p53-Dependent radiation-induced apoptosis in vivo: relationship to Bcl-2 and Bax expression
International Nuclear Information System (INIS)
Hasegawa, Masatoshi; Suzuki, Yoshiyuki; Furuta, Masaya; Yamakawa, Michitaka; Maebayashi, Katsuya; Hayakawa, Kayoko; Saito, Yoshihiro; Mitsuhashi, Norio; Niibe, Hideo
1997-01-01
Purpose: A close correlation between p53 protein expression and radiation-induced apoptosis has already been reported, however, Bcl-2 and Bax expression and the ratio of Bcl-2 to Bax have been also suggested to play an important role in the regulation of apoptotic cell death. In this study, we investigated the relationship between p53-dependent radiation-induced apoptosis and expression of Bcl-2 and Bax by using human tumors transplanted into nude mice. Materials and Methods: Three human tumors (an ependymoblastoma, a glioblastoma, and a small cell lung cancer) were subcutaneously transplanted into nude mice and irradiated with single doses of 1, 2, 5, or 10 Gy. The tumors were excised 1, 3, 6, 12, 24, and 48 hours after irradiation, fixed in 10% formalin for 24 hours, and embedded in paraffin. Slides were stained with hematoxylin and eosin for morphologic examination. Immunohistochemical studies were performed with mouse monoclonal antibodies to demonstrate p53, p21 (WAF-1), Bcl-2, and Bax expression. TdT-mediated dUTP-biotin nick-end labeling (TUNEL) and electron microscopic studies were performed to identify apoptosis, and PCR-SSCP analysis was used to evaluate p53 gene mutation. Results: All of the tumors showed only a few cells undergoing apoptosis before irradiation. Beginning several hours after irradiation, only the ependymoblastoma showed a large increase in the number of cells undergoing apoptosis, peaking at 6 hours after irradiation, and there was a clear dose-effect relationship. In contrast, the other tumors showed much less change following irradiation, and the dose-effect relationship was not as clear as in the ependymoblastoma. Immunohistochemically, the non-irradiated ependymoblastoma was negative for p53, p21, Bcl-2, and Bax. Following irradiation, however, many of the tumor cells became positive for p53 and p21, and a few cells became positive for bcl-2. In contrast, the glioblastoma and the small cell lung cancer were positive for p53 and Bcl-2
Involvement of p53 and Bcl-2 in sensory cell degeneration in aging rat cochleae.
Xu, Yang; Yang, Wei Ping; Hu, Bo Hua; Yang, Shiming; Henderson, Donald
2017-06-01
p53 and Bcl-2 (B-cell lymphoma 2) are involved in the process of sensory cell degeneration in aging cochleae. To determine molecular players in age-related hair cell degeneration, this study examined the changes in p53 and Bcl-2 expression at different stages of apoptotic and necrotic death of hair cells in aging rat cochleae. Young (3-4 months) and aging (23-24 months) Fisher 344/NHsd rats were used. The thresholds of the auditory brainstem response (ABR) were measured to determine the auditory function. Immunolabeling was performed to determine the expression of p53 and Bcl-2 proteins in the sensory epithelium. Propidium iodide staining was performed to determine the morphologic changes in hair cell nuclei. Aging rats exhibited a significant elevation in ABR thresholds at all tested frequencies (p aging hair cells showing the early signs of apoptotic changes in their nuclei. The Bcl-2 expression increase was also observed in hair cells displaying early signs of necrosis. As the hair cell degenerative process advanced, p53 and Bcl-2 immunoreactivity became reduced or absent. In the areas where no detectable nuclear staining was present, p53 and Bcl-2 immunoreactivity was absent.
Wu, Weizhong; Liu, Sanguang; Liang, Yunfei; Zhou, Zegao; Bian, Wei; Liu, Xueqing
2017-12-01
The pathogenesis of hepatocellular carcinoma (HC) is unclear. It is suggested that psychological stress associates with the pathogenesis of liver cancer. Bcl2-like protein 12 (Bcl2L12) suppresses p53 protein. This study tests a hypothesis that the major stress hormone, cortisol, inhibits the expression of p53 in HC cells (HCC) via up regulating the expression of Bcl2L12. Peripheral blood samples were collected from patients with HC to be analyzed for the levels of cortisol. HCC were cultured to assess the role of cortisol in the regulation of the expression of Bcl2L12 and p53 in HCC. We observed that the serum cortisol levels were higher in HC patients. Expression of Bcl2L12 in HCC was correlated with serum cortisol. Cortisol enhanced the Bcl2L12 expression in HCC. Bcl2L12 binding to the TP53 promoter was correlated with p53 expression in HCC. Cortisol increased the Bcl2L12 expression in HCC to inhibit p53 expression. Stress hormone cortisol suppresses p53 in HCC via enhancing Bcl2L12 expression in HCC. The results suggest that cortisol may be a therapeutic target for the treatment of HC.
Energy Technology Data Exchange (ETDEWEB)
Noh, Woo Chul; Ham, Yong Ho [Korea Cancer Center Hospital, Seoul (Korea, Republic of)
1998-01-01
To investigate the relationship of bcl-2, p53, ER and tamoxifen-induced apoptosis of breast cancer cells, MCF-7 (ER+/bcl-2+/p53-) and MB MDA 468 (ER-/bcl-2-/p53+) cell line were cultured in estrogen-free condition. E2(10`-`9M) and tamoxifen (10`-`5M) were added to the media. The changes of bcl-2 and mutant p53 protein were checked by Western blot and apoptosis were measured by flowcytometry. In MCF-7 cells, we found that treatment with tamoxifen resulted in a decrease in bcl-2 protein level, but produced no change in mutant p53. In MB MDA 468 cell however, there were no changes of bcl-2 and mutant p53 protein level when E2 or tamoxifen were added. Apoptotic cells increased with time-dependent pattern when tamoxifen was added to MCF-7 cells. According to these result, ER+/blc-2+/mutant p53- cells, when treated with tamoxifen, were converted into bcl-2/mutant p53- cells which were more prone to apoptosis than bcl-2-/mutant p53+ cells. The paradoxical correlation of bcl-2 and ER which had been observed in clinical studies might be explained with this results and bcl-2 protein seems to be one of important factors that can predict the effect of hormone therapy. (author). 26 refs., 5 figs
International Nuclear Information System (INIS)
Noh, Woo Chul; Ham, Yong Ho
1998-01-01
To investigate the relationship of bcl-2, p53, ER and tamoxifen-induced apoptosis of breast cancer cells, MCF-7 (ER+/bcl-2+/p53-) and MB MDA 468 (ER-/bcl-2-/p53+) cell line were cultured in estrogen-free condition. E2(10'-'9M) and tamoxifen (10'-'5M) were added to the media. The changes of bcl-2 and mutant p53 protein were checked by Western blot and apoptosis were measured by flowcytometry. In MCF-7 cells, we found that treatment with tamoxifen resulted in a decrease in bcl-2 protein level, but produced no change in mutant p53. In MB MDA 468 cell however, there were no changes of bcl-2 and mutant p53 protein level when E2 or tamoxifen were added. Apoptotic cells increased with time-dependent pattern when tamoxifen was added to MCF-7 cells. According to these result, ER+/blc-2+/mutant p53- cells, when treated with tamoxifen, were converted into bcl-2/mutant p53- cells which were more prone to apoptosis than bcl-2-/mutant p53+ cells. The paradoxical correlation of bcl-2 and ER which had been observed in clinical studies might be explained with this results and bcl-2 protein seems to be one of important factors that can predict the effect of hormone therapy. (author). 26 refs., 5 figs
International Nuclear Information System (INIS)
Tsutsui, Shinichi; Yasuda, Kazuhiro; Suzuki, Kosuke; Takeuchi, Hideya; Nishizaki, Takashi; Higashi, Hidefumi; Era, Shoichi
2006-01-01
Recent experimental studies have shown that Bcl-2, which has been established as a key player in the control of apoptosis, plays a role in regulating the cell cycle and proliferation. The aim of this study was to investigate the relationship between Bcl-2 and p27 protein expression, p53 protein expression and the proliferation activity as defined by the MIB-1 counts. The prognostic implication of Bcl-2 protein expression in relation to p27 and p53 protein expressions and MIB-1 counts for breast cancer was also evaluated. The immunohistochemical expression of Bcl-2 protein was evaluated in a series of 249 invasive ductal carcinomas of the breast, in which p27 and p53 protein expressions and MIB-1 counts had been determined previously. The Bcl-2 protein expression was found to be decreased in 105 (42%) cases. A decreased Bcl-2 protein expression was significantly correlated with a nuclear grade of III, a negative estrogen receptor, a decreased p27 protein expression, a positive p53 protein expression, positive MIB-1 counts and a positive HER2 protein expression. The incidence of a nuclear grade of III and positive MIB-1 counts increased as the number of abnormal findings of Bcl-2, p27 and p53 protein expressions increased. A univariate analysis indicated a decreased Bcl-2 protein expression to be significantly (p = 0.0089) associated with a worse disease free survival (DFS), while a multivariate analysis indicated the lymph node status and MIB-1 counts to be independently significant prognostic factors for the DFS. The Bcl-2 protein expression has a close correlation with p27 and p53 protein expressions and the proliferation activity determined by MIB-1 counts in invasive ductal carcinoma of the breast. The prognostic value of Bcl-2 as well as p27 and p53 protein expressions was dependent on the proliferation activity in breast cancer
Directory of Open Access Journals (Sweden)
Nishizaki Takashi
2006-07-01
Full Text Available Abstract Background Recent experimental studies have shown that Bcl-2, which has been established as a key player in the control of apoptosis, plays a role in regulating the cell cycle and proliferation. The aim of this study was to investigate the relationship between Bcl-2 and p27 protein expression, p53 protein expression and the proliferation activity as defined by the MIB-1 counts. The prognostic implication of Bcl-2 protein expression in relation to p27 and p53 protein expressions and MIB-1 counts for breast cancer was also evaluated. Methods The immunohistochemical expression of Bcl-2 protein was evaluated in a series of 249 invasive ductal carcinomas of the breast, in which p27 and p53 protein expressions and MIB-1 counts had been determined previously. Results The Bcl-2 protein expression was found to be decreased in 105 (42% cases. A decreased Bcl-2 protein expression was significantly correlated with a nuclear grade of III, a negative estrogen receptor, a decreased p27 protein expression, a positive p53 protein expression, positive MIB-1 counts and a positive HER2 protein expression. The incidence of a nuclear grade of III and positive MIB-1 counts increased as the number of abnormal findings of Bcl-2, p27 and p53 protein expressions increased. A univariate analysis indicated a decreased Bcl-2 protein expression to be significantly (p = 0.0089 associated with a worse disease free survival (DFS, while a multivariate analysis indicated the lymph node status and MIB-1 counts to be independently significant prognostic factors for the DFS. Conclusion The Bcl-2 protein expression has a close correlation with p27 and p53 protein expressions and the proliferation activity determined by MIB-1 counts in invasive ductal carcinoma of the breast. The prognostic value of Bcl-2 as well as p27 and p53 protein expressions was dependent on the proliferation activity in breast cancer.
International Nuclear Information System (INIS)
Liang Xin; Xu Ke; Xu Yufang; Liu Jianwen; Qian Xuhong
2011-01-01
The Bcl-2 family contains a panel of proteins which are conserved regulators of apoptosis in mammalian cells, like the anti-apoptotic protein Bcl-2. According to its significant role in altering susceptibility to apoptosis, the deciphering of the mechanism of Bcl-2 expression modulation may be crucial for identifying therapeutics strategies for cancer. Treatment with naphthalimide-based DNA intercalators, including M2-A and R16, generally leads to a decrease in Bcl-2 intracellular amounts. Whereas the interest for these chemotherapeutics is accompanied by advances in the fundamental understanding of their anticancer properties, the molecular mechanism underlying changes in Bcl-2 expression remains poorly understood. We report here that p53 contributes to Bcl-2 down-regulation induced by B1, a novel naphthalimide-based DNA intercalating agent. Indeed, the decrease in Bcl-2 protein levels observed during B1-induced apoptosis was correlated to the decrease in mRNA levels, as a result of the inhibition of Bcl-2 transcription and promoter activity. In this context, we evaluated p53 contribution in the Bcl-2 transcriptional down-regulation. We found a significant increase of p53 binding to P 2 promoter TATA box in MCF7 cells by chromatin immunoprecipitation. These data suggest that B1-induced caspase-independent apoptosis in MCF-7 cells is associated with the activation of p53 and the down-regulation of Bcl-2. Our study strengthens the links between p53 and Bcl-2 at a transcriptional level, upon naphthalimide-based DNA intercalator treatment. - Research highlights: → B1 induced apoptosis in MCF-7 cells, following a transcriptional decrease in Bcl-2. → B1 treatment triggered p53 activation and leads to a p53-dependent down-regulation of Bcl-2. → B1 induced significant increase of p53 binding to Bcl-2 P 2 promoter TATA box.
Borax-induced apoptosis in HepG2 cells involves p53, Bcl-2, and Bax.
Wei, Y; Yuan, F J; Zhou, W B; Wu, L; Chen, L; Wang, J J; Zhang, Y S
2016-06-21
Borax, a boron compound and a salt of boric acid, is known to inhibit the growth of tumor cells. HepG2 cells have been shown to be clearly susceptible to the anti-proliferative effects of borax. However, the specific mechanisms regulating this effect are poorly understood. This study aimed to investigate the pathways underlying the growth inhibition induced by borax in HepG2 cells. The effects of borax on HepG2 cell viability were characterized using MTT. Apoptosis was also verified by annexin V/propidium iodide staining. JC-1 dye and western blotting techniques were used to measure mitochondrial membrane potential and p53, Bax, and Bcl-2 protein expression, respectively. Relevant mRNA levels were measured by qRT-PCR. Borax inhibited the proliferation of HepG2 cells in a time- and dose-dependent manner in vitro. The apoptotic process triggered by borax involved the upregulation of p53 and Bax and the downregulation of Bcl-2, which was confirmed by a change in the mitochondrial membrane potential. These results elucidate a borax-induced apoptotic pathway in HepG2 cells that involves the upregulation of p53 and Bax and the downregulation of Bcl-2.
Ghatei, Najmeh; Nabavi, Ariane Sadr; Toosi, Mohammad Hossein Bahreyni; Azimian, Hosein; Homayoun, Mansour; Targhi, Reza Ghasemnezhad; Haghir, Hossein
2017-09-01
The increasing rate of over using cell phones has been considerable in youths and pregnant women. We examined the effect of mobile phones radiation on genes expression variation on cerebellum of BALB/c mice before and after of the birth. In this study, a mobile phone jammer, which is an instrument to prevent receiving signals between cellular phones and base transceiver stations (two frequencies 900 and 1800 MHz) for exposure was used and twelve pregnant mice (BALB/c) divided into two groups (n=6), first group irradiated in pregnancy period (19th day), the second group did not irradiate in pregnancy period. After childbirth, offspring were classified into four groups (n=4): Group1: control, Group 2: B1 (Irradiated after birth), Group 3: B2 (Irradiated in pregnancy period and after birth), Group 4: B3 (Irradiated in pregnancy period). When maturity was completed (8-10 weeks old), mice were dissected and cerebellum was isolated. The expression level of bax , bcl-2, p21 and p53 genes examined by real-time reverse transcription polymerase chain reaction (Real-Time RT- PCR). The data showed that mobile phone radio waves were ineffective on the expression level of bcl-2 and p53 genes) P >0.05(. Also gene expression level of bax decreased and gene expression level of p21 increased comparing to the control group ( P mobile phone radiations did not induce apoptosis in cells of the cerebellum and the injured cells can be repaired by cell cycle arrest.
Molecular basis of Bcl-X(L-p53 interaction: insights from molecular dynamics simulations.
Directory of Open Access Journals (Sweden)
Nagakumar Bharatham
Full Text Available Bcl-X(L, an antiapoptotic Bcl-2 family protein, plays a central role in the regulation of the apoptotic pathway. Heterodimerization of the antiapoptotic Bcl-2 family proteins with the proapoptotic family members such as Bad, Bak, Bim and Bid is a crucial step in the apoptotic regulation. In addition to these conventional binding partners, recent evidences reveal that the Bcl-2 family proteins also interact with noncanonical binding partners such as p53. Our previous NMR studies showed that Bcl-X(L: BH3 peptide and Bcl-X(L: SN15 peptide (a peptide derived from residues S15-N29 of p53 complex structures share similar modes of bindings. To further elucidate the molecular basis of the interactions, here we have employed molecular dynamics simulations coupled with MM/PBSA approach. Bcl-X(L and other Bcl-2 family proteins have 4 hydrophobic pockets (p1-p4, which are occupied by four systematically spaced hydrophobic residues (h1-h4 of the proapoptotic Bad and Bak BH3 peptides. We observed that three conserved hydrophobic residues (F19, W23 and L26 of p53 (SN15 peptide anchor into three hydrophobic pockets (p2-p4 of Bcl-X(L in a similar manner as BH3 peptide. Our results provide insights into the novel molecular recognition by Bcl-X(L with p53.
Buglioni, S; D'Agnano, I; Cosimelli, M; Vasselli, S; D'Angelo, C; Tedesco, M; Zupi, G; Mottolese, M
1999-12-22
About 40% of patients with colorectal carcinoma will develop local or distant tumour recurrences. Integrated analyses of bio-pathological markers, predictive of tumour aggressiveness, may offer a more rational approach to planning adjuvant therapy. To this end, we analysed the correlation between p53 accumulation, Bcl-2 expression, DNA ploidy, cell proliferation and conventional clinico-pathological parameters by testing the prognostic significance of these variables in a series of 171 colorectal carcinoma patients with long-term follow-up. The relationships among the various bio-pathological parameters, analysed by multiple correspondence analysis, showed 2 different clinico-biological profiles. The first, characterised by p53 negativity, Bcl-2 positivity, diploidy, low percentage of cells in S-phase (%S-phase), a low Ki-67 score, is associated with Dukes' A-B stage, well differentiated tumours and lack of relapse. The second, defined by p53 positivity, Bcl-2 negativity, aneuploidy, high %S-phase and elevated Ki-67 score, correlates with Dukes' C-D stage, poorly differentiated tumours and presence of relapse. When these parameters were examined according to Kaplan-Meier's method, significantly shorter disease-free (DFS) and overall survival (OS) were also observed in patients bearing p53 positive and Bcl-2 negative tumours, in Dukes' B stage. In multivariate analysis, p53 accumulation and Bcl-2 expression emerged as independent predictors of a worse and better clinical outcome, respectively. Our results indicate that, in colorectal adenocarcinomas, a biological profile, based on the combined evaluation of p53 and Bcl-2, may be useful for identifying high risk patients to be enrolled in an adjuvant setting, mainly in an early stage of the disease. Int. J. Cancer (Pred. Oncol.) 84:545-552, 1999. Copyright 1999 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Lech Chyczewski
2012-01-01
Full Text Available The objective of this study was to verify the frequency of P53 and BCL-2 immunohistochemical expression in 98 patients with endometrial carcinoma, and to correlate it with clinical stage and patient survival. A significant difference was found regarding the frequency of P53 expression when comparing type I and II tumors (23.7% and 54.5%, respectively; p = 0.006. A positive correlation was observed between P53 immunoexpression and patient survival in type I and II tumors (p = 0.009 and p = 0.036, respectively. BCL-2 expression was significantly more frequent in early clinical stages in both types of endometrial cancer (p < 0.001 and 0.002 and correlated with a decrease in overall survival in type I endometrial cancer (p = 0.014. Thus, the prognostic value of these biomarkers in endometrial cancer needs to be further investigated. (Folia Histochemica et Cytobiologica 2011; Vol. 49, No. 4, pp. 631–635
HAMLET triggers apoptosis but tumor cell death is independent of caspases, Bcl-2 and p53.
Hallgren, O; Gustafsson, L; Irjala, H; Selivanova, G; Orrenius, S; Svanborg, C
2006-02-01
HAMLET (Human alpha-lactalbumin Made Lethal to Tumor cells) triggers selective tumor cell death in vitro and limits tumor progression in vivo. Dying cells show features of apoptosis but it is not clear if the apoptotic response explains tumor cell death. This study examined the contribution of apoptosis to cell death in response to HAMLET. Apoptotic changes like caspase activation, phosphatidyl serine externalization, chromatin condensation were detected in HAMLET-treated tumor cells, but caspase inhibition or Bcl-2 over-expression did not prolong cell survival and the caspase response was Bcl-2 independent. HAMLET translocates to the nuclei and binds directly to chromatin, but the death response was unrelated to the p53 status of the tumor cells. p53 deletions or gain of function mutations did not influence the HAMLET sensitivity of tumor cells. Chromatin condensation was partly caspase dependent, but apoptosis-like marginalization of chromatin was also observed. The results show that tumor cell death in response to HAMLET is independent of caspases, p53 and Bcl-2 even though HAMLET activates an apoptotic response. The use of other cell death pathways allows HAMLET to successfully circumvent fundamental anti-apoptotic strategies that are present in many tumor cells.
Energy Technology Data Exchange (ETDEWEB)
Jiang, L.C.; Huang, S.Y.; Zhang, D.S.; Zhang, S.H.; Li, W.G.; Zheng, P.H.; Chen, Z.W. [Shandong Provincial Hospital Affiliated to Shandong University, Department of Oral and Maxillofacial Surgery, Jinan, China, Department of Oral and Maxillofacial Surgery, Shandong Provincial Hospital Affiliated to Shandong University, Jinan (China)
2014-03-03
Beclin 1 plays a critical role in autophagy and functions as a haploinsufficient tumor suppressor. The expression and prognostic significance of beclin 1 in head and neck adenoid cystic carcinoma (ACC) are largely unexplored. Therefore, we investigated the expression of beclin 1, Bcl-2, and p53 in head and neck ACC tissue. Tissue samples from 35 cases (15 females, 20 males) of head and neck ACC were utilized for immunohistochemistry. Beclin 1 expression was observed in 32 cases (91.4%) and considered to be high in 15 cases (42.9%) and low in 20 cases (57.1%). Beclin 1 expression was significantly correlated with a histological growth pattern (P=0.046) and histological grade (P=0.037). Beclin 1 expression was inversely correlated with Bcl-2 expression (P=0.013) and significantly associated with overall survival (P=0.006). Bcl-2 and p53 expression were observed in 21 cases (60.0%) and 16 cases (45.7%). Bcl-2 expression was significantly correlated with perineural invasion (P=0.041) and not associated with overall survival (P=0.053). p53 expression was directly correlated with beclin 1 expression (P=0.044). Our results indicated that beclin 1 may be a novel, promising prognostic factor for clinical outcome in head and neck ACC patients and may play a part in the development of head and neck ACC by interacting with Bcl-2 and p53.
Stroescu, Cezar; Dragnea, Adrian; Ivanov, Bogdan; Pechianu, Catalin; Herlea, Vlad; Sgarbura, Olivia; Popescu, Andra; Popescu, Irinel
2008-12-01
Hepatocellular carcinoma is one of the most common malignant tumors that carry a poor prognosis. To improve the long-term outlook for HCC, an accurate prognosis is important. To study the immunohistochemical expressions of p53, Ki67, Bcl-2, VEGF and PCNA and their potential role as prognostic factors in patients with radical resection of hepatocellular carcinoma. Forty-seven formalin-fixed paraffin-embedded tumor samples from patients with HCC receiving liver resection were investigated immunohistochemically for the expression of cellular proliferation markers PCNA, Ki67, p53, Bcl-2 and VEGF and their correlation with tumor characteristics and survival time after resection. p53 was expressed in a higher percentage (85.7 vs. 42.1%) in undifferentiated histological tumor grades (Edmondson Steiner G3/G4 vs. G1/G2). Patients with p53 accumulating tumors showed a worse survival than patients with p53 non-accumulating tumors (median 9.5 vs. 16.5 months). Over-expression of VEGF was found in 38.3% of all HCCs. VEGF expression was significantly correlated with p53 expression and recurrence rates. The results showed that the labeling index of PCNA and expression of p53 are correlated. The high labeling index of PCNA or over-expression of p53 resulted in high risk of tumor recurrence, more aggressive growth and poor survival. High labeling index of PCNA, p53 nuclear accumulation and VEGF high expression are associated with poor survival in patients with HCC.
Influence of p53 and bcl-2 on chemosensitivity in benign and malignant prostatic cell lines.
Serafin, Antonio M; Bohm, Lothar
2005-01-01
The administration of cancer chemotherapeutic agents results in an increase in the apoptotic cells in the tumor: therefore, it has been assumed that anticancer drugs exhibit their cytotoxic effects via apoptotic signaling pathways. Characteristics that confer sensitivity to drug-induced apoptosis are, a functional p53 protein and expression of the apoptosis-promoting protein, bax. The role of p53 and bax/bcl-2 in drug-induced apoptosis was assessed in six prostate cell lines, 1532T, 1535T, 1542T, 1542N, BPH-1 and LNCaP using TD(50) concentrations of etoposide, vinblastine and estramustine. Cell death was monitored morphologically by fluorescent microscopy, and by flow cytometry (Annexin-V assay). Apoptotic morphology was rather low and ranged from 0.1% to 12.1%, 3.0% to 6.0% and 0.1% to 8.5% for etoposide, estramustine and vinblastine, respectively. Annexin-V binding and flow cytometry indicated apoptotic propensities of 0% to 4%, 0% to 3% and 0% to 5%, respectively. The percentage of cells responding to drug-induced apoptosis was, on average, higher in the tumor cell lines than in the normal cell lines, but showed no correlation with p53 status. The percentage of cells showing necrosis, assessed by Annexin binding and Propidium Iodide permeability in aqueous medium, tended to be much higher, and was found to be at the level of 5% to 30%. Immunoblotting demonstrated that bax and bcl-2 proteins were expressed at a basal level in all cell lines, but did not increase after exposure to TD(50) doses of the three drugs. The ratio of bax and bcl-2, measured by laser scanning densitometry, was not altered by the drug-induced DNA damage. The results suggest that apoptosis is not a major mechanism of drug-induced cell death in prostate cell lines and appears to be independent of p53 status and bax/bcl-2 expression.
Mottolese, M; Benevolo, M; Del Monte, G; Buglioni, S; Papaldo, P; Nisticò, C; Di Filippo, F; Vasselli, S; Vici, P; Botti, C
2000-12-01
Adjuvant therapy has become an integral component of the managment of primary high-risk breast cancer patients. However, a considerable fraction of women receive no benefit from this treatment. This study investigates whether a number of biopathological factors can influence the outcome of patients submitted to adjuvant chemotherapy involving the use of high-dose epirubicin and cyclophosphamide. One hundred and fifty-seven primary breast cancer patients, considered at high risk according to the St. Gallen Meeting Consensus Conference, were evaluated immunohistochemically for estrogen, progesterone receptors, p53, bcl-2, HER-2/neu, and Ki-67, of which the results were correlated with patient outcome. Results obtained demonstrated that p53 is a significant predictor of disease-free survival (DFS P < 0.0001) and overall survival (OS P = 0.0002) both in ductal and lobular carcinomas, whereas bcl-2 expression seems to be of prognostic value only in lobular carcinomas (DFS P = 0.01; OS P = 0.02). This data indicates that in high-risk breast cancer patients the immunohistochemical evaluation of p53 and bcl-2 may be of clinical value in distinguishing different responses to adjuvant anthracycline-based chemotherapy.
International Nuclear Information System (INIS)
Kyndi, M.; Alsner, J.; Nielsen, H.M.; Overgaard, J.; Soerensen, F.B.; Knudsen, H.; Overgaard, M.
2008-01-01
Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b and c studies. Tissue microarray sections were stained with immunohistochemistry for p53 and BCL2. Median potential follow-up was 17 years. Clinical endpoints were locoregional recurrence (LRR), distant metastases (DM), overall mortality, and overall survival (OS). Statistical analyses included Kappa statistics, χ2 or exact tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots showed reduced OS and improved DM and LRR probabilities after PMRT within subgroups of both p53 negative and p53 positive patients. Negative BCL2 expression was significantly associated with increased overall mortality, DM and LRR probability in multivariate Cox regression analyses. Kaplan-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2 and randomization status. Significant reductions in LRR probability after PMRT were recorded within both the BCL2 positive and BCL2 negative subgroups. Conclusion. p53 was not associated with survival after radiotherapy in high-risk breast cancer, but BCL2 might be
International Nuclear Information System (INIS)
Vergis, Roy; Corbishley, Catherine M.; Thomas, Karen
2010-01-01
Purpose: Established prognostic factors in localized prostate cancer explain only a moderate proportion of variation in outcome. We analyzed tumor expression of apoptotic markers with respect to outcome in men with localized prostate cancer in two randomized controlled trials of radiotherapy dose escalation. Methods and Materials: Between 1995 and 2001, 308 patients with localized prostate cancer received neoadjuvant androgen deprivation and radical radiotherapy at our institution in one of two dose-escalation trials. The biopsy specimens in 201 cases were used to make a biopsy tissue microarray. We evaluated tumor expression of Bcl-2, p53, and MDM2 by immunohistochemistry with respect to outcome. Results: Median follow-up was 7 years, and 5-year freedom from biochemical failure (FFBF) was 70.4% (95% CI, 63.5-76.3%). On univariate analysis, expression of Bcl-2 (p < 0.001) and p53 (p = 0.017), but not MDM2 (p = 0.224), was significantly associated with FFBF. Expression of Bcl-2 remained significantly associated with FFBF (p = 0.001) on multivariate analysis, independently of T stage, Gleason score, initial prostate-specific antigen level, and radiotherapy dose. Seven-year biochemical control was 61% vs. 41% (p = 0.0122) for 74 Gy vs. 64 Gy, respectively, among patients with Bcl-2-positive tumors and 87% vs. 81% (p = 0.423) for 74 Gy vs. 64 Gy, respectively, among patients with Bcl-2-negative tumors. There was no statistically significant interaction between dose and Bcl-2 expression. Conclusions: Bcl-2 expression was a significant, independent determinant of biochemical control after neoadjuvant androgen deprivation and radical radiotherapy for prostate cancer. These data generate the hypothesis that Bcl-2 expression could be used to inform the choice of radiotherapy dose in individual patients.
Directory of Open Access Journals (Sweden)
Mintareja Teguh
2014-06-01
Full Text Available Objective: To determine the role of protein-with-molecular-weight-53 (p53, burkit cell lymphoma 2 (Bcl2, Fas ligand (FasL mRNA, and vascular cell adhesion molecule 1 (VCAM-1, known as the apoptosis-related molecular pathway, in preeclamptic patients. Methods: Observation on the correlation between the mRNA levels of p53, Bcl2 and FasL and VCAM-1 in 31 subjects at 28-42 weeks gestational age was performed in this study using the real time reverse transcriptase-polymerase chain reaction (RT-PCR. Results: The results showed that p53 mRNA increased (>1.2350 ng/μL in the preeclampsia group compared to the normal pregnancy group (p=0.010, Bcl2 mRNA was lower (≤0.9271 ng/μL in the preeclampsia group than the control group (p=0.041. There was also a tendency of increased FasL mRNA expression (>0.5509 ng/μL in the preeclampsia group compared to the normal pregnancy group (p=0.300. The level of VCAM-1 elevated (>890.08 ng/mL in the preeclampsia group compared to the normal pregnancy group (p=0.001. In preeclampsia, the correlation between the Bcl2/p53 ratio and VCAM-1 was r=0.541 (p=0.002, whereas the correlation in normal pregnancy was r=0.099 (p=0.595. Conclusions: There are correlations between the mRNA expression levels of p53 and Bcl2 as an intrinsic pathway of apoptosis along with the VCAM-1 levels in the incidence of preeclampsia. However, no correlation is found between FasL mRNA expression and the incidence of preeclampsia.
DEFF Research Database (Denmark)
Kyndi, M.; Sorensen, F.B.; Alsner, J.
2008-01-01
-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue microarray......, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots...
International Nuclear Information System (INIS)
Yamashita, Hideomi; Murakami, Naoya; Asari, Takao; Okuma, Kae; Ohtomo, Kuni; Nakagawa, Keiichi
2009-01-01
Purpose: The expressions of six cell-cycle-associated proteins were analyzed in cervical squamous cell carcinomas in correlation in a search for prognostic correlations in tumors treated with concurrent chemoradiation therapy (cCRT). Methods and Materials: The expressions of p53, p21/waf1/cip1, molecular immunology borstel-1 (MIB-1), epidermal growth factor receptor (EGFR), human epidermal growth factor receptor type 2 (HER2), and Bcl-2 were studied using an immunohistochemical method in 57 cases of cervical squamous cell carcinoma treated with cCRT. Patients received cCRT between 1998 and 2005. The mean patient age was 61 years (range, 27-82 years). The number of patients with Stage II, III, and IVA disease was 18, 29, and 10, respectively. Results: The number of patients with tumors positive for p53, p21/waf1/cip1, MIB-1, EGFR, HER2, and Bcl-2 was 26, 24, 49, 26, 13, and 11, respectively; no significant correlation was noted. The 5-year overall survival rates of HER2-positive and -negative patients was 76% vs. 44%, which was of borderline significance (p = 0.0675). No significant correlation was noted between overall survival and expressions of p53, p21/waf1/cip1, MIB-1, EGFR, and Bcl-2. No correlation was observed between local control and expression of any of the proteins. Conclusion: Expression of HER2 protein had a weak impact of borderline significance on overall survival in squamous cell carcinoma of the uterine cervix treated with cCRT. However, no clinical associations could be established for p53, p21/waf1/cip1, MIB-1, EGFR, and Bcl-2 protein expressions.
DEFF Research Database (Denmark)
Kyndi, Marianne; Sørensen, Flemming Brandt; Knudsen, Helle
2008-01-01
-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......PURPOSE: To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). PATIENTS AND METHODS: The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue...... tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. RESULTS: p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan...
Lai, Jonathan H; Fleming, Kirsten E; Ly, Thai Yen; Pasternak, Sylvia; Godlewski, Marek; Doucette, Steve; Walsh, Noreen M
2015-09-01
Merkel cell polyomavirus is of oncogenic significance in approximately 80% of Merkel cell carcinomas. Morphological subcategories of the tumor differ in regard to viral status, the rare combined type being uniformly virus negative and the predominant pure type being mainly virus positive. Indications that different biological subsets of the tumor exist led us to explore this diversity. In an Eastern Canadian cohort of cases (75 patients; mean age, 76 years [range, 43-91]; male/female ratio, 43:32; 51 [68%] pure and 24 [34%] combined tumors), we semiquantitatively compared the immunohistochemical expression of 3 cellular proteins (p53, Bcl-2, and c-kit) in pure versus combined groups. Viral status was known in a subset of cases. The significant overexpression of p53 in the combined group (mean [SD], 153.8 [117.8] versus 121.6 [77.9]; P = .01) and the increased epidermal expression of this protein (p53 patches) in the same group lend credence to a primary etiologic role for sun damage in these cases. Expression of Bcl-2 and c-kit did not differ significantly between the 2 morphological groups. A relative increase in c-kit expression was significantly associated with a virus-negative status (median [interquartile range], 100 [60-115] versus 70 [0-100]; P = .03). Emerging data reveal divergent biological pathways in Merkel cell carcinoma, each with a characteristic immunohistochemical profile. Virus-positive tumors (all pure) exhibit high retinoblastoma protein and low p53 expression, whereas virus-negative cases (few pure and all combined) show high p53 and relatively high c-kit expression. The potential biological implications of this dichotomy call for consistent stratification of these tumors in future studies. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Ana Paula Percicote
2013-02-01
Full Text Available INTRODUCTION: Nephroblastoma or Wilms' tumor is the most frequent renal cancer in children. Although its prognosis is favorable for most patients, it may relapse or have a fatal outcome. The characterization of risk groups by applying immunohistochemical biomarkers aims to adapt the treatment to its corresponding group as well as to reduce relapses and fatal outcome. p53, B-cell lymphoma 2 (BCL-2, BCL-2 associated protein X (BAX and vascular endothelial growth factor receptor 1 (VEGFR1 are among the most widely studied biomarkers, which are related to the apoptotic pathway, DNA repair and neovascularization. OBJECTIVE: The objective of this study is to assess the immunohistochemical expression of p53, BCL-2, BAX and VEGFR1 in samples of human nephroblastoma and to correlate them with clinicopathological prognostic factors. MATERIAL AND METHODS: Twenty-nine surgical specimens of nephroblastoma diagnosed from 1994 to 2007 were selected from the Anatomopathological Service of two hospitals in Curitiba. The immunohistochemical analysis of tissue microarrays was performed through immunoperoxidase staining and the yielded results were compared with clinicopathological prognostic factors. RESULTS: The major immunohistochemical expression of VEGFR1 in blastema and epithelium presented positive association with the risk group. Hence this may be related to higher vascular neoplastic invasion apparently caused by the endothelial growth factor, which maximizes the chances of metastasis and ultimately changes tumor staging, risk group and clinical evolution. CONCLUSIONS: The immunohistochemical expression of VEGFR1 substantiated a directly proportional association with the nephroblastoma risk group.INTRODUÇÃO: O nefroblastoma, ou tumor de Wilms, é a neoplasia renal mais frequente na infância. Embora o prognóstico seja favorável para a maioria dos pacientes, muitos evoluem para recidiva ou óbito. A caracterização de grupos de risco por meio de
International Nuclear Information System (INIS)
Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei
2009-01-01
CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.
Energy Technology Data Exchange (ETDEWEB)
Yu, Zhendong, E-mail: zdyu@hotmail.com [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Wang, Hao [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China); Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Li, Pengfei, E-mail: lipengfei@cuhk.edu.hk [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China)
2009-09-04
CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.
Directory of Open Access Journals (Sweden)
Vladimir O. Pustylnyak
2015-01-01
Full Text Available Gene expression plays an important role in the mechanisms of long-term potentiation (LTP, which is a widely accepted experimental model of synaptic plasticity. We have studied the expression of at least 50 genes that are transcriptionally regulated by p53, as well as other genes that are related to p53-dependent processes, in the early phase of LTP. Within 30 min after Schaffer collaterals (SC tetanization, increases in the mRNA and protein levels of Bax, which are upregulated by p53, and a decrease in the mRNA and protein levels of Bcl2, which are downregulated by p53, were observed. The inhibition of Mdm2 by nutlin-3 increased the basal p53 protein level and rescued its tetanization-induced depletion, which suggested the involvement of Mdm2 in the control over p53 during LTP. Furthermore, nutlin-3 caused an increase in the basal expression of Bax and a decrease in the basal expression of Bcl2, whereas tetanization-induced changes in their expression were occluded. These results support the hypothesis that p53 may be involved in transcriptional regulation during the early phase of LTP. We hope that the presented data may aid in the understanding of the contribution of p53 and related genes in the processes that are associated with synaptic plasticity.
Directory of Open Access Journals (Sweden)
Dárcio Matenhauer Lehrbach
2009-12-01
Full Text Available CONTEXT: Esophagogastric junction adenocarcinoma has an aggressive behavior, and TNM (UICC staging is not always accurate enough to categorize patient's outcome. OBJECTIVES: To evaluated p53, cyclin D1 and Bcl-2 immunoexpressions in esophagogastric junction adenocarcinoma patients, without Barrett's esophagus, and to compared to clinicopathological characteristics and survival rate. METHODS: Tissue sections from 75 esophagogastric junction adenocarcinomas resected from 1991 to 2003 were analyzed by immunohistochemistry for p53, cyclin D1 and Bcl-2 using streptavidin-biotin-peroxidase method. The mean follow-up time was 60 months SD = 61.5 (varying from 4 to 273 months. RESULTS: Fifty (66.7% of the tumors were intestinal type and 25 (33.3% were diffuse. Vascular, lymph node and perineural infiltration were verified in 16%, 80% and 68% of the patients, respectively. The patients were distributed according to the TNM staging in IA in 4 (5.3%, IB in 10 (13.3%, II in 15 (20%, IIA in 15 (20%, IIIB in 15 (20% and IV in 16 (21.3%. Immunohistochemical analysis was positive for p53, cyclin D1 and bcl-2 in 68%, 18.7% and 100%, respectively. There was no association between immunoexpression and vascular and/or perineural invasions, clinicopathological characteristics and patients' survival rate. CONCLUSION: In this selected population, there was no association between the immunomarkers, p53, cyclin D1 and bcl-2 and clinicopathological data and/or overall survival.CONTEXTO: O adenocarcinoma da junção esôfago-gástrica tem um comportamento agressivo e o estádio TNM não é sempre suficiente para categorizar o paciente de acordo com a evolução do mesmo. OBJETIVO: Avaliar a imunoexpressão do p53, ciclina D1 e Bcl-2 em pacientes com adenocarcinoma da junção esôfago-gástrica sem esôfago de Barrett e comparar com as características clínicas e sobrevida. MÉTODOS: Cortes histológicos de 75 adenocarcinomas da esôfago-gástrica ressecados de 1991 a
International Nuclear Information System (INIS)
Banu, Sakhila K.; Stanley, Jone A.; Lee, JeHoon; Stephen, Sam D.; Arosh, Joe A.; Hoyer, Patricia B.; Burghardt, Robert C.
2011-01-01
Hexavalent chromium (CrVI) has been widely used in industries throughout the world. Increased usage of CrVI and atmospheric emission of CrVI from catalytic converters of automobiles, and its improper disposal causes various health hazards including female infertility. Recently we have reported that lactational exposure to CrVI induced a delay/arrest in follicular development at the secondary follicular stage. In order to investigate the underlying mechanism, primary cultures of rat granulosa cells were treated with 10 μM potassium dichromate (CrVI) for 12 and 24 h, with or without vitamin C pre-treatment for 24 h. The effects of CrVI on intrinsic apoptotic pathway(s) were investigated. Our data indicated that CrVI: (i) induced DNA fragmentation and increased apoptosis, (ii) increased cytochrome c release from the mitochondria to cytosol, (iii) downregulated anti-apoptotic Bcl-2, Bcl-XL, HSP70 and HSP90; upregulated pro-apoptotic BAX and BAD, (iv) altered translocation of Bcl-2, Bcl-XL, BAX, BAD, HSP70 and HSP90 to the mitochondria, (v) upregulated p-ERK and p-JNK, and selectively translocated p-ERK to the mitochondria and nucleus, (vi) activated caspase-3 and PARP, and (vii) increased phosphorylation of p53 at ser-6, ser-9, ser-15, ser-20, ser-37, ser-46 and ser-392, increased p53 transcriptional activation, and downregulated MDM-2. Vitamin C pre-treatment mitigated CrVI effects on apoptosis and related pathways. Our study, for the first time provides a clear insight into the effect of CrVI on multiple pathways that lead to apoptosis of granulosa cells which could be mitigated by vitamin C.
Stimulation of autophagy by the p53 target gene Sestrin2.
Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido
2009-05-15
The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.
Prognostic significance of CD95, P53, and BCL2 expression in extranodal non-Hodgkin's lymphoma
Chatzitolios , Anastasios; Venizelos , Ioannis; Tripsiannis , Gregory; Anastassopoulos , George; Papadopoulos , Nikolaos
2010-01-01
Abstract Apoptosis-related proteins play an important role in lymphoma cell death during chemotherapy. In our study, we investigated the prognostic significance of CD95, BCL2, and P53 expression in extranodal non-Hodgkin?s lymphoma (NHL). We examined 71 patients with extranodal NHL [45 diffuse large B-cell lymphomas (DLBCLs) and 26 mucosa-associated lymphoid tissue lymphomas (MALTLs)], 35 male and 36 female, with a median age of 65.8 years. The most common site of origin was the st...
DEFF Research Database (Denmark)
Xu-Monette, Zijun Y; Zhang, Shanxiang; Li, Xin
2016-01-01
with a pan-p63-monoclonal antibody and correlated it with other clinicopathologic factors and clinical outcomes. p63 expression was observed in 42.5% of DLBCL, did not correlate with p53 levels, but correlated with p21, MDM2, p16INK4A, Ki-67, Bcl-6, IRF4/MUM-1 and CD30 expression, REL gains, and BCL6...... was likely due to the association of p63 expression with high-risk IPI, and potential presence of ∆Np63 isoform in TP63 rearranged patients (a mere speculation). Gene expression profiling suggested that p63 has both overlapping and distinct functions compared with p53, and that p63 and mutated p53 antagonize...
Zalata, Khaled Refaat; Elshal, Mohamed Farouk; Foda, Abd AlRahman Mohammad; Shoma, Ashraf
2015-08-01
The current paradigm of metastasis proposes that rare cells within primary tumors acquire metastatic capability via sequential mutations, suggesting that metastases are genetically dissimilar from their primary tumors. This study investigated the changes in the level of expression of a well-defined panel of cell proliferation, differentiation, and apoptosis markers between the primary colorectal cancer (CRC) and the corresponding synchronous lymph node (LN) metastasis from the same patients. DNA flow cytometry and immunostaining of p53, bcl-2, and c-myc were carried out on 36 cases of CRC radical resection specimens with their corresponding LN metastases. There was very low probability that the histological patterns of primary tumors and LN metastases are independent (p < 0.001). Metastatic tumors were significantly more diffusely positive for p53 than the primary tumors (p < 0.001). Conversely, primary tumors were significantly more diffusely positive for c-myc than metastatic tumors (p = 0.011). No significant difference was found between the LNs and the primary tumors in bcl-2 positivity (p = 0.538) and DNA aneuploidy (p = 0.35), with a tendency towards negative bcl-2 and less aneuploidy in LN metastases than primary tumors. In conclusion, LN metastatic colorectal carcinomas have a tendency of being less differentiated, with a higher incidence of diffuse p53 staining, lower incidence of bcl-2 staining, and less aneuploidy in comparison to their primary counterparts suggesting a more aggressive biological behavior, which could indicate the necessity for more aggressive adjuvant therapy.
Transcription of five p53- and Stat-3-Inducible genes after ionizing radiation
Energy Technology Data Exchange (ETDEWEB)
Grace, M.B. [Uniformed Services University (USUHS), Armed Forces Radiobiology Research Institute, Building 42, RM 3321, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)], E-mail: grace@afrri.usuhs.mil; Blakely, W.F. [Uniformed Services University (USUHS), Armed Forces Radiobiology Research Institute, Building 42, RM 3321, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)
2007-07-15
Ionizing radiation (IR) produces temporal- and dose-dependent changes in multiple gene mRNA targets that are potential biomarkers of radiation dose. We confirmed IR-induced changes in expression of gadd45a, ddb-2, and cdkn1a downstream transcripts of p53 by quantitative reverse transcription-polymerase chain reaction (QRT-PCR) assay in total RNA samples from the whole blood of radiotherapy patients undergoing total-body irradiation [Amundson, S.A., Grace, M.B., McLeland, C.B., Epperly, M.W., Yeager, A., Zhan, Q., Greenberger, J.S., Fornace Jr., A.J., 2004. Human in vivo radiation-induced biomarkers: gene expression changes in radiotherapy patients. Cancer Res. 64, 6368-6371.]. We now confirm dose-dependent up-regulation of bax in addition to these p53-dependent transcripts, and bcl-2, a downstream transcript of Stat-3, in ex vivo irradiated blood samples from healthy unrelated volunteers. Together these biomarkers represent pathways involved in growth arrest, DNA damage, and apoptosis. The objectives of this study were to (1) investigate the relationship between baseline mRNA expression levels, and (2) define expression patterns in response to IR in a large cohort (n=20). Whole-blood samples were irradiated ex vivo to measure gene expression in samples from (i) three healthy donors over a broad dose range (0, 0.25, 0.50, 0.75, 1, 2, and 3 Gy), and (ii) 20 healthy donors at two doses, 0.25 and 2.5 Gy. Expression level variance ({sigma}{sub 2}) of baseline values (0 Gy) showed negligible inter-individual variation with all values {<=}1.0. {sigma}{sub 2}values=0.50bax, 0.25 bcl-2, 0.73 gadd45a, 0.66 cdkn1a, and 1.0 ddb-2. Meaningful IR dose-responses were observed for bax, gadd45a, and ddb-2 profiles and the ratio of bax:bcl-2 mRNA expression over a broad dose range. QRT-PCR studies were extended in the lower dose range (0, 0.1, 0.5, 0.75, and 1 Gy). Results showed that bax:bcl-2 ratio initially favors bax expression at doses of <1Gy, with IR-induced dose responses
International Nuclear Information System (INIS)
Bubb, Robbin S.; Komaki, Ritsuko; Hachiya, Tsutomu; Milas, Ivan; Ro, Jae Y.; Langford, Lauren; Sawaya, Raymond; Putnam, Joe B.; Allen, Pamela; Cox, James D.; McDonnell, Timothy J.; Brock, William; Hong, Waun K.; Roth, Jack A.; Milas, Luka
2002-01-01
Purpose: The study was conducted to determine whether immunohistochemical analysis of Ki-67, p53, and bcl-2 in patients with non-small-cell lung cancer is associated with a higher rate of brain metastases and whether the intrapatient expression of these biomarkers (in the primary tumors vs. brain lesions) is similar. Methods and Materials: At the M. D. Anderson Cancer Center, tumors from 29 case patients with primary lung tumor and brain metastasis and 29 control patients with primary lung tumor but no brain metastasis were resected and examined for immunohistochemical expression. Ki-67, p53, and bcl-2 were analyzed in resected primary lung, lymph node, and metastatic brain tumors. Each control patient was matched by age, gender, and histology to a patient with brain metastasis. Results: No significant differences in patient survival characteristics were detected between the case group and control group. Also, difference in patient outcome between the two groups was not generally predicted by biomarker analysis. However, when the groups were combined, the biomarker analysis was predictive for certain patient outcome end points. Using median values as cutoff points between low and high expression of biomarkers, it was observed that high expression of Ki-67 (>40%) in lung primaries was associated with poorer disease-free survival (p=0.04), whereas low expression of p53 in lung primaries was associated with poorer overall survival (p=0.04), and these patients had a higher rate of nonbrain distant metastases (p=0.02). The patients with brain metastases were particularly prone to developing nonbrain distant metastases if the percentage of p53-positive cells in brain metastases was low (p=0.01). There was a positive correlation in the expression of Ki-67 (p=0.02) (r 2 =0.1608), as well as p53 (p 2 =0.7380), between lung primaries and brain metastases. Compared to Ki-67 and p53, bcl-2 was the least predictive. Conclusion: Differences in biomarker expression between the
International Nuclear Information System (INIS)
Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.
2014-01-01
Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach
Huang, Wenting; Medeiros, L Jeffrey; Lin, Pei; Wang, Wei; Tang, Guilin; Khoury, Joseph; Konoplev, Sergej; Yin, C Cameron; Xu, Jie; Oki, Yasuhiro; Li, Shaoying
2018-05-21
High-grade B-cell lymphomas with MYC, BCL2, and BCL6 rearrangements (triple hit lymphoma) are uncommon. We studied the clinicopathologic features of 40 patients with triple hit lymphoma and compared them to 157 patients with MYC/BCL2 double hit lymphoma and 13 patients with MYC/BCL6 double hit lymphoma. The triple hit lymphoma group included 25 men and 15 women with a median age of 61 years (range, 34-85). Nine patients had a history of B-cell lymphoma. Histologically, 23 (58%) cases were diffuse large B-cell lymphoma and 17 cases had features of B-cell lymphoma, unclassifiable, with features intermediate between diffuse large B-cell lymphoma and Burkitt lymphoma. Most cases of triple hit lymphoma were positive for CD10 (100%), BCL2 (95%), BCL6 (82%), MYC (74%), and 71% with MYC and BCL2 coexpression. P53 was overexpressed in 29% of triple hit lymphoma cases. The clinicopathological features of triple hit lymphoma patients were similar to patients with MYC/BCL2 and MYC/BCL6 double hit lymphoma, except that triple hit lymphoma cases were more often CD10 positive compared with MYC/BCL6 double hit lymphoma (p hit lymphoma and double hit lymphoma and overall survival in triple hit lymphoma patients was 17.6 months, similar to the overall survival of patients with double hit lymphoma (p = 0.67). Patients with triple hit lymphoma showing P53 overexpression had significantly worse overall survival compared with those without P53 overexpression (p = 0.04). On the other hand, double expressor status and prior history of B-cell lymphoma did not correlate with overall survival. In conclusion, most patients with triple hit lymphoma have an aggressive clinical course and poor prognosis and these tumors have a germinal center B-cell immunophenotype, similar to patients with double hit lymphomas. P53 expression is a poor prognostic factor in patients with triple hit lymphoma.
Restoration of tumor suppressor miR-34 inhibits human p53-mutant gastric cancer tumorspheres
International Nuclear Information System (INIS)
Ji, Qing; Hao, Xinbao; Meng, Yang; Zhang, Min; DeSano, Jeffrey; Fan, Daiming; Xu, Liang
2008-01-01
MicroRNAs (miRNAs), some of which function as oncogenes or tumor suppressor genes, are involved in carcinogenesis via regulating cell proliferation and/or cell death. MicroRNA miR-34 was recently found to be a direct target of p53, functioning downstream of the p53 pathway as a tumor suppressor. miR-34 targets Notch, HMGA2, and Bcl-2, genes involved in the self-renewal and survival of cancer stem cells. The role of miR-34 in gastric cancer has not been reported previously. In this study, we examined the effects of miR-34 restoration on p53-mutant human gastric cancer cells and potential target gene expression. Human gastric cancer cells were transfected with miR-34 mimics or infected with the lentiviral miR-34-MIF expression system, and validated by miR-34 reporter assay using Bcl-2 3'UTR reporter. Potential target gene expression was assessed by Western blot for proteins, and by quantitative real-time RT-PCR for mRNAs. The effects of miR-34 restoration were assessed by cell growth assay, cell cycle analysis, caspase-3 activation, and cytotoxicity assay, as well as by tumorsphere formation and growth. Human gastric cancer Kato III cells with miR-34 restoration reduced the expression of target genes Bcl-2, Notch, and HMGA2. Bcl-2 3'UTR reporter assay showed that the transfected miR-34s were functional and confirmed that Bcl-2 is a direct target of miR-34. Restoration of miR-34 chemosensitized Kato III cells with a high level of Bcl-2, but not MKN-45 cells with a low level of Bcl-2. miR-34 impaired cell growth, accumulated the cells in G1 phase, increased caspase-3 activation, and, more significantly, inhibited tumorsphere formation and growth. Our results demonstrate that in p53-deficient human gastric cancer cells, restoration of functional miR-34 inhibits cell growth and induces chemosensitization and apoptosis, indicating that miR-34 may restore p53 function. Restoration of miR-34 inhibits tumorsphere formation and growth, which is reported to be
Directory of Open Access Journals (Sweden)
Ye Cheng
Full Text Available AS1411 binds nucleolin (NCL and is the first oligodeoxynucleotide aptamer to reach phase I and II clinical trials for the treatment of several cancers. However, the mechanisms by which AS1411 targets and kills glioma cells and tissues remain unclear. Here we report that AS1411 induces cell apoptosis and cycle arrest, and inhibits cell viability by up-regulation of p53 and down-regulation of Bcl-2 and Akt1 in human glioma cells. NCL was overexpressed in both nucleus and cytoplasm in human glioma U87, U251 and SHG44 cells compared to normal human astrocytes (NHA. AS1411 bound NCL and inhibited the proliferation of glioma cells but not NHA, which was accompanied with up-regulation of p53 and down-regulation of Bcl-2 and Akt1. Moreover, AS1411 treatment resulted in the G2/M cell cycle arrest in glioma cells, which was however abolished by overexpression of NCL. Further, AS1411 induced cell apoptosis, which was prevented by silencing of p53 and overexpression of Bcl-2. In addition, AS1411 inhibited the migration and invasion of glioma cells in an Akt1-dependent manner. Importantly, AS1411 inhibited the growth of glioma xenograft and prolonged the survival time of glioma tumor-bearing mice. These results revealed a promising treatment of glioma by oligodeoxynucleotide aptamer.
Directory of Open Access Journals (Sweden)
Tsogzolmaa Dorjgochoo
Full Text Available In vitro studies have demonstrated the role of the BCL-2 family of genes in endometrial carcinogenesis. The role of genetic variants in BCL-2 genes and their interactions with non-genetic factors in the development of endometrial cancer has not been investigated in epidemiological studies.We examined the relationship between BCL-2 gene family variants and endometrial cancer risk among 1,028 patients and 1,922 age-matched community controls from Shanghai, China. We also investigated possible interactions between genetic variants and established risk factors (demographic, lifestyle and clinical. Individuals were genotyped for 86 tagging single nucleotide polymorphisms (SNPs in the BCL2, BAX, BAD and BAK1 genes.Significant associations with endometrial cancer risk were found for 9 SNPs in the BCL2 gene (P trend<0.05 for all. For SNPs rs17759659 and rs7243091 (minor allele for both: G, the associations were independent. The odds ratio was 1.27 (95% CI: 1.04-1.53 for women with AG genotype for the SNP rs17759659 and 1.82 (95% CI: 1.21-2.73 for women with the GG genotype for the SNP rs7243091. No interaction between these two SNPs and established non-genetic risk factors of endometrial cancer was noticed.Genetic polymorphisms in the BCL2 gene may be associated with the risk of endometrial cancer in Chinese women.
Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.
2012-01-01
During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738
Pan-Cancer Analysis Links PARK2 to BCL-XL-Dependent Control of Apoptosis
Directory of Open Access Journals (Sweden)
Yongxing Gong
2017-02-01
Full Text Available Mutation of the PARK2 gene can promote both Parkinson's Disease and cancer, yet the underlying mechanisms of how PARK2 controls cellular physiology is incompletely understood. Here, we show that the PARK2 tumor suppressor controls the apoptotic regulator BCL-XL and modulates programmed cell death. Analysis of approximately 10,000 tumor genomes uncovers a striking pattern of mutual exclusivity between PARK2 genetic loss and amplification of BCL2L1, implicating these genes in a common pathway. PARK2 directly binds to and ubiquitinates BCL-XL. Inactivation of PARK2 leads to aberrant accumulation of BCL-XL both in vitro and in vivo, and cancer-specific mutations in PARK2 abrogate the ability of the ubiquitin E3 ligase to target BCL-XL for degradation. Furthermore, PARK2 modulates mitochondrial depolarization and apoptosis in a BCL-XL-dependent manner. Thus, like genes at the nodal points of growth arrest pathways such as p53, the PARK2 tumor suppressor is able to exert its antiproliferative effects by regulating both cell cycle progression and programmed cell death.
International Nuclear Information System (INIS)
Tannapfel, Andrea; Nuesslein, Siegfried; Fietkau, Rainer; Katalinic, Alexander; Koeckerling, Ferdinand; Wittekind, Christian
1998-01-01
Purpose: To investigate the relationship between apoptotic cell death, proliferative activity, and the expression of apoptosis regulating proteins in rectal cancer prior to and after radiochemotherapy. Materials and Methods: In 32 patients dispositioned to receive preoperative radiochemotherapy for locally advanced rectal carcinoma, pretherapy biopsies and the final resected specimen after radiochemotherapy were available for analyses. Apoptotic cells were identified and quantified using in situ end labeling (ISEL) technique. The expression of the bax protein was assessed immunohistochemically. Additionally, double immunostaining was performed for apoptotic cells and bax expression. The proliferative activity was determined by immunohistochemical assessment of the Ki67 (MIB-1) and the proliferating cell nuclear antigen (PCNA). p53- and bcl-2 expression was analyzed immunohistochemically. A clinical-to-pathologic downstaging after radiochemotherapy was achieved in 25 of 32 patients (78%). During follow-up, tumor recurrence was observed in six cases. In one case, no residual tumor was detected after radiochemotherapy. Results: After radiochemotherapy, the apoptotic index increased significantly in almost every case examined. In contrast, the proliferative activity was significantly decreased in resected specimens as compared to biopsies. Bax immunostaining was detected in 12/31 (39%) biopsies and in 26/31 (84%) resected specimens. In the resected specimen, significantly more apoptotic cells that were bax-positive were found than in biopsies. Bcl-2 immunostaining occurred in 15/31 biopsies and 12/31 resected specimens, respectively. Tumors that were immunohistochemically negative for p53 (20/31 [65%]) generally exhibited a higher apoptotic index and a high expression level of bax than p53-positive tumors (11/31 [35%]). However, we did not find any correlation between the (pre- and post-therapeutic) rate of apoptosis or the level of bax expression and the degree of
Cao, Yongmei; Jiang, Zhen; Zeng, Zhen; Liu, Yujing; Gu, Yuchun; Ji, Yingying; Zhao, Yupeng; Li, Yingchuan
2016-01-01
Pulmonary arterial hypertension (PAH) is a life-threatening disorder that ultimately causes heart failure. While the underlying causes of this condition are not well understood, previous studies suggest that the anti-apoptotic nature of pulmonary microvascular endothelial cells (PMVECs) in hypoxic environments contributes to PAH pathogenesis. In this study, we focus on the contribution of Bcl-2 and hypoxia response element (HRE) to apoptosis-resistant endothelial cells and investigate the mechanism. PMVECs obtained from either normal rats or apoptosis-resistant PMVECs obtained from PAH rats were transduced with recombinant lentiviral vectors carrying either Bcl-2-shRNA or HRE combined Bcl-2-shRNA, and then cultured these cells for 24 h under hypoxic (5% O2) or normoxic (21% O2) conditions. In normal PMVECs, Bcl-2-shRNA or HRE combined with Bcl-2-shRNA transduction successfully decreased Bcl-2 expression, while increasing apoptosis as well as caspase-3 and P53 expression in a normoxic environment. In a hypoxic environment, the effects of Bcl-2-shRNA treatment on cell apoptosis, and on Bcl-2, caspase-3, P53 expression were significantly suppressed. Conversely, HRE activation combined with Bcl-2-shRNA transduction markedly enhanced cell apoptosis and upregulated caspase-3 and P53 expression, while decreasing Bcl-2 expression. Furthermore, in apoptosis-resistant PMVECs, HRE-mediated Bcl-2 silencing effectively enhanced cell apoptosis and caspase-3 activity. The apoptosis rate was significantly depressed when Lv-HRE-Bcl-2-shRNA was combined with Lv-P53-shRNA or Lv-caspase3-shRNA transduction in a hypoxic environment. These results suggest that HRE-mediated Bcl-2 inhibition can effectively attenuate hypoxia-induced apoptosis resistance in PMVECs by downregulating Bcl-2 expression and upregulating caspase-3 and P53 expression. This study therefore reveals critical insight into potential therapeutic targets for treating PAH.
The p53 gene with emphasis on its paralogues in mosquitoes
Directory of Open Access Journals (Sweden)
Tien-Huang Chen
2017-12-01
Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival
International Nuclear Information System (INIS)
Saintigny, Yannick
1999-01-01
The control of cell cycle, associated with the mechanisms of replication, DNA repair/recombination allows the cells to maintain their genetic integrity. The p53 protein ensures the control of G1/S transition. Its inactivation would allow to initial replication on damaged matrix and lead to the block of replication forks followed by DNA strand breaks, good substrates for recombination. This work shows that the expression of mutant p53 protein stimulates both spontaneous and radio-induced homologous recombination, independently of the control of cell cycle. Moreover, the use of a set of replication inhibitors show that inhibition of the replication elongation stimulates recombination more strongly than the initiation inhibition. Replication arrest by these inhibitors also significantly increases the number of DNA strand breaks. These results highlighted a point of action of p53 protein on the ultimate stages of the homologous recombination mechanism. Lastly, the expression of Bcl-2 protein inhibits apoptosis and increases survival, but specifically inhibits conservative recombination, after radiation as well as in absence of apoptotic stress. The extinction of this mechanism of DNA repair is associated with an increase of mutagenesis. Taken together, these results allow ta consider the maintenance of the genetic stability as a cellular network involving different pathways. A multiple stages model for tumoral progression can be deduced. (author) [fr
Solomon, Monica Charlotte; Vidyasagar, M S; Fernandes, Donald; Guddattu, Vasudev; Mathew, Mary; Shergill, Ankur Kaur; Carnelio, Sunitha; Chandrashekar, Chetana
2016-12-01
Oral squamous cell carcinomas comprise a heterogeneous tumor cell population with varied molecular characteristics, which makes prognostication of these tumors a complex and challenging issue. Thus, molecular profiling of these tumors is advantageous for an accurate prognostication and treatment planning. This is a retrospective study on a cohort of primary locally advanced oral squamous cell carcinomas (n = 178) of an Indian rural population. The expression of EGFR, p53, cyclin D1, Bcl-2 and p16 in a cohort of primary locally advanced oral squamous cell carcinomas was evaluated. A potential biomarker that can predict the tumor response to treatment was identified. Formalin-fixed paraffin-embedded tumor blocks of (n = 178) of histopathologically diagnosed cases of locally advanced oral squamous cell carcinomas were selected. Tissue microarray blocks were constructed with 2 cores of 2 mm diameter from each tumor block. Four-micron-thick sections were cut from these tissue microarray blocks. These tissue microarray sections were immunohistochemically stained for EGFR, p53, Bcl-2, cyclin D1 and p16. In this cohort, EGFR was the most frequently expressed 150/178 (84%) biomarker of the cases. Kaplan-Meier analysis showed a significant association (p = 0.038) between expression of p53 and a poor prognosis. A Poisson regression analysis showed that tumors that expressed p53 had a two times greater chance of recurrence (unadjusted IRR-95% CI 2.08 (1.03, 4.5), adjusted IRR-2.29 (1.08, 4.8) compared with the tumors that did not express this biomarker. Molecular profiling of oral squamous cell carcinomas will enable us to categorize our patients into more realistic risk groups. With biologically guided tumor characterization, personalized treatment protocols can be designed for individual patients, which will improve the quality of life of these patients.
Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals
Directory of Open Access Journals (Sweden)
Yasuhito Ohsaka
2010-01-01
Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.
Directory of Open Access Journals (Sweden)
Maryam Mosadegh
2017-02-01
Full Text Available Objective(s: Present study was performed in order to uncover new aspects for nicotine-induced damages on spermatogenesis cell lineage. Materials and Methods: For this purpose, 36 mature male Wistar rats were divided into three groups as; control-sham (0.2 ml, saline normal, IP, low dose (0.2 mg/kg BW-1, IP nicotine-received and high dose (0.4 mg/kg BW-1, IP nicotine-received groups. Following 7 weeks, the expression of bcl-2, p53 and caspase-3 at mRNA and protein levels were investigated by using reverse-transcriptase PCR (RT-PCR and immunohistochemical (IHC analyses, respectively. Moreover, the serum level of FSH, LH and testosterone were evaluated. Finally, the mRNA damage was analyzed by using special fluorescent staining. Results: Nicotine, at both dose levels, decreased tubular differentiation, spermiogenesis and repopulation indices and enhanced cellular depletion. Animals in nicotine-received groups exhibited a significant (P
Directory of Open Access Journals (Sweden)
Christian Lehmann
2016-06-01
Full Text Available Abstract Background Venetoclax, a small molecule BH3 mimetic which inhibits the anti-apoptotic protein Bcl-2, and idasanutlin, a selective MDM2 antagonist, have both shown activity as single-agent treatments in pre-clinical and clinical studies in acute myeloid leukemia (AML. In this study, we deliver the rationale and molecular basis for the combination of idasanutlin and venetoclax for treatment of p53 wild-type AML. Methods The effect of idasanutlin and venetoclax combination on cell viability, apoptosis, and cell cycle progression was investigated in vitro using established AML cell lines. In vivo efficacy was demonstrated in subcutaneous and orthotopic xenograft models generated in female nude or non-obese diabetic/severe combined immunodeficiency (NOD/SCID mice. Mode-of-action analyses were performed by means of cell cycle kinetic studies, RNA sequencing as well as western blotting experiments. Results Combination treatment with venetoclax and idasanutlin results in synergistic anti-tumor activity compared with the respective single-agent treatments in vitro, in p53 wild-type AML cell lines, and leads to strongly superior efficacy in vivo, in subcutaneous and orthotopic AML models. The inhibitory effects of idasanutlin were cell-cycle dependent, with cells arresting in G1 in consecutive cycles and the induction of apoptosis only evident after cells had gone through at least two cell cycles. Combination treatment with venetoclax removed this dependency, resulting in an acceleration of cell death kinetics. As expected, gene expression studies using RNA sequencing showed significant alterations to pathways associated with p53 signaling and cell cycle arrest (CCND1 pathway in response to idasanutlin treatment. Only few gene expression changes were observed for venetoclax treatment and combination treatment, indicating that their effects are mediated mainly at the post-transcriptional level. Protein expression studies demonstrated that
INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.
2003-01-01
monotherapy or in combination with one or more chemotherapeutic drugs, radiation therapies, or other agents that have a damaging effect on the DNA or survival of (i.e. 2-methoxyestradiol, patent No. 6,410,029) cancer cells. In July 2002, the US Patent and Trademark Office issued to The Board of Regents of The University of Texas System US patent No. 6,410,010. The patent broadly covers all adenoviral p53 compositions (including ADVEXIN), therapeutic and otherwise, that express adequate p53 in amounts sufficient to suppress the growth of or kill cancer cells in patients. The patent also covers adenoviral p53 that incorporates a specific type of promoter that helps cells to express the p53 tumour suppressor gene. Introgen is the exclusive licensee of this composition of matter patent covering ADVEXIN. In December 2002, Aventis Pharmaceuticals was issued US patent No. 6,262,032 B1 entitled "Method of Destroying Hyperproliferative Cells by Combining p53 and Taxoid Treatment". Introgen has an exclusive license to this patent and is using this type of combination therapy in its breast cancer trial. Introgen expects to realise $US 2.5-3 million from sales of INGN 201.
BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells
Directory of Open Access Journals (Sweden)
Liu Jun
2004-07-01
Full Text Available Abstract Background BAK (Bcl-2 homologous antagonist/killer is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Methods Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53 and MKN-28 (mutant-type p53. RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. Results BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G0/G1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45, or in p53 mutant-type (MKN-28 gastric cancer cells. Conclusions The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies.
BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells
International Nuclear Information System (INIS)
Tong, Qiang-Song; Zheng, Li-Duan; Wang, Liang; Liu, Jun; Qian, Wei
2004-01-01
BAK (Bcl-2 homologous antagonist/killer) is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53) and MKN-28 (mutant-type p53). RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G 0 /G 1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45), or in p53 mutant-type (MKN-28) gastric cancer cells. The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies
International Nuclear Information System (INIS)
Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong
2005-01-01
Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)
Directory of Open Access Journals (Sweden)
Jennifer M. Smith
2007-12-01
Full Text Available Two adjacent regions within the transactivation domain of p53 are sufficient to support sequence-specific transactivation when fused to a heterologous DNA binding domain. It has been hypothesized that these two subdomains of p53 may contribute to the expression of distinct p53-responsive genes. Here we have used oligonucleotide microarrays to identify transcripts induced by variants of p53 with point mutations within subdomains 1, 2, or 1 and 2 (QS1, QS2, QS1/QS2, respectively. The expression of 254 transcripts was increased in response to wild-type p53 expression but most of these transcripts were poorly induced by these variants of p53. Strikingly, a number of known p53regulated transcripts including TNFRSF10B, BAX, BTG2, POLH were increased to wild-type levels by p53QS1 and p53QS2 but not p53QS1/QS2, indicating that either sub domain 1 or 2 is sufficient for p53-dependent expression of a small subset of p53-responsive genes. Unexpectedly, there was no evidence for p53QS1- or p53QS2-specific gene expression. Taken together, we found heterogeneity in the requirement for transactivation subdomains 1 and 2 of p53 without any subdomain-specific contribution to p53-induced gene expression.
Gene expression patterns associated with p53 status in breast cancer
International Nuclear Information System (INIS)
Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M
2006-01-01
Breast cancer subtypes identified in genomic studies have different underlying genetic defects. Mutations in the tumor suppressor p53 occur more frequently in estrogen receptor (ER) negative, basal-like and HER2-amplified tumors than in luminal, ER positive tumors. Thus, because p53 mutation status is tightly linked to other characteristics of prognostic importance, it is difficult to identify p53's independent prognostic effects. The relation between p53 status and subtype can be better studied by combining data from primary tumors with data from isogenic cell line pairs (with and without p53 function). The p53-dependent gene expression signatures of four cell lines (MCF-7, ZR-75-1, and two immortalized human mammary epithelial cell lines) were identified by comparing p53-RNAi transduced cell lines to their parent cell lines. Cell lines were treated with vehicle only or doxorubicin to identify p53 responses in both non-induced and induced states. The cell line signatures were compared with p53-mutation associated genes in breast tumors. Each cell line displayed distinct patterns of p53-dependent gene expression, but cell type specific (basal vs. luminal) commonalities were evident. Further, a common gene expression signature associated with p53 loss across all four cell lines was identified. This signature showed overlap with the signature of p53 loss/mutation status in primary breast tumors. Moreover, the common cell-line tumor signature excluded genes that were breast cancer subtype-associated, but not downstream of p53. To validate the biological relevance of the common signature, we demonstrated that this gene set predicted relapse-free, disease-specific, and overall survival in independent test data. In the presence of breast cancer heterogeneity, experimental and biologically-based methods for assessing gene expression in relation to p53 status provide prognostic and biologically-relevant gene lists. Our biologically-based refinements excluded genes
Directory of Open Access Journals (Sweden)
Ching-Hao Li
2010-02-01
Full Text Available p53, can regulate cell apoptosis in both transcription-dependent and -independent manners. The transcription-independent pathway was demonstrated by the translocation of p53 to mitochondria. Our study showed that p53 mitochondrial translocation was found in mitomycin C (MMC-treated HepG2. The p53 C-terminal domain is clustered with potential nuclear leading sequences and showed strong electrostatic ion-ion interactions with cardiolipin, phosphatidylglycerol and phosphatidic acid in vitro. Disruption of cardiolipin biosynthesis by phosphatidylglycero-phosphate synthase (PGS or CDP-diacylglycerol synthase 2 (CDS-2 short hairpin RNA (shRNA transfection eliminated the MMC-induced translocation of mitochondrial p53. The elimination of mitochondrial p53 translocation also reduced Bcl-xL and Bcl-2 mitochondrial distribution. In HEK 293T models with saturated p53 expression, the mitochondrial partition of p53, Bcl-xL, and Bcl-2 obviously decreased in their PGS shRNA- or CDS-2 shRNA-expressing stable clones. In p53-null H1299 models, both the mitochondrial partitions of Bcl-xL and Bcl-2 were strongly reduced in relation to the HEK 293T models. The Bcl-xL mitochondrial partition was elevated in H1299 models expressing pCEP4-p53wt suggesting the direct carrier role of p53 in transporting Bcl-xL to the mitochondria. We also found that the cytosolic pool of Bcl-xL and Bcl-2 remained unaffected in the low-dose MMC treatment but decreased in the high-dose MMC treatment. The cytosolic pool of Bcl-2 and Bcl-xL directly regulated their amounts in p53-dependent mitochondrial distribution. In the low-dose MMC treatment, the increased mitochondrial p53, Bcl-xL, and Bcl-2 could attenuate apoptosis. However, in the high-dose MMC treatment, only the p53 translocated to the mitochondria and resulted in apoptosis progression. On the basis of this study, we thought mitochondrial p53 might regulate apoptosis in a biphasic manner.
CLCA2 as a p53-Inducible Senescence Mediator
Directory of Open Access Journals (Sweden)
Chizu Tanikawa
2012-02-01
Full Text Available p53 is a tumor suppressor gene that is frequently mutated in multiple cancer tissues. Activated p53 protein regulates its downstream genes and subsequently inhibits malignant transformation by inducing cell cycle arrest, apoptosis, DNA repair, and senescence. However, genes involved in the p53-mediated senescence pathway are not yet fully elucidated. Through the screening of two genome-wide expression profile data sets, one for cells in which exogenous p53 was introduced and the other for senescent fibroblasts, we have identified chloride channel accessory 2 (CLCA2 as a p53-inducible senescence-associated gene. CLCA2 was remarkably induced by replicative senescence as well as oxidative stress in a p53-dependent manner. We also found that ectopically expressed CLCA2 induced cellular senescence, and the down-regulation of CLCA2 by small interfering RNA caused inhibition of oxidative stress-induced senescence. Interestingly, the reduced expression of CLCA2 was frequently observed in various kinds of cancers including prostate cancer, whereas its expression was not affected in precancerous prostatic intraepithelial neoplasia. Thus, our findings suggest a crucial role of p53/CLCA2-mediated senescence induction as a barrier for malignant transformation.
Directory of Open Access Journals (Sweden)
Angel Gonzalez-Sistal
Full Text Available Invasive lobular breast carcinoma is the second most common type of breast cancer after invasive ductal carcinoma. According to the American Cancer Society, more than 180,000 women in the United States find out they have invasive breast cancer each year. Personal history of breast cancer and certain changes in the breast are correlated with an increased breast cancer risk. The aim of this work was to analyze breastfeeding in patients with infiltrating lobular breast carcinoma, in relation with: 1 clinicopathological parameters, 2 hormonal receptors and 3 tissue-based tumor markers.The study included 80 women with ILC, 46 of which had breastfeed their children. Analyzed parameters were: age, tumor size, axillary lymph node (N, distant metastasis (M, histological grade (HG, estrogen receptor (ER, progesterone receptor (PR, androgen receptor (AR, Ki-67, p53 and BCL2.ILC of non-lactating women showed a larger (p = 0.009, lymph node involvement (p = 0.051 and distant metastasis (p = 0.060. They were also more proliferative tumors measured by Ki-67 (p = 0.053. Breastfeeding history did not influence the subsequent behavior of the tumor regardless of histological subtype.Lactation seems to influence the biological characteristics of ILC defining a subgroup with more tumor size, axillary lymph node involvement, distant metastasis and higher proliferation measured by ki-67 expression.
Shailaja Shukla; Jasmita Dass; Mukta Pujani
2014-01-01
Background and Objective: Persistent high risk human papilloma virus (HPV) infection is probably the best predictor of increased risk of cervical cancer, but expression of certain markers of cell proliferation and apoptosis have been studied. The present study was conducted to evaluate the expression of p53 and bcl2 in premalignant and malignant lesions of cervix and its correlation with HPV type 16 and 18. Materials and Methods: The study comprised of 35 cases (including 24 prospective cases...
Srivastava, Niloo; Manvati, Siddharth; Srivastava, Archita; Pal, Ranjana; Kalaiarasan, Ponnusamy; Chattopadhyay, Shilpi; Gochhait, Sailesh; Dua, Raina; Bamezai, Rameshwar N K
2011-04-04
New levels of gene regulation with microRNA (miR) and gene copy number alterations (CNAs) have been identified as playing a role in various cancers. We have previously reported that sporadic breast cancer tissues exhibit significant alteration in H2AX gene copy number. However, how CNA affects gene expression and what is the role of miR, miR-24-2, known to regulate H2AX expression, in the background of the change in copy number, are not known. Further, many miRs, including miR-24-2, are implicated as playing a role in cell proliferation and apoptosis, but their specific target genes and the pathways contributing to them remain unexplored. Changes in gene copy number and mRNA/miR expression were estimated using real-time polymerase chain reaction assays in two mammalian cell lines, MCF-7 and HeLa, and in a set of sporadic breast cancer tissues. In silico analysis was performed to find the putative target for miR-24-2. MCF-7 cells were transfected with precursor miR-24-2 oligonucleotides, and the gene expression levels of BRCA1, BRCA2, ATM, MDM2, TP53, CHEK2, CYT-C, BCL-2, H2AFX and P21 were examined using TaqMan gene expression assays. Apoptosis was measured by flow cytometric detection using annexin V dye. A luciferase assay was performed to confirm BCL-2 as a valid cellular target of miR-24-2. It was observed that H2AX gene expression was negatively correlated with miR-24-2 expression and not in accordance with the gene copy number status, both in cell lines and in sporadic breast tumor tissues. Further, the cells overexpressing miR-24-2 were observed to be hypersensitive to DNA damaging drugs, undergoing apoptotic cell death, suggesting the potentiating effect of mir-24-2-mediated apoptotic induction in human cancer cell lines treated with anticancer drugs. BCL-2 was identified as a novel cellular target of miR-24-2. mir-24-2 is capable of inducing apoptosis by modulating different apoptotic pathways and targeting BCL-2, an antiapoptotic gene. The study suggests
Directory of Open Access Journals (Sweden)
Fatma Ashour
2018-06-01
Full Text Available Background and Objectives: Breast cancer (BC is classified according to estrogen receptor (ER status into ER+ and ER− tumors. ER+ tumors have a worse response to chemotherapy compared to ER− tumors. BCL-2, TP53, BAX and NF-ΚB are involved in drug resistance in the ER+ tumors. Recently it was shown that Cancer Stem Cells (CSCs play an important role in drug resistance. In this study we tested the hypothesis that CSCs of the ER+ tumors resist drug through the overexpression of BCL-2, TP53, BAX and NF-ΚB. Methods: CSCs were isolated by anoikis resistance assay from MCF7 (ER+ and MDA-MB-231 (ER− cell lines. Isolated CSCs were treated with doxorubicin (DOX and the mRNA expression levels of BCL-2, TP53, BAX and NFKB were investigated by quantitative real time PCR (qPCR with and without treatment. Results: BCL-2, BAX and NF-ΚB showed decreased expression in MCF7 bulk cancer cells after DOX treatment whereas only BCL-2 and BAX showed decreased expression in MDA-MB-231 bulk cancer cells. Interestingly TP53 was the only gene showed a considerable increase in its expression in CSCs of the ER+ MCF7 cell line compared to bulk cancer cells. Moreover, TP53 was the only gene showing exceptionally higher level of expression in MCF7-CSCs compared to MDA-MB-231-CSCs. Conclusion: Our results suggest that CSCs in the ER+ cells escape the effect of DOX treatment by the elevation of p53 expression. Keywords: Breast cancer, Cancer Stem Cells, Drug resistance, Estrogen receptors
Directory of Open Access Journals (Sweden)
Bo Ram Seo
Full Text Available The PI3K/Akt and mTOR signaling pathways are important for cell survival and growth, and they are highly activated in cancer cells compared with normal cells. Therefore, these signaling pathways are targets for inducing cancer cell death. The dual PI3K/Akt and mTOR inhibitor NVP-BEZ235 completely inhibited both signaling pathways. However, NVP-BEZ235 had no effect on cell death in human renal carcinoma Caki cells. We tested whether combined treatment with natural compounds and NVP-BEZ235 could induce cell death. Among several chemopreventive agents, curcumin, a natural biologically active compound that is extracted from the rhizomes of Curcuma species, markedly induced apoptosis in NVP-BEZ235-treated cells. Co-treatment with curcumin and NVP-BEZ235 led to the down-regulation of Mcl-1 protein expression but not mRNA expression. Ectopic expression of Mcl-1 completely inhibited curcumin plus NVP-NEZ235-induced apoptosis. Furthermore, the down-regulation of Bcl-2 was involved in curcumin plus NVP-BEZ235-induced apoptosis. Curcumin or NVP-BEZ235 alone did not change Bcl-2 mRNA or protein expression, but co-treatment reduced Bcl-2 mRNA and protein expression. Combined treatment with NVP-BEZ235 and curcumin reduced Bcl-2 expression in wild-type p53 HCT116 human colon carcinoma cells but not p53-null HCT116 cells. Moreover, Bcl-2 expression was completely reversed by treatment with pifithrin-α, a p53-specific inhibitor. Ectopic expression of Bcl-2 also inhibited apoptosis in NVP-BE235 plus curcumin-treated cells. In contrast, NVP-BEZ235 combined with curcumin did not have a synergistic effect on normal human skin fibroblasts and normal human mesangial cells. Taken together, combined treatment with NVP-BEZ235 and curcumin induces apoptosis through p53-dependent Bcl-2 mRNA down-regulation at the transcriptional level and Mcl-1 protein down-regulation at the post-transcriptional level.
Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo
2014-04-01
p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.
Directory of Open Access Journals (Sweden)
Sushma Kalmodia
2017-12-01
Full Text Available Inhibition of the interaction between p53 and HDM2 is an effective therapeutic strategy in cancers that harbor a wild-type p53 protein such as retinoblastoma (RB. Nanoparticle-based delivery of therapeutic molecules has been shown to be advantageous in localized delivery, including to the eye, by overcoming ocular barriers. In this study, we utilized biocompatible gold nanoparticles (GNPs to deliver anti-HDM2 peptide to RB cells. Characterization studies suggested that GNP-HDM2 was stable in biologically relevant solvents and had optimal cellular internalization capability, the primary requirement of any therapeutic molecule. GNP-HDM2 treatment in RB cells in vitro suggested that they function by arresting RB cells at the G2M phase of the cell cycle and initiating apoptosis. Analysis of molecular changes in GNP-HDM2-treated cells by qRT-PCR and western blotting revealed that the p53 protein was upregulated; however, transactivation of its downstream targets was minimal, except for the PUMA-BCl2 and Bax axis. Global gene expression and in silico bioinformatic analysis of GNP-HDM2-treated cells suggested that upregulation of p53 might presumptively mediate apoptosis through the induction of p53-inducible miRNAs.
Montazeri, Maryam; Pilehvar-Soltanahmadi, Younes; Mohaghegh, Mina; Panahi, Alireza; Khodi, Samaneh; Zarghami, Nosratollah; Sadeghizadeh, Majid
2017-01-01
The aim of this paper is to investigate the effect of dendrosomal curcumin (DNC) on the expression of p53 in both p53 mutant cell lines SKBR3/SW480 and p53 wild-type MCF7/HCT116 in both RNA and protein levels. Curcumin, derived from Curcumin longa, is recently considered in cancer related researches for its cell growth inhibition properties. p53 is a common tumor-suppressor gene involved in cancers and its mutation not only inhibits tumor suppressor activity but also promotes oncogenic activity. Here, p53 mutant/Wild-type cells were employed to study the toxicity of DNC using MTT assay, Flow cytometry and Annexin-V, Real-time PCR and Western blot were used to analyze p53, BAX, Bcl-2, p21 and Noxa changes after treatment. During the time, DNC increased the SubG1 cells and decreased G1, S and G2/M cells, early apoptosis also indicated the inhibition of cell growth in early phase. Real-Time PCR assay showed an increased mRNA of BAX, Noxa and p21 during the time with decreased Bcl-2. The expression of p53 mutant decreased in SKBR3/SW480, and the expression of p53 wild-type increased in MCF7/HCT116. Consequently, p53 plays an important role in mediating the survival by DNC, which can prevent tumor cell growth by modulating the expression of genes involved in apoptosis and proliferation. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Mitofusin-2 is a novel direct target of p53
International Nuclear Information System (INIS)
Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen
2010-01-01
Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.
Wang, Lin; Pang, Xiao-Cong; Yu, Zi-Ru; Yang, Sheng-Qian; Liu, Ai-Lin; Wang, Jin-Hua; Du, Guan-Hua
2017-06-01
The aim of this study is to investigate the synergism of low dose of actinomycin D (LDActD) to the cytotoxicity of cisplatin (CDDP) on KB cells. The role of P53 reactivation by LDActD in the synergism and its mechanism were further studied. Cell viability was determined by MTT assay. Apoptosis was determined by AnnexinV-FITC/PI staining. Mitochondrial membrane potential (MMP) was detected by JC-1 staining. Expression of proteins was detected by Western blotting (WB) and/or immunofluorescence (IF). Molecular docking of actinomycin D (ACTD) to Mouse double minute 2 homolog (MDM2) and Mouse double minute 2 homolog X (MDMX). MDMX was analyzed by Discovery Studio. The content of P53-MDM2 complex was detected by ELISA assay. The cytotoxicity of CDDP was increased by the combination of LDActD in kinds of cancer cells. Molecular docking showed strong interaction between ACTD and MDM2/MDMX. Meanwhile, LDActD significantly decreased P53-MDM2 complex. Significant increase of the apoptotic activity by the combination therapy in KB cells is P53 upregulated modulator of apoptosis (PUMA) dependent. In addition to the decrease in MMP, LDActD increased P53 regulated protein and decreased BCL-XL in KB cells. LDActD efficiently enhanced the cytotoxicity of CDDP in cancer cells and induced P53-PUMA-dependent and mitochondria-mediated apoptosis in KB cells. The reactivation of P53 was probably achieved by disturbing the interaction of P53 and MDM2/MDMX.
Effect of p53 genotype on gene expression profiles in murine liver
International Nuclear Information System (INIS)
Morris, Suzanne M.; Akerman, Gregory S.; Desai, Varsha G.; Tsai, Chen-an; Tolleson, William H.; Melchior, William B.; Lin, Chien-Ju; Fuscoe, James C.; Casciano, Daniel A.; Chen, James J.
2008-01-01
The tumor suppressor protein p53 is a key regulatory element in the cell and is regarded as the 'guardian of the genome'. Much of the present knowledge of p53 function has come from studies of transgenic mice in which the p53 gene has undergone a targeted deletion. In order to provide additional insight into the impact on the cellular regulatory networks associated with the loss of this gene, microarray technology was utilized to assess gene expression in tissues from both the p53 -/- and p53 +/- mice. Six male mice from each genotype (p53 +/+ , p53 +/- , and p53 -/- ) were humanely killed and the tissues processed for microarray analysis. The initial studies have been performed in the liver for which the Dunnett test revealed 1406 genes to be differentially expressed between p53 +/+ and p53 +/- or between p53 +/+ and p53 -/- at the level of p ≤ 0.05. Both genes with increased expression and decreased expression were identified in p53 +/- and in p53 -/- mice. Most notable in the gene list derived from the p53 +/- mice was the significant reduction in p53 mRNA. In the p53 -/- mice, not only was there reduced expression of the p53 genes on the array, but genes associated with DNA repair, apoptosis, and cell proliferation were differentially expressed, as expected. However, altered expression was noted for many genes in the Cdc42-GTPase pathways that influence cell proliferation. This may indicate that alternate pathways are brought into play in the unperturbed liver when loss or reduction in p53 levels occurs
Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family
International Nuclear Information System (INIS)
Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain
2003-01-01
The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA
Directory of Open Access Journals (Sweden)
Meenu Varshney
2015-01-01
Full Text Available Trichloroethylene (TCE is widely used as a metal degreaser in industrial processes. The present study reports on the effects of TCE exposure on workers employed in the lock industries. To ensure exposure of the workers to TCE, its toxic metabolites, trichloroacetic acid (TCA, dichloroacetic acid (DCA and trichloroethanol (TCEOH were detected in the plasma of the subjects through solid phase microextraction-gas chromatography-electron capture detection. TCA, DCA and TCEOH were detected in the range of 0.004–2.494 μg/mL, 0.01–3.612 μg/mL and 0.002–0.617 μg/mL, respectively. Quantitative reverse transcription polymerase chain reaction analysis revealed up-regulated expression of p53 (2.4-fold; p < 0.05, p21 (2-fold; p < 0.01, bax (2.9-fold; p < 0.01 mRNAs and down-regulated expression of bcl-2 (67%; p < 0.05 mRNAs, indicating DNA damaging potential of these metabolites. No effects were observed on the levels of p16 and c-myc mRNAs. Further, as TCA and DCA, the ligand of peroxisome proliferator activated receptor alpha (PPARA, are involved in the process of hepatocarcinogenesis in rodents, we examined expression of PPARA mRNA and let-7c miRNA in the workers. No statistically significant differences in expression of PPARA mRNA and let-7c miRNA in patients were observed as compared to values in controls. Dehydroepiandosterone sulfate (DHEAS is a reported endogenous ligand of PPARA so its competitive role was also studied. We observed decreased levels of DHEAS hormone in the subjects. Hence, its involvement in mediation of the observed changes in the levels of various mRNAs analyzed in this study appears unlikely.
The effects of combining ionizing radiation and adenoviral p53 therapy in nasopharyngeal carcinoma
International Nuclear Information System (INIS)
Li Jianhua; Lax, Stuart A.; Kim, John; Klamut, Henry; Liu Feifei
1999-01-01
Purpose: Nasopharyngeal carcinoma (NPC) is a malignant disease of the head/neck region, with a 5-year survival level of approximately 65%. To explore gene therapy as a novel approach which might improve outcome, we have shown previously that introduction of human recombinant wild-type p53 mediated by the adenoviral vector (Ad5CMV-p53) was cytotoxic in two human nasopharyngeal carcinoma (NPC) cell lines (CNE-1 and CNE-2Z). The current work was designed to determine whether this strategy, combined with ionizing radiation (XRT), was more effective than either treatment alone. Methods and Materials: CNE-1, CNE-2Z, and a normal human nasopharyngeal fibroblast strain, KS1, were infected with 2- and 6-plaque-forming units (pfu)/cell of Ad5CMV-p53, respectively. These doses were iso-effective for β-galactosidase activity in the CNE-1 and CNE-2Z cells. XRT was administered 24 h post-infection, and Western blot analyses were conducted for p53, p21 WAF1/CIP1 , bax, and bcl-2 2 days after XRT. Cell survival was assessed using a clonogenic assay. Presence of DNA ladders reflecting apoptosis was detected using DNA agarose gel electrophoresis, and cell cycle was analyzed using flow cytometry. Results: The combination of Ad5CMV-p53 plus XRT (2, 4, and 6 Gy) resulted in an approximately 1-log greater level of cytotoxicity compared to that observed with XRT alone for both NPC cell lines. The two modalities appear to be interacting in a synergistic manner in cancer cells, but not in KS1 fibroblasts. XRT alone stimulated minimal p53 expression in control cells; Ad5CMV-p53 alone induced significant recombinant p53 expression, which was not further enhanced by the addition of XRT. Similar observations were made for p21 WAF1/CIP1 expression. No changes were observed for bax or bcl-2 expression with any of these treatments. Apoptosis was induced following 4 Gy of XRT alone, but was observed after only 2 Gy when combined with Ad5CMV-p53. Cell cycle analysis indicated that Ad5CMV-p53
International Nuclear Information System (INIS)
Li Huixiang; Wang Yaohe; Shi Yonggang; Gao Dongling; Zhang Yunhan
2000-01-01
Objective: To observing the relationship between apoptosis-related genes bcl-2,c-myc, p53 and the radiosensitivity of esophageal squamous cell carcinoma. Methods: The expression levels of bcl-2, c-myc and p53 genes in 57 biopsy samples from patients of esophageal squamous cell carcinoma were detected with the LSAB immunohistochemistry method. All the patients were treated with radiotherapy. The radiotherapeutic effect in these patients was observed and the relation between gene expression and radiosensitivity was analyzed. Results: Compared with the bcl-2-negative group, the radiosensitivity of bcl-2-positive one was lower(P<0.01). The radiosensitivity of p53-positive group was slightly lower than that of the p53-negative one (P<0.05). The c-myc protein expression was not related to radiosensitivity. Conclusion: Detection and comprehensive analysis of bcl-2, c-myc and p53 protein expressions are useful in forecasting the radiotherapeutic effect on squamous cell carcinoma of esophagus
International Nuclear Information System (INIS)
Tsuyama, Naohiro; Danjoh, Inaho; Otsuyama, Ken-ichiro; Obata, Masanori; Tahara, Hidetoshi; Ohta, Tsutomu; Ishikawa, Hideaki
2005-01-01
IL-6 is a growth and survival factor for myeloma cells, although the mechanism by which it induces myeloma cell proliferation through gene expression is largely unknown. Microarray analysis showed that some B-cell lymphoma-associated oncogenes such as Bcl6, which is absent in normal plasma cells, were upregulated by IL-6 in IL-6-dependent myeloma cell lines. We found that Bcl6 variant 2 was upregulated by STAT3. ChIP assay and EMSA showed that STAT3 bound to the upstream region of variant 2 DNA. Expression of p53, a direct target gene of Bcl6, was downregulated in the IL-6-stimulated cells, and this process was impaired by an HDAC inhibitor. Bcl6 was knocked down by introducing small hairpin RNA, resulting in decreased proliferation and increased sensitivity to a DNA damaging agent. Thus, STAT3-inducible Bcl6 variant 2 appears to generate an important IL-6 signal that supports proliferation and survival of IL-6-dependent myeloma cells
Lin, Grace; LaPensee, Christopher R; Qin, Zhaohui S; Schwartz, Jessica
2014-09-01
Expression of the Growth Hormone (GH)-stimulated gene Socs2 (Suppressor of Cytokine Signaling 2) is mediated by the transcription activator STAT5 (Signal Transducer and Activator of Transcription 5) and the transcription repressor BCL6 (B-Cell Lymphoma 6). ChIP-Sequencing identified Cish (Cytokine-Inducible SH2-containing protein) and Bcl6 as having similar patterns of reciprocal occupancy by BCL6 and STAT5 in response to GH, though GH stimulates Cish and inhibits Bcl6 expression. The co-activator p300 occupied Socs2, Cish and Bcl6 promoters, and enhanced STAT5-mediated activation of Socs2 and Cish. In contrast, on Bcl6, p300 functioned as a repressor and inhibited in conjunction with STAT5 or BCL6. The co-repressor HDAC3 (Histone deacetylase 3) inhibited the Socs2, Cish and Bcl6 promoters in the presence of STAT5. Thus transcriptional outcomes on GH-regulated genes occupied by BCL6 and STAT5 are determined in a promoter-specific fashion by co-regulatory proteins which mediate the distinction between activating and repressive transcription factors. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Alterations in the K-ras and p53 genes in rat lung tumors
Energy Technology Data Exchange (ETDEWEB)
Belinsky, S.A.; Swafford, D.S.; Finch, G.L.; Mitchell, C.E. [Inhalation Toxicology Research Institute, Albuquerque, NM (United States)] [and others
1997-06-01
Activation of the K-ras protooncogene and inactivation of the p53 tumor suppressor gene are events common to many types of human cancers. Molecular epidemiology studies have associated mutational profiles in these genes with specific exposures. The purpose of this paper is to review investigations that have examined the role of the K-ras and p53 genes in lung tumors induced in the F344 rat by mutagenic and nonmutagenic exposures. Mutation profiles within the K-ras and p53 genes, if present in rat lung tumors, would help to define some of the molecular mechanisms underlying cancer induction by various environmental agents. Pulmonary adenocarcinomas or squamous cell carcinomas were induced by tetranitromethane (TNM), 4-methylnitrosamino-1-(3-pyridyl)-1-butanone (NNK), beryllium metal, plutonium-239, X-ray, diesel exhaust, or carbon black. These agents were chosen because the tumors they produced could arise via different types of DNA damage. Mutation of the K-ras gene was determined by approaches that included DNA transfection, direct sequencing, mismatch hybridization, and restriction fragment length polymorphism analysis. The frequency for mutation of the K-ras gene was exposure dependent. The transition mutations formed could have been derived from deamination of cytosine. Alteration in the p53 gene was assessed by immunohistochemical analysis for p53 protein and single-strand conformation polymorphism (SSCP) analysis of exons 4 to 9. None of the 93 adenocarinomas examined was immunoreactive toward the anti-p53 antibody CM1. In contrast, 14 of 71 squamous cell carcinomas exhibited nuclear p53 immunoreactivity with no correlation to type of exposure. However, SSCP analysis only detected mutations in 2 of 14 squamous cell tumors that were immunoreactive, suggesting that protein stabilization did not stem from mutations within the p53 gene. Thus, the p53 gene does not appear to be involved in the genesis of most rat lung tumors. 2 figs., 2 tabs., 48 refs.
BCL2 genotypes and prostate cancer survival
Energy Technology Data Exchange (ETDEWEB)
Renner, Wilfried [Medical University of Graz, Clinical Institute of Medical and Chemical Laboratory Diagnostics, Graz (Austria); Langsenlehner, Uwe [GKK Outpatient Department, Division of Internal Medicine, Graz (Austria); Krenn-Pilko, Sabine; Langsenlehner, Tanja [Medical University of Graz, Department of Therapeutic Radiology and Oncology, Graz (Austria); Eder, Petra [University Hospital Wuerzburg, Department of Internal Medicine I, Wuerzburg (Germany)
2017-06-15
The antiapoptotic B-cell lymphoma 2 (BCL2) gene is a key player in cancer development and progression. A functional single-nucleotide polymorphism (c.-938C>A, rs2279115) in the inhibitory P2 BCL2 gene promoter has been associated with clinical outcomes in various types of cancer. Aim of the present study was to analyze the role of BCL2-938C>A genotypes in prostate cancer mortality. The association between BCL2-938C>A (rs2279115) genotypes and prostate cancer outcome was studied within the prospective PROCAGENE study comprising 702 prostate cancer patients. During a median follow-up time of 92 months, 120 (17.1%) patients died. A univariate Cox regression model showed a significant association of the CC genotype with reduced cancer-specific survival (CSS; hazard ratio, HR, 2.13, 95% confidence interval, CI, 1.10-4.12; p = 0.024) and overall survival (OS; HR 2.34, 95% CI 1.58-3.47; p < 0.001). In a multivariate Cox regression model including age at diagnosis, risk group, and androgen deprivation therapy, the CC genotype remained a significant predictor of poor CSS (HR 2.05, 95% CI 1.05-3.99; p = 0.034) and OS (HR 2.25, 95% CI 1.51-3.36; p < 0.001). This study provides evidence that the homozygous BCL2-938 CC genotype is associated with OS and C in prostate cancer patients. (orig.) [German] Das antiapoptotische Gen B cell lymphoma 2 (BCL2) spielt eine Schluesselrolle in der Entstehung und Progression von Krebserkrankungen. Ein funktioneller Einzelnukleotid-Polymorphismus (c.-938C>A, rs2279115) im inhibitorischen P2-BCL2-Promotor wurde mit dem klinischen Outcome verschiedener Krebserkrankungen verknuepft. Ziel der vorliegenden Studie war die Untersuchung der Rolle von BCL2-938C>A-Genotypen fuer die Mortalitaet bei Patienten mit Prostatakarzinom. Der Zusammenhang zwischen BCL2-938C>A-Genotypen (rs2279115) und dem Outcome bei Prostatakrebs wurde in der prospektiven PROCAGENE-Studie, die 702 Patienten mit Prostatakarzinom umfasste, untersucht. Waehrend der medianen
Shvarts, A.; Brummelkamp, T.; Koh, E.; Daley, G.Q.; Bernards, R.A.
2002-01-01
Senescence limits the proliferative capacity of primary cells in culture. We describe here a genetic screen to identify genes that allow bypass of this checkpoint. Using retroviral cDNA expression libraries, we identify BCL6 as a potent inhibitor of senescence. BCL6 is frequently activated in
Shvarts, Avi; Brummelkamp, Thijn R.; Scheeren, Ferenc; Koh, Eugene; Daley, George Q.; Spits, Hergen; Bernards, René
2002-01-01
Senescence limits the proliferative capacity of primary cells in culture. We describe here a genetic screen to identify genes that allow bypass of this checkpoint. Using retroviral cDNA expression libraries, we identify BCL6 as a potent inhibitor of senescence. BCL6 is frequently activated in
Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6
Energy Technology Data Exchange (ETDEWEB)
Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)
2015-11-15
Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4
p53 represses autophagy in a cell cycle-dependent fashion.
Tasdemir, Ezgi; Maiuri, Maria Chiara; Orhon, Idil; Kepp, Oliver; Morselli, Eugenia; Criollo, Alfredo; Kroemer, Guido
2008-10-01
Autophagy is one of the principal mechanisms of cellular defense against nutrient depletion and damage to cytoplasmic organelles. When p53 is inhibited by a pharmacological antagonist (cyclic pifithrin-alpha), depleted by a specific small interfering RNA (siRNA) or deleted by homologous recombination, multiple signs of autophagy are induced. Here, we show by epistatic analysis that p53 inhibition results in a maximum level of autophagy that cannot be further enhanced by a variety of different autophagy inducers including lithium, tunicamycin-induced stress of the endoplasmic reticulum (ER) or inhibition of Bcl-2 and Bcl-X(L) with the BH3 mimetic ABT737. Chemical inducers of autophagy (including rapamycin, lithium, tunicamycin and ABT737) induced rapid depletion of the p53 protein. The absence or the inhibition of p53 caused autophagy mostly in the G(1) phase, less so in the S phase and spares the G(2)/M phase of the cell cycle. The possible pathophysiological implications of these findings are discussed.
[CCR5, CCR2, apoe, p53, ITGB3 and HFE gene polymorphism in Western Siberia long-livers].
Ivanoshchuk, D E; Mikhaĭlova, S V; Kulikov, I V; Maksimov, V N; Voevoda, M I; Romashchenko, A G
2012-01-01
In order to estimate the distribution of some polymorphisms for the CCR5, CCR2, apoE, p53, ITGB3, and HFE genes in Russian long-livers from Western Siberia, a sample of 271 individuals (range 90-105 years) was examined. It was demonstrated that carriage of the delta32 polymorphism for the CCR5 gene, V64/polymorphism for the CCR2 gene, e2/e3/e4 for the apoE gene, L33P for the ITGB3 gene, as well as H63D and S65C polymorphisms for the HFE gene does not influence on predisposition to the longevity; carriage of the 282 Y allele for the HFE gene negatively influences on the longevity; carriage of the heterozygous genotype for the R72P polymorphism for the p53 gene correlates with the longevity of elderly people.
The pharmacodynamics of the p53-Mdm2 targeting drug Nutlin: the role of gene-switching noise.
Directory of Open Access Journals (Sweden)
Krzysztof Puszynski
2014-12-01
Full Text Available In this work we investigate, by means of a computational stochastic model, how tumor cells with wild-type p53 gene respond to the drug Nutlin, an agent that interferes with the Mdm2-mediated p53 regulation. In particular, we show how the stochastic gene-switching controlled by p53 can explain experimental dose-response curves, i.e., the observed inter-cell variability of the cell viability under Nutlin action. The proposed model describes in some detail the regulation network of p53, including the negative feedback loop mediated by Mdm2 and the positive loop mediated by PTEN, as well as the reversible inhibition of Mdm2 caused by Nutlin binding. The fate of the individual cell is assumed to be decided by the rising of nuclear-phosphorylated p53 over a certain threshold. We also performed in silico experiments to evaluate the dose-response curve after a single drug dose delivered in mice, or after its fractionated administration. Our results suggest that dose-splitting may be ineffective at low doses and effective at high doses. This complex behavior can be due to the interplay among the existence of a threshold on the p53 level for its cell activity, the nonlinearity of the relationship between the bolus dose and the peak of active p53, and the relatively fast elimination of the drug.
Energy Technology Data Exchange (ETDEWEB)
Guangyu, Zhu; Qin, Lu; Gaojun, Teng; Jinhe, Guo; Hui, Yu; Gang, Deng; Shicheng, He; Wen, Fang; Guozhao, Li; Xiaoying, Wei [Zhongda Hospital, Southeast Univ., Nanjing (China)
2007-02-15
Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)
International Nuclear Information System (INIS)
Zhu Guangyu; Lu Qin; Teng Gaojun; Guo Jinhe; Yu Hui; Deng Gang; He Shicheng; Fang Wen; Li Guozhao; Wei Xiaoying
2007-01-01
Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)
Directory of Open Access Journals (Sweden)
Juliana Noguti
2013-01-01
Full Text Available Background: The aim of this study was to evaluate whether paradoxical sleep deprivation could affects the mechanisms and pathways essentials for cancer cells in tongue cancer induced by 4-nitroquinole 1-oxide in Wistar rats. Materials and Methods: For this purpose, the animals were distributed into 4 groups of 5 animals each treated with 50 ppm 4 nitroquinoline 1 oxide (4 NQO solution through their drinking water for 4 and 12 weeks. The animals were submitted to paradoxical sleep deprivation (PSD for 72 h using the modified multiple platform method, which consisted of placing 5 mice in a cage (41 × 34 × 16 cm containing 10 circular platforms (3.5 cm in diameter with water 1 cm below the upper surface. The investigations were conducted using immunohistochemistry of p53, Bax and Bcl-2 proteins related to apoptosis and its pathways. Statistical analysis was performed by Kruskal-Wallis non-parametric test followed by the Dunn′s test using SPSS software pack (version 1.0. P value < 0.05 was considered for statistic significance. Results: Although no histopathological abnormalities were induced in the epithelium after 4 weeks of carcinogen exposure in all groups, in 12 weeks were observed pre-neoplasic lesions. Data analysis revealed statistically significant differences ( P < 0.05 in 4 weeks group for p53 and for bcl-2 and for all immunomarkers after 12 weeks of 4NQO administration. Conclusion: Our results reveal that sleep deprivation exerted alterations in proteins associated with proliferation and apoptosis in carcinogenesis.
ER, p53 and MIB-1 are significantly associated with malignant phyllodes tumor
Directory of Open Access Journals (Sweden)
Nurhayati H Munawer
2012-12-01
Full Text Available Background: Phyllodes tumors (PT are rare. We evaluated the expression status of ER, Bcl2, p53, and MIB-1 protein in these tumors. Methods: One hundred and ninety-three tumors were examined using immunohistochemistry on tissue microarray. Results: ERβ (p <0.001, and p53 (p=0.006 in the stromal component were associated with tumor size. p53 expression was significantly associated with both epithelial and stromal components of malignant PTs (p<0.05. In PT, the decreased expressions of p53 and MIB-1 were significantly different with positive Bcl2 protein expression in epithelial component (p=0.000. Besides, MIB-1 was also found to be associated with ERα and ERβ in stromal component (p=0.000. Conclusion: The expression of p53 with tumor size and histological grade in PTs may increase risk for malignancy.
International Nuclear Information System (INIS)
Liu Feifei; Li Jianhua; Lax, Stuart; Klamut, Henry
1997-01-01
Purpose/Objective: We have previously demonstrated that the introduction of human recombinant wild-type p53 carried by the adenoviral vector (Ad5CMV-p53) into two human nasopharyngeal carcinoma (NPC) cell lines (CNE-1 and CNE-2Z) resulted in significant cytotoxicity. In the current work, we wanted to evaluate the results of this strategy when combined with ionizing radiation (XRT). Materials and Methods: CNE-1, CNE-2Z, and a normal human nasopharyngeal fibroblast strain KS1, were infected with iso-effective doses of 2, 6 and 6 pfu/cell of Ad5CMV-p53 respectively. XRT was administered 24 hours post-infection, to coincide with the time of maximal recombinant p53 expression. Western blot analyses were conducted for p53, p21 WAF1/CIP1 , bax and bcl-2. Cell viability was evaluated using both the MTT and clonogenic assays. Presence of apoptosis was determined by using DNA agarose gel electrophoresis. Results: We observed that the combination of Ad5CMV-p53 + XRT (2, 4, and 6 Gy) resulted in an approximately 1-log greater level of cytotoxicity compared to that observed with XRT alone for both NPC cell lines. The MTT assay indicated sparing of the KS1 cells when subjected to the identical treatments. XRT alone stimulated minimal p53 expression; Ad5CMV-p53 alone induced significant recombinant p53 expression, which was not further enhanced by the addition of XRT. Similar observations were made for p21 WAF1/CIP1 expression. No changes were observed for bax and bcl-2 expression with any of these treatments. Apoptosis was induced following 4 Gy of XRT alone, but was observed earlier, at 2 Gy when combined with Ad5CMV-p53. Conclusion: Additional cytotoxicity was observed for the NPC cell lines when XRT was combined with Ad5CMV-p53 infection, with concurrent sparing of normal cells (KS1). This cytotoxicity also appeared to be mediated through the induction of the apoptotic pathway. These results support our previous observation of the potential application of this strategy in the
Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy
Directory of Open Access Journals (Sweden)
Christian Bressy
2017-06-01
Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.
p53 as the focus of gene therapy: past, present and future.
Valente, Joana Fa; Queiroz, Joao A; Sousa, Fani
2018-01-15
Several gene deviations can be responsible for triggering oncogenic processes. However, mutations in tumour suppressor genes are usually more associated to malignant diseases, being p53 one of the most affected and studied element. p53 is implicated in a number of known cellular functions, including DNA damage repair, cell cycle arrest in G1/S and G2/M and apoptosis, being an interesting target for cancer treatment. Considering these facts, the development of gene therapy approaches focused on p53 expression and regulation seems to be a promising strategy for cancer therapy. Several studies have shown that transfection of cancer cells with wild-type p53 expressing plasmids could directly drive cells into apoptosis and/or growth arrest, suggesting that a gene therapy approach for cancer treatment can be based on the re-establishment of the normal p53 expression levels and function. Up until now, several clinical research studies using viral and non-viral vectors delivering p53 genes, isolated or combined with other therapeutic agents, have been accomplished and there are already in the market therapies based on the use of this gene. This review summarizes the different methods used to deliver and/or target the p53 as well as the main results of therapeutic effect obtained with the different strategies applied. Finally, the ongoing approaches are described, also focusing the combinatorial therapeutics to show the increased therapeutic potential of combining gene therapy vectors with chemo or radiotherapy. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
International Nuclear Information System (INIS)
Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina
2006-01-01
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
Energy Technology Data Exchange (ETDEWEB)
Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it
2006-02-22
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.
ZNF307, a novel zinc finger gene suppresses p53 and p21 pathway
International Nuclear Information System (INIS)
Li Jing; Wang Yuequn; Fan Xiongwei; Mo Xiaoyang; Wang Zequn; Li Yongqing; Yin Zhaochu; Deng Yun; Luo Na; Zhu Chuanbing; Liu Mingyao; Ma Qian; Ocorr, Karen; Yuan Wuzhou; Wu Xiushan
2007-01-01
We have cloned a novel KRAB-related zinc finger gene, ZNF307, encoding a protein of 545 aa. ZNF307 is conserved across species in evolution and is differentially expressed in human adult and fetal tissues. The fusion protein of EGFP-ZNF307 localizes in the nucleus. Transcriptional activity assays show ZNF307 suppresses transcriptional activity of L8G5-luciferase. Overexpressing ZNF307 in different cell lines also inhibits the transcriptional activities of p53 and p21. Moreover, ZNF307 works by reducing the p53 protein level and p53 protein reduction is achieved by increasing transcription of MDM2 and EP300. ZNF307 might suppress p53-p21 pathway through activating MDM2 and EP300 expression and inducing p53 degradation
Directory of Open Access Journals (Sweden)
Rejane Mattar
2004-01-01
Full Text Available Inactivation of tumor suppressor genes has been frequently observed in gastric carcinogenesis. Our purpose was to study the involvement of p53, APC, DCC, and Rb genes in gastric carcinoma. METHOD: Loss of heterozygosity of the p53, APC, DCC and Rb genes was studied in 22 gastric cancer tissues using polymerase chain reaction; single-strand conformation polymorphism of the p53 gene exons 5-6 and exons 7-8 was studied using 35S-dATP, and p53 expression was detected using a histological immunoperoxidase method with an anti-p53 clone. RESULTS AND DISCUSSION: No loss of heterozygosity was observed in any of these tumor suppressor genes; homozygous deletion was detected in the Rb gene in 23% (3/13 of the cases of intestinal-type gastric carcinoma. Eighteen (81.8% cases showed band mobility shifts in exons 5-6 and/or 7-8 of the p53 gene. The presence of the p53 protein was positive in gastric cancer cells in 14 cases (63.6%. Normal gastric mucosa showed negative staining for p53; thus, the immunoreactivity was likely to represent mutant forms. The correlation of band mobility shift and the immunoreactivity to anti-p53 was not significant (P = .90. There was no correlation of gene alterations with the disease severity. CONCLUSIONS: The inactivation of Rb and p53 genes is involved in gastric carcinogenesis in our environment. Loss of the Rb gene observed only in the intestinal-type gastric cancer should be further evaluated in association with Helicobacter pylori infection. The p53 gene was affected in both intestinal and diffuse histological types of gastric cancer.A inativação de genes supressores tumorais tem sido freqüentemente observada na carcinogênese gástrica. O nosso objetivo foi estudar o envolvimento dos genes p53, APC, DCC e Rb no câncer gástrico. MÉTODO: Vinte e dois casos de câncer gástrico foram estudados por PCR-LOH (reação de polimerase em cadeia- perda de alelo heterozigoto dos genes p53, APC, DCC e Rb; e por PCR-SSCP (rea
Isolation and characterization of DUSP11, a novel p53 target gene
DEFF Research Database (Denmark)
Caprara, Greta; Zamponi, Raffaella; Melixetian, Marina
2009-01-01
target gene. Consistent with this, the expression of DUSP11 is induced in a p53-dependent manner after treatment with DNA damaging agents. Chromatin immunoprecipitation analysis showed that p53 binds to 2 putative p53 DNA binding sites in the promoter region of DUSP11. Colony formation and proliferation...
The effect of radiation on bcl-2 and bax in hyperplastic prostatic tissues
International Nuclear Information System (INIS)
Ma Qingjie; Li Yuxin; Gu Xinquan; Cao Xia; Zhao Jie; Kong Xiangbo; Cai Shanyu
2004-01-01
Aim: To investigate the expressions of bcl-2 and bax in benign prostatic hyperplasia (BPH) and the effect of β-rays on bcl-2 and bax. Methods: The expressions of bcl-2 and bax are studied by means of immunohistochemical method in 9 normal prostate (NP) and 15 BPH and 35 patients treated with 90Sr/90Y Prostatic Hyperplasia Applicator. Results: The expressions of bcl-2 in epithelia of NP and BPH are higher than that in stroma P<0.01=. The expressions of bcl-2 in epithelia and stroma of BPH are higher than that in NP P<0.01=. The expressions of bax in epithelia of NP are higher than that in BPH P<0.05=. However ,the expressions of bcl-2 in epithelia and stroma of BPH are higher than bax P<0.01 =. Compared with the control group, the expressions of bcl-2 in epithelia and stroma of BPH treated with 90Sr/90Y Prostatic Hyperplasia Applicator decreased and the expressions of bax increased P<0.01=. Conclusion: bcl-2 gene and bax gene play an important role in the regulation of prostatic apoptosis and the treatment of β-rays can accelerate the apoptosis of prostatic tissues. (authors)
DNA rearrangement in human follicular lymphoma can involve the 5' or the 3' region of the bcl-2 gene
International Nuclear Information System (INIS)
Tsujimoto, Y.; Bashir, M.M.; Givol, I.; Cossman, J.; Jaffe, E.; Croce, C.M.
1987-01-01
In most human lymphomas, the chromosome translocation t(14;18) occurs within two breakpoint clustering regions on chromosome 18, the major one at the 3' untranslated region of the bcl-2 gene and the minor one at 3' of the gene. Analysis of a panel of follicular lymphoma DNAs using probes for the first exon of the bcl-2 gene indicates that DNA rearrangements may also occur 5' to the involved bcl-2 gene. In this case the IgH locus and the bcl-2 gene are found in an order suggesting that an inversion also occurred during the translocation process. The coding region of the bcl-2 gene, however, are left intact in all cases of follicular lymphoma studied to date
p53 tumor suppressor gene: significance in neoplasia - a review
International Nuclear Information System (INIS)
Alam, J.M.
2000-01-01
p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)
Expression of Bcl-2 family proteins and spontaneous apoptosis in normal human testis.
Oldereid, N B; Angelis, P D; Wiger, R; Clausen, O P
2001-05-01
We investigated the frequency of spontaneous apoptosis and expression of the Bcl-2 family of proteins during normal spermatogenesis in man. Testicular tissue with both normal morphology and DNA content was obtained from necro-donors and fixed in Bouin's solution. A TdT-mediated dUTP end-labelling method (TUNEL) was used for the detection of apoptotic cells. Expression of apoptosis regulatory Bcl-2 family proteins and of p53 and p21(Waf1) was assessed by immunohistochemistry. Germ cell apoptosis was detected in all testes and was mainly seen in primary spermatocytes and spermatids and in a few spermatogonia. Bcl-2 and Bak were preferentially expressed in the compartments of spermatocytes and differentiating spermatids, while Bcl-x was preferentially expressed in spermatogonia. Bax showed a preferential expression in nuclei of round spermatids, whereas Bad was only seen in the acrosome region of various stages of spermatids. Mcl-1 staining was weak without a particular pattern, whereas expression of Bcl-w, p53 and p21(Waf1) proteins was not detected by immunohistochemistry. The results show that spontaneous apoptosis occurs in all male germ cell compartments in humans. Bcl-2 family proteins are distributed preferentially within distinct germ cell compartments suggesting a specific role for these proteins in the processes of differentiation and maturation during human spermatogenesis.
Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.
Loging, W T; Reisman, D
1999-11-01
The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.
Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A
2009-05-01
Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.
Akyurek, Nalan; Uner, Aysegul; Benekli, Mustafa; Barista, Ibrahim
2012-09-01
Diffuse large B-cell lymphomas (DLBCLs) are a biologically heterogeneous group in which various gene alterations have been reported. The aim of this study was to investigate the frequency and prognostic impact of BCL2, BCL6, and MYC rearrangements in cyclophosphamide, doxorubicin, vincristine, and prednisone plus rituximab (R-CHOP)-treated DLBCL cases. Tissue microarrays were constructed from 239 cases of DLBCL, and the expressions of CD10, BCL6, MUM1/IRF4, and BCL2 were evaluated by immunohistochemistry. MYC, BCL2, and BCL6 rearrangements were investigated by interphase fluorescence in situ hybridization on tissue microarrays. Survival analysis was constructed from 145 R-CHOP-treated patients. MYC, BCL2, and BCL6 rearrangements were detected in 14 (6%), 36 (15%), and 69 (29%) of 239 DLBCL patients. Double or triple rearrangements were detected in 7 (3%) of 239 DLBCL cases. Of these, 4 had BCL2 and MYC, 2 had BCL6 and MYC, and 1 had BCL2, BCL6, and MYC rearrangements. The prognosis of these cases was extremely poor, with a median survival of 9 months. MYC rearrangement was associated with significantly worse overall survival (P = .01), especially for the cases with GC phenotype (P = .009). BCL6 rearrangement also predicted significantly shorter overall survival (P = .04), especially for the non-GC phenotype (P = .03). BCL2 rearrangement had no prognostic impact on outcome. International Prognostic Index (P = .004) and MYC rearrangement (P = .009) were independent poor prognostic factors. Analysis of MYC gene rearrangement along with BCL2 and BCL6 is critical in identifying high-risk patients with poor prognosis. Copyright © 2011 American Cancer Society.
A dynamic P53-MDM2 model with time delay
Energy Technology Data Exchange (ETDEWEB)
Mihalas, Gh.I. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: mihalas@medinfo.umft.ro; Neamtu, M. [Department of Forecasting, Economic Analysis, Mathematics and Statistics, West University of Timisoara, Str. Pestalozzi, nr. 14A, 300115 Timisoara (Romania)]. E-mail: mihaela.neamtu@fse.uvt.ro; Opris, D. [Department of Applied Mathematics, West University of Timisoara, Bd. V. Parvan, nr. 4, 300223 Timisoara (Romania)]. E-mail: opris@math.uvt.ro; Horhat, R.F. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: rhorhat@yahoo.com
2006-11-15
Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results.
A dynamic P53-MDM2 model with time delay
International Nuclear Information System (INIS)
Mihalas, Gh.I.; Neamtu, M.; Opris, D.; Horhat, R.F.
2006-01-01
Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results
SS-A/Ro52 promotes apoptosis by regulating Bcl-2 production
Energy Technology Data Exchange (ETDEWEB)
Jauharoh, Siti Nur Aisyah [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Faculty of Medicine and Health Science, Syarif Hidayatullah State Islamic University, Jakarta 15412 (Indonesia); Saegusa, Jun; Sugimoto, Takeshi [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Ardianto, Bambang [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Department of Child Health, Faculty of Medicine, Gadjah Mada University, Yogyakarta 55282 (Indonesia); Kasagi, Shimpei; Sugiyama, Daisuke; Kurimoto, Chiyo [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Tokuno, Osamu; Nakamachi, Yuji [Department of Laboratory Medicine, Kobe University Hospital, Hyogo 650-0017 (Japan); Kumagai, Shunichi [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Kawano, Seiji, E-mail: sjkawano@med.kobe-u.ac.jp [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Department of Laboratory Medicine, Kobe University Hospital, Hyogo 650-0017 (Japan)
2012-01-06
Highlights: Black-Right-Pointing-Pointer Ro52{sup low} HeLa cells are resistant to apoptosis upon various stimulations. Black-Right-Pointing-Pointer Ro52 is upregulated by IFN-{alpha}, etoposide, or IFN-{gamma} and anti-Fas Ab. Black-Right-Pointing-Pointer Ro52-mediated apoptosis is independent of p53. Black-Right-Pointing-Pointer Ro52 selectively regulates Bcl-2 expression. -- Abstract: SS-A/Ro52 (Ro52), an autoantigen in systemic autoimmune diseases such as systemic lupus erythematosus and Sjoegren's syndrome, has E3 ligase activity to ubiquitinate proteins that protect against viral infection. To investigate Ro52's role during stress, we transiently knocked it down in HeLa cells by siRo52 transfection. We found that Ro52{sup low} HeLa cells were significantly more resistant to apoptosis than wild-type HeLa cells when stimulated by H{sub 2}O{sub 2}- or diamide-induced oxidative stress, IFN-{alpha}, IFN-{gamma} and anti-Fas antibody, etoposide, or {gamma}-irradiation. Furthermore, Ro52-mediated apoptosis was not influenced by p53 protein level in HeLa cells. Depleting Ro52 in HeLa cells caused Bcl-2, but not other Bcl-2 family molecules, to be upregulated. Taken together, our data showed that Ro52 is a universal proapoptotic molecule, and that its proapoptotic effect does not depend on p53, but is exerted through negative regulation of the anti-apoptotic protein Bcl-2. These findings shed light on a new physiological role for Ro52 that is important to intracellular immunity.
SS-A/Ro52 promotes apoptosis by regulating Bcl-2 production
International Nuclear Information System (INIS)
Jauharoh, Siti Nur Aisyah; Saegusa, Jun; Sugimoto, Takeshi; Ardianto, Bambang; Kasagi, Shimpei; Sugiyama, Daisuke; Kurimoto, Chiyo; Tokuno, Osamu; Nakamachi, Yuji; Kumagai, Shunichi; Kawano, Seiji
2012-01-01
Highlights: ► Ro52 low HeLa cells are resistant to apoptosis upon various stimulations. ► Ro52 is upregulated by IFN-α, etoposide, or IFN-γ and anti-Fas Ab. ► Ro52-mediated apoptosis is independent of p53. ► Ro52 selectively regulates Bcl-2 expression. -- Abstract: SS-A/Ro52 (Ro52), an autoantigen in systemic autoimmune diseases such as systemic lupus erythematosus and Sjögren’s syndrome, has E3 ligase activity to ubiquitinate proteins that protect against viral infection. To investigate Ro52’s role during stress, we transiently knocked it down in HeLa cells by siRo52 transfection. We found that Ro52 low HeLa cells were significantly more resistant to apoptosis than wild-type HeLa cells when stimulated by H 2 O 2 - or diamide-induced oxidative stress, IFN-α, IFN-γ and anti-Fas antibody, etoposide, or γ-irradiation. Furthermore, Ro52-mediated apoptosis was not influenced by p53 protein level in HeLa cells. Depleting Ro52 in HeLa cells caused Bcl-2, but not other Bcl-2 family molecules, to be upregulated. Taken together, our data showed that Ro52 is a universal proapoptotic molecule, and that its proapoptotic effect does not depend on p53, but is exerted through negative regulation of the anti-apoptotic protein Bcl-2. These findings shed light on a new physiological role for Ro52 that is important to intracellular immunity.
Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma
International Nuclear Information System (INIS)
Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.
2014-01-01
Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)
International Nuclear Information System (INIS)
Tsujimoto, Yoshihide
1989-01-01
The biological activity of the human BCL-2 gene product was analyzed in an Epstein-Barr virus (EBV)-infected human lymphoblastoid B-cell line transfected with BCL-2 sequences driven by the simian virus 40 promoter and enhancer. Overproduction of the BCL-2 protein conferred a selective growth advantage to the EBV-infected B cells as compared with control transfectants in low-serum medium and also after seeding at limiting dilution but did not render the cells tumorigenic in athymic nude mice. This growth enhancement was also seen in cells transfected with the BCL-2 gene with its own promoter juxtaposed to the immunoglobulin heavy chain gene enhancer, which represents the translocated form of the BCL-2 gene observed in follicular lymphomas with the t(14;18) translocation. The growth advantage of EBV-infected B cells overproducing the BCL-2 protein is neither due to the enhanced growth factor production nor due to an enhanced sensitivity of the BCL-2 transfectants to interleukins 1 or 6, although both lymphokines are known to stimulate proliferation of EBV-infected B-cell lines. The growth advantage of EBV-infected B-cell lines. The growth advantage of EBV-infected B cells by overproduction of the BCL-2 protein suggests the direct involvement of the BCL-2 gene product in the pathogenesis of follicular lymphoma
International Nuclear Information System (INIS)
Changchien, Jung-Jung; Chen, Ying-Jung; Huang, Chia-Hui; Cheng, Tian-Lu; Lin, Shinne-Ren; Chang, Long-Sen
2015-01-01
Although previous studies have revealed the anti-cancer activity of quinacrine, its effect on leukemia is not clearly resolved. We sought to explore the cytotoxic effect and mechanism of quinacrine action in human leukemia K562 cells. Quinacrine induced K562 cell apoptosis accompanied with ROS generation, mitochondrial depolarization, and down-regulation of BCL2L1 and BCL2. Upon exposure to quinacrine, ROS-mediated p38 MAPK activation and ERK inactivation were observed in K562 cells. Quinacrine-induced cell death and mitochondrial depolarization were suppressed by the p38MAPK inhibitor SB202190 and constitutively active MEK1 over-expression. Activation of p38 MAPK was shown to promote BCL2 degradation. Further, ERK inactivation suppressed c-Jun-mediated transcriptional expression of BCL2L1. Over-expression of BCL2L1 and BCL2 attenuated quinacrine-evoked mitochondrial depolarization and rescued the viability of quinacrine-treated cells. Taken together, our data indicate that quinacrine-induced K562 cell apoptosis is mediated through mitochondrial alterations triggered by p38 MAPK-mediated BCL2 down-regulation and suppression of ERK/c-Jun-mediated BCL2L1 expression. - Highlights: • Quinacrine induces K562 cell apoptosis via down-regulation of BCL2 and BCL2L1. • Quinacrine induces p38 MAPK activation and ERK inactivation in K562 cells. • Quinacrine elicits p38 MAPK-mediated BCL2 down-regulation. • Quinacrine suppresses ERK/c-Jun-mediated BCL2L1 expression
DEFF Research Database (Denmark)
Møller, Michael Boe; Ino, Y; Gerdes, A M
1999-01-01
The two gene products of the CDKN2A gene, p16 and p19ARF, have recently been linked to each of two major tumour suppressor pathways in human carcinogenesis, the RB1 pathway and the p53 pathway. p16 inhibits the phosphorylation of the retinoblastoma gene product by cyclin D-dependent kinases...
Directory of Open Access Journals (Sweden)
Ahmed Shalaby
2009-01-01
Full Text Available Background. We studied the effect of fast induction of cardiac arrest with denosine on myocardial bax and bcl-2 expression. Methods and Results. 40 elective CABG patients were allocated into two groups. The adenosine group (n=20 received 250 μg/kg adenosine into the aortic root followed by blood potassium cardioplegia. The control group received potassium cardioplegia in blood. Bcl-2 and bax were measured. Bax was reduced in the postoperative biopsies (1.38 versus 0.47, P=.002 in the control group. Bcl-2 showed a reducing tendency (0.14 versus 0.085, P=.07. After the adenosine treatment, the expression of both bax (0.52 versus 0.59, P=.4 and bcl-2 (0.104 versus 0.107, P=.4 remained unaltered after the operation. Conclusion. Open heart surgery is associated with rapid reduction in the expression of apoptosis regulating genes bax and bcl-2. Fast Adenosine induction abolished changes in their expression.
Directory of Open Access Journals (Sweden)
Hunaldo Lima de Menezes
2010-06-01
Full Text Available CONTEXT: Search of tumors markers that allow treatment with higher survival rates, and indicate the response to treatment and recurrence of cancer OBJECTIVE: To analyze the immunoexpression of the proteins p53, bcl-2 and Ki-67 in colorectal adenocarcinoma and correlate them with the clinical-pathological prognostic factors. METHOD: Tissue microarray paraffin blocks were made from colorectal adenocarcinoma tissue resected from 82 patients who had undergone surgery but not chemotherapy or radiotherapy, at "Hospital São Paulo", São Paulo, SP, Brazil, between 2002 and 2005. Thin sections (4 µm were subjected to immunohistochemical reactions, and immunoexpression staining scores were obtained. The scores were correlated with the degree of cell differentiation, staging, disease-free interval, recurrence, survival and specific mortality. The study variables were analyzed using the chi-square and Kaplan-Meier tests to investigate associations with the markers. The significance of the differences between the curves of the disease-free interval and survival was analyzed using the Logrank and Wilcoxon tests. RESULTS: The immunohistochemical expression of p53 was positive in 70 tumors (85.4% and negative in 12 (14.6%. The expression of bcl-2 was positive in 26 (31.7% and negative in 56 (68.3%. The expression of Ki-67 was positive in 62 (75.6% and negative in 20 (24.4%. There was no statistically significant correlation between the expressions of these markers separately or in conjunction, in relation to the degree of cell differentiation, staging, disease-free interval, survival and specific mortality. In relation to recurrence, there was a statistically significant correlation with positive expression of Ki-67 (P = 0.035. CONCLUSION: The immunohistochemical expression of Ki-67 in colorectal cancer is associated with recurrence of this disease.CONTEXTO: Pesquisa de marcadores tumorais que permitam tratamento com maiores índices de sobrevida, além de
International Nuclear Information System (INIS)
Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming
2008-01-01
Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)
OTUD5 regulates p53 stability by deubiquitinating p53.
Directory of Open Access Journals (Sweden)
Judong Luo
Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.
Noda, Takeshi
2011-12-01
I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.
Combination of Heavy-ion radiotherapy and p53-gene therapy by radio-sensitizing promoter for glioma
International Nuclear Information System (INIS)
Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie
2005-01-01
In this study we have investigated the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing promoter-E9ns-2/CMV chimeric promoter (Scott et al:2003) in p53-gene therapy. First, EGFP reporter gene with E9ns-2/CMV chimeric promoter was transfected in C6 rat glioma cell-line and the transfected-cell bulk was irradiated at dose of 3, 5, 10 Gy respectively with charged carbon particle (290 MeV/nucleon). The light upregulation of EGFP was observed in 24 hours after 5 Gy irradiation. On the basis of this result, p53 gene with E9ns-2/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 5 Gy. There was, however, no obvious p53-upregulation at any time-point, so far. Further investigation is needed to clarify the appropriate experimental system. (author)
Directory of Open Access Journals (Sweden)
Rouba Hage-Sleiman
Full Text Available Molt-4 leukemia cells undergo p53-dependent apoptosis accompanied by accumulation of de novo ceramide after 14 hours of γ-irradiation. In order to identify the potential mediators involved in ceramide accumulation and the cell death response, differentially expressed genes were identified by Affymetrix Microarray Analysis. Molt-4-LXSN cells, expressing wild type p53, and p53-deficient Molt-4-E6 cells were irradiated and harvested at 3 and 8 hours post-irradiation. Human genome U133 plus 2.0 array containing >47,000 transcripts was used for gene expression profiling. From over 10,000 probes, 281 and 12 probes were differentially expressed in Molt-4-LXSN and Molt-4-E6 cells, respectively. Data analysis revealed 63 (upregulated and 20 (downregulated genes (>2 fold in Molt-4-LXSN at 3 hours and 140 (upregulated and 21 (downregulated at 8 hours post-irradiation. In Molt-4-E6 cells, 5 (upregulated genes each were found at 3 hours and 8 hours, respectively. In Molt-4-LXSN cells, a significant fraction of the genes with altered expression at 3 hours were found to be involved in apoptosis signaling pathway (BCL2L11, p53 pathway (PMAIP1, CDKN1A and FAS and oxidative stress response (FDXR, CROT and JUN. Similarly, at 8 hours the genes with altered expression were involved in the apoptosis signaling pathway (BAX, BIK and JUN, p53 pathway (BAX, CDKN1A and FAS, oxidative stress response (FDXR and CROT and p53 pathway feedback loops 2 (MDM2 and CDKN1A. A global molecular and biological interaction map analysis showed an association of these altered genes with apoptosis, senescence, DNA damage, oxidative stress, cell cycle arrest and caspase activation. In a targeted study, activation of apoptosis correlated with changes in gene expression of some of the above genes and revealed sequential activation of both intrinsic and extrinsic apoptotic pathways that precede ceramide accumulation and subsequent execution of apoptosis. One or more of these altered genes
Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva
2018-03-01
HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Park, Jong Ho; Zo, Jae Ill; Paik, Hee Jong; Kim, Mi Hee
1996-12-01
The main purpose of this research was to identify of the p53 and 3p gene alteration in non-small cell lung cancer patients residing in Korea. Furthermore, we analyzed the relationship between the p53 and 3p gene alterations and the clinicopathologic results of lung cancer patients. And we have investigated the role of PCR-LOH in analyzing tumor samples for LOH of defined chromosomal loci. We have used the 40 samples obtained from the lung cancer patients who were diagnosed and operated curatively at Korea Cancer Center Hospital. We have isolated the high molecular weight. DNA from the tumors and normal tissues. And we have amplified the DNA with PCR method and used the microsatellite assay method to detect the altered p53 and 3p gene. The conclusions were as follow: 1) The 3p gene alteration was observed in 9/39 (23.1%) and p53 gene alteration was observed in 15/40 (37.5%) of resected non-small cell lung cancer. 2) There was no correlations between the 3p or p53 gene alterations and prognosis of patients, but further study is necessary. 3) PCR-LOH is a very useful tool for analyzing small amount of tumor samples for loss of heterozygosity of defined chromosomal loci. (author). 10 refs
International Nuclear Information System (INIS)
Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie
2006-01-01
In this study we have started to investigate the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing E 9ns-2 /cytomegalovirus (CMV) chimeric promoter (Scott et al: 2003) in p53-gene therapy. Our study in the first year, however, suggested the uselessness of E 9ns-2 /CMV chimeric promoter. Then we applied E 9ns-2 /Epo5/CMV-radio and hypoxia-sensitizing chimeric promoter to amplify p53 gene exopression. P53 gene with E 9ns2 /Epo5/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 1 Gy of high linear energy transfer (LET)-carbon ion beam or low-LET X-ray under various hypoxic conditions. The result suggested the possible role of 1 Gy of high LET-carbon ion beam as a ''useful trigger'' to enhance a selective anti-tumor effect toward glioma under hypoxic condition through amplification of p53 gene expression. (author)
International Nuclear Information System (INIS)
Hwang, Jun-Hwa; Lim, Sung-Chul; Kim, Young-Chul; Park, Kyung-Ok; Ahn, Sung-Ja; Chung, Woong-Ki
2001-01-01
Objectives: We assessed the role of apoptosis and the expression of bcl-2, p53, and c-myc oncoproteins in pretreatment histologic specimens as a predictor of response to radiation therapy and survival in non-small-cell lung cancer (NSCLC) patients. Methods: Pretreatment biopsy specimens of 68 patients with NSCLC (62 squamous cell carcinoma, 6 adenocarcinoma) were stained with hematoxylin and eosin. From 5 high-powered fields, the apoptotic index (AI) was calculated as the ratio of apoptotic tumor cells to the total number of tumor cells. Bcl-2, p53, and c-myc oncoprotein expression was detected by immunohistochemical staining. Results: Twenty-nine cases showed partial or complete remission, whereas 39 showed no response. AI ranged from 0.2 to 12.0% (mean ± SD; 4.3±2.6%, median 4.0%). There was no difference in AI between responders (4.0±2.3) and nonresponders (4.5±2.8, p>0.05). However, in the responders, AI was correlated with the degree of change in tumor volume (r=0.41, p<0.05). In an analysis of 53 subjects who survived more than 1 month after the completion of radiation therapy, the patients with a higher AI (n=27, MST=22.8 m) survived longer than those with a lower AI (n=26, MST=9.2, log-rank, p=0.03). Patients expressing bcl-2 had poorer survival (n=22, MST=6.0 m) than patients without bcl-2 (n=31, 22.8 m, p<0.003). According to multivariate analysis, three variables, bcl-2 expression, AI, and response to radiation, were independent prognostic factors for survival. Conclusion: A low level of spontaneous apoptosis and expression of apoptosis blocking bcl-2 protein in pretreatment histology predict a poor prognosis for radiation-treated NSCLC patients
P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability
International Nuclear Information System (INIS)
Mukh-Syaifudin
2006-01-01
Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and
Recurrent pregnancy failure is associated with a polymorphism in the p53 tumour suppressor gene.
Pietrowski, Detlef; Bettendorf, Hertha; Riener, Eva-Katrin; Keck, Christoph; Hefler, Lukas A; Huber, Johannes C; Tempfer, Clemens
2005-04-01
The p53 tumour suppressor gene is a well-known factor regulating apoptosis in a wide variety of cells and tissues. Alterations in the p53 gene are among the most common genetic changes in human cancers. In addition, recent data provide evidence that p53 plays a critical role in mediating pregnancy by regulating steroid hormone activation. In idiopathic recurrent miscarriages (IRM), causes and associations are much debated as the exact pathophysiological mechanisms are unknown. In this study, we assess whether an established polymorphism in the p53 gene is associated with the occurrence of IRM. Genotyping was performed by PCR-based amplification of the p53 Arg and Pro variants at codon 72 in 175 cases of IRM and 143 controls. We observed a statistically significant association between carriage of the Pro allele and the occurrence of IRM (P = 0.03, odds ratio 1.49, confidence interval 1.04-2.14). Distribution of genotypes was in Hardy-Weinberg equilibrium. Our results indicate an over-representation of the Pro allele of the p53 gene in women with IRM, giving support to the theory that p53 has a potential role during pregnancy.
Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.
Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu
2017-08-01
p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.
Wild type p53 transcriptionally represses the SALL2 transcription factor under genotoxic stress.
Directory of Open Access Journals (Sweden)
Carlos Farkas
Full Text Available SALL2- a member of the Spalt gene family- is a poorly characterized transcription factor found deregulated in various cancers, which suggests it plays a role in the disease. We previously identified SALL2 as a novel interacting protein of neurotrophin receptors and showed that it plays a role in neuronal function, which does not necessarily explain why or how SALL2 is deregulated in cancer. Previous evidences indicate that SALL2 gene is regulated by the WT1 and AP4 transcription factors. Here, we identified SALL2 as a novel downstream target of the p53 tumor suppressor protein. Bioinformatic analysis of the SALL2 gene revealed several putative p53 half sites along the promoter region. Either overexpression of wild-type p53 or induction of the endogenous p53 by the genotoxic agent doxorubicin repressed SALL2 promoter activity in various cell lines. However R175H, R249S, and R248W p53 mutants, frequently found in the tumors of cancer patients, were unable to repress SALL2 promoter activity, suggesting that p53 specific binding to DNA is important for the regulation of SALL2. Electrophoretic mobility shift assay demonstrated binding of p53 to one of the identified p53 half sites in the Sall2 promoter, and chromatin immunoprecipitation analysis confirmed in vivo interaction of p53 with the promoter region of Sall2 containing this half site. Importantly, by using a p53ER (TAM knockin model expressing a variant of p53 that is completely dependent on 4-hydroxy-tamoxifen for its activity, we show that p53 activation diminished SALL2 RNA and protein levels during genotoxic cellular stress in primary mouse embryo fibroblasts (MEFs and radiosensitive tissues in vivo. Thus, our finding indicates that p53 represses SALL2 expression in a context-specific manner, adding knowledge to the understanding of SALL2 gene regulation, and to a potential mechanism for its deregulation in cancer.
Directory of Open Access Journals (Sweden)
Ivan Raimondi
Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.
Energy Technology Data Exchange (ETDEWEB)
Nakagawa, Yosuke [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Takahashi, Akihisa [Advanced Scientific Research Leader Development Unit, Gunma University, 3-39-22 Showa-machi, Maebashi, Gunma 371-8511 (Japan); Kajihara, Atsuhisa; Yamakawa, Nobuhiro; Imai, Yuichiro [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ota, Ichiro; Okamoto, Noritomo [Department of Otorhinolaryngology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Mori, Eiichiro [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Noda, Taichi [Department of Dermatology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Furusawa, Yoshiya [Heavy-ion Radiobiology Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kirita, Tadaaki [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ohnishi, Takeo, E-mail: tohnishi@naramed-u.ac.jp [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan)
2012-07-13
Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggested that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp
Detection of p53 gene mutations in bronchial biopsy samples of patients with lung cancer
International Nuclear Information System (INIS)
Irshad, S.; Nawaz, T.
2008-01-01
Lung cancer is the malignant transformation and expansion of lung tissue. It is the most lethal of all cancers worldwide, responsible for 1.2 million deaths annually. The goal of this study was to detect the p53 gene mutations in lung cancer, in local population of Lahore, Pakistan. These mutations were screened in the bronchial biopsy lung cancer tissue samples. For this purpose microtomed tissue sections were collected. Following DNA extraction from tissue sections, the p53 mutations were detected by amplifying Exon 7 (145 bp) and Exon 8 (152 bp) of the p53 gene. PCR then followed by single-strand conformation polymorphism analysis for screening the p53 gene mutations. This results of SSCP were visualized of silver staining. The results showed different banding pattern indicating the presence of mutation. Majority of the mutations were found in Exon 7. Exon 7 of p53 gene may be the mutation hotspot in lung cancer. In lung cancer, the most prevalent mutations of p53 gene are G -> T transversions; other types of insertions and deletions are also expected, however, the exact nature of mutations in presented work could be confirmed by direct sequencing. (author)
Heterozygous inactivation of tsc2 enhances tumorigenesis in p53 mutant zebrafish
Directory of Open Access Journals (Sweden)
Seok-Hyung Kim
2013-07-01
Tuberous sclerosis complex (TSC is a multi-organ disorder caused by mutations of the TSC1 or TSC2 genes. A key function of these genes is to inhibit mTORC1 (mechanistic target of rapamycin complex 1 kinase signaling. Cells deficient for TSC1 or TSC2 have increased mTORC1 signaling and give rise to benign tumors, although, as a rule, true malignancies are rarely seen. In contrast, other disorders with increased mTOR signaling typically have overt malignancies. A better understanding of genetic mechanisms that govern the transformation of benign cells to malignant ones is crucial to understand cancer pathogenesis. We generated a zebrafish model of TSC and cancer progression by placing a heterozygous mutation of the tsc2 gene in a p53 mutant background. Unlike tsc2 heterozygous mutant zebrafish, which never exhibited cancers, compound tsc2;p53 mutants had malignant tumors in multiple organs. Tumorigenesis was enhanced compared with p53 mutant zebrafish. p53 mutants also had increased mTORC1 signaling that was further enhanced in tsc2;p53 compound mutants. We found increased expression of Hif1-α, Hif2-α and Vegf-c in tsc2;p53 compound mutant zebrafish compared with p53 mutant zebrafish. Expression of these proteins probably underlies the increased angiogenesis seen in compound mutant zebrafish compared with p53 mutants and might further drive cancer progression. Treatment of p53 and compound mutant zebrafish with the mTORC1 inhibitor rapamycin caused rapid shrinkage of tumor size and decreased caliber of tumor-associated blood vessels. This is the first report using an animal model to show interactions between tsc2, mTORC1 and p53 during tumorigenesis. These results might explain why individuals with TSC rarely have malignant tumors, but also suggest that cancer arising in individuals without TSC might be influenced by the status of TSC1 and/or TSC2 mutations and be potentially treatable with mTORC1 inhibitors.
Directory of Open Access Journals (Sweden)
Elainy Patricia Lino Gasparotto
2011-12-01
Full Text Available Apoptosis deregulation might have a role in the pathophysiology of polycythemia vera (PV. This study evaluated Bcl-2 molecule expression in CD34+ cells and leukocytes in 12 PV patients. Gene expression was investigated by real time PCR using SybrGreen Quantitect kit and protein expression was evaluated by western-blotting. JAK2 V617F mutation was detected according to Baxter et al (2005. CD34+ cells from PV patients presented higher levels of A1 and Mcl-1 expression (median: 22.6 and 5.2, respectively in comparison with controls (0.9 and 0.5, p=0.004 and p=0.020; while Bcl-2 and Bcl-xL expression decreased in PV patients (0.18 and 1.19 compared with controls (1.39 and 2.01, p=0.006 and p=0.020. CD34+ cells in PV patients showed an elevated Bid expression (14.4 in comparison with healthy subjects (1.0; p=0.002. Patients' leukocytes showed an A1 augmentation (7.41, p=0.001 and a reduced expression of Bax (0.19; p=0.040 and Bad (0.2; p=0.030. There was no correlation between JAK2 V617F allele burden and molecular expression. PV patients showed alterations in Bcl-2 members' expression, which may interfere with control of apoptotic machinery and contribute to disease pathogenesis.A desregulação da apoptose parece participar da fisiopatologia da policitemia vera (PV. Este estudo avaliou a expressão das moléculas da família Bcl-2 em células hematopoéticas CD34 + e leucócitos de 12 pacientes com PV. Foram realizados: a quantificação da expressão gênica por PCR em tempo real utilizando kit Sybrgreen Quantitect, avaliação da expressão de proteínas por western-blot e detecção da mutação JAK2 V617F segundo Baxter et al. (2005. Células CD34 + dos pacientes com PV apresentaram maior expressão de A1 e Mcl-1 (mediana: 22,6 e 5,2, respectivamente em comparação com controles (0,9 e 0,5, p = 0,004 e p = 0,020 e expressão de Bcl-2 e Bcl-xL diminuída nestes pacientes (0,18 e 1,19 em relação aos controles (1,39 e 2,01, p = 0,006 e p = 0
Gene expression profiles in BCL11B-siRNA treated malignant T cells
Directory of Open Access Journals (Sweden)
Grabarczyk Piotr
2011-05-01
Full Text Available Abstract Background Downregulation of the B-cell chronic lymphocytic leukemia (CLL/lymphoma11B (BCL11B gene by small interfering RNA (siRNA leads to growth inhibition and apoptosis of the human T-cell acute lymphoblastic leukemia (T-ALL cell line Molt-4. To further characterize the molecular mechanism, a global gene expression profile of BCL11B-siRNA -treated Molt-4 cells was established. The expression profiles of several genes were further validated in the BCL11B-siRNA -treated Molt-4 cells and primary T-ALL cells. Results 142 genes were found to be upregulated and 109 genes downregulated in the BCL11B-siRNA -treated Molt-4 cells by microarray analysis. Among apoptosis-related genes, three pro-apoptotic genes, TNFSF10, BIK, BNIP3, were upregulated and one anti-apoptotic gene, BCL2L1 was downregulated. Moreover, the expression of SPP1 and CREBBP genes involved in the transforming growth factor (TGF-β pathway was down 16-fold. Expression levels of TNFSF10, BCL2L1, SPP1, and CREBBP were also examined by real-time PCR. A similar expression pattern of TNFSF10, BCL2L1, and SPP1 was identified. However, CREBBP was not downregulated in the BLC11B-siRNA -treated Molt-4 cells. Conclusion BCL11B-siRNA treatment altered expression profiles of TNFSF10, BCL2L1, and SPP1 in both Molt-4 T cell line and primary T-ALL cells.
Marx, Christian; Marx-Blümel, Lisa; Lindig, Nora; Thierbach, René; Hoelzer, Doerte; Becker, Sabine; Wittig, Susan; Lehmann, Roland; Slevogt, Hortense; Heinzel, Thorsten; Wang, Zhao-Qi; Beck, James F; Sonnemann, Jürgen
2018-06-01
The sirtuin 1/2 inhibitor tenovin-1 activates p53 and may have potential in the management of cancer. Here, we investigated the responsiveness of Ewing's sarcoma cells to tenovin-1. We examined its effects in two Ewing's sarcoma cell lines with different p53 status, i.e. in p53 wild-type and p53 null cells. Effects were assessed by flow cytometric analyses of cell death, mitochondrial membrane depolarization and reactive oxygen species (ROS) generation, by caspase 3/7 activity measurement, by mRNA expression profiling and by immunoblotting. Tenovin-1 elicited caspase-mediated cell death in p53 wild-type cells, but caspase-independent cell death in p53 null cells. Remarkably, it induced a nonlinear concentration response in the latter: low concentrations of tenovin-1 were much more effective than were higher concentrations. Tenovin-1's effects in p53 null cells involved gene expression changes of Bcl-2 family members, mitochondrial membrane depolarization, nuclear translocation of apoptosis-inducing factor, ROS formation and DNA damage; all these effects followed a bell-shaped pattern. In conclusion, our results provide new insights into tenovin-1's mode of action by demonstrating that it can induce different pathways of cell death.
Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef
2005-07-01
To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.
Withaferin A Suppresses Anti-apoptotic BCL2, Bcl-xL, XIAP and ...
African Journals Online (AJOL)
apoptotic genes, BCL2, Bcl-xL, XIAP and Survivin), in cervical carcinoma cells. Methods: Annexin V-FITC/propidium iodide (PI) staining was used for the investigation of cell apoptosis. RNA RNeasy Kits was used to isolate RNA and Omniscript ...
Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.
Directory of Open Access Journals (Sweden)
Simon Leuchs
Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.
Fickova, Maria; Macho, Ladislav; Brtko, Julius
2015-06-01
In recent years it was disclosed, that numerous organotin(IV) derivatives have remarkable cytotoxicity against several types of cancer cells. The property to inhibit cell growth makes these compounds promising for antitumor therapy, as the clinical effectiveness of cisplatin is limited by drug resistance and significant side effects. Tributyltin and triphenyltin are known as endocrine disruptors. Moreover, the compounds exert their toxicity in mammals predominantly through nuclear receptor signaling. Here we present the effects of tributyltin chloride (TBT-Cl) and triphenyltin chloride (TPT-Cl) on cell proliferation, expression of proapoptotic p53, Bax, and antiapoptotic Bcl-2 proteins in human breast cancer MCF-7 cell line. Dose and time dependent (24, 48 and 72 h) cell expositions have demonstrated TBT-Cl as more effective in inhibiting MCF-7 cell proliferation than TPT-Cl. Short time treatment with TBT-Cl displayed marked stimulation of p53 protein expression when compared to TPT-Cl. Both organotin compounds displayed similar mild enhancement of Bax protein expression. The 24h exposition of TPT-Cl induced substantial diminution of Bcl-2 protein expression in comparison with both, untreated cells and TBT-Cl treated cells. Our observations indicate that TBT-Cl and TPT-Cl have different antiproliferative potency and distinct impact on expression of apoptosis marker proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
International Nuclear Information System (INIS)
Patel, Nirav; Joseph, Cecil; Corcoran, George B.; Ray, Sidhartha D.
2010-01-01
The emergence of silymarin (SMN) as a natural remedy for liver diseases, coupled with its entry into NIH clinical trial, signifies its hepatoprotective potential. SMN is noted for its ability to interfere with apoptotic signaling while acting as an antioxidant. This in vivo study was designed to explore the hepatotoxic potential of Doxorubicin (Dox), the well-known cardiotoxin, and in particular whether pre-exposures to SMN can prevent hepatotoxicity by reducing Dox-induced free radical mediated oxidative stress, by modulating expression of apoptotic signaling proteins like Bcl-xL, and by minimizing liver cell death occurring by apoptosis or necrosis. Groups of male ICR mice included Control, Dox alone, SMN alone, and Dox with SMN pre/co-treatment. Control and Dox groups received saline i.p. for 14 days. SMN was administered p.o. for 14 days at 16 mg/kg/day. An approximate LD 50 dose of Dox, 60 mg/kg, was administered i.p. on day 12 to animals receiving saline or SMN. Animals were euthanized 48 h later. Dox alone induced frank liver injury (> 50-fold increase in serum ALT) and oxidative stress (> 20-fold increase in malondialdehyde [MDA]), as well as direct damage to DNA (> 15-fold increase in DNA fragmentation). Coincident genomic damage and oxidative stress influenced genomic stability, reflected in increased PARP activity and p53 expression. Decreases in Bcl-xL protein coupled with enhanced accumulation of cytochrome c in the cytosol accompanied elevated indexes of apoptotic and necrotic cell death. Significantly, SMN exposure reduced Dox hepatotoxicity and associated apoptotic and necrotic cell death. The effects of SMN on Dox were broad, including the ability to modulate changes in both Bcl-xL and p53 expression. In animals treated with SMN, tissue Bcl-xL expression exceeded control values after Dox treatment. Taken together, these results demonstrated that SMN (i) reduced, delayed onset, or prevented toxic effects of Dox which are typically associated with
Directory of Open Access Journals (Sweden)
Paramita Banerjee Sawant
Full Text Available Hypoxia is a global phenomenon affecting recruitment as well as the embryonic development of aquatic fauna. The present study depicts hypoxia induced disruption of the intrinsic pathway of programmed cell death (PCD, leading to embryonic malformation in the goldfish, Carrasius auratus. Constant hypoxia induced the early expression of pro-apoptotic/tumor suppressor p53 and concomitant expression of the cell death molecule, caspase-3, leading to high level of DNA damage and cell death in hypoxic embryos, as compared to normoxic ones. As a result, the former showed delayed 4 and 64 celled stages and a delay in appearance of epiboly stage. Expression of p53 efficiently switched off expression of the anti-apoptotic Bcl-2 during the initial 12 hours post fertilization (hpf and caused embryonic cell death. However, after 12 hours, simultaneous downregulation of p53 and Caspase-3 and exponential increase of Bcl-2, caused uncontrolled cell proliferation and prevented essential programmed cell death (PCD, ultimately resulting in significant (p<0.05 embryonic malformation up to 144 hpf. Evidences suggest that uncontrolled cell proliferation after 12 hpf may have been due to downregulation of p53 abundance, which in turn has an influence on upregulation of anti-apoptotic Bcl-2. Therefore, we have been able to show for the first time and propose that hypoxia induced downregulation of p53 beyond 12 hpf, disrupts PCD and leads to failure in normal differentiation, causing malformation in gold fish embryos.
Javid, J; Mir, R; Mirza, M; Imtiyaz, A; Prasant, Y; Mariyam, Z; Julka, P K; Mohan, A; Lone, M; Ray, P C; Saxena, A
2015-04-01
B cell lymphoma 2 (BCL-2) gene is a well-known regulator of apoptosis and a key element in cancer development and progression. A regulatory (-938C>A, rs2279115) single-nucleotide polymorphism in the inhibitory P2 BCL-2 gene promoter generates significantly different BCL-2 promoter activities and has been associated with different clinical outcomes in various malignancies. The aim of the present study was to analyze the possible influence of the (-938C>A) SNP on the risk and survival of Indian patients suffering from NSCLC. A hospital-based case-control study of 155 age- and sex-matched patients diagnosed with NSCLC and 155 cancer-free controls was conducted and genotyped by performing PIRA-PCR to elucidate the putative association between clinical outcome and genotypes of BCL-2 (-938C>A, rs2279115). The association of the polymorphism with the survival of NSCLC patients was analyzed by Kaplan-Meier curves. In Indian NSCLC, patients increased risk of developing NSCLC was found to be associated with BCL-2 (-938) CC genotype, [OR 3.68 (1.92-6.79), RR 1.87 (1.35-2.57) and RD 31.03 (16.79-45.27) p 0.00006 for CC and OR 2.08 (1.18-3.66), RR 1.36 (1.08-1.71) and RD 17.74 (4.68-30.81) p 0.01 for AC genotype]. Patients homozygous for C allele exhibited a significant poor overall survival compared with patients displaying AC + CC or AC or AA genotype [median survival (months) 8 vs. 11 vs. 14 vs. 35.5 (p A) polymorphism. Genetic polymorphism in the inhibitory P2 promoter region of anti-apoptotic BCL-2 genes contributes to the risk of developing non-small-cell lung cancer in Indian population. BCL-2 (-938CC) genotype was an independent adverse prognostic factor for patients with NSCLC.
Directory of Open Access Journals (Sweden)
Jeyran eShahbazi
2013-05-01
Full Text Available Tumor protein 53-induced nuclear protein 1 (TP53INP1 is a stress-induced p53 target gene whose expression is modulated by transcription factors such as p53, p73 and E2F1. TP53INP1 gene encodes two isoforms of TP53INP1 proteins, TP53INP1α and TP53INP1β, both of which appear to be key elements in p53 function. When associated with homeodomain-interacting protein kinase-2 (HIPK2, TP53INP1 phosphorylates p53 protein at Serine 46, enhances p53 protein stability and its transcriptional activity, leading to transcriptional activation of p53 target genes such as p21, PIG-3 and MDM2, cell growth arrest and apoptosis upon DNA damage stress. The anti-proliferative and pro-apoptotic activities of TP53INP1 indicate that TP53INP1 has an important role in cellular homeostasis and DNA damage response. Deficiency in TP53INP1 expression results in increased tumorigenesis; while TP53INP1 expression is repressed during early stages of cancer by factors such as miR-155. This review aims to summarize the roles of TP53INP1 in blocking tumor progression through p53-dependant and p53-independent pathways, as well as the elements which repress TP53INP1 expression, hence highlighting its potential as a therapeutic target in cancer treatment.
International Nuclear Information System (INIS)
Okaichi, Kumio; Wang Lihong; Sasaki, Ji-ichiro; Saya, Hideyuki; Tada, Mitsuhiro; Okumura, Yutaka
1999-01-01
Purpose: The 123A point mutation of p53 showed increased radiosensitivity, whereas other mutations (143A, 175H, and 273H) were not affected. To determine the reason for increased radiosensitivity of the 123A mutation, the response of the transformant of 123A mutation to ionizing radiation (IR) was examined and compared to those of transformants with the wild type p53 or other point mutations (143A, 175H, and 273H). Methods and Materials: Stable transformants with a mutant or wild type p53 made by introducing cDNA into the human osteosarcoma cell line, Saos-2, which lacks an endogenous p53 were used. The transcriptional activity of mutant p53 was examined using a yeast functional assay. The transformants were examined for the accumulation of p53, the induction of p21 Waf1/Cip1/Sdi1 (hereafter referred to as p21), and the other response of p53-responsive genes (MDM2, Bax, and Bcl-2) by Western blotting. Apoptosis was analyzed by detection of DNA fragmentation. Results: The 123A point mutation of p53 was detected as a wild type in the yeast functional assay. The 123A mutant accumulated p53 in response to IR. The 123A mutant did not induce p21, but normally responded to MDM2, Bax, and Bcl-2. The 123A mutant entered apoptosis earlier than the wild type p53 transformant, and induced Fas at earlier in response to IR. Conclusion: The 123A mutant led to apoptosis, but not p21 expression in response to IR. The occurrence of apoptosis, but not induction of p21, corresponded to the radiosensitivity in the transformant. The early occurrence of apoptosis in 123A transformants may depend on the early induction of Fas
Effect of Bcl11b genotypes and γ-radiation on the development of mouse thymic lymphomas
International Nuclear Information System (INIS)
Yoshikai, Yoshihiro; Sato, Toshihiro; Morita, Shinichi; Kohara, Yuki; Takagi, Ritsuo; Mishima, Yukio; Kominami, Ryo
2008-01-01
Bcl11b is a haploinsufficient tumor suppressor gene and expressed in many tissues such as thymus, brain and skin. Irradiated Bcl11b +/- heterozygous mice mostly develop thymic lymphomas, but the preference of Bcl11b inactivation for thymic lymphomas remains to be addressed. We produced Bcl11b +/- heterozygous and Bcl11b wild-type mice of p53 +/- background and compared their incidence of γ-ray induced thymic lymphomas. Majority of the tumors in p53 +/- mice were skin tumors, and only 5 (36%) of the 14 tumors were thymic lymphomas. In contrast, Bcl11b +/- p53 +/- doubly heterozygous mice developed thymic lymphomas at the frequency of 27 (79%) of the 34 tumors developed (P = 0.008). This indicates the preference of Bcl11b impairment for thymic lymphoma development. We also analyzed loss of the wild-type alleles in the 27 lymphomas, a predicted consequence given by γ-irradiation. However, the loss frequency was low, only six (22%) for Bcl11b and five (19%) for p53. The frequencies did not differ from those of spontaneously developed thymic lymphomas in the doubly heterozygous mice, though the latency of lymphoma development markedly differed between them. This suggests that the main contribution of irradiation at least in those mice is not for the tumor initiation by inducing allelic losses but probably for the promotion of thymic lymphoma development
International Nuclear Information System (INIS)
Yue-Hua Wang; De-jie Chen; Tie-Nan Yi
2010-01-01
To study the relationship between the infection of human papillomavirus (HPV) type 16, type 18, the expression of survivin, and the mutation of p53 gene in lung squamous carcinoma tissue for the research of pathogenesis of lung carcinoma.This study was carried out at the Laboratory of Molecular Biology, Xiangfan Central Hospital of Hubei Province, China from September 2008 to May 2010. Forty-five specimens of lung squamous carcinoma tissue confirmed by histopathology were the excisional specimens taken by the Thoracic Surgery of Xiangfan Central Hospital. Normal tissue, closely adjacent to the fresh carcinoma specimens, was used as the control group for p53 gene mutation analysis. Sixteen surgical excisional specimens of benign lung disease were used as a control group of non-carcinomatous diseases. Human papillomavirus DNA were detected by polymerase chain reaction (PCR), and we used the PCR-single-strand conformation polymorphism-ethidium bromide (PCR-SSCP-EB) method to detect the mutations of the p53 gene. The expression of the survivin gene was detected by immunohistochemistry methods. Approximately 68.9% of 45 lung squamous carcinoma tissue had p53 gene mutations. The mutation rate of exon 5-8 p53 were 15.6%, 17.8%, 15.6% and 20%. Approximately 42.2% of lung squamous cell carcinoma samples were shown to be positive for HPV DNA expression and 62.2% were positive for survivin expression. There was an inverse correlation between the presence of HPV infections and mutations of p53 gene; and the mutations of p53 gene and expression of survivin had a positive relationship. Mutation of p53 gene and HPV infection may facilitate each other in the generation of lung squamous cell carcinoma. Abnormal expression of the survivin gene may take part in the onset and progression of lung squamous cell carcinoma (Author).
THE EXPRESSION AND CLINICAL VALUE OF APOPTOSIS CONTROL GENE Bcl-2 AND Bax IN BREAST CANCER
Institute of Scientific and Technical Information of China (English)
ZHENG Jun; YAO Zhen-xiang; ZHANG Jing
1999-01-01
Objective: To study the expression and clinical value of apoptosis control gene bcl-2 and bax in breast cancer.Methods: Protein bax and bcl-2 in 41 breast cancers obtained from operations in our hospital in 1996 were detected using ABC immunohistochemical stain assay and compared with 10 cases with normal breast tissues.Results: The positive rate of bax in normal breast tissue was 90% and in breast cancer was 59%, with a significant statistical difference between them (P<0.05), but there was no statistical difference in bcl-2 protein expression. Among the 41 breast cancer, the group with lymph node metastasis (21 cases) had obviously low bax expression (43%) and high bcl-2 expression (76%), showing significant difference to the group without lymph node metastasis (P<0.05).Conclusion: The antiapoptosis function of bcl-2 was stronger than bax in breast cancer. Protein bax and bcl-2 assay may be useful in understanding the biological behaviors of breast cancer.
Directory of Open Access Journals (Sweden)
Michaela Waibel
2013-11-01
Full Text Available To design rational therapies for JAK2-driven hematological malignancies, we functionally dissected the key survival pathways downstream of hyperactive JAK2. In tumors driven by mutant JAK2, Stat1, Stat3, Stat5, and the Pi3k and Mek/Erk pathways were constitutively active, and gene expression profiling of TEL-JAK2 T-ALL cells revealed the upregulation of prosurvival Bcl-2 family genes. Combining the Bcl-2/Bcl-xL inhibitor ABT-737 with JAK2 inhibitors mediated prolonged disease regressions and cures in mice bearing primary human and mouse JAK2 mutant tumors. Moreover, combined targeting of JAK2 and Bcl-2/Bcl-xL was able to circumvent and overcome acquired resistance to single-agent JAK2 inhibitor treatment. Thus, inhibiting the oncogenic JAK2 signaling network at two nodal points, at the initiating stage (JAK2 and the effector stage (Bcl-2/Bcl-xL, is highly effective and provides a clearly superior therapeutic benefit than targeting just one node. Therefore, we have defined a potentially curative treatment for hematological malignancies expressing constitutively active JAK2.
International Nuclear Information System (INIS)
Tierney, L.A.; Hahn, F.F.; Lechner, J.F.
1996-01-01
Inhalation of high-linear energy transfer radiation in the form of radon progeny is a suspected cause of human lung cancer. To gain insight into the types of genetic derangements caused by this type of radiation, lung tumors from beagle dogs exposed to 239 PuO 2 and those arising in animals with no known carcinogen exposure were examined for evidence of aberrations in genes known to be altered in lung tumors. Altered expression of the p53 tumor suppressor gene and proto-oncogene erbB-2 proteins (p185 erbB2 ) was evaluated by immunohistochemical analysis of 117 tumors representing different histological types in exposed (n = 80) and unexposed (n = 37) animals. Twenty-eight tumors were analyzed for K-ras proto-oncogene mutations by polymerase chain reaction amplification and direct sequencing. Fourteen percent (16/116) of all lung neoplasms showed elevated nuclear accumulation of p53 protein. Regardless of exposure history, adenosquamous and squamous cell cancers comprised 94% of all tumors with p53 abnormalities. Eighteen percent (21/117) of all tumors had evidence of erbB-2 protein overexpression. K-ras mutations were not detected in codons 12, 13 or 61 of tumors from unexposed (n = 9) or plutonium-exposed dogs (n = 19). These data indicate that p53 and K-ras gene abnormalities as a result of missense mutation are infrequent events in spontaneous and 239 PuO 2 -induced lung neoplasia in this colony of beagle dogs. Alternative mechanisms of gene alteration may be involved in canine pulmonary carcinogenesis. 45 refs., 3 figs., 2 tabs
Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice; Kramer, Daniela; Najafova, Zeynab; Weiss, Miriam; Karpiuk, Oleksandra; Kassem, Moustapha; Zhang, Yanping; Lozano, Guillermina; Johnsen, Steven A; Moll, Ute M; Zhang, Xin; Dobbelstein, Matthias
2016-01-07
The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell proliferation. In conclusion, MDM2 supports the Polycomb-mediated repression of lineage-specific genes, independent of p53. Copyright © 2016 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Logsdon, Mark D.; Meyn, Raymond E.; Besa, Pelayo C.; Pugh, William C.; Stephens, L. Clifton; Peters, Lester J.; Milas, Luka; Cox, James D.; Cabanillas, Fernando; Brisbay, Shawn; Andersen, Margret; McDonnell, Timothy J.
1999-01-01
Purpose: The prognostic significance of spontaneous levels of apoptosis and Bcl-2, Bax, and Bcl-x protein expression in follicular center lymphoma (FCL) is unknown. The objectives of this retrospective study were (1) to investigate the relationship between pretreatment apoptosis levels and long-term treatment outcome in patients with Stage I and II FCL; (2) to define the incidence and patterns of Bax and Bcl-x protein expression in human FC; and (3) to determine the relationship of Bcl-2, Bax, and Bcl-x expression with spontaneous apoptosis levels and clinical outcome in localized FCL. Methods and Materials: Between 1974 and 1988, 144 patients with Stage I or II FCL were treated. Hematoxylin and eosin (H and E) stained tissue sections of pretreatment specimens were retrieved for 96 patients. Treatment consisted of regional radiation therapy (XRT) for 25 patients, combined modality therapy (CMT) consisting of combination chemotherapy and XRT for 57 patients, and other treatments for 14 patients. Median follow-up for living patients was nearly 12 years. The apoptotic index (AI) was calculated by dividing the number of apoptotic cells by the total number of cells counted and multiplying by 100. Expression of Bcl-2, Bax, and Bcl-x proteins was assessed using immunohistochemistry. Results: The mean and median AI values for the entire group were 0.53 and 0.4, respectively (range: 0-5.2). The AI strongly correlated with cytologic grade, with mean AI values of 0.25 for grade 1, 0.56 for grade 2, and 0.84 for grade 3 (p < 0.0005; Kendall correlation). A positive correlation was present between grouped AI and grouped mitotic index (MI) (p = 0.014). For patients treated with CMT, an AI < 0.4 correlated with improved freedom from relapse (FFR) (p = 0.0145) and overall survival (OS) (p = 0.0081). An AI < 0.4 did not correlate with clinical outcome for the entire cohort or for patients receiving XRT only. Staining of tumor follicles for the Bcl-2 protein was positive, variable
Expression of p53, MDM2 in a mice hydradecarcinoma model induced by γ-ray irradiation
International Nuclear Information System (INIS)
Huang Yuecheng; Cai Jianming; Han Ling; Gao Fu; Sun Ding; Dong Zhitao; Zhe Wanli
2004-01-01
Objective: To investigate the role of the p53, MDM2 in carcinogenesis of mice hydradecarcinoma induced by γ-rays. Methods: A radiation-induced mice hydradecarcinoma model was established by γ-ray irradiation. Expression of MDM2 protein in hydradecarcinoma tissue, paracancerous tissue and normal control tissue was detected with Western blot. Immunoprecipitation (IP) was conducted to examine the phosphorylation level of MDM2 protein. PCR-SSCP was performed to detect p53 gene mutation. Results: Compared with the normal control tissue, the MDM2 protein expression and its phosphorylation level were significantly higher in hydradecarcinoma tissue. SSCP showed there were p53 gene mutations in hydradecarcinoma samples. Conclusion: p53/MDM2 pathway may be involved in the development and progression of hydradecarcinoma induced by γ-ray irradiation. The over-expression of MDM2 and hyperphosphorylation may be responsible for malignant transformation induced by irradiation by a possible mechanism of p53 inactivation. The gene mutation of p53 further supported the hypothesis that p53/MDM2 pathway played a central role in carcinogenesis of γray induced hydradecarcinoma. (authors)
Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G
2000-03-01
Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.
Infrequent alterations of the P53 gene in rat skin cancers induced by ionising-radiation
International Nuclear Information System (INIS)
Jin, Y.; Burns, F.J.; Garte, S.J.; Hosselet, S.; New York Univ., NY
1996-01-01
Radiation carcinogenesis almost certainly involves multiple genetic alterations. Identification of such genetic alterations would provide information to help understand better the molecular mechanism or radiation carcinogenesis. The energy released by ionizing radiation has the potential to produce DNA strand breaks, major gene deletions or rearrangements, and other base damages. Alterations of the p53 gene, a common tumour suppressor gene altered in human cancers, were examined in radiation-induced rat skin cancers. Genomic DNA from a total of 33rat skin cancers induced by ionizing radiation was examined by Southern blot hybridization for abnormal restriction fragment patterns in the p53 gene. A abnormal p53 restriction pattern was found in one of 16 cancers induced by electron radiation and in one of nine cancers induced by neon ions. The genomic DNA from representative cancers, including the two with an abnormal restriction pattern was further examined by polymerase chain reaction amplification and direct sequencing in exons 5-8 of the p53 gene. The results showed that one restriction fragment length polymorphism (RFLP)-positive cancer induced by electron radiation had a partial gene deletion which was defined approximately between exons 2-8, while none of the other cancers showed sequence changes. Our results indicate that the alterations in the critical binding region of the p53 gene are infrequent in rat skin cancers induced by either electron or neon ion radiation. (Author)
Directory of Open Access Journals (Sweden)
Agnes C. Fett-Conte
2002-04-01
Full Text Available Existem várias razões que justificam o título de "guardião do genoma" do gene P53. Seu envolvimento, direto ou indireto, tem sido observado na etiopatogenia de praticamente todas as neoplasias humanas, incluindo as leucemias e linfomas. Conhecer seus mecanismos de ação é fundamental para compreender os aspectos moleculares da carcinogênese. O presente trabalho apresenta uma revisão sobre as características deste gene e sua importância no diagnóstico, prognóstico e terapêutica, o que faz dele um alvo em potencial das estratégias de terapia gênica.There are several reasons which justify the name of 'guardian of the genome' given to the P53 gene. Its involvement either directly or indirectly has been observed in the pathology of practically all human neoplasias, including leukemia and lymphomas. Knowledge of its mechanisms of action is fundamental to understand molecular aspects of carcinogenesis. This work presents a revision of the characteristics of this gene and its importance in the diagnosis, prognosis and treatment and why this makes it a potential target for gene therapy strategies.
A systematic review of p53 regulation of oxidative stress in skeletal muscle.
Beyfuss, Kaitlyn; Hood, David A
2018-12-01
transcription factor 4; ATM: ATM serine/threonine kinase; Bax: BCL2 associated X, apoptosis regulator; Bcl-2: B cell Leukemia/Lymphoma 2 apoptosis regulator; Bhlhe40: basic helix-loop-helix family member e40; BH3: Borane; Bim: bcl-2 interacting mediator of cell death; Bok: Bcl-2 related ovarian killer; COX-IV: cytochrome c oxidase IV; cGMP: Cyclic guanosine monophosphate; c-myc: proto-oncogene protein; Cpt1b: carnitine palmitoyltransferase 1B; Dr5: death receptor 5; eNOS: endothelial nitric oxide synthase; ERK: extracellular regulated MAP kinase; Fas: Fas Cell surface death receptor; FDXR: Ferredoxin Reductase; FOXO3a: forkhead box O3; Gadd45a: growth arrest and DNA damage-inducible 45 alpha; GLS2: glutaminase 2; GLUT 1 and 4: glucose transporter 1(endothelial) and 4 (skeletal muscle); GSH: Glutathione; Hes1: hes family bHLH transcription factor 1; Hey1: hes related family bHLH transcription factor with YRPW motif 1; HIFI-α: hypoxia-inducible factor 1, α-subunit; HK2: Hexokinase 2; HSP70: Heat Shock Protein 70; H 2 O 2 : Hydrogen Peroxide; Id2: inhibitor of DNA-binding 2; IGF-1-BP3: Insulin-like growth factor binding protein 3; IL-1β: Interleukin 1 beta; iNOS: inducible nitric oxide synthase; IRS-1: Insulin receptor substrate 1; JNK: c-Jun N-terminal kinases; LY-83583: 6-anilino-5,8-quinolinedione; inhibitor of soluble guanylate cyclase and of cGMP production; Mdm 2/ 4: Mouse double minute 2 homolog (mouse) Mdm4 (humans); mtDNA: mitochondrial DNA; MURF1: Muscle RING-finger protein-1; MyoD: Myogenic differentiation 1; MyoG: myogenin; Nanog: Nanog homeobox; NF-kB: Nuclear factor-κB; NO: nitric oxide; NoxA: phorbol-12-myristate-13-acetate-induced protein 1 (Pmaip1); NRF-1: nuclear respiratory factor 1; Nrf2: Nuclear factor erythroid 2-related factor 2; P21: Cdkn1a cyclin-dependent kinase inhibitor 1A (P21); P38 MAPK: mitogen-activated protein kinases; p53R2: p53 inducible ribonucleotide reductase gene; P66Shc: src homology 2 domain-containing transforming protein C1; PERP: p
International Nuclear Information System (INIS)
Peng Ruiyun; Wang Dewen; Xiong Chengqi; Gao Yabing; Yang Hong; Cui Yufang; Wang Baozhen
2001-01-01
Objective: To study apoptosis and expressions bcl-2 and p53 in irradiated mouse bone marrow. Methods: LACA mice were irradiated with 60 Co γ-rays. By means of in situ terminal labelling, in situ hybridization and image analysis, the authors studied radiation-induced apoptosis of hematopoietic cells and the expressions of bcl-2 and p53. Results: The characteristics of apoptosis appeared in hematopoietic cells at 6 hrs after irradiation. The expression of bcl-2 was obviously decreased when apoptosis of hematopoietic cells occurred, whereas it increased in the early recovery phase; p53 protein increased during both apoptosis of hematopoietic cells and the recovery phase, and mutant type p53 DNA was positive only in the recovery phase. Conclusion: Radiation may induced apoptosis of hematopoietic cells in a dose-dependent manner; Both bcl-2 and p53 genes play an important role in apoptosis and recovery phase
Polymorphism at codon 36 of the p53 gene.
Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A
1994-01-01
A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.
Enhanced p53 gene transfer to human ovarian cancer cells using the cationic nonviral vector, DDC.
Kim, Chong-Kook; Choi, Eun-Jeong; Choi, Sung-Hee; Park, Jeong-Sook; Haider, Khawaja Hasnain; Ahn, Woong Shick
2003-08-01
Previously we have formulated a new cationic liposome, DDC, composed of dioleoyltrimethylamino propane (DOTAP), 1,2-dioeoyl-3-phosphophatidylethanolamine (DOPE), and cholesterol (Chol), and it efficiently delivered plasmid DNA into ovarian cancer cells. Mutations in the p53 tumor suppressor gene are the most common molecular genetic abnormalities to be described in ovarian cancer. However, there has been so far no report of nonviral vector-mediated p53 gene deliveries in ovarian cancer. In this study, wild-type p53 DNA was transfected into the ovarian cancer cells, using the DDC as a nonviral vector and the expression and activity of p53 gene were evaluated both in vitro and in vivo. DDC liposomes were prepared by mixing DOTAP:DOPE:Chol in a 1:0.7:0.3 molar ratio using the extrusion method. Plasmid DNA (pp53-EGFP) and DDC complexes were transfected into ovarian carcinoma cells (OVCAR-3 cells) and gene expression was determined by reverse transcription-polymerase chain reaction and Western blot analysis. The cellular growth inhibition and apoptosis of DDC-mediated p53 transfection were assessed by trypan blue exclusion assay and annexin-V staining, respectively. The OVCAR-3 cells treated with DDC/pp53-EGFP complexes were inoculated into female balb/c nude mice and tumor growth was observed. The transfection of liposome-complexed p53 gene resulted in a high level of wild-type p53 mRNA and protein expressions in OVCAR-3 cells. In vitro cell growth assay showed growth inhibition of cancer cells transfected with DDC/pp53-EGFP complexes compared with the control cells. The reestablishment of wild-type p53 function in ovarian cancer cells restored the apoptotic pathway. Following the inoculation of DDC/pp53-EGFP complexes, the volumes of tumors in nude mice were significantly reduced more than 60% compared to the control group. The DDC-mediated p53 DNA delivery may have the potential for clinical application as nonviral vector-mediated ovarian cancer therapy due to its
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-07-15
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-01-01
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137
CP-31398 prevents the growth of p53-mutated colorectal cancer cells in vitro and in vivo.
He, Xingxing; Kong, Xinjuan; Yan, Junwei; Yan, Jingjun; Zhang, Yunan; Wu, Qian; Chang, Ying; Shang, Haitao; Dou, Qian; Song, Yuhu; Liu, Fang
2015-03-01
Rescuing the function of mutant p53 protein is an attractive cancer therapeutic strategy. Small molecule CP-31398 was shown to restore mutant p53 tumor suppressor functions in cancer cells. Here, we determined the effects of CP-31398 on the growth of p53-mutated colorectal cancer (CRC) cells in vitro and in vivo. CRC cells which carry p53 mutation in codon 273 were treated with CP-31398 and the control, and the effects of CP-31398 on cell cycle, cell apoptosis, and proliferation were determined. The expression of p53-responsive downstream genes was evaluated by quantitative reverse transcriptase PCR (RT-PCR) and Western blot. CP-31398 was administrated into xenograft tumors created by the inoculation of HT-29 cells, and then the effect of CP-31398 on the growth of xenograft tumors was examined. CP-31398 induced p53 downstream target molecules in cultured HT-29 cells, which resulted in the inhibition of CRC cell growth assessed by the determination of cell cycle, apoptosis, and cell proliferation. In xenograft tumors, CP-31398 modulated the expression of Bax, Bcl-2, caspase 3, cyclin D, and Mdm2 and then blocked the growth of xenograft tumors. CP-31398 would be developed as a therapeutic candidate for p53-mutated CRC due to the restoration of mutant p53 tumor suppressor functions.
Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda
International Nuclear Information System (INIS)
Mohareer, Krishnaveni; Sahdev, Sudhir; Hasnain, Seyed E.
2011-01-01
Highlights: ► Baculovirus p35 is regulated by both viral and host factors. ► Baculovirus p35 is negatively regulated by SfP53-like factor. ► Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at −1401 while P53 motif is at −1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.
Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda
Energy Technology Data Exchange (ETDEWEB)
Mohareer, Krishnaveni [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Sahdev, Sudhir [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Ranbaxy Pharmaceuticals, Gurgaon, New Delhi (India); Hasnain, Seyed E., E-mail: seh@bioschool.iitd.ac.in [Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Kusuma School of Biological Sciences, IIT Delhi, New Delhi 110016 (India); ILBS, Vasant Kunj, New Delhi (India); King Saud University, Riyadh, KSA (Saudi Arabia)
2011-11-04
Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.
DEFF Research Database (Denmark)
Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice
2016-01-01
The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion...... in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically...... associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell...
International Nuclear Information System (INIS)
Vodusek, Ana Lina; Novakovic, Srdjan; Stegel, Vida; Jereb, Berta
2011-01-01
Some tumour suppressor genes (BRCA2) and mismatch repair genes (MSH2, MLH1) are correlated with an increased risk for male breast cancer. Our patient developed secondary breast cancer after the treatment for Hodgkin’s disease in childhood. DNA was isolated from the patients’ blood and screened for mutations, polymorphisms and variants in BRCA1, BRCA2, p53, CDKN2A, MLH1 and MSH2 genes. We found no mutations but common polymorphisms, and three variants in mismatch repair genes. Nucleotide variants c.2006-6T>C and p.G322D in MSH2 might be correlated with male breast cancer
2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.
Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R
2016-09-06
The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.
Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki
2012-01-20
The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.
Tabata, Rie; Yasumizu, Ryoji; Tabata, Chiharu; Kojima, Masaru
2013-01-01
Here, we report a rare case of double-hit lymphoma, demonstrating t(6;14;18)(p25;q32;q21), suggesting two independent dual-translocations, c-MYC/BCL-2 and IRF4/BCL-2. The present case had a rare abnormal chromosome, t(6;14;18)(p25;q32;q21), independently, in addition to known dual-hit chromosomal abnormalities, t(14;18)(q32;q21) and t(8;22)(q24;q11.2). Lymph node was characterized by a follicular and diffuse growth pattern with variously sized neoplastic follicles. The intrafollicular area was composed of centrocytes with a few centroblasts and the interfollicular area was occupied by uniformly spread medium- to large-sized lymphocytes. CD23 immunostaining demonstrated a disrupted follicular dendritic cell meshwork. The intrafollicular tumor cells had a germinal center phenotype with the expression of surface IgM, CD10, Bcl-2, Bcl-6, and MUM1/IRF4. However, the interfollicular larger cells showed plasmacytic differentiation with diminished CD20, Bcl-2, Bcl-6, and positive intracytoplasmic IgM, and co-expression of MUM1/IRF4 and CD138 with increased Ki-67-positive cells (> 90%). MUM1/IRF4 has been found to induce c-MYC expression, and in turn, MYC transactivates MUM1/IRF4, creating a positive autoregulatory feedback loop. On the other hand, MUM1/IRF4 functions as a tumor suppressor in c-MYC-induced B-cell leukemia. The present rare case arouses interest in view of the possible "dual" activation of both c-MYC and MUM1/IRF4 through two independent dual-translocations, c-MYC/BCL-2 and IRF4/BCL-2.
Directory of Open Access Journals (Sweden)
Marie Lue Antony
Full Text Available Benzyl isothiocyanate (BITC, a constituent of edible cruciferous vegetables, decreases viability of cancer cells by causing apoptosis but the mechanism of cell death is not fully understood. The present study was undertaken to determine the role of Bcl-2 family proteins in BITC-induced apoptosis using MDA-MB-231 (breast, MCF-7 (breast, and HCT-116 (colon human cancer cells. The B-cell lymphoma 2 interacting mediator of cell death (Bim protein was dispensable for proapoptotic response to BITC in MCF-7 and MDA-MB-231 cells as judged by RNA interference studies. Instead, the BITC-treated MCF-7 and MDA-MB-231 cells exhibited upregulation of p53 upregulated modulator of apoptosis (PUMA protein. The BITC-mediated induction of PUMA was relatively more pronounced in MCF-7 cells due to the presence of wild-type p53 compared with MDA-MB-231 with mutant p53. The BITC-induced apoptosis was partially but significantly attenuated by RNA interference of PUMA in MCF-7 cells. The PUMA knockout variant of HCT-116 cells exhibited significant resistance towards BITC-induced apoptosis compared with wild-type HCT-116 cells. Attenuation of BITC-induced apoptosis in PUMA knockout HCT-116 cells was accompanied by enhanced G2/M phase cell cycle arrest due to induction of p21 and down regulation of cyclin-dependent kinase 1 protein. The BITC treatment caused a decrease in protein levels of Bcl-xL (MCF-7 and MDA-MB-231 cells and Bcl-2 (MCF-7 cells. Ectopic expression of Bcl-xL in MCF-7 and MDA-MB-231 cells and that of Bcl-2 in MCF-7 cells conferred protection against proapoptotic response to BITC. Interestingly, the BITC-treated MDA-MB-231 cells exhibited induction of Bcl-2 protein expression, and RNA interference of Bcl-2 in this cell line resulted in augmentation of BITC-induced apoptosis. The BITC-mediated inhibition of MDA-MB-231 xenograft growth in vivo was associated with the induction of PUMA protein in the tumor. In conclusion, the results of the present study
Wang, Xiaoyuan; Liow, Sing Shy; Wu, Qiaoqiong; Li, Chuang; Owh, Cally; Li, Zibiao; Loh, Xian Jun; Wu, Yun-Long
2017-11-01
Antiapoptotic Bcl-2 protein's upregulated expression is a key reason for drug resistance leading to failure of chemotherapy. In this report, a series of biocompatible amphiphilic cationic poly[(R)-3-hydroxybutyrate] (PHB)-b-poly(2-(dimethylamino)ethyl methacrylate) (PDMAEMA) copolymer, comprising hydrophobic PHB block and cationic PDMAEMA block, is designed to codeliver hydrophobic chemotherapeutic paclitaxel and Bcl-2 converting gene Nur77/ΔDBD with enhanced stability, due to the micelle formation by hydrophobic PHB segment. This copolymer shows less toxicity but similar gene transfection efficiency to polyethyenimine (25k). More importantly, this codelivery approach by PHB-PDMAEMA leads to increased drug resistant HepG2/Bcl-2 cancer cell death, by increased expression of Nur77 proteins in the Bcl-2 present intracellular mitochondria. This work signifies for the first time that cationic amphiphilic PHB-b-PDMAEMA copolymers can be utilized for the drug and gene codelivery to drug resistant cancer cells with high expression of antiapoptosis Bcl-2 protein and the positive results are encouraging for the further design of codelivery platforms for combating drug resistant cancer cells. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Seki, Masafumi; Iwakawa, Jun; Cheng, Helen; Cheng, Pi-Wan
2002-04-10
We previously reported that supplementation of a cationic liposome with transferrin (Tf) greatly enhanced lipofection efficiency (P.-W. Cheng, Hum. Gene Ther. 1996;7:275-282). In this study, we examined the efficacy of p53 and PTEN tumor suppressor gene therapy in a mouse xenograft model of human prostate PC-3 carcinoma cells, using a vector consisting of dimyristoyloxypropyl-3-dimethylhydroxyethyl ammonium bromide (DMRIE)-cholesterol (DC) and Tf. When the volume of the tumors grown subcutaneously in athymic nude mice reached 50-60 mm(3), three intratumoral injections of the following four formulations were performed during week 1 and then during week 3: (1) saline, (2) DC + Tf + pCMVlacZ, (3) DC + Tf + pCMVPTEN, and (4) DC + Tf + pCMVp53 (standard formulation). There was no significant difference in tumor volume and survival between group 1 and group 2 animals. As compared with group 1 controls, group 3 animals had slower tumor growth during the first 3 weeks but thereafter their tumor growth rate was similar to that of the controls. By day 2 posttreatment, group 4 animals had significantly lower tumor volume relative to initial tumor volume as well as controls at the comparable time point. Also, animals treated with p53 survived longer. Treatment with DC, Tf, pCMVp53, DC + pCMVp53, or Tf + pCMVp53 had no effect on tumor volume or survival. Expression of p53 protein and apoptosis were detected in tumors treated with the standard formulation, thus associating p53 protein expression and apoptosis with efficacy. However, p53 protein was expressed in only a fraction of the tumor cells, suggesting a role for bystander effects in the efficacy of p53 gene therapy. We conclude that intratumoral gene delivery by a nonviral vector consisting of a cationic liposome and Tf can achieve efficacious p53 gene therapy of prostate cancer.
International Nuclear Information System (INIS)
Ohnishi, T.; Asakawa, I.; Tamamoto, T.; Takahashi, A.; Ohnishi, K.
2003-01-01
The mutations of many kinds of cancer related genes have been investigated for the predictive assay against cancer therapy by the application of molecular biology. A tumor suppressor gene product of wtp53 plays important roles in cancer suppression through the induction of cell growth arrest, DNA repair or apoptosis. The p53 exerts its function by induction of downstream genes and/or interaction to various proteins. Mutations in the p53 gene (mp53) cause conformational alterations in the p53 protein, the majority of which can no longer induce expression of the downstream genes. The genetic status of p53 gene has been focused as the most important candidate among them for cancer therapy. The gene therapy of p53 has been already applied. We reported that the transfection of mp53 gene increased the radio-, thermo- and chemo-resistance, and depressed apoptosis introduced with them through bax-induction and proteolysis of PARP and caspase-3. From these results, we propose that the gene therapy of wtp53 to p53-deleted cancer cells may be very useful for cancer therapy by the combination with radiotherapy. Even in the case of mp53 cancer cells, we succeeded the restoration of mp53 to wtp53 by glycerol or C-terminal peptide of p53 as chemical chaperones. These experimental progresses might support effective cancer therapy against individual patients bearing with different p53 gene status by the use of the most suitable treatment to them in the near future
Dual targeting of MDM2 and BCL2 as a therapeutic strategy in neuroblastoma.
Van Goethem, Alan; Yigit, Nurten; Moreno-Smith, Myrthala; Vasudevan, Sanjeev A; Barbieri, Eveline; Speleman, Frank; Shohet, Jason; Vandesompele, Jo; Van Maerken, Tom
2017-08-22
Wild-type p53 tumor suppressor activity in neuroblastoma tumors is hampered by increased MDM2 activity, making selective MDM2 antagonists an attractive therapeutic strategy for this childhood malignancy. Since monotherapy in cancer is generally not providing long-lasting clinical responses, we here aimed to identify small molecule drugs that synergize with idasanutlin (RG7388). To this purpose we evaluated 15 targeted drugs in combination with idasanutlin in three p53 wild type neuroblastoma cell lines and identified the BCL2 inhibitor venetoclax (ABT-199) as a promising interaction partner. The venetoclax/idasanutlin combination was consistently found to be highly synergistic in a diverse panel of neuroblastoma cell lines, including cells with high MCL1 expression levels. A more pronounced induction of apoptosis was found to underlie the synergistic interaction, as evidenced by caspase-3/7 and cleaved PARP measurements. Mice carrying orthotopic xenografts of neuroblastoma cells treated with both idasanutlin and venetoclax had drastically lower tumor weights than mice treated with either treatment alone. In conclusion, these data strongly support the further evaluation of dual BCL2/MDM2 targeting as a therapeutic strategy in neuroblastoma.
Zerumbone induced apoptosis in liver cancer cells via modulation of Bax/Bcl-2 ratio
Directory of Open Access Journals (Sweden)
Azimahtol Hawariah LP
2007-04-01
Full Text Available Abstract Background Zerumbone is a cytotoxic component isolated from Zingiber zerumbet Smith, a herbal plant which is also known as lempoyang. This new anticancer bioactive compound from Z. zerumbet was investigated for its activity and mechanism in human liver cancer cell lines. Results Zerumbone significantly showed an antiproliferative activity upon HepG2 cells with an IC50 of 3.45 ± 0.026 μg/ml. Zerumbone was also found to inhibit the proliferation of non-malignant Chang Liver and MDBK cell lines. However the IC50 obtained was higher compared to the IC50 for HepG2 cells (> 10 μg/ml. The extent of DNA fragmentation was evaluated by the Tdt-mediated dUTP nick end labelling assay which showed that, zerumbone significantly increased apoptosis in HepG2 cells in a time-course manner. In detail, the apoptotic process triggered by zerumbone involved the up-regulation of pro-apoptotic Bax protein and the suppression of anti-apoptotic Bcl-2 protein expression. The changes that occurred in the levels of this antagonistic proteins Bax/Bcl-2, was independent of p53 since zerumbone did not affect the levels of p53 although this protein exists in a functional form. Western blotting analysis for Bax protein was further confirmed qualitatively with an immunoassay that showed the distribution of Bax protein in zerumbone-treated cells. Conclusion Therefore, zerumbone was found to induce the apoptotic process in HepG2 cells through the up and down regulation of Bax/Bcl-2 protein independently of functional p53 activity.
Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53
International Nuclear Information System (INIS)
Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi
2001-01-01
Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)
Directory of Open Access Journals (Sweden)
Hayder M. Al-kuraishy
2018-01-01
Full Text Available The p53 gene is also known as tumor suppressor p53. The main functions of the p53 gene are an anticancer effect and cellular genomic stability via various pathways including activation of DNA repair, induction of apoptosis, and arresting of cell growth at the G1/S phase. Normally, the p53 gene is inactivated by mouse double minute 2 proteins (mdm2, but it is activated in chronic myeloid leukemia (CML. Tyrosine kinase inhibitors are effective chemotherapeutic agents in the management of CML. The purpose of the present study was to evaluate the differential effect of imatinib and nilotinib on p53 gene serum levels in patients with CML. A total number of 60 patients with chronic myeloid leukemia with ages ranging from 47 to 59 years were recruited from the Iraqi Hematology Center. They started with tyrosine kinase inhibitors as first-line chemotherapy. They were divided into two groups—Group A, 29 patients treated with imatinib and Group B, 31 patients treated with nilotinib—and compared with 28 healthy subjects for evaluation p53 serum levels regarding the selective effect of either imatinib or nilotinib. There were significantly (p < 0.01 high p53 gene serum levels in patients with CML (2.135 ± 1.44 ng/mL compared to the control (0.142 ± 0.11 ng/mL. Patients with CML that were treated with either imatinib or nilotinib showed insignificant differences in most of the hematological profile (p > 0.05 whereas, p53 serum levels were high (3.22 ± 1.99 ng/mL in nilotinib-treated patients and relatively low (1.18 ± 0.19 ng/mL in imatinib-treated patients (p = 0.0001. Conclusions: Nilotinib is more effective than imatinib in raising p53 serum levels in patients with chronic myeloid leukemia.
Alterations in tumour suppressor gene p53 in human gliomas from ...
Indian Academy of Sciences (India)
Unknown
Alterations in the tumour suppressor p53 gene are among the most common defects seen in a variety of human cancers. ..... rangement of the EGF receptor gene in primary human brain tumors ... the INK4A gene in superficial bladder tumors.
p21(Waf1/Cip1) expression and the p53/MDM2 feedback loop in gastric carcinogenesis
Craanen, M. E.; Blok, P.; Offerhaus, G. J.; Meijer, G. A.; Dekker, W.; Kuipers, E. J.; Meuwissen, S. G.
1999-01-01
Data are non-existent regarding coincidental alterations in the expression of p53 and its downstream target genes MDM2 and p21(Waf1/Cip1) in gastric carcinogenesis. An immunohistochemical study was therefore performed to examine the interrelationships of p53, MDM2, and p21(Waf1/Cip1) expression in a
Bcl-2 Protein Expression in Egyptian Acute Myeloid Leukemia
International Nuclear Information System (INIS)
El-Shakankiry, N.; El-Sayed, Gh.M.M.; El-Maghraby, Sh.; Moneer, M.M.
2009-01-01
Objective: The primary cause of treatment failure in acute myeloid leukemia (AML) is the emergence of both resistant disease and early relapse. The bcl-2 gene encodes a 26-kDa protein that promotes cell survival by blocking programmed cell death (apoptosis). In the present study, bcl-2 protein expression was evaluated in newly diagnosed AML patients and correlated with the induction of remission and overall survival (OS), in an attempt to define patients who might benefit from modified therapeutic strategies. Patients and methods: Pretreatment cellular bcl-2 protein expression was measured in bone marrow samples obtained from 68 patients of newly diagnosed acute myeloid leukemia and 10 healthy controls by western blotting. Results: The mean bcl-2 protein expression was significantly higher in patients (0.68610.592) compared to controls (0.313±0.016) (p=0.002). The overall survival for patients with mean bcl-2 expression of less, and more than or equal to 0.315, was 67% and 56%, respectively, with no significant difference between the two groups 0»=0.86). Conclusion: Even though we did not observe a significant difference in overall survival between patients with high and low levels of bcl-2, modulation of this protein might still be considered as an option for enhancing the effectiveness of conventional chemotherapy.
Stress-specific response of the p53-Mdm2 feedback loop
Directory of Open Access Journals (Sweden)
Jensen Mogens H
2010-07-01
Full Text Available Abstract Background The p53 signalling pathway has hundreds of inputs and outputs. It can trigger cellular senescence, cell-cycle arrest and apoptosis in response to diverse stress conditions, including DNA damage, hypoxia and nutrient deprivation. Signals from all these inputs are channeled through a single node, the transcription factor p53. Yet, the pathway is flexible enough to produce different downstream gene expression patterns in response to different stresses. Results We construct a mathematical model of the negative feedback loop involving p53 and its inhibitor, Mdm2, at the core of this pathway, and use it to examine the effect of different stresses that trigger p53. In response to DNA damage, hypoxia, etc., the model exhibits a wide variety of specific output behaviour - steady states with low or high levels of p53 and Mdm2, as well as spiky oscillations with low or high average p53 levels. Conclusions We show that even a simple negative feedback loop is capable of exhibiting the kind of flexible stress-specific response observed in the p53 system. Further, our model provides a framework for predicting the differences in p53 response to different stresses and single nucleotide polymorphisms.
Surmiak, Ewa; Twarda-Clapa, Aleksandra; Zak, Krzysztof M.; Musielak, Bogdan; Tomala, Marcin D.; Kubica, Katarzyna; Grudnik, Przemyslaw; Madej, Mariusz; Jablonski, Mateusz; Potempa, Jan; Kalinowska-Tluscik, Justyna; Dömling, Alexander; Dubin, Grzegorz; Holak, Tad A.
2016-01-01
The p53 pathway is inactivated in almost all types of cancer by mutations in the p53 encoding gene or overexpression of the p53 negative regulators, Mdm2 and/or Mdmx. Restoration of the p53 function by inhibition of the p53-Mdm2/Mdmx interaction opens up a prospect for a nongenotoxic anticancer
Status and advances of p53-gene therapy and radiotherapy in malignant tumor
International Nuclear Information System (INIS)
Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong
2006-01-01
Cancer treatment is one of the most important fields in medical research. All strategies such as radio-therapy, chemotherapy, surgery, and gene-based therapy have their own advantages and disadvantages. Nowadays, a novel method which combined p53-gene therapy with radiotherapy plays an important role in the field of cancer research. This review summarized the current state of combined therapies of p53-gene therapy and radiotherapy, possible mechanism and recent progress. (authors)
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-01-01
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...
Butein activates p53 in hepatocellular carcinoma cells via blocking MDM2-mediated ubiquitination
Directory of Open Access Journals (Sweden)
Zhou Y
2018-04-01
Full Text Available Yuanfeng Zhou,1,2 Kuifeng Wang,2 Ni Zhou,2 Tingting Huang,2 Jiansheng Zhu,2 Jicheng Li1 1Institute of Cell Biology, Zhejiang University, Hangzhou, People’s Republic of China; 2Department of Infectious Diseases, Affiliated Taizhou Hospital of Wenzhou Medical University, Taizhou, People’s Republic of China Introduction: In this study, we aimed to investigate the effect of butein on p53 in hepatocellular carcinoma (HCC cells and the related molecular mechanisms by which p53 was activated. Methods: MTS assay and clonogenic survival assay were used to examine the antitumor activity of butein in vitro. Reporter gene assay was adopted to evaluate p53 transcriptional activity. Flow cytometry and western blotting were performed to study apoptosis induction and protein expression respectively. Xenograft model was applied to determine the in vivo efficacy and the expression of p53 in tumor tissue was detected by immunohistochemistry. Results: HCC cell proliferation and clonogenic survival were significantly inhibited after butein treatment. With the activation of cleaved-PARP and capsase-3, butein induced apoptosis in HCC cells in a dose-dependent manner. The transcriptional activity of p53 was substantially promoted by butein, and the expression of p53-targeted gene was increased accordingly. Mechanism studies demonstrated that the interaction between MDM2 and p53 was blocked by butein and MDM2-mediated p53 ubiquitination was substantially decreased. Short-hairpin RNA experiment results showed that the sensitivity of HCC cells to butein was substantially impaired after p53 was knocked down and butein-induced apoptosis was dramatically decreased. In vivo experiments validated substantial antitumor efficacy of butein against HepG2 xenograft growth, and the expression of p53 in butein-treated tumor tissue was significantly increased. Conclusion: Butein demonstrated potent antitumor activities in HCC by activating p53, and butein or its analogs had
Urodele p53 tolerates amino acid changes found in p53 variants linked to human cancer
Directory of Open Access Journals (Sweden)
Villiard Éric
2007-09-01
Full Text Available Abstract Background Urodele amphibians like the axolotl are unique among vertebrates in their ability to regenerate and their resistance to develop cancers. It is unknown whether these traits are linked at the molecular level. Results Blocking p53 signaling in axolotls using the p53 inhibitor, pifithrin-α, inhibited limb regeneration and the expression of p53 target genes such as Mdm2 and Gadd45, suggesting a link between tumor suppression and regeneration. To understand this relationship we cloned the p53 gene from axolotl. When comparing its sequence with p53 from other organisms, and more specifically human we observed multiple amino acids changes found in human tumors. Phylogenetic analysis of p53 protein sequences from various species is in general agreement with standard vertebrate phylogeny; however, both mice-like rodents and teleost fishes are fast evolving. This leads to long branch attraction resulting in an artefactual basal emergence of these groups in the phylogenetic tree. It is tempting to assume a correlation between certain life style traits (e.g. lifespan and the evolutionary rate of the corresponding p53 sequences. Functional assays of the axolotl p53 in human or axolotl cells using p53 promoter reporters demonstrated a temperature sensitivity (ts, which was further confirmed by performing colony assays at 37°C. In addition, axolotl p53 was capable of efficient transactivation at the Hmd2 promoter but has moderate activity at the p21 promoter. Endogenous axolotl p53 was activated following UV irradiation (100 j/m2 or treatment with an alkylating agent as measured using serine 15 phosphorylation and the expression of the endogenous p53 target Gadd45. Conclusion Urodele p53 may play a role in regeneration and has evolved to contain multiple amino acid changes predicted to render the human protein defective in tumor suppression. Some of these mutations were probably selected to maintain p53 activity at low temperature. However
Directory of Open Access Journals (Sweden)
Momoko Ishimine
2018-01-01
Full Text Available Irinotecan (CPT-11 is an anticancer prodrug that is activated by the carboxylesterase CES2 and has been approved for the treatment of many types of solid tumors, including colorectal cancer. Recent studies with cell lines show that CES2 expression is regulated by the tumor suppressor protein p53. However, clinical evidence for this regulatory mechanism in cancer is lacking. In this study, we examined the relationship between TP53 gene status and CES2 expression in human colorectal cancer. Most colorectal cancer specimens (70%; 26 of 37 showed lower CES2 mRNA levels (≥1.5-fold lower than the adjacent normal tissue, and only 30% (12 of 37 showed similar (<1.5-fold lower or higher CES2 mRNA levels. However, TP53 gene sequencing revealed no relationship between CES2 downregulation and TP53 mutational status. Moreover, while colorectal cancer cells expressing wild-type p53 exhibited p53-dependent upregulation of CES2, PRIMA-1MET, a drug that restores the transcriptional activity of mutant p53, failed to upregulate CES2 expression in cells with TP53 missense mutations. These results, taken together, suggest that CES2 mRNA expression is decreased in human colorectal cancer independently of p53.
Liu, Chen; Sun, Bin; An, Ni; Tan, Weifeng; Cao, Lu; Luo, Xiangji; Yu, Yong; Feng, Feiling; Li, Bin; Wu, Mengchao; Su, Changqing; Jiang, Xiaoqing
2011-12-01
Gene therapy has become an important strategy for treatment of malignancies, but problems remains concerning the low gene transferring efficiency, poor transgene expression and limited targeting specific tumors, which have greatly hampered the clinical application of tumor gene therapy. Gallbladder cancer is characterized by rapid progress, poor prognosis, and aberrantly high expression of Survivin. In the present study, we used a human tumor-specific Survivin promoter-regulated oncolytic adenovirus vector carrying P53 gene, whose anti-cancer effect has been widely confirmed, to construct a wide spectrum, specific, safe, effective gene-viral therapy system, AdSurp-P53. Examining expression of enhanced green fluorecent protein (EGFP), E1A and the target gene P53 in the oncolytic adenovirus system validated that Survivin promoter-regulated oncolytic adenovirus had high proliferation activity and high P53 expression in Survivin-positive gallbladder cancer cells. Our in vitro cytotoxicity experiment demonstrated that AdSurp-P53 possessed a stronger cytotoxic effect against gallbladder cancer cells and hepatic cancer cells. The survival rate of EH-GB1 cells was lower than 40% after infection of AdSurp-P53 at multiplicity of infection (MOI) = 1 pfu/cell, while the rate was higher than 90% after infection of Ad-P53 at the same MOI, demonstrating that AdSurp-P53 has a potent cytotoxicity against EH-GB1 cells. The tumor growth was greatly inhibited in nude mice bearing EH-GB1 xenografts when the total dose of AdSurp-P53 was 1 × 10(9) pfu, and terminal dUTP nick end-labeling (TUNEL) revealed that the apoptotic rate of cancer cells was (33.4 ± 8.4)%. This oncolytic adenovirus system overcomes the long-standing shortcomings of gene therapy: poor transgene expression and targeting of only specific tumors, with its therapeutic effect better than the traditional Ad-P53 therapy regimen already on market; our system might be used for patients with advanced gallbladder cancer and
Profiling of oligosaccharides and p53 gene mutation in Filipino breast tumors
International Nuclear Information System (INIS)
Deocaris, Custer C.; De Vera, Azucena C.; Magno, Jose Donato A.; Cruz, Michael Joseph B.; Prodigalidad, Abelardo-Alan T.; Jacinto, Sonia D.
2010-01-01
Majority of patients are diagnosed with benign tumors, however, such benign tumors can progress to an invasive disease. Since carbohydrate-mediated cell-cell adhesion and proliferative potential play crucial roles in tumorigenesis and tumor aggressive behavior, we analyzed the qualitative changes in oligosaccharide expression and analyzed for presence of mutation in the tumor suppressor p53 gene, the most mutated gene in all human cancers. Forty-three (43) breast tumors were screened for p53 mutation in exons 2-11 using polymerase chain reaction (PCR)-amplification coupled to temporal temperature gradient electrophoresis (TTGE). Paraffin-embedded tissues were stained with biotinylated-glycoproteins containing the following sugar groups: mannose (Man), lactose (Lac), fucoidan (Fuc), N-acetyl-glucosamine (GlcNac), N-acetyl-b-galactosamine (GalNAc) and hyaluronic acid (Hya). Expression of carbohydrate receptors was significantly elevated (p=0.003) in malignant compared with benign tumors, particularly at receptors for GalNAc, lac and Fuc. No change in overall glycan signatures using our panel of neoglycoconjugates was noted when grouped according to p53 mutation status in both benign and malignant cases. Although the prognostic value of carbohydrate-receptors in breast cancer has not been validated to date, our results indicate that benign and malignant tumors can be defined by their affinities to our battery of neoglyconjugates. However, result from our reverse lectin histochemistry failed to correlated glycan signature with presence of p53 mutations. (author)
Sutariya, Rakesh V; Manjunatha, Bhari Sharanesha
2016-11-01
Oral Squamous cell carcinoma (OSCC) results from genetic damage, leading to uncontrolled cell proliferation of damaged cells and the cell death. In the course of its progression, visible changes are taking place at the cellular level (atypical) and the resultant at the tissue level (epithelial dysplasia). The Aim of the present study was to evaluate and compare the expressions of intensity of p21 and Bcl-2 in Leukoplakia, oralsubmucous fibrosis (OSMF) and oral squamous cell carcinoma. Total 60 cases, 30 cases of oral squamous cell carcinoma, 15 cases of oral submucous fibrosis and 15 cases of Leukoplakia were evaluated immunohistochemically for p21 and Bcl-2 expression. p21 showed positive expression in 13 (86.67%) cases out of 15 cases of OSMF, 12 (80%) cases of leukoplakia out of 15 cases and 24 (80%) cases out of 30 cases of OSCC. The Bcl-2 expression was positive in 13 (86.67%) cases of OSMF, all cases of Leukoplakia and 25 (83.33%) cases of OSCC. No statistical significance was noted in the expression of p21 and Bcl-2 positive expression between OSMF, Leukoplakia and OSCC. Statistical analysis for comparison of intensity of p21 expression in different grades of OSCC showed no significance. Statistical significance difference was found between the expressions of Bcl-2 in moderately and poorly differentiated SCC. The intensity of p21 and Bcl-2 expressions in different grades of OSCC indicates a key role in progression of oral neoplasia.
Chk2 regulates transcription-independent p53-mediated apoptosis in response to DNA damage
International Nuclear Information System (INIS)
Chen Chen; Shimizu, Shigeomi; Tsujimoto, Yoshihide; Motoyama, Noboru
2005-01-01
The tumor suppressor protein p53 plays a central role in the induction of apoptosis in response to genotoxic stress. The protein kinase Chk2 is an important regulator of p53 function in mammalian cells exposed to ionizing radiation (IR). Cells derived from Chk2-deficient mice are resistant to the induction of apoptosis by IR, and this resistance has been thought to be a result of the defective transcriptional activation of p53 target genes. It was recently shown, however, that p53 itself and histone H1.2 translocate to mitochondria and thereby induces apoptosis in a transcription-independent manner in response to IR. We have now examined whether Chk2 also regulates the transcription-independent induction of apoptosis by p53 and histone H1.2. The reduced ability of IR to induce p53 stabilization in Chk2-deficient thymocytes was associated with a marked impairment of p53 and histone H1 translocation to mitochondria. These results suggest that Chk2 regulates the transcription-independent mechanism of p53-mediated apoptosis by inducing stabilization of p53 in response to IR
The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.
Directory of Open Access Journals (Sweden)
Daniel Menendez
2011-03-01
Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.
Directory of Open Access Journals (Sweden)
O. A. Gonchar
2017-12-01
Full Text Available The intensity of oxidative stress, protein expression of antiapoptotic Bcl-2 as well as antioxidant enzymes manganese superoxide dismutase (MnSOD and glutathione peroxidase (GPx and their regulator p53 were studied in the mitochondria of rat heart. Sessions of repeated hypoxia/reoxygenation ((H/R, 5 cycles of 10 min hypoxia (5.5% O2 in N2 alternated with 10 min normoxia, daily were performed in our study. It was shown that short-term sessions of H/R (during 1-3 days caused a significant increase in the oxidative stress markers (ROS formation and lipid peroxidation, mitochondrial p53 translocation, a decrease in MnSOD protein expression/activity and Bcl-2 protein content, but up-regulated GPx. We have demonstrated that prolonged H/R (7-14 days induced myocardial tolerance to fluctuation in oxygen levels that was associated with the reduction in mitochondrial p53 protein content, elevation of mitochondrial Bcl-2 protein level, and increase in antioxidant capacity. A close correlation between the mitochondrial p53 accumulation and ROS formation as well as the activity and protein content of MnSOD and GPx allowed us to assume that p53 took an active part in the regulation of prooxidant/antioxidant balance in mitochondria of rat heart during repeated H/R.
Interactions between the otitis media gene, Fbxo11, and p53 in the mouse embryonic lung.
Tateossian, Hilda; Morse, Susan; Simon, Michelle M; Dean, Charlotte H; Brown, Steve D M
2015-12-01
Otitis media with effusion (OME) is the most common cause of hearing loss in children, and tympanostomy (ear tube insertion) to alleviate the condition remains the commonest surgical intervention in children in the developed world. Chronic and recurrent forms of otitis media (OM) are known to have a very substantial genetic component; however, until recently, little was known of the underlying genes involved. The Jeff mouse mutant carries a mutation in the Fbxo11 gene, a member of the F-box family, and develops deafness due to a chronic proliferative OM. We previously reported that Fbxo11 is involved in the regulation of transforming growth factor beta (TGF-β) signalling by regulating the levels of phospho-Smad2 in the epithelial cells of palatal shelves, eyelids and airways of the lungs. It has been proposed that FBXO11 regulates the cell's response to TGF-β through the ubiquitination of CDT2. Additional substrates for FBXO11 have been identified, including p53. Here, we have studied both the genetic and biochemical interactions between FBXO11 and p53 in order to better understand the function of FBXO11 in epithelial development and its potential role in OM. In mice, we show that p53 (also known as Tp53) homozygous mutants and double heterozygous mutants (Jf/+ p53/+) exhibit similar epithelial developmental defects to Fbxo11 homozygotes. FBXO11 and p53 interact in the embryonic lung, and mutation in Fbxo11 prevents the interaction with p53. Both p53 and double mutants show raised levels of pSMAD2, recapitulating that seen in Fbxo11 homozygotes. Overall, our results support the conclusion that FBXO11 regulates the TGF-β pathway in the embryonic lung via cross-talk with p53. © 2015. Published by The Company of Biologists Ltd.
MDM2 SNP309 promoter polymorphism and p53 mutations in urinary bladder carcinoma stage T1
Directory of Open Access Journals (Sweden)
Olsson Hans
2013-01-01
Full Text Available Abstract Background Urinary bladder carcinoma stage T1 is an unpredictable disease that in some cases has a good prognosis with only local or no recurrence, but in others can appear as a more aggressive tumor with progression to more advanced stages. The aim here was to investigate stage T1 tumors regarding MDM2 promoter SNP309 polymorphism, mutations in the p53 gene, and expression of p53 and p16 measured by immunohistochemistry, and subsequently relate these changes to tumor recurrence and progression. We examined a cohort of patients with primary stage T1 urothelial carcinoma of the bladder and their tumors. Methods After re-evaluation of the original slides and exclusions, the study population comprised 141 patients, all with primary stage T1 urothelial carcinoma of the bladder. The hospital records were screened for clinical parameters and information concerning presence of histologically proven recurrence and progression. The paraffin-embedded tumor material was evaluated by immunohistochemistry. Any mutations found in the p53 gene were studied by single-strand conformation analysis and Sanger sequencing. The MDM2 SNP309 polymorphism was investigated by pyrosequencing. Multivariate analyses concerning association with prognosis were performed, and Kaplan-Meier analysis was conducted for a combination of changes and time to progression. Results Of the 141 patients, 82 had at least one MDM2 SNP309 G allele, and 53 had a mutation in the p53 gene, but neither of those anomalies was associated with a worse prognosis. A mutation in the p53 gene was associated with immunohistochemically visualized p53 protein expression at a cut-off value of 50%. In the group with p53 mutation Kaplan-Meier analysis showed higher rate of progression and shorter time to progression in patients with immunohistochemically abnormal p16 expression compared to them with normal p16 expression (p = 0.038. Conclusions MDM2 SNP309 promoter polymorphism and mutations in
Soleymaninejad, Masoume; Joursaraei, Seyed Gholamali; Feizi, Farideh; Jafari Anarkooli, Iraj
2017-01-01
The aim of this study was to evaluate the effects of antioxidants lycopene and insulin on histological changes and expression of Bcl-2 family genes in the hippocampus of streptozotocin-induced type 1 diabetic rats. Forty-eight Wistar rats were divided into six groups of control (C), control treated with lycopene (CL), diabetic (D), diabetic treated with insulin (DI), diabetic treated with lycopene (DL), and diabetic treated with insulin and lycopene (DIL). Diabetes was induced by an injection of streptozotocin (60 mg/kg, IP), lycopene (4 mg/kg/day) was given to the lycopene treated groups as gavages, and insulin (Sc, 1-2 U/kg/day) was injected to the groups treated with insulin. The number of hippocampus neurons undergoing cell death in group D had significant differences with groups C and DIL ( p lycopene alone or together reduced the expression of Bax , but increased Bcl-2 and Bcl-x L levels in DI, DL, and DIL rats, especially when compared to group D ( p lycopene contribute to the prevention of cell death by reducing the expression of proapoptotic genes and increasing the expression of antiapoptotic genes in the hippocampus.
Withaferin A Suppresses Anti-apoptotic BCL2, Bcl-xL, XIAP and ...
African Journals Online (AJOL)
apoptotic ... Quantitative real-time polymerase chain reaction (qPCR) was performed using Taq PCR Master ... Keywords: Anti-apoptotic genes, Cervical cancer, Apoptosis, Cell viability, BCL2, .... polyclonal anti-rabbit immunoglobulin HRP-linked.
Directory of Open Access Journals (Sweden)
Rabia Johnson
2017-09-01
Full Text Available Doxorubicin (Dox is an effective chemotherapeutic agent used in the treatment of various cancers. Its clinical use is often limited due to its potentially fatal cardiotoxic side effect. Increasing evidence indicates that tumour protein p53 (p53, adenosine monophosphate-activated protein kinase (AMPK, nucleoporin p62 (p62, and the mammalian target of rapamycin (mTOR are critical mediators of Dox-induced apoptosis, and subsequent dysregulation of autophagy. Aspalathin, a polyphenolic dihydrochalcone C-glucoside has been shown to activate AMPK while decreasing the expression of p53. However, the role that aspalathin could play in the inhibition of Dox-induced cardiotoxicity through increased autophagy flux remained unexplored. H9c2 cardiomyocytes and Caov-3 ovarian cancer cells were cultured in Dulbecco’s Modified Eagle’s medium and treated with or without Dox for five days. Thereafter, cells exposed to 0.2 µM Dox were co-treated with either 20 µM Dexrazozane (Dexra or 0.2 µM aspalathin (ASP daily for 5 days. Results obtained showed that ASP mediates its cytoprotective effect in a p53-dependent manner, by increasing the Bcl-2/Bax ratio and decreasing apoptosis. The latter effect was diminished through ASP-induced activation of autophagy-related genes (Atgs with an associated decrease in p62 through induction of AMPK and Fox01. Furthermore, we showed that ASP was able to potentiate this effect without decreasing the anti-cancer efficacy of Dox, as could be observed in Caov-3 ovarian cancer cells. Taken together, the data presented in this study provides a credible mechanism by which ASP co-treatment could protect the myocardium from Dox-induced cardiotoxicity.
Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression
International Nuclear Information System (INIS)
Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng
2008-01-01
Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression
TAF6delta controls apoptosis and gene expression in the absence of p53.
Directory of Open Access Journals (Sweden)
Emmanuelle Wilhelm
Full Text Available BACKGROUND: Life and death decisions of metazoan cells hinge on the balance between the expression of pro- versus anti-apoptotic gene products. The general RNA polymerase II transcription factor, TFIID, plays a central role in the regulation of gene expression through its core promoter recognition and co-activator functions. The core TFIID subunit TAF6 acts in vitro as an essential co-activator of transcription for the p53 tumor suppressor protein. We previously identified a splice variant of TAF6, termed TAF6delta that can be induced during apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate the impact of TAF6delta on cell death and gene expression, we have employed modified antisense oligonucleotides to enforce expression of endogenous TAF6delta. The induction of endogenous TAF6delta triggered apoptosis in tumor cell lines, including cells devoid of p53. Microarray experiments revealed that TAF6delta activates gene expression independently of cellular p53 status. CONCLUSIONS: Our data define TAF6delta as a pivotal node in a signaling pathway that controls gene expression programs and apoptosis in the absence of p53.
Conditional inactivation of PDCD2 induces p53 activation and cell cycle arrest
Directory of Open Access Journals (Sweden)
Celine J. Granier
2014-08-01
Full Text Available PDCD2 (programmed cell death domain 2 is a highly conserved, zinc finger MYND domain-containing protein essential for normal development in the fly, zebrafish and mouse. The molecular functions and cellular activities of PDCD2 remain unclear. In order to better understand the functions of PDCD2 in mammalian development, we have examined PDCD2 activity in mouse blastocyst embryos, as well as in mouse embryonic stem cells (ESCs and embryonic fibroblasts (MEFs. We have studied mice bearing a targeted PDCD2 locus functioning as a null allele through a splicing gene trap, or as a conditional knockout, by deletion of exon2 containing the MYND domain. Tamoxifen-induced knockout of PDCD2 in MEFs, as well as in ESCs, leads to defects in progression from the G1 to the S phase of cell cycle, associated with increased levels of p53 protein and p53 target genes. G1 prolongation in ESCs was not associated with induction of differentiation. Loss of entry into S phase of the cell cycle and marked induction of nuclear p53 were also observed in PDCD2 knockout blastocysts. These results demonstrate a unique role for PDCD2 in regulating the cell cycle and p53 activation during early embryonic development of the mouse.
Directory of Open Access Journals (Sweden)
Kim Dong-Wan
2007-04-01
Full Text Available Abstract Background Bcl-2 is positively regulated by hormonal receptor pathways in breast cancer. A study was conducted to assess the prognostic significances of clinico-pathologic variables and of ER, PR, p53, c-erbB2, bcl-2, or Ki-67 as markers of relapse in breast cancer patients who had received the identical adjuvant therapy at a single institution. Methods A cohort of 151 curatively resected stage III breast cancer patients (M:F = 3:148, median age 46 years who had 4 or more positive lymph nodes and received doxorubicin and cyclophosphamide followed by paclitaxel (AC/T as adjuvant chemotherapy was analyzed for clinico-pathologic characteristics including disease-free survival (DFS and overall survival (OS. Patients with positive ER and/or PR expression received 5 years of tamoxifen following AC/T. The protein expressions of biomarkers were assessed immunohistochemically. Results The median follow-up duration was 36 months, and 37 patients (24.5% experienced a recurrence. Univariate analyses indicated that the tumor size (P = 0.038 and the number of involved lymph nodes (P P = 0.013, bcl-2 positivity (P = 0.002 and low p53 expression (P = 0.032 were found to be significantly associated with a prolonged DFS. Furthermore, multivariate analysis identified 10 or more involved lymph nodes (HR 7.366; P P = 0.030, and c-erbB2 over-expression (HR 3.535; P = 0.001 as independent indicators of poorer DFS. In addition, bcl-2 expression was found to be significantly correlated with the expressions of ER and PR, and inversely correlated with the expressions of p53, c-erbB2 and Ki-67. Patients with bcl-2 expression had a significantly longer DFS than those without, even in the ER (+ subgroup. Moreover, OS was significantly affected by ER, bcl-2 and c-erbB2. Conclusion Bcl-2 is an independent prognostic factor of DFS in curatively resected stage III breast cancer patients and appears to be a useful prognostic factor in combination with c-erbB2 and the
Chronic ultraviolet exposure-induced p53 gene alterations in sencar mouse skin carcinogenesis model
International Nuclear Information System (INIS)
Tong, Ying; Smith, M.A.; Tucker, S.B.
1997-01-01
Alterations of the tumor suppressor gene p53 have been found in ultraviolet radiation (UVR) related human skin cancers and in UVR-induced murine skin tumors. However, links between p53 gene alterations and the stages of carcinogenesis induced by UVR have not been clearly defined. We established a chronic UVR exposure-induced Sencar mouse skin carcinogenesis model to determine the frequency of p53 gene alterations in different stages of carcinogenesis, including UV-exposed skin, papillomas, squamous-cell carcinomas (SCCs), and malignant spindle-cell tumors (SCTs). A high incidence of SCCs and SCTs were found in this model. Positive p53 nuclear staining was found in 10137 (27%) of SCCs and 12124 (50%) of SCTs, but was not detected in normal skin or papillomas. DNA was isolated from 40 paraffin-embedded normal skin, UV-exposed skin, and tumor sections. The p53 gene (exons 5 and 6) was amplified from the sections by using nested polymerase chain reaction (PCR). Subsequent single-strand conformation polymorphism (SSCP) assay and sequencing analysis revealed one point mutation in exon 6 (coden 193, C → A transition) from a UV-exposed skin sample, and seven point mutations in exon 5 (codens 146, 158, 150, 165, and 161, three C → T, two C → A, one C → G, and one A → T transition, respectively) from four SCTs, two SCCs and one UV-exposed skin sample. These experimental results demonstrate that alterations in the p53 gene are frequent events in chronic UV exposure-induced SCCs and later stage SCTs in Sencar mouse skin. 40 refs., 5 figs., 1 tab
Heterozygous loss of TSC2 alters p53 signaling and human stem cell reprogramming.
Armstrong, Laura C; Westlake, Grant; Snow, John P; Cawthon, Bryan; Armour, Eric; Bowman, Aaron B; Ess, Kevin C
2017-12-01
Tuberous sclerosis complex (TSC) is a pediatric disorder of dysregulated growth and differentiation caused by loss of function mutations in either the TSC1 or TSC2 genes, which regulate mTOR kinase activity. To study aberrations of early development in TSC, we generated induced pluripotent stem cells using dermal fibroblasts obtained from patients with TSC. During validation, we found that stem cells generated from TSC patients had a very high rate of integration of the reprogramming plasmid containing a shRNA against TP53. We also found that loss of one allele of TSC2 in human fibroblasts is sufficient to increase p53 levels and impair stem cell reprogramming. Increased p53 was also observed in TSC2 heterozygous and homozygous mutant human stem cells, suggesting that the interactions between TSC2 and p53 are consistent across cell types and gene dosage. These results support important contributions of TSC2 heterozygous and homozygous mutant cells to the pathogenesis of TSC and the important role of p53 during reprogramming. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Liu, Shu-Xia; Geng, Yi-Zhao; Yan, Shi-Wei
2017-06-01
Approximately half of all human cancers show normal TP53 gene expression but aberrant overexpression of MDM2 and/or MDMX. This fact suggests a promising cancer therapeutic strategy in targeting the interactions between p53 and MDM2/MDMX. To help realize the goal of developing effective inhibitors to disrupt the p53-MDM2/MDMX interaction, we systematically investigated the structural and interaction characteristics of p53 with inhibitors of its interactions with MDM2 and MDMX from an atomistic perspective using stochastic molecular dynamics simulations. We found that some specific α helices in the structures of MDM2 and MDMX play key roles in their binding to inhibitors, and that the hydrogen bond formed by the Trp23 residue of p53 with its counterpart in MDM2 or MDMX determines the dynamic competition processes of the disruption of the MDM2-p53 interaction and replacement of p53 from the MDM2-p53 complex in vivo. The results reported in this paper are expected to provide basic information for designing functional inhibitors and realizing new strategies of cancer gene therapy.
International Nuclear Information System (INIS)
Anagnostou, Valsamo K; Boffa, Daniel; Gettinger, Scott; Detterbeck, Frank; Homer, Robert J; Dougenis, Dimitrios; Rimm, David L; Syrigos, Konstantinos N; Lowery, Frank J; Zolota, Vassiliki; Tzelepi, Vassiliki; Gopinath, Arun; Liceaga, Camil; Panagopoulos, Nikolaos; Frangia, Konstantina; Tanoue, Lynn
2010-01-01
Bcl-2 promotes cell survival by inhibiting adapters needed for the activation and cleavage of caspases thus blocking the proteolytic cascade that ultimately dismantles the cell. Bcl-2 has been investigated as a prognostic factor in non small cell lung cancer (NSCLC) patients with conflicting results. Here, we quantitatively assessed Bcl-2 expression in two large and independent cohorts to investigate the impact of Bcl-2 on survival. AQUA ® , a fluorescent-based method for analysis of in situ protein expression, was used to measure Bcl-2 protein levels and classify tumors by Bcl-2 expression in a cohort of 180 NSCLC patients. An independent cohort of 354 NSCLC patients was used to validate Bcl-2 classification and evaluate outcome. Fifty % and 52% of the cases were classified as high expressers in training and validation cohorts respectively. Squamous cell carcinomas were more likely to be high expressers compared to adenocarcinomas (63% vs. 45%, p = 0.002); Bcl-2 was not associated with other clinical or pathological characteristics. Survival analysis showed that patients with high BCL-2 expression had a longer median survival compared to low expressers (22 vs. 17.5 months, log rank p = 0.014) especially in the subset of non-squamous tumors (25 vs. 13.8 months, log rank p = 0.04). Multivariate analysis revealed an independent lower risk for all patients with Bcl-2 expressing tumors (HR = 0.53, 95% CI 0.37-0.75, p = 0.0003) and for patients with non-squamous tumors (HR = 0.5, 95% CI 0.31-0.81, p = 0.005). Bcl-2 expression defines a subgroup of patients with a favorable outcome and may be useful for prognostic stratification of NSCLC patients
International Nuclear Information System (INIS)
Lee, Kyung-Hun; Noh, Dong-Young; Heo, Dae Seog; Ha, Sung Whan; Bang, Yung-Jue; Im, Seock-Ah; Oh, Do-Youn; Lee, Se-Hoon; Chie, Eui Kyu; Han, Wonshik; Kim, Dong-Wan; Kim, Tae-You; Park, In Ae
2007-01-01
Bcl-2 is positively regulated by hormonal receptor pathways in breast cancer. A study was conducted to assess the prognostic significances of clinico-pathologic variables and of ER, PR, p53, c-erbB2, bcl-2, or Ki-67 as markers of relapse in breast cancer patients who had received the identical adjuvant therapy at a single institution. A cohort of 151 curatively resected stage III breast cancer patients (M:F = 3:148, median age 46 years) who had 4 or more positive lymph nodes and received doxorubicin and cyclophosphamide followed by paclitaxel (AC/T) as adjuvant chemotherapy was analyzed for clinico-pathologic characteristics including disease-free survival (DFS) and overall survival (OS). Patients with positive ER and/or PR expression received 5 years of tamoxifen following AC/T. The protein expressions of biomarkers were assessed immunohistochemically. The median follow-up duration was 36 months, and 37 patients (24.5%) experienced a recurrence. Univariate analyses indicated that the tumor size (P = 0.038) and the number of involved lymph nodes (P < 0.001) significantly affected the recurrences. However, the type of surgery, the histology, histologic grade, the presence of endolymphatic emboli, and a close resection margin did not. Moreover, ER positivity (P = 0.013), bcl-2 positivity (P = 0.002) and low p53 expression (P = 0.032) were found to be significantly associated with a prolonged DFS. Furthermore, multivariate analysis identified 10 or more involved lymph nodes (HR 7.366; P < 0.001), negative bcl-2 expression (HR 2.895; P = 0.030), and c-erbB2 over-expression (HR 3.535; P = 0.001) as independent indicators of poorer DFS. In addition, bcl-2 expression was found to be significantly correlated with the expressions of ER and PR, and inversely correlated with the expressions of p53, c-erbB2 and Ki-67. Patients with bcl-2 expression had a significantly longer DFS than those without, even in the ER (+) subgroup. Moreover, OS was significantly affected by ER, bcl
Chemical Variations on the p53 Reactivation Theme
Directory of Open Access Journals (Sweden)
Carlos J. A. Ribeiro
2016-05-01
Full Text Available Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX. Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented.
Florou, Dimitra; Patsis, Christos; Ardavanis, Alexandros; Scorilas, Andreas
2013-07-01
Defective apoptosis comprises the main reason for tumor aggressiveness and chemotherapy tolerance in solid neoplasias. Among the BCL-2 family members, whose mRNA or protein expression varies considerably in different human malignancies, BCL2L12 is the one for which we have recently shown its propitious prognostic value in gastric cancer. The purpose of the current work was to investigate the expression behavior of BCL2L12, BAX, and BCL-2 in human stomach adenocarcinoma cells following their exposure to anti-tumor substances. The 3-(4,5-dimethyl thiazol-2-yl)-2,5-diphenyl tetrazolium bromide and trypan blue methods assessed the impact of doxorubicin, oxaliplatin and methotrexate on AGS cells' viability and growth. Following isolation from cells, total RNA was reverse-transcribed to cDNA. Quantification of target genes' expression was performed with real-time PCR using SYBR Green detection system. The relative changes in their mRNA levels between drug-exposed and untreated cells were calculated with the comparative Ct method (2(-ddCt)). All three drugs, as a result of their administration to AGS cancer cells for particular time intervals, provoked substantial fluctuations in the transcriptional levels of the apoptosis-related genes studied. While BAX was principally upregulated, striking similar were the notable changes regarding BCL-2 and BCL2L12 expression in our cellular system. Our findings indicate the growth suppressive effects of doxorubicin, oxaliplatin and methotrexate treatment on stomach carcinoma cells and the implication of BCL2L12, BAX, and BCL-2 expression profiles in the molecular signaling pathways triggered by chemotherapy.
Radiosensitivity of cancer cells against carbon-ion beams in an aspect of the p53 gene status
International Nuclear Information System (INIS)
Takahashi, Akihisa; Ohnishi, Takeo; Matsumoto, Hideki
2004-01-01
We can easily understand that radiation sensitivities of cancer cells are dependent on the status of cancer-related genes. It is important to clarify which genes affect radiation sensitivity and reflect the effectiveness of radiation therapy for cancer cells. We have studied about the function of a tumor suppressor gene of p53, because p53 controls apoptosis, cell cycle and DNA repair from an aspect of important roles in cell fate. By analysis of function of p53 gene, therefore, we aim to predict the therapeutic effectiveness and to select the modalities of cancer therapies such as radiotherapy, chemotherapy and hyperthermia. As a final goal, we want to accept the most effective therapy, namely tailor-made cancer therapy, for each patient. Here, we introduce that carbon-beam therapy induced the expression of p53-independent apoptosis-related genes and NO radicals in mutated p53 cancer cells. (author)
Hale, T K; Braithwaite, A W
1999-08-20
Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.
Directory of Open Access Journals (Sweden)
Yu-Li Lo
Full Text Available Multidrug resistance (MDR is a major impediment to chemotherapy. In the present study, we designed antisense oligonucleotides (ASOs against MDR1, MDR-associated protein (MRP1, MRP2, and/or BCL-2/BCL-xL to reverse MDR transporters and induce apoptosis, respectively. The cationic liposomes (100 nm composed of N-[1-(2,3-dioleyloxypropyl]-n,n,n-trimethylammonium chloride and dioleoyl phosphotidylethanolamine core surrounded by a polyethylene glycol (PEG shell were prepared to carry ASOs and/or epirubicin, an antineoplastic agent. We aimed to simultaneously suppress efflux pumps, provoke apoptosis, and enhance the chemosensitivity of human colon adenocarcinoma Caco-2 cells to epirubicin. We evaluated encapsulation efficiency, particle size, cytotoxicity, intracellular accumulation, mRNA levels, cell cycle distribution, and caspase activity of these formulations. We found that PEGylated liposomal ASOs significantly reduced Caco-2 cell viability and thus intensified epirubicin-mediated apoptosis. These formulations also decreased the MDR1 promoter activity levels and enhanced the intracellular retention of epirubicin in Caco-2 cells. Epirubicin and ASOs in PEGylated liposomes remarkably decreased mRNA expression levels of human MDR1, MRP1, MRP2, and BCL-2. The combined treatments all significantly increased the mRNA expressions of p53 and BAX, and activity levels of caspase-3, -8, and -9. The formulation of epirubicin and ASOs targeting both pump resistance of MDR1, MRP1, and MRP2 and nonpump resistance of BCL-2/BCL-xL demonstrated more superior effect to all the other formulations used in this study. Our results provide a novel insight into the mechanisms by which PEGylated liposomal ASOs against both resistance types act as activators to epirubicin-induced apoptosis through suppressing MDR1, MRP1, and MRP2, as well as triggering intrinsic mitochondrial and extrinsic death receptor pathways. The complicated regulation of MDR highlights the necessity
Fischer, Martin; Grossmann, Patrick; Padi, Megha; DeCaprio, James A
2016-07-27
Cell cycle (CC) and TP53 regulatory networks are frequently deregulated in cancer. While numerous genome-wide studies of TP53 and CC-regulated genes have been performed, significant variation between studies has made it difficult to assess regulation of any given gene of interest. To overcome the limitation of individual studies, we developed a meta-analysis approach to identify high confidence target genes that reflect their frequency of identification in independent datasets. Gene regulatory networks were generated by comparing differential expression of TP53 and CC-regulated genes with chromatin immunoprecipitation studies for TP53, RB1, E2F, DREAM, B-MYB, FOXM1 and MuvB. RNA-seq data from p21-null cells revealed that gene downregulation by TP53 generally requires p21 (CDKN1A). Genes downregulated by TP53 were also identified as CC genes bound by the DREAM complex. The transcription factors RB, E2F1 and E2F7 bind to a subset of DREAM target genes that function in G1/S of the CC while B-MYB, FOXM1 and MuvB control G2/M gene expression. Our approach yields high confidence ranked target gene maps for TP53, DREAM, MMB-FOXM1 and RB-E2F and enables prediction and distinction of CC regulation. A web-based atlas at www.targetgenereg.org enables assessing the regulation of any human gene of interest. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
International Nuclear Information System (INIS)
Liu Bing; Min Fengling; Xie Yi; Zhou Qingming; Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong; Li Wenjian; Hao Jifang; Zhou Guangming; Gao Qingxiang
2006-01-01
The effect of AdCMV-p53 gene transfection induced by γ-ray irradiation on human colorectal adenocarcinoma cells was investigated. The HT-29 cells were irradiated by 0.5, 1.0, 2.0 Gy 60 Co γ-rays, then were transfected with AdCMV-GFP (a replication of deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein) or AdCMV-p53 (a replication of deficient recombinant adenoviral vector containing a CMV promoter and carrying human wild p53 gene). Cytotoxity was measured by clonogenic survival assay; apoptosis and the p53 expression were determined by flow cytometry. The results show that the pre-exposure of 0.5 Gy 60 Co γ-rays significantly enhanced the inhibition of HT-29 cells with AdCMV-53 transfection and promoted cell apoptosis. The inhibition rates for the groups of pre-exposure with 0.5 Gy and transfection with 40 and 80 MOI AdCMV-p53 were 50% and 20% higher than those for the groups of the mere transfection, and 40% more than the mere irradiation group. In the case of higher than 0.5 Gy pre-exposure, no significant difference was found between the pre-exposure with transfection group and the mere irradiation group. So 0.5 Gy pre-irradiation and AdCMV-p53 transfection obviously increases the inhibition of HT-29 cells with AdCMV-p53 transfection. The optimum condition is the lower than 1.0 Gy pre-exposure combined with the lower than 80 MOI AdCMV-p53 transfection. (authors)
Riaz, Muhammad; Ashfaq, Usman A; Qasim, Muhammad; Yasmeen, Erum; Ul Qamar, Muhammad T; Anwar, Farooq
2017-10-01
In most types of cancer, overexpression of murine double minute 2 (MDM2) often leads to inactivation of p53. The crystal structure of MDM2, with a 109-residue amino-terminal domain, reveals that MDM2 has a core hydrophobic region to which p53 binds as an amphipathic α helix. The interface depends on the steric complementarity between MDM2 and the hydrophobic region of p53. Especially, on p53's triad, amino acids Phe19, Trp23 and Leu26 bind to the MDM2 core. Results from studies suggest that the structural motif of both p53 and MDM2 can be attributed to similarities in the amphipathic α helix. Thus, in the current investigation it is hypothesized that the similarity in the structural motif might be the cause of p53 inactivation by MDM2. Hence, molecular docking and phytochemical screening approaches are appraised to inhibit the hydrophobic cleft of MDM2 and to stop p53-MDM2 interaction, resulting in reactivation of p53 activity. For this purpose, a library of 2295 phytochemicals were screened against p53-MDM2 to find potential candidates. Of these, four phytochemicals including epigallocatechin gallate, alvaradoin M, alvaradoin E and nordihydroguaiaretic acid were found to be potential inhibitors of p53-MDM2 interaction. The screened phytochemicals, derived from natural extracts, may have negligible side effects and can be explored as potent antagonists of p53-MDM2 interactions, resulting in reactivation of the normal transcription of p53.
Ouyang, Qiaohong; Duan, Zhongxiang; Jiao, Guangli; Lei, Jixiao
2015-07-01
A biomimic reconstituted high-density-lipoprotein-based drug and p53 gene co-delivery system (rHDL/CD-PEI/p53 complexes) was fabricated as a targeted co-delivery nanovector of drug and gene for potential bladder cancer therapy. Here, CD-PEI was utilized to effectively condense the p53 plasmid, to incorporate the plasmid into rHDL, and to act as an antitumor drug to suppress tumor angiogenesis. The rHDL/CD-PEI/p53 complexes exhibited desirable and homogenous particle size, neutral surface charge, and low cytotoxicity in vitro. The results of confocal laser scanning microscopy and flow cytometry confirmed that SR-BI-targeted function induced specific cytoplasmic delivery and high gene transfection efficiency in MBT-2 murine bladder cells. In addition, rHDL/CD-PEI/p53 complexes co-delivering CD and p53 gene achieved synergistic angiogenesis suppression by more effectively downregulating the expression of vascular endothelial growth factor (VEGF) messenger RNA (mRNA) and protein via different pathways in vitro. In vivo investigation on C3H/He mice bearing MBT-2 tumor xenografts revealed that rHDL/CD-PEI/p53 complexes possessed strong antitumor activity. These findings suggested that rHDL/CD-PEI/p53 complexes could be an ideal tumor-targeting system for simultaneous transfer of drug and gene, which might be a new promising strategy for effective bladder cancer therapy.
International Nuclear Information System (INIS)
Powell, S.N.; DeFrank, J.S.; Connell, P.; Eogan, M.; Preffer, F.; Dombkowski, D.; Tang, W.; Friend, S.H.
1995-01-01
G1/S arrest. Cell cycle checkpoint arrest in response to 4 or 8 Gy X-rays was measured without caffeine and with 0.5 and 2mM caffeine. In (+/+) cells, G1/S and G2/M arrest was seen and there was no demonstrable impact of caffeine at either dose on either checkpoint. By contrast (-/-) cells showed a clear reduction (50%) of the size of G2/M arrest at 0.5mM caffeine and complete override at 2mM caffeine. These data imply that cells which lack p53, are sensitized by low-dose caffeine and their G2/M checkpoint is altered, seen by the different effects of caffeine upon G2/M override. Tumor cells which do and do not have functional p53 have also been evaluated. Preliminary data suggest a similar conclusion can be drawn. MCF-7 cells transfected with control plasmid or plasmids containing the gene for HPV-E6 protein also show sensitization with low dose caffeine only in cells which have E6. Conclusions: The greater caffeine-induced radiosensitization in p53(-) cells suggests that p53, already shown to control the G1/S checkpoint, may also influence aspects of G2/M arrest. These data indicate an opportunity for therapeutic gain by combining DNA damaging agents with compounds that disrupt G2/M arrest in tumors lacking functional p53. The role of p53 in G2/M transition remains to be defined
Ishizawa, Jo; Kojima, Kensuke; Chachad, Dhruv; Ruvolo, Peter; Ruvolo, Vivian; Jacamo, Rodrigo O; Borthakur, Gautam; Mu, Hong; Zeng, Zhihong; Tabe, Yoko; Allen, Joshua E; Wang, Zhiqiang; Ma, Wencai; Lee, Hans C; Orlowski, Robert; Sarbassov, Dos D; Lorenzi, Philip L; Huang, Xuelin; Neelapu, Sattva S; McDonnell, Timothy; Miranda, Roberto N; Wang, Michael; Kantarjian, Hagop; Konopleva, Marina; Davis, R Eric; Andreeff, Michael
2016-02-16
The clinical challenge posed by p53 abnormalities in hematological malignancies requires therapeutic strategies other than standard genotoxic chemotherapies. ONC201 is a first-in-class small molecule that activates p53-independent apoptosis, has a benign safety profile, and is in early clinical trials. We found that ONC201 caused p53-independent apoptosis and cell cycle arrest in cell lines and in mantle cell lymphoma (MCL) and acute myeloid leukemia (AML) samples from patients; these included samples from patients with genetic abnormalities associated with poor prognosis or cells that had developed resistance to the nongenotoxic agents ibrutinib and bortezomib. Moreover, ONC201 caused apoptosis in stem and progenitor AML cells and abrogated the engraftment of leukemic stem cells in mice while sparing normal bone marrow cells. ONC201 caused changes in gene expression similar to those caused by the unfolded protein response (UPR) and integrated stress responses (ISRs), which increase the translation of the transcription factor ATF4 through an increase in the phosphorylation of the translation initiation factor eIF2α. However, unlike the UPR and ISR, the increase in ATF4 abundance in ONC201-treated hematopoietic cells promoted apoptosis and did not depend on increased phosphorylation of eIF2α. ONC201 also inhibited mammalian target of rapamycin complex 1 (mTORC1) signaling, likely through ATF4-mediated induction of the mTORC1 inhibitor DDIT4. Overexpression of BCL-2 protected against ONC201-induced apoptosis, and the combination of ONC201 and the BCL-2 antagonist ABT-199 synergistically increased apoptosis. Thus, our results suggest that by inducing an atypical ISR and p53-independent apoptosis, ONC201 has clinical potential in hematological malignancies. Copyright © 2016, American Association for the Advancement of Science.
Sun, Wen-Chong; Pei, Ling
2016-07-01
Propofol exerts a cytotoxic influence over immature neurocytes. Our previous study revealed that clinically relevant doses of propofol accelerated apoptosis of primary cultured astrocytes of developing rodent brains via rno-miR-665 regulation. However, the role of rno-miR-665 during the growth spurt of neonatal rodent brains in vivo is still uncertain. Post-natal day 7 (P7) rats received a single injection of propofol 30 mg/kg intraperitoneally (i.p.), and neuroapoptosis of hippocampal astrocytes was analyzed by immunofluorescence and scanning electron microscopy. The differential expression of rno-miR-665, BCL2L1 (Bcl-xl), and cleaved caspase 3 (CC3) was surveyed by qRT-PCR and western blotting. In addition, the utility of A-1155463, a highly potent and BCL2L1-selective antagonist, was aimed to assess the contribution of BCL2L1 for neuroglial survival. Following the intraventricular injection of lentivirus rno-miR-665, neuroprotection was detected by 5-point scale measurement. The single dose of propofol 30 mg/kg triggered dose-dependent apoptosis of developing hippocampal astrocytes. Meanwhile, propofol triggered both rno-miR-665 and CC3, and depressed BCL2L1, which was predicted as one target gene of rno-miR-665. Combination treatment with A-1155463 and propofol induced lower mRNA and protein levels of BCL2L1 and more CC3 activation than propofol treatment alone in vivo. The lentivirus-mediated knockdown of rno-miR-665 elevated BCL2L1 and attenuated CC3 levels, whereas up-regulation of rno-miR-665 suppressed BCL2L1 and induced CC3 expression in vivo. More importantly, rno-miR-665 antagomir infusion improved neurological outcomes of pups receiving propofol during the brain growth spurt. Rno-miR-665, providing a potential target for alternative therapeutics for pediatric anesthesia, is susceptible to propofol by negatively targeting antiapoptotic BCL2L1. Relatively little is known about the association between exposure of astrocytes to brief propofol
International Nuclear Information System (INIS)
Seong, J. S.
1997-01-01
To analyze the involvement of apoptosis regulatory genes p53, p21 waf1/cip1 , bax and bcl-2 in induction of apoptosis by radiation in murine tumors. The radiation-sensitive ovarian carcinoma OCa-I and the radiation-resistant hepatocarcinoma HCa-I were used. Tumors, 8mm in diameter, were irradiated with 25Gy and at various times after irradiation, ranging from 1 to 48 h, were analyzed histologically for apoptosis and by western blot for alterations in the expression of these genes. The p53 status of the tumors were determined by the polymerase chain reaction-single strand conformation polymorphism assay. Both tumors were positive for wild-type p53. Radiation induced apoptosis in OCa-I but not in HCa-I. Apoptosis developed rapidly, peaked at 2 h after irradiation and returned to almost the background level at 48 h. In OCa-I radiation upregulated the expression of p53, p21 waf1/cip1 , and the bcl-2/bax ratio was decreased. In HCa-I radiation increased the expression of both p53 and p21 waf1/cip1 , although the increase of the latter was small. The bcl-2/bax ratio was greatly increased. In general the observed changes occurred within a few hours after irradiation, and either preceded or coincided with development of apoptosis. The development of apoptosis required upregulation of both p53 and p21 waf1/cip1 as well as a decrease in bcl-2/bax ratio. In contrast, an increase in bcl-2/bax ratio prevented apoptosis in the presence of upregulated p53 and p21 waf1/cip1 . These findings identified the involvement of multiple oncogenes in apoptosis regulation in vivo and demonstrate the complexity that may be associated with the use of a single oncogene assessment for predicting the outcome of cancer therapy with cytotoxic agents. (author)
Energy Technology Data Exchange (ETDEWEB)
Seong, J S [Yonsei Univ., Seoul (Korea, Republic of). Coll. of Medicine; Hunter, N R; Milas, L [Texas Univ., Houston, TX (United States)
1997-09-01
To analyze the involvement of apoptosis regulatory genes p53, p21{sup waf1/cip1}, bax and bcl-2 in induction of apoptosis by radiation in murine tumors. The radiation-sensitive ovarian carcinoma OCa-I and the radiation-resistant hepatocarcinoma HCa-I were used. Tumors, 8mm in diameter, were irradiated with 25Gy and at various times after irradiation, ranging from 1 to 48 h, were analyzed histologically for apoptosis and by western blot for alterations in the expression of these genes. The p53 status of the tumors were determined by the polymerase chain reaction-single strand conformation polymorphism assay. Both tumors were positive for wild-type p53. Radiation induced apoptosis in OCa-I but not in HCa-I. Apoptosis developed rapidly, peaked at 2 h after irradiation and returned to almost the background level at 48 h. In OCa-I radiation upregulated the expression of p53, p21{sup waf1/cip1}, and the bcl-2/bax ratio was decreased. In HCa-I radiation increased the expression of both p53 and p21{sup waf1/cip1}, although the increase of the latter was small. The bcl-2/bax ratio was greatly increased. In general the observed changes occurred within a few hours after irradiation, and either preceded or coincided with development of apoptosis. The development of apoptosis required upregulation of both p53 and p21{sup waf1/cip1} as well as a decrease in bcl-2/bax ratio. In contrast, an increase in bcl-2/bax ratio prevented apoptosis in the presence of upregulated p53 and p21{sup waf1/cip1}. These findings identified the involvement of multiple oncogenes in apoptosis regulation in vivo and demonstrate the complexity that may be associated with the use of a single oncogene assessment for predicting the outcome of cancer therapy with cytotoxic agents. (author).
p53 in differentiation of thyroid cancer
International Nuclear Information System (INIS)
Seyama, Toshio; Ito, Takashi; Akiyama, Mitoshi; Hayashi, Yuzo; Dohi, Kiyohiko.
1993-01-01
P53 is a tumor suppressor gene with such a recessive nature and is inactivated in many carcinomas. DNA was extracted from 10 primary papillary adenocarcinomas and eight undifferentiated carcinomas of the thyroid, using three 5 μm sliced paraffin segments, and then amplified by PCR. The products were analyzed for mutations in the p53 gene exons 5 to 8 by the direct sequencing method and for allelic deletion by the RFLP method. In five human thyroid carcinomas, DNA was extracted from each tissue and analyzed. Mutations in the p53 gene exons 5 to 8 and p53 gene deletions were not detected in the 10 papillary adenocarcinomas, mutations were detected in seven of eight cases and allelic deletions was detected in three of the five cases examined. In each of the five cases which had both differentiated and undifferentiated tissues in the same tumor, p53 gene mutations were not detected in the differentiated tissues while mutations and gene deletions were detected in the undifferentiated sections. The p53 gene was analyzed using paraffin-embedded tissues by the combined use of the direct sequencing and PCR methods and by the RFLP method. It was found that the progression of human thyroid carcinoma is closely related to the p53 genetic changes. Furthermore, the analysis of differentiated and undifferentiated tissues in the same tumor showed that human undifferentiated thyroid carcinomas develop from differentiated carcinomas. (J.P.N.)
He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang
2010-08-27
P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
Kharazmi, Sara; Ataie Kachoie, Elham; Behjatnia, Seyed Ali Akbar
2016-05-01
The betasatellite DNA associated with Cotton leaf curl Multan virus (CLCuMB) contains a single complementary-sense ORF, βC1, which is a pathogenicity determinant. CLCuMB was able to replicate in plants in the presence of diverse helper geminiviruses, including Tomato leaf curl virus-Australia (TLCV-Au), Iranian isolate of Tomato yellow leaf curl virus (TYLCV-[Ab]), and Beet curly top virus (BCTV-Svr), and can be used as a plant gene delivery vector. To test the hypothesis that CLCuMB has the potential to act as an animal gene delivery vector, a specific insertion construct was produced by the introduction of a human B-cell lymphoma 2 (Bcl-2) cDNA into a mutant DNA of CLCuMB in which the βC1 was deleted (β∆C1). The recombinant βΔC1-Bcl-2 construct was successfully replicated in tomato and tobacco plants in the presence of TLCV-Au, BCTV-Svr and TYLCV-[Ab]. Real-time PCR and Western blot analyses of plants containing the replicative forms of recombinant βΔC1-Bcl-2 DNA showed that Bcl-2 gene was expressed in an acceptable level in these plants, indicating that β∆C1 can be used as a tool to deliver and express animal genes in plants. This CLCuMB-based system, having its own promoter activity, offers the possibility of production of animal recombinant proteins in plants.
Ishida, M; Gomyo, Y; Ohfuji, S; Ikeda, M; Kawasaki, H; Ito, H
1997-05-01
To examine in vivo the validity of the results of experiments in vitro, we analyzed the relationship between p53 gene status and apoptotic cell death of human gastric intestinal-type adenocarcinomas. Surgical specimens were classified into two categories: 18 gastric cancers with nuclear p53 protein (A), and 17 gastric cancers without nuclear p53 protein (B). Polymerase chain reaction-single strand conformation polymorphism disclosed a shifted band that corresponded to a mutation in the p53 gene in 13 cases (72%) in category A and 3 cases (18%) in category B, the frequency being significantly higher in the former (P terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL). The TUNEL index [TI; (the number of TUNEL-positive apoptotic cells/the total number of tumor cells) x 100] was 3.8 +/- 1.4% in category A and 4.9 +/- 1.2% in category B, the value being significantly lower in the former (P gastric cancer, in accordance with the previous in vitro finding that p53 gene mutation provides a possible selective advantage for tumor cell proliferation, and (2) apoptosis is related not only to expression of p53 and the stage of the cell cycle, but also to p53-independent and cell cycle-independent events.
International Nuclear Information System (INIS)
Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang
2008-01-01
Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)
Galvão, Hebel Cavalcanti; Gordón-Núñez, Manuel Antonio; de Amorim, Rivadavio Fernandes Batista; Freitas, Roseana de Almeida; de Souza, Lelia Batista
2013-01-01
Even though odontogenic cysts share a similar histogenesis, they show different growth and differentiation profile due to differences in the proliferative cellular activity. We perform an immunohistochemical assessment of protein 53 (p53), proliferating cell nuclear antigen (PCNA), B-cell lymphoma 2 (bcl-2), and murine double minute 2 (MDM2) expression in odontogenic cysts and keratocystic odontogenic tumor analyzing their correlation with the biological behavior of these lesions. By the streptavidin-biotin-peroxidase method with antibodies against p53, PCNA, bcl-2, and MDM2 proteins, 11 radicular cysts, 11 dentigerous cysts, and 11 keratocystic odontogenic tumor were analyzed. The non-parametric Mann-Whitney U-test and Kruskall-Wallis test (P ≤ 0.05) were used to analyze the data. Immunopositivity for PCNA was observed in all cases appraised, predominantly in the suprabasal layer of keratocystic odontogenic tumor epithelial lining (SD ± 19.44), but no significant differences were found among the groups of lesions. Bcl-2 immunoexpression was observed especially in the basal layer of keratocystic odontogenic tumor. PCNA LI was significantly higher than bcl-2 LI in keratocystic odontogenic tumor. MDM2 and p53 immunoexpression were not detected in the lesions studied. Among the evaluated lesions, the keratocystic odontogenic tumor showed different immunoexpression of the proliferation and apoptosis markers. The results of this study suggest that the keratocystic odontogenic tumor presents distinct biological behavior of the odontogenic cysts, as for the processes of proliferation, apoptosis, and differentiation, reinforcing the information in favor of the neoplastic nature of this lesion.
Directory of Open Access Journals (Sweden)
Alfredo Ribeiro-Silva
2003-06-01
Full Text Available O p53 é um gene regulador chave do ciclo celular que, quando sofre mutações, leva ao desenvolvimento de neoplasias, atuando, portanto, como um gene supressor tumoral em condições normais. Recentemente foram identificados genes homólogos ao p53 denominados p73 e p63, provavelmente oriundos de um gene ancestral comum. Apesar da grande homologia estrutural, os membros da família do p53 possuem diferenças funcionais entre si. O presente artigo tem por finalidade discorrer sobre os principais aspectos estruturais e funcionais do p73 e do p63, ressaltando seus papéis na tumorigênese humana. O p73 ativa vários genes responsivos ao p53 e, quando superexpresso, inibe a ação do p53. Raramente encontra-se mutado em neoplasias, e seu papel na tumorigênese humana ainda é motivo de controvérsias. O p63 não é um gene supressor tumoral clássico, sendo essencial para a manutenção de uma população de células precursoras (células-tronco em vários tecidos epiteliais. O p63 marca as células basais de vários órgãos epiteliais, como a pele e a próstata, podendo ser considerado um marcador de indiferenciação celular. O p63 é um marcador recentemente descrito e ainda requer maior investigação para determinar seu papel no desenvolvimento de neoplasias em humanos.The p53 gene has a key role in the cell cycle control. When mutated, it promotes the development of neoplasms, acting in so far as a tumor suppressor gene in normal conditions. Recently, genes homologue to p53 were identified, named p73 e p63, probably originated from a common ancestral gene. Despite the great structural homology, the members of p53 family have functional differences. This article aims to discourse about the major structural and functional aspects of p73 and p63, reinforcing their role in human tumorigenesis. P73 activates several p53 responsive genes and, when overexpressed, inhibits the p53 action. It is rarely mutated in neoplasms and its role in human
Targeting MUC1-C suppresses BCL2A1 in triple-negative breast cancer.
Hiraki, Masayuki; Maeda, Takahiro; Mehrotra, Neha; Jin, Caining; Alam, Maroof; Bouillez, Audrey; Hata, Tsuyoshi; Tagde, Ashujit; Keating, Amy; Kharbanda, Surender; Singh, Harpal; Kufe, Donald
2018-01-01
B-cell lymphoma 2-related protein A1 (BCL2A1) is a member of the BCL-2 family of anti-apoptotic proteins that confers resistance to treatment with anti-cancer drugs; however, there are presently no agents that target BCL2A1. The MUC1-C oncoprotein is aberrantly expressed in triple-negative breast cancer (TNBC) cells, induces the epithelial-mesenchymal transition (EMT) and promotes anti-cancer drug resistance. The present study demonstrates that targeting MUC1-C genetically and pharmacologically in TNBC cells results in the downregulation of BCL2A1 expression. The results show that MUC1-C activates the BCL2A1 gene by an NF-κB p65-mediated mechanism, linking this pathway with the induction of EMT. The MCL-1 anti-apoptotic protein is also of importance for the survival of TNBC cells and is an attractive target for drug development. We found that inhibiting MCL-1 with the highly specific MS1 peptide results in the activation of the MUC1-C→NF-κB→BCL2A1 pathway. In addition, selection of TNBC cells for resistance to ABT-737, which inhibits BCL-2, BCL-xL and BCL-W but not MCL-1 or BCL2A1, is associated with the upregulation of MUC1-C and BCL2A1 expression. Targeting MUC1-C in ABT-737-resistant TNBC cells suppresses BCL2A1 and induces death, which is of potential therapeutic importance. These findings indicate that MUC1-C is a target for the treatment of TNBCs unresponsive to agents that inhibit anti-apoptotic members of the BCL-2 family.
DEFF Research Database (Denmark)
Savelyeva, I.; Dobbelstein, M.
2011-01-01
to the suppression of p21 transcription. Depending on the E1A conserved region 3, E1B-defective adenovirus impaired the ability of the transcription factor Sp1 to bind the p21 promoter. Moreover, the amino terminal region of E1A, binding the acetyl transferases p300 and CREB-binding protein, blocked p53 K382...... accumulation of p53, without obvious defects in p53 localization, phosphorylation, conformation and oligomerization. Nonetheless, p53 completely failed to induce its target genes in this scenario, for example, p21/CDKN1A, Mdm2 and PUMA. Two regions of the E1A gene products independently contributed...... acetylation in infected cells. Mutating either of these E1A regions, in addition to E1B, partially restored p21 mRNA levels. Our findings argue that adenovirus attenuates p53-mediated p21 induction, through at least two E1B-independent mechanisms. Other virus species and cancer cells may employ analogous...
Directory of Open Access Journals (Sweden)
Wei Xu
2010-08-01
Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
The Transcriptional Landscape of p53 Signalling Pathway
Directory of Open Access Journals (Sweden)
Chizu Tanikawa
2017-06-01
Full Text Available Although recent cancer genomics studies have identified a large number of genes that were mutated in human cancers, p53 remains as the most frequently mutated gene. To further elucidate the p53-signalling network, we performed transcriptome analysis on 24 tissues in p53+/+ or p53−/− mice after whole-body X-ray irradiation. Here we found transactivation of a total of 3551 genes in one or more of the 24 tissues only in p53+/+ mice, while 2576 genes were downregulated. p53 mRNA expression level in each tissue was significantly associated with the number of genes upregulated by irradiation. Annotation using TCGA (The Cancer Genome Atlas database revealed that p53 negatively regulated mRNA expression of several cancer therapeutic targets or pathways such as BTK, SYK, and CTLA4 in breast cancer tissues. In addition, stomach exhibited the induction of Krt6, Krt16, and Krt17 as well as loricrin, an epidermal differentiation marker, after the X-ray irradiation only in p53+/+ mice, implying a mechanism to protect damaged tissues by rapid induction of differentiation. Our comprehensive transcriptome analysis elucidated tissue specific roles of p53 and its signalling networks in DNA-damage response that will enhance our understanding of cancer biology.
Targeting the p53 Pathway in Ewing Sarcoma
Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.
2011-01-01
The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471
NGF-mediated transcriptional targets of p53 in PC12 neuronal differentiation
Directory of Open Access Journals (Sweden)
Labhart Paul
2007-05-01
Full Text Available Abstract Background p53 is recognized as a critical regulator of the cell cycle and apoptosis. Mounting evidence also suggests a role for p53 in differentiation of cells including neuronal precursors. We studied the transcriptional role of p53 during nerve growth factor-induced differentiation of the PC12 line into neuron-like cells. We hypothesized that p53 contributed to PC12 differentiation through the regulation of gene targets distinct from its known transcriptional targets for apoptosis or DNA repair. Results Using a genome-wide chromatin immunoprecipitation cloning technique, we identified and validated 14 novel p53-regulated genes following NGF treatment. The data show p53 protein was transcriptionally activated and contributed to NGF-mediated neurite outgrowth during differentiation of PC12 cells. Furthermore, we describe stimulus-specific regulation of a subset of these target genes by p53. The most salient differentiation-relevant target genes included wnt7b involved in dendritic extension and the tfcp2l4/grhl3 grainyhead homolog implicated in ectodermal development. Additional targets included brk, sdk2, sesn3, txnl2, dusp5, pon3, lect1, pkcbpb15 and other genes. Conclusion Within the PC12 neuronal context, putative p53-occupied genomic loci spanned the entire Rattus norvegicus genome upon NGF treatment. We conclude that receptor-mediated p53 transcriptional activity is involved in PC12 differentiation and may suggest a contributory role for p53 in neuronal development.
Directory of Open Access Journals (Sweden)
Zanatta Daniela B
2010-06-01
Full Text Available Abstract Background Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. Methods B16 (mouse melanoma and C6 (rat glioma cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Results Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet
International Nuclear Information System (INIS)
Merkel, Christian A; Silva Soares, Rafael B da; Carvalho, Anna Carolina V de; Zanatta, Daniela B; Bajgelman, Marcio C; Fratini, Paula; Costanzi-Strauss, Eugenia; Strauss, Bryan E
2010-01-01
Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. B16 (mouse melanoma) and C6 (rat glioma) cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet p53 was further activated by the combination of p19
p53 and the pathogenesis of skin cancer
International Nuclear Information System (INIS)
Benjamin, Cara L.; Ananthaswamy, Honnavara N.
2007-01-01
The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients
Loss of p53 induces M-phase retardation following G2 DNA damage checkpoint abrogation.
Minemoto, Yuzuru; Uchida, Sanae; Ohtsubo, Motoaki; Shimura, Mari; Sasagawa, Toshiyuki; Hirata, Masato; Nakagama, Hitoshi; Ishizaka, Yukihito; Yamashita, Katsumi
2003-04-01
Most cell lines that lack functional p53 protein are arrested in the G2 phase of the cell cycle due to DNA damage. When the G2 checkpoint is abrogated, these cells are forced into mitotic catastrophe. A549 lung adenocarcinoma cells, in which p53 was eliminated with the HPV16 E6 gene, exhibited efficient arrest in the G2 phase when treated with adriamycin. Administration of caffeine to G2-arrested cells induced a drastic change in cell phenotype, the nature of which depended on the status of p53. Flow cytometric and microscopic observations revealed that cells that either contained or lacked p53 resumed their cell cycles and entered mitosis upon caffeine treatment. However, transit to the M phase was slower in p53-negative cells than in p53-positive cells. Consistent with these observations, CDK1 activity was maintained at high levels, along with stable cyclin B1, in p53-negative cells. The addition of butyrolactone I, which is an inhibitor of CDK1 and CDK2, to the p53-negative cells reduced the floating round cell population and induced the disappearance of cyclin B1. These results suggest a relationship between the p53 pathway and the ubiquitin-mediated degradation of mitotic cyclins and possible cross-talk between the G2-DNA damage checkpoint and the mitotic checkpoint.
International Nuclear Information System (INIS)
Wang Jianhua; Wang Feng; Liu Yongping; Zhang Yaping; Ni Yan; Li Shirong
2008-01-01
Objective: To evaluate the effect of exogenous wild type p53 (wtp53) gene on radiosensitivity of human lung adenocarcinoma cell line under hypoxia. Methods: Human lung adenocarcinoma cell line A549 was transfected with adenovirus carrying recombinant exogenous wtp53. Four irradiation groups were studied: normal cell (Group A), wtp53 transfected cell (Group B), normal cell under hypoxia (Group C) and wtp53 transfected cell under hypoxia(Group D). Cells were irradiated with 9 MeV electron beams. Cellular survival fraction was analyzed. Multi-target single-hit model was used to plot the survival curve. D 0 , D q , oxygen enhancement ratio (OER), sensitizing enhancement ratio (SER) and other parameters were used to evaluate the effects of wtp53 gene on radiosensitivity of A549. The cell apoptotic rate of each group was examined by flow cytometry. Results: OER was 1.75 and 0.81 before and after wtp53 transfection. SER was 1.77 in oxic circumstance and 3.84 under hypoxia. The cell apoptotic rate of Group A and B was lower than Group C and D (F=7.92, P=0.048), with Group A lower than B and Group C lower than D (F=82.50, P=0.001). But Group B and D were similar(t=2.04, P=0.111). Conclusions: Hypoxia can increase the radiation resistance of lung adenocarcinoma cell line A549. The wtp53 can promote apoptosis and improve tumor radiosensitivity, especially under hypoxia. (authors)
International Nuclear Information System (INIS)
Lu Qin; Niu Huanzhang; Zhu Guangyu; An Yanli; Qiu Dinghong; Teng Gaojun
2007-01-01
Objective: To investigate the function of transferrin-DNA complex, transported by transferrin(Tf) and trans-arterial injection via interventional approach be the duel-target-orientated delivery and the transferring into malignant cells to get more effective therapy. Methods: p53-LipofectAMINE ligand with different concentrations of Tf (0, 10, 25, 50, 100 μg)transfected the 4 strains including LM6,Hep3B,YY and L02 in vitro to evaluate the gene transfection efficiency through western blot. Then, after setting up the VX2 hepatocarcinoma models, we delivered the Tf-p53-LipofectAMlNE complex into the hepatic arteries via interventional techniques to analyse the transfection efficiency in vivo. Results: Tf, within the range of l0 100 μg, could increase gene transfection efficiency mediated by liposome, and the efficiency increases with the raise of Tf concentration. Combination with interventional technique to inject Tf-DNA complex into tumor arteries, gene transfection efficiency was enhanced in rabbit models. Conclusion: Tf can enhance gene-liposome transfection efficiency, furthermore with combination of interventional catheter technique, there would be a potential duel-target-orientated gene therapy method. (authors)
Energy Technology Data Exchange (ETDEWEB)
Qin, Lu; Huanzhang, Niu; Guangyu, Zhu; Yanli, An; Dinghong, Qiu; Gaojun, Teng [Radiologic Department, Zhongda Hospital, Southeast Univ., Nanjing (China)
2007-02-15
Objective: To investigate the function of transferrin-DNA complex, transported by transferrin(Tf) and trans-arterial injection via interventional approach be the duel-target-orientated delivery and the transferring into malignant cells to get more effective therapy. Methods: p53-LipofectAMINE ligand with different concentrations of Tf (0, 10, 25, 50, 100 {mu}g)transfected the 4 strains including LM6,Hep3B,YY and L02 in vitro to evaluate the gene transfection efficiency through western blot. Then, after setting up the VX2 hepatocarcinoma models, we delivered the Tf-p53-LipofectAMlNE complex into the hepatic arteries via interventional techniques to analyse the transfection efficiency in vivo. Results: Tf, within the range of l0 100 {mu}g, could increase gene transfection efficiency mediated by liposome, and the efficiency increases with the raise of Tf concentration. Combination with interventional technique to inject Tf-DNA complex into tumor arteries, gene transfection efficiency was enhanced in rabbit models. Conclusion: Tf can enhance gene-liposome transfection efficiency, furthermore with combination of interventional catheter technique, there would be a potential duel-target-orientated gene therapy method. (authors)
The contribution of p53 and Y chromosome long arm genes to regulation of apoptosis in mouse testis.
Lech, Tomasz; Styrna, Józefa; Kotarska, Katarzyna
2018-03-01
Apoptosis of excessive or defective germ cells is a natural process occurring in mammalian testes. Tumour suppressor protein p53 is involved in this process both in developing and adult male gonads. Its contribution to testicular physiology is known to be modified by genetic background. The aim of this study was to evaluate the combined influence of the p53 and Y chromosome long arm genes on male germ cell apoptosis. Knockout of the transformation related protein 53 (Trp53) gene was introduced into congenic strains: B10.BR (intact Y chromosome) and B10.BR-Ydel (Y chromosome with a deletion in the long arm). The level of apoptosis in the testes of 19-day-old and 3-month-old male mice was determined using the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick-end labelling (TUNEL) method. The study revealed that although p53 is involved in germ cell apoptosis in peripubertal testes, this process can also be mediated by p53-independent mechanisms. However, activation of p53-independent apoptotic pathways in the absence of the p53 protein requires engagement of the multicopy Yq genes and was not observed in gonads of B10.BR-Ydel-p53-/- males. The role of Yq genes in the regulation of testicular apoptosis seems to be restricted to the initial wave of spermatogenesis and is not evident in adult gonads. The study confirmed, instead, that p53 does participate in spontaneous apoptosis in mature testes.
Molecular mechanism of X-ray-induced p53-dependent apoptosis
Energy Technology Data Exchange (ETDEWEB)
Nakano, Hisako [Tokyo Metropolitan Inst. of Medical Center (Japan)
1999-03-01
Radiation-induced cell death has been classified into the interphase- and mitotic-ones, both of which apoptosis involving. This review described the molecular mechanism of the apoptosis, focusing on its p53-dependent process. It is known that there are genes regulating cell death either negatively or positively and the latter is involved in apoptosis. As an important factor in the apoptosis, p53 has become remarkable since it was shown that X-ray-induced apoptosis required RNA and protein syntheses in thymocytes and those cells of p53 gene-depleted mouse were shown to be resistant to gamma-ray-induced apoptosis. Radiation sensitivity of MOLT-4 cells derived from human T cell leukemia, exhibiting the typical X-ray-induced p53-dependent apoptosis, depends on the levels of p53 mRNA and protein. p53 is a gene suppressing tumor and also a transcription factor. Consequently, mutation of p53 conceivably leads to the failure of cell cycle regulation, which allows damaged cells to divide without both repair and exclusion due to loss of the apoptotic mechanism, and finally results in carcinogenesis. The radiation effect occurs in the order of the cell damage, inhibition of p53-Mdm2 binding, accumulation of p53, activation of mdm2 transcription, Mdm2 accumulation, p53-protein degradation and recovery to the steady state level. Here, the cystein protease (caspases) plays an important role as a disposing mechanism for cells scheduled to die. However, many are unknown to be solved in future. (K.H.) 119 refs.
International Nuclear Information System (INIS)
Hara, Takamitsu; Omura-Minamisawa, Motoko; Chao Cheng; Nakagami, Yoshihiro; Ito, Megumi; Inoue, Tomio
2005-01-01
Purpose: Bcl-2, an inhibitor of apoptosis frequently shows elevated expression in human tumors, thus resulting in resistance to radiation therapy. Therefore, inhibiting Bcl-2 function may enhance the radiosensitivity of tumor cells. Tetrocarcin A (TC-A) and bcl-2 antisense oligonucleotides exhibit antitumor activity by inhibiting Bcl-2 function and transcription, respectively. We investigated whether these antitumor agents would enhance the cytotoxic effects of radiation in tumor cells overexpressing Bcl-2. Methods and materials: We used HeLa/bcl-2 cells, a stable Bcl-2-expressing cell line derived from wild-type HeLa (HeLa/wt) cells. Cells were incubated with TC-A and bcl-2 antisense oligonucleotides for 24 h after irradiation, and cell viability was then determined. Apoptotic cells were quantified by flow cytometric assay. Results: The HeLa/bcl-2 cells were more resistant to radiation than HeLa/wt cells. At concentrations that are not inherently cytotoxic, both TC-A and bcl-2 antisense oligonucleotides increased the cytotoxic effects of radiation in HeLa/bcl-2 cells, but not in HeLa/wt cells. However, in HeLa/bcl-2 cells, additional treatment with TC-A in combination with radiation did not significantly increase apoptosis. Conclusions: The present results suggest that TC-A and bcl-2 antisense oligonucleotides reduce radioresistance of tumor cells overexpressing Bcl-2. Therefore, a combination of radiotherapy and Bcl-2 inhibitors may prove to be a useful therapeutic approach for treating tumors that overexpress Bcl-2
Effect of bcl-2 overexpression in mice on ovotoxicity caused by 4-vinylcyclohexene
International Nuclear Information System (INIS)
Flaws, Jodi A.; Marion, Samuel L.; Miller, Kimberly P.; Christian, Patricia J.; Babus, Janice K.; Hoyer, Patricia B.
2006-01-01
The occupational chemical 4-vinylcyclohexene (VCH) destroys small preantral ovarian follicles in mice following repeated daily dosing. The cell survival gene bcl-2 is thought to protect against follicular death during embryogenesis because primordial follicle numbers in newborn bcl-2 overexpressing (OE) mice are greater than in wild-type (WT) controls. Thus, this study was designed to determine if overexpression of bcl-2 protects against VCH-induced follicle loss during embryonic development. Pregnant bcl-2 OE or WT mice were dosed (p.o.) daily with VCH (500 mg/kg) or sesame oil (vehicle control) on days 8-18 of pregnancy. Ovaries were collected from moms and female pups on pup postnatal day (PND) 8. Nonpregnant OE and WT females were also treated with VCH (500 mg/kg p.o.) or vehicle and evaluated in the same manner. As previously reported, ovaries from PND8 OE female pups contained 50% more primordial follicles than WT pups (P < 0.05). Unlike WT pups, relative to vehicle controls, in utero exposure to VCH resulted in a reduction in primordial (25% of control), primary (38% of control), and secondary (33% of control) follicles in ovaries of OE pups (P < 0.05). VCH had no significant effect on follicle numbers in OE or WT moms. Conversely, in nonpregnant adults, VCH did not affect WT mice but caused loss of primordial (55% of control), primary (51% of control), and secondary (69% of control) follicles in OE mice (P < 0.05). These results demonstrate that bcl-2 overexpression does not protect against, but instead increases susceptibility to VCH-induced follicle loss in transplacentally exposed or in nonpregnant mice
International Nuclear Information System (INIS)
Wiese, Claudia; Pierce, Andrew J.; Gauny, Stacey S.; Jasin, Maria; Kronenberg, Amy
2001-01-01
Homology-directed repair (HDR) of DNA double-strand breaks (DSBs) is a well-established mechanism that contributes to the maintenance of genomic stability in rodent cells, and it has been assumed that HDR is of similar importance in the repair of DSBs in human cells. However, in addition to promoting genomic stability, some outcomes of homologous recombination can be deleterious, suggesting that factors exist to regulate HDR. We previously demonstrated that overexpression of BCL-2 or BCL-xL enhanced the frequency of x-ray-induced mutations involving the TK1 locus, including loss of heterozygosity (LOH) events presumed to arise by mitotic recombination. The present study was designed to test whether HDR is a prominent DSB repair pathway in human cells, and to directly determine whether ectopic expression of BCL-xL affects HDR. We used the B-lymphoblastoid cell line TK6, which expresses wild-type TP53 and resembles normal lymphocytes in undergoing apoptosis following genotoxic stress. U sing isogenic derivatives of TK6 cells (TK6-neo, TK6-bcl-xL), we find that a DSB in an integrated HDR reporter stimulates gene conversion 40-50-fold in TK6-neo cells, demonstrating that a DSB can be efficiently repaired by gene conversion in human cells. Significantly, DSB-induced gene conversion events are 3- to 4-fold more frequent in BCL-xL overexpressing cells. The results demonstrate that HDR plays an important role in maintaining genomic integrity in human cells and that ectopic expression of BCL-xL enhances HDR of DSBs. To our knowledge, this is the first study to highlight a function for BCL-xL in modulating DSB repair in human cells
Overexpression of p53, MDM2 proteins in some atr radiation-induced skin ulcers
International Nuclear Information System (INIS)
Gu Qingyang; Gao Yabing; Wang Dewen; Cui Yufang; Zhao Po; Yang Zhixiang; Zhou Jie
2000-01-01
An animal model of radiation-induced skin ulcer was set up with 140 rats, which were locally irradiated with 35-55 Gy γ-rays. The pathological changes were observed for 1 year. Immunohistochemical studies were performed in 72 rat radiation skin ulcer specimens using anti-p53 and anti-MDM2 proteins polyclonal antibodies. The results showed that the positive rate for overexpression of p53 protein was 9.7%, and for that of MDM2 was 19.4%. The overexpression of p53 was mainly seen in the nuclei of activated squamous epithelial cells, and in fibroblasts, endotheliocytes in deeper part of the skin ulcers. The overexpression of MDM2 had the same localizations. It is suggested that the changes of p53 and MDM2, genes and proteins, may be related to the cancer transformation and poor healing of radiation-induced skin ulcers
Directory of Open Access Journals (Sweden)
Steven N Reuland
Full Text Available Metastatic melanoma has poor prognosis and is refractory to most conventional chemotherapies. The alkylating agent temozolomide (TMZ is commonly used in treating melanoma but has a disappointing response rate. Agents that can act cooperatively with TMZ and improve its efficacy are thus highly sought after. The BH3 mimetic ABT-737, which can induce apoptosis by targeting pro-survival Bcl-2 family members, has been found to enhance the efficacy of many conventional chemotherapeutic agents in multiple cancers. We found that combining TMZ and ABT-737 induced strong synergistic apoptosis in multiple human melanoma cell lines. When the drugs were used in combination in a mouse xenograft model, they drastically reduced tumor growth at concentrations where each individual drug had no significant effect. We found that TMZ treatment elevated p53 levels, and that the pro-apoptotic protein Noxa was elevated in TMZ/ABT-737 treated cells. Experiments with shRNA demonstrated that the synergistic effect of TMZ and ABT-737 was largely dependent on Noxa. Experiments with nutlin-3, a p53 inducer, demonstrated that p53 induction was sufficient for synergistic cell death with ABT-737 in a Noxa-dependent fashion. However, p53 was not necessary for TMZ/ABT-737 synergy as demonstrated by a p53-null line, indicating that TMZ and ABT-737 together induce Noxa in a p53-independent fashion. These results demonstrate that targeting anti-apoptotic Bcl-2 members is a promising method for treating metastatic melanoma, and that clinical trials with TMZ and Bcl-2 inhibitors are warranted.
Directory of Open Access Journals (Sweden)
Tayebeh Hamzehloie
2012-03-01
Full Text Available The gene TP53 (also known as protein 53 or tumor protein 53, encoding transcription factor P53, is mutated or deleted in half of human cancers, demonstrating the crucial role of P53 in tumor suppression. There are reports of nearly 250 independent germ line TP53 mutations in over 100 publications. The P53 protein has the structure of a transcription factor and, is made up of several domains. The main function of P53 is to organize cell defense against cancerous transformation. P53 is a potent transcription factor that is activated in response to diverse stresses, leading to the induction of cell cycle arrest, apoptosis or senescence. The P53 tumor suppressor is negatively regulated in cells by the murine double minute 2 (MDM2 protein. Murine double minute 2 favors its nuclear export, and stimulates its degradation. Inhibitors of the P53-MDM2 interaction might be attractive new anticancer agents that could be used to activate wild-type P53 in tumors. Down regulation of MDM2 using an small interfering RNA (siRNA approach has recently provided evidence for a new role of MDM2 in the P53 response, by modulating the inhibition of the cyclin dependent kinase 2 (cdk2 by P21/WAF1 (also known as cyclin-dependent kinase inhibitor 1 or CDK-interacting protein 1.
International Nuclear Information System (INIS)
Chen, W.; Barthelman, M.; Martinez, J.; Alberts, D.; Gensler, H.L.
1997-01-01
Mutations or alterations in the p53 gene have been observed in 50-100% of ultraviolet light (UV)-induced squamous cell carcinoma in humans and animals. Most of the mutations occurred at dipyrimidine sequences, suggesting that pyrimidine dimers in the p53 gene play a role in the pathogenesis of cutaneous squamous cell carcinoma. We previously showed that topical alpha-tocopherol prevents UV-induced skin carcinogenesis in the mouse. In the present study we asked whether topical alpha-tocopherol reduces the level of UV-induced cyclobutane pyrimidine dimers in the murine epidermal p53 gene. Mice received six dorsal applications of 25 mg each of alpha-tocopherol, on alternate days, before exposure to 500 J/m2 of UV-B irradiation. Mice were killed at selected times after irradiation. The level of dimers in the epidermal p53 gene was measured using the T4 endonuclease V assay with quantitative Southern hybridization. Topical alpha-tocopherol caused a 55% reduction in the formation of cyclobutane pyrimidine dimers in the epidermal p53 gene. The rate of reduction of pyrimidine dimers between 1 and 10 hours after irradiation was similar in UV-irradiated mice, regardless of alpha-tocopherol treatment. Therefore, the lower level of cyclobutane pyrimidine dimers in UV-irradiated mice treated with alpha-tocopherol than in control UV-irradiated mice resulted from the prevention of formation of the dimers, and not from enhanced repair of these lesions. Our results indicate that alpha-tocopherol acts as an effective sunscreen in vivo, preventing the formation of premutagenic DNA lesions in a gene known to be important in skin carcinogenesis
Directory of Open Access Journals (Sweden)
Yousif A. Asiri
2010-01-01
Full Text Available Cyclophosphamide (CP is a widely used drug in cancer chemotherapy and immunosuppression, which could cause toxicity of the normal cells due to its toxic metabolites. Probucol, a cholesterol-lowering drug, acts as potential inhibitor of DNA damage and shows to protect against doxorubicin-induced cardiomyopathy by enhancing the endogenous antioxidant system including glutathione peroxidase, catalase and superoxide dismutase. This study examined the possible protective effects of probucol, a lipid-lowering compound with strong antioxidant properties, against CPinduced cardiotoxicity. This objective could be achieved through studying the gene expression-based on the possible protective effects of probucol against CP-induced cardiac failure in rats. Adult male Wistar albino rats were assigned into four treatment groups: Animals in the first (control and second (probucol groups were injected intraperitoneally with corn oil and probucol (61 mg/kg/day, respectively, for two weeks. Animals in the third (CP and fourth (probucol plus CP groups were injected with the same doses of corn oil and probucol (61 mg/kg/day, respectively, for one week before and one week after a single dose of CP (200 mg/kg, I.P.. The p53, Bax, Bcl2 and oxidative genes signal expression were measured by real time PCR. CP-induced cardiotoxicity was clearly observed by a significant increase in serum creatine phosphokinase isoenzyme (CK-MB (117%, lactate dehydrogenase (LDH (64%, free (69% and esterified cholesterol (42% and triglyceride (69% compared to control group. In cardiac tissues, CP significantly increases the mRNA expression levels of apoptotic genes, p53 with two-fold and Bax with 1.6-fold, and decreases the anti-apoptotic gene Bcl2 with 0.5-fold. Moreover, CP caused downregulation of antioxidant genes, glutathione peroxidase, catalase, and superoxide dismutase and increased the lipid peroxidation and decreased adenosine triphosphate (ATP (40% and ATP/ADP (44% in cardiac
The expanding universe of p53 targets.
Menendez, Daniel; Inga, Alberto; Resnick, Michael A
2009-10-01
The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.
White, Elizabeth A; Walther, Johanna; Javanbakht, Hassan; Howley, Peter M
2014-08-01
The genus beta human papillomaviruses (beta HPVs) cause cutaneous lesions and are thought to be involved in the initiation of some nonmelanoma skin cancers (NMSCs), particularly in patients with the genetic disorder epidermodysplasia verruciformis (EV). We have previously reported that at least two of the genus beta HPV E6 proteins bind to and/or increase the steady-state levels of p53 in squamous epithelial cells. This is in contrast to a well-characterized ability of the E6 proteins of cancer-associated HPVs of genus alpha HPV, which inactivate p53 by targeting its ubiquitin-mediated proteolysis. In this study, we have investigated the ability of genus beta E6 proteins from eight different HPV types to block the transactivation of p53 target genes following DNA damage. We find that the E6 proteins from diverse beta HPV species and types vary in their capacity to block the induction of MDM2, p21, and proapoptotic genes after genotoxic stress. We conclude that some genus beta HPV E6 proteins inhibit at least some p53 target genes, although perhaps not by the same mechanism or to the same degree as the high-risk genus alpha HPV E6 proteins. This study addresses the ability of various human papillomavirus E6 proteins to block the activation of p53-responsive cellular genes following DNA damage in human keratinocytes, the normal host cell for HPVs. The E6 proteins encoded by the high-risk, cancer-associated HPV types of genus alpha HPV have a well-established activity to target p53 degradation and thereby inhibit the response to DNA damage. In this study, we have investigated the ability of genus beta HPV E6 proteins from eight different HPV types to block the ability of p53 to transactivate downstream genes following DNA damage. We find that some, but not all, genus beta HPV E6 proteins can block the transactivation of some p53 target genes. This differential response to DNA damage furthers the understanding of cutaneous HPV biology and may help to explain the
Effect of radiation combined with p53 gene therapy and endostatin on mouse prostate cancer
International Nuclear Information System (INIS)
Zhang Min; Ren Jun; Xu Bo; Gao Xianshu; He Zhisong; He Xiaoming; Zhang Ming; Liu Chaoxing; He Xinyong; Cao Guangming; Zhang Shaolong
2009-01-01
Objective: To test the hypothesis that p53 gene therapy combined with endostatin can enhance tumor response to radiation therapy of RM-1 mouse xenograft prostate cancer and to investigate its mechanism. Methods: A mouse prostate cancer model was established. Then mice with xenograft tumor were randomly divided into group A (control), B (radiation), C (radiation and rAdp53), D (radiation and rh-endostatin) and E (radiation and rAdp53 and rhendostatin). On day 1, rAdp53 was injected intra-tumorously with 1 x 10 10 vp per animal to group C and E. From day 1 to 14, rh-endostatin was given 15 mg/kg intraperitoneally daily to group D and E. On day 4 single fraction of 15 Gy was given to tumors in groups B, C, D and E. Normal saline was injected intra-tumorously or intraperitoneaUy accordingly as control. No treatment was done to group A. Tumor volume was measured daily. Samples were collected on Days 5, 10 and 15. Ki67, CD31, p53 and VEGF were detected by means of immunohistochemistry. Results: (1) Radiation alone, radiation combined with intra-tumorous injection of Adp53 and/or intraperitoneal injection of rhendostatin resulted in tumor growth arrest of RM-1 cells in vivo (P = 0.000). Radiation combined with both rAdp53 and rhendostatin was the most effective treatment (P < 0.05). (2) All the four treatment groups had a decreased expression of mutant type P53 (P = 0.000). The expression of Ki67 in groups B and C were equal (P 0.05) and increasing (P = 0.000), respectively. Group D had a up-down-up curve (P < 0.05), but group E had a up-down one. On day 5 the expresion of VEGF in group E was the lowest (P < 0.05). An increased expression of MVD compared with the control was shown, and MVD in groups C, D and E were always higher than that in the control (P < 0.05). Conclusions: The limitation of radiotherapy could be overcome by combination with beth p53 gene therapy and endostatin on the growth of mouse prostate cancer cell. Radiation, rAdp53 and endostatin have their
Gao, Meili; Li, Yongfei; Ji, Xiaoying; Xue, Xiaochang; Chen, Lan; Feng, Guodong; Zhang, Huqin; Wang, Huichun; Shah, Walayat; Hou, Zhanwu; Kong, Yu
2016-03-01
Epidemiological studies have demonstrated that cigarette smoking is an important cofactor or an independent risk factor for the development of cervical cancer. Benzo(a)pyrene (BaP) is one of the most potent tobacco smoke carcinogens in tobacco smoke. BaP induced DNA damage and over expression in p53 cervical tissue of mice as demonstrated in our previous study. Here we present the findings of exposure to BaP on the expression of Bcl-2, C-myc, Ki-67, Caspase-3 and Bax genes in mouse cervix. Acute intraperitoneal administration of BaP (12.5, 25, 50, 100mg/kg body weight) to ICR female mice induced a significant increase in Bcl-2, C-myc, Ki-67 mRNA and protein level till 72h except in Bcl-2 at 24h with 12.5, 25, 50mg/kg as well as at 48h with 12.5mg/kg body weight post treatment. A significant increase was also seen in Caspase-3 and Bax mRNA and protein level with peak level at 24h and gradual decrease till 72h, however, the expression of caspase-3 increased while that of Bax decreased with increasing dose of Bap after 24h. In sub chronic intraperitoneal and oral gavage administration of BaP (2.5, 5, 10mg/kg body weight), similar significant increase was observed for all the examined genes as compared to the control and vehicle groups, however the expression of Bax decreased in a dose dependent manner. The findings of this study will help in further understanding the molecular mechanism of BaP induced carcinogenesis of cervical cancer. Copyright © 2015 Elsevier GmbH. All rights reserved.
Preliminary study of p53 and c-erbB-2 expression in gallbladder cancer in Indian patients
Directory of Open Access Journals (Sweden)
Singh Usha
2006-05-01
Full Text Available Abstract Background The inactivation of the tumour suppressor gene and activation of the proto-oncogene are the key steps in the development of the human cancer. The p53 and c-erbB-2 are the best examples of it. In the present study, our aim was to determine the role of these genes in the carcinogenesis of gallbladder by immunohistochemistry. Methods In all 78 consecutive patients of gall bladder diseases were studied for p53 and c-erbB-2 expression immunohistochemically and their expression was correlated with the age, grades and stages of the disease and presence of stone. An informed consent was obtained in each case. Chi square and z test were applied to see the association of p53 and c-erbB-2 over expression with other clinicopathological factors. Results Eight (20% patients of gall bladder cancer were positive for p53 expression and 10 (25% patients for c-erbB-2. The p53 positivity increased with increasing grade while cerbB-2 positivity decreased with increasing grade of gall bladder cancer. Mean age in cerbB-2 positive cases were lesser as compared to negative cases while p53 did not show such association with age. Conclusion Only one case of gall bladder cancer co-expressed the p53 and c-erbB-2, thereby suggesting that p53 and c-erbB-2 may have independent role in carcinogenesis of gall bladder cancer. c-erbB-2 over expression in adenoma and younger age group indicates its role as an early event in carcinogenesis of gallbladder. However study of larger sample is required to further validate the results.
Zeng, Ke-Wu; Liao, Li-Xi; Zhao, Ming-Bo; Song, Fang-Jiao; Yu, Qian; Jiang, Yong; Tu, Peng-Fei
2015-03-15
Protosappanin B (PTB) is a bioactive dibenzoxocin derivative isolated from Caesalpinia sappan L. Here, we investigated the neuroprotective effects and the potential mechanisms of PTB on oxygen-glucose deprivation (OGD)-injured PC12 cells. Results showed that PTB significantly increased cell viability, inhibited cell apoptosis and up-regulated the expression of growth-associated protein 43 (a marker of neural outgrowth). Moreover, our study revealed that PTB effectively maintained mitochondrial homeostasis by up-regulation of mitochondrial membrane potential (MMP), inhibition of cytochrome c release from mitochondria and inactivation of mitochondrial caspase-9/3 apoptosis pathway. Further study showed that PTB significantly promoted cytoplasmic component degradation of p53 protein, a key negative regulator for mitochondrial function, resulting in a release of Bcl-2 from p53-Bcl-2 complex and an enhancing translocation of Bcl-2 to mitochondrial outer membrane. Finally, we found the degradation of p53 protein was induced by PTB via activation of a MDM2-dependent ubiquitination process. Taken together, our findings provided a new viewpoint of neuronal protection strategy for anoxia and ischemic injury with natural small molecular dibenzoxocin derivative by activating ubiquitin-dependent p53 protein degradation as well as increasing mitochondrial function. Copyright © 2015 Elsevier B.V. All rights reserved.
Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells.
Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi
2018-05-18
The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.
P53-dependent upregulation of neutral sphingomyelinase-2: role in doxorubicin-induced growth arrest.
Shamseddine, A A; Clarke, C J; Carroll, B; Airola, M V; Mohammed, S; Rella, A; Obeid, L M; Hannun, Y A
2015-10-29
Neutral sphingomyelinase-2 (nSMase2) is a ceramide-generating enzyme that has been implicated in growth arrest, apoptosis and exosome secretion. Although previous studies have reported transcriptional upregulation of nSMase2 in response to daunorubicin, through Sp1 and Sp3 transcription factors, the role of the DNA damage pathway in regulating nSMase2 remains unclear. In this study, we show that doxorubicin induces a dose-dependent induction of nSMase2 mRNA and protein with concomitant increases in nSMase activity and ceramide levels. Upregulation of nSMase2 was dependent on ATR, Chk1 and p53, thus placing it downstream of the DNA damage pathway. Moreover, overexpression of p53 was sufficient to transcriptionally induce nSMase2, without the need for DNA damage. DNA-binding mutants as well as acetylation mutants of p53 were unable to induce nSMase2, suggesting a role of nSMase2 in growth arrest. Moreover, knockdown of nSMase2 prevented doxorubicin-induced growth arrest. Finally, p53-induced nSMase2 upregulation appears to occur via a novel transcription start site upstream of exon 3. These results identify nSMase2 as a novel p53 target gene, regulated by the DNA damage pathway to induce cell growth arrest.
p53 downregulates the Fanconi anaemia DNA repair pathway.
Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck
2016-04-01
Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.
Chromatin-Bound MDM2 Regulates Serine Metabolism and Redox Homeostasis Independently of p53.
Riscal, Romain; Schrepfer, Emilie; Arena, Giuseppe; Cissé, Madi Y; Bellvert, Floriant; Heuillet, Maud; Rambow, Florian; Bonneil, Eric; Sabourdy, Frédérique; Vincent, Charles; Ait-Arsa, Imade; Levade, Thierry; Thibaut, Pierre; Marine, Jean-Christophe; Portais, Jean-Charles; Sarry, Jean-Emmanuel; Le Cam, Laurent; Linares, Laetitia K
2016-06-16
The mouse double minute 2 (MDM2) oncoprotein is recognized as a major negative regulator of the p53 tumor suppressor, but growing evidence indicates that its oncogenic activities extend beyond p53. Here, we show that MDM2 is recruited to chromatin independently of p53 to regulate a transcriptional program implicated in amino acid metabolism and redox homeostasis. Identification of MDM2 target genes at the whole-genome level highlights an important role for ATF3/4 transcription factors in tethering MDM2 to chromatin. MDM2 recruitment to chromatin is a tightly regulated process that occurs during oxidative stress and serine/glycine deprivation and is modulated by the pyruvate kinase M2 (PKM2) metabolic enzyme. Depletion of endogenous MDM2 in p53-deficient cells impairs serine/glycine metabolism, the NAD(+)/NADH ratio, and glutathione (GSH) recycling, impacting their redox state and tumorigenic potential. Collectively, our data illustrate a previously unsuspected function of chromatin-bound MDM2 in cancer cell metabolism. Copyright © 2016 Elsevier Inc. All rights reserved.
Emanuels, AG; Koudstaal, J; Burger, MPM; Hollema, H
To offer more tailored treatment to individual patients with squamous cell carcinoma of the vulval more accurate prediction of lymph node metastases is required. As p53 and mdm2 are genes known to be involved in the development of other tumours, we studied expression of p53 and mdm2 in
International Nuclear Information System (INIS)
Min Fengling; Zhang Hong; Li Wenjian; Liu Bing; Zhou Qingming; Duan Xin; Gao Qingxiang
2007-01-01
Objective: To investigate the effect of low dose irradiation on gene transfer efficiency and the effect of adenoviral-mediated exogenous P53 overexpression on apoptosis and radiosensitivity of radioresistant human melanoma cell lines A375(wild type p53)and WM983a(mutant type p53). Methods: Control vector, a replication deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein (AdCMV-GFP), was used to transfect A375 cells and WM983a cells preirradiated with or without 1 Gy X-ray. The transduction efficiency of GFP gene was determined with fluorescence microscope directly. These two types of cells irradiated by 1 Gy X-ray were transfected with a replication deficient recombinant adenoviral vector carrying human wild p53 (AdCMV-p53), and mRNA level was detected by RT-PCR. The cell cycle delay and the expression of exogenous P53 were detected using flow cytometry (FCM) at different times after transfection. Tunel technique was used to detect cell apoptosis. The radiosensivity of A375 and WM983a cells after p53 transduction was analyzed by colony formation. Results: It is found that 1 Gy irradiation increased the gene transfection efficiency of A375 and WM983a cells. The expression of exogenous P53 was found to range from 60% to 80% among transfected cells during the first three days after transduction and then declined continuously down to the control level on day 10. G 1 cell cycle arrest was also observed after p53 gene transduction. WM983a cells transfected with p53 showed higher sensitivity to X-ray-induced cell killing than A375 cells. Conclusions: It is indicated that low dose of ionizing radiation can improve gene transfection efficiency of A375 and WM983a cells mediated by adenovirus vector. Althrough the overexpresion of exogenous p53 may not inhibit cell growth and induce apoptosis of melanoma cell line A375 and WM983a irt vitro, the two cell lines are much more sensitive to cell death induced by irradiation. It is
Palmitate induces VSMC apoptosis via toll like receptor (TLR)4/ROS/p53 pathway.
Zhang, Yuanjun; Xia, Guanghao; Zhang, Yaqiong; Liu, Juxiang; Liu, Xiaowei; Li, Weihua; Lv, Yaya; Wei, Suhong; Liu, Jing; Quan, Jinxing
2017-08-01
Toll-like receptor 4 (TLR4) has been implicated in vascular inflammation, as well as in the pathogenesis of atherosclerosis and diabetes. Vascular smooth muscle cell (VSMC) apoptosis has been shown to induce plaque vulnerability in atherosclerosis. Previous studies reported that palmitate induced apoptosis in VSMCs; however, the role of TLR4 in palmitate-induced apoptosis in VSMCs has not yet been defined. In this study, we investigated whether or not palmitate-induced apoptosis depended on the activation of the TLR4 pathway. VSMCs were treated with or without palmitate, CRISPR/Cas9z-mediated genome editing methods were used to deplete TLR4 expression, while NADPH oxidase inhibitors were used to inhibit reactive oxygen species (ROS) generation. Cell apoptosis was detected by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay, ROS was measured using the 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA) method, the mRNA and protein expression levels of caspase 3, caspase 9, BCL-2 and p53 were studied by real-time polymerase chain reaction (RT-PCR) and ELISA. Palmitate significantly promotes VSMC apoptosis, ROS generation, and expression of caspase 3, caspase 9 and p53; while NADPH oxidase inhibitor pretreatment markedly attenuated these effects. Moreover, knockdown of TLR4 significantly blocked palmitate-induced ROS generation and VSMC apoptosis accompanied by inhibition of caspase 3, caspase 9, p53 expression and restoration of BCL-2 expression. Our results suggest that palmitate-induced apoptosis depends on the activation of the TLR4/ROS/p53 signaling pathway, and that TLR4 may be a potential therapeutic target for the prevention and treatment of atherosclerosis. Copyright © 2017 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Visco, Carlo; Wang, Jinfen; Tisi, Maria Chiara
2017-01-01
apoptotic pathways, have higher proliferative index, and lack BCL2 translocations. CONCLUSIONS: HCV-positive DLBCL have distinct molecular and pathological features compared to the HCV-negative counterparts.British Journal of Cancer advance online publication, 26 September 2017; doi:10.1038/bjc.2017.345 www.bjcancer.com....... in lymphomagenesis, as witnessed by the curative potential of antiviral therapy in HCV-related low-grade B-cell lymphomas. METHODS: We performed a case-control study including 44 HCV-positive cases of de novo DLBCL, comparing them with 132 HCV-negative patients as controls (ratio 3 to 1). Cases and controls were...... for MYC, BCL2 and BCL6, TP53 mutations, and diagnostic specimens reviewed to exclude transformation from low-grade lymphoma. RESULTS: Compared to the HCV-negative controls, patients with HCV-positive de novo DLBCL had differential expression of genes that regulate innate immune response and modulate...
Directory of Open Access Journals (Sweden)
Maria Dirlei F. S. Begnami
2005-08-01
Full Text Available INTRODUÇÃO: Em nosso meio, os carcinomas gástricos ainda são neoplasias bastante freqüentes e responsáveis por altas taxas de mortalidade. Recentemente, têm-se demonstrado a expressão de p53 e a amplificação do gene c-erb-B2 nos carcinomas gástricos. A relevância e o significado biológico destas alterações ainda não foram totalmente estabelecidos. OBJETIVO: Estudar as expressões imuno-histoquímicas de p53 e c-erb-B2 em 482 casos de carcinomas gástricos. MATERIAL E MÉTODOS: Foram construídos três blocos de tissue microarray (TMA utilizando-se duplicatas de 482 casos de carcinomas gástricos. Os cortes foram corados por hematoxilina e eosina (HE, tendo sido feita pesquisa para p53 e c-erb-B2. Foram considerados positivos para p53 os casos com marcação nuclear em mais de 10% das células tumorais. Para o c-erb-B2 foram considerados positivos os casos com marcação de membrana completa em mais de 10% das células tumorais. RESULTADOS: A expressão de p53 e c-erb-B2 foi observada em 30% e 12% dos casos, respectivamente. Em relação aos tipos histológicos observou-se correlação entre os carcinomas do tipo intestinal e a expressão de c-erb-B2 (p INTRODUCTION: Gastric cancer is one of the commonest cancers in our country being responsible for a high mortality rate. Recently, the expression of p53 and amplification of c-erb-B2 gene have been described in gastric carcinoma. The relevance and biological significance of these findings are not established yet. OBJECTIVE: The authors investigated p53, c-erb-B2 immunohistochemical expression in 482 cases of gastric carcinomas. MATERIAL AND METHODS: Tissue microarray (TMA blocks were designed using replicate samples of paraffin-embedded tissue from 482 gastric carcinomas. Sections were stained with HE, and antibodies to p53 and c-erb-B2. Cases were considered p53 positive if nuclear staining was detected in > 10% of the tumor cells. Cases were assessed c-erb-B2 positive if the
Werner, Tamara V.; Hart, Martin; Nickels, Ruth; Kim, Yoo-Jin; Menger, Michael D.; Bohle, Rainer M.; Keller, Andreas; Ludwig, Nicole; Meese, Eckart
2017-01-01
Micro (mi)RNAs are short, noncoding RNAs and deregulation of miRNAs and their targets are implicated in tumor generation and progression in many cancers. Meningiomas are mostly benign, slow growing tumors of the central nervous system with a small percentage showing a malignant phenotype. Following in silico prediction of potential targets of miR-34a-3p, SMAD4, FRAT1, and BCL2 have been confirmed as targets by dual luciferase assays with co-expression of miR-34a-3p and reporter gene constructs containing the respective 3'UTRs. Disruption of the miR-34a-3p binding sites in the 3'UTRs resulted in loss of responsiveness to miR-34a-3p overexpression. In meningioma cells, overexpression of miR-34a-3p resulted in decreased protein levels of SMAD4, FRAT1 and BCL2, while inhibition of miR-34a-3p led to increased levels of these proteins as confirmed by Western blotting. Furthermore, deregulation of miR-34a-3p altered cell proliferation and apoptosis of meningioma cells in vitro. We show that SMAD4, FRAT1 and BCL2 are direct targets of miR-34a-3p and that deregulation of miR-34a-3p alters proliferation and apoptosis of meningioma cells in vitro. As part of their respective signaling pathways, which are known to play a role in meningioma genesis and progression, deregulation of SMAD4, FRAT1 and BCL2 might contribute to the aberrant activation of these signaling pathways leading to increased proliferation and inhibition of apoptosis in meningiomas. PMID:28340489
Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena; Spiotto, Michael T
2016-01-01
p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways.
International Nuclear Information System (INIS)
Wang, Feng; Shi, Yongli; Yadav, Santosh; Wang, He
2010-01-01
Arsenic is a well-recognized human carcinogen that causes a number of malignant diseases, including lung cancer. Previous studies have indicated that cyclin D1 is frequently over-expressed in many cancer types. It is also known that arsenite exposure enhances cyclin D1 expression, which involves NF-κB activation. However, the mechanism between cyclin D1 and the NF-κB pathway has not been well studied. This study was designed to characterize the underlying mechanism of induced cell growth and cyclin D1 expression in response to low concentration sodium arsenic (NaAsO 2 ) exposure through the NF-κB pathway. Cultured human bronchial epithelial cells, BEAS-2B, were exposed to low concentration sodium arsenite for the indicated durations, and cytotoxicity, gene expression, and protein activity were assessed. To profile the canonical and non-canonical NF-κB pathways involved in cell growth and cyclin D1 expression induced by low concentration arsenite, the NF-κB-specific inhibitor-phenethyl caffeate (CAPE) and NF-κB2 mRNA target sequences were used, and cyclin D1 expression in BEAS-2B cells was assessed. Our results demonstrated that exposure to low concentration arsenite enhanced BEAS-2B cells growth and cyclin D1 mRNA and protein expression. Activation and nuclear localization of p52 and Bcl3 in response to low concentration arsenite indicated that the non-canonical NF-κB pathway was involved in arsenite-induced cyclin D1 expression. Moreover, we further demonstrated that p52/Bcl3 complex formation enhanced cyclin D1 expression through the cyclin D1 gene promoter via its κB site. The up-regulation of cyclin D1 mediated by the p52-Bcl3 complex in response to low concentration arsenite might be important in assessing the health risk of low concentration arsenite and understanding the mechanisms of the harmful effects of arsenite.
Increased sensitivity of p53-deficient cells to anticancer agents due to loss of Pms2
Fedier, A; Ruefenacht, U B; Schwarz, V A; Haller, U; Fink, D
2002-01-01
A large fraction of human tumours carries mutations in the p53 gene. p53 plays a central role in controlling cell cycle checkpoint regulation, DNA repair, transcription, and apoptosis upon genotoxic stress. Lack of p53 function impairs these cellular processes, and this may be the basis of resistance to chemotherapeutic regimens. By virtue of the involvement of DNA mismatch repair in modulating cytotoxic pathways in response to DNA damaging agents, we investigated the effects of loss of Pms2 on the sensitivity to a panel of widely used anticancer agents in E1A/Ha-Ras-transformed p53-null mouse fibroblasts either proficient or deficient in Pms2. We report that lack of the Pms2 gene is associated with an increased sensitivity, ranging from 2–6-fold, to some types of anticancer agents including the topoisomerase II poisons doxorubicin, etoposide and mitoxantrone, the platinum compounds cisplatin and oxaliplatin, the taxanes docetaxel and paclitaxel, and the antimetabolite gemcitabine. In contrast, no change in sensitivity was found after treatment with 5-fluorouracil. Cell cycle analysis revealed that both, Pms2-deficient and -proficient cells, retain the ability to arrest at the G2/M upon cisplatin treatment. The data indicate that the concomitant loss of Pms2 function chemosensitises p53-deficient cells to some types of anticancer agents, that Pms2 positively modulates cell survival by mechanisms independent of p53, and that increased cytotoxicity is paralleled by increased apoptosis. Tumour-targeted functional inhibition of Pms2 may be a valuable strategy for increasing the efficacy of anticancer agents in the treatment of p53-mutant cancers. British Journal of Cancer (2002) 87, 1027–1033. doi:10.1038/sj.bjc.6600599 www.bjcancer.com © 2002 Cancer Research UK PMID:12434296
International Nuclear Information System (INIS)
Golubovskaya, Vita M; Ho, Baotran; Zheng, Min; Magis, Andrew; Ostrov, David; Morrison, Carl; Cance, William G
2013-01-01
Focal Adhesion Kinase (FAK) is a 125 kDa non-receptor kinase that plays a major role in cancer cell survival and metastasis. We performed computer modeling of the p53 peptide containing the site of interaction with FAK, predicted the peptide structure and docked it into the three-dimensional structure of the N-terminal domain of FAK involved in the complex with p53. We screened small molecule compounds that targeted the site of the FAK-p53 interaction and identified compounds (called Roslins, or R compounds) docked in silico to this site. By different assays in isogenic HCT116p53 + / + and HCT116 p53 - / - cells we identified a small molecule compound called Roslin 2 (R2) that bound FAK, disrupted the binding of FAK and p53 and decreased cancer cell viability and clonogenicity in a p53-dependent manner. In addition, dual-luciferase assays demonstrated that the R2 compound increased p53 transcriptional activity that was inhibited by FAK using p21, Mdm-2, and Bax-promoter targets. R2 also caused increased expression of p53 targets: p21, Mdm-2 and Bax proteins. Furthermore, R2 significantly decreased tumor growth, disrupted the complex of FAK and p53, and up-regulated p21 in HCT116 p53 + / + but not in HCT116 p53 - / - xenografts in vivo. In addition, R2 sensitized HCT116p53 + / + cells to doxorubicin and 5-fluorouracil. Thus, disruption of the FAK and p53 interaction with a novel small molecule reactivated p53 in cancer cells in vitro and in vivo and can be effectively used for development of FAK-p53 targeted cancer therapy approaches
Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.
Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom
2012-01-01
The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.
Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.
Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine
2009-06-17
P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.
Dendritic cell fate is determined by BCL11A
Ippolito, Gregory C.; Dekker, Joseph D.; Wang, Yui-Hsi; Lee, Bum-Kyu; Shaffer, Arthur L.; Lin, Jian; Wall, Jason K.; Lee, Baeck-Seung; Staudt, Louis M.; Liu, Yong-Jun; Iyer, Vishwanath R.; Tucker, Haley O.
2014-01-01
The plasmacytoid dendritic cell (pDC) is vital to the coordinated action of innate and adaptive immunity. pDC development has not been unequivocally traced, nor has its transcriptional regulatory network been fully clarified. Here we confirm an essential requirement for the BCL11A transcription factor in fetal pDC development, and demonstrate this lineage-specific requirement in the adult organism. Furthermore, we identify BCL11A gene targets and provide a molecular mechanism for its action in pDC commitment. Embryonic germ-line deletion of Bcl11a revealed an absolute cellular, molecular, and functional absence of pDCs in fetal mice. In adults, deletion of Bcl11a in hematopoietic stem cells resulted in perturbed yet continued generation of progenitors, loss of downstream pDC and B-cell lineages, and persisting myeloid, conventional dendritic, and T-cell lineages. Challenge with virus resulted in a marked reduction of antiviral response in conditionally deleted adults. Genome-wide analyses of BCL11A DNA binding and expression revealed that BCL11A regulates transcription of E2-2 and other pDC differentiation modulators, including ID2 and MTG16. Our results identify BCL11A as an essential, lineage-specific factor that regulates pDC development, supporting a model wherein differentiation into pDCs represents a primed “default” pathway for common dendritic cell progenitors. PMID:24591644
Energy Technology Data Exchange (ETDEWEB)
Cappadone, C., E-mail: concettina.cappadone@unibo.it [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Stefanelli, C. [Department for Life Quality Studies, University of Bologna, Rimini Campus, Rimini (Italy); Malucelli, E. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Zini, M. [Department of Biomedical and Neuromotor Sciences, University of Bologna, Bologna (Italy); Onofrillo, C. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Locatelli, A.; Rambaldi, M.; Sargenti, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Merolle, L. [ELETTRA–Sincrotrone Trieste S.C.p.A., Trieste (Italy); Farruggia, G. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy); Graziadio, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Montanaro, L. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Iotti, S. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy)
2015-11-13
Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.
International Nuclear Information System (INIS)
Cappadone, C.; Stefanelli, C.; Malucelli, E.; Zini, M.; Onofrillo, C.; Locatelli, A.; Rambaldi, M.; Sargenti, A.; Merolle, L.; Farruggia, G.; Graziadio, A.; Montanaro, L.; Iotti, S.
2015-01-01
Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.
Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J
2012-04-05
Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.
Expression of Bcl-2, Melan A and HMB-45 in Dysplastic Nevi.
Patrascu, Oana Maria; Costache, Mariana; Dumitru, Adrian Vasile; Mehotin, Corina Nicoleta; Sajin, Maria; Lazaroiu, Anca Mihaela
2016-03-01
From the first recognition of dysplastic nevi as a pathology per se, many debates have been raised and many histological and immunohistological studies have been conducted in order to establish the true significance of these lesions. Therefore, the aim of this study was to establish if there is a correlation between HMB-45, Melan A and Bcl-2 expression and the grade of dysplasia, as well as between the marker's staining patterns. Ten dysplastic nevi from six female patients were selected and their histological features (size, dysplasia), as well as the immunohistological staining patterns, were studied (HMB-45, Melan A, Bcl-2). The Pearson correlation coefficient and regression was calculated with Windows Excel Data Analysis. We demonstrated that there was a notable correlation between the dysplasia and the size of the lesions (r(8)= 0.62 with p-value= 0.052), and also between Melan A and Bcl-2 (a r(6)= 0.73, p0.05). We can affirm, at least in our cases, there is a correlation between the grade of dysplasia and the size of the lesion, and also, that there is a correlation between Melan A and Bcl-2 staining, explained by MITF gene. These results were only partial concordant with those in other studies, therefore a larger number of cases is recommended to be further analyzed in order to clearly draw a conclusion.
Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H
2014-07-10
Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.
Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT
Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.
2015-01-01
Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455
Directory of Open Access Journals (Sweden)
Zhihong CHEN
2011-10-01
Full Text Available Background and objective It has been proven that p53 gene was related to many human cancers. The mutations in p53 gene play an important role in carcinogensis and mostly happened in exon 5-8. The aim of this study is to establish a high resolution melting (HRM assay to detect p53 mutations from patients with non-small cell lung cancer (NSCLC, to investigate the characteristics of p53 gene mutations, and to analyze the relationship between p53 mutations and evolution regularity of pathogenesis. Methods p53 mutations in exon 5-8 were detected by HRM assay on DNA insolated from 264 NSCLC samples derived from tumor tissues and 54 control samples from pericancerous pulmonary tissues. The mutation samples by the HRM assay were confirmed by sequencing technique. Samples which were positive by HRM but wild type by sequencing were further confirmed by sub-clone and sequencing. Results No mutation was found in 54 pericancerous pulmonary samples by HRM assay. 104 of the 264 tumor tissues demonstrated mutation curves by HRM assay, 102 samples were confirmed by sequencing, including 95 point mutations and 7 frame shift mutations by insertion or deletion. The mutation rate of p53 gene was 39.4%. The mutation rate from exon 5-8 were 11.7%, 8%, 12.5% and 10.6%, respectively and there was no statistically significant difference between them (P=0.35. p53 mutations were significantly more frequent in males than that in females, but not related to the other clinicopathologic characteristics. Conclusion The results indicate that HRM is a sensitive in-tube methodology to detect for mutations in clinical samples. The results suggest that the arising p53 mutations in NSCLC may be due to spontaneous error in DNA synthesis and repair.
Bladder-like graphical representation of p53 gene alterations in some human cancers
International Nuclear Information System (INIS)
Helal, N.L.; Dorrah, M.; LI, C.
2005-01-01
the p53 tumor suppressor gene is mutated in about half of all human cancer cells. These mutations are not only important in tumor progression but apparently also in the response of some tumors to chemotherapy and radiation treatment, thus to clinical outcome. Recent studies have shown that cells carrying p53 mutations are more resistant to radiation and chemotherapy than cells with functional p53. More than 15000 tumors with Tp53 mutations were published, leadingto the description of more than 1500 different Tp53 mutants (at the site http:// p53. curie.fr). To exploit this huge bulk of data, specific analytic tools were highly warranted. Also, new computational techniques for rapid determination of such information and comparative studies of different mutations are required. In the present study, a mathematical method for the IARC library p53 mutation database comparing p53 mutations occurring in four different cancers was described. The sizes of the four cancers in the database were bladder (860), liver (786), brain (1170) and skin (38) cancers, for a total of 2854 of p53 mutations. The study was carried out on exons 4-8 of p53 for the four cancers under investigation. From this study, it can be quantitatively obtained some information for each characteristic sequence. The data showed that exon 8 was the most mutant exon in skin cancer and exon 7 was the lowest one. In hepatocellular carcinoma, exon 4 was the most mutant exon and exon 7 was the lowest mutant exon. Brain cancer showed high mutation in exon 8 and low mutation at exon 6. Finally, bladder mutation was mostly mutated at exon 6 comparing to the least value of exon 7. It is expected that this study of p53 mutation may provide useful information for the diagnosis, prognosis and treatment of cancer
Divergent evolution of human p53 binding sites: cell cycle versus apoptosis.
Directory of Open Access Journals (Sweden)
Monica M Horvath
2007-07-01
Full Text Available The p53 tumor suppressor is a sequence-specific pleiotropic transcription factor that coordinates cellular responses to DNA damage and stress, initiating cell-cycle arrest or triggering apoptosis. Although the human p53 binding site sequence (or response element [RE] is well characterized, some genes have consensus-poor REs that are nevertheless both necessary and sufficient for transactivation by p53. Identification of new functional gene regulatory elements under these conditions is problematic, and evolutionary conservation is often employed. We evaluated the comparative genomics approach for assessing evolutionary conservation of putative binding sites by examining conservation of 83 experimentally validated human p53 REs against mouse, rat, rabbit, and dog genomes and detected pronounced conservation differences among p53 REs and p53-regulated pathways. Bona fide NRF2 (nuclear factor [erythroid-derived 2]-like 2 nuclear factor and NFkappaB (nuclear factor of kappa light chain gene enhancer in B cells binding sites, which direct oxidative stress and innate immunity responses, were used as controls, and both exhibited high interspecific conservation. Surprisingly, the average p53 RE was not significantly more conserved than background genomic sequence, and p53 REs in apoptosis genes as a group showed very little conservation. The common bioinformatics practice of filtering RE predictions by 80% rodent sequence identity would not only give a false positive rate of approximately 19%, but miss up to 57% of true p53 REs. Examination of interspecific DNA base substitutions as a function of position in the p53 consensus sequence reveals an unexpected excess of diversity in apoptosis-regulating REs versus cell-cycle controlling REs (rodent comparisons: p < 1.0 e-12. While some p53 REs show relatively high levels of conservation, REs in many genes such as BAX, FAS, PCNA, CASP6, SIVA1, and P53AIP1 show little if any homology to rodent sequences. This
Yin, W J; Zhu, X; Yang, H Y; Sun, W Y; Wu, M J
2018-01-08
Objective: To investigate the impact of clinicopathological features, gene rearrangements and protein expression of bcl-6, bcl-2, C-MYC and chemotherapy regime on the prognosis of patients with primary central nervous system diffuse large B-cell lymphoma (PCNS-DLBCL). Methods: Thirty-three cases of PCNS-DLBCL diagnosed from January 2006 to December 2016 at Zhejiang Cancer Hospital were collected. The expression of CD10, bcl-6, bcl-2, MUM1 and MYC were detected by immunohistochemical staining (IHC). The presence of EB virus was detected by in situ hybridization(EBER). Copy number variation (ICN) and translocation status of bcl-6, bcl-2 and C-MYC genes were detected by fluorescence in situ hybridization (FISH). The relationship between the above indexes and the prognosis was analyzed by univariate, bivariate survival analysis and multiple Cox hazard regression analysis. Results: The study included 33 patients of PCNS-DLBCL, without evidence of primary or secondary immunodeficient disease. Male to female ratio was 1.36∶1.00, and the average age was 56 years. Twenty cases had single lesion while 13 had multiple lesions. Deep brain involvement was seen in 12 cases. All patients underwent partial or total tumor resection. Five patients received whole brain post-surgery radiotherapy, nine patients received high-dose methotrexate (HD-MTX) based chemotherapy, and 12 patients received whole-brain radiotherapy combined with HD-MTX based chemotherapy. Severn patients received no further treatment and rituximab was used in 8 patients. According to the Hans model, 27 cases were classified as non-GCB subtypes (81.8%). Bcl-2 was positive in 25 cases (75.8%, 25/33) and highly expressed in 8 (24.2%). MYC was positive in 12 cases (36.4%) and double expression of bcl-2 and MYC was seen in 6 cases. EBER positive rate was 10.0%(3/30), all of which had multiple lesions. Two bcl-6 gene translocations and 3 amplifications were found in 28 patients. Two translocations, 3 ICN or with both
Effect of Bcl-2 rs956572 polymorphism on age-related gray matter volume changes.
Directory of Open Access Journals (Sweden)
Mu-En Liu
Full Text Available The anti-apoptotic protein B-cell CLL/lymphoma 2 (Bcl-2 gene is a major regulator of neural plasticity and cellular resilience. Recently, the Bcl-2 rs956572 single nucleotide polymorphism was proposed to be a functional allelic variant that modulates cellular vulnerability to apoptosis. Our cross-sectional study investigated the genetic effect of this Bcl-2 polymorphism on age-related decreases in gray matter (GM volume across the adult lifespan. Our sample comprised 330 healthy volunteers (191 male, 139 female with a mean age of 56.2±22.0 years (range: 21-92. Magnetic resonance imaging and genotyping of the Bcl-2 rs956572 were performed for each participant. The differences in regional GM volumes between G homozygotes and A-allele carriers were tested using optimized voxel-based morphometry. The association between the Bcl-2 rs956572 polymorphism and age was a predictor of regional GM volumes in the right cerebellum, bilateral lingual gyrus, right middle temporal gyrus, and right parahippocampal gyrus. We found that the volume of these five regions decreased with increasing age (all P<.001. Moreover, the downward slope was steeper among the Bcl-2 rs956572 A-allele carriers than in the G-homozygous participants. Our data provide convergent evidence for the genetic effect of the Bcl-2 functional allelic variant in brain aging. The rs956572 G-allele, which is associated with significantly higher Bcl-2 protein expression and diminished cellular sensitivity to stress-induced apoptosis, conferred a protective effect against age-related changes in brain GM volume, particularly in the cerebellum.
International Nuclear Information System (INIS)
Sasaki, Masayuki; Sugio, Kenji; Kuwabara, Yasuo
2003-01-01
The FDG uptake in lung cancer is considered to reflect the degree of malignancy, while alterations of some tumor suppressor genes are considered to be related to the malignant biological behavior of tumors. The aim of this study is to examine the relationship between FDG-PET and alterations in the tumor suppression genes of lung cancer. We examined 28 patients with primary lung cancer who underwent FDG-PET before surgery consisting of 17 patients with adenocarcinoma, 10 with squamous cell carcinoma and 1 with large cell carcinoma. The FDG-PET findings were evaluated based on the standardized uptake value (SUV). Alterations in the tumor suppressor genes, Rb, p16, p27 and p53, were evaluated immunohistochemically. The FDG uptake in lung cancer with alteration in each tumor suppressor gene tended to be higher than in those genes without alterations, although the differences were not significant. In 15 tumors with alterations in either tumor suppressor genes, the FDG uptake was 6.83±3.21. On the other hand, the mean FDG uptake was 1.95 in 2 tumors without alterations in any genes. The difference in the FDG uptake between the 2 groups was statistically significant (p<0.001). In conclusion, the presence of abnormalities in the tumor suppressor genes, which results in an accelerated cell proliferation, is thus considered to increase the FDG uptake in lung cancer. (author)
International Nuclear Information System (INIS)
Wang, Chaoyun; He, Yanhao; Yang, Ming; Sun, Hongliu; Zhang, Shuping; Wang, Chunhua
2013-01-01
Intracellular reactive oxygen species (ROS) are derived from nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Angiotensin II (Ang II) can cause endothelial dysfunction by promoting intracellular ROS generation. Safflor yellow B (SYB) effectively inhibits ROS generation by upregulating Bcl-2 expression. In this study, we examined the effects of SYB on Ang II-induced injury to human umbilical vein endothelial cells (HUVECs), and elucidated the roles of NADPH oxidase and Bcl-2. We treated cultured HUVECs with Ang II, SYB, and Bcl-2 siRNA, and determined NADPH oxidase activity and ROS levels. Furthermore, cellular and mitochondrial physiological states were evaluated, and the expression levels of target proteins were analyzed. Ang II significantly enhanced intracellular ROS levels, caused mitochondrial membrane dysfunction, and decreased cell viability, leading to apoptosis. This was associated with increased expression of AT1R and p22 phox , increased NADPH oxidase activity, and an increased ratio of Bax/Bcl-2, leading to decreases in antioxidant enzyme activities, which were further strengthened after blocking Bcl-2. Compared to Ang II treatment alone, co-treatment with SYB significantly reversed HUVEC injury. Taken together, these results demonstrate that SYB could significantly protect endothelial cells from Ang II-induced cell damage, and that it does so by upregulating Bcl-2 expression and inhibiting ROS generation. - Highlights: • Angiotensin II depresses mitochondria physiological function. • Angiotensin II activates NADPH oxidase via up-regulating expresion of p22 phox . • Bcl-2 plays a pivotal role in improving mitochondria function and regulates ROS level. • Inhibitor of Bcl-2 promotes angiotensin II mediated HUVEC injury. • SYB attenuates angiotensin II mediated HUVEC injury via up regulating Bcl-2 expression
Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage
Directory of Open Access Journals (Sweden)
Rolletschek Alexandra
2009-06-01
Full Text Available Abstract Background P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. Results In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. Conclusion In embryonic stem cells where (anti-proliferative p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.
Energetic heavy ions overcome tumor radioresistance caused by overexpression of Bcl-2
International Nuclear Information System (INIS)
Hamada, Nobuyuki; Hara, Takamitsu; Omura-Minamisawa, Motoko; Funayama, Tomoo; Sakashita, Tetsuya; Sora, Sakura; Yokota, Yuichiro; Nakano, Takashi
2008-01-01
Background and purpose: Overexpression of Bcl-2 is frequent in human cancers and has been associated with radioresistance. Here we investigated the potential impact of heavy ions on Bcl-2 overexpressing tumors. Materials and methods: Bcl-2 cells (Bcl-2 overexpressing HeLa cells) and Neo cells (neomycin resistant gene-expressing HeLa cells) exposed to γ-rays or heavy ions were assessed for the clonogenic survival, apoptosis and cell cycle distribution. Results: Whereas Bcl-2 cells were more resistant to γ-rays (0.2 keV/μm) and helium ions (16.2 keV/μm) than Neo cells, heavy ions (76.3-1610 keV/μm) yielded similar survival regardless of Bcl-2 overexpression. Carbon ions (108 keV/μm) decreased the difference in the apoptotic incidence between Bcl-2 and Neo cells, and prolonged G 2 /M arrest that occurred more extensively in Bcl-2 cells than in Neo cells. Conclusions: High-LET heavy ions overcome tumor radioresistance caused by Bcl-2 overexpression, which may be explained at least in part by the enhanced apoptotic response and prolonged G 2 /M arrest. Thus, heavy-ion therapy may be a promising modality for Bcl-2 overexpressing radioresistant tumors
Westra, W. H.; Offerhaus, G. J.; Goodman, S. N.; Slebos, R. J.; Polak, M.; Baas, I. O.; Rodenhuis, S.; Hruban, R. H.
1993-01-01
Mutations in the p53 tumor suppressor gene are frequently observed in primary lung adenocarcinomas, suggesting that these mutations are critical events in the malignant transformation of airway cells. These mutations are often associated with stabilization of the p53 gene product, resulting in the
The genetic alteration of p53 in esophageal cancer
Energy Technology Data Exchange (ETDEWEB)
Cho, Jae Il; Baik, Hee Jong; Kim, Chang Min; Kim, Mi Hee [Korea Cancer Center Hospital, Seoul (Korea, Republic of)
1996-01-01
Genetic alterations in the p53 gene have been detected in various human malignancies, and its alterations inactive the function of p53 as a tumor suppressor. Point mutation and gene deletion are the main mechanisms of p53 inactivation. To determine the incidence of genetic alteration of p53 and their clinical implications in Korean patients of esophageal cancer, we investigated p53 alterations in 26 esophageal cancer tissues paired with its normal tissue by Southern blot analysis, PCR-SSCP, and direct sequencing. Allelic loss of chromosome 17p occurred in 12 out of 21 informative cases(57%) by Southern blot analysis, and 16 cases showed mobility shift in PCR-SSCP, so overall incidence of p53 gene alterations was 77%(20/26). The mutations detected was randomly dispersed over exon4-8 and was frequently G-T transversion and C:T transitions. Three identical mutations were clustered at codon 213 suggested the same etiologic agents in this cases. The p53 gene alterations play a significant role in the development of esophageal cancers, however, no relationship between p53 mutation and clinical data was detected so far. 9 refs. (Author).
Directory of Open Access Journals (Sweden)
Arindam Datta
2016-06-01
Full Text Available Mutation in TP53 is a common genetic alteration in human cancers. Certain tumor associated p53 missense mutants acquire gain-of-function (GOF properties and confer oncogenic phenotypes including enhanced chemoresistance. The colorectal cancers (CRC harboring mutant p53 are generally aggressive in nature and difficult to treat. To identify a potential gene expression signature of GOF mutant p53-driven acquired chemoresistance in CRC, we performed transcriptome profiling of floxuridine (FUdR treated SW480 cells expressing mutant p53R273H (GEO#: GSE77533. We obtained several genes differentially regulated between FUdR treated and untreated cells. Further, functional characterization and pathway analysis revealed significant enrichment of crucial biological processes and pathways upon FUdR treatment in SW480 cells. Our data suggest that in response to chemotherapeutics treatment, cancer cells with GOF mutant p53 can modulate key cellular pathways to withstand the cytotoxic effect of the drugs. The genes and pathways identified in the present study can be further validated and targeted for better chemotherapy response in colorectal cancer patients harboring mutant p53.
International Nuclear Information System (INIS)
Dai, Guodong; Peng, Tao; Zhou, Xuhong; Zhu, Jun; Kong, Zhihua; Ma, Li; Xiong, Zhi; Yuan, Yulin
2013-01-01
Highlight: •Construction of shRNA segments expression vectors is valid by the investigation of RT-PCR for IGF1R, EGFR and Bcl-xl mRNA and protein expression. •Studies have suggested that the vectors in blocking these genes of the growth factor receptors and anti- apoptosis is capable of breaking the balance of tumor growth so that tumor trend apoptosis and senescence. •Simultaneously blocking multiple genes that are abnormally expressed may be more effective in treating cancer cells than silencing a single gene. -- Abstract: Background: In previous work, we constructed short hairpin RNA (shRNA) expression plasmids that targeted human EGF and IGF-1 receptors messenger RNA, respectively, and demonstrated that these vectors could induce apoptosis of human nasopharyngeal cell lines (CNE2) and inhibit ligand-induced pAkt and pErk activation. Method: We have constructed multiple shRNA expression vectors of targeting EGFR, IGF1R and Bcl-xl, which were transfected to the CNE2 cells. The mRNA expression was assessed by RT-PCR. The growth of the cells, cell cycle progression, apoptosis of the cells, senescent tumor cells and the proteins of EGFR, IGF1R and Bcl-xl were analyzed by MTT, flow cytometry, cytochemical therapy or Western blot. Results: In group of simultaneously blocking EGFR, IGF1R and Bcl-xl genes, the mRNA of EGFR, IGF1R and Bcl-xl expression was decreased by (66.66 ± 3.42)%, (73.97 ± 2.83)% and (64.79 ± 2.83)%, and the protein expressions was diminished to (67.69 ± 4.02)%, (74.32 ± 2.30)%, and (60.00 ± 3.34)%, respectively. Meanwhile, the cell apoptosis increased by 65.32 ± 0.18%, 65.16 ± 0.25% and 55.47 ± 0.45%, and senescent cells increased by 1.42 ± 0.15%, 2.26 ± 0.15% and 3.22 ± 0.15% in the second, third and fourth day cultures, respectively. Conclusions: Simultaneously blocking EGFR, IGF1R and Bcl-xl genes is capable of altering the balance between proliferating versus apoptotic and senescent cells in the favor of both of apoptosis and
Energy Technology Data Exchange (ETDEWEB)
Dai, Guodong [Anatomy and Embryology, Wuhan University School of Medicine, Wuhan, Hubei 430071 (China); Peng, Tao; Zhou, Xuhong [Department of Otolaryngology-Head and Neck Surgery, Zhongnan Hospital of Wuhan University, Wuhan 430071 (China); Zhu, Jun; Kong, Zhihua; Ma, Li; Xiong, Zhi [Anatomy and Embryology, Wuhan University School of Medicine, Wuhan, Hubei 430071 (China); Yuan, Yulin, E-mail: yuanyulin19620120@126.com [Anatomy and Embryology, Wuhan University School of Medicine, Wuhan, Hubei 430071 (China)
2013-11-01
Highlight: •Construction of shRNA segments expression vectors is valid by the investigation of RT-PCR for IGF1R, EGFR and Bcl-xl mRNA and protein expression. •Studies have suggested that the vectors in blocking these genes of the growth factor receptors and anti- apoptosis is capable of breaking the balance of tumor growth so that tumor trend apoptosis and senescence. •Simultaneously blocking multiple genes that are abnormally expressed may be more effective in treating cancer cells than silencing a single gene. -- Abstract: Background: In previous work, we constructed short hairpin RNA (shRNA) expression plasmids that targeted human EGF and IGF-1 receptors messenger RNA, respectively, and demonstrated that these vectors could induce apoptosis of human nasopharyngeal cell lines (CNE2) and inhibit ligand-induced pAkt and pErk activation. Method: We have constructed multiple shRNA expression vectors of targeting EGFR, IGF1R and Bcl-xl, which were transfected to the CNE2 cells. The mRNA expression was assessed by RT-PCR. The growth of the cells, cell cycle progression, apoptosis of the cells, senescent tumor cells and the proteins of EGFR, IGF1R and Bcl-xl were analyzed by MTT, flow cytometry, cytochemical therapy or Western blot. Results: In group of simultaneously blocking EGFR, IGF1R and Bcl-xl genes, the mRNA of EGFR, IGF1R and Bcl-xl expression was decreased by (66.66 ± 3.42)%, (73.97 ± 2.83)% and (64.79 ± 2.83)%, and the protein expressions was diminished to (67.69 ± 4.02)%, (74.32 ± 2.30)%, and (60.00 ± 3.34)%, respectively. Meanwhile, the cell apoptosis increased by 65.32 ± 0.18%, 65.16 ± 0.25% and 55.47 ± 0.45%, and senescent cells increased by 1.42 ± 0.15%, 2.26 ± 0.15% and 3.22 ± 0.15% in the second, third and fourth day cultures, respectively. Conclusions: Simultaneously blocking EGFR, IGF1R and Bcl-xl genes is capable of altering the balance between proliferating versus apoptotic and senescent cells in the favor of both of apoptosis and
International Nuclear Information System (INIS)
Shu, H.-K.G.; Furman, Felix; Dee, Suzanne; Israel, Mark A.
1997-01-01
Purpose/Objective: Medulloblastoma cell lines readily undergo a p53-mediated apoptosis following exposure to ionizing radiation, while glioma cell lines do not undergo significant levels of apoptosis following irradiation. This study attempts to define some of the molecular events that characterize the differential ability medulloblastomas and gliomas to undergo radiation-induced apoptosis. Materials and Methods: The medulloblastoma cell lines D283 and D341 and the glioma cell lines U87, U343 and U563 were used in this study. All five cell lines were confirmed to have a wild type p53 by their ability to induce p21 protein levels and to undergo a cell-cycle arrest in G1 following treatment with ionizing radiation. Also, 3 clonal derivatives of D283 were used. Two of the clones were derived following transfection with an expression plasmid containing a dominant negative mutant p53 (Arg175 --> His) expressed from the CMV promoter (D283/53.6 and D283/53.7), while the remaining clone was derived following transfection with that same expression plasmid without mutant p53 (D283/vec). All irradiation experiments were performed on Phillips RT-250 X-ray unit using 250 Kvp X-rays. In each case, 5 Gy of ionizing radiation was given at a dose rate of 250 cGy/minute. Apoptosis was quantitated by staining fixed cells with propidium iodide and determining the percentage of cells with subdiploid DNA content by flow cytometry. Northern blot analysis was performed using standard methods. Results: The D283 and D341 cell lines exhibited a significant induction of apoptosis when assayed 2 days following treatment with radiation while the U87, U343 and U563 cell lines displayed only minimal induction of apoptosis when assayed following treatment at that time. RNA was prepared from the different cell lines that were unirradiated, 6 hours or 24 hours post-irradiation. Northern blots were made of the total RNAs and probed for bax, bcl-2 and bcl-x mRNA. This analysis detected no significant
p53, SKP2, and DKK3 as MYCN Target Genes and Their Potential Therapeutic Significance
Energy Technology Data Exchange (ETDEWEB)
Chen, Lindi; Tweddle, Deborah A., E-mail: deborah.tweddle@ncl.ac.uk [Newcastle Cancer Centre, Northern Institute for Cancer Research, Newcastle University, Newcastle (United Kingdom)
2012-11-28
Neuroblastoma is the most common extra-cranial solid tumor of childhood. Despite significant advances, it currently still remains one of the most difficult childhood cancers to cure, with less than 40% of patients with high-risk disease being long-term survivors. MYCN is a proto-oncogene implicated to be directly involved in neuroblastoma development. Amplification of MYCN is associated with rapid tumor progression and poor prognosis. Novel therapeutic strategies which can improve the survival rates whilst reducing the toxicity in these patients are therefore required. Here we discuss genes regulated by MYCN in neuroblastoma, with particular reference to p53, SKP2, and DKK3 and strategies that may be employed to target them.
p53-Dependent suppression of genome instability in germ cells
Energy Technology Data Exchange (ETDEWEB)
Otozai, Shinji [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Ishikawa-Fujiwara, Tomoko [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Oda, Shoji [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Kamei, Yasuhiro [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ryo, Haruko [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Sato, Ayuko [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Nomura, Taisei [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Mitani, Hiroshi [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Tsujimura, Tohru [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Inohara, Hidenori [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Todo, Takeshi, E-mail: todo@radbio.med.osaka-u.ac.jp [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)
2014-02-15
Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2{sup −/−} fish had a high frequency of spontaneous MSI. • p53{sup −/−} fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2{sup −/−} males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2{sup −/−} and wild-type fish. By contrast, irradiated p53{sup −/−} fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2{sup −/−} fish, but negligible levels in p53{sup −/−} fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells.
p53-Dependent suppression of genome instability in germ cells
International Nuclear Information System (INIS)
Otozai, Shinji; Ishikawa-Fujiwara, Tomoko; Oda, Shoji; Kamei, Yasuhiro; Ryo, Haruko; Sato, Ayuko; Nomura, Taisei; Mitani, Hiroshi; Tsujimura, Tohru; Inohara, Hidenori; Todo, Takeshi
2014-01-01
Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2 −/− fish had a high frequency of spontaneous MSI. • p53 −/− fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2 −/− males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2 −/− and wild-type fish. By contrast, irradiated p53 −/− fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2 −/− fish, but negligible levels in p53 −/− fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells
Rapid detection of single nucleotide mutation in p53 gene based on ...
Indian Academy of Sciences (India)
mutation.27 Nevertheless, more than 50% of all human tumors contain p53 mutation; ... gene mutation detection in various fields of biology and medicine persuaded us to find ..... Yola M L, Eren T and Atar N 2014 Electrochim. Acta. 125 38. 26.
Vaandrager, J W; Schuuring, E; Raap, T; Philippo, K; Kleiverda, K; Kluin, P
Rearrangement of the BCL2 gene is an important parameter for the differential diagnosis of non-Hodgkin lymphomas. Although a relatively large proportion of breakpoints is clustered, many are missed by standard PCR. A FISH assay is therefore desired. Up to now, a lack of probes flanking the BCL2 gene
Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine
2014-06-14
The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.
Directory of Open Access Journals (Sweden)
Yitao Wang
2017-03-01
Full Text Available We previously identified proline-rich protein 11 (PRR11 as a novel cancer-related gene that is implicated in the regulation of cell cycle and tumorigenesis. Our recent study demonstrated that PRR11 and its adjacent gene, kinetochore associated 2 (SKA2, constitute a classic head-to-head gene pair that is coordinately regulated by nuclear factor Y (NF-Y. In the present study, we further show that the PRR11-SKA2 bidirectional transcription unit is an indirect target of the tumor suppressor p53. A luciferase reporter assay revealed that overexpression of wild type p53, but not mutant p53, significantly represses the basal activity and NF-Y mediated transactivation of the PRR11-SKA2 bidirectional promoter. Deletion and mutation analysis of the PRR11-SKA2 promoter revealed that p53-mediated PRR11-SKA2 repression is dependent on the presence of functional NF-Y binding sites. Furthermore, a co-immunoprecipitation assay revealed that p53 associates with NF-Y in lung cancer cells, and a chromatin immunoprecipitation assay showed that p53 represses PRR11-SKA2 transcription by reducing the binding amount of NF-Y in the PRR11-SKA2 promoter region. Consistently, the ability of p53 to downregulate PRR11-SKA2 transcription was significantly attenuated upon siRNA-mediated depletion of nuclear factor Y subunit beta (NF-YB. Notably, lung cancer patients with lower expression of either PRR11 or SKA2 along with wild type p53 exhibited the best overall survival compared with others with p53 mutation and/or higher expression of either PRR11 or SKA2. Taken together, our results demonstrate that p53 negatively regulates the expression of the PRR11-SKA2 bidirectional transcription unit through NF-Y, suggesting that the inability to repress the PRR11-SKA2 bidirectional transcription unit after loss of p53 might contribute to tumorigenesis.
Identification and characterization of the Bcl-2- associated ...
African Journals Online (AJOL)
Identification and characterization of the Bcl-2- associated athanogene (BAG) protein family in rice. ... Data obtained from real-time PCR of OsBAG genes under heat stress showed that maximum induction in the expression of all the genes occurred after one hour exposure to heat stress, while reduction in the expression ...
International Nuclear Information System (INIS)
Ohnishi, Takeo
1997-01-01
I report the induced accumulation of wild-type p53 protein of a tumor suppressor gene within 12 h in various organs of rats exposed to X-ray irradiation at low doses (10-50 cGy). The levels of p53 in some organs of irradiated rats were increased about 2- to 3-fold in comparison with the basal p53 levels in non-irradiated rats. Differences in the levels of p53 induction after low-dose X-ray irradiation were observed among the small intestine, bone marrow, brain, liver, adrenal gland, spleen, hypophysis and skin. In contrast, there was no obvious accumulation of p53 protein in the testis and ovary. Thus, the induction of cellular p.53 accumulation by low-dose X-ray irradiation in rats seems to be organ-specific. I consider that cell type, and interactions with other signal transduction pathways of the hormone system, immune system and nervous system may contribute to the variable induction of p53 by low-dose X-ray irradiation. I discussed the induction of p53 by radiation and its biological meaning from an aspect of the defense system for radiation-induced cancer. (author)
Joo, Min Cheol; Jang, Chul Hwan; Park, Jong Tae; Choi, Seung Won; Ro, Seungil; Kim, Min Seob; Lee, Moon Young
2018-02-01
Although electrical stimulation is therapeutically applied for neural regeneration in patients, it remains unclear how electrical stimulation exerts its effects at the molecular level on spinal cord injury (SCI). To identify the signaling pathway involved in electrical stimulation improving the function of injured spinal cord, 21 female Sprague-Dawley rats were randomly assigned to three groups: control (no surgical intervention, n = 6), SCI (SCI only, n = 5), and electrical simulation (ES; SCI induction followed by ES treatment, n = 10). A complete spinal cord transection was performed at the 10 th thoracic level. Electrical stimulation of the injured spinal cord region was applied for 4 hours per day for 7 days. On days 2 and 7 post SCI, the Touch-Test Sensory Evaluators and the Basso-Beattie-Bresnahan locomotor scale were used to evaluate rat sensory and motor function. Somatosensory-evoked potentials of the tibial nerve of a hind paw of the rat were measured to evaluate the electrophysiological function of injured spinal cord. Western blot analysis was performed to measure p38-RhoA and ERK1/2-Bcl-2 pathways related protein levels in the injured spinal cord. Rat sensory and motor functions were similar between SCI and ES groups. Compared with the SCI group, in the ES group, the latencies of the somatosensory-evoked potential of the tibial nerve of rats were significantly shortened, the amplitudes were significantly increased, RhoA protein level was significantly decreased, protein gene product 9.5 expression, ERK1/2, p38, and Bcl-2 protein levels in the spinal cord were significantly increased. These data suggest that ES can promote the recovery of electrophysiological function of the injured spinal cord through regulating p38-RhoA and ERK1/2-Bcl-2 pathway-related protein levels in the injured spinal cord.
Joo, Min Cheol; Jang, Chul Hwan; Park, Jong Tae; Choi, Seung Won; Ro, Seungil; Kim, Min Seob; Lee, Moon Young
2018-01-01
Although electrical stimulation is therapeutically applied for neural regeneration in patients, it remains unclear how electrical stimulation exerts its effects at the molecular level on spinal cord injury (SCI). To identify the signaling pathway involved in electrical stimulation improving the function of injured spinal cord, 21 female Sprague-Dawley rats were randomly assigned to three groups: control (no surgical intervention, n = 6), SCI (SCI only, n = 5), and electrical simulation (ES; SCI induction followed by ES treatment, n = 10). A complete spinal cord transection was performed at the 10th thoracic level. Electrical stimulation of the injured spinal cord region was applied for 4 hours per day for 7 days. On days 2 and 7 post SCI, the Touch-Test Sensory Evaluators and the Basso-Beattie-Bresnahan locomotor scale were used to evaluate rat sensory and motor function. Somatosensory-evoked potentials of the tibial nerve of a hind paw of the rat were measured to evaluate the electrophysiological function of injured spinal cord. Western blot analysis was performed to measure p38-RhoA and ERK1/2-Bcl-2 pathways related protein levels in the injured spinal cord. Rat sensory and motor functions were similar between SCI and ES groups. Compared with the SCI group, in the ES group, the latencies of the somatosensory-evoked potential of the tibial nerve of rats were significantly shortened, the amplitudes were significantly increased, RhoA protein level was significantly decreased, protein gene product 9.5 expression, ERK1/2, p38, and Bcl-2 protein levels in the spinal cord were significantly increased. These data suggest that ES can promote the recovery of electrophysiological function of the injured spinal cord through regulating p38-RhoA and ERK1/2-Bcl-2 pathway-related protein levels in the injured spinal cord. PMID:29557386
Thymocyte apoptosis induced by p53-dependent and independent pathways
International Nuclear Information System (INIS)
Clarke, A.R.; Purdie, C.A.; Harrison, D.J.; Morris, R.G.; Bird, C.C.; Hooper, M.L.; Wyllie, A.H.
1993-01-01
The authors studied the dependence of apoptosis on p53 expression in cells from the thymus cortex. Short-term thymocyte cultures were prepared from mice constitutively heterozygous or homozygous for a deletion in the p53 gene introduced into the germ line after gene targeting. Wild-type thymocytes readily undergo apoptosis after treatment with ionizing radiation, the glucocorticoid methylprednisolone, or etoposide (an inhibitor of topoisomerase II), or after Ca 2+ -dependent activation by phorbol ester and a calcium ionophore. In contrast, homozygous null p53 thymocytes are resistant to induction of apoptosis by radiation or etoposide, but retain normal sensitivity to glucocorticoid and calcium. The time-dependent apoptosis that occurs in untreated cultures is unaffected by p53 status. Cells heterozygous for p53 deletion are partially resistant to radiation and etoposide. Results show that p53 exerts a significant and dose-dependent effect in the initiation of apoptosis, but only when it is induced by agents that cause DNA-strand breakage. (Author)
International Nuclear Information System (INIS)
Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang
2008-01-01
This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)
Li, Xiaomei; Huang, Ying; Bi, Chengfeng; Yuan, Ji; He, Hong; Zhang, Hong; Yu, QiuBo; Fu, Kai; Li, Dan
2017-06-01
Diffuse large B-cell lymphoma (DLBCL) is the most common non-Hodgkin lymphoma, whose main prognostic factor is closely related to germinal center B-cell-like subtype (GCB- DLBCL) or activated B-cell-like type (non-GCB-DLBCL). The most common type of primary central nervous system lymphoma is diffuse large B-cell type with poor prognosis and the reason is unclear. This study aims to stratify primary central nervous system diffuse large B-cell lymphoma (PCNS-DLBCL) according to the cell-of-origin (COO) and to investigate the multiple proteins expression of C-MYC, BCL-6, BCL-2, TP53, further to elucidate the reason why primary central nervous system diffuse large B-cell lymphoma possesses a poor clinical outcome as well. Nineteen cases of primary central nervous system DLBCL were stratified according to immunostaining algorithms of Hans, Choi and Meyer (Tally) and we investigated the multiple proteins expression of C-MYC, BCL-6, BCL-2, TP53. The Epstein-Barr virus and Borna disease virus infection were also detected. Among nineteen cases, most (15-17 cases) were assigned to the activated B-cell-like subtype, highly expression of C-MYC (15 cases, 78.9%), BCL-2 (10 cases, 52.6%), BCL-6 (15 cases, 78.9%). Unfortunately, two cases were positive for PD-L1 while PD-L2 was not expressed in any case. Two cases infected with BDV but no one infected with EBV. In conclusion, most primary central nervous system DLBCLs show an activated B-cell-like subtype characteristic and have multiple expressions of C-MYC, BCL-2, BCL-6 protein, these features might be significant factor to predict the outcome and guide treatment of PCNS-DLBCLs. Copyright © 2017 Elsevier GmbH. All rights reserved.
Expression of Bcl-2 and Bax in extrahepatic biliary tract carcinoma and dysplasia
Li, Sheng-Mian; Yao, Shu-Kun; Yamamura, Nobuyoshi; Nakamura, Toshitsugu
2003-01-01
AIM: To compare the difference of expression of Bcl-2 and Bax in extrahepatic biliary tract carcinoma and dysplasia, and to analyze the role of Bcl-2 and Bax proteins in the progression from dysplasia to carcinoma and to evaluate the correlation of Bcl-2/Bax protein expression with the biological behaviors. METHODS: Expressions of Bcl-2 and Bax were examined immunohistochemically in 27 cases of extrahepatic biliary tract carcinomas (bile duct carcinoma: n = 21, carcinoma of ampulla of Vater: n = 6), and 10 cases of atypical dysplasia. Five cases of normal biliary epithelial tissues were used as controls. A semiquantitative scoring system was used to assess the Bcl-2 and Bax reactivity. RESULTS: The expression of Bcl-2 was observed in 10 out of 27 (37.0%) invasive carcinomas, 1 out of 10 dysplasias, none out of 5 normal epithelial tissues. Bax expression rate was 74.1% (20/27) in invasive carcinoma, 30% (3/10) in dysplasia, and 40% (2/5) in normal biliary epithelium. Bcl-2 and Bax activities were more intense in carcinoma than in dysplasia, with no significant difference in Bcl-2 expression (P = 0.110), and significant difference in Bax expression (P = 0.038). Level of Bax expression was higher in invasive carcinoma than in dysplasia and normal tissue (P = 0.012). Bcl-2 expression was correlated to Bax expression (P = 0.0059). However, Bcl-2/Bax expression had no correlation with histological subtype, grade of differentiation, or level of invasion. CONCLUSION: Increased Bcl-2/Bax expression from dysplasia to invasive tumors supports the view that this is the usual route for the development of extrahepatic biliary tract carcinoma. Bcl-2/Bax may be involved, at least in part, in the apoptotic activity in extrahepatic biliary carcinoma. PMID:14606101
Directory of Open Access Journals (Sweden)
Bin Tang
Full Text Available B-cell leukemia/lymphoma 11B (Bcl11b is a transcription factor showing predominant expression in the striatum. To date, there are no known gene targets of Bcl11b in the nervous system. Here, we define targets for Bcl11b in striatal cells by performing chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq in combination with genome-wide expression profiling. Transcriptome-wide analysis revealed that 694 genes were significantly altered in striatal cells over-expressing Bcl11b, including genes showing striatal-enriched expression similar to Bcl11b. ChIP-seq analysis demonstrated that Bcl11b bound a mixture of coding and non-coding sequences that were within 10 kb of the transcription start site of an annotated gene. Integrating all ChIP-seq hits with the microarray expression data, 248 direct targets of Bcl11b were identified. Functional analysis on the integrated gene target list identified several zinc-finger encoding genes as Bcl11b targets, and further revealed a significant association of Bcl11b to brain-derived neurotrophic factor/neurotrophin signaling. Analysis of ChIP-seq binding regions revealed significant consensus DNA binding motifs for Bcl11b. These data implicate Bcl11b as a novel regulator of the BDNF signaling pathway, which is disrupted in many neurological disorders. Specific targeting of the Bcl11b-DNA interaction could represent a novel therapeutic approach to lowering BDNF signaling specifically in striatal cells.
Nikdel, K; Aminafshar, M; Mohammadi-Sangcheshmeh, A; EmamJomeh-Kashan, N; Seyedjafari, E
2017-05-20
In this study, in vitro maturation was performed in presence of various concentrations (0, 10, 100, or 1000 µM) of H2O2. The intracellular glutathione (GSH) level, fertilization, cleavage, and blastocyst rates, total cell number, and apoptotic cell number and expression of Bax, Bcl-2, and p53 genes in blastocyst-stage embryos were studied. At 10 μM H2O2 concentration, a higher GSH level was detected in comparison to the other groups while oocytes exposed to 1000 μM H2O2 had the lowest GSH level. Treatment of oocytes with 1000 μM H2O2 decreased the rate of two pronuclei formation as compared with other groups. A higher rate of blastocyst formation was seen in 100 μM H2O2 group as compared with the control group. However, exogenous H2O2 in maturation medium did not affect total cell numbers and apoptotic cell ratio at the blastocyst stage. Moreover, mRNA transcript abundance of Bax, Bcl-2, and p53 genes was similar between blastocysts derived from H2O2-induced oocytes and control blastocysts. Treatment of oocytes with H2O2 at mild level during in vitro maturation had a positive effect on GSH level and this, in turn, may lead to improvement in preimplantation embryonic development.
Ching, L Y; Yeung, Bonnie H Y; Wong, Chris K C
2012-06-01
Human stanniocalcin 1 (STC1) has recently been identified as a putative protein factor involved in cellular apoptosis. The use of histone deacetylase inhibitor (i.e. trichostatin A (TSA)) and doxorubicin (Dox) is one of the common treatment methods to induce apoptosis in human cancer cells. A study on TSA and Dox-mediated apoptosis may shed light on the regulation and function of STC1 in cancer treatment. In this study, TSA and Dox cotreatment in human nasopharyngeal carcinoma cells (CNE2) elicited synergistic effects on STC1 gene expression and cellular apoptosis. An activation of p53 (TP53) transcriptional activity in Dox- or Dox+TSA-treated cells was revealed by the increased expression levels of p53 mRNA/protein as well as p53-driven luciferase activities. To elucidate the possible involvement of p53 in STC1 gene transcription, a vector expressing wild-type or dominant negative (DN) p53 was transiently transfected into the cells. Both STC1 promoter luciferase constructs and chromatin immunoprecipitation assays did not support the direct role of p53 in STC1 gene transactivation. However, the synergistic effects of p53 on the induction of NF-κB phosphorylation and the recruitment of acetylated histone H3 in STC1 promoter were observed in TSA-cotreated cells. The overexpression of exogenous STC1 sensitized apoptosis in Dox-treated cells. Taken together, this study provides data to show the cross talk of NF-κB, p53, and histone protein in the regulation of STC1 expression and function.
Directory of Open Access Journals (Sweden)
Rashid Mir
2016-01-01
Full Text Available Aim: Lung cancer is considered to be the most common cancer in the world. In humans, about 50% or more cancers have a mutated tumor suppressor p53 gene thereby resulting in accumulation of p53 protein and losing its function to activate the target genes that regulate the cell cycle and apoptosis. Extensive research conducted in murine cancer models with activated p53, loss of p53, or p53 missense mutations have facilitated researchers to understand the role of this key protein. Our study was aimed to evaluate the frequency of cytosine deletion in nonsmall cell lung cancer (NSCLC patients. Methods: One hundred NSCLC patients were genotyped for P53 (exon5, codon168 cytosine deletion leading to loss of its function and activate the target genes by allele-specific polymerase chain reaction. The P53 cytosine deletion was correlated with all the clinicopathological parameters of the patients. Results and Analysis: 59% cases were carrying P53 cytosine deletion. Similarly, the significantly higher incidence of cytosine deletion was reported in current smokers (75% in comparison to exsmoker and nonsmoker. Significantly higher frequency of cytosine deletion was reported in adenocarcinoma (68.08% than squamous cell carcinoma (52.83%. Also, a significant difference was reported between p53 cytosine deletion and metastasis (64.28%. Further, the majority of the cases assessed for response carrying P53 cytosine deletion were found to show faster disease progression. Conclusion: The data suggests that there is a significant association of the P53 exon 5 deletion of cytosine in codon 168 with metastasis and staging of the disease.
p53 Acetylation: Regulation and Consequences
International Nuclear Information System (INIS)
Reed, Sara M.; Quelle, Dawn E.
2014-01-01
Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer
p53 Acetylation: Regulation and Consequences
Energy Technology Data Exchange (ETDEWEB)
Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: dawn-quelle@uiowa.edu [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)
2014-12-23
Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.
Lehnerdt, G F; Franz, P; Bankfalvi, A; Grehl, S; Kelava, A; Nückel, H; Lang, S; Schmid, K W; Siffert, W; Bachmann, H S
2009-06-01
Expression of the antiapoptotic and antiproliferative protein B-cell lymphoma 2 (Bcl-2) has been repeatedly shown to be associated with better locoregional control and patients' survival in oropharyngeal squamous cell carcinoma (OSCC). A regulatory (-938C>A) single-nucleotide polymorphism (SNP) in the inhibitory P2 BCL2 gene promoter generates significantly different BCL2 promoter activities and has been associated with outcome in different malignancies. The aim of the present study was to analyze the possible influence of the (-938C>A) SNP on survival of patients suffering from OSCC. One hundred and thirty-three patients with primary OSCC were retrospectively investigated. Bcl-2 expression of tumor cells was demonstrated by means of immunohistochemistry. Both the Bcl-2 expression and the (-938C>A) genotypes were correlated with the patients' survival. The (-938C>A) SNP was significantly related to Bcl-2 expression (P = 0.008). Kaplan-Meier curves revealed a significant association of the -938 SNP with relapse-free (P = 0.0283) and overall survival (P = 0.0247). Multiple Cox regression identified the BCL2 (-938CC) genotype as an independent prognostic factor for relapse [hazard ratio (HR) 1.898, P = 0.021] as well as for death in OSCC patients (HR 1.897, P = 0.013). The (-938C>A) SNP represents a potential novel prognostic marker in patients with OSCC that could help to identify a group of patients at high risk for relapse and death.
Slebos, R. J.; Baas, I. O.; Clement, M.; Polak, M.; Mulder, J. W.; van den Berg, F. M.; Hamilton, S. R.; Offerhaus, G. J.
1996-01-01
Inactivation of the p53 tumour-suppressor gene is common in a wide variety of human neoplasms. In the majority of cases, single point mutations in the protein-encoding sequence of p53 lead to positive immunohistochemistry (IHC) for the p53 protein, and are accompanied by loss of the wild-type
Doxycyclin induces p53 expression in SaOs (osteosarcoma) cell line ...
African Journals Online (AJOL)
The p53 tumour suppressor gene plays an important role in preventing cancer development. This study determined if p53 can be induced in osteosarcoma cell line upon treatment ... represent an important component of the p53 tumor suppressor pathway. Keywords: Tumor suppressor, oncogene, mdm2, cyclinE, apoptosis ...
Chou, Fu-Sheng; Griesinger, Andrea; Wunderlich, Mark; Lin, Shan; Link, Kevin A.; Shrestha, Mahesh; Goyama, Susumu; Mizukawa, Benjamin; Shen, Shuhong; Marcucci, Guido
2012-01-01
AML1-ETO (AE) is a fusion product of translocation (8;21) that accounts for 40% of M2 type acute myeloid leukemia (AML). In addition to its role in promoting preleukemic hematopoietic cell self-renewal, AE represses DNA repair genes, which leads to DNA damage and increased mutation frequency. Although this latter function may promote leukemogenesis, concurrent p53 activation also leads to an increased baseline apoptotic rate. It is unclear how AE expression is able to counterbalance this intrinsic apoptotic conditioning by p53 to promote survival and self-renewal. In this report, we show that Bcl-xL is up-regulated in AE cells and plays an essential role in their survival and self-renewal. Further investigation revealed that Bcl-xL expression is regulated by thrombopoietin (THPO)/MPL-signaling induced by AE expression. THPO/MPL-signaling also controls cell cycle reentry and mediates AE-induced self-renewal. Analysis of primary AML patient samples revealed a correlation between MPL and Bcl-xL expression specifically in t(8;21) blasts. Taken together, we propose that survival signaling through Bcl-xL is a critical and intrinsic component of a broader self-renewal signaling pathway downstream of AML1-ETO–induced MPL. PMID:22337712
Directory of Open Access Journals (Sweden)
2006-01-01
Full Text Available Herpesvirus-associated ubiquitin-specific protease (HAUSP, also known as USP7, a deubiquitylating enzyme of the ubiquitin-specific processing protease family, specifically deubiquitylates both p53 and MDM2, hence playing an important yet enigmatic role in the p53-MDM2 pathway. Here we demonstrate that both p53 and MDM2 specifically recognize the N-terminal tumor necrosis factor-receptor associated factor (TRAF-like domain of HAUSP in a mutually exclusive manner. HAUSP preferentially forms a stable HAUSP-MDM2 complex even in the presence of excess p53. The HAUSP-binding elements were mapped to a peptide fragment in the carboxy-terminus of p53 and to a short-peptide region preceding the acidic domain of MDM2. The crystal structures of the HAUSP TRAF-like domain in complex with p53 and MDM2 peptides, determined at 2.3-A and 1.7-A resolutions, respectively, reveal that the MDM2 peptide recognizes the same surface groove in HAUSP as that recognized by p53 but mediates more extensive interactions. Structural comparison led to the identification of a consensus peptide-recognition sequence by HAUSP. These results, together with the structure of a combined substrate-binding-and-deubiquitylation domain of HAUSP, provide important insights into regulation of the p53-MDM2 pathway by HAUSP.
Implication of p53-dependent cellular senescence related gene, TARSH in tumor suppression
International Nuclear Information System (INIS)
Wakoh, Takeshi; Uekawa, Natsuko; Terauchi, Kunihiko; Sugimoto, Masataka; Ishigami, Akihito; Shimada, Jun-ichi; Maruyama, Mitsuo
2009-01-01
A novel target of NESH-SH3 (TARSH) was identified as a cellular senescence related gene in mouse embryonic fibroblasts (MEFs) replicative senescence, the expression of which has been suppressed in primary clinical lung cancer specimens. However, the molecular mechanism underlying the regulation of TARSH involved in pulmonary tumorigenesis remains unclear. Here we demonstrate that the reduction of TARSH gene expression by short hairpin RNA (shRNA) system robustly inhibited the MEFs proliferation with increase in senescence-associated β-galactosidase (SA-β-gal) activity. Using p53 -/- MEFs, we further suggest that this growth arrest by loss of TARSH is evoked by p53-dependent p21 Cip1 accumulation. Moreover, we also reveal that TARSH reduction induces multicentrosome in MEFs, which is linked in chromosome instability and tumor development. These results suggest that TARSH plays an important role in proliferation of replicative senescence and may serve as a trigger of tumor development.
Circumvention and reactivation of the p53 oncogene checkpoint in mouse colon tumors.
Aizu, Wataru; Belinsky, Glenn S; Flynn, Christopher; Noonan, Emily J; Boes, Colleen C; Godman, Cassandra A; Doshi, Bindi; Nambiar, Prashant R; Rosenberg, Daniel W; Giardina, Charles
2006-10-16
The p53 tumor suppressor protein is sequence-normal in azoxymethane (AOM)-induced mouse colon tumors, making them a good model for human colon cancers that retain a wild type p53 gene. Cellular localization and co-immunoprecipitation experiments using a cell line derived from an AOM-induced colon tumor (AJ02-NM(0) cells) pointed to constitutively expressed Mdm2 as being an important negative regulator of p53 in these cells. Although the Mdm2 inhibitory protein p19/ARF was expressed in AJ02-NM(0) cells, its level of expression was not sufficient for p53 activation. We tested the response of AJ02-NM(0) cells to the recently developed Mdm2 inhibitor, Nutlin-3. Nutlin-3 was found to activate p53 DNA binding in AJ02-NM(0) cells, to a level comparable to doxorubicin and 5-fluorouracil (5-FU). In addition, Nutlin-3 increased expression of the p53 target genes Bax and PERP to a greater extent than doxorubicin or 5-FU, and triggered a G2/M phase arrest in these cells, compared to a G1 arrest triggered by doxorubicin and 5-FU. The differences in the cellular response may be related to differences in the kinetics of p53 activation and/or its post-translational modification status. In an ex vivo experiment, Nutlin-3 was found to activate p53 target gene expression and apoptosis in AOM-induced tumor tissue, but not in normal adjacent mucosa. Our data indicate that Mdm2 inhibitors may be an effective means of selectively targeting colon cancers that retain a sequence-normal p53 gene while sparing normal tissue and that the AOM model is an appropriate model for the preclinical development of these drugs.
Knockout and transgenic mice of Trp53: what have we learned about p53 in breast cancer?
International Nuclear Information System (INIS)
Blackburn, Anneke C; Jerry, D Joseph
2002-01-01
The human p53 tumor suppressor gene TP53 is mutated at a high frequency in sporadic breast cancer, and Li-Fraumeni syndrome patients who carry germline mutations in one TP53 allele have a high incidence of breast cancer. In the 10 years since the first knockout of the mouse p53 tumor suppressor gene (designated Trp53) was published, much has been learned about the contribution of p53 to biology and tumor suppression in the breast through the use of p53 transgenic and knockout mice. The original mice deficient in p53 showed no mammary gland phenotype. However, studies using BALB/c-Trp53-deficient mice have demonstrated a delayed involution phenotype and a mammary tumor phenotype. Together with other studies of mutant p53 transgenes and p53 bitransgenics, a greater understanding has been gained of the role of p53 in involution, of the regulation of p53 activity by hormones, of the effect of mouse strain and modifier genes on tumor phenotype, and of the cooperation between p53 and other oncogenic pathways, chemical carcinogens and hormonal stimulation in mammary tumorigenesis. Both p53 transgenic and knockout mice are important in vivo tools for understanding breast cancer, and are yet to be exploited for developing therapeutic strategies in breast cancer
Bogusz, Agata M
2017-01-01
Posttransplant lymphoproliferative disorders (PTLDs) are a diverse group of lymphoid or plasmacytic proliferations frequently driven by Epstein-Barr virus (EBV). EBV-negative PTLDs appear to represent a distinct entity. This report describes an unusual case of a 33-year-old woman that developed a monomorphic EBV-negative PTLD consistent with diffuse large B-cell lymphoma (DLBCL) 13 years after heart-lung transplant. Histological examination revealed marked pleomorphism of the malignant cells including nodular areas reminiscent of classical Hodgkin lymphoma (cHL) with abundant large, bizarre Hodgkin-like cells. By immunostaining, the malignant cells were immunoreactive for CD45, CD20, CD79a, PAX5, BCL6, MUM1, and p53 and negative for CD15, CD30, latent membrane protein 1 (LMP1), and EBV-encoded RNA (EBER). Flow cytometry demonstrated lambda light chain restricted CD5 and CD10 negative B-cells. Fluorescence in situ hybridization studies (FISH) were negative for cMYC , BCL2, and BCL6 rearrangements but showed deletion of TP53 and monosomy of chromosome 17. Next-generation sequencing studies (NGS) revealed numerous genetic alterations including 6 pathogenic mutations in ASXL1, BCOR, CDKN2A, NF1, and TP53 (x2) genes and 30 variants of unknown significance (VOUS) in ABL1, ASXL1, ATM, BCOR, BCORL1, BRNIP3, CDH2, CDKN2A, DNMT3A, ETV6, EZH2, FBXW7, KIT, NF1, RUNX1, SETPB1, SF1, SMC1A, STAG2, TET2, TP53, and U2AF2.
Directory of Open Access Journals (Sweden)
Agata M. Bogusz
2017-01-01
Full Text Available Posttransplant lymphoproliferative disorders (PTLDs are a diverse group of lymphoid or plasmacytic proliferations frequently driven by Epstein-Barr virus (EBV. EBV-negative PTLDs appear to represent a distinct entity. This report describes an unusual case of a 33-year-old woman that developed a monomorphic EBV-negative PTLD consistent with diffuse large B-cell lymphoma (DLBCL 13 years after heart-lung transplant. Histological examination revealed marked pleomorphism of the malignant cells including nodular areas reminiscent of classical Hodgkin lymphoma (cHL with abundant large, bizarre Hodgkin-like cells. By immunostaining, the malignant cells were immunoreactive for CD45, CD20, CD79a, PAX5, BCL6, MUM1, and p53 and negative for CD15, CD30, latent membrane protein 1 (LMP1, and EBV-encoded RNA (EBER. Flow cytometry demonstrated lambda light chain restricted CD5 and CD10 negative B-cells. Fluorescence in situ hybridization studies (FISH were negative for cMYC, BCL2, and BCL6 rearrangements but showed deletion of TP53 and monosomy of chromosome 17. Next-generation sequencing studies (NGS revealed numerous genetic alterations including 6 pathogenic mutations in ASXL1, BCOR, CDKN2A, NF1, and TP53(x2 genes and 30 variants of unknown significance (VOUS in ABL1, ASXL1, ATM, BCOR, BCORL1, BRNIP3, CDH2, CDKN2A, DNMT3A, ETV6, EZH2, FBXW7, KIT, NF1, RUNX1, SETPB1, SF1, SMC1A, STAG2, TET2, TP53, and U2AF2.
van Doorn, Remco; Zoutman, Willem H; Dijkman, Remco; de Menezes, Renee X; Commandeur, Suzan; Mulder, Aat A; van der Velden, Pieter A; Vermeer, Maarten H; Willemze, Rein; Yan, Pearlly S; Huang, Tim H; Tensen, Cornelis P
2005-06-10
To analyze the occurrence of promoter hypermethylation in primary cutaneous T-cell lymphoma (CTCL) on a genome-wide scale, focusing on epigenetic alterations with pathogenetic significance. DNA isolated from biopsy specimens of 28 patients with CTCL, including aggressive CTCL entities (transformed mycosis fungoides and CD30-negative large T-cell lymphoma) and an indolent entity (CD30-positive large T-cell lymphoma), were investigated. For genome-wide DNA methylation screening, differential methylation hybridization using CpG island microarrays was applied, which allows simultaneous detection of the methylation status of 8640 CpG islands. Bisulfite sequence analysis was applied for confirmation and detection of hypermethylation of eight selected tumor suppressor genes. The DNA methylation patterns of CTCLs emerging from differential methylation hybridization analysis included 35 CpG islands hypermethylated in at least four of the 28 studied CTCL samples when compared with benign T-cell samples. Hypermethylation of the putative tumor suppressor genes BCL7a (in 48% of CTCL samples), PTPRG (27%), and thrombospondin 4 (52%) was confirmed and demonstrated to be associated with transcriptional downregulation. BCL7a was hypermethylated at a higher frequency in aggressive (64%) than in indolent (14%) CTCL entities. In addition, the promoters of the selected tumor suppressor genes p73 (48%), p16 (33%), CHFR (19%), p15 (10%), and TMS1 (10%) were hypermethylated in CTCL. Malignant T cells of patients with CTCL display widespread promoter hypermethylation associated with inactivation of several tumor suppressor genes involved in DNA repair, cell cycle, and apoptosis signaling pathways. In view of this, CTCL may be amenable to treatment with demethylating agents.
Battle Against Cancer: An Everlasting Saga of p53
Directory of Open Access Journals (Sweden)
Qian Hao
2014-12-01
Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.
The expanding regulatory universe of p53 in gastrointestinal cancer [version 1; referees: 2 approved
Directory of Open Access Journals (Sweden)
Andrew Fesler
2016-04-01
Full Text Available Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs through direct binding to the promoter region of these miRNAs. Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs. Like miRNA, lncRNAs have been found to play important roles in cancer biology. With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.
Directory of Open Access Journals (Sweden)
Fu Jia
2009-12-01
Full Text Available Abstract Background Tumor Protein p53 (p53, cyclin-dependent kinase inhibitor 1A (p21/WAF1, and murine double minute 2 (MDM2 participate in the regulation of cell growth. Altered expression of these gene products has been found in malignant tumors and has been associated with poor prognosis. Our aim was to investigate the expression of the 3 proteins in hepatocellular carcinoma (HCC and their prognostic significance. Methods We examined p53, p21/WAF1, and MDM2 expression in 181 pairs of HCC tissues and the adjacent hepatic tissues by performing immunohistochemistry and examined the expression of the 3 proteins in 7 pairs of HCC tissues and the adjacent hepatic tissues by using western blot analysis. Results The expression of p53, p21/WAF1, and MDM2 in the HCC tissues was significantly higher than those in the adjacent hepatic tissues (P P = 0.008. A statistical correlation was observed between expression of p53 and p21/WAF1 (R = 0.380, P = 0.000, p53 and MDM2 (R = 0.299, P = 0.000, p21/WAF1 and MDM2 (R = 0.285, P = 0.000 in 181 liver tissues adjacent to the tumor. Patients with a low pathologic grade HCC (I+II had a higher tendency to express p53 on tumor cells than the patients with high pathologic grade HCC (III+IV (P = 0.007. Survival analysis showed that positive p21/WAF1 expression or/and negative MDM2 expression in HCC was a predictor of better survival of patients after tumor resection (P Conclusions The proteins p53, p21/WAF1, and MDM2 were overexpressed in all the HCC cases in this study, and p53 and p21/WAF1 overexpression were positively correlated. The expression of p21/WAF1 and MDM2 can be considered as 2 useful indicators for predicting the prognosis of HCC.
Directory of Open Access Journals (Sweden)
Reza Akhavan-Sigari
2014-08-01
Full Text Available The aim of this paper is to investigate p53 gene expression in the central and peripheral zones of glioblastoma multiforme using a real-time reverse transcription polymerase chain reaction (RT-PCR technique in patients who use cell phones ≥3 hours a day and determine its relationship to clinicopathological findings and overall survival. Sixty-three patients (38 males and 25 females, diagnosed with glioblastoma multiforme (GBM, underwent tumor resection between 2008 and 2011. Patient ages ranged from 25 to 88 years, with a mean age of 55. The levels of expression of p53 in the central and peripheral zone of the GBM were quantified by RT-PCR. Data on p53 gene expression from the central and peripheral zone, the related malignancy and the clinicopatholagical findings (age, gender, tumor location and size, as well as overall survival, were analyzed. Forty-one out of 63 patients (65% with the highest level of cell phone use (≥3 hours/day had higher mutant type p53 expression in the peripheral zone of the glioblastoma; the difference was statistically significant (P=0.034. Results from the present study on the use of mobile phones for ≥3 hours a day show a consistent pattern of increased risk for the mutant type of p53 gene expression in the peripheral zone of the glioblastoma, and that this increase was significantly correlated with shorter overall survival time. The risk was not higher for ipsilateral exposure. We found that the mutant type of p53 gene expression in the peripheral zone of the glioblastoma was increased in 65% of patients using cell phones ≥3 hours a day.
The p53 gene as a modifier of intrinsic radiosensitivity: implications for radiotherapy
International Nuclear Information System (INIS)
Bristow, Robert G.; Benchimol, Samuel; Hill, Richard P.
1996-01-01
cellular phenotypes, including the radioresistant phenotype. Pre-clinical studies suggest that these phenotypes may be reversed using adenovirus-mediated gene therapy or pharmacologic strategies designed to re-institute WTp53 protein function. Our analysis of the published data strongly argues for the use offunctional assays for the determination of WTp53 protein function in studies which attempt to correlate normal and tumour tissue radioresponse with p53 genotype, or p53 protein expression
Cisplatinum and Taxol Induce Different Patterns of p53 Phosphorylation
Directory of Open Access Journals (Sweden)
Giovanna Damia
2001-01-01
Full Text Available Posttranslational modifications of p53 induced by two widely used anticancer agents, cisplatinum (DDP and taxol were investigated in two human cancer cell lines. Although both drugs were able to induce phosphorylation at serine 20 (Ser20, only DDP treatment induced p53 phosphorylation at serine 15 (Ser15. Moreover, both drug treatments were able to increase p53 levels and consequently the transcription of waf1 and mdm-2 genes, although DDP treatment resulted in a stronger inducer of both genes. Using two ataxia telangiectasia mutated (ATM cell lines, the role of ATM in druginduced p53 phosphorylations was investigated. No differences in drug-induced p53 phosphorylation could be observed, indicating that ATM is not the kinase involved in these phosphorylation events. In addition, inhibition of DNA-dependent protein kinase activity by wortmannin did not abolish p53 phosphorylation at Ser15 and Ser20, again indicating that DNA-PK is unlikely to be the kinase involved. After both taxol and DDP treatments, an activation of hCHK2 was found and this is likely to be responsible for phosphorylation at Ser20. In contrast, only DDP was able to activate ATR, which is the candidate kinase for phosphorylation of Ser15 by this drug. This data clearly suggests that differential mechanisms are involved in phosphorylation and activation of p53 depending on the drug type.
Rb and p53 gene deletions in lung adenocarcinomas from irradiated and control mice
International Nuclear Information System (INIS)
Zhang, Y.; Woloschak, G.E.
1997-01-01
This study was conducted on mouse lung adenocarcinoma tissues that were formalin-treated and paraffin-embedded 25 years ago to investigate the large gene deletions of mRb and p53 in B6CF 1 male mice. A total of 80 lung tissue samples from irradiated mice and 40 lung samples from nonirradiated controls were randomly selected and examined in the mRb portion of this study. The results showed a significant (P 0.05) from that for spontaneous lung adenocarcinomas or lung adenocarcinomas from mice exposed to single-dose γ irradiation at a similar total dose. mRb fragments 3 (71%) and 5 (67%), the parts of the gene that encoded the pocket binding region of Rb protein to adenovirus E1A and SV40 T-antigen, were the most frequently deleted fragments. p53 gene deletion analysis was carried out on normal lungs and lung adenocarcinomas that were initially found to bear mRb deletions. Exons 1,4,5,6, and 9 were chosen to be analyzed
A p53-independent role for the MDM2 antagonist Nutlin-3 in DNA damage response initiation
Directory of Open Access Journals (Sweden)
Kumar Sonia
2011-02-01
Full Text Available Abstract Background The mammalian DNA-damage response (DDR has evolved to protect genome stability and maximize cell survival following DNA-damage. One of the key regulators of the DDR is p53, itself tightly regulated by MDM2. Following double-strand DNA breaks (DSBs, mediators including ATM are recruited to the site of DNA-damage. Subsequent phosphorylation of p53 by ATM and ATM-induced CHK2 results in p53 stabilization, ultimately intensifying transcription of p53-responsive genes involved in DNA repair, cell-cycle checkpoint control and apoptosis. Methods In the current study, we investigated the stabilization and activation of p53 and associated DDR proteins in response to treatment of human colorectal cancer cells (HCT116p53+/+ with the MDM2 antagonist, Nutlin-3. Results Using immunoblotting, Nutlin-3 was observed to stabilize p53, and activate p53 target proteins. Unexpectedly, Nutlin-3 also mediated phosphorylation of p53 at key DNA-damage-specific serine residues (Ser15, 20 and 37. Furthermore, Nutlin-3 induced activation of CHK2 and ATM - proteins required for DNA-damage-dependent phosphorylation and activation of p53, and the phosphorylation of BRCA1 and H2AX - proteins known to be activated specifically in response to DNA damage. Indeed, using immunofluorescent labeling, Nutlin-3 was seen to induce formation of γH2AX foci, an early hallmark of the DDR. Moreover, Nutlin-3 induced phosphorylation of key DDR proteins, initiated cell cycle arrest and led to formation of γH2AX foci in cells lacking p53, whilst γH2AX foci were also noted in MDM2-deficient cells. Conclusion To our knowledge, this is the first solid evidence showing a secondary role for Nutlin-3 as a DDR triggering agent, independent of p53 status, and unrelated to its role as an MDM2 antagonist.
Czech Academy of Sciences Publication Activity Database
Congur, G.; Plucnara, Medard; Erdem, A.; Fojta, Miroslav
2015-01-01
Roč. 27, č. 7 (2015), s. 1579-1586 ISSN 1040-0397 R&D Projects: GA ČR GAP206/11/1638 Institutional support: RVO:68081707 Keywords : p53 Gene * Carbon nanotubes * Magnetic particles Subject RIV: BO - Biophysics Impact factor: 2.471, year: 2015
Chemotherapy-Induced Apoptosis in a Transgenic Model of Neuroblastoma Proceeds Through p53 Induction
Directory of Open Access Journals (Sweden)
Louis Chesler
2008-11-01
Full Text Available Chemoresistance in neuroblastoma is a significant issue complicating treatment of this common pediatric solid tumor. MYCN-amplified neuroblastomas are infrequently mutated at p53 and are chemosensitive at diagnosis but acquire p53 mutations and chemoresistance with relapse. Paradoxically, Myc-driven transformation is thought to require apoptotic blockade. We used the TH-MYCN transgenic murine model to examine the role of p53-driven apoptosis on neuroblastoma tumorigenesis and the response to chemotherapy. Tumors formed with high penetrance and low latency in p53-haploinsufficient TH-MYCN mice. Cyclophosphamide (CPM induced a complete remission in p53 wild type TH-MYCN tumors, mirroring the sensitivity of childhood neuroblastoma to this agent. Treated tumors showed a prominent proliferation block, induction of p53 protein, and massive apoptosis proceeding through induction of the Bcl-2 homology domain-3-only proteins PUMA and Bim, leading to the activation of Bax and cleavage of caspase-3 and -9. Apoptosis induced by CPM was reduced in p53-haploinsufficient tumors. Treatment of MYCN-expressing human neuroblastoma cell lines with CPM induced apoptosis that was suppressible by siRNA to p53. Taken together, the results indicate that the p53 pathway plays a significant role in opposing MYCN-driven oncogenesis in a mouse model of neuroblastoma and that basal inactivation of the pathway is achieved in progressing tumors. This, in part, explains the striking sensitivity of such tumors to chemotoxic agents that induce p53-dependent apoptosis and is consistent with clinical observations that therapy-associated mutations in p53 are a likely contributor to the biology of tumors at relapse and secondarily mediate resistance to therapy.
40 Years of Research Put p53 in Translation
Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques
2018-01-01
Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.
Insulin receptor substrate-3, interacting with Bcl-3, enhances p50 NF-{kappa}B activity
Energy Technology Data Exchange (ETDEWEB)
Kabuta, Tomohiro [Departments of Animal Sciences and Applied Biological Chemistry, Graduate School of Agriculture and Life Sciences, The University of Tokyo, Tokyo 113-8657 (Japan); Department of Degenerative Neurological Diseases, National Institute of Neuroscience, National Center of Neurology and Psychiatry, Kodaira, Tokyo 187-8502 (Japan); Hakuno, Fumihiko; Cho, Yoshitake; Yamanaka, Daisuke; Chida, Kazuhiro [Departments of Animal Sciences and Applied Biological Chemistry, Graduate School of Agriculture and Life Sciences, The University of Tokyo, Tokyo 113-8657 (Japan); Asano, Tomoichiro [Graduate School of Biomedical Science, Hiroshima University, Hiroshima 734-8551 (Japan); Wada, Keiji [Department of Degenerative Neurological Diseases, National Institute of Neuroscience, National Center of Neurology and Psychiatry, Kodaira, Tokyo 187-8502 (Japan); Takahashi, Shin-Ichiro, E-mail: atkshin@mail.ecc.u-tokyo.ac.jp [Departments of Animal Sciences and Applied Biological Chemistry, Graduate School of Agriculture and Life Sciences, The University of Tokyo, Tokyo 113-8657 (Japan)
2010-04-09
The insulin receptor substrate (IRS) proteins are major substrates of both insulin receptor and insulin-like growth factor (IGF)-I receptor tyrosine kinases. Previously, we reported that IRS-3 is localized to both cytosol and nucleus, and possesses transcriptional activity. In the present study, we identified Bcl-3 as a novel binding protein to IRS-3. Bcl-3 is a nuclear protein, which forms a complex with the homodimer of p50 NF-{kappa}B, leading to enhancement of transcription through p50 NF-{kappa}B. We found that Bcl-3 interacts with the pleckstrin homology domain and the phosphotyrosine binding domain of IRS-3, and that IRS-3 interacts with the ankyrin repeat domain of Bcl-3. In addition, IRS-3 augmented the binding activity of p50 to the NF-{kappa}B DNA binding site, as well as the tumor necrosis factor (TNF)-{alpha}-induced transcriptional activity of NF-{kappa}B. Lastly, IRS-3 enhanced NF-{kappa}B-dependent anti-apoptotic gene induction and consequently inhibited TNF-{alpha}-induced cell death. This series of results proposes a novel function for IRS-3 as a transcriptional regulator in TNF-{alpha} signaling, distinct from its function as a substrate of insulin/IGF receptor kinases.
Bcl-2 overexpression: effects on transmembrane calcium movement
International Nuclear Information System (INIS)
Rangaswami, Arun A.; Premack, Brett; Walleczek, Jan; Killoran, Pamela; Gardner, Phyllis; Knox, Susan J.
1996-01-01
calcium influx rate was measured as above. Apoptosis was measured by morphological, DNA fragmentation, and FACS analyses. Levels of Bcl-2 expression in the various cell types were quantified by Western Blot Analysis. Results: In both cell lines, Bcl-2 overexpression had no effect on the resting cytosolic calcium concentration. However, there was a 1.7 to 1.8 fold increase in the cytosolic calcium concentration in the Bcl-2 transfected cells following exposure to 0.5 μM thapsigargin (p<0.001), which was not observed in similarly treated parental or neomycin control transfected cells. Furthermore, this difference was only observed in cells incubated in media containing 2 mM extracellular calcium and was abrogated by chelation of external calcium with EGTA. Quantification of calcium influx rates by the manganese quench technique demonstrated enhanced calcium influx rates in Bcl-2 transfected cell lines both at rest and in response to depletion of cellular calcium stores by thapsigargin. Furthermore, neither hyper polarization of the cells by Valinomycin nor depolarization by isotonic potassium chloride abrogated the relative enhancement of calcium entry in the Bcl-2 over expressing cell lines as compared with the parental or neomycin transfected controls. Conclusion: These preliminary results suggest that Bcl-2 overexpression may contribute to chemo and radioresistance of tumor cells by altering capacitive calcium entry. Although Bcl-2 overexpression does not alter the resting calcium concentration, it does significantly enhance the resting calcium influx rate, suggesting that the dynamic equilibrium of calcium movement across the plasma membrane is significantly altered in cells which over express the Bcl-2 onco-protein. This perturbation is independent of the effect of Bcl-2 on plasma membrane hyper polarization. Given the importance of calcium in signaling a variety of cellular processes including cell division and differentiation, these findings may help to explain the
Herr, D; Keck, C; Tempfer, C; Pietrowski, Detlef
2004-12-01
The ovarian corpus luteum plays a critical role in reproduction being the primary source of circulating progesterone. After ovulation the corpus luteum is build by avascular granulosa lutein cells through rapid vascularization regulated by gonadotropic hormones. The present study was performed to investigate whether this process might be influenced by the human chorionic gonadotropin (hCG)-dependent expression of different tumor suppressor genes and hypoxia dependent transcription factors. RNA was isolated from cultured granulosa lutein cells, transcribed into cDNA, and the transcript level of following genes were determined: RB-1, VHL, NF-1, NF-2, Wt-1, p53, APC, and hypoxia inducible factor-1 (HIF-1), -2, and -3alpha. Additionally, the influence of hCG on the expression of VHL, p53, and HIf2alpha were investigated. We demonstrate that in human granulosa lutein cells the tumor suppressor genes RB-1, VHL, NF-1, NF-2, Wt-1, p53, and APC and the hypoxia dependent transcription factors HIF-1alpha, -2alpha, and -3alpha are expressed. In addition, we showed that hCG regulates the expression of p53, VHL, and HIF-2alpha. Our results indicate that hCG may determine the growth and development of the corpus luteum by mediating hypoxic and apoptotic pathways in human granulosa lutein cells. Copyright 2004 Wiley-Liss, Inc.
p53 functions as a cell cycle control protein in osteosarcomas.
Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B
1990-11-01
Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.
p53 functions as a cell cycle control protein in osteosarcomas.
Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B
1990-01-01
Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717
The role of p53 molecule in radiation and hyperthermic therapies
International Nuclear Information System (INIS)
Yasumoto, Jun-ichi; Takahashi, Akihisa; Ohnishi, Ken; Ohnishi, Takeo
2003-01-01
In recent years, cancer-related genes have been analyzed at the molecular level as predictive indicators for cancer therapy. Among those genes, the tumor suppressor gene p53 is worthy of notice in cancer therapy, because the p53 molecule prevents the malignant degeneration of non-cancer cells by regulating cell-cycle arrest, apoptosis, and DNA repair. An abnormality of the p53 gene introduces a genetic instability and increases the incidence of carcinogenesis and teratogenesis. Therefore, p53 is called a guardian of the genome. Mutations of p53 are observed at a high frequency in human tumors, and are recognized in about half of all malignant tumors in human head and neck cancers. We previously reported that radio- and heat-sensitivities of human cultured tongue squamous cell carcinoma cells are p53-dependent, and are closely correlated with the induction of apoptosis. In a human cell culture system, the interactive hyperthermic enhancement of radiosensitivity was observed in wild-type p53 cells, but not in mutated p53 cells. In a transplanted tumor system, the combination therapies of radiation and hyperthermia induced efficient tumor growth depression and apoptosis in the wild-type p53 tumors. In this review, we discuss the p53 activation signaling pathways through the modification of p53 molecules, such as phosphorylation after radiation and hyperthermia treatments. (author)
Functional Significance of Mutant p53 in Breast Cancer
National Research Council Canada - National Science Library
O'Lear, Rene
2002-01-01
... in those cells with irreparable damage. In human tumors, many hot-spot mutations are found within the DNA-binding domain of p53, rendering it incapable of sequence-specific transactivation of target genes such as p2l, bax, and mdm2...
Energy Technology Data Exchange (ETDEWEB)
Stein, J.; Hecht, T. [Univ. of Texas, Houston, TX (United States); Stal, S. [Texas Children`s Hospital, Houston, TX (United States)] [and others
1995-08-01
Nonsyndromic cleft lip with or without cleft palate (CL/P) is a common craniofacial developmental defect. Recent segregation analyses have suggested that major genes play a role in the etiology of CL/P. Linkage to 22 candidate genes was tested in 11 multigenerational families with CL/P, and 21 of these candidates were excluded. APOC2, 19q13.1, which is linked to the proto-oncogene BCL3, gave suggestive evidence for linkage to CL/P. The study was expanded to include a total of 39 multigenerational CL/P families. Linkage was tested in all families, using anonymous marker, D19S178, and intragenic markers in BCL3 and APOC2. Linkage was tested under two models, autosomal dominant with reduced penetrance and affecteds-only model. Both models showed evidence of heterogeneity, with 43% of families linked at zero recombination to BCL3 when marker data from BCL3 and APOC2 were included. A maximum multipoint LOD score of 7.00 at BCL3 was found among the 17 families that had posterior probabilities {ge}50% in favor of linkage. The transmission disequilibrium test provided additional evidence for linkage with the 3 allele of BCL3 more often transmitted to affected children. These results suggest that BCL3, or a nearby gene, plays a role in the etiology of CL/P in some families. 39 refs., 8 figs., 4 tabs.
SETD1A modulates cell cycle progression through a miRNA network that regulates p53 target genes
Tajima, Ken; Yae, Toshifumi; Javaid, Sarah; Tam, Oliver; Comaills, Valentine; Morris, Robert; Wittner, Ben S.; Liu, Mingzhu; Engstrom, Amanda; Takahashi, Fumiyuki; Black, Joshua C.; Ramaswamy, Sridhar; Shioda, Toshihiro; Hammell, Molly; Haber, Daniel A.
2015-01-01
Expression of the p53-inducible antiproliferative gene BTG2 is suppressed in many cancers in the absence of inactivating gene mutations, suggesting alternative mechanisms of silencing. Using a shRNA screen targeting 43 histone lysine methyltransferases (KMTs), we show that SETD1A suppresses BTG2 expression through its induction of several BTG2-targeting miRNAs. This indirect but highly specific mechanism, by which a chromatin regulator that mediates transcriptional activating marks can lead t...
Interaction between Na-K-ATPase and Bcl-2 proteins BclXL and Bak.
Lauf, Peter K; Alqahtani, Tariq; Flues, Karin; Meller, Jaroslaw; Adragna, Norma C
2015-01-01
In silico analysis predicts interaction between Na-K-ATPase (NKA) and Bcl-2 protein canonical BH3- and BH1-like motifs, consistent with NKA inhibition by the benzo-phenanthridine alkaloid chelerythrine, a BH3 mimetic, in fetal human lens epithelial cells (FHLCs) (Lauf PK, Heiny J, Meller J, Lepera MA, Koikov L, Alter GM, Brown TL, Adragna NC. Cell Physiol Biochem 31: 257-276, 2013). This report establishes proof of concept: coimmunoprecipitation and immunocolocalization showed unequivocal and direct physical interaction between NKA and Bcl-2 proteins. Specifically, NKA antibodies (ABs) coimmunoprecipitated BclXL (B-cell lymphoma extra large) and BAK (Bcl-2 antagonist killer) proteins in FHLCs and A549 lung cancer cells. In contrast, both anti-Bcl-2 ABs failed to pull down NKA. Notably, the molecular mass of BAK1 proteins pulled down by NKA and BclXL ABs appeared to be some 4-kDa larger than found in input monomers. In silico analysis predicts these higher molecular mass BAK1 proteins as alternative splicing variants, encoding 42 amino acid (aa) larger proteins than the known 211-aa long canonical BAK1 protein. These BAK1 variants may constitute a pool separate from that forming mitochondrial pores by specifically interacting with NKA and BclXL proteins. We propose a NKA-Bcl-2 protein ternary complex supporting our hypothesis for a special sensor role of NKA in Bcl-2 protein control of cell survival and apoptosis. Copyright © 2015 the American Physiological Society.
Miyaoka, Masashi; Kikuti, Yara Y; Carreras, Joaquim; Ikoma, Haruka; Hiraiwa, Shinichiro; Ichiki, Akifumi; Kojima, Minoru; Ando, Kiyoshi; Yokose, Tomoyuki; Sakai, Rika; Hoshikawa, Masahiro; Tomita, Naoto; Miura, Ikuo; Takata, Katsuyoshi; Yoshino, Tadashi; Takizawa, Jun; Bea, Silvia; Campo, Elias; Nakamura, Naoya
2018-02-01
Most high-grade B-cell lymphomas with MYC and BCL2 and/or BCL6 rearrangements are aggressive B-cell lymphomas. Occasional double-hit follicular lymphomas have been described but the clinicopathological features of these tumors are not well known. To clarify the characteristics of double-hit follicular lymphomas, we analyzed 10 cases of double-hit follicular lymphomas and 15 cases of high-grade B-cell lymphomas with MYC and BCL2 and/or BCL6 rearrangements for clinicopathological and genome-wide copy-number alterations and copy-neutral loss-of-heterozygosity profiles. For double-hit follicular lymphomas, the median age was 67.5 years (range: 48-82 years). The female/male ratio was 2.3. Eight patients presented with advanced clinical stage. The median follow-up time was 20 months (range: 1-132 months). At the end of the follow-up, 8 patients were alive, 2 patients were dead including 1 patient with diffuse large B-cell lymphoma transformation. Rearrangements of MYC/BCL2, MYC/BCL6, and MYC/BCL2/BCL6 were seen in 8, 1, and 1 cases, respectively. The partner of MYC was IGH in 6 cases. There were no cases of histological grade 1, 4 cases of grade 2, 5 cases of grade 3a, and 1 case of grade 3b. Two cases of grade 3a exhibited immunoblast-like morphology. Immunohistochemistry demonstrated 9 cases with ≥50% MYC-positive cells. There was significant difference in MYC intensity (P=0.00004) and MIB-1 positivity (P=0.001) between double-hit follicular lymphomas and high-grade B-cell lymphomas with MYC and BCL2 and/or BCL6 rearrangements. The genome profile of double-hit follicular lymphomas was comparable with conventional follicular lymphomas (GSE67385, n=198) with characteristic gains of 2p25.3-p11.1, 7p22.3-q36.3, 12q11-q24.33, and loss of 18q21.32-q23 (Phit follicular lymphomas had fewer copy-number alterations and minimal common region of gain at 2p16.1 (70%), locus also significant against conventional follicular lymphomas (P=0.0001). In summary, double-hit follicular
Directory of Open Access Journals (Sweden)
Hong Chang
2016-01-01
Full Text Available Introduction. Luteolin, a falconoid compound in many Chinese herbs and formula, plays important roles in cardiovascular diseases. The underlying mechanism of luteolin remains to be further elaborated. Methods. A model of hydrogen peroxide- (H2O2- induced H9C2 cells apoptosis was established. Cell viabilities were examined with an MTT assay. 2′,7′-Dichlorofluorescin diacetate (DCFH-DA and flow cytometry were used to detect ROS level and apoptosis rate, respectively. The expressions of signaling proteins related to apoptosis were analyzed by western blot and mRNA levels were detected by real-time polymerase chain reaction (PCR. Quercetin was applied as positive drug. Results. Incubation with various concentrations of H2O2 (0, 50, 100, and 200 μM for 1 h caused dose-dependent loss of cell viability and 100 μM H2O2 reduced the cell viability to approximately 50%. Treatments with luteolin and quercetin protected cells from H2O2-induced cytotoxicity and reduced cellular ROS level and apoptosis rate. Moreover, luteolin could downregulate the expressions of Bax, caspase-8, cleaved-caspase-3, and p53 in apoptotic signaling pathway. Further study showed that the expressions of Akt, Bcl-2, and Mdm2 were upregulated by luteolin. Conclusion. Luteolin protects H9C2 cells from H2O2-induced apoptosis. The protective and antiapoptotic effects of luteolin could be mediated by regulating the Akt-P53/Mdm2 apoptotic pathway.
Csatlós, Éva; Máté, Szabolcs; Laky, Marcella; Rigó, János; Joó, József Gábor
2015-07-01
To describe gene expression patterns of the apoptotic regulatory genes Bcl and Bax in human uterine leiomyoma tissue. To investigate the relationship between alterations of gene expression patterns and several relevant clinical parameters. We obtained samples from 101 cases undergoing surgery for uterine leiomyoma for gene expression analysis of the Bcl-2 and Bax genes. Gene expression was quantified using RT-PCR technique. In the leiomyoma group, the Bcl-2 gene was significantly overexpressed compared with the control group although there was no such difference in the gene expression of Bax. Gene activity of Bcl-2 positively correlated with the tumor number in individual uterine leiomyoma cases. Although there was no significant correlation between the length of the cumulative lactation period before the development of uterine leiomyoma and Bcl-2 gene expression in the leiomyoma tissue, we observed a trend for a shorter cumulative lactation period to be associated with overexpression of the Bcl-2 gene. Overexpression of the antiapoptotic Bcl-2 gene appeared to be a factor in the development of uterine leiomyoma, whereas gene activity of the proapoptotic Bax gene did not seem to play a role in the process.
Blok, P.; Craanen, M. E.; Dekker, W.; Offerhaus, G. J.; Tytgat, G. N.
1998-01-01
Inactivation of wild-type p53 during gastric carcinogenesis is usually caused by mutations within exons 5-8 of the p53 gene leading to mutated, usually immunohistochemically detectable p53 proteins. However, functional inactivation of wild-type p53, mimicking mutational inactivation, may also result
Xu, Miao; Chen, Xiumei; Han, Yanling; Ma, Chunqing; Ma, Lin; Li, Shirong
2015-01-01
Clusterin (CLU) is known as a multifunctional protein involved in a variety of physiological processes including lipid transport, epithelial cell differentiation, tumorigenesis, and apoptosis. Our recent study has demonstrated that knockdown of clusterin sensitizes pancreatic cancer cell lines to gmcitabine treatment. However the details of this survival mechanism remain undefined. Of the various downstream targets of CLU, we examined activation of the NF-kB transcription factor and subsequent transcriptional regulation of BCL-2 gene in pancreatic cancer cell MIA-PaCa-2. The MIA-PaCa-2 cells were transfected with an antisense oligonucleotide (ASO) against clusterin, which led to a decreased protein level of the antiapoptotic gene BCL-2. Furthermore, inhibition of CLU decreased the function of NF-kB, which is capable of transcriptional regulation of the BCL-2 gene. Inhibiting this pathway increased the apoptotic effect of gmcitabine chemotherapy. Re-activated NF-kB resulted in attenuation of ASO-induced effects, followed by the bcl-2 upregulation, and bcl-2 re-inhibition resulted in attenuation of Re-activated NF-kB -induced effects. Animals injected with ASO CLU in MIA-PaCa-2 cells combined with gmcitabine treatment had fewer tumors than gmcitabine or ASO CLU alone. These findings suggest that knockdown of CLU sensitized MIA-PaCa-2 cells to gmcitabine chemotherapy through modulating NF-Kb/bcl-2 pathway.
The prognostic value of p53 mutation in pediatric marrow hypoplasia
Directory of Open Access Journals (Sweden)
Sharaf Alzahraa EA
2011-06-01
Full Text Available Abstract Background The tumor suppressor gene p53 is involved in the control of cell proliferation, particularly in stressed cells. p 53 gene mutations are the most frequent genetic event found in human cancers. Fanconi Anemia (FA is the most common representative of inherited bone marrow failure syndromes (IBMFS with a leukemic propensity. P 53 DNA alteration has not been studied before in Egyptian children with FA. Patients and methods we investigated p53 mutation in the bone marrow and peripheral blood of forty children, FA (n = 10, acquired aplastic anemia (AAA (n = 10, and immune thrombocytopenia (ITP as a control (n = 20, using real-time PCR by TaqMan probe assay Results Mutation of p53 gene was demonstrated in the BM of 90% (9/10 of children with FA, compared to 10% (1/10 in AAA (p Conclusion mutation of p53 gene in hypoplastic marrow especially FA may represent an early indicator of significant DNA genetic alteration with cancer propensity.
Yu, Albert Cheung Hoi; Yung, Hon Wa; Hui, Michael Hung Kit; Lau, Lok Ting; Chen, Xiao Qian; Collins, Richard A
2003-10-15
An in vitro ischemia model was established and the effect of the metabolic inhibitors cycloheximide (CHX) and actinomycin D (ActD) on apoptosis in astrocytes under ischemia studied. CHX decreased by 75% the number of cells dying after 6 hr of ischemia compared with control cultures. TdT-mediated dUTP nick end labelling (TUNEL) staining of comparable cultures was reduced by 40%. ActD decreased cell death by 60% compared with controls. The number of TUNEL-positive cells was reduced by 38%. The nuclear shrinkage in TUNEL-positive astrocytes in control cultures did not occur in ActD-treated astrocytes, indicating that nuclear shrinkage and DNA fragmentation during apoptosis are two unrelated processes. Expression of bcl-2 (alpha and beta), bax, and Ice in astrocytes under similar ischemic conditions, as measured by quantitative reverse transcription-polymerase chain reaction, indicated that ischemia down-regulated bcl-2 (alpha and beta) and bax. Ice was initially down-regulated from 0 to 4 hr, before returning to control levels after 8 hr of ischemia. ActD decreased the expression of these genes. CHX reduced the expression of bcl-2 (alpha and beta) but increased bax and Ice expression. It is hypothesized that the balance of proapoptotic (Bad, Bax) and antiapoptotic (Bcl-2, Bcl-Xl) proteins determines apoptosis. The data suggest that the ratio of Bcl-2/Bad in astrocytes following ActD and CHX treatment does not decrease as much in untreated cells during ischemia. Our data indicate that it is the ratio of Bcl-2 family members that plays a critical role in determining ischemia-induced apoptosis. It is also important to note that ischemia-induced apoptosis involves the regulation of RNA and protein synthesis. Copyright 2003 Wiley-Liss, Inc.
Friend or Foe: MicroRNAs in the p53 network.
Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo
2018-04-10
The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.
Powari, Manish; Varma, Neelam; Varma, Subhash; Marwaha, Ram Kumar; Sandhu, Harpreet; Ganguly, Nirmal Kumar
2002-06-01
To characterize the phenotype of acute leukemia cases using flow cytometry, to detect mixed lineage cases and to use DNA index determination, including S-phase fraction (SPF) and p53 detection, to find if there was any correlation of SPF and p53 expression with outcome. Fifty-five cases of acute leukemia were enrolled in this study. A complete hemogram and routine bone marrow examination, including cytochemistry, was done. Mycloperoxidase-negative cases were evaluated on a flow cytometer using monoclonal antibodies. DNA indices were determined by flow cytometry in all cases, and p53 was detected immunohistochemically using the alkaline phosphatase/antialkaline phosphatase technique. Acute myeloblastic leukemia (AML) was diagnosed in 32 cases; acute lymphoblastic leukemia (ALL) was diagnosed in 18 (14 B lineage and 4 T line age). Four cases showed mixed lineage leukemia, and undifferentiated acute leukemia was diagnosed in one case. The mean/range of SPF for these groups were 3.76/0.33-6.91, 6.25/0.15-21.4, 2.89/0.35-10.64, 2.60/0.72-6.94 and 7.34, respectively. Aneuploidy was detected in two cases of B-lineage ALL and tetraploidy in a case of AML-M7, while all others were diploid p53. Was detected in 6 of 55 cases (10.90%). Follow-up was available for 24 patients. Five patients relapsed, and four had B-cell type ALL and were diploid and expressed no p53 gene. SPF% did not show any correlation with outcome. These data suggest that within acute leukemia subtypes, there is a wide variation in SPF. SPF does not seem to correlate with outcome. Immunophenotyping is essential to determine the lineage in myeloperoxidase-negative cases. It is perhaps the only way to diagnose mixed lineage leukemia and aberrant expression of markers presently. The p53 gene was detected less frequently. However, more studies are required from different centers with longer follow-up to evaluate prognostic significance.
Energy Technology Data Exchange (ETDEWEB)
Shukla, Shatrunajay [Herbal Research Section, CSIR — Indian Institute of Toxicology Research, Post Box No. 80, Mahatma Gandhi Marg, Lucknow‐226001 (India); Department of Medical Elementology and Toxicology, Jamia Hamdard (Hamdard University), Hamdard Nagar, New Delhi ‐110062 (India); Sharma, Ankita [Herbal Research Section, CSIR — Indian Institute of Toxicology Research, Post Box No. 80, Mahatma Gandhi Marg, Lucknow‐226001 (India); Pandey, Vivek Kumar [Herbal Research Section, CSIR — Indian Institute of Toxicology Research, Post Box No. 80, Mahatma Gandhi Marg, Lucknow‐226001 (India); Academy of Scientific and Innovative Research (India); Raisuddin, Sheikh [Department of Medical Elementology and Toxicology, Jamia Hamdard (Hamdard University), Hamdard Nagar, New Delhi ‐110062 (India); Kakkar, Poonam, E-mail: kakkarp59@gmail.com [Herbal Research Section, CSIR — Indian Institute of Toxicology Research, Post Box No. 80, Mahatma Gandhi Marg, Lucknow‐226001 (India); Academy of Scientific and Innovative Research (India)
2016-01-15
Post-translational modifications i.e. phosphorylation and acetylation are pivotal requirements for proper functioning of eukaryotic proteins. The current study aimed to decode the impact of acetylation/deacetylation of non-histone targets i.e. FoxO1/3a and p53 of sirtuins (NAD{sup +} dependent enzymes with lysine deacetylase activity) in berberine treated human hepatoma cells. Berberine (100 μM) inhibited sirtuins significantly (P < 0.05) at transcriptional level as well as at translational level. Combination of nicotinamide (sirtuin inhibitor) with berberine potentiated sirtuins inhibition and increased the expression of FoxO1/3a and phosphorylation of p53 tumor suppressor protein. As sirtuins deacetylate non-histone targets including FoxO1/3a and p53, berberine increased the acetylation load of FoxO1/3a and p53 proteins. Acetylated FoxO and p53 proteins transcriptionally activate BH3-only proteins Bim and PUMA (3.89 and 3.87 fold respectively, P<0.001), which are known as direct activator of pro-apoptotic Bcl-2 family protein Bax that culminated into mitochondria mediated activation of apoptotic cascade. Bim/PUMA knock-down showed no changes in sirtuins' expression while cytotoxicity induced by berberine and nicotinamide was curtailed up to 28.3% (P < 0.001) and it restored pro/anti apoptotic protein ratio in HepG2 cells. Sirtuins inhibition was accompanied by decline in NAD{sup +}/NADH ratio, ATP generation, enhanced ROS production and decreased mitochondrial membrane potential. TEM analysis confirmed mitochondrial deterioration and cell damage. SRT-1720 (1–10 μM), a SIRT-1 activator, when pre-treated with berberine (25 μM), reversed sirtuins expression comparable to control and significantly restored the cell viability (P < 0.05). Thus, our findings suggest that berberine mediated sirtuins inhibition resulting into FoxO1/3a and p53 acetylation followed by BH3-only protein Bim/PUMA activation may in part be responsible for mitochondria
Crosstalk between Bcl-2 family and Ras family small GTPases: potential cell fate regulation?
International Nuclear Information System (INIS)
Kang, Jia; Pervaiz, Shazib
2013-01-01
Cell fate regulation is a function of diverse cell signaling pathways that promote cell survival and or inhibit cell death execution. In this regard, the role of the Bcl-2 family in maintaining a tight balance between cell death and cell proliferation has been extensively studied. The conventional dogma links cell fate regulation by the Bcl-2 family to its effect on mitochondrial permeabilization and apoptosis amplification. However, recent evidence provide a novel mechanism for death regulation by the Bcl-2 family via modulating cellular redox metabolism. For example overexpression of Bcl-2 has been shown to contribute to a pro-oxidant intracellular milieu and down-regulation of cellular superoxide levels enhanced death sensitivity of Bcl-2 overexpressing cells. Interestingly, gene knockdown of the small GTPase Rac1 or pharmacological inhibition of its activity also reverted death phenotype in Bcl-2 expressing cells. This appears to be a function of an interaction between Bcl-2 and Rac1. Similar functional associations have been described between the Bcl-2 family and other members of the Ras superfamily. These interactions at the mitochondria provide novel opportunities for strategic therapeutic targeting of drug-resistant cancers.
International Nuclear Information System (INIS)
Dong, Guang-Hui; Wang, Jing; Zhang, Ying-Hua; Liu, Miao-Miao; Wang, Da; Zheng, Li; Jin, Yi-He
2012-01-01
Perfluorooctane sulfonate (PFOS) is a persistent environmental contaminant found in human and wildlife tissues. It has been reported that PFOS can cause atrophy of the immune organs and apoptosis of immunocytes in rodents. However, the mechanism behind such cause is still unclear. To understand the model of cell death and its mechanism on lymphoid cells in vivo, we conducted a dose/response experiment in which 4 groups of male adult C57BL/6 mice (12 mice per group) were dosed daily by oral gavage with PFOS at 0, 0.0167, 0.0833, or 0.8333 mg/kg/day, yielding targeted Total Administered Dose (TAD) of 0, 1, 5, or 50 mg PFOS/kg, respectively, over 60 days. The results showed that spleen and thymus weight were significantly reduced in the highest PFOS-dose-group (TAD 50 mg PFOS/kg) compared to the control group, whereas liver weight was significantly increased. We analyzed the cell death via apoptosis with an annexin-V/propidium iodide assay by flow cytometry, and observed that both the percentage of apoptosis and the expression of the pro-apoptotic proteins p53 in splenocytes and thymocytes increased in a dose-related manner after PFOS treatment. We also observed that PFOS induced p53-dependent apoptosis through the cooperation between the Bcl-xl down regulation without changing the Bcl-2 and Bax expression. The down regulation of Bcl-xl was strongly indicating mitochondrial involvement in apoptosis. It is confirmed by the release of cytochrome c and activation of caspase-3. All of these findings establish an important role of p53 and mitochondrial function in PFOS induced toxic environment in the host. -- Highlights: ► PFOS immunotoxicity is caused by induction of apoptosis via the p53 activation. ► PFOS exposure can induce down regulation of Bcl-xl. ► Mitochondria are involved in PFOS-induced apoptosis. ► PFOS exposure can cause the release of cytochrome c and activation of caspase-3.
Energy Technology Data Exchange (ETDEWEB)
Dong, Guang-Hui, E-mail: ghdong@mail.cmu.edu.cn [School of Public Health, China Medical University, Shenyang 110001 (China); Wang, Jing [Department of Biostatistics, School of Public Health, Saint Louis University, Saint Louis, MO 63104 (United States); Zhang, Ying-Hua; Liu, Miao-Miao; Wang, Da [School of Public Health, China Medical University, Shenyang 110001 (China); Zheng, Li [Department of Immunology, College of Basic Medical Science, China Medical University, Shenyang 110001 (China); Jin, Yi-He [School of Public Health, China Medical University, Shenyang 110001 (China); School of Environmental Science and Technology, Dalian University of Technology, Key Laboratory of Industrial Ecology and Environmental Engineering, Ministry of Education, Dalian 116024 (China)
2012-10-15
Perfluorooctane sulfonate (PFOS) is a persistent environmental contaminant found in human and wildlife tissues. It has been reported that PFOS can cause atrophy of the immune organs and apoptosis of immunocytes in rodents. However, the mechanism behind such cause is still unclear. To understand the model of cell death and its mechanism on lymphoid cells in vivo, we conducted a dose/response experiment in which 4 groups of male adult C57BL/6 mice (12 mice per group) were dosed daily by oral gavage with PFOS at 0, 0.0167, 0.0833, or 0.8333 mg/kg/day, yielding targeted Total Administered Dose (TAD) of 0, 1, 5, or 50 mg PFOS/kg, respectively, over 60 days. The results showed that spleen and thymus weight were significantly reduced in the highest PFOS-dose-group (TAD 50 mg PFOS/kg) compared to the control group, whereas liver weight was significantly increased. We analyzed the cell death via apoptosis with an annexin-V/propidium iodide assay by flow cytometry, and observed that both the percentage of apoptosis and the expression of the pro-apoptotic proteins p53 in splenocytes and thymocytes increased in a dose-related manner after PFOS treatment. We also observed that PFOS induced p53-dependent apoptosis through the cooperation between the Bcl-xl down regulation without changing the Bcl-2 and Bax expression. The down regulation of Bcl-xl was strongly indicating mitochondrial involvement in apoptosis. It is confirmed by the release of cytochrome c and activation of caspase-3. All of these findings establish an important role of p53 and mitochondrial function in PFOS induced toxic environment in the host. -- Highlights: ► PFOS immunotoxicity is caused by induction of apoptosis via the p53 activation. ► PFOS exposure can induce down regulation of Bcl-xl. ► Mitochondria are involved in PFOS-induced apoptosis. ► PFOS exposure can cause the release of cytochrome c and activation of caspase-3.
Meng, X; Carlson, NR; Dong, J; Zhang, Y
2015-01-01
The multifaceted oncogene c-Myc plays important roles in the development and progression of human cancer. Recent in vitro and in vivo studies have shown that the p19Arf–Mdm2–p53 and the ribosomal protein (RP)–Mdm2–p53 pathways are both essential in preventing oncogenic c-Myc-induced tumorigenesis. Disruption of each pathway individually by p19Arf deletion or by Mdm2C305F mutation, which disrupts RP-Mdm2 binding, accelerates Eμ-myc transgene-induced pre-B/B-cell lymphoma in mice at seemingly s...
p53 functions as a cell cycle control protein in osteosarcomas.
Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B
1990-01-01
Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfect...
Dummer, R; Bergh, J; Karlsson, Y; Horovitz, JA; Mulder, NH; Huinin, DT; Burg, G; Hofbauer, G; Osanto, S
p53 mutations are common genetic alterations in human cancer. Gene transfer of a wild-type (wt) p53 gene reverses the loss of normal p53 function in vitro and in vivo. A phase I dose escalation study of single intratumoral (i.t.) injection of a replication-defective adenoviral expression vector
Directory of Open Access Journals (Sweden)
Rama Jasty
2001-01-01
Full Text Available The bcl-2 and c-myc oncogenes cooperate to transform multiple cell types. In the pediatric malignancy NB2, Bcl2 is highly expressed. In tumors with a poor prognosis, N-Myc, a protein homologous to c-Myc, is overexpressed as a result of gene amplification. The present study was designed to determine whether Bcl-2 cooperates with N-Myc to bestow a tumorigenic phenotype to neuroblastoma (NB cells. NB cell lines that at baseline express neither Bcl-2 nor N-Myc were stably transfected to express these gene products. In this model, we found Bcl-2 rescues N-Myc-expressing cells from apoptosis induced by serum withdrawal. Coexpression of Bcl-2 and N-Myc supports growth in low serum conditions and anchorage-independent growth in soft agar. Similarly, in vivo tumorigenic and angiogenic activity was dependent on coexpression. Our data further suggests that the mechanism underlying these changes involves the receptor for insulin growth factor type I (IGF-IR.
Fluoxetine protects against IL-1β-induced neuronal apoptosis via downregulation of p53.
Shan, Han; Bian, Yaqi; Shu, Zhaoma; Zhang, Linxia; Zhu, Jialei; Ding, Jianhua; Lu, Ming; Xiao, Ming; Hu, Gang
2016-08-01
Fluoxetine, a selective serotonin reuptake inhibitor, exerts neuroprotective effects in a variety of neurological diseases including stroke, but the underlying mechanism remains obscure. In the present study, we addressed the molecular events in fluoxetine against ischemia/reperfusion-induced acute neuronal injury and inflammation-induced neuronal apoptosis. We showed that treatment of fluoxetine (40 mg/kg, i.p.) with twice injections at 1 h and 12 h after transient middle cerebral artery occlusion (tMCAO) respectively alleviated neurological deficits and neuronal apoptosis in a mouse ischemic stroke model, accompanied by inhibiting interleukin-1β (IL-1β), Bax and p53 expression and upregulating anti-apoptotic protein Bcl-2 level. We next mimicked neuroinflammation in ischemic stroke with IL-1β in primary cultured cortical neurons and found that pretreatment with fluoxetine (1 μM) prevented IL-1β-induced neuronal apoptosis and upregulation of p53 expression. Furthermore, we demonstrated that p53 overexpression in N2a cell line abolished the anti-apoptotic effect of fluoxetine, indicating that p53 downregulation is required for the protective role of fluoxetine in IL-1β-induced neuronal apoptosis. Fluoxetine downregulating p53 expression could be mimicked by SB203580, a specific inhibitor of p38, but blocked by anisomycin, a p38 activator. Collectively, our findings have revealed that fluoxetine protects against IL-1β-induced neuronal apoptosis via p38-p53 dependent pathway, which give us an insight into the potential of fluoxetine in terms of opening up novel therapeutic avenues for neurological diseases including stroke. Copyright © 2016 Elsevier Ltd. All rights reserved.
p53-Induced Apoptosis Occurs in the Absence of p14ARF in Malignant Pleural Mesothelioma
Directory of Open Access Journals (Sweden)
Sally Hopkins-Donaldson
2006-07-01
Full Text Available Malignant pleural mesotheliomas (MPMs are usually wild type for the p53 gene but contain homozygous deletions in the INK4A locus that encodes p14ARF, an inhibitor of p53-MDM2 interaction. Previous findings suggest that lack of p14ARF expression and the presence of SV40 large T antigen (L-Tag result in p53 inactivation in MPM. We did not detect SV40 L-Tag mRNA in either MPM cell lines or primary cultures, treatment of p14ARF-deficient cells with cisplatin (CDDP increased both total and phosphorylated p53 and enhanced p53 DNA-binding activity. On incubation with CDDP, levels of positively regulated p53 transcriptional targets p21WAF, PIG3, MDM2, Bax, PUMA increased in p14ARF-deficient cells, whereas negatively regulated survivin decreased. Significantly, p53-induced apoptosis was activated by CDDP in p14ARF-deficient cells, treatment with p53-specific siRNA rendered them more CDDP-resistant. p53 was also activated by: 1 inhibition of MDM2 (using nutlin-3; 2 transient overexpression of p14ARF; and 3 targeting of survivin using antisense oligonucleotides. However, it is noteworthy that only survivin downregulation sensitized cells to CDDP-induced apoptosis. These results suggest that p53 is functional in the absence of p14ARF in MPM and that targeting of the downstream apoptosis inhibitor survivin can sensitize to CDDP-induced apoptosis.
Functional Significance of Mutant p53 in Breast Cancer
National Research Council Canada - National Science Library
O'Lear, Renee
2001-01-01
... in those cells with irreparable damage. In human tumors, many hot-spot mutations are found within the DNA-binding domain of p53, rendering it incapable of sequence-specific transactivation of target genes such as p21, bax, and mdm2...
Directory of Open Access Journals (Sweden)
Dong S
2013-10-01
Full Text Available Shengli Dong,1 Qibin Tang,2 Miaoyun Long,3 Jian Guan,4 Lu Ye,5 Gaopeng Li6 1Department of General Surgery, The Second Hospital of Shanxi Medical University, Shanxi Medical University, Taiyuan, Shanxi Province, 2Department of Hepatobiliopancreatic Surgery, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou, Guangdong Province, 3Department of Thyroid and Vascular Surgery, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou, Guangdong Province, 4Department of Radiology, First Affiliated Hospital, Sun Yat-sen University, Guangzhou, Guangdong Province, 5Infection Department, Guangzhou No 8 Hospital, Guangzhou, Guangdong Province, 6Department of Ultrasound, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou, Guangdong Province, People's Republic of China Background/aim: A local nanotherapy (LNT combining the therapeutic efficacy of trans-arterial embolization, nanoparticles, and p53 gene therapy has been previously presented. The study presented here aimed to further improve the incomplete tumor eradication and limited survival enhancement and to elucidate the molecular mechanism of the LNT. Methods: In a tumor-targeting manner, recombinant expressing plasmids harboring wild-type p53 and Rb were either co-transferred or transferred separately to rabbit hepatic VX2 tumors in a poly-L-lysine-modified hydroxyapatite nanoparticle nanoplex and Lipiodol® (Guerbet, Villepinte, France emulsion via the hepatic artery. Subsequent co-expression of p53 and Rb proteins within the treated tumors was investigated by Western blotting and in situ analysis by laser-scanning confocal microscopy. The therapeutic effect was evaluated by the tumor growth velocity, apoptosis and necrosis rates, their sensitivity to Adriamycin® (ADM, mitomycin C, and fluorouracil, the microvessel density of tumor tissue, and the survival time of animals. Eventually, real-time polymerase chain reaction and enhanced chemiluminescence Western blotting
International Nuclear Information System (INIS)
Liu Guangwei; Wang Chunyan; Lu Zhe; Liu Shunchun; Gong Shouliang
2003-01-01
The different kinds of spermatogenic cells were separated using density gradient centrifugation and their apoptosis and Bcl-2 and Bax protein expression were measured with flow cytometry and immunohistochemical method, respectively. The results showed the apoptosis in all kinds of spermatogenic cells induced by low dose radiation (LDR) had a obvious regularity. When the doses were 0.025 and 0.05 Gy, spermatogonia apoptosis was dominant. With the increase of irradiation dose (0.075-0.2 Gy), spermatocytes also showed an apoptotic change, but the apoptotic percentage of spermatogonia was significantly higher than that of spermatocytes. Moreover, the apoptosis of spermatids and spermatozoa scarcely occurred after LDR. Bax protein was primarily expressed in spermatogonia and spermatocytes, and the former was significantly higher than that of the latter after LDR. With the increase of irradiation dose, Bax protein expression showed a upgrading tendency, but that of spermatids and spermatozoa scarcely occurred. Bcl-2 protein was primarily expressed in spermatids and spermatozoa, but the Bcl-2 protein expressions of spermatogonia and spermatocytes scarcely occurred after LDR. These results imply that the interacting regulation of Bcl-2 and Bax gene expression might be involved in selective apoptosis of spermatogenic cells induced by LDR, which provided an experimental evidence for further exploring the apoptotic mechanism of adaptive response of spermatogenic cells by LDR
Badr, Ramak; Hashemi, Mehrdad; Javadi, Gholamreza; Movafagh, Abolfazl; Mahdian, Reza
2015-12-01
The hippocampus is a tiny nub in the mammalian brain that is involved in forming, organizing, and storing memories. Global cerebral ischemia (GCI) and reperfusion induced apoptosis lead to cell injury and death. FK-506 is a strong immunosuppressant drug that has neuroprotective effects on the hypoxic-ischemic effects of brain damage. BAD and Bcl-xL are pro-apoptotic and anti-apoptotic genes, respectively. These genes belong to The B-cell lymphoma-2 (Bcl-2) family. In this study, we assessed the neurotrophic properties of FK-506 on expression of the BAD and Bcl-xL genes in the hippocampus following global ischemia and reperfusion. In the present experimental study, adult male Wistar rats were obtained and housed under standard conditions in the Tehran University of Medical Science in Iran. Rats were equally distributed in groups of three among the following groups: normal control, treated-1 (ischemia/reperfusion), and treated-2 (ischemia/reperfusion followed by FK-506). Global ischemia was induced for animals in the treated-1 and treated-2 groups. In treated-2, two doses of FK-506 were injected: one dose as an IV injection immediately after reperfusion and another as an intra-peritoneal (IP) injection after 48 hours. Then, the hippocampus tissue was removed after anaesthetizing the rats. RNA was isolated, cDNA was synthesized, and real-time PCR was performed. Finally, the obtained data were analyzed statistically (P value ˂ 0.05). The quantitative results of real-time PCR show that the mRNA expression ratio of Bcl-xL down-regulated was 0.75 ± 0.06 in the ischemia/reperfusion group versus 1.57 ± 0.09 in the control group (P value BAD up-regulated in the ischemia/reperfusion + FK506 group was 3.65 ± 0.49 compared to Normal control (1.39 ± 0.09) and Ischemia/reperfusion + FK506 was 1.09 ± 0.20 (P value BAD /Bcl-xL) confirmed that expression of the pro-apoptotic gene significantly decreased (P value ˂ 0.001) under the ischemia/reperfusion condition. In contrast
Basal p53 expression is indispensable for mesenchymal stem cell integrity.
Boregowda, Siddaraju V; Krishnappa, Veena; Strivelli, Jacqueline; Haga, Christopher L; Booker, Cori N; Phinney, Donald G
2018-03-01
Marrow-resident mesenchymal stem cells (MSCs) serve as a functional component of the perivascular niche that regulates hematopoiesis. They also represent the main source of bone formed in adult bone marrow, and their bifurcation to osteoblast and adipocyte lineages plays a key role in skeletal homeostasis and aging. Although the tumor suppressor p53 also functions in bone organogenesis, homeostasis, and neoplasia, its role in MSCs remains poorly described. Herein, we examined the normal physiological role of p53 in primary MSCs cultured under physiologic oxygen levels. Using knockout mice and gene silencing we show that p53 inactivation downregulates expression of TWIST2, which normally restrains cellular differentiation to maintain wild-type MSCs in a multipotent state, depletes mitochondrial reactive oxygen species (ROS) levels, and suppresses ROS generation and PPARG gene and protein induction in response to adipogenic stimuli. Mechanistically, this loss of adipogenic potential skews MSCs toward an osteogenic fate, which is further potentiated by TWIST2 downregulation, resulting in highly augmented osteogenic differentiation. We also show that p53 - /- MSCs are defective in supporting hematopoiesis as measured in standard colony assays because of decreased secretion of various cytokines including CXCL12 and CSF1. Lastly, we show that transient exposure of wild-type MSCs to 21% oxygen upregulates p53 protein expression, resulting in increased mitochondrial ROS production and enhanced adipogenic differentiation at the expense of osteogenesis, and that treatment of cells with FGF2 mitigates these effects by inducing TWIST2. Together, these findings indicate that basal p53 levels are necessary to maintain MSC bi-potency, and oxygen-induced increases in p53 expression modulate cell fate and survival decisions. Because of the critical function of basal p53 in MSCs, our findings question the use of p53 null cell lines as MSC surrogates, and also implicate dysfunctional
Directory of Open Access Journals (Sweden)
Daruka Mahadevan
Full Text Available Pearson correlation coefficient for expression analysis of the Lymphoma/Leukemia Molecular Profiling Project (LLMPP demonstrated Aurora A and B are highly correlated with MYC in DLBCL and mantle cell lymphoma (MCL, while both Auroras correlate with BCL2 only in DLBCL. Auroras are up-regulated by MYC dysregulation with associated aneuploidy and resistance to microtubule targeted agents such as vincristine. Myc and Bcl2 are differentially expressed in U-2932, TMD-8, OCI-Ly10 and Granta-519, but only U-2932 cells over-express mutated p53. Alisertib [MLN8237 or M], a highly selective small molecule inhibitor of Aurora A kinase, was synergistic with vincristine [VCR] and rituximab [R] for inhibition of cell proliferation, abrogation of cell cycle checkpoints and enhanced apoptosis versus single agent or doublet therapy. A DLBCL (U-2932 mouse model showed tumor growth inhibition (TGI of ∼ 10-20% (p = 0.001 for M, VCR and M-VCR respectively, while R alone showed ∼ 50% TGI (p = 0.001. M-R and VCR-R led to tumor regression [TR], but relapsed 10 days after discontinuing therapy. In contrast, M-VCR-R demonstrated TR with no relapse >40 days after stopping therapy with a Kaplan-Meier survival of 100%. Genes that are modulated by M-VCR-R (CENP-C, Auroras play a role in centromere-kinetochore function in an attempt to maintain mitosis in the presence of synthetic lethality. Together, our data suggest that the interaction between alisertib plus VCR plus rituximab is synergistic and synthetic lethal in Myc and Bcl-2 co-expressing DLBCL. Alisertib plus vincristine plus rituximab [M-VCR-R] may represent a new strategy for DLBCL therapy.
Mahadevan, Daruka; Morales, Carla; Cooke, Laurence S; Manziello, Ann; Mount, David W; Persky, Daniel O; Fisher, Richard I; Miller, Thomas P; Qi, Wenqing
2014-01-01
Pearson correlation coefficient for expression analysis of the Lymphoma/Leukemia Molecular Profiling Project (LLMPP) demonstrated Aurora A and B are highly correlated with MYC in DLBCL and mantle cell lymphoma (MCL), while both Auroras correlate with BCL2 only in DLBCL. Auroras are up-regulated by MYC dysregulation with associated aneuploidy and resistance to microtubule targeted agents such as vincristine. Myc and Bcl2 are differentially expressed in U-2932, TMD-8, OCI-Ly10 and Granta-519, but only U-2932 cells over-express mutated p53. Alisertib [MLN8237 or M], a highly selective small molecule inhibitor of Aurora A kinase, was synergistic with vincristine [VCR] and rituximab [R] for inhibition of cell proliferation, abrogation of cell cycle checkpoints and enhanced apoptosis versus single agent or doublet therapy. A DLBCL (U-2932) mouse model showed tumor growth inhibition (TGI) of ∼ 10-20% (p = 0.001) for M, VCR and M-VCR respectively, while R alone showed ∼ 50% TGI (p = 0.001). M-R and VCR-R led to tumor regression [TR], but relapsed 10 days after discontinuing therapy. In contrast, M-VCR-R demonstrated TR with no relapse >40 days after stopping therapy with a Kaplan-Meier survival of 100%. Genes that are modulated by M-VCR-R (CENP-C, Auroras) play a role in centromere-kinetochore function in an attempt to maintain mitosis in the presence of synthetic lethality. Together, our data suggest that the interaction between alisertib plus VCR plus rituximab is synergistic and synthetic lethal in Myc and Bcl-2 co-expressing DLBCL. Alisertib plus vincristine plus rituximab [M-VCR-R] may represent a new strategy for DLBCL therapy.
Immunogenicity of Bcl-2 in patients with cancer
DEFF Research Database (Denmark)
Andersen, Mads Hald; Svane, Inge Marie; Kvistborg, Pia
2005-01-01
patients suffering from unrelated tumor types (ie, pancreatic cancer, breast cancer, acute myeloid leukemia [AML], and chronic lymphocytic leukemia [CLL]). Additionally, we show that these Bcl-2-reactive T cells are indeed peptide-specific, cytotoxic effector cells. Thus, Bcl-2 may serve as an important......B-cell lymphoma 2 (Bcl-2) is a pivotal regulator of apoptotic cell death and it is overexpressed in many cancers. Consequently, the Bcl-2 protein is an attractive target for drug design, and Bcl-2-specific antisense oligonucleotides or small-molecule Bcl-2 inhibitors have shown broad anticancer......-2 in cancer and the fact that immune escape by down-regulation or loss of expression of this protein would impair sustained tumor growth makes Bcl-2 a very attractive target for anticancer immunotherapy. Herein, we describe spontaneous T-cell reactivity against Bcl-2 in peripheral blood from...
Directory of Open Access Journals (Sweden)
Falah M
2016-07-01
Full Text Available Masoumeh Falah,1,2 Mohammad Najafi,2 Massoud Houshmand,3 Mohammad Farhadi1 1ENT and Head & Neck Research Center and Department, Iran University of Medical Sciences, Tehran, Iran; 2Cellular and Molecular Research Center, Biochemistry Department, Iran University of Medical Sciences, Tehran, Iran; 3Department of Medical Genetics, National Institute for Genetic Engineering and Biotechnology, Tehran, Iran Abstract: Age-related hearing impairment (ARHI is a progressive and a common sensory disorder in the elderly and will become an increasingly important clinical problem given the growing elderly population. Apoptosis of cochlear cells is an important factor in animal models of ARHI. As these cells cannot regenerate, their loss leads to irreversible hearing impairment. Identification of molecular mechanisms can facilitate disease prevention and effective treatment. In this study, we compared the expression of the genes BAK1 and BCL2 as two arms of the intrinsic apoptosis pathway between patients with ARHI and healthy subjects. ARHI and healthy subjects were selected after an ear nose throat examination, otoscopic investigation, and pure tone audiometry. RNA was extracted from peripheral blood samples, and relative gene expression levels were measured using quantitative real-time polymerase chain reaction. BAK1 and the BAK1/BCL2 ratio were statistically significantly upregulated in the ARHI subjects. The BAK1/BCL2 ratio was positively correlated with the results of the audiometric tests. Our results indicate that BAK-mediated apoptosis may be a core mechanism in the progression of ARHI in humans, similar to finding in animal models. Moreover, the gene expression changes in peripheral blood samples could be used as a rapid and simple biomarker for early detection of ARHI. Keywords: age-related hearing impairment (ARHI, presbycusis, biomarker, treatment
COX-2 and p53 in human sinonasal cancer
DEFF Research Database (Denmark)
Holmila, Reetta; Cyr, Diane; Luce, Danièle
2008-01-01
The causal role of wood-dust exposure in sinonasal cancer (SNC) has been established in epidemiological studies, but the mechanisms of SNC carcinogenesis are still largely unknown. Increased amounts of COX-2 are found in both premalignant and malignant tissues, and experimental evidence link COX-2...... to development of cancer. Many signals that activate COX-2 also induce tumor suppressor p53, a transcription factor central in cellular stress response. We investigated COX-2 and p53 expressions by immunohistochemistry in 50 SNCs (23 adenocarcinomas, and 27 squamous cell carcinomas (SCC); 48 analyzed for COX-2...... displayed adenocarcinoma. COX-2 was expressed at higher levels in adenocarcinoma as compared to SSC (p COX-2 expression showed significant association with occupational exposure to wood dust (p = 0.024), and with nonsmoking status (p = 0.001). No statistically significant associations between...
An N-terminal Region of Mot-2 Binds to p53 In Vitro
Directory of Open Access Journals (Sweden)
Sunil C. Kaul
2001-01-01
Full Text Available The mouse mot-2 protein was earlier shown to bind to the tumor suppressor protein, p53. The mot-2 binding site of p53 was mapped to C-terminal amino acid residues 312–352, which includes the cytoplasmic sequestration domain. In the present study, we have found that both mot-1 and mot-2 bind to p53 in vitro. By using His-tagged deletion mutant proteins, the p53-binding domain of mot-2 was mapped to its Nterminal amino acid residues 253–282, which are identical in mot-1 and mot-2 proteins. Some peptides containing the p53-binding region of mot-2 were able to compete with the full-length protein for p53 binding. The data provided rationale for in vitro binding of mot-1 and mot-2 proteins to p53 and supported the conclusion that inability of mot-1 protein to bind p53 in vivo depends on secondary structure or its binding to other cellular factors. Most interestingly, the p53-binding region of mot-2 was common to its MKT-077, a cationic dye that exhibits antitumor activity, binding region. Therefore it is most likely that MKT-077-induced nuclear translocation and restoration of wild-type p53 function in transformed cells takes place by a competitional mechanism.
Expression of Androgen Receptor Is Negatively Regulated By p53
Directory of Open Access Journals (Sweden)
Fatouma Alimirah
2007-12-01
Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.
Discrimination of p53 immunohistochemistry-positive tumors by its staining pattern in gastric cancer
International Nuclear Information System (INIS)
Ando, Koji; Oki, Eiji; Saeki, Hiroshi; Yan, Zhao; Tsuda, Yasuo; Hidaka, Gen; Kasagi, Yuta; Otsu, Hajime; Kawano, Hiroyuki; Kitao, Hiroyuki; Morita, Masaru; Maehara, Yoshihiko
2015-01-01
Immunohistochemistry staining of p53 is a cheap and simple method to detect aberrant function of p53. However, there are some discrepancies between the result of immunohistochemistry staining and mutation analysis. This study attempted to find a new definition of p53 staining by its staining pattern. Immunohistochemistry staining of p53 and TP53 gene mutation analysis were performed in 148 gastric cancer patients. Also SNP-CGH array analysis was conducted to four cases. Positive staining of p53 was observed in 88 (59.5%) tumors. Tumors with positive p53 staining showed malignant features compared to negative tumors. Mutation of TP53 gene was observed in 29 (19.6%) tumors with higher age and differentiated type. In positive p53 tumors, two types could be distinguished; aberrant type and scattered type. With comparison to TP53 gene mutation analysis, all the scattered type had wild-type TP53 gene (P = 0.0003). SNP-CGH array showed that scattered-type tumors had no change in the structure of chromosome 17. P53-scattered-type staining tumors may reflect a functionally active nonmutated TP53 gene. In interpretation of p53 immunohistochemistry staining, distinguishing p53-positive tumors by their staining pattern may be important in gastric cancer
Zeng, Huawei; Yan, Lin; Cheng, Wen-Hsing; Uthus, Eric O
2011-08-01
The regulation of site-specific DNA methylation of tumor suppressor genes has been considered as a leading mechanism by which certain nutrients exert their anticancer property. This study was to investigate whether selenium (Se) affects the methylation of globe genomic DNA and the exon-specific p53 gene. Three groups of rats (n = 6-7/group) were fed the AIN-93G basal diet supplemented with 0 [Se deficient (D)], 0.15 [Se adequate (A)], or 4 mg [Se supranutritional (S)] (Se as l-selenomethionine)/kg diet for 104 d, respectively. Rats fed the A or S diet had greater plasma and liver glutathione peroxidase activity, liver thioredoxin reductase activity, and plasma homocysteine concentration than those fed the D diet. However, compared with the A diet, rats fed the S diet did not further increase these Se-dependent enzyme activities or homocysteine concentration. In contrast, Se concentrations in kidney, liver, gastrocnemius muscle, and plasma were increased in a Se-dose-dependent manner. Interestingly, rats fed the S diet had significantly less global liver genomic DNA methylation than those fed the D diet. However, the S diet significantly increased the methylation of the p53 gene (exons 5-8) but not the β-actin gene (exons 2-3) DNA in liver and colon mucosa compared with those fed the D diet. Taken together, long-term Se consumption not only affects selenoprotein enzyme activities, homocysteine, tissue Se concentrations, and global genomic DNA methylation but also increases exon-specific DNA methylation of the p53 gene in a Se-dose-dependent manner in rat liver and colon mucosa.
Directory of Open Access Journals (Sweden)
Jacqueline Miranda de Lima
2006-03-01
Full Text Available RACIONAL: Polimorfismos genéticos são variações genéticas que podem ocorrer em seqüências codificadoras e não-codificadoras, levando a alterações qualitativas e/ou quantitativas das proteínas em questão. O p53 é o gene mais comumente alterado no câncer humano. O polimorfismo desse gene no códon 72 ocorre por substituição de uma base e tem sido associado a maior risco de câncer. OBJETIVO: Determinar a possível associação entre o polimorfismo no códon 72 (72 arginina/prolina do gene p53 e câncer colorretal. CASUÍSTICA E MÉTODOS: Foram avaliados em 100 pacientes com câncer colorretal e em 100 indivíduos sem câncer, pareados quanto ao sexo idade, o hábito de fumar, o etilismo e no grupo caso o estádio, o grau de diferenciação e a evolução da doença. O genótipo (72 arginina/prolina foi determinado por PCR, utilizando-se primers (seqüências de nucleotídeos específicos. RESULTADOS: O genótipo homozigoto arginina/arginina foi prevalente em 56% no grupo controle e em 58% no grupo caso. Não se observou diferença entre os dois grupos. No estádio IV este genótipo foi mais freqüente quando comparado ao estádio I (80% versus 14%. Não se observou diferença entre as variações do genótipo e fumo, álcool, evolução clínica ou grau de diferenciação. CONCLUSÃO: A prevalência do genótipo arginina/arginina foi a mais freqüente nos dois grupos. Não foi encontrada correlação entre maior risco de câncer e o polimorfismo no códon 72 prolina/arginina do gene p53. Apesar do pequeno número de doentes com câncer em estádio avançado (IV, estes tiveram maior prevalência do genótipo arginina/arginina.BACKGROUND: Polymorphisms are genetic variations that can occur in sequences of codons, leading to defective proteins. p53 is the most commonly gene affected in human cancer. The polymorphism of this gene occurs by a substitution of a base in codon 72 and may increase the risk of cancer. AIM: To investigate the
The critical role of catalase in prooxidant and antioxidant function of p53
Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J
2013-01-01
The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438
Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos
2015-01-01
Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947
Matter, Brock; Wang, Gang; Jones, Roger; Tretyakova, Natalia
2004-06-01
G --> T transversion mutations in the p53 tumor suppressor gene are characteristic of smoking-related lung tumors, suggesting that these genetic changes may result from exposure to tobacco carcinogens. It has been previously demonstrated that the diol epoxide metabolites of bay region polycyclic aromatic hydrocarbons present in tobacco smoke, e.g., benzo[a]pyrene diol epoxide (BPDE), preferentially bind to the most frequently mutated guanine nucleotides within p53 codons 157, 158, 248, and 273 [Denissenko, M. F., Pao, A., Tang, M., and Pfeifer, G. P. (1996) Science 274, 430-432]. However, the methodology used in that work (ligation-mediated polymerase chain reaction in combination with the UvrABC endonuclease incision assay) cannot establish the chemical structures and stereochemical identities of BPDE-guanine lesions. In the present study, we employ a stable isotope-labeling HPLC-MS/MS approach [Tretyakova, N., Matter, B., Jones, R., and Shallop, A. (2002) Biochemistry 41, 9535-9544] to analyze the formation of diastereomeric N(2)-BPDE-dG lesions within double-stranded oligodeoxynucleotides representing p53 lung cancer mutational hotspots and their surrounding DNA sequences. (15)N-labeled dG was placed at defined positions within DNA duplexes containing 5-methylcytosine at all physiologically methylated sites, followed by (+/-)-anti-BPDE treatment and enzymatic hydrolysis of the adducted DNA to 2'-deoxynucleosides. Capillary HPLC-ESI(+)-MS/MS was used to establish the amounts of (-)-trans-N(2)-BPDE-dG, (+)-cis-N(2)-BPDE-dG, (-)-cis-N(2)-BPDE-dG, and (+)-trans-N(2)-BPDE-dG originating from the (15)N-labeled bases. We found that all four N(2)-BPDE-dG diastereomers were formed preferentially at the methylated CG dinucleotides, including the frequently mutated p53 codons 157, 158, 245, 248, and 273. The contributions of individual diastereomers to the total adducts number at a given site varied between 70.8 and 92.9% for (+)-trans-N(2)-BPDE-dG, 5.6 and 16.7% for
International Nuclear Information System (INIS)
Tierney, L.A.; Johnson, N.F.; Lechner, J.F.
1994-01-01
Mutations in the p53 tumor suppressor gene are the most frequently occurring gene alterations in malignant human cancers, including lung cancer. In lung cancer, common point mutations within conserved exons of the p53 gene result in a stabilized form of mutant protein which is detectable in most cases by immunohistochemistry. In addition to point mutations, allelic loss, rearrangements, and deletions of the p53 gene have also been detected in both human and rodent tumors. It has been suggested that for at least some epithelial neoplasms, the loss of expression of wild-type p53 protein may be more important for malignant transformation than the acquisition of activating mutations. Mechanisms responsible for the loss of expression of wild-type protein include gene deletion or rearrangement, nonsense or stop mutations, mutations within introns or upstream regulatory regions of the gene, and accelerated rates of degradation of the protein by DNA viral oncoproteins
P53 Gene Mutagenesis in Breast Cancer
National Research Council Canada - National Science Library
Sommer, Steve S
2005-01-01
.... The central hypothesis of this proposal is that variability in the patterns of p53 mutagensis in breast cancer reflects differences in exposures to different amounts and/or types of diverse environmental mutagens...
Energy Technology Data Exchange (ETDEWEB)
Drane, P.; Alvarez, S.; Meiller, A.; May, E. [CEA Fontenay-aux-Roses, Dept. de Radiobiologie et de Radiopathologie, Lab. de Cancerogenese Moleculaire, CNRS, UMR 217, 92 (France)
2002-03-01
The tumor suppressor gene p53 encodes a protein whose major function is to protect organisms from proliferation of potentially tumorigenic cells. In normal conditions (unstressed cells), the p53 protein is inert and maintained at low level through its association with the Mdm2 oncogene, causing its translocation from the nucleus into the cytoplasm and its degradation through ubiquitin/proteasome pathway. In response to damaged DNA or to a variety of stresses, p53 accumulates in the nucleus and is activated as a transcriptional trans-activator. Posttranslational modifications of p53 including multi-site phosphorylation and acetylation are the major mechanism of p53 regulation. After exposure to ionising radiation, p53 activation implicates ATM, ATR, Chk2 and Chk1 kinases that phosphorylate the N-terminal domain on Ser15 (ATM and/or ATR), and Ser20 (Chk2 and/or Chk1), causing the dissociation of the p53/Mdm2 complex and thereby the stabilisation of p53. The process initiated by {gamma}-irradiation exposure involves also increased interaction of the p53 N-terminal domain with CBP/p300 and P/CAF leading to acetylation of the distant C-terminal domain at Lys 320, 373 and 382. In addition, the ATM-mediated dephosphorylation of Ser376 creates a fixation site for 14-3-3 protein. Taken together, phosphorylation, acetylation and association with co factors induce the stimulation of p53 transcriptional activity resulting in the expression of a set of genes involved, notably, in cell cycle arrest and apoptosis. This stress-induced p53 pathways lead to one of two outcomes: growth arrest or apoptosis and consequently protects the organism from the genotoxic effects of ionising radiation. (author)
International Nuclear Information System (INIS)
Rodin, S.N.; Rodin, A.S.; Juhasz, A.; Holmquist, G.P.
2002-01-01
The database of tumor-associated p53 base substitutions includes about 5% of tumors with two or more base substitutions. These multiplet base substitutions in one tumor are evidence for hyper-mutagenesis. Our retrospective analysis of this database indicates that most multiplets arise from a single transient hyper-mutagenic event in one cell that subsequently proliferated into a clonal tumor. The hyper-mutagenesis, 1.8x10 -4 substitutions per base pair, is detected as multiple mutations in p53 genes of tumors. It requires one strongly tumorigenic p53 substitution, usually missense, called the driver mutation. The occurrence frequencies of ancillary base substitutions, those that hitch-hike along with the driver mutation, are independent of their amino acid coding properties. In this respect, they act like neutral mutations. In support of this neutrality, we find that the frequency distribution of hitch-hiking CpG transitions along the p53 exons, their mutational spectrum, approximates the spontaneous pre-selection mutational spectrum of most human tissues and is correlated with the mutational spectrum of p53 pseudogenes in mammalian germ cells. The driver substitutions of multiplets predominantly originate along the transcribed strand while the ancillary substitutions tend to originate along the non-transcribed strand. This data is consistent with a model of time-dependent mutagenesis in non-dividing stem cells for generating multiple strand-asymmetric p53 mutations in tumors. By transcriptional bypass of DNA lesions with concomitant misincorporation, transcriptional mutagenesis generates a transient mutant p53 mRNA. The associated mutant p53 protein could allow the host cell a growth advantage, release from G 1 -arrest. Then, during subsequent DNA replication and misreading of the same lesion, the damaged base along the transcribed DNA strand would serve as the origin of the p53 base substitution that drives the hyper-mutagenic event leading to tumors with
Burmakin, Mikhail; Shi, Yao; Hedström, Elisabeth; Kogner, Per; Selivanova, Galina
2013-09-15
Restoration of the p53 function in tumors is a promising therapeutic strategy due to the high potential of p53 as tumor suppressor and the fact that established tumors depend on p53 inactivation for their survival. Here, we addressed the question whether small molecule RITA can reactivate p53 in neuroblastoma and suppress the growth of neuroblastoma cells in vitro and in vivo. The ability of RITA to inhibit growth and to induce apoptosis was shown in seven neuroblastoma cell lines. Mechanistic studies were carried out to determine the p53 dependence and the molecular mechanism of RITA-induced apoptosis in neuroblastoma, using cell viability assays, RNAi silencing, co-immunoprecipitation, qPCR, and Western blotting analysis. In vivo experiments were conducted to study the effect of RITA on human neuroblastoma xenografts in mice. RITA induced p53-dependent apoptosis in a set of seven neuroblastoma cell lines, carrying wild-type or mutant p53; it activated p53 and triggered the expression of proapoptotic p53 target genes. Importantly, p53 activated by RITA inhibited several key oncogenes that are high-priority targets for pharmacologic anticancer strategies in neuroblastoma, including N-Myc, Aurora kinase, Mcl-1, Bcl-2, Wip-1, MDM2, and MDMX. Moreover, RITA had a strong antitumor effect in vivo. Reactivation of wild-type and mutant p53 resulting in the induction of proapoptotic factors along with ablation of key oncogenes by compounds such as RITA may be a highly effective strategy to treat neuroblastoma. ©2013 AACR.
Sotomatsu, M; Hayashi, Y; Kawamura, M; Yugami, S; Shitara, T
1993-10-01
A new human pre-B acute lymphoblastic leukemia cell line (KMO-90) was established from the bone marrow sample of a 12-year-old girl with acute lymphoblastic leukemia (ALL) carrying 1;19 chromosome translocation. KMO-90 cells expressed HLA-DR, CD10, CD19, and CD22 antigens. These cells had also cytoplasmic immunoglobulin lacking surface immunoglobulin, indicating that these had a pre-B phenotype. Chromosome analysis of this cell line showed 48, XX, +8, +19, t(1;19)(q23;p13). Southern blot analysis showed the same sized rearrangements of the E2A gene in KMO-90 cells as those in the original leukemic cells. By means of reverse transcriptase-polymerase chain reaction analysis, we detected E2A/PBX1 fusion transcripts in KMO-90 cells. KMO-90 is useful when studying the role of the 1;19 translocation in the etiology of pre-B ALL. Furthermore, we studied alterations of the p53 gene in this cell line by polymerase chain reaction, single-strand conformation polymorphism analysis. KMO-90 cells were identified to have a point mutation at codon 177 (CCC-->TCC) of the p53 gene, suggesting that alterations of the p53 gene may have an important role in the establishment of this cell line.
Bcl-2 overexpression prevents 99mTc-MIBI uptake in breast cancer cell lines
International Nuclear Information System (INIS)
Aloj, Luigi; Zannetti, Antonella; Caraco, Corradina; Del Vecchio, Silvana; Salvatore, Marco
2004-01-01
We have previously shown a correlation between the absence of technetium-99m methoxyisobutylisonitrile ( 99m Tc-MIBI) uptake and overexpression of the anti-apoptotic protein Bcl-2 in human breast carcinoma. To establish a direct cause-effect relationship between Bcl-2 overexpression and reduced 99m Tc-MIBI uptake, MCF-7 and T47D breast cancer cell lines were stably transfected with the human Bcl-2 gene to increase intracellular protein levels and tested for 99m Tc-MIBI uptake. All clones overexpressing Bcl-2 showed a dramatic reduction of 99m Tc-MIBI uptake as compared with mock transfected control cells. Tracer uptake was promptly and partially restored by induction of apoptosis with staurosporine treatment. After 4.5 h of staurosporine treatment, a tenfold increase in 99m Tc-MIBI uptake was observed in treated as compared with untreated Bcl-2 overexpressing cells. Our findings provide a rational basis for the development of an in vivo test to detect Bcl-2 overexpression in human tumours. (orig.)
Choi, Tae Gyu; Nguyen, Minh Nam; Kim, Jieun; Jo, Yong Hwa; Jang, Miran; Nguyen, Ngoc Ngo Yen; Yun, Hyeong Rok; Choe, Wonchae; Kang, Insug; Ha, Joohun; Tang, Dean G; Kim, Sung Soo
2018-06-06
Colorectal cancer (CRC) is one of the leading causes of cancer-related deaths worldwide. Chemoresistance is a major problem for effective therapy in CRC. Here, we investigated the mechanism by which peptidylprolyl isomerase B (PPIB; cyclophilin B, CypB) regulates chemoresistance in CRC. We found that CypB is a novel wild type p53 (p53WT)-inducible gene but a negative regulator of p53WT in response to oxaliplatin treatment. Overexpression of CypB shortens the half-life of p53WT and inhibits oxaliplatin-induced apoptosis in CRC cells, whereas knockdown of CypB lengthens the half-life of p53WT and stimulates p53WT dependent apoptosis. CypB interacts directly with MDM2, and enhances MDM2-dependent p53WT ubiquitination and degradation. Furthermore, we firmly validated using bioinformatics analyses that overexpression of CypB is associated with poor prognosis in CRC progression and chemoresistance. Hence, we suggest a novel mechanism of chemoresistance caused by overexpressed CypB, which may help to develop new anti-cancer drugs. We also propose that CypB may be utilized as a predictive biomarker in CRC patients. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Yang, Xiao; Zhu, Fan; Yu, Chaoran; Lu, Jiaoyang; Zhang, Luyang; Lv, Yanfeng; Sun, Jing; Zheng, Minhua
2017-07-18
N-myc downstream-regulated gene1 (NDRG1) has been identified as a potent tumor suppressor gene. The molecular mechanisms of anti-tumor activity of NDRG1 involve its suppressive effects on a variety of tumorigenic signaling pathways. The purpose of this study was to investigate the role of NDRG1 in the apoptosis of colorectal cancer (CRC) cells. We first collected the clinical data of locally advanced rectal cancer (LARC) patients receiving oxaliplatin-based neoadjuvant chemotherapy in our medical center. Correlation analysis revealed that NDRG1 positively associated with the downstaging rates and prognosis of patients. Then, the effects of over-expression and depletion of NDRG1 gene on apoptosis of colorectal cancer were tested in vitro and in vivo. NDRG1 over-expression promoted apoptosis in colorectal cancer cells whereas depletion of NDRG1 resulted in resistance to oxaliplatin treatment. Furthermore, we observed that Bcl-2, a major anti-apoptotic protein, was regulated by NDRG1 at post-transcriptional level. By binding Protein kinase Cα (PKCα), a classical regulating factor of Bcl-2, NDRG1 enhanced the ubiquitination and degradation of Bcl-2, thus promoting apoptosis in CRC cells. In addition, NDRG1 inhibited tumor growth and promoted apoptosis in mouse xenograft model. In conclusion,NDRG1 promotes oxaliplatin-triggered apoptosis in colorectal cancer. Therefore, colorectal cancer patients can be stratified by the expression level of NDRG1. NDRG1-positive patients may benefit from oxaliplatin-containing chemotherapy regimens whereas those with negative NDRG1 expression should avoid the usage of this cytotoxic drug.
Tobacco, alcohol, and p53 overexpression in early colorectal neoplasia
International Nuclear Information System (INIS)
Terry, Mary Beth; Neugut, Alfred I; Mansukhani, Mahesh; Waye, Jerome; Harpaz, Noam; Hibshoosh, Hanina
2003-01-01
The p53 tumor suppressor gene is commonly mutated in colorectal cancer. While the effect of p53 mutations on colorectal cancer prognosis has been heavily studied, less is known about how epidemiologic risk factors relate to p53 status, particularly in early colorectal neoplasia prior to clinically invasive colorectal cancer (including adenomas, carcinoma in situ (CIS), and intramucosal carcinoma). We examined p53 status, as measured by protein overexpression, in 157 cases with early colorectal neoplasia selected from three New York City colonoscopy clinics. After collecting paraffin-embedded tissue blocks, immunohistochemistry was performed using an anti-p53 monoclonal mouse IgG 2 a [BP53-12-1] antibody. We analyzed whether p53 status was different for risk factors for colorectal neoplasia relative to a polyp-free control group (n = 508). p53 overexpression was found in 10.3%, 21.7%, and 34.9%, of adenomatous polyps, CIS, and intramucosal cases, respectively. Over 90% of the tumors with p53 overexpression were located in the distal colon and rectum. Heavy cigarette smoking (30+ years) was associated with cases not overexpressing p53 (OR = 1.8, 95% CI = 1.1–2.9) but not with those cases overexpressing p53 (OR = 1.0, 95% CI = 0.4–2.6). Heavy beer consumption (8+ bottles per week) was associated with cases overexpressing p53 (OR = 4.0, 95% CI = 1.3–12.0) but not with cases without p53 overexpression (OR = 1.6, 95% CI = 0.7–3.7). Our findings that p53 overexpression in early colorectal neoplasia may be positively associated with alcohol intake and inversely associated with cigarette smoking are consistent with those of several studies of p53 expression and invasive cancer, and suggest that there may be relationships of smoking and alcohol with p53 early in the adenoma to carcinoma sequence
Che-1 gene silencing induces osteosarcoma cell apoptosis by inhibiting mutant p53 expression
Energy Technology Data Exchange (ETDEWEB)
Liu, Ming; Wang, Dan, E-mail: danwangwdd@163.com; Li, Ning
2016-04-22
The transcriptional cofactor Che-1 is an RNA polymerase II (Pol II) which is involved in tumorigenesis, such as breast cancer and multiple myeloma. Che-1 can also regulate mutant p53 expression, which plays roles in many types of cancer. In this study, we aimed to investigate the effects and specific mechanism of Che-1 in the regulation of osteosarcoma (OS) cell growth. We found that Che-1 is highly expressed in several kinds of OS cells compared with osteoblast hFOB1.19 cells. MTT and flow cytometry assays showed that Che-1 depletion by siRNA markedly suppressed MG-63 and U2OS cell proliferation and promoted apoptosis. The chromatin immunoprecipitation (ChIP) assay verified the presence of Che-1 on the p53 promoter in MG-63 and U2OS cells carrying mutant p53. Further studies showed that Che-1 depletion inhibited mutant p53 expression. Notably, our study showed that the loss of Che-1 inhibits proliferation and promotes apoptosis in MG-63 cells by decreasing the level of mutant p53. Therefore, these findings open the possibility that silencing of Che-1 will have therapeutic benefit in OS. - Highlights: • Che-1 is highly expressed in several kinds of OS cells. • Che-1 depletion suppressed MG-63 and U2OS cell growth. • Che-1 is existed in the p53 promoter in MG-63 and U2OS cells. • Che-1 depletion inhibited mutant p53 expression. • Che-1 depletion inhibits cell growth by decreasing the level of mutant p53.
The BCL6 RD2 Domain Governs Commitment of Activated B Cells to Form Germinal Centers
Directory of Open Access Journals (Sweden)
Chuanxin Huang
2014-09-01
Full Text Available To understand how the Bcl6 transcriptional repressor functions in the immune system, we disrupted its RD2 repression domain in mice. Bcl6RD2MUT mice exhibit a complete loss of germinal center (GC formation but retain normal extrafollicular responses. Bcl6RD2MUT antigen-engaged B cells migrate to the interfollicular zone and interact with cognate T helper cells. However, these cells fail to complete early GC-commitment differentiation and coalesce as nascent GC aggregates. Bcl6 directly binds and represses trafficking receptors S1pr1 and Gpr183 by recruiting Hdac2 through the RD2 domain. Deregulation of these genes impairs B cell migration and may contribute to GC failure in Bcl6RD2MUT mice. The development of functional GC-TFH cells was partially impaired in Bcl6RD2MUT mice. In contrast to Bcl6−/− mice, Bcl6RD2MUT animals experience no inflammatory disease or macrophage deregulation. These results reveal an essential role for RD2 repression in early GC commitment and striking biochemical specificity in Bcl6 control of humoral and innate immune-cell phenotypes.
G2-block after irradiation of cells with different p53 status
Energy Technology Data Exchange (ETDEWEB)
Zoelzer, Friedo [University of South Bohemia in Ceske Budejovice, Department of Radiology, Toxicology and Civil Protection, Faculty of Health and Social Studies, Ceske Budejovice (Czech Republic); University Duisburg-Essen, Institute of Medical Radiobiology, Medical Faculty, Essen (Germany); Jagetia, Ganesh [University Duisburg-Essen, Institute of Medical Radiobiology, Medical Faculty, Essen (Germany); Mizoram University, Department of Zoology, School of Life Sciences, Aizawl (India); Streffer, Christian [University Duisburg-Essen, Institute of Medical Radiobiology, Medical Faculty, Essen (Germany)
2014-11-15
Although it is clear that functional p53 is not required for radiation-induced G{sub 2} block, certain experimental findings suggest a role for p53 in this context. For instance, as we also confirm here, the maximum accumulation in the G{sub 2} compartment after X-ray exposure occurs much later in p53 mutants than in wild types. It remains to be seen, however, whether this difference is due to a longer block in the G{sub 2} phase itself. We observed the movement of BrdU-labeled cells through G{sub 2} and M into G{sub 1}. From an analysis of the fraction of labeled cells that entered the second posttreatment cell cycle, we were able to determine the absolute duration of the G{sub 2} and M phases in unirradiated and irradiated cells. Our experiments with four cell lines, two melanomas and two squamous carcinomas, showed that the radiation-induced delay of transition through the G{sub 2} and M phases did not correlate with p53 status. We conclude that looking at the accumulation of cells in the G{sub 2} compartment alone is misleading when differences in the G{sub 2} block are investigated and that the G{sub 2} block itself is indeed independent of functional p53. (orig.) [German] Obwohl klar ist, dass ein funktionelles p53-Protein fuer die Ausbildung des strahleninduzierten G{sub 2}-Blocks nicht zwingend erforderlich ist, gibt es experimentelle Befunde, die nahe legen, dass p53 in diesem Zusammenhang doch eine gewisse Rolle spielt. Zum Beispiel bestaetigen wir hier fruehere Berichte, dass die Akkumulation von Zellen im G{sub 2}-Kompartiment bei p53-Mutanten deutlich spaeter nach Bestrahlung ihr Maximum erreicht als bei p53-Wildtypen. Es bleibt jedoch zu klaeren, ob dieser Unterschied seinen Grund in einem laengeren Block der G{sub 2}-Phase selbst hat. Beobachtet wurde die Bewegung von BrdU-markierten Zellen durch G{sub 2} und M nach G{sub 1}. Aus der zeitlichen Veraenderung des Anteils markierter Zellen im G{sub 1}-Kompartiment des naechsten Zellzyklus konnte die
Immunogenicity of Bcl-2 in patients with cancer
DEFF Research Database (Denmark)
Andersen, Mads Hald; Svane, Inge Marie; Kvistborg, Pia
2005-01-01
activities in preclinical models and are currently in several clinical trials. The clinical application of immunotherapy against cancer is rapidly moving forward in multiple areas, including the adoptive transfer of anti-tumor-reactive T cells and the use of "therapeutic" vaccines. The overexpression of Bcl......-2 in cancer and the fact that immune escape by down-regulation or loss of expression of this protein would impair sustained tumor growth makes Bcl-2 a very attractive target for anticancer immunotherapy. Herein, we describe spontaneous T-cell reactivity against Bcl-2 in peripheral blood from......B-cell lymphoma 2 (Bcl-2) is a pivotal regulator of apoptotic cell death and it is overexpressed in many cancers. Consequently, the Bcl-2 protein is an attractive target for drug design, and Bcl-2-specific antisense oligonucleotides or small-molecule Bcl-2 inhibitors have shown broad anticancer...
The T-ALL related gene BCL11B regulates the initial stages of human T-cell differentiation.
Ha, V L; Luong, A; Li, F; Casero, D; Malvar, J; Kim, Y M; Bhatia, R; Crooks, G M; Parekh, C
2017-11-01
The initial stages of T-cell differentiation are characterized by a progressive commitment to the T-cell lineage, a process that involves the loss of alternative (myelo-erythroid, NK, B) lineage potentials. Aberrant differentiation during these stages can result in T-cell acute lymphoblastic leukemia (T-ALL). However, the mechanisms regulating the initial stages of human T-cell differentiation are obscure. Through loss of function studies, we showed BCL11B, a transcription factor recurrently mutated T-ALL, is essential for T-lineage commitment, particularly the repression of NK and myeloid potentials, and the induction of T-lineage genes, during the initial stages of human T-cell differentiation. In gain of function studies, BCL11B inhibited growth of and induced a T-lineage transcriptional program in T-ALL cells. We found previously unknown differentiation stage-specific DNA binding of BCL11B at multiple T-lineage genes; target genes showed BCL11B-dependent expression, suggesting a transcriptional activator role for BCL11B at these genes. Transcriptional analyses revealed differences in the regulatory actions of BCL11B between human and murine thymopoiesis. Our studies show BCL11B is a key regulator of the initial stages of human T-cell differentiation and delineate the BCL11B transcriptional program, enabling the dissection of the underpinnings of normal T-cell differentiation and providing a resource for understanding dysregulations in T-ALL.
Directory of Open Access Journals (Sweden)
Qingyu Qin
Full Text Available Perturbation of lipid metabolism, especially of cholesterol homeostasis, can be catastrophic to mammalian brain, as it has the highest level of cholesterol in the body. This notion is best illustrated by the severe progressive neurodegeneration in Niemann-Pick Type C (NPC disease, one of the lysosomal storage diseases, caused by mutations in the NPC1 or NPC2 gene. In this study, we found that growth cone collapse induced by genetic or pharmacological disruption of cholesterol egress from late endosomes/lysosomes was directly related to a decrease in axonal and growth cone levels of the phosphorylated form of the tumor suppressor factor p53. Cholesterol perturbation-induced growth cone collapse and decrease in phosphorylated p53 were reduced by inhibition of p38 mitogen-activated protein kinase (MAPK and murine double minute (Mdm2 E3 ligase. Growth cone collapse induced by genetic (npc1-/- or pharmacological modification of cholesterol metabolism was Rho kinase (ROCK-dependent and associated with increased RhoA protein synthesis; both processes were significantly reduced by P38 MAPK or Mdm2 inhibition. Finally, in vivo ROCK inhibition significantly increased phosphorylated p53 levels and neurofilaments in axons, and axonal bundle size in npc1-/- mice. These results indicate that NPC-related and cholesterol perturbation-induced axonal pathology is associated with an abnormal signaling pathway consisting in p38 MAPK activation leading to Mdm2-mediated p53 degradation, followed by ROCK activation. These results also suggest new targets for pharmacological treatment of NPC disease and other diseases associated with disruption of cholesterol metabolism.
p53 expression and mutation analysis of odontogenic cysts with and without dysplasia.
Cox, Darren P
2012-01-01
Overexpression of p53 protein is well described in odontogenic cystic lesions (OCLs), including those with epithelial dysplasia; however, most p53 antibodies stain both wild-type and mutated p53 protein and may not reflect genotype. Direct sequencing of the p53 gene has not identified mutations in OCLs with dysplasia. The purpose of this study was to determine the molecular basis of p53 expression in several types of OCLs with and without dysplasia. The study material comprised 13 OCLs: odontogenic keratocyst (n = 5), orthokeratinized odontogenic cyst (n = 5), dentigerous cyst (n = 2), lateral periodontal cyst (n = 1), and unspecified developmental odontogenic cyst (UDOC) (n = 1). Five of these had features of mild or moderate epithelial dysplasia. One intraosseous squamous cell carcinoma (SCC) that was believed to have arisen from an antecedent dysplastic orthokeratinized OC was also included. Immunohistochemistry was performed using the DO7 monoclonal antibody that recognizes wild-type and mutated p53. DNA was extracted from microdissected tissue for all samples and exons 4 to 8 of the p53 gene direct sequenced. In 4 of 5 OCLs with dysplasia there was strong nuclear staining of basal and suprabasal cells. In all cases without dysplasia, nuclear expression in basal cells was either negative or weak and was absent in suprabasal cell nuclei. A mutation in exon 6 of the p53 gene (E224D) was identified in both the dysplastic orthokeratinized OC and the subsequent intraosseous SCC. OCLs with features of dysplasia show increased expression of p53 protein that does not reflect p53 mutational status. One dysplastic OC shared the same p53 mutation with a subsequent intraosseous SCC, indicating that p53 mutation may be associated with malignant transformation in this case. Copyright © 2012 Elsevier Inc. All rights reserved.
Substrate Stiffness Influences Doxorubicin-Induced p53 Activation via ROCK2 Expression
Directory of Open Access Journals (Sweden)
Takahiro Ebata
2017-01-01
Full Text Available The physical properties of the extracellular matrix (ECM, such as stiffness, are involved in the determination of the characteristics of cancer cells, including chemotherapy sensitivity. Resistance to chemotherapy is often linked to dysfunction of tumor suppressor p53; however, it remains elusive whether the ECM microenvironment interferes with p53 activation in cancer cells. Here, we show that, in MCF-7 breast cancer cells, extracellular stiffness influences p53 activation induced by the antitumor drug doxorubicin. Cell growth inhibition by doxorubicin was increased in response to ECM rigidity in a p53-dependent manner. The expression of Rho-associated coiled coil-containing protein kinase (ROCK 2, which induces the activation of myosin II, was significantly higher when cells were cultured on stiffer ECM substrates. Knockdown of ROCK2 expression or pharmacological inhibition of ROCK decreased doxorubicin-induced p53 activation. Our results suggest that a soft ECM causes downregulation of ROCK2 expression, which drives resistance to chemotherapy by repressing p53 activation.
Immunohistochemical analysis of P53 protein in odontogenic cysts
Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.
2010-01-01
The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493
Bcl-2 expression during the development and degeneration of RCS rat retinae.
Sharma, R K
2001-12-14
In various hereditary retinal degenerations, including that in Royal College of Surgeons (RCS) rats, the photoreceptors ultimately die by apoptosis. Bcl-2 is one of the genes, which regulates apoptosis and is thought to promote survival of cells. This study has investigated the developmental expression of Bcl-2 in RCS rat, which is a well-studied animal model for hereditary retinal degeneration. An antibody against Bcl-2 was used for its immunohistochemical localization in dystrophic RCS rat retinae from postnatal (PN) days 4, 7, 13, 35, 45, 70, 202 and 14 months. Results were compared with Bcl-2 localization in congenic non-dystrophic rats from PN 4, 7, 13, 44, 202 and 14 months. Bcl-2 immunoreactivity in non-dystrophic retinae was already present in PN 4 retinae in the nerve fiber layer (presumably in the endfeet of immature Müller cells) and in the proximal parts of certain radially aligned neuroepithelial cells/immature Müller cell radial processes. With increasing age the immunoreactivity in relatively more mature Müller cell radial processes spread distally towards the outer retina and between PN 13 and 44 it reached the adult distribution. No cell bodies in the ganglion cell layer were found to be immunoreactive. Expression of Bcl-2 immunoreactivity in dystrophic RCS rat retinae closely resembled that of non-dystrophic retinae. No immunoreactivity was seen in photoreceptors or retinal pigment epithelium in dystrophic or non-dystrophic retinae. In conclusion, Bcl-2 expression is not altered, either in terms of its chronology or the cell type expressing it, during retinal degeneration in RCS rats.
Energy Technology Data Exchange (ETDEWEB)
Phadnis-Moghe, Ashwini S.; Li, Jinpeng [Genetics Program, Michigan State University, East Lansing, MI 48824 (United States); Institute for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States); Crawford, Robert B. [Institute for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States); Department of Pharmacology and Toxicology, Michigan State University, East Lansing, MI 48824 (United States); Kaminski, Norbert E., E-mail: kamins11@msu.edu [Institute for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States); Department of Pharmacology and Toxicology, Michigan State University, East Lansing, MI 48824 (United States)
2016-11-01
The environmental contaminant 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), which is a strong AHR agonist, causes significant suppression of human B cell activation and differentiation. The current studies describe the identification of Src homology phosphatase 1 (SHP-1) encoded by the gene PTPN6 as a putative regulator of TCDD-mediated suppression of B cell activation. Shp-1 was initially identified through a genome-wide analysis of AHR binding in mouse B cells in the presence of TCDD. The binding of AHR to the PTPN6 promoter was further confirmed using electrophoretic mobility shift assays in which, specific binding of AHR was detected at four putative DRE sites within PTPN6 promoter. Time-course measurements performed in human B cells highlighted a significant increase in SHP-1 mRNA and protein levels in the presence of TCDD. The changes in the protein levels of SHP-1 were also observed in a TCDD concentration-dependent manner. The increase in SHP-1 levels was also seen to occur due to a change in early signaling events in the presence of TCDD. We have shown that BCL-6 regulates B cell activation by repressing activation marker CD80 in the presence of TCDD. TCDD-treatment led to a significant increase in the double positive (SHP-1{sup hi} BCL-6{sup hi}) population. Interestingly, treatment of naïve human B cells with SHP-1 inhibitor decreased BCL-6 protein levels suggesting possible regulation of BCL-6 by SHP-1 for the first time. Collectively, these results suggest that SHP-1 is regulated by AHR in the presence of TCDD and may, in part through BCL-6, regulate TCDD-mediated suppression of human B cell activation. - Highlights: • SHP-1 encoded by the gene PTPN6 is directly activated by the AHR. • AHR binds to dioxin response elements within the SHP-1 promoter in a TCDD-inducible manner. • TCDD-mediated increase in SHP-1 levels is observed in primary human B cells. • Higher SHP-1 levels help in maintaining high BCL-6 levels in the presence of TCDD. • In
Wu, Chueh-Wei; Peng, Mei-Ling; Yeh, Ken-Tu; Tsai, Yi-Yu; Chiang, Chun-Chi; Cheng, Ya-Wen
2016-05-01
Loss of p53 function has been linked to progression of pterygium. MiR-200a is known to be controlled by p53. Here, we hypothesize that expression of miR-200a and downstream ZEB1/ZEB2 genes are regulated epithelial-mesenchymal transition (EMT) involved in the pathogenesis and recurrence of pterygium. For this study, 120 primary pterygial samples were collected. Immunohistochemistry and real-time RT-PCR were performed to determine the expression of p53, p53 down-stream EMT associated protein and miR-200a. The molecular correlation of p53, miR-200a and downstream genes were confirmed using primary pterygium cells (PECs). Expression of miR-200a in pterygium tissues was significantly lower than in conjunctiva controls (p = 0.015). Up-regulated miR-200a levels were positively correlated with and p53 protein expression (p influence miR-200a, resulting in ZEB1/ZEB2 up-regulation and EMT processing of pterygium. Therefore, we suggest that expression of miR-200a play an important role in EMT processing and recurrence of pterygium. Copyright © 2016 Elsevier Ltd. All rights reserved.
Novel small molecule induces p53-dependent apoptosis in human colon cancer cells
International Nuclear Information System (INIS)
Park, Sang Eun; Min, Yong Ki; Ha, Jae Du; Kim, Bum Tae; Lee, Woo Ghil
2007-01-01
Using high-throughput screening with small-molecule libraries, we identified a compound, KCG165 [(2-(3-(2-(pyrrolidin-1-yl)ethoxy)-1,10b-dihydro-[1,2,4]triazolo[1,5-c] quinazolin-5(6H)-one)], which strongly activated p53-mediated transcriptional activity. KCG165-induced phosphorylations of p53 at Ser 6 , Ser 15 , and Ser 20 , which are all key residues involved in the activation and stabilization of p53. Consistent with these findings, KCG165 increased level of p53 protein and led to the accumulation of transcriptionally active p53 in the nucleus with the increased occupancy of p53 in the endogenous promoter region of its downstream target gene, p21 WAF1/CIP . Notably, KCG165-induced p53-dependent apoptosis in cancer cells. Furthermore, we suggested topoisomerase II as the molecular target of KCG165. Together, these results indicate that KCG165 may have potential applications as an antitumor agent
A dual role of p53 in the control of autophagy.
Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido
2008-08-01
Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.
The p53-dependent radioadaptive response
Ohnishi, Takeo
We already reported that conditioning exposures at low doses, or at low dose-rates, lowered radiation-induced p53-dependent apoptosis in cultured cells in vitro and in the spleens of mice in vivo. In this study, the aim was to characterize the p53-dependent radioadaptive response at the molecular level. We used wild-type (wt) p53 and mutated (m) p53 containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulation of p53, Hdm2, and iNOS was analyzed with Western blotting. The quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about 2-4 fold after challenging irradiation following a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of Pifithrin-α (a p53 inhibitor), RITA or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover, radioresistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of the radioadaptive response acting through the activation of Hdm2 and the depression of p53 accumulations.
Fu, San; Yang, Yanfang; Liu, Dan; Luo, Yan; Ye, Xiaochuan; Liu, Yanwen; Chen, Xin; Wang, Song; Wu, Hezhen; Wang, Yuhang; Hu, Qiwei; You, Pengtao
2017-01-01
In vitro evidence indicates that Smilax china L. rhizome (SCR) can inhibit cell proliferation. Therefore, in the present study, we analyzed the effects in vitro of SCR extracts on human lung adenocarcinoma A549 cells. Our results showed that A549 cell growth was inhibited in a dose- and time-dependent manner after treatment with SCR extracts. Total flavonoids and total tannins from SCR induced A549 apoptosis in a dose-dependent manner, as shown by our flow cytometry analysis, which was consistent with the alterations in nuclear morphology we observed. In addition, the total apoptotic rate induced by total tannins was higher than the rate induced by total flavonoids at the same dose. Cleaved-caspase-3 protein levels in A549 cells after treatment with total flavonoids or total tannins were increased in a dose-dependent manner, followed by the activation of caspase-8 and caspase-9, finally triggering to PARP cleavage. Furthermore, total flavonoids and total tannins increased the expression of Bax, decreased the expression of Bcl-2, and promoted cytochrome [Formula: see text] release. Moreover, MDM2 and p-MDM2 proteins were decreased, while p53 and p-p53 proteins were increased, both in a dose-dependent manner, after A549 treatment with total flavonoids and total tannins. Finally, cleaved-caspase-3 protein levels in the total flavonoids or total tannins-treated H1299 (p53 null) and p53-knockdown A549 cells were increased. Our results indicated that total flavonoids and total tannins from SCR exerted a remarkable effect in reducing A549 growth through their action on mitochondrial pathway and disruption of MDM2-p53 balance. Hence, our findings demonstrated a potential application of total flavonoids and total tannins from SCR in the treatment of human lung adenocarcinoma.
Muscella, Antonella; Vetrugno, Carla; Cossa, Luca Giulio; Antonaci, Giovanna; Barca, Amilcare; De Pascali, Sandra Angelica; Fanizzi, Francesco Paolo; Marsigliante, Santo
2017-01-01
Mesothelioma cancer cells have epithelioid or sarcomatoid morphology. The worst prognosis is associated with sarcomatoid phenotype and resistance to therapy is affected by cells heterogeneity. We recently showed that in ZL55 mesothelioma cell line of epithelioid origin [Pt(O,O'-acac)(γ-acac)(DMS)] (Ptac2S) has an antiproliferative effect in vitro and in vivo. Aim of this work was to extend the study on the effects of Ptac2S on ZL34 cell line, representative of sarcomatoid mesothelioma. ZL34 cells were used to assay the antitumor activity of Ptac2S in a mouse xenograft model in vivo. Then, both ZL34 and ZL55 cells were used in order to assess the involvement of p53 protein in (a) the processes underlying the sensitivity to chemotherapy and (b) the activation of various transduction proteins involved in apoptosis/survival processes. Ptac2S increases ZL34 cell death in vivo compared with cisplatin and, in vitro, Ptac2S was more efficacious than cisplatin in inducing apoptosis. In Ptac2S-treated ZL34 and ZL55 cells, p53 regulated gene products of apoptotic BAX and anti-apoptotic Bcl-2 proteins via transcriptional activation. Ptac2S activated PKC-δ and PKC-ε; their inhibition by PKC-siRNA decreased the apoptotic death of cells. PKC-δ was responsible for JNK1/2 activation that has a role in p53 activation. In addition, PKC-ε activation provoked phosphorylation of p38MAPK, concurring to apoptosis. In ZL34 cells, Ptac2S also activated PKC-α thus provoking ERK1/2 activation; inhibition of PKC-α, or ERK1/2, increased Ptac2S cytotoxicity. Results confirm that Ptac2S is a promising therapeutic agent for malignant mesothelioma, giving a substantial starting point for its further validation.
HER-2 positive and p53 negative breast cancers are associated with poor prognosis.
LENUS (Irish Health Repository)
2011-06-01
p53 and HER-2 coexpression in breast cancer has been controversial. These markers were tested using immunohistochemistry and HercepTest. HER-2 expression is related to reduced breast cancer survival (p = .02) . p53 expression relates to HER-2 expression (p = .029). Coexpression between p53 and HER-2 has no relation to prognosis. On univariate and multivariate analysis, combination of HER-2 positive and p53 negative expression was associated with a poor prognosis (p = .018 and p = .027, respectively), while the combination of HER-2 negative and p53 positive expression was associated with a favorable prognosis (p = .022 and p = .010, respectively). Therefore the expression of these markers should be considered collectively.
HER-2 positive and p53 negative breast cancers are associated with poor prognosis.
LENUS (Irish Health Repository)
2012-02-01
p53 and HER-2 coexpression in breast cancer has been controversial. These markers were tested using immunohistochemistry and HercepTest. HER-2 expression is related to reduced breast cancer survival (p = .02) . p53 expression relates to HER-2 expression (p = .029). Coexpression between p53 and HER-2 has no relation to prognosis. On univariate and multivariate analysis, combination of HER-2 positive and p53 negative expression was associated with a poor prognosis (p = .018 and p = .027, respectively), while the combination of HER-2 negative and p53 positive expression was associated with a favorable prognosis (p = .022 and p = .010, respectively). Therefore the expression of these markers should be considered collectively.
The antagonism between MCT-1 and p53 affects the tumorigenic outcomes
Directory of Open Access Journals (Sweden)
Lin Tai-Du
2010-12-01
Full Text Available Abstract Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1 are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development.
Bachmann, Hagen S; Otterbach, Friedrich; Callies, Rainer; Nückel, Holger; Bau, Maja; Schmid, Kurt W; Siffert, Winfried; Kimmig, Rainer
2007-10-01
Expression of the antiapoptotic and antiproliferative protein Bcl-2 has been repeatedly shown to be associated with better clinical outcome in breast cancer. We recently showed a novel regulatory (-938C>A) single-nucleotide polymorphism (SNP) in the inhibitory P2 BCL2 gene promoter generating significantly different BCL2 promoter activities. Paraffin-embedded neoplastic and nonneoplastic tissues from 274 patients (161 still alive after a follow-up period of at least 80 months) with primary unilateral invasive breast carcinoma were investigated. Bcl-2 expression of tumor cells was shown by immunohistochemistry; nonneoplastic tissues were used for genotyping. Both the Bcl-2 expression and the (-938C>A) genotypes were correlated with the patients' survival. Kaplan-Meier curves revealed a significant association of the AA genotype with increased survival (P = 0.030) in lymph node-negative breast cancer patients, whereas no genotype effect could be observed in lymph node-positive cases. Ten-year survival rates were 88.6% for the AA genotype, 78.4% for the AC genotype, and 65.8% for the CC genotype. Multivariable Cox regression identified the BCL2 (-938CC) genotype as an independent prognostic factor for cancer-related death in lymph node-negative breast carcinoma patients (hazard ratio, 3.59; P = 0.032). Immunohistochemical Bcl-2 expression was significantly associated with the clinical outcome of lymph node-positive but not of lymph node-negative breast cancer patients. In lymph node-negative cases, the (-938C>A) SNP was both significantly related with the immunohistochemically determined level of Bcl-2 expression (P = 0.044) and the survival of patients with Bcl-2-expressing carcinomas (P = 0.006). These results suggest the (-938C>A) polymorphism as a survival prognosticator as well as indicator of a high-risk group within patients with lymph node-negative breast cancer.
Zhang, Ye; Rohde, Larry H.; Mehta, Satish K.; Pierson, Duane L.; Wu, Honglu
2009-01-01
Radio-resistant or recurrent prostate cancer represents a serious health risk for approximately 20%-30% of patients treated with primary radiation therapy for clinically localized prostate cancer. In our current studies, we investigated the expressions of apoptosis related gene expression profile (84 genes) in two distinct prostate cell lines Lncap (P53+ and AR+) and PC3 (P53- and AR-) before and after exposure to X-rays or protons, using cDNA PCR arrays. In Lncap cells, 10Gy X-ray radiation significantly induced the expression of 19 out of 84 genes at 4h after irradiation. The changed genes were mostly in death and death receptor domain families, TNF ligand and receptor families, and apoptotic group of the BCL2 family, especially in P53 related genes, such as FAS, BAX, BAK1 and GADD45A. In PC3, X-rays only induced the expression of 3 genes, including an increased expression of BIRC3. There was no difference of the X-ray mediated cell killing in both cell lines using the cell cycle analysis. However, these X-ray-induced gene expression differences between PC3 and Lncap may explain the phenotype of PC3 cells that shows more tolerant not only to radiation, but also to other apoptosis inducing and sensitizing reagents. To compare the effectiveness of cell killing with X-rays, we also exposed PC3 cells to 10Gy protons at the Bragg peak region. Protons did not induce more apoptosis than X-rays for the same dose. In comparison to X-rays, protons significantly altered expressions of 13 genes in PC3, which included decreased expressions of anti-apoptosis genes (BCL2 and BCL2L2), and increased expressions of death and death receptor domain family genes, TNF ligand and receptor family and several kinases (FAS, DAPK1 and RIPK2). These data suggest that proton treatment is more effective in influencing the apoptosis pathways in PC3 cells than X-rays, thus protons may be more effective in the treatment of specific prostate tumor.
p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.
Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R
2007-10-01
Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).
Regulation of p53 tetramerization and nuclear export by ARC.
Foo, Roger S-Y; Nam, Young-Jae; Ostreicher, Marc Jason; Metzl, Mark D; Whelan, Russell S; Peng, Chang-Fu; Ashton, Anthony W; Fu, Weimin; Mani, Kartik; Chin, Suet-Feung; Provenzano, Elena; Ellis, Ian; Figg, Nichola; Pinder, Sarah; Bennett, Martin R; Caldas, Carlos; Kitsis, Richard N
2007-12-26
Inactivation of the transcription factor p53 is central to carcinogenesis. Yet only approximately one-half of cancers have p53 loss-of-function mutations. Here, we demonstrate a mechanism for p53 inactivation by apoptosis repressor with caspase recruitment domain (ARC), a protein induced in multiple cancer cells. The direct binding in the nucleus of ARC to the p53 tetramerization domain inhibits p53 tetramerization. This exposes a nuclear export signal in p53, triggering Crm1-dependent relocation of p53 to the cytoplasm. Knockdown of endogenous ARC in breast cancer cells results in spontaneous tetramerization of endogenous p53, accumulation of p53 in the nucleus, and activation of endogenous p53 target genes. In primary human breast cancers with nuclear ARC, p53 is almost always WT. Conversely, nearly all breast cancers with mutant p53 lack nuclear ARC. We conclude that nuclear ARC is induced in cancer cells and negatively regulates p53.
International Nuclear Information System (INIS)
Zhang, Hongling; Huang, Yong; Du, Qian; Luo, Xiaomao; Zhang, Liang; Zhao, Xiaomin; Tong, Dewen
2015-01-01
Highlights: • PPV reduces PK-15 cells viability by inducing apoptosis. • PPV infection induces apoptosis through mitochondria-mediated pathway. • PPV infection activates p53 to regulate the mitochondria apoptotic signaling. - Abstract: Porcine parvovirus (PPV) infection has been reported to induce the cytopathic effects (CPE) in some special host cells and contribute the occurrence of porcine parvovirus disease, but the molecular mechanisms underlying PPV-induced CPE are not clear. In this study, we investigated the morphological and molecular changes of porcine kidney cell line (PK-15 cells) infected with PPV. The results showed that PPV infection inhibited the viability of PK-15 cells in a time and concentration dependent manner. PPV infection induced typical apoptotic features including chromatin condensation, apoptotic body formation, nuclear fragmentation, and Annexin V-binding activity. Further studies showed that Bax was increased and translocated to mitochondria, whereas Bcl-2 was decreased in PPV-infected cells, which caused mitochondrial outer-membrane permeabilization, resulting in the release of mitochondrial cytochrome c, followed by caspase-9 and caspase-3 activation. However, the expression of Fas and Fas ligand (FasL) did not appear significant changes in the process of PPV-induced apoptosis. Moreover, PPV infection activated p53 signaling, which was involved in the activation of apoptotic signaling induced by PPV infection via regulation of Bax and Bcl-2. Taken together, our results demonstrated that PPV infection induced apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated apoptosis pathway. This study may contribute to shed light on the molecular pathogenesis of PPV infection
Energy Technology Data Exchange (ETDEWEB)
Zhang, Hongling; Huang, Yong; Du, Qian; Luo, Xiaomao; Zhang, Liang; Zhao, Xiaomin; Tong, Dewen, E-mail: dwtong@nwsuaf.edu.cn
2015-01-09
Highlights: • PPV reduces PK-15 cells viability by inducing apoptosis. • PPV infection induces apoptosis through mitochondria-mediated pathway. • PPV infection activates p53 to regulate the mitochondria apoptotic signaling. - Abstract: Porcine parvovirus (PPV) infection has been reported to induce the cytopathic effects (CPE) in some special host cells and contribute the occurrence of porcine parvovirus disease, but the molecular mechanisms underlying PPV-induced CPE are not clear. In this study, we investigated the morphological and molecular changes of porcine kidney cell line (PK-15 cells) infected with PPV. The results showed that PPV infection inhibited the viability of PK-15 cells in a time and concentration dependent manner. PPV infection induced typical apoptotic features including chromatin condensation, apoptotic body formation, nuclear fragmentation, and Annexin V-binding activity. Further studies showed that Bax was increased and translocated to mitochondria, whereas Bcl-2 was decreased in PPV-infected cells, which caused mitochondrial outer-membrane permeabilization, resulting in the release of mitochondrial cytochrome c, followed by caspase-9 and caspase-3 activation. However, the expression of Fas and Fas ligand (FasL) did not appear significant changes in the process of PPV-induced apoptosis. Moreover, PPV infection activated p53 signaling, which was involved in the activation of apoptotic signaling induced by PPV infection via regulation of Bax and Bcl-2. Taken together, our results demonstrated that PPV infection induced apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated apoptosis pathway. This study may contribute to shed light on the molecular pathogenesis of PPV infection.
Nuclear localization signal of ING4 plays a key role in its binding to p53
International Nuclear Information System (INIS)
Zhang Xin; Wang Kesheng; Wang Zhiqin; Xu Lusheng; Wang Qingwan; Chen Fei; Wei Dongzhi; Han Zeguang
2005-01-01
ING4, a novel member of ING family, is recently reported to interact with tumor suppressor p53 and negatively regulate the cell growth with significant G2/M arrest of cell cycle in HepG2 cells through upregulation of p53-inducible gene p21. However, which region of ING4 could have contributed to the binding to p53 remains largely unclear. Herein, the GST-pulldown experiments revealed that the middle region of ING4, a potential bipartite nuclear localization signal (NLS), could be involved in the binding to p53. Furthermore, the interaction of ING4 to p53 was abrogated in vitro and in vivo when certain mutations or the entire deletion of the NLS domain occurred. More interestingly, the mutations of the NLS domain could alter the ING4 nuclear localization, disrupt the interaction of ING4 with p53, and even, deregulate the p53-inducible gene p21 in MCF-7 cells. All data indicated that the NLS domain of ING4 is essential for the binding of ING4 to p53 and the function of ING4 associated with p53
Cui, Ziwei; Shen, Liangyun; Lin, Yue; Wang, Shuqin; Zheng, Dongfeng; Tan, Qian
2014-08-01
Adipose-derived stem cells (ADSCs) have become a promising tool for a wide range of cell-based therapies. However, transplanted ADSCs do not survive well under ischemic conditions. In this study we aimed to inhibit oxygen-glucose deprivation (OGD)-induced apoptosis of human ADSCs by genetic modification with antiapoptotic protein Bcl-2. After isolation and culture, the phenotypes of human ADSCs at passage 3 were analyzed by flow cytometry. Then, genetic modification of ADSCs with Bcl-2 was carried out. Bcl-2 gene transfection was verified by Western blot analysis and multipotent differentiation properties were evaluated in Bcl-2-modified ADSCs (Bcl-2-ADSCs). Apoptosis was evaluated by a TUNEL assay under ischemic conditions induced by OGD. Apoptotic nuclei were also assessed and quantified by Hoechst staining. The cultured ADSCs expressed stem cell-associated markers CD29, CD34, CD44, and CD90, but not fibroblast marker HLA-DR or hematopoietic stem cell marker CD133. The Bcl-2 gene was transferred into ADSCs efficiently, and Bcl-2-ADSCs differentiated into adipocytes, chondrocytes, and osteoblasts. In addition, Bcl-2 overexpression reduced the percentage of apoptotic Bcl-2-ADSCs by 38 % under OGD. Our results indicate that Bcl-2 overexpression through gene transfection inhibits apoptosis of ADSCs under ischemic conditions. This journal requires that authors assign a level of evidence to each submission to which Evidence-Based Medicine rankings are applicable. This excludes Review Articles, Book Reviews, and manuscripts that concern Basic Science, Animal Studies, Cadaver Studies, and Experimental Studies. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 .
Park, Shin-Young; Ma, Weina; Yoon, Sung Nyo; Kang, Min Jeong; Han, Joong-Soo
2015-01-01
We studied the possible role of phospholipase D1 (PLD1) in the neuronal differentiation, including neurite formation of neural stem cells. PLD1 protein and PLD activity increased during neuronal differentiation. Bcl-2 also increased. Downregulation of PLD1 by transfection with PLD1 siRNA or a dominant-negative form of PLD1 (DN-PLD1) inhibited both neurite outgrowth and Bcl-2 expression. PLD activity was dramatically reduced by a PLCγ (phospholipase Cγ) inhibitor (U73122), a Ca(2+)chelator (BAPTA-AM), and a PKCα (protein kinase Cα) inhibitor (RO320432). Furthermore, treatment with arachidonic acid (AA) which is generated by the action of PLA2 (phospholipase A2) on phosphatidic acid (a PLD1 product), increased the phosphorylation of p38 MAPK and CREB, as well as Bcl-2 expression, indicating that PLA2 is involved in the differentiation process resulting from PLD1 activation. PGE2 (prostaglandin E2), a cyclooxygenase product of AA, also increased during neuronal differentiation. Moreover, treatment with PGE2 increased the phosphorylation of p38 MAPK and CREB, as well as Bcl-2 expression, and this effect was inhibited by a PKA inhibitor (Rp-cAMP). As expected, inhibition of p38 MAPK resulted in loss of CREB activity, and when CREB activity was blocked with CREB siRNA, Bcl-2 production also decreased. We also showed that the EP4 receptor was required for the PKA/p38MAPK/CREB/Bcl-2 pathway. Taken together, these observations indicate that PLD1 is activated by PLCγ/PKCα signaling and stimulate Bcl-2 expression through PLA2/Cox2/EP4/PKA/p38MAPK/CREB during neuronal differentiation of rat neural stem cells.
MDM2, p53 and pRb Expression Prior to Definitive Chemoradiotherapy in Esophageal Carcinoma
International Nuclear Information System (INIS)
Yoon, Mee Sun; Nam, Taek Keun; Lee, Jae Hyuk; Cho, Sang Hee; Song, Ju Young; Ahn, Sung Ja; Chung, Ik Joo; Chung, Woong Ki; Nah, Byung Sik
2007-01-01
Purpose: This study evaluated the pretreatment expression patterns of MDM2, p53, and pRb proteins to determine if the expression patterns could predict the outcome of concurrent chemoradiotherapy (CCRT) for esophageal squamous cell carcinoma and aid in the decisions for the selection of treatment modalities. Materials and Methods: Fifty-one patients that were treated with definitive hemoradiotherapy for stage I∼ IVa esohageal squamous cell carcinoma were selected for this study. Radiotherapy was administered with daily 1.8∼2 Gy fractions up to a median dose of 54 Gy for primary tumors, and with four cycles of cisplatin/5-fluorouracil chemotherapy that was administered every 4 weeks, the first two cycles of which were administered concurrently with radiotherapy. Expression of MDM2, p53, and pRb was investigated by immunohistochemical analysis using pretreatment biopsy specimens. Results: MDM2, p53, and pRb were detected with high immunoreactivity in 19.6%, 27.5%, and 66.7% of the patients, respectively. However, there was no significant correlation between expression of these factors and clinical outcome. By the use of multivariate analysis with nine covariates-age, tumor location, tumor length, stage, pathological response, clinical response, MDM2 expression, p53 expression, and pRb expression, only pathological response and stage were significant factors for cause-specific survival. Conclusion: Expression of MDM2, p53, and pRb was not found to be clinically significant for predicting outcomes after CCRT in this study. Further studies with a larger patient population and longer follow-up periods are needed to re-evaluate the expression pattern and to identify new predictors for CCRT response
De novo microdeletion of BCL11A is associated with severe speech sound disorder.
Peter, Beate; Matsushita, Mark; Oda, Kaori; Raskind, Wendy
2014-08-01
In 10 cases of 2p15p16.1 microdeletions reported worldwide to date, shared phenotypes included growth retardation, craniofacial and skeletal dysmorphic traits, internal organ defects, intellectual disability, nonverbal or low verbal status, abnormal muscle tone, and gross motor delays. The size of the deletions ranged from 0.3 to 5.7 Mb, where the smallest deletion involved the BCL11A, PAPOLG, and REL genes. Here we report on an 11-year-old male with a heterozygous de novo 0.2 Mb deletion containing a single gene, BCL11A, and a phenotype characterized by childhood apraxia of speech and dysarthria in the presence of general oral and gross motor dyspraxia and hypotonia as well as expressive language and mild intellectual delays. BCL11A is situated within the dyslexia susceptibility candidate region 3 (DYX3) candidate region on chromosome 2. The present case is the first to involve a single gene within the microdeletion region and a phenotype restricted to a subset of the traits observed in other cases with more extensive deletions. © 2014 Wiley Periodicals, Inc.
Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.
Hirsch, Matthew L; Fagan, B Matthew; Dumitru, Raluca; Bower, Jacquelyn J; Yadav, Swati; Porteus, Matthew H; Pevny, Larysa H; Samulski, R Jude
2011-01-01
Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.
Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.
Directory of Open Access Journals (Sweden)
Matthew L Hirsch
Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.
The expanding regulatory universe of p53 in gastrointestinal cancer.
Fesler, Andrew; Zhang, Ning; Ju, Jingfang
2016-01-01
Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs. Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology. With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.
International Nuclear Information System (INIS)
Deocaris, Custer C.
2004-01-01
Ionizing radiation remains one of the most effective tools for the treatment of breast cancer. It combines properties of a potent DNA-damaging agent and high degree of spatial specificity to the target tissue. Nonetheless, there remain considerable differences in the outcome for treatment of tumors of differing histological type treated by radiotherapy. The identification of predictive indicators of radiosensitivity is crucial for selecting patients suited for preoperative radiotherapy as well as those unwarranted for postoperative treatments. To improve prognostication, numerous genes involved in the breast carcinogenesis have been studied and thus far over the last decade several multi-center researches converge on the role of tumor suppressor p53 in tumor biology. The p53 gene is located on the short arm of chromosome 17 and encodes a 53-kd nuclear protein, p-53, also referred to as 'the guardian of the genome', it orchestrates multiple cellular processes such as cell growth control, DNA repair and programmed cell death. During radiotherapy, genotoxic damage induces p53 overexpression in order to control the rate of proliferating damaged cells, repair damage or induce the apoptotic pathway. Its molecular inactivation in a tumor cell, typically by a point mutation, leads to chemo/radio resistance due to the inability of the molecule to trigger p53-dependent programmed cell death
Phenotype specific analyses reveal distinct regulatory mechanism for chronically activated p53.
Directory of Open Access Journals (Sweden)
Kristina Kirschner
2015-03-01
Full Text Available The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage and chronically activated (in senescent or pro-apoptotic conditions p53. Compared to the classical 'acute' p53 binding profile, 'chronic' p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory 'p53 hubs' where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the 'lipogenic phenotype', a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms.
Polycomb Group Protein PHF1 Regulates p53-dependent Cell Growth Arrest and Apoptosis*
Yang, Yang; Wang, Chenji; Zhang, Pingzhao; Gao, Kun; Wang, Dejie; Yu, Hongxiu; Zhang, Ting; Jiang, Sirui; Hexige, Saiyin; Hong, Zehui; Yasui, Akira; Liu, Jun O.; Huang, Haojie; Yu, Long
2013-01-01
Polycomb group protein PHF1 is well known as a component of a novel EED-EZH2·Polycomb repressive complex 2 complex and plays important roles in H3K27 methylation and Hox gene silencing. PHF1 is also involved in the response to DNA double-strand breaks in human cells, promotes nonhomologous end-joining processes through interaction with Ku70/Ku80. Here, we identified another function of PHF1 as a potential p53 pathway activator in a pathway screen using luminescence reporter assay. Subsequent studies showed PHF1 directly interacts with p53 proteins both in vivo and in vitro and co-localized in nucleus. PHF1 binds to the C-terminal regulatory domain of p53. Overexpression of PHF1 elevated p53 protein level and prolonged its turnover. Knockdown of PHF1 reduced p53 protein level and its target gene expression both in normal state and DNA damage response. Mechanically, PHF1 protects p53 proteins from MDM2-mediated ubiquitination and degradation. Furthermore, we showed that PHF1 regulates cell growth arrest and etoposide-induced apoptosis in a p53-dependent manner. Finally, PHF1 expression was significantly down-regulated in human breast cancer samples. Taken together, we establish PHF1 as a novel positive regulator of the p53 pathway. These data shed light on the potential roles of PHF1 in tumorigenesis and/or tumor progression. PMID:23150668
Wang, Zuoyun; Sun, Yihua; Gao, Bin; Lu, Yi; Fang, Rong; Gao, Yijun; Xiao, Tian; Liu, Xin-Yuan; Pao, William; Zhao, Yun; Chen, Haiquan; Ji, Hongbin
2014-01-01
Germline mutations are responsible for familial cancer syndromes which account for approximately 5-10% of all types of cancers. These mutations mainly occur at tumor suppressor genes or genome stability genes, such as DNA repair genes. Here we have identified a cancer predisposition family, in which eight members were inflicted with a wide spectrum of cancer including one diagnosed with lung cancer at 22years old. Sequencing analysis of tumor samples as well as histologically normal specimens identified two germline mutations co-existing in the familial cancer syndrome, the mutation of tumor suppressor gene P53 V157D and mismatch repair gene PMS2 R20Q. We further demonstrate that P53 V157D and/or PMS2 R20Q mutant promotes lung cancer cell proliferation. These two mutants are capable of promoting colony formation in soft agar as well as tumor formation in transgenic drosophila system. Collectively, these data have uncovered the important role of co-existing germline P53 and PMS2 mutations in the familial cancer syndrome development. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Wang MS
2017-10-01
Full Text Available Ming-Shan Wang,1 Liang Chen,2 Ya-Qiong Xiong,2 Jing Xu,2 Ji-Peng Wang,2 Zi-Li Meng2 1Department of Oncology, Huaiyin Hospital of Huai’an City, Huai’an, China; 2Department of Respiration, Huai’an First People’s Hospital, Nanjing Medical University, Huai’an, China Abstract: Actein (AT is a triterpene glycoside isolated from the rhizomes of Cimicifuga foetida that has been investigated for its antitumor effects. AT treatment leads to apoptosis in various cell types, including breast cancer cells, by regulating different signaling pathways. Iron oxide (Fe3O4 magnetic nanoparticles (MNPs are nanomaterials with biocompatible activity and low toxicity. In the present study, the possible benefits of AT in combination with MNPs on non-small-cell lung cancer (NSCLC were explored in in vitro and in vivo studies. AT-MNP treatment contributed to apoptosis in NSCLC cells, as evidenced by activation of the caspase 3-signaling pathway, which was accompanied by downregulation of the antiapoptotic proteins Bcl2 and BclXL, and upregulation of the proapoptotic signals Bax and Bad. The death receptors of TRAIL were also elevated following AT-MNP treatment in a p53-dependent manner. Furthermore, a mouse xenograft model in vivo revealed that AT-MNP treatment exhibited no toxicity and suppressed NSCLC growth compared to either AT or MNP monotherapies. In conclusion, this study suggests a novel therapy to induce apoptosis in suppressing NSCLC growth in a p53-dependent manner by combining AT with Fe3O4 MNPs. Keywords: actein, Fe3O4 magnetic nanoparticles, NSCLC, apoptosis, p53
Phylogenetic analysis of human Tp53 gene using computational ...
African Journals Online (AJOL)
The TP53 gene encoding p53 protein is involved in regulating a series of pathways. New discoveries about the function and control of p53 are still in progress and it is hoped to develop better therapeutics and diagnostics by exploiting this system. Evolutionary studies are of prime importance in the field of biological ...
Directory of Open Access Journals (Sweden)
Edwards Jeremy
2003-07-01
Full Text Available Abstract Background The identification of known mutations in a cell population is important for clinical applications and basic cancer research. In this work an immobilized form of the polymerase chain reaction, referred to as polony technology, was used to detect mutations as well as gene deletions, resulting in loss of heterozygosity (LOH, in cancer cell lines. Specifically, the mutational hotspots in p53, namely codons 175, 245, 248, 249, 273, and 282, and K-ras2, codons 12, 13 and 61, were genotyped in the pancreatic cell line, Panc-1. In addition LOH analysis was also performed for these same two genes in Panc-1 by quantifying the relative gene copy number of p53 and K-ras2. Results Using polony technology, Panc-1 was determined to possess only one copy of p53, which possessed a mutation in codon 273, and two copies of K-ras2, one wildtype and one with a mutation in codon 12. To further demonstrate the general approach of this method, polonies were also used to detect K-ras2 mutations in the pancreatic cell lines, AsPc-1 and CAPAN-1. Conclusions In conclusion, we have developed an assay that can detect mutations in hotspots of p53 and K-ras2 as well as diagnose LOH in these same genes.
G2-block after irradiation of cells with different p53 status
International Nuclear Information System (INIS)
Zoelzer, Friedo; Jagetia, Ganesh; Streffer, Christian
2014-01-01
Although it is clear that functional p53 is not required for radiation-induced G 2 block, certain experimental findings suggest a role for p53 in this context. For instance, as we also confirm here, the maximum accumulation in the G 2 compartment after X-ray exposure occurs much later in p53 mutants than in wild types. It remains to be seen, however, whether this difference is due to a longer block in the G 2 phase itself. We observed the movement of BrdU-labeled cells through G 2 and M into G 1 . From an analysis of the fraction of labeled cells that entered the second posttreatment cell cycle, we were able to determine the absolute duration of the G 2 and M phases in unirradiated and irradiated cells. Our experiments with four cell lines, two melanomas and two squamous carcinomas, showed that the radiation-induced delay of transition through the G 2 and M phases did not correlate with p53 status. We conclude that looking at the accumulation of cells in the G 2 compartment alone is misleading when differences in the G 2 block are investigated and that the G 2 block itself is indeed independent of functional p53. (orig.) [de
International Nuclear Information System (INIS)
Fujita, Y.; Kamida, A.; Kato, I.; Yura, Y.; Ono, K.; Suzuki, M.; Sakurai, Y.; Ohnishi, T.; Ohnishi, K.
2006-01-01
The role of the p53 gene in the sensitivity of oral squamous cell carcinoma (SCC) to boron neutron capture therapy (BNCT) had not been studied. We examined the effect of boronophenylalanine (BPA)-mediated BNCT on oral SCC cells showing either wild-type p53 (SAS/neo) or mutated-type p53 (SAS/mp53). Survival ratio of cells was determined by colony formation. Cell viability was measured by MTT assay. Apoptotic cells were evaluated by flow cytometric analysis and nuclear DNA staining. When SAS/neo and SAS/mp53 cells were subjected to BNCT, more suppressive effects on colony formation and cell viability were observed in SAS/neo cells as compared with SAS/mp53. The proportion of apoptotic cells with DNA fragmentation was also increased in the cells with functional p53. These results suggest that oral SCC cells with mutated p53 cells are more resistant to BNCT than those with wild-type p53. BNCT must inhibit oral SCC cells in p53-dependent and p53-independent mechanisms. (author)
The Bcl-2 Family in Host-Virus Interactions.
Kvansakul, Marc; Caria, Sofia; Hinds, Mark G
2017-10-06
Members of the B cell lymphoma-2 (Bcl-2) family are pivotal arbiters of mitochondrially mediated apoptosis, a process of fundamental importance during tissue development, homeostasis, and disease. At the structural and mechanistic level, the mammalian members of the Bcl-2 family are increasingly well understood, with their interplay ultimately deciding the fate of a cell. Dysregulation of Bcl-2-mediated apoptosis underlies a plethora of diseases, and numerous viruses have acquired homologs of Bcl-2 to subvert host cell apoptosis and autophagy to prevent premature death of an infected cell. Here we review the structural biology, interactions, and mechanisms of action of virus-encoded Bcl-2 proteins, and how they impact on host-virus interactions to ultimately enable successful establishment and propagation of viral infections.
Influence of X-ray on the P53 gene in human peripheral blood lymphocytes
International Nuclear Information System (INIS)
Jin Wenwei; Cai Ting
2002-01-01
Objective: To evaluate the reliability and safety of varying X-ray dosage. Methods: peripheral lymphocytes of five healthy volunteers were processed by varying X-rays, then detect the P53 gene mutation in 5-9 exons by PCR-SSCP silver staining, investigate the 249 th codon's mutation by PCR-RFLP, through immunohistochemistry staining monitor the abnormal expression of P53 and screen the apoptosis employing the Bio-dUTP terminal labelling technology included by DNA terminal transferase. Results: The frequency of apoptosis represents transparent dose-dependent manner with X-ray. When exposed to X-ray > 50 cGy after 48 h, the apoptosis group has evident difference compared with the control (P 0.05). After treating peripheral lymphocytes with 5-200 cGy X-ray and culturing 96 h, utilizing PCR-SSCP to determine the mutation in 5-9 exons, there was no single strand DNA abnormal migration. PCR-RFLP result indicates no mutation in the hotspot site-249 codon, and there was no obviously abnormal expression of P53 in immunohistochemistry staining. Conclusions: The apoptosis of peripheral lymphocytes is sensitive to the X-ray, and this can be a guideline or model reflecting the body state when exposing to the radiation
cDNA sequencing improves the detection of P53 missense mutations in colorectal cancer
International Nuclear Information System (INIS)
Szybka, Malgorzata; Kordek, Radzislaw; Zakrzewska, Magdalena; Rieske, Piotr; Pasz-Walczak, Grazyna; Kulczycka-Wojdala, Dominika; Zawlik, Izabela; Stawski, Robert; Jesionek-Kupnicka, Dorota; Liberski, Pawel P
2009-01-01
Recently published data showed discrepancies beteween P53 cDNA and DNA sequencing in glioblastomas. We hypothesised that similar discrepancies may be observed in other human cancers. To this end, we analyzed 23 colorectal cancers for P53 mutations and gene expression using both DNA and cDNA sequencing, real-time PCR and immunohistochemistry. We found P53 gene mutations in 16 cases (15 missense and 1 nonsense). Two of the 15 cases with missense mutations showed alterations based only on cDNA, and not DNA sequencing. Moreover, in 6 of the 15 cases with a cDNA mutation those mutations were difficult to detect in the DNA sequencing, so the results of DNA analysis alone could be misinterpreted if the cDNA sequencing results had not also been available. In all those 15 cases, we observed a higher ratio of the mutated to the wild type template by cDNA analysis, but not by the DNA analysis. Interestingly, a similar overexpression of P53 mRNA was present in samples with and without P53 mutations. In terms of colorectal cancer, those discrepancies might be explained under three conditions: 1, overexpression of mutated P53 mRNA in cancer cells as compared with normal cells; 2, a higher content of cells without P53 mutation (normal cells and cells showing K-RAS and/or APC but not P53 mutation) in samples presenting P53 mutation; 3, heterozygous or hemizygous mutations of P53 gene. Additionally, for heterozygous mutations unknown mechanism(s) causing selective overproduction of mutated allele should also be considered. Our data offer new clues for studying discrepancy in P53 cDNA and DNA sequencing analysis
TRIM65 negatively regulates p53 through ubiquitination
Energy Technology Data Exchange (ETDEWEB)
Li, Yang [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Ma, Chengyuan [Department of Neurosurgery, The First Hospital of Jilin University, Changchun 130021 (China); Zhou, Tong [Department of Endocrinology, The First Hospital of Jilin University, Changchun 130021 (China); Liu, Ying [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Sun, Luyao [Department of Infectious Diseases, The First Hospital of Jilin University, Changchun 130021 (China); Yu, Zhenxiang, E-mail: zhenxiangyu2015@gmail.com [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China)
2016-04-22
Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.
Predictive value of bcl-2 immunoreactivity in prostate cancer patients treated with radiotherapy
International Nuclear Information System (INIS)
Bylund, A.; Widmark, A.; Stattin, P.; Bergh, A.
1998-01-01
Background and purpose: Recent experimental evidence suggests that overexpression of bcl-2, a protein functioning by blocking apoptosis, may influence the treatment outcome in human tumours, including prostate cancer. To test the clinical implications of this hypothesis, tumours from patients with prostate cancer treated with external beam radiotherapy were investigated for bcl-2 immunoreactivity (IR) and correlated with prognosis and treatment outcome. Materials and methods: Bcl-2 IR was evaluated in archival tumour specimens obtained through transurethral resection from 42 patients with localized prostate cancer (T0-T4, N0 and M0). Bcl-2 IR expression was related to stage, grade and cancer-specific survival. Specimens were obtained prior to administrating routine radiotherapy for all patients. Results: Bcl-2 IR was present in 19/42 (45%) tumours. The bcl-2-positive patients had a significantly longer cancer-specific survival than the bcl-2-negative patients (10.3 versus 3.4 years, P<0.04). At follow-up (7-19 years), nine patients were still alive, 26 patients had died of prostate cancer and seven patients had died of other causes. Conclusions: This study indicates that pre-treatment bcl-2 overexpression is related to a favourable outcome in prostate cancer treated with radiotherapy. Low bcl-2 along with a high stage may be a predictor of poor prognosis and these patients might benefit from additional treatment. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)
Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes
Directory of Open Access Journals (Sweden)
Iva Simeonova
2013-06-01
Full Text Available Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53Δ31, a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis, hallmarks of syndromes caused by short telomeres. Indeed, p53Δ31/Δ31 mice had short telomeres and other phenotypic traits associated with the telomere disease dyskeratosis congenita and its severe variant the Hoyeraal-Hreidarsson syndrome. Heterozygous p53+/Δ31 mice were only mildly affected, but decreased levels of Mdm4, a negative regulator of p53, led to a dramatic aggravation of their symptoms. Importantly, several genes involved in telomere metabolism were downregulated in p53Δ31/Δ31 cells, including Dyskerin, Rtel1, and Tinf2, which are mutated in dyskeratosis congenita, and Terf1, which is implicated in aplastic anemia. Together, these data reveal that a truncating mutation can activate p53 and that p53 plays a major role in the regulation of telomere metabolism.
Directory of Open Access Journals (Sweden)
Monserrate Jessica P
2012-07-01
Full Text Available Abstract Background B cell lymphoma 2 (Bcl-2 proteins are the central regulators of apoptosis. The two bcl-2 genes in Drosophila modulate the response to stress-induced cell death, but not developmental cell death. Because null mutants are viable, Drosophila provides an optimum model system to investigate alternate functions of Bcl-2 proteins. In this report, we explore the role of one bcl-2 gene in nutrient stress responses. Results We report that starvation of Drosophila larvae lacking the bcl-2 gene, buffy, decreases survival rate by more than twofold relative to wild-type larvae. The buffy null mutant reacted to starvation with the expected responses such as inhibition of target of rapamycin (Tor signaling, autophagy initiation and mobilization of stored lipids. However, the autophagic response to starvation initiated faster in larvae lacking buffy and was inhibited by ectopic buffy. We demonstrate that unusually high basal Tor signaling, indicated by more phosphorylated S6K, was detected in the buffy mutant and that removal of a genomic copy of S6K, but not inactivation of Tor by rapamycin, reverted the precocious autophagy phenotype. Instead, Tor inactivation also required loss of a positive nutrient signal to trigger autophagy and loss of both was sufficient to activate autophagy in the buffy mutant even in the presence of enforced phosphoinositide 3-kinase (PI3K signaling. Prior to starvation, the fed buffy mutant stored less lipid and glycogen, had high lactate levels and maintained a reduced pool of cellular ATP. These observations, together with the inability of buffy mutant larvae to adapt to nutrient restriction, indicate altered energy metabolism in the absence of buffy. Conclusions All animals in their natural habitats are faced with periods of reduced nutrient availability. This study demonstrates that buffy is required for adaptation to both starvation and nutrient restriction. Thus, Buffy is a Bcl-2 protein that plays an
Increased expression of Bcl-2 during mucous cell metaplasia induced by endotoxin and ozone
Energy Technology Data Exchange (ETDEWEB)
Tesfaigzi, J.; Ray, L.M.; Hotchkiss, J.A. [Michigan State Univ., East Lansing, MI (United States)] [and others
1995-12-01
Apoptosis or programmed cell death is accompanied by characteristic morphological changes that distinguish apoptosis from other forms of cell death. These changes include DNA fragmentation, chromatin condensation, cell shrinkage, cell surface pseudopodia, and finally the cellular collapse into membrane-enclosed apoptotic bodies which are rapidly engulfed by macrophages or neighboring cells. Although the morphological features of apoptotic cells are well studied, the biochemical events that control apoptosis are not understood. Programmed cell death is triggered by a variety of pathways that are initiated by different stimuli including noxious agents, DNA damage, the activation of TNF receptors, or the withdrawl of growth factors. The central process of programmed cell death involves a cascade of biochemical events that begins with the initiation of a family of cysteine proteases, including the interleukin-1-{Beta}-converting enzyme, CPP-32, and Apopain. The ratio of Bax, a death-inducer gene, to Bcl-2, an apoptosis suppressor gene, determines whether or not the main apoptotic pathyway is blocked. Apoptosis is suppressed if the ratio of Bcl-2/Bax is > 1, and cells undergo apoptosis if the ratio is < 1. The overexpression of Bcl-2 has been shown to block the apoptotic program triggered by a variety of agents. Therefore, Bcl-2 must be involved in blocking the central pathway of the cell death program. In conclusion, this study showed that high levels of Bcl-2 were detected in some mucous cells at specific time points during mucous cell metaplasia, and this expression was reduced at later time points or was absent after remodeling of this epithelium.
Directory of Open Access Journals (Sweden)
Manuel D Díaz-Muñoz
Full Text Available Post-transcriptional mRNA regulation by RNA binding proteins (RBPs associated with AU-rich elements (AREs present in the 3' untranslated region (3'UTR of specific mRNAs modulates transcript stability and translation in eukaryotic cells. Here we have functionally characterised the importance of the AREs present within the Bcl2 3'UTR in order to maintain Bcl2 expression. Gene targeting deletion of 300 nucleotides of the Bcl2 3'UTR rich in AREs diminishes Bcl2 mRNA stability and protein levels in primary B cells, decreasing cell lifespan. Generation of chimeric mice indicates that Bcl2-ARE∆/∆ B cells have an intrinsic competitive disadvantage compared to wild type cells. Biochemical assays and predictions using a bioinformatics approach show that several RBPs bind to the Bcl2 AREs, including AUF1 and HuR proteins. Altogether, association of RBPs to Bcl2 AREs contributes to Bcl2 protein expression by stabilizing Bcl2 mRNA and promotes B cell maintenance.
P53 function influences the effect of fractionated radiotherapy on glioblastoma tumors
International Nuclear Information System (INIS)
Haas-Kogan, Daphne A.; Kogan, Scott S.; Yount, Garret; Hsu, Jennie; Haas, Martin; Deen, Dennis F.; Israel, Mark A.
1999-01-01
Purpose: Glioblastoma multiforme brain tumors (GM) are treated with a spectrum of fractionation regimens based on the clinical and anatomical characteristics of the tumor but rarely based on the molecular characteristics of the individual neoplasm. This study tests the hypothesis that the response of cell lines derived from GM to fractionated radiotherapy depends on the function of wild-type p53 (wt p53), a tumor suppressor gene frequently mutated in GM tumors. Methods and Materials: Isogenic derivatives of glioblastoma cells differing only in p53 function were prepared using a retroviral vector expressing a dominant negative mutant of p53 (mt p53). Radiation survival in vitro was quantitated using linear quadratic and repair-saturation mathematical models. Apoptosis was assayed by a terminal deoxynucleotide transferase-labeling technique and chromatin morphology. Results: We have previously reported the generation of isogenic GM cell lines differing only in p53 function. U87-175.4, lacking wt p53 function, had a significantly lower α/β value than U87-LUX.8, expressing functional wt p53, leading us to hypothesize that fractionated irradiation would preferentially spare GM cells harboring mt p53 compared with those expressing functional, wt p53. Survival curves following either 2.0 Gy or 3.5 Gy/fraction demonstrated that lack of functional wt p53 was associated with resistance to fractionated irradiation. Radiation-induced apoptosis could not account for the observed differences in clonogenic survival. Rather, our data suggested that a deficit in the G1-checkpoint contributed to increased resistance to fractionated irradiation of cells expressing mutant p53. Conclusions: The effect of fractionated radiotherapy in GM may depend on the function of the tumor suppressor gene p53. A potential clinical consequence of these findings is that hyperfractionation regimens may provide a therapeutic advantage specifically for tumors expressing wt p53 whereas a radiotherapy
Andrographolide induces degradation of mutant p53 via activation of Hsp70.
Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu
2018-05-22
The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.
Expression of Bcl-2 in canine osteosarcoma
Piro, F.; Leonardi, L.
2015-01-01
Osteosarcoma (OS) is the most common primary malignancy of bone. It is responsible for 80-85% of the primary bone tumors affecting dogs and it is characterized by aggressive and invasive behavior, with a high metastatic potential. Several studies on cancer and related tumorigenesis, show an involvement of the mechanisms of programmed cell death and cell survival. Many signals seem to be involved in the related mechanism of autophagy and in particular, our interest is focused on the expression of a family of Bcl-2 that seems to be involved either in the control of biomolecular mechanisms like autophagy and apoptosis. In this study we investigated the expression of Bcl-2 in different cases of spontaneous canine osteosarcoma and the related preliminary results are described. We found Bcl-2 activity was increased in OS tissue compared to normal bone tissue. These results suggested that Bcl-2 activity may play an important role in the formation of OS and as a diagnostic for neoplastic activity. However, further research is needed to confirm the role of Bcl-2 activity in OS in canines. PMID:26623359
Expression of apoptotic genes in immature and in vitro matured equine oocytes and cumulus cells.
Leon, P M M; Campos, V F; Kaefer, C; Begnini, K R; McBride, A J A; Dellagostin, O A; Seixas, F K; Deschamps, J C; Collares, T
2013-08-01
The gene expression of Bax, Bcl-2, survivin and p53, following in vitro maturation of equine oocytes, was compared in morphologically distinct oocytes and cumulus cells. Cumulus-oocyte complexes (COC) were harvested and divided into two groups: G1 - morphologically healthy cells; and G2 - less viable cells or cells with some degree of atresia. Total RNA was isolated from both immature and in vitro matured COC and real-time reverse transcription polymerase chain reaction (qRT-PCR) was used to quantify gene expression. Our results showed there was significantly higher expression of survivin (P < 0.05) and lower expression of p53 (P < 0.01) in oocytes compared with cumulus cells in G1. No significant difference in gene expression was observed following in vitro maturation or in COC derived from G1 and G2. However, expression of the Bax gene was significantly higher in cumulus cells from G1 (P < 0.02).
Human glioblastoma multiforme: p53 reactivation by a novel MDM2 inhibitor.
Directory of Open Access Journals (Sweden)
Barbara Costa
Full Text Available Cancer development and chemo-resistance are often due to impaired functioning of the p53 tumor suppressor through genetic mutation or sequestration by other proteins. In glioblastoma multiforme (GBM, p53 availability is frequently reduced because it binds to the Murine Double Minute-2 (MDM2 oncoprotein, which accumulates at high concentrations in tumor cells. The use of MDM2 inhibitors that interfere with the binding of p53 and MDM2 has become a valid approach to inhibit cell growth in a number of cancers; however little is known about the efficacy of these inhibitors in GBM. We report that a new small-molecule inhibitor of MDM2 with a spirooxoindolepyrrolidine core structure, named ISA27, effectively reactivated p53 function and inhibited human GBM cell growth in vitro by inducing cell cycle arrest and apoptosis. In immunoincompetent BALB/c nude mice bearing a human GBM xenograft, the administration of ISA27 in vivo activated p53, inhibited cell proliferation and induced apoptosis in tumor tissue. Significantly, ISA27 was non-toxic in an in vitro normal human cell model and an in vivo mouse model. ISA27 administration in combination with temozolomide (TMZ produced a synergistic inhibitory effect on GBM cell viability in vitro, suggesting the possibility of lowering the dose of TMZ used in the treatment of GBM. In conclusion, our data show that ISA27 releases the powerful antitumor capacities of p53 in GBM cells. The use of this MDM2 inhibitor could become a novel therapy for the treatment of GBM patients.
Liu, Ling; Huang, Zile; Chen, Jingjing; Wang, Jiangang; Wang, Shuying
2018-04-25
Protein phosphatase 2A (PP2A) is an important enzyme within various signal transduction pathways. The present study was investigated PP2A mediates JS-K-induced apoptosis by affecting Bcl-2 family protein. JS-K showed diverse inhibitory effects in five HCC cell lines, especially HepG2 cells. JS-K caused a dose- and time-dependent reduction in cell viability and increased in levels of LDH release. Meanwhile, JS-K- induced apoptosis was characterized by mitochondrial membrane potential reduction, Hoechst 33342 + /PI + dual staining, release of cytochrome c (Cyt c), and activation of cleaved caspase-9/3. Moreover, JS-K-treatment could lead to the activation of protein phosphatase 2A-C (PP2A-C), decrease of anti-apoptotic Bcl-2 family-protein expression including p-Bcl-2 (Ser70), Bcl-2, Bcl-xL, and Mcl-1 as well as the increase of pro-apoptosis Bcl-2 family-protein including Bim, Bad, Bax, and Bak. Furthermore, JS-K caused a marked increase of intracellular NO levels while pre-treatment with Carboxy-PTIO (a NO scavenger) reduced the cytotoxicity effects and the apoptosis rate. Meanwhile, pre-treatment with Carboxy-PTIO attenuated the JS-K-induced up-regulation of PP2A, Cyt c, and cleaved-caspase-9/3 activation. The silencing PP2A-C by siRNA could abolish the activation of PP2A-C, down-regulation of anti-apoptotic Bcl-2 family-protein (p-Bcl-2, Bcl-2, Bcl-xL, and Mcl-1), increase of pro-apoptosis Bcl-2 family-protein (Bim, Bad, Bax, and Bak) and apoptotic-related protein (Cyt c, cleaved caspase-9/3) that were caused by JS-K in HepG2 cells. In addition, pre-treatment with OA (a PP2A inhibitor) also attenuated the above effects induced by JS-K. In summary, NO release from JS-K induces apoptosis through PP2A activation, which contributed to the regulation of Bcl-2 family proteins. © 2018 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Zhang Yili; Du Hongwen; Zhang Yun; Zhang Yuelang; Kuang Fangjun; Guo Zuomin
2004-01-01
Objective: To discuss the correlation of mammographical imaging signs with the expression of bcl-2 and bax proteins in breast cancer for early diagnosis and forecast of its prognoses. Methods: Fifty-four breast cancers and 26 benign diseases were proved by pathologic methods and all cases underwent mammography. Immunohistochemical technique was used to measure the expression of bcl-2 and bax proteins in these tissues. The correlation of imaging signs with the expression of bcl-2 and bax proteins in breast cancer and benign lesion was analyzed. Results: The expression of bcl-2 or bax protein in the breast cancer was higher than that in breast benign diseases (χ 2 =15.116, 11.361, P 2 =10.358, 12.818, P 2 =10.996, 10.667, P 2 =10.405, P 2 =6.841, P<0.05). Conclusion: Some imaging signs of breast cancer were closely related to the expression of bcl-2 and bax proteins and these signs could reflect the biological behavior of tumor cells and prognoses. Therefore it could be helpful to the early diagnosis and treatment of breast cancer. (authors)
Bcl-2 antisense therapy in B-cell malignancies.
Chanan-Khan, Asher
2005-07-01
Bcl-2 is an apoptosis regulating protein, overexpression of which is associated with chemotherapy resistant disease, aggressive clinical course, and poor survival in patients with B-cell lymphoproliferative disorders. Overexpression of Bcl-2 protein results in an aberrant intrinsic apoptotic pathway that confers a protective effect on malignant cells against a death signal (e.g., chemotherapy or radiotherapy). Downregulation of this oncoprotein, thus, represents a possible new way to target clinically aggressive disease. Preclinical studies have shown that this oncoprotein can be effectively decreased by Bcl-2 antisense in malignant lymphoid cells and can reverse chemotherapy resistance, as well as enhance the anti-apoptotic potential of both chemotherapeutic and biologic agents. Ongoing clinical trials are exploring the role of Bcl-2 downregulation with oblimersen (Bcl-2 antisense) in patients with non-Hodgkin's lymphoma, chronic lymphocytic leukemia and multiple myeloma. Early results from these studies are promising and support the proof of the principle. As these studies are completed and mature data emerges, the role of Bcl-2 antisense therapy in the treatment of B-cell malignancies will become clearer.
Directory of Open Access Journals (Sweden)
O. B. Abdurakhmanov
2015-01-01
Full Text Available Objective. To investigate the prognostic value of the apoptotic markers (p53 and vascular endothelial growth factor (VEGF in evaluating the clinical course of juvenile nasopharyngeal angiofibroma (JNA.Subjects and methods. The investigation enrolled 43 patients with primary JNA (a study group and 20 with its relapses (a control group. The expression of VEGF and mutant p53 (mtp53 gene was immunohistochemically determined using DAKO kits (Denmark. The results of reactions with antibodies to VEGF-A and mtp53 located in the nuclei and membranes were expressed as percentages in terms of stained cell counts per 100 cells examined in different visual fields.Results. An associative analysis showed that both study and control group patients with high mtp53 gene expression in the tumor cells had clinical stages IIIA–B and IV and those in whom the expression of this gene in the tumor cells was weak or absent were found to have clinical stages I and II. The high (3+ and moderate (2+ mtp53 gene expressions suggest that the disease is severe. Consequently, this is of prognostic value and a poor predictor and the absence of mutations or the decreased expression of this gene is associated with a favorable disease outcome.Our investigations indicated that the high expression of the VEGF gene was detected in none of the tumor specimens. In the study group, the tumor cell expression of this gene was found to be moderate (2+ in 18 (41.9 % patients, weak in 6 (13.9 % and absent in 19 (44.2 % of the 43 patients. In the control group, the absence of VEGF gene expression in the tumor specimens was 9 times lower than that in the study group.A comparison with the clinical characteristics of the patients demonstrated that in both the study and control groups, the VEGF expression was observed to be moderate, or weak and absent in those with clinical stages IIIA–B and IV or in those with stage II and I, respectively.Conclusion. The associative analysis showed that both
International Nuclear Information System (INIS)
Roychoudhury, Paromita; Ghosh, Utpal; Bhattacharyya, Nitai P.; Chaudhuri, Keya
2006-01-01
The cellular response to ionizing radiation is mediated by a complex interaction of number of proteins involving different pathways. Previously, we have shown that up regulation of mitochondrial genes ND1, ND4, and COX1 transcribed from the heavy strand promoter (P H ) has been increased in a radio-resistant cell strain designated as M5 in comparison with the parental Chinese hamster V79 cells. These genes are also up regulated in Chinese hamster V79 cells VB13 that express exogenous human Bcl2. In the present study, the expression of the gene ND6 that is expressed from the light strand promoter (P L ) was found to be similar in both the cell lines, as determined by RT-PCR. To test the possibility that this differential expression of mitochondrial genes under these two promoters was mediated by differences in proteins' affinity to interact with these promoters, we have carried out electrophoretic mobility shift assay (EMSA) using mitochondrial cell extracts from these two cell lines. Our result of these experiments revealed that two different proteins formed complex with the synthetic promoters and higher amount of protein from M5 cell extracts interacted with the P H promoter in comparison to that observed with cell extracts from Chinese hamster V79 cells. The promoter-specific differential binding of proteins was also observed in VB13. These results showed that differential mitochondrial gene expression observed earlier in the radio-resistant M5 cells was due to enhanced interaction proteins with the promoters P H and mediated by the expression of Bcl2
Absence of p53 gene mutations in mice colon pre-cancerous stage induced by o-nitrotoluene
Directory of Open Access Journals (Sweden)
Nahed A Hussien
2014-01-01
Conclusion: The results from the present study indicate that point mutations in the p53 gene, in the coding region (exons 5-8 and outside it (exons 10, 11, are not involved in the development of the colon precancerous stage induced by o-nt in mice.
Hormonal control of p53 and chemoprevention
International Nuclear Information System (INIS)
Jerry, D Joseph; Minter, Lisa M; Becker, Klaus A; Blackburn, Anneke C
2002-01-01
Improvements in the detection and treatment of breast cancer have dramatically altered its clinical course and outcome. However, prevention of breast cancer remains an elusive goal. Parity, age of menarche, and age at menopause are major risk factors drawing attention to the important role of the endocrine system in determining the risk of breast cancer, while heritable breast cancer susceptibility syndromes have implicated tumor suppressor genes as important targets. Recent work demonstrating hormonal modulation of the p53 tumor suppressor pathway draws together these established determinants of risk to provide a model of developmental susceptibility to breast cancer. In this model, the mammary epithelium is rendered susceptible due to impaired p53 activity during specific periods of mammary gland development, but specific endocrine stimuli serve to activate p53 function and to mitigate this risk. The results focus attention on p53 as a molecular target for therapies to reduce the risk of breast cancer
Tumor hypoxia, p53, and prognosis in cervical cancers
International Nuclear Information System (INIS)
Haensgen, Gabriele; Krause, Ulf; Becker, Axel; Stadler, Peter; Lautenschlaeger, Christine; Wohlrab, Wolfgang; Rath, Friedrich W.; Molls, Michael; Dunst, Juergen
2001-01-01
Background: The p53 protein is involved in the regulation of initiation of apoptosis. In vitro, p53-deficient cells do not respond to hypoxia with apoptosis as do p53-normal cells, and this may lead to a relative growth advantage of cells without a functioning p53 under hypoxia. On the basis of this hypothesis, a selection of cells with a functionally inactive p53 may occur in hypoxic tumors. The development of uterine cervical carcinomas is closely associated with infections of human papilloma viruses, which may cause a degradation of the tumor suppressor gene p53, resulting in a restriction of apoptosis. Thus, cervical cancers have often a functionally inactive p53. The purpose of our clinical study was therefore to investigate the association between p53, hypoxia, and prognosis in cervical cancers in which the oxygenation status can be determined by clinical methods. Material and Methods: Seventy patients with locally advanced squamous cell cervical cancer Stages IIB (n=14), IIIB (n=49), and IVA (n=7) were investigated in the period from 1996 through 1999. All were treated with definitive radiotherapy with curative intent by a combination of external radiotherapy plus high-dose-rate afterloading. Before therapy, tumor oxygenation was measured with a needle probe polarographically using the Eppendorf histograph. Hypoxic tumors were defined as those with pO 2 measurements below 5 mm Hg (HF5). Pretreatment biopsies were taken and analyzed immunohistologically for p53 protein expression with the DO-7 antibody. The DNA index was measured by flow cytometry. The statistical data analysis was done with SPSS 9.0 for Windows. Results: The 3-year overall survival was 55% for the whole group of patients. Clinical prognostic factors in a multivariate analysis were pretreatment hemoglobin level (3-year survival 62% for patients with a pretreatment hemoglobin ≥11 g/dl vs. 27% for hemoglobin <11 g/dl, p=0.006) and FIGO stage (Stage IIB: 65%; Stage IIIB: 60%; Stage IVA: 29%, p
Requirement of the ATM/p53 tumor suppressor pathway for glucose homeostasis.
Armata, Heather L; Golebiowski, Diane; Jung, Dae Young; Ko, Hwi Jin; Kim, Jason K; Sluss, Hayla K
2010-12-01
Ataxia telangiectasia (A-T) patients can develop multiple clinical pathologies, including neuronal degeneration, an elevated risk of cancer, telangiectasias, and growth retardation. Patients with A-T can also exhibit an increased risk of insulin resistance and type 2 diabetes. The ATM protein kinase, the product of the gene mutated in A-T patients (Atm), has been implicated in metabolic disease, which is characterized by insulin resistance and increased cholesterol and lipid levels, blood pressure, and atherosclerosis. ATM phosphorylates the p53 tumor suppressor on a site (Ser15) that regulates transcription activity. To test whether the ATM pathway that regulates insulin resistance is mediated by p53 phosphorylation, we examined insulin sensitivity in mice with a germ line mutation that replaces the p53 phosphorylation site with alanine. The loss of p53 Ser18 (murine Ser15) led to increased metabolic stress, including severe defects in glucose homeostasis. The mice developed glucose intolerance and insulin resistance. The insulin resistance correlated with the loss of antioxidant gene expression and decreased insulin signaling. N-Acetyl cysteine (NAC) treatment restored insulin signaling in late-passage primary fibroblasts. The addition of an antioxidant in the diet rendered the p53 Ser18-deficient mice glucose tolerant. This analysis demonstrates that p53 phosphorylation on an ATM site is an important mechanism in the physiological regulation of glucose homeostasis.
Expression of apoptosis-related genes in acute β-irradiated skin injury in rats
International Nuclear Information System (INIS)
Zhao Xiaoyu; He Hanliang; Qi Qiang; Lin Wei; Shen Guoliang
2012-01-01
Objective: To investigate the dynamic expression of apoptosis-related genes Bcl-2, Bax and P53 in acute radiation-induced skin ulcers, and to explore the underlying mechanism involved in retarded healing of the ulcer. Methods: Fifty-four female SD rats were divided into 3 groups. The model of acute radiation-induced skin injury, in rats was replicated with 45 Gy electron accelerator β-ray to the skin as radiation group (n=24); the model of deep second degree scald in rats was established as burn group (n=24); 6 normal rats were served as normal control group. From different periods skin wounds, the expression of Bcl-2, Bax and P53 were respectively assessed by means of immunohistochemical technique and. apoptosis was observed by TUNEL assay. Results: (1) The result of the TUNEL manifested that the integral absorbance (IA) of the radiation group was much higher than that of the control group. There is statistical significance between the two groups (P<0.05). (2) 0, 1, 2, 3 weeks after wound emerging, the Bax and P53 integral absorbance (IA) in radiation group was much higher than that of the control group. The Bcl-2 integral absorbance (IA) in bum group was much higher than that of the radiation group. There is statistical significance between the two groups (P<0.05). Conclusions: It was shown that apoptosis of β radiation manifested three typical characteristics, namely early occurrence, high frequency and delayed disappearance after radiation, which might explain the delayed wound healing caused by β radiation. (authors)
Nongenotoxic p53 activation protects cells against S-phase-specific chemotherapy
DEFF Research Database (Denmark)
Kranz, Dominique; Dobbelstein, Matthias
2006-01-01
Mutations in the tumor suppressor gene TP53 represent the most frequent genetic difference between tumor cells and normal cells. Here, we have attempted to turn this difference into an advantage for normal cells during therapy. Using the Mdm2 antagonist nutlin-3, we first activated p53 in U2OS an...... a killer to a protector of cells, with the potential to reduce unwanted side effects of chemotherapy....
Directory of Open Access Journals (Sweden)
Nyiraneza Christine
2012-06-01
Full Text Available Abstract Background It has been suggested that inactivation of p14ARF, a tumor suppressor central to regulating p53 protein stability through interaction with the MDM2 oncoprotein, abrogates p53 activity in human tumors retaining the wild-type TP53 gene. Differences in expression of tumor suppressor genes are frequently associated with cancer. We previously reported on a pattern of restricted p53 immunohistochemical overexpression significantly associated with microsatellite instability (MSI, low TP53 mutation frequency, and MDM2 overexpression in colorectal cancers (CRCs. In this study, we investigated whether p14ARF alterations could be a mechanism for disabling the p53 pathway in this subgroup of CRCs. Results Detailed maps of the alterations in the p14ARF gene were determined in a cohort of 98 CRCs to detect both nucleotide and copy-number changes. Methylation-specific PCR combined with bisulfite sequencing was used to evaluate the prevalence and distribution of p14ARF methylation. p14ARF alterations were then correlated with MSI status, TP53 mutations, and immunohistochemical expression of p53 and MDM2. The frequency of p14ARF mutations was extremely low (1/98; 1%, whereas coexistence of methylated and unmethylated alleles in both tumors and normal colon mucosa was common (91/98; 93%. Only seven of ninety-eight tumors (7% had a distinct pattern of methylation compared with normal colon mucosa. Evaluation of the prevalence and distribution of p14ARF promoter methylation in a region containing 27 CpG sites in 35 patients showed a range of methylated CpG sites in tumors (0 to 25 (95% CI 1 to 13 versus 0 to 17 (95% CI 0 to 2 in adjacent colon mucosa (P = 0.004. Hypermethylation of the p14ARF promoter was significantly correlated with the restricted p53 overexpression pattern (P = 0.03, and MDM2 overexpression (P = 0.02, independently of MSI phenotype. Although no significant correlation between p14ARF methylation and TP53 mutational
Directory of Open Access Journals (Sweden)
Mihai TOMA
2009-11-01
Full Text Available Inactivation of tumor suppressor genes p53 and DCC has been frequently observed in colorectal cancer. The aim of this case-control study was to test possible association between polymorphisms g.32008376A>G (rs714 of DCC gene and g.7175464A>G (rs1625895 of p53 gene and colorectal cancer risk in Romanian patients. We investigate these two polymorphisms by PCR-RFLP in individuals with colorectal cancer (n=120, M:W=74:46 and healthy persons (n=60, M:W=32:28. We observed that GG genotype of both genes confer protection for CRC (ORDCC 0.34, 95%CI 0.18-0.66, ORp53 0.28, 95%CI 0.14-0.55. The presence of DCC AA (OR 2.97, 95%CI 0.97-9.08 and p53 GA (OR 3.86, 95%CI 1.89-7.87 genotypes are associated with an increased risk for CRC. The alleles A of both markers are associated with the risk for disease (OR 2.87, 95%CI 1.49-5.50, respectively 3.54, 95%CI 1.81-6.91. We also observed that coinheritance of DCC GG genotype and p53 GG (OR 0.36 or p53 GA (OR 0.23 confer protection for CRC. These apparent discordant results obtained for the p53 gene may be the result of interaction with other markers or a selection bias. Our findings indicate that the p53 and DCC polymorphisms are associated with a risk of CRC in Romanian patients.
International Nuclear Information System (INIS)
Yi Fuming; Saha, Abhik; Murakami, Masanao; Kumar, Pankaj; Knight, Jason S.; Cai Qiliang; Choudhuri, Tathagata; Robertson, Erle S.
2009-01-01
The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3C with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF Skp2 , cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53 -/- ) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.
Correlation between p53 expression and clinical-pathological characteristics of gastric cancer
Directory of Open Access Journals (Sweden)
Radovanović Dragče
2011-01-01
Full Text Available Backgraund/Aim. Gene p53, or “cell genome keeper”, has a preventive effect on the occurrence of genetic aberrations and prevents abnormal expansion of (tumor cells. In gastric cancer cells in most cases we register high expression of mutated p53 gene, which correlates with prognosis and specific clinicalpathological characteristics of gastric cancer. Methods. Using the imunohistochemical method we determined the level of expression of p53 protein in 62 gastric cancers and 30 precancerous conditions (intestinal metaplasia of the stomach. We analyzed the relationship of the level of p53 expression and clinical pathological characteristics of gastric cancer. Results. Expression of p53 was positive in 42 (67.7% tumor cases and in 7 (14.3% cases of intestinal metaplasia. Expression of P53 and stomach cancer were in direct correlation (p = 0.000. Sensitivity for p53 in stomach cancer cases was 67.7% (42/62, and specifility was 76.7% (23/30. Expression of mutated p53 protein was in direct correlation with the invasion of lymph nodes (p = 0.034 and with invasion of blood vessels by carcinoma cells (p = 0.042. Conclusion. There is a direct correlation between p53 expression and gastric cancer and it indicates the ability of carcinoma cells to invade blood vessels.
Expression of Bcl-2 in canine osteosarcoma
Directory of Open Access Journals (Sweden)
F. Piro
2015-03-01
Full Text Available Osteosarcoma (OS is the most common primary malignancy of bone. It is responsible for 80-85% of the primary bone tumors affecting dogs and it is characterized by aggressive and invasive behavior, with a high metastatic potential. Several studies on cancer and related tumorigenesis, show an involvement of the mechanisms of programmed cell death and cell survival. Many signals seem to be involved in the related mechanism of autophagy and in particular, our interest is focused on the expression of a family of Bcl-2 that seems to be involved either in the control of biomolecular mechanisms like autophagy and apoptosis. In this study we investigated the expression of Bcl-2 in different cases of spontaneous canine osteosarcoma and the related preliminary results are described. We found Bcl-2 activity was increased in OS tissue compared to normal bone tissue. These results suggested that Bcl-2 activity may play an important role in the formation of OS and as a diagnostic for neoplastic activity. However, further research is needed to confirm the role of Bcl-2 activity in OS in canines.
International Nuclear Information System (INIS)
Elsawy, W.H.; Abdel Kader, M.; Abdulla, M.H.
2002-01-01
The aim of this prospective trial was to evaluate the feasibility and outcome of breast conservation therapy for patients with locally advanced breast cancer after neoadjuvant chemotherapy. We studied also the value of p53 and MDR1 as predictors to neoadjuvant chemotherapy. Patients and methods: Bet ween August 1997 and May 2000, 58 patients with locally advanced breast carcinoma (stages IlIA and lllB) completed treatment consisting of 5 fluorouracil 600 mg/m 2 , epirubicin 60 mg/m 2 and cyclophosphamide 600 mg/m 2 (FEC) administered intravenously, at intervals of 3 weeks. The number of cycles of chemotherapy given depended on the clinical tumor response. Surgery (local excision if sufficiently down staged, or mastectomy if not, both with axillary dissection) was performed. Surgery was followed by radiation therapy and 4 more cycles of FEC chemotherapy as an adjuvant therapy. P53 and MDR1 were assessed in the initial tissue biopsy by means of reverse transcriptase-mediated polymerase chain reaction (RT-PCR). p53 and MDR1 findings were correlated with treatment response and linkage between p53 function and cellular response was assessed by terminal deoxynucleotidyl transferase-mediated nick end labeling assay. Results: The overall response (CR+PR) was 87.9%, with a clinical complete response rate of 29.3%. Six patients had a pathological complete response and 10 patients had only minimal residual disease. Median followup from the start of chemotherapy was 24 months (range 6 to 40). Twenty two patients (43%) underwent BCS with actuarial 3-year disease-free and overall survival of 58% and 75% respectively. Cosmetic results were good to excellent in 77.2% of the patients. Modified radical mastectomy was done in 29/51 (56.9%) patients with actuarial 3 year disease-free and overall survival of 60% and 78% respectively.In 13 out of 58 patients (22.4%), p53 mutations could be identified, including eight point mutations, three minor deletions and two complex deletions
De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic
2017-05-01
Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great
Zhao, Xinkai; Ning, Qiaoming; Sun, Xiaoning; Tian, De'an
2011-06-01
To investigate the relationship among Pokemon, NF-κ B p65 and Bcl-2 in hepatoma cells. HCC cell HepG2, SMMC7721 and human fetal liver cell line LO2 cells were used, and expression of Pokemon, NF-κ B p65 and Bcl-2 in three cells were detected by real-time PCR and western blot. Then siRNA of Pokemon was applied to inhibit the expression of Pokemon and NF-κ B p65 and apoptotic rate was determined by flow cytometric analysis. Expressions of Pokemon, NF-κ B p65 and Bcl-2 in human hepatoma cell HepG2, SMMC7721 expression were significantly higher than those in human embryonic stem cells LO2. siRNA of Pokemon inhibited the expression of Pokemon, NF-κ B p65 and Bcl-2 in liver cancer cells, and significantly increased apoptosis of liver cells. While siRNA of NF-κ B p65 inhibited the expression of NF-κ B p65 and Bcl-2, but Pokemon expression in hepatoma cells had no significant change. The proto-oncogene Pokemon can inhibit P14ARF by specific transcription regulation of cell cycle and can induce tumors. In addition, Pokemon can regulate NF-κ B p65 through the expression of apoptosis repressor, and promote the development of liver cancer. It suggests signal network in the liver include the regulation of new non-classical NF-κ B regulatory pathway. Copyright © 2011 Hainan Medical College. Published by Elsevier B.V. All rights reserved.
p53 Aggregates penetrate cells and induce the co-aggregation of intracellular p53.
Directory of Open Access Journals (Sweden)
Karolyn J Forget
Full Text Available Prion diseases are unique pathologies in which the infectious particles are prions, a protein aggregate. The prion protein has many particular features, such as spontaneous aggregation, conformation transmission to other native PrP proteins and transmission from an individual to another. Protein aggregation is now frequently associated to many human diseases, for example Alzheimer's disease, Parkinson's disease or type 2 diabetes. A few proteins associated to these conformational diseases are part of a new category of proteins, called prionoids: proteins that share some, but not all, of the characteristics associated with prions. The p53 protein, a transcription factor that plays a major role in cancer, has recently been suggested to be a possible prionoid. The protein has been shown to accumulate in multiple cancer cell types, and its aggregation has also been reproduced in vitro by many independent groups. These observations suggest a role for p53 aggregates in cancer development. This study aims to test the «prion-like» features of p53. Our results show in vitro aggregation of the full length and N-terminally truncated protein (p53C, and penetration of these aggregates into cells. According to our findings, the aggregates enter cells using macropinocytosis, a non-specific pathway of entry. Lastly, we also show that once internalized by the cell, p53C aggregates can co-aggregate with endogenous p53 protein. Together, these findings suggest prion-like characteristics for p53 protein, based on the fact that p53 can spontaneously aggregate, these aggregates can penetrate cells and co-aggregate with cellular p53.
Zeng, Kaixuan; Chen, Xiaoxiang; Hu, Xiuxiu; Liu, Xiangxiang; Xu, Tao; Sun, Huiling; Pan, Yuqin; He, Bangshun; Wang, Shukui
2018-06-13
Colorectal cancer (CRC) is one of the most common aggressive malignancies. Like other solid tumors, inactivation of tumor suppressor genes and activation of oncogenes occur during CRC development and progression. Recently, a novel tumor suppressor, LACTB, was proposed to inhibit tumor progression, but the functional and clinical significance of this tumor suppressor in CRC remains unexplored. Herein, we found LACTB was significantly downregulated in CRC due to promoter methylation and histone deacetylation, which was associated with metastasis and advanced clinical stage. CRC patients with low LACTB expression had poorer overall survival and LACTB also determined to be an independent prognostic factor for poorer outcome. Ectopic expression of LACTB suppressed CRC cells proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) in vitro and inhibited CRC growth and metastasis in vivo, while knockout of LACTB by CRISPR/Cas9 gene editing technique resulted in an opposite phenotype. Interestingly, LACTB could exert antitumorigenic effect only in HCT116 and HCT8 cells harboring wild-type TP53, but not in HT29 and SW480 cells harboring mutant TP53 or HCT116 p53 -/- cells. Mechanistic studies demonstrated that LACTB could directly bind to the C terminus of p53 to inhibit p53 degradation by preventing MDM2 from interacting with p53. Moreover, ablation of p53 attenuated the antitumorigenic effects of LACTB overexpression in CRC. Collectively, our findings successfully demonstrate for the first time that LACTB is a novel epigenetic silenced tumor suppressor through modulating the stability of p53, supporting the pursuit of LACTB as a potential therapeutic target for CRC.
Colin, Didier J; Hain, Karolina O; Allan, Lindsey A; Clarke, Paul R
2015-03-01
Anti-cancer drugs that disrupt mitosis inhibit cell proliferation and induce apoptosis, although the mechanisms of these responses are poorly understood. Here, we characterize a mitotic stress response that determines cell fate in response to microtubule poisons. We show that mitotic arrest induced by these drugs produces a temporally controlled DNA damage response (DDR) characterized by the caspase-dependent formation of γH2AX foci in non-apoptotic cells. Following exit from a delayed mitosis, this initial response results in activation of DDR protein kinases, phosphorylation of the tumour suppressor p53 and a delay in subsequent cell cycle progression. We show that this response is controlled by Mcl-1, a regulator of caspase activation that becomes degraded during mitotic arrest. Chemical inhibition of Mcl-1 and the related proteins Bcl-2 and Bcl-xL by a BH3 mimetic enhances the mitotic DDR, promotes p53 activation and inhibits subsequent cell cycle progression. We also show that inhibitors of DDR protein kinases as well as BH3 mimetics promote apoptosis synergistically with taxol (paclitaxel) in a variety of cancer cell lines. Our work demonstrates the role of mitotic DNA damage responses in determining cell fate in response to microtubule poisons and BH3 mimetics, providing a rationale for anti-cancer combination chemotherapies.
Directory of Open Access Journals (Sweden)
Taufiqurrachman Nasihun
2015-04-01
Full Text Available Background: Treatment with buceng combination of Eurycoma longifolia Jack and Pimpinella alpine Molk has been proven to increase testosterone level, decrease apoptosis and caspase3 expression. Bcl2 is an antiapoptotic protein found in cytoplasm which inhibits cells apoptosis. This study was aimed to investigate the effect of buceng on Bcl2 expression on penile and prostate tissues of the rats. Methods: In this experimental study, 24 male Sprague Dawley rats of 90 days old, weighing ± 300 grams, were randomly assigned into four groups. Group A, normal rats. Group B, castrated rats and treated with buceng 100 mg/day, per oral (Cast-Bcg; Group C, castrated rats and treated with 2 ml of water as placebo against buceng (Cast-Plac. Group D, castrated rats, treated with mesterolone 6.75 mg/day, per oral, as exogenous testosterone (Cast-Mest. All rats were treated for 30 days. Manova test was used to analyze the different expression of Bcl2 among groups with significance level at p ≤ 0.05. Results: Castration was associated with significant decrease of Bcl2 expression in the penile and prostate tissues (53.0 and 50.9%, respectively compared to normal rats (82.6 and 84.2%, respectively, p < 0.001. Treatment with mesterolone reversed Bcl2 expression (77.1 and 78.1% to a near normal level. The same level of Bcl2 expression was also observed with buceng treatment (73.8 and 78.2%.Conclusion: The treatment with buceng could enhance Bcl2 expression in penile and prostate tissues, comparable to normal rats and mesterolone treated rats.
Bcl-2 prevents loss of mitochondria in CCCP-induced apoptosis
International Nuclear Information System (INIS)
Graaf, Aniek O. de; Heuvel, Lambert P. van den; Dijkman, Henry B.P.M.; Abreu, Ronney A. de; Birkenkamp, Kim U.; Witte, Theo de; Reijden, Bert A. van der; Smeitink, Jan A.M.; Jansen, Joop H.
2004-01-01
Bcl-2 family proteins regulate apoptosis at the level of mitochondria. To examine the mechanism of Bcl-2 function, we investigated the effects of the protonophore carbonyl cyanide m-chlorophenyl hydrazone (CCCP) on two hematopoietic cell lines and Bcl-2 overexpressing transfectants. CCCP directly interferes with mitochondrial function and induces apoptosis. We show that Bcl-2 inhibits apoptosis and that the antiapoptotic effect of Bcl-2 takes place upstream of caspase activation and nuclear changes associated with apoptosis, since these were markedly inhibited in cells overexpressing Bcl-2. Bcl-2 does not prevent the decrease in mitochondrial membrane potential nor the alterations in cellular ATP content induced by CCCP in FL5.12 and Jurkat cells. A higher number of mitochondria was observed in untreated Bcl-2 transfected cells compared to parental cells, as shown by electron microscopy. Exposure to CCCP induced a dramatic decrease in the number of mitochondria and severely disrupted mitochondrial ultrastructure, with apparent swelling and loss of cristae in parental cells. Bcl-2 clearly diminished the disruption of mitochondrial structure and preserved a higher number of mitochondria. These data suggest that CCCP induces apoptosis by structural disruption of mitochondria and that Bcl-2 prevents apoptosis and mitochondrial degeneration by preserving mitochondrial integrity
Bcl-2 prevents loss of mitochondria in CCCP-induced apoptosis.
de Graaf, Aniek O; van den Heuvel, Lambert P; Dijkman, Henry B P M; de Abreu, Ronney A; Birkenkamp, Kim U; de Witte, Theo; van der Reijden, Bert A; Smeitink, Jan A M; Jansen, Joop H
2004-10-01
Bcl-2 family proteins regulate apoptosis at the level of mitochondria. To examine the mechanism of Bcl-2 function, we investigated the effects of the protonophore carbonyl cyanide m-chlorophenyl hydrazone (CCCP) on two hematopoietic cell lines and Bcl-2 overexpressing transfectants. CCCP directly interferes with mitochondrial function and induces apoptosis. We show that Bcl-2 inhibits apoptosis and that the antiapoptotic effect of Bcl-2 takes place upstream of caspase activation and nuclear changes associated with apoptosis, since these were markedly inhibited in cells overexpressing Bcl-2. Bcl-2 does not prevent the decrease in mitochondrial membrane potential nor the alterations in cellular ATP content induced by CCCP in FL5.12 and Jurkat cells. A higher number of mitochondria was observed in untreated Bcl-2 transfected cells compared to parental cells, as shown by electron microscopy. Exposure to CCCP induced a dramatic decrease in the number of mitochondria and severely disrupted mitochondrial ultrastructure, with apparent swelling and loss of cristae in parental cells. Bcl-2 clearly diminished the disruption of mitochondrial structure and preserved a higher number of mitochondria. These data suggest that CCCP induces apoptosis by structural disruption of mitochondria and that Bcl-2 prevents apoptosis and mitochondrial degeneration by preserving mitochondrial integrity.
Alterations of the TP53 Gene in Gastric and Esophageal Carcinogenesis
Directory of Open Access Journals (Sweden)
Marilanda Ferreira Bellini
2012-01-01
Full Text Available TP53 genes is one of more important tumor suppressor gene, which acts as a potent transcription factor with fundamental role in the maintenance of genetic stability. The development of esophageal and gastric cancers is a multistep process resulting in successive accumulation of genetic alterations that culminates in the malignant transformation. Thus, this study highlights the participation of the main genetic alterations of the TP53 gene in esophageal and gastric carcinogenesis. Among these changes, high frequency of TP53 mutations, loss of heterozygosity (LOH, overexpression of the p53 protein, and consequently loss of p53 function, which would be early events in esophageal and gastric cancers, as well as an important biomarker of the prognosis and treatment response. Furthermore, Single Nucleotide Polymorphisms (SNPs of TP53 have been implicated in the development and prognosis of several cancers, mainly TP53 codon 72 polymorphism whose role has been extensively studied in relation to susceptibility for esophageal and gastric cancer development.
DEFF Research Database (Denmark)
Karlsson, Richard; Engström, Maria; Jönsson, Maria
2003-01-01
Cytokines such as interleukin 3 (IL-3), kit ligand (KL), and flt3 ligand (FL) promote survival of hematopoietic stem cells and myeloid progenitor cells. In many cell types, members of the Bcl-2 gene family are major regulators of survival, but the mediating mechanisms are not fully understood....... Using two myeloid progenitor cell lines, FDCP-mix and FDC-P1, as well as primary mouse bone marrow progenitors, we demonstrate that KL-mediated survival is dependent on the activation of phosphatidylinositol-3 (PI-3) kinase. The inhibitor LY294002 was able to completely abolish survival mediated by KL...
Analysis of the K-ras and p53 pathways in x-ray-induced lung tumors in the rat
Energy Technology Data Exchange (ETDEWEB)
Belinsky, S.A.; Middleton, S.K.; Hahn, F.F.; Nikula, K.J. [Inhalation Toxicology Research Inst., Albuquerque, NM (United States); Picksley, S.M. [Medical Sciences Inst., Dundee (United Kingdom)
1996-04-01
The risk from exposure to low-dose radiation in conjunction with cigarette smoking has not been estimated due in part to lmited knowledge surrounding the molecular mechanisms underlying radiation-induced cancers. The purpose of this investigation was to determine the frequency for alterations in genes within the K-ras and p53 signal and cell cycle regulatory pathways, respectively, in X-ray-induced lung tumors in the F344/N rat. These tumors were examined for genetic alterations in the K-ras, c-raf-1, p53, mdm2 and cip1 genes. No K-ras mutations were detected by sequencing in 18 squamous cell carcinomas (SCCs) or 17 adenocarcinomas. However, using a K-ras codon 12 mutation selection assay, a codon 12 GGT {r_arrow} GAT mutation was detected in one SCC, suggesting that activation of the K-ras proto-oncogene is both a rare and late event. Single-strand conformation polymorphism (SSCP) analysis of the kinase-binding domain of the c-raf-1 gene did not detect any polymorphisms. Three of 18 SCCs but none of the adenocarcinomas showed p53 nuclear immunoreactivity. Single-strand conformation polymorphism analysis of exons 4-9 of the p53 gene detected only an exon 9 mutation in one SCC. Mutations were not detected in the three SCCs with immunoreactive p53 protein. No amplification of the mdm2 gene was detected; however, nuclear mdm2 immunoreactivity was present in one of the three SCCs that stained positive for the p53 protein. The complete cDNA of the rat cip1 gene comprising 810 bases was cloned and sequenced. The frequency of somatic mutations in exon 2 of the cip1 gene was determined by SSCP analysis. No alterations in electrophoretic mobility were detected. The results of this investigation indicate that alterations in the K-ras and p53 pathways do not play a major role in the genesis of X-ray-induced lung tumors in the rat. 49 refs., 5 figs.
International Nuclear Information System (INIS)
Rückert, Felix; Samm, Nicole; Lehner, Anne-Kathrin; Saeger, Hans-Detlev; Grützmann, Robert; Pilarsky, Christian
2010-01-01
Pancreatic ductal adenocarcinoma shows a distinct apoptosis resistance, which contributes significantly to the aggressive nature of this tumor and constrains the effectiveness of new therapeutic strategies. Apoptosis resistance is determined by the net balance of the cells pro-and anti-apoptotic 'control mechanisms'. Numerous dysregulated anti-apoptotic genes have been identified in pancreatic cancer and seem to contribute to the high anti-apoptotic buffering capacity. We aimed to compare the benefit of simultaneous gene silencing (SGS) of several candidate genes with conventional gene silencing of single genes. From literature search we identified the anti-apoptotic genes XIAP, Survivin and Bcl-2 as commonly upregulated in pancreatic cancer. We performed SGS and silencing of single candidate genes using siRNA molecules in two pancreatic cancer cell lines. Effectiveness of SGS was assessed by qRT-PCR and western blotting. Apoptosis induction was measured by flow cytometry and caspase activation. Simultaneous gene silencing reduced expression of the three target genes effectively. Compared to silencing of a single target or control, SGS of these genes resulted in a significant higher induction of apoptosis in pancreatic cancer cells. In the present study we performed a subliminal silencing of different anti-apoptotic target genes simultaneously. Compared to silencing of single target genes, SGS had a significant higher impact on apoptosis induction in pancreatic cancer cells. Thereby, we give further evidence for the concept of an anti-apoptotic buffering capacity of pancreatic cancer cells
DEFF Research Database (Denmark)
Williams, Kristine; Christensen, Jesper; Rappsilber, Juri
2014-01-01
linked to the regulation of different biological processes such as differentiation of embryonic stem cells, inflammatory responses in macrophages, and induction of cellular senescence via regulation of the INK4A-ARF locus. Here we show here that JMJD3 interacts with the tumour suppressor protein p53. We...... find that the interaction is dependent on the p53 tetramerization domain. Following DNA damage, JMJD3 is transcriptionally upregulated and by performing genome-wide mapping of JMJD3, we demonstrate that it binds genes involved in basic cellular processes, as well as genes regulating cell cycle......, response to stress and apoptosis. Moreover, we find that JMJD3 binding sites show significant overlap with p53 bound promoters and enhancer elements. The binding of JMJD3 to p53 target sites is increased in response to DNA damage, and we demonstrate that the recruitment of JMJD3 to these sites is dependent...
Energy Technology Data Exchange (ETDEWEB)
Huang, Chao-Yuan [Graduate Institute of Clinical Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Department of Urology, National Taiwan University Hospital, College of Medicine National Taiwan University, Taipei, Taiwan (China); Su, Chien-Tien [Department of Family Medicine, Taipei Medical University Hospital, Taipei, Taiwan (China); Chu, Jan-Show [Graduate Institute of Clinical Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Department of Pathology, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Huang, Shu-Pin [Department of Urology, Kaohsiung Medical University Hospital, College of Medicine Kaohsiung Medical University, Kaohsiung, Taiwan (China); Pu, Yeong-Shiau [Department of Urology, National Taiwan University Hospital, College of Medicine National Taiwan University, Taipei, Taiwan (China); Yang, Hsiu-Yuan [School of Public Health, College of Public Health and Nutrition, Taipei Medical University, Taipei, Taiwan (China); Chung, Chi-Jung [Department of Medical Research, China Medical University Hospital, Taichung, Taiwan (China); Department of Health Risk Management, College of Public Health, China Medical University, Taichung, Taiwan (China); Wu, Chia-Chang [School of Public Health, College of Public Health and Nutrition, Taipei Medical University, Taipei, Taiwan (China); Department of Urology, Taipei Medical Universtiy-Shuang Ho Hospital, Taipei, Taiwan (China); Hsueh, Yu-Mei, E-mail: ymhsueh@tmu.edu.tw [School of Public Health, College of Public Health and Nutrition, Taipei Medical University, Taipei, Taiwan (China); Department of Public Health, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China)
2011-12-15
Our recent study demonstrated the increased risk of renal cell carcinoma (RCC) associated with high urinary total arsenic levels among people living in a low arsenic exposure area. Genomic instability is important in arsenic carcinogenesis. This study evaluated the relationship between the polymorphisms of p53, p21, and MDM2, which plays a role in gene stability, and the arsenic-related RCC risk. Here, we found that p53 Pro/Pro genotype and MDM2 SNP309 GG genotype significantly increased RCC risk compared to the p53 Arg/Arg genotype and MDM2 SNP309 TT genotype. RCC patients with the p53Arg/Arg genotype had a signicantly low percentage of inorganic arsenic, a low percentage of monomethylarsonic acid (MMA), and a high percentage of dimethylarsinic acid (DMA), which indicates efcient arsenic methylation capacity. Subjects with the p53 Arg/Pro + Pro/Pro genotype or MDM2 SNP309 TG + GG genotype, in conjunction with high urinary total arsenic ({>=} 14.02 {mu}g/L), had a signicantly higher RCC risk than those with the p53 Arg/Arg or MDM2 SNP309 TT genotypes and low urinary total arsenic. Taken together, this is the first study to show that a variant genotype of p53 Arg{sup 72}Pro or MDM2 SNP309 may modify the arsenic-related RCC risk even in a non-obvious arsenic exposure area. -- Highlights: Black-Right-Pointing-Pointer Subjects with p53 Pro/Pro or MDM2 GG genotype significantly increased RCC risk. Black-Right-Pointing-Pointer A significant multiplicative joint effect of p53 and p21 on RCC risk. Black-Right-Pointing-Pointer RCC patients with p53 Arg/Arg genotype had efficient arsenic methylation capacity. Black-Right-Pointing-Pointer Joint effect of p53 or MDM2 genotype and high urinary total arsenic on RCC risk.
Bartchewsky, Waldemar; Martini, Mariana R; Squassoni, Aline C; Alvarez, Marisa C; Ladeira, Marcelo S P; Salvatore, Daisy M F; Trevisan, Miriam A; Pedrazzoli, José; Ribeiro, Marcelo L
2010-01-01
The aim of the present study is to evaluate the influence of Helicobacter pylori on Bax and Bcl-2 mRNA and protein levels in patients with chronic gastritis and gastric cancer. The study included 217 patients, of which 26 were uninfected; 127 had chronic gastritis and were H. pylori-positive, and 64 had gastric cancer. Bacterial genotypes were evaluated by PCR, and the expression values were determined by quantitative real-time PCR and immunohistochemistry. Our data showed that the up-regulationary effects of H. pylori infection on the pro-apoptotic gene, Bax, were stronger than its induction of Bcl-2; this effect may increase apoptosis in patients with chronic gastritis. In patients with gastric cancer, the up-regulation of the anti-apoptotic gene, Bcl-2, counteracted the pro-apoptotic effects of Bax, leading to a deregulation of apoptosis-associated gene expression, favoring cell proliferation. Thus, the disturbance in Bax and Bcl-2 balance, induced by H. pylori, might be important in gastric cancer development.
Tumor gene expression and prognosis in breast cancer patients with 10 or more positive lymph nodes.
Cobleigh, Melody A; Tabesh, Bita; Bitterman, Pincas; Baker, Joffre; Cronin, Maureen; Liu, Mei-Lan; Borchik, Russell; Mosquera, Juan-Miguel; Walker, Michael G; Shak, Steven
2005-12-15
This study, along with two others, was done to develop the 21-gene Recurrence Score assay (Oncotype DX) that was validated in a subsequent independent study and is used to aid decision making about chemotherapy in estrogen receptor (ER)-positive, node-negative breast cancer patients. Patients with >or=10 nodes diagnosed from 1979 to 1999 were identified. RNA was extracted from paraffin blocks, and expression of 203 candidate genes was quantified using reverse transcription-PCR (RT-PCR). Seventy-eight patients were studied. As of August 2002, 77% of patients had distant recurrence or breast cancer death. Univariate Cox analysis of clinical and immunohistochemistry variables indicated that HER2/immunohistochemistry, number of involved nodes, progesterone receptor (PR)/immunohistochemistry (% cells), and ER/immunohistochemistry (% cells) were significantly associated with distant recurrence-free survival (DRFS). Univariate Cox analysis identified 22 genes associated with DRFS. Higher expression correlated with shorter DRFS for the HER2 adaptor GRB7 and the macrophage marker CD68. Higher expression correlated with longer DRFS for tumor protein p53-binding protein 2 (TP53BP2) and the ER axis genes PR and Bcl2. Multivariate methods, including stepwise variable selection and bootstrap resampling of the Cox proportional hazards regression model, identified several genes, including TP53BP2 and Bcl2, as significant predictors of DRFS. Tumor gene expression profiles of archival tissues, some more than 20 years old, provide significant information about risk of distant recurrence even among patients with 10 or more nodes.
Inhibition of bladder cancer cell proliferation by allyl isothiocyanate (mustard essential oil)
Energy Technology Data Exchange (ETDEWEB)
Sávio, André Luiz Ventura, E-mail: savio.alv@gmail.com [UNESP – Universidade Estadual Paulista, Faculdade de Medicina de Botucatu, Departamento de Patologia, Botucatu, SP (Brazil); Nicioli da Silva, Glenda [UFOP – Universidade Federal de Ouro Preto, Escola de Farmácia, Departamento de Análises Clínicas, Ouro Preto, MG (Brazil); Salvadori, Daisy Maria Fávero [UNESP – Universidade Estadual Paulista, Faculdade de Medicina de Botucatu, Departamento de Patologia, Botucatu, SP (Brazil)
2015-01-15
Highlights: • AITC inhibits mutant and wild-type TP53 cell proliferation. • Morphological changes and cells debris were observed after AITC treatment in both cells. • BAX and BCL2 expression modulation was observed in wild-type TP53 cells. • BCL2, BAX and ANLN increased and S100P decreased expression was detected in mutated TP53 cells. • AITC effects in gene modulation are dependent TP53 gene status. - Abstract: Natural compounds hold great promise for combating antibiotic resistance, the failure to control some diseases, the emergence of new diseases and the toxicity of some contemporary medical products. Allyl isothiocyanate (AITC), which is abundant in cruciferous vegetables and mustard seeds and is commonly referred to as mustard essential oil, exhibits promising antineoplastic activity against bladder cancer, although its mechanism of action is not fully understood. Therefore, the aim of this study was to investigate the effects of AITC activity on bladder cancer cell lines carrying a wild type (wt; RT4) or mutated (T24) TP53 gene. Morphological changes, cell cycle kinetics and CDK1, SMAD4, BAX, BCL2, ANLN and S100P gene expression were evaluated. In both cell lines, treatment with AITC inhibited cell proliferation (at 62.5, 72.5, 82.5 and 92.5 μM AITC) and induced morphological changes, including scattered and elongated cells and cellular debris. Gene expression profiles revealed increased S100P and BAX and decreased BCL2 expression in RT4 cells following AITC treatment. T24 cells displayed increased BCL2, BAX and ANLN and decreased S100P expression. No changes in SMAD4 and CDK1 expression were observed in either cell line. In conclusion, AITC inhibits cell proliferation independent of TP53 status. However, the mechanism of action of AITC differed in the two cell lines; in RT4 cells, it mainly acted via the classical BAX/BCL2 pathway, while in T24 cells, AITC modulated the activities of ANLN (related to cytokinesis) and S100P. These data confirm
Inhibition of bladder cancer cell proliferation by allyl isothiocyanate (mustard essential oil)
International Nuclear Information System (INIS)
Sávio, André Luiz Ventura; Nicioli da Silva, Glenda; Salvadori, Daisy Maria Fávero
2015-01-01
Highlights: • AITC inhibits mutant and wild-type TP53 cell proliferation. • Morphological changes and cells debris were observed after AITC treatment in both cells. • BAX and BCL2 expression modulation was observed in wild-type TP53 cells. • BCL2, BAX and ANLN increased and S100P decreased expression was detected in mutated TP53 cells. • AITC effects in gene modulation are dependent TP53 gene status. - Abstract: Natural compounds hold great promise for combating antibiotic resistance, the failure to control some diseases, the emergence of new diseases and the toxicity of some contemporary medical products. Allyl isothiocyanate (AITC), which is abundant in cruciferous vegetables and mustard seeds and is commonly referred to as mustard essential oil, exhibits promising antineoplastic activity against bladder cancer, although its mechanism of action is not fully understood. Therefore, the aim of this study was to investigate the effects of AITC activity on bladder cancer cell lines carrying a wild type (wt; RT4) or mutated (T24) TP53 gene. Morphological changes, cell cycle kinetics and CDK1, SMAD4, BAX, BCL2, ANLN and S100P gene expression were evaluated. In both cell lines, treatment with AITC inhibited cell proliferation (at 62.5, 72.5, 82.5 and 92.5 μM AITC) and induced morphological changes, including scattered and elongated cells and cellular debris. Gene expression profiles revealed increased S100P and BAX and decreased BCL2 expression in RT4 cells following AITC treatment. T24 cells displayed increased BCL2, BAX and ANLN and decreased S100P expression. No changes in SMAD4 and CDK1 expression were observed in either cell line. In conclusion, AITC inhibits cell proliferation independent of TP53 status. However, the mechanism of action of AITC differed in the two cell lines; in RT4 cells, it mainly acted via the classical BAX/BCL2 pathway, while in T24 cells, AITC modulated the activities of ANLN (related to cytokinesis) and S100P. These data confirm
Directory of Open Access Journals (Sweden)
Mohammad Esmaeil Afzalpour
2016-11-01
Full Text Available Physical activity and diet are the most important modifiable determinants of cancer risk. The objective of this study was to examine the effect of intense intermittent training with and without taking vitamin E on expression of p53 and PTEN tumor suppressing genes in the prostate gland of male rats. For this purpose, 50 Sprague-Dawley male rats were randomly assigned into 5 groups: [1] control (CON, n = 10, [2] sham (S, n = 10, [3] intense intermittent training (IIT, n = 10, [4] intense intermittent training + vitamin E (IIT + VE, n = 10, [5] vitamin E (VE, n = 10. Protocol of this study was implemented for 6 days per week for 6 weeks, with observing the overload principle on the motorized treadmill. After implementing training protocol, expression rate of p53 and PTEN genes reduced significantly (p<0.000, p<0.031, respectively. Taking vitamin E with intermittent training caused significant reduction in p53 expression (p<0.013, while it caused significant increase in expression of PTEN (p<0.035. These results showed that intense intermittent training reduces expression of p53 and PTEN tumor suppressing genes and taking supplementation vitamin E along with this type of training could cause different effects in expression of these tumor suppressor genes.
Directory of Open Access Journals (Sweden)
Anirban Chakraborty
Full Text Available Ribosome is responsible for protein synthesis in all organisms and ribosomal proteins (RPs play important roles in the formation of a functional ribosome. L11 was recently shown to regulate p53 activity through a direct binding with MDM2 and abrogating the MDM2-induced p53 degradation in response to ribosomal stress. However, the studies were performed in cell lines and the significance of this tumor suppressor function of L11 has yet to be explored in animal models. To investigate the effects of the deletion of L11 and its physiological relevance to p53 activity, we knocked down the rpl11 gene in zebrafish and analyzed the p53 response. Contrary to the cell line-based results, our data indicate that an L11 deficiency in a model organism activates the p53 pathway. The L11-deficient embryos (morphants displayed developmental abnormalities primarily in the brain, leading to embryonic lethality within 6-7 days post fertilization. Extensive apoptosis was observed in the head region of the morphants, thus correlating the morphological defects with apparent cell death. A decrease in total abundance of genes involved in neural patterning of the brain was observed in the morphants, suggesting a reduction in neural progenitor cells. Upregulation of the genes involved in the p53 pathway were observed in the morphants. Simultaneous knockdown of the p53 gene rescued the developmental defects and apoptosis in the morphants. These results suggest that ribosomal dysfunction due to the loss of L11 activates a p53-dependent checkpoint response to prevent improper embryonic development.
P53 expression in prostatic cancer: an immunohistochemical study
International Nuclear Information System (INIS)
Al-Nuaimy, W.M.; Al-Allaf, L.I.; Alnaimi, H.A.
2011-01-01
Prostate cancer is the most common malignancy in men and second leading cause of cancer death in the Western world. P53 alterations are the most frequent genetic changes in human cancers. Mutation of the p53 gene has been implicated in the development of >50% of all human cancer. The current study aims at evaluating the immuno-histochemical expression of p53 protein in patients with cancer of prostate, as prognostic parameter in correlation with other parameters including PSA receptors, and to correlate the results with those of other studies. (authors).
International Nuclear Information System (INIS)
Sun Yuanlin; Tang Jian; Gu Xiaohong; Li Deyuan
2009-01-01
Objective: To investigate the effect of polysaccharides from Angelica sinensis (ASP3) on Bcl-2 and Bax protein expression of irradiated liver cells from mice. Methods: Bcl-2 and Bax protein expression of liver cells in vitro exposed to 2.0 Gy rays were examined by using immunohistochemistry method. Results: The expression of apoptosis-accelerating protein Bax in the irradiation group was enhanced obviously (70.83%), while apoptosis inhibiting protein Bcl-2 tended to decline (55.60%), with the statistically significant difference (P <0.01) compared with that of the control. ASP3 pretreatment could regulate Bcl-2 and Bax protein expression of liver cells, inhibiting Bax protein expression(64.14/58.37%) and increasing Bcl-2 protein expression(59.21%/ 67.45%). The differences between the high dosage (100 mg/L of ASP3) and the irradiation group were statistically significant (P<0.05). Conclusions: ASP3 pretreatment could prohibit the apoptosis of radiation- damaged liver cells due to abnormal expression of Bcl-2 and Bax, and reduce the cell apoptosis by increasing Bcl-2/Bax protein expression so as to enhance the radiation endurance of liver cells. (authors)
[Punish or cherish: p53, metabolism and tumor suppression].
Albagli, Olivier
2015-10-01
The p53 gene is essential for tumor suppression, but how it does so remains unclear. Upon genotoxic or oncogenic stresses, increased p53 activity induces transient cell cycle arrest, senescence or apoptosis, the three cornerstones of the so-called triumvirate. Accordingly, it has long been thought that p53 suppresses tumorigenesis by somehow counteracting cell proliferation or survival. However, several recently described genetically modified mice indicate that p53 can suppress tumorigenesis without triggering these three responses. Rather, as an important mechanism for tumor suppression, these mutant mice point to the ability of p53 to prevent the Warburg effect, that is to dampen glycolysis and foster mitochondrial respiration. Interestingly, these metabolic functions of p53 rely, in part, on its "unstressed" (basal) expression, a feature shared by its mechanistically linked anti-oxydant function. Together, these "conservative" activities of p53 may prevent tumor initiation by promoting and maintaining a normal oxidative metabolism and hence underly the "daily" tumor suppression by p53 in most cells. Conversely, destructive activities elicited by high p53 levels and leading to senescence or apoptosis provide a shield against partially or overtly transformed cells. This last situation, although relatively infrequent throughout life, is usual in experimental settings, which could explain the disproportionally high number of data implicating the triumvirate in tumor suppression by p53. © 2015 médecine/sciences – Inserm.
AAVPG: A vigilant vector where transgene expression is induced by p53
Energy Technology Data Exchange (ETDEWEB)
Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.; Strauss, Bryan E., E-mail: bstrauss@usp.br
2013-12-15
Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 fold increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.
Design, Synthesis and Evaluation of 2,5-Diketopiperazines as Inhibitors of the MDM2-p53 Interaction.
Directory of Open Access Journals (Sweden)
Mariell Pettersson
Full Text Available The transcription factor p53 is the main tumour suppressor in cells and many cancer types have p53 mutations resulting in a loss of its function. In tumours that retain wild-type p53 function, p53 activity is down-regulated by MDM2 (human murine double minute 2 via a direct protein-protein interaction. We have designed and synthesised two series of 2,5-diketopiperazines as inhibitors of the MDM2-p53 interaction. The first set was designed to directly mimic the α-helical region of the p53 peptide, containing key residues in the i, i+4 and i+7 positions of a natural α-helix. Conformational analysis indicated that 1,3,6-trisubstituted 2,5-diketopiperazines were able to place substituents in the same spatial orientation as an α-helix template. The key step of the synthesis involved the cyclisation of substituted dipeptides. The other set of tetrasubstituted 2,5-diketopiperazines were designed based on structure-based docking studies and the Ugi multicomponent reaction was used for the synthesis. This latter set comprised the most potent inhibitors which displayed micromolar IC50-values in a biochemical fluorescence polarisation assay.
Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S
2017-11-01
Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.
Kashofer, Karl; Regauer, Sigrid
2017-08-01
This study evaluates the frequency and type of TP53 gene mutations and HPV status in 72 consecutively diagnosed primary invasive vulvar squamous cell carcinomas (SCC) during the past 5years. DNA of formalin-fixed and paraffin embedded tumour tissue was analysed for 32 HPV subtypes and the full coding sequence of the TP53 gene, and correlated with results of p53 immunohistochemistry. 13/72 (18%) cancers were HPV-induced squamous cell carcinomas, of which 1/13 (8%) carcinoma harboured a somatic TP53 mutation. Among the 59/72 (82%) HPV-negative cancers, 59/72 (82%) SCC were HPV-negative with wild-type gene in 14/59 (24%) SCC and somatic TP53 mutations in 45/59 (76%) SCC. 28/45 (62%) SCC carried one (n=20) or two (n=8) missense mutations. 11/45 (24%) carcinomas showed a single disruptive mutation (3× frame shift, 7× stop codon, 1× deletion), 3/45 SCC a splice site mutation. 3/45 (7%) carcinomas had 2 or 3 different mutations. 18 different "hot spot" mutations were observed in 22/45 cancers (49%; 5× R273, 3× R282; 2× each Y220, R278, R248). Immunohistochemical p53 over expression was identified in most SCC with missense mutations, but not in SCC with disruptive TP53 mutations or TP53 wild-type. 14/45 (31%) patients with TP53 mutated SCC died of disease within 12months (range 2-24months) versus 0/13 patients with HPV-induced carcinomas and 0/14 patients with HPV-negative, TP53 wild-type carcinomas. 80% of primary invasive vulvar SCC were HPV-negative carcinomas with a high frequency of disruptive mutations and "hot spot" TP53 gene mutations, which have been linked to chemo- and radioresistance. The death rate of patients with p53 mutated vulvar cancers was 31%. Immunohistochemical p53 over expression could not reliably identify SCC with TP53 gene mutation. Pharmacological therapies targeting mutant p53 will be promising strategies for personalized therapy in patients with TP53 mutated vulvar cancers. Copyright © 2017. Published by Elsevier Inc.
International Nuclear Information System (INIS)
Ito, Atsushi; Nakano, Hisako; Shinohara, Kunio
2010-01-01
The sensitizing effects of wild-type p53 on X-ray-induced cell death and on heat-induced apoptosis in M10, a radiosensitive and Trp53 (mouse p53 gene)-mutated lymphoma cell line which dies through necrosis by X-irradiation, were investigated using three M10 derived transfectants with wild-type TP53 (human p53 gene). Cell death was determined by colony formation and/or dye exclusion test, and apoptosis was detected as the changes in nuclear morphology by Giemsa staining. Expression of wild-type p53 protein increased radiosensitivity of cell death as determined by both clonogenic and dye exclusion assays. This increase in radiosensitivity was attributable largely to apoptosis induction in addition to a small enhancement of necrosis. Interestingly neither pathway to cell death was accompanied by caspase-3 activation. On the other hand, heat-induced caspase-3 dependent apoptotic cell death without transfection was further increased by the transfection of wild-type p53. In conclusion, the introduction of wild-type p53 enhanced apoptotic cell death by X-rays or heat via different mechanisms that do or do not activate caspase-3, respectively. In addition, p53 also enhanced the X-ray-induced necrosis in M10 cells. (author)
Arecoline-induced growth arrest and p21WAF1 expression are dependent on p53 in rat hepatocytes
International Nuclear Information System (INIS)
Chou, W.-W.; Guh, J.-Y.; Tsai, J.-F.; Hwang, C.-C.; Chen, H.-C.; Huang, J.-S.; Yang, Y.-L.; Hung, W.-C.; Chuang, L.-Y.
2008-01-01
Betel-quid use is associated with the risk of liver cirrhosis and hepatocellular carcinoma and arecoline, the major alkaloid of betel-quid, is hepatotoxic in mice. Therefore, we studied the cytotoxic and genotoxic effects of arecoline in normal rat hepatocytes (Clone-9 cells). Arecoline dose-dependently (0.1-1 mM) decreased cell cycle-dependent proliferation while inducing DNA damage at 24 h. Moreover, arecoline (1 mM)-induced apoptosis and necrosis at 24 h. Arecoline dose-dependently (0.1-0.5 mM) increased transforming growth factor-β (TGF-β) mRNA, gene transcription and bioactivity and neutralizing TGF-β antibody attenuated arecoline (0.5 mM)-inhibited cell proliferation at 24 h. Arecoline (0.5 mM) also increased p21 WAF1 protein expression and p21 WAF1 gene transcription. Moreover, arecoline (0.5 mM) time-dependently (8-24 h) increased p53 serine 15 phosphorylation. Pifithrin-α (p53 inhibitor) and the loss of the two p53-binding elements in the p21 WAF1 gene promoter attenuated arecoline-induced p21 WAF1 gene transcription at 24 h. Pifithrin-α also attenuated arecoline (0.5 mM)-inhibited cell proliferation at 24 h. We concluded that arecoline induces cytotoxicity, DNA damage, G 0 /G 1 cell cycle arrest, TGF-β1, p21 WAF1 and activates p53 in Clone-9 cells. Moreover, arecoline-induced p21 WAF1 is dependent on p53 while arecoline-inhibited growth is dependent on both TGF-β and p53
Analysis of P53 mutations and their expression in 56 colorectal cancer cell lines
DEFF Research Database (Denmark)
Liu, Ying; Bodmer, Walter F
2006-01-01
A comprehensive analysis of the TP53 gene and its protein status was carried out on a panel of 56 colorectal cancer cell lines. This analysis was based on a combination of denaturing HPLC mutation screening of all exons of the p53 gene, sequencing the cDNA, and assessing the function of the p53 p...
A nanobody modulates the p53 transcriptional program without perturbing its functional architecture
Bethuyne, Jonas; De Gieter, Steven; Zwaenepoel, Olivier; Garcia-Pino, Abel; Durinck, Kaat; Verhelle, Adriaan; Hassanzadeh-Ghassabeh, Gholamreza; Speleman, Frank; Loris, Remy; Gettemans, Jan
2014-01-01
The p53 transcription factor plays an important role in genome integrity. To perform this task, p53 regulates the transcription of genes promoting various cellular outcomes including cell cycle arrest, apoptosis or senescence. The precise regulation of this activity remains elusive as numerous mechanisms, e.g. posttranslational modifications of p53 and (non-)covalent p53 binding partners, influence the p53 transcriptional program. We developed a novel, non-invasive tool to manipulate endogenous p53. Nanobodies (Nb), raised against the DNA-binding domain of p53, allow us to distinctively target both wild type and mutant p53 with great specificity. Nb3 preferentially binds ‘structural’ mutant p53, i.e. R175H and R282W, while a second but distinct nanobody, Nb139, binds both mutant and wild type p53. The co-crystal structure of the p53 DNA-binding domain in complex with Nb139 (1.9 Å resolution) reveals that Nb139 binds opposite the DNA-binding surface. Furthermore, we demonstrate that Nb139 does not disturb the functional architecture of the p53 DNA-binding domain using conformation-specific p53 antibody immunoprecipitations, glutaraldehyde crosslinking assays and chromatin immunoprecipitation. Functionally, the binding of Nb139 to p53 allows us to perturb the transactivation of p53 target genes. We propose that reduced recruitment of transcriptional co-activators or modulation of selected post-transcriptional modifications account for these observations. PMID:25324313