followed by a decrease in the activity of protein kinase B (PKB/Akt), which occurred after 24 h of MEC exposure to TGF-beta 1. The decrease in PKB/Akt activity coincided in time with the decline of phosphorylated Bad expression (inactive form). Present study supported additional evidence that stimulation of insulin-like growth factor I (IGF-I) was associated with complete abrogation of TGF-beta 1-induced activation of Bad and Bax and in the consequence protection against apoptosis. In conclusion, apoptotic effect of TGF-beta 1 in bovine MEC is mediated by IGFBPs and occurs through IGF-I sequestration, resulting in inhibition of PKB/Akt-dependent survival pathway.
Somatic mutations in leafs of tobacco seedlings induced by ionizing radiation and pesticide
International Nuclear Information System (INIS)
Shin, H. S.; Kim, J. K.; Song, H. S.; Lee, Y. I.
2001-01-01
Somatic mutations induced by the combined treatment of pesticide and ionizing radiation were analyzed in the leaves of tobacco seedlings. The pesticide (1,5 and 10 ppm of parathion) was sprayed directly onto the seedlings. The seedlings, with or without pretreatment of pesticide, were irradiated with 0.1 ∼10 Gy of gamma ray. The difference in the somatic mutation frequencies were not significant among groups treated with different concentration of pesticide. The somatic mutations in tobacco seedlings irradiated with gamma-ray showed a clear dose-response relationship in a range of 0.1 to 10 Gy. However, the combined treatment of pesticide and radiation did not cause any synergistic enhancement in the mutation frequencies. The highest efficiency in the induction of somatic mutations could be obtained by irradiating the seedlings with 5 Gy, 12 hours after 1 ppm of pesticide treatment, or 24 hours after 5 ppm of pesticide treatment
Haas, Michael J; Kurban, William; Shah, Harshit; Onstead-Haas, Luisa; Mooradian, Arshag D
Beta blockers are known to have favorable effects on endothelial function partly because of their capacity to reduce oxidative stress. To determine whether beta blockers can also prevent dextrose-induced endoplasmic reticulum (ER) stress in addition to their antioxidative effects, human coronary artery endothelial cells and hepatocyte-derived HepG2 cells were treated with 27.5 mM dextrose for 24 hours in the presence of carvedilol (a lipophilic beta blockers with alpha blocking activity), propranolol (a lipophilic nonselective beta blockers), and atenolol (a water-soluble selective beta blockers), and ER stress, oxidative, stress and cell death were measured. ER stress was measured using the placental alkaline phosphatase assay and Western blot analysis of glucose regulated protein 78, c-Jun-N-terminal kinase (JNK), phospho-JNK, eukaryotic initiating factor 2α (eIF2α), and phospho-eIF2α and measurement of X-box binding protein 1 (XBP1) mRNA splicing using reverse transcriptase-polymerase chain reaction. Superoxide (SO) generation was measured using the superoxide-reactive probe 2-methyl-6-(4-methoxyphenyl)-3,7-dihydroimidazo[1,2-A]pyrazin-3-one hydrochloride (MCLA) chemiluminescence. Cell viability was measured by propidium iodide staining method. The ER stress, SO production, and cell death induced by 27.5 mM dextrose were inhibited by all 3 beta blockers tested. The antioxidative and ER stress reducing effects of beta blockers were also observed in HepG2 cells. The salutary effects of beta blockers on endothelial cells in reducing both ER stress and oxidative stress may contribute to the cardioprotective effects of these agents.
Molecular cytogenetics of radiation-induced gene mutations in Drosophila melanogaster
International Nuclear Information System (INIS)
Aleksandrov, I.D.; Aleksandrova, M.V.; Lapidus, I.L.; Karpovskij, A.L.
1996-01-01
The classical paradigm of spatially unrelated lesions for gene mutations and chromosomal exchange breakpoints induced by ionizing radiations in eukaryotic cells was re-examined in the experiments on the mapping of gamma-ray- or neutron-induced breakpoints in and outside of white (w) and vestigial (vg) genes of Drosophila melanogaster using the in situ hybridization of the large fragments of the genes under study with the polythene chromosomes of the relevant mutants. The results for the random sample of 60 inversion and translocation breakpoints analysed to date have shown that (i) 50% of them are mapped as the hot spots within big introns of both the genes, and (ii) 21 of 60 breaks (35%) are located outside of genes. It is important to note that 26% (16/60) of the breakpoints analysed are flanked by the deletions, the sizes of which vary from the quarter to a whole of the gene. It was found that the deletions flank both the inversion and translocation breakpoints and arise more often after action of neutrons than photons. An unexpectedly high frequency of the multiple-damaged w and vg mutants that have the gene/point mutation and additional, but separate, chromosome exchange (the so-called double- or triple-site mutants) has shown that the genetic danger of ionizing radiation is higher than usually accepted on the base of single gene/point mutation assessments. 11 refs., 3 figs
Design of a tritium gas cell for beta-ray induced X-ray spectrometry using Monte Carlo simulation
Energy Technology Data Exchange (ETDEWEB)
Hara, Masanori, E-mail: masahara@ctg.u-toyama.ac.jp [Hydrogen Isotope Research Center, Organization for Promotion of Research, University of Toyama, 3190 Gofuku, Toyama City, Toyama 930-8555 (Japan); Abe, Shinsuke; Matsuyama, Masao [Hydrogen Isotope Research Center, Organization for Promotion of Research, University of Toyama, 3190 Gofuku, Toyama City, Toyama 930-8555 (Japan); Aso, Tsukasa [Electronics and Computer Engineering, National Institute of Technology, Toyama College, 1-2 Ebie-neriya, Imizu City, Toyama 933-0293 (Japan); Tatenuma, Katsuyoshi; Kawakami, Tomohiko; Ito, Takeshi [KAKEN Company Limited, 1044 Horimachi, Mito City, Ibaraki 310-0903 (Japan)
2017-06-15
Highlights: • Beta-ray induced X-ray spectrometry (BIXS) is a method for tritium gas analysis. • Gas cell for BIXS was designed by Monte Carlo simulations. • The optimum thickness of the gold layer on a beryllium window was around 150 nm. • This simulation model considered the self-absorption with increasing the cell length. - Abstract: One of the methods used for tritium gas analysis is beta-ray induced X-ray spectrometry (BIXS). Gas cell design is important in this method. The structure of the gas cell for BIXS was optimized by Monte Carlo simulation of beta-ray induced X-ray spectra in various window geometries using the Geant4 tool kit (version 10.01.p02). The simulated spectrum from tritium decay fitted the observed one, and the simulation model was used to obtain the cell parameters for BIXS. The optimum thickness of the gold layer on a beryllium window was around 150 nm. This simulation model also considered the relationship between self-absorption by hydrogen gas and the cell length. Self-absorption increased with increasing cell length and the relationship between the sample pressure and cell length was formulated.
Thalassemia and related hemoglobinopathies.
Sarnaik, Sharada A
2005-04-01
Hemoglobinopathies are the most common single gene disorders in man. There are several hundred of these disorders though the thalassemias -- alpha and beta and the sickling disorders make up the vast majority. Recent advances in the understanding of the hemoglobin structure and the genetics of its synthesis has contributed significantly to the understanding of these diseases. Disorders include those with reduced globin synthesis, abnormal globin chains and failure to switch globin chain synthesis at the appropriate age. This review focuses on the clinical features, diagnosis and management strategies of the alpha and beta thalassemias, the sickling disorders and touches on a few rarer hemoglobinopathies. It also emphasizes prevention strategies and chronic transfusion safety in countries like India where there are limited resources.
Energy Technology Data Exchange (ETDEWEB)
Halliday, Gary M. [Dermatology Research Laboratories, Division of Medicine, Melanoma and Skin Cancer Research Institute, Royal Prince Alfred Hospital at the University of Sydney, Sydney, NSW (Australia)]. E-mail: garyh@med.usyd.edu.au
2005-04-01
Ultraviolet (UV) radiation causes inflammation, gene mutation and immunosuppression in the skin. These biological changes are responsible for photocarcinogenesis. UV radiation in sunlight is divided into two wavebands, UVB and UVA, both of which contribute to these biological changes, and therefore probably to skin cancer in humans and animal models. Oxidative damage caused by UV contributes to inflammation, gene mutation and immunosuppression. This article reviews evidence for the hypothesis that UV oxidative damage to these processes contributes to photocarcinogenesis. UVA makes a larger impact on oxidative stress in the skin than UVB by inducing reactive oxygen and nitrogen species which damage DNA, protein and lipids and which also lead to NAD+ depletion, and therefore energy loss from the cell. Lipid peroxidation induces prostaglandin production that in association with UV-induced nitric oxide production causes inflammation. Inflammation drives benign human solar keratosis (SK) to undergo malignant conversion into squamous cell carcinoma (SCC) probably because the inflammatory cells produce reactive oxygen species, thus increasing oxidative damage to DNA and the immune system. Reactive oxygen or nitrogen appears to cause the increase in mutational burden as SK progress into SCC in humans. UVA is particularly important in causing immunosuppression in both humans and mice, and UV lipid peroxidation induced prostaglandin production and UV activation of nitric oxide synthase is important mediators of this event. Other immunosuppressive events are likely to be initiated by UV oxidative stress. Antioxidants have also been shown to reduce photocarcinogenesis. While most of this evidence comes from studies in mice, there is supporting evidence in humans that UV-induced oxidative damage contributes to inflammation, gene mutation and immunosuppression. Available evidence implicates oxidative damage as an important contributor to sunlight-induced carcinogenesis in humans.
International Nuclear Information System (INIS)
Halliday, Gary M.
2005-01-01
Ultraviolet (UV) radiation causes inflammation, gene mutation and immunosuppression in the skin. These biological changes are responsible for photocarcinogenesis. UV radiation in sunlight is divided into two wavebands, UVB and UVA, both of which contribute to these biological changes, and therefore probably to skin cancer in humans and animal models. Oxidative damage caused by UV contributes to inflammation, gene mutation and immunosuppression. This article reviews evidence for the hypothesis that UV oxidative damage to these processes contributes to photocarcinogenesis. UVA makes a larger impact on oxidative stress in the skin than UVB by inducing reactive oxygen and nitrogen species which damage DNA, protein and lipids and which also lead to NAD+ depletion, and therefore energy loss from the cell. Lipid peroxidation induces prostaglandin production that in association with UV-induced nitric oxide production causes inflammation. Inflammation drives benign human solar keratosis (SK) to undergo malignant conversion into squamous cell carcinoma (SCC) probably because the inflammatory cells produce reactive oxygen species, thus increasing oxidative damage to DNA and the immune system. Reactive oxygen or nitrogen appears to cause the increase in mutational burden as SK progress into SCC in humans. UVA is particularly important in causing immunosuppression in both humans and mice, and UV lipid peroxidation induced prostaglandin production and UV activation of nitric oxide synthase is important mediators of this event. Other immunosuppressive events are likely to be initiated by UV oxidative stress. Antioxidants have also been shown to reduce photocarcinogenesis. While most of this evidence comes from studies in mice, there is supporting evidence in humans that UV-induced oxidative damage contributes to inflammation, gene mutation and immunosuppression. Available evidence implicates oxidative damage as an important contributor to sunlight-induced carcinogenesis in humans
X-ray-induced bystander response reduce spontaneous mutations in V79 cells
International Nuclear Information System (INIS)
Maeda, Munetoshi; Kobayashi, Katsumi; Matsumoto, Hideki; Usami, Noriko; Tomiya, Masanori
2013-01-01
The potential for carcinogenic risks is increased by radiation-induced bystander responses; these responses are the biological effects in unirradiated cells that receive signals from the neighboring irradiated cells. Bystander responses have attracted attention in modern radiobiology because they are characterized by non-linear responses to low-dose radiation. We used a synchrotron X-ray microbeam irradiation system developed at the Photon Factory, High Energy Accelerator Research Organization, KEK, and showed that nitric oxide (NO)-mediated bystander cell death increased biphasically in a dose-dependent manner. Here, we irradiated five cell nuclei using 10 × 10 µm 2 5.35 keV X-ray beams and then measured the mutation frequency at the hypoxanthine-guanosine phosphoribosyl transferase (HPRT) locus in bystander cells. The mutation frequency with the null radiation dose was 2.6 × 10 -5 (background level), and the frequency decreased to 5.3 × 10 -6 with a dose of approximately 1 Gy (absorbed dose in the nucleus of irradiated cells). At high doses, the mutation frequency returned to the background level. A similar biphasic dose-response effect was observed for bystander cell death. Furthermore, we found that incubation with 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (carboxy-PTIO), a specific scavenger of NO, suppressed not only the biphasic increase in bystander cell death but also the biphasic reduction in mutation frequency of bystander cells. These results indicate that the increase in bystander cell death involves mechanisms that suppress mutagenesis. This study has thus shown that radiation-induced bystander responses could affect processes that protect the cell against naturally occurring alterations such as mutations. (author)
International Nuclear Information System (INIS)
Abrahamson, S.
1981-02-01
Neutron-induced mutation experiments with Drosophila oogonia were conducted at the University of Wisconsin, with irradiations being carried out at the RARAF facility at Brookhaven National Laboratory. X-linked recessive lethals and specific locus mutations were studied. Using the α value of the weighted linear regression equation for lethal data, RBE's relative to X-rays were calculated for the energies of neutrons studied. They are: 15 MeV to 2.0; 6 MeV to 2.9; 2 MeV to 3.2; .66 MeV to 4.0; .43 MeV to 4.8. The dose/frequency response curves for lethal data of all neutron energies studied was suggestive of a quadratic component. All data best fit a linear hypothesis, however. Control data for specific locus mutations was used to estimate the number of loci on the X-chromosome which are capable of mutating to lethals. Neutron-induced data for specific locus mutation was inconclusive due to the high error inherent in the frequencies obtained
Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth
2015-01-01
Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.
Directory of Open Access Journals (Sweden)
Priscila Da Silva Figueiredo Celestino Gomes
Full Text Available The receptors tyrosine kinases (RTKs for the colony stimulating factor-1, CSF-1R, and for the stem cell factor, SCFR or KIT, are important mediators of signal transduction. The abnormal function of these receptors, promoted by gain-of-function mutations, leads to their constitutive activation, associated with cancer or other proliferative diseases. A secondary effect of the mutations is the alteration of receptors' sensitivity to tyrosine kinase inhibitors, compromising effectiveness of these molecules in clinical treatment. In particular, the mutation V560G in KIT increases its sensitivity to Imatinib, while the D816V in KIT, and D802V in CSF-1R, triggers resistance to the drug. We analyzed the Imatinib binding affinity to the native and mutated KIT (mutations V560G, S628N and D816V and CSF-1R (mutation D802V by using molecular dynamics simulations and energy calculations of Imatinib•target complexes. Further, we evaluated the sensitivity of the studied KIT receptors to Imatinib by measuring the inhibition of KIT phosphorylation. Our study showed that (i the binding free energy of Imatinib to the targets is highly correlated with their experimentally measured sensitivity; (ii the electrostatic interactions are a decisive factor affecting the binding energy; (iii the most deleterious impact to the Imatinib sensitivity is promoted by D802V (CSF-1R and D816V (KIT mutations; (iv the role of the juxtamembrane region, JMR, in the imatinib binding is accessory. These findings contribute to a better description of the mutation-induced effects alternating the targets sensitivity to Imatinib.
International Nuclear Information System (INIS)
Turinetto, Valentina; Porcedda, Paola; Orlando, Luca; De Marchi, Mario; Amoroso, Antonio; Giachino, Claudia
2009-01-01
Current chemotherapy of human cancers focuses on the DNA damage pathway to induce a p53-mediated cellular response leading to either G1 arrest or apoptosis. However, genotoxic treatments may induce mutations and translocations that result in secondary malignancies or recurrent disease. In addition, about 50% of human cancers are associated with mutations in the p53 gene. Nongenotoxic activation of apoptosis by targeting specific molecular pathways thus provides an attractive therapeutic approach. Normal and leukemic cells were evaluated for their sensitivity to 5, 6-dichloro-1-beta-D-ribofuranosylbenzimidazole (DRB) through cell viability and caspase activation tests. The apoptotic pathway induced by DRB was analysed by immunfluorescence and immunoblot analysis. H2AX phosphorylation and cell cycle analysis were performed to study the dependance of apoptosis on DNA damage and DNA replication, respectively. To investigate the role of p53 in DRB-induced apoptosis, specific p53 inhibitors were used. Statistical analysis on cell survival was performed with the test of independence. Here we report that DRB, an inhibitor of the transcriptional cyclin-dependent kinases (CDKs) 7 and 9, triggers DNA replication-independent apoptosis in normal and leukemic human cells regardless of their p53 status and without inducing DNA damage. Our data indicate that (i) in p53-competent cells, apoptosis induced by DRB relies on a cytosolic accumulation of p53 and subsequent Bax activation, (ii) in the absence of p53, it may rely on p73, and (iii) it is independent of ATM and NBS1 proteins. Notably, even apoptosis-resistant leukemic cells such as Raji were sensitive to DRB. Our results indicate that DRB represents a potentially useful cancer chemotherapeutic strategy that employs both the p53-dependent and -independent apoptotic pathways without inducing genotoxic stress, thereby decreasing the risk of secondary malignancies
Hosey, Alison M; Chaturvedi, Chandra-Prakash; Brand, Marjorie
2010-05-16
Genome wide studies have provided a wealth of information related to histone modifications. Particular modifications, which can encompass both broad and discrete regions, are associated with certain genomic elements and gene expression status. Here we focus on how studies on the beta-globin gene cluster can complement the genome wide effort through the thorough dissection of histone modifying protein crosstalk. The beta-globin locus serves as a model system to study both regulation of gene expression driven at a distance by enhancers and mechanisms of developmental switching of clustered genes. We investigate recent studies, which uncover that histone methyltransferases, recruited at the beta-globin enhancer, control gene expression by long range propagation on chromatin. Specifically, we focus on how seemingly antagonistic complexes, such as those including MLL2, G9a and UTX, can cooperate to functionally regulate developmentally controlled gene expression. Finally, we speculate on the mechanisms of chromatin modifying complex propagation on genomic domains.