Enzyme activity of a Phanerochaete chrysosporium cellobiohydrolase
African Journals Online (AJOL)
The white-rot, basidiomycete fungus, Phanerochaete chrysosporium, has attracted .... with Congo red (1 mg/ml) solution, incubated at room temperature for 15 min and washed several times with sterile 1 .... white rot fungus Phanerochaete chrysosporium: cloning, sequence analysis and regulation of differential expression.
Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette
2006-01-01
The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...
Demonstration of laccase in the white rot basidiomycete phanerochaete chrysosporium BKM-F1767
Energy Technology Data Exchange (ETDEWEB)
Srinivasan, C.; D`Souza, T.M.; Boominathan, K. [Michigan State Univ., East Lansing, MI (United States)
1995-12-01
It has been widely reported that the white rot basidiomycete Phanerochaete chrysosporium, unlike most other white rot fungi, does not produce laccase, an enzyme implicated in lignin biodegradation. Our results showed that P. chrysosporium BKM-F1767 produces extracellular laccase in a defined culture medium containing cellulose (10 g/liter) and either 2.4 or 24 mM ammonium tartrate. Laccase activity was demonstrated in the concentrated extracellular culture fluids of this organism as determined by a laccase plate assay as well as a spectrophotometric assay with ABTS [2,2`-azinobis(3-ethylbenzathiazoline-6-sulfonic acid)] as the substrate. Laccase activity was observed even after addition of excess catalase to the extracellular culture fluid to destroy the endogenously produced hydrogen peroxide, indicating that the observed activity is not due to a peroxidase. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by activity staining with ABTS revealed the presence of a laccase band with an estimated M{sub r} of 46,500.
International Nuclear Information System (INIS)
Lopera Mesa, Margarita Maria; Penuela Mesa, Gustavo Antonio; Dominguez Gual, Maria Carolina; Mejia Zapata, Gloria Maria
2005-01-01
Degradation of the insecticide chloropyrifos was investigated in sterilized soil samples supplemented by the white rot basidiomycetes Phanerochaete chrysosporium. Degradation rates were measured during 21-day incubation at pesticide concentrations of 0,95, 5,3, and 9,41 μ/g. Phanerochaete chrysosporium showed ability to biodegrade the insecticide in values of 96,3%, 82,4% and 62,2%, respectively, followed by rapid degradation at low initial concentration of chloropyrifos
Genetic recombination in auxotrophic strains of Phanerochaete chrysosporium
International Nuclear Information System (INIS)
Krejci, R.
1987-01-01
Four auxotrophic strains of ligninolytic basidiomycete Phanerochaete chrysosporium were obtained by UV mutagenesis. The heterokaryotic mycelium formed by complementation of different auxotrophic isolates was able to fruit and produce basidiospores. Prototrophic strains and strains with a recombined set of parental nutritional requirements were isolated from the basidiospore progeny of the heterokaryons. Genetic recombination hence takes place in fruit bodies produced by the heterokaryotic mycelium. (author). 3 tabs., 13 refs
Elena Fernandez-Fueyo; Francisco J. Ruiz-Dueñas; Patricia Ferreira; Dimitrios Floudas; David S. Hibbett; Paulo Canessa; Luis F. Larrondo; Tim Y. James; Daniela Seelenfreund; Sergio Lobos; Rubén Polanco; Mario Tello; Yoichi Honda; Takahito Watanabe; Takashi Watanabe; Jae San Ryu; Christian P. Kubicek; Monika Schmoll; Jill Gaskell; Kenneth E. Hammel; Franz J. St. John; Amber Vanden Wymelenberg; Grzegorz Sabat; Sandra Splinter BonDurant; Khajamohiddin Syed; Jagjit S. Yadav; Harshavardhan Dodapaneni; Venkataramanan Subramanian; José L. Lavin; José A. Oguiza; Gumer Perez; Antonio G. Pisabarro; Lucia Ramirez; Francisco Santoyo; Emma Master; Pedro M. Coutinho; Bernard Henrissat; Vincent Lombard; Jon Karl Magnuson; Ursula Kües; Chiaki Hori; Kiyohiko Igarashi; Masahiro Samejima; Benjamin W. Held; Kerrie W. Barry; Kurt M. LaButti; Alla Lapidus; Erika A. Lindquist; Susan M. Lucas; Robert Riley; Asaf A. Salamov; Dirk Hoffmeister; Daniel Schwenk; Yitzhak Hadar; Oded Yarden; Ronald P. de Vries; Ad Wiebenga; Jan Stenlid; Daniel Eastwood; Igor V. Grigoriev; Randy M. Berka; Robert A. Blanchette; Phil Kersten; Angel T. Martinez; Rafael Vicuna; Daniel Cullen
2012-01-01
Efficient lignin depolymerization is unique to the wood decay basidiomycetes, collectively referred to as white rot fungi. Phanerochaete chrysosporium simultaneously degrades lignin and cellulose, whereas the closely related species, Ceriporiopsis subvermispora, also depolymerizes lignin but may do so with relatively little...
Amber J. Vanden Wymelenberg; Jill Gaskell; Michael Mozuch; Grzegorz Sabat; John Ralph; Oleksandr Skyba; Shawn D Mansfield; Robert A. Blanchette; Diego Martinez; Igor Grigoriev; Philip J Kersten; Daniel Cullen
2010-01-01
Cellulose degradation by brown rot fungi, such as Postia placenta, is poorly understood relative to the phylogenetically related white rot basidiomycete, Phanerochaete chrysosporium. To elucidate the number, structure, and regulation of genes involved in lignocellulosic cell wall attack, secretome and transcriptome analyses were performed on both wood decay fungi...
Energy Technology Data Exchange (ETDEWEB)
Nakamura, Tomofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 (Japan); Ichinose, Hirofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Wariishi, Hiroyuki, E-mail: hirowari@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)
2010-04-09
We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.
International Nuclear Information System (INIS)
Nakamura, Tomofumi; Ichinose, Hirofumi; Wariishi, Hiroyuki
2010-01-01
We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD + -binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.
Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer
2009-01-01
The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...
Amber Vanden Wymelenberg; Jill Gaskell; Michael Mozuch; Sandra Splinter BonDurant; Grzegorz Sabat; John Ralph; Oleksandr Skyba; Shawn D. Mansfield; Robert A. Blanchette; Igor Grigoriev; Philip J. Kersten; Daniel Cullen
2011-01-01
Identification of specific genes and enzymes involved in conversion of lignocellulosics from an expanding number of potential feedstocks is of growing interest to bioenergy process development. The basidiomycetous wood decay fungi Phanerochaete chrysosporium and Postia placenta are promising in this regard because they are able to utilize a wide range of simple and...
International Nuclear Information System (INIS)
Covert, S.F.
1991-01-01
During the past several years, molecular genetics research on phanerochaete chrysosporium, a white-rot basidiomycete, has increased dramatically. It is known that families of highly homologous, clustered genes encode the lignin peroxidases. The same appears to be true with the exocellobiohydrolase genes. Functional domains and active sites have been tentatively identified from the deduced amino acid sequences of these genes. Current investigations focus on elucidating the genomic organization of gene families, the mechanism(s) of gene regulation, and the role and interaction of specific gene products in lignocellulose degradation. (author)
Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna
2004-01-01
A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...
Bioremediation of textile effluent using Phanerochaete chrysosporium
African Journals Online (AJOL)
Bioremediation of textile effluent using Phanerochaete chrysosporium. ... African Journal of Biotechnology. Journal Home · ABOUT THIS ... The discharge of these waste residues into the environment eventually poison, damage or affect one or ...
Energy Technology Data Exchange (ETDEWEB)
Fernandez-Fueyo, Elena; Ruiz-Duenas, Francisco J.; Ferreira, Patrica; Floudas, Dimitrios; HIbbett, David S.; Canessa, Paulo; Larrondo, Luis F.; James, Tim Y.; Seelenfreund, Daniela; Lobos, Sergio; Polanco, Ruben; Tello, Mario; Honda, Yoichi; Watanabe, Takahito; Watanabe, Takashi; Ryu, Jae San; Kubicek, Christian P.; Schmoll, Monika; Gaskell, Jill; Hammel, Kenneth E.; John, Franz J.; Vanden Wymelenberg, Amber; Sabat, Grzegorz; Splinter BonDurant, Sandra; Syed, Khajamohiddin; Yadav, Jagjit S.; Doddapaneni, Harshavardhan; Subramanian, Venkataramanan; Lavin, Jose L.; Oguiza, Jose A.; Perez, Gumer; Pisabarro, Antonio G.; Ramirez, Lucia; Santoyo, Francisco; Master, Emma; Coutinho, Pedro M.; Henrissat, Bernard; Lombard, Vincent; Magnuson, Jon Karl; Kues, Ursula; Hori, Chiaki; Igarashi, Kiyohiko; Samejima, Masahiro; Held, Benjamin W.; Barry, Kerrie W.; LaButti, Kurt M.; Lapidus, Alla; Lindquist, Erika A.; Lucas, Susan M.; Riley, Robert; Salamov, Asaf A.; Hoffmeister, Dirk; Schwenk, Daniel; Hadar, Yitzhak; Yarden, Oded; de Vries, Ronald P.; Wiebenga, Ad; Stenlid, Jan; Eastwood, Daniel; Grigoriev, Igor V.; Berka, Randy M.; Blanchette, Robert A.; Kersten, Phil; Martinez, Angel T.; Vicuna, Rafael; Cullen, Dan
2011-12-06
Efficient lignin depolymerization is unique to the wood decay basidiomycetes, collectively referred to as white rot fungi. Phanerochaete chrysosporium simultaneously degrades lignin and cellulose, whereas the closely related species, Ceriporiopsis subvermispora, also depolymerizes lignin but may do so with relatively little cellulose degradation. To investigate the basis for selective ligninolysis, we conducted comparative genome analysis of C. subvermispora and P. chrysosporium. Genes encoding manganese peroxidase numbered 13 and five in C. subvermispora and P. chrysosporium, respectively. In addition, the C. subvermispora genome contains at least seven genes predicted to encode laccases, whereas the P. chrysosporium genome contains none. We also observed expansion of the number of C. subvermispora desaturase-encoding genes putatively involved in lipid metabolism. Microarray-based transcriptome analysis showed substantial up-regulation of several desaturase and MnP genes in wood-containing medium. MS identified MnP proteins in C. subvermispora culture filtrates, but none in P. chrysosporium cultures. These results support the importance of MnP and a lignin degradation mechanism whereby cleavage of the dominant nonphenolic structures is mediated by lipid peroxidation products. Two C. subvermispora genes were predicted to encode peroxidases structurally similar to P. chrysosporium lignin peroxidase and, following heterologous expression in Escherichia coli, the enzymes were shown to oxidize high redox potential substrates, but not Mn2. Apart from oxidative lignin degradation, we also examined cellulolytic and hemicellulolytic systems in both fungi. In summary, the C. subvermispora genetic inventory and expression patterns exhibit increased oxidoreductase potential and diminished cellulolytic capability relative to P. chrysosporium.
Enzyme activity of a Phanerochaete chrysosporium cellobiohydrolase
African Journals Online (AJOL)
The aim of this study was to produce a secreted, heterologously expressed Phanerochaete chrysosporium cellobiohydrolase (CBHI.1) protein that required no in vitro chemical refolding and to investigate the cellulolytic activity of the clone expressing the glutathione S-transferase (GST) fused CBHI.1 protein. Plate enzyme ...
International Nuclear Information System (INIS)
Tri Retno DL; Nana Mulyana; Nurhasni; Uswatun Hasanah
2016-01-01
This research aims to increase the activity of extracellular enzymes lignolitik fungi phanerochaete chrysosporium and ganoderma lucidum to degrade lignocellulosic waste. Lignocellulosic difficult to degrade because it is composed of lignin, cellulose and hemicellulose. Phanerochaete chrysosporium and ganoderma lucidum group white rot fungi can degrade lignin because it is able to synthesize enzymes lignin peroxidase (LiP). Irradiation low dose gamma rays capable menstimulsi increase extracellular enzyme activity. Fungi phanerochaete chrysosporium and ganoderma lucidum in medium slent exposed to gamma irradiation at doses of 0 (control), 200, 400, 600, 800 and 1000 Gy. In a liquid medium containing Potatoes Dextrose Broth (PDB), mineral salts with the substrate lignin alkali 0 and 5 % w/v, fungi phanerochaete chrysosporium were exposed to a dose of 600 Gy of gamma rays have LiP activity (30 U/mL) by 2.5 times higher compared with controls (12 U/mL). While ganoderma lucidum that are exposed to gamma radiation at a dose of 800 Gy has LiP activity (34 U/mL) was 1.7 times higher than the control (20 U/mL). On a solid substrate fermentation of white teak powder (Gmelina arborea Roxb.) For 12 days at pH 6.4 and water content of 79 % by fungi phanerochaete chrysosporium were exposed to gamma ray dose of 600 Gy has an efficiency of lignin degradation by 42 %, whereas on fungi ganoderma lucidum that are exposed gamma ray dose of 800 Gy has an efficiency of lignin degradation by 21 % with optimal conditions of pH 7. And; water content of 71.3 %. (author)
Energy Technology Data Exchange (ETDEWEB)
Hoque, E.; Klotz, D.; Teichmann, G.; Lang, H.; Wolf, M. [GSF - Forschungszentrum fuer Umwelt und Gesundheit GmbH, Neuherberg (Germany). Inst. fuer Hydrologie; Beisker, W. [GSF, Inst. fuer Pathologie (Germany)
2001-11-01
Just as bacteria so can aquatic fungi contribute effectively to pollutant elimination, at least in superficial groundwaters. However, very little is known about this. Nor is it known whether fungal spores are capable of being transported through sedimentary cavities. At least fungal spores are for some part of similar size as bacteria. We here report for the first time on a demonstration of the migration through quartz sand of spores of the two fungal species Phanerochaete chrysosporium and Mucor hiemalis f. irnsingii. [German] Neben Bakterien koennen auch aquatische Pilze, zumindest im oberflaechennahen Grundwasser, effiziente Beitraege zur Schadstoffentgiftung leisten. Darueber ist aber sehr wenig bekannt. Es ist auch nicht bekannt, ob ueberhaupt Pilzsporen durch Sedimenthohlraeume transportiert werden koennen, obwohl die Pilzsporen z.T. aehnliche Abmessungen wie Bakterien haben. Hier berichten wir erstmalig ueber den Nachweis der Migration von Sporen der beiden Pilzarten Phanerochaete chrysosporium und Mucor hiemalis f. irnsingii durch Quarzsand. (orig.)
Directory of Open Access Journals (Sweden)
Nurhasni Nurhasni
2016-12-01
Full Text Available Abstrak Biomassa lignoselulosa yang merupakan limbah pemanenan kayu harus dilakukan proses untuk memisahkan selulosa, hemiselulosa dan lignin sehingga dapat termanfaatkan. Penelitian ini bertujuan untuk mengetahui efektivitas inokulan fungi Phanerochaete chrysosporium iradiasi gamma dan pretreatment kimia terhadap percepatan delignifikasi serbuk kayu jati putih (Gmelina arborea Roxb. sehingga dapat dimanfaatkan dalam proses pulping. Pada penelitian ini dilakukan pretreatment substrat kayu jati putih (Gmelina arborea Roxb. menggunakan larutan NaOH 1% dan H2SO4 1% serta iradiasi gamma Co-60, yang mempunyai daya ionisasi kecil, daya tembus yang tinggi serta Co-60 dapat memancarkan sinar gamma dengan waktu paruh pendek. Penelitian ini dilakukan dalam dua tahap, tahap pertama penentuan dosis optimum iradiasi gamma terhadap fungi Phanerochaete chrysosporium (0 Gy, 200 Gy, 400 Gy, 600 Gy, 800 Gy, dan 1000 Gy dan tahap kedua analisis karakteristik substrat kayu jati putih yang telah di pretreatment dengan metode Solid State Fermentation (SSF selama 21 hari. Hasil penelitian menunjukkan bahwa dosis optimum pemberian iradiasi gamma pada fungi Phanerochaete chrysosporium yaitu pada dosis 600 Gy yang dapat meningkatkan aktivitas enzim lignin peroksidase (LiP sebesar 22.18 U/mL. Proses pretreatment kimia dengan menggunakan H2SO4 1% dapat mempercepat proses biodelignifikasi yang menghasilkan efisiensi degradasi lignin tertinggi yaitu sebesar 25.65%. Kata kunci: Lignoselulosa, delignifikasi, Solid State Fermentation (SSF, Phanerochaete chrysosporium,iradiasi gamma. Abstract Lignocellulose biomass is waste wood harvesting should be a process for separating cellulose, hemicellulose and lignin that can be utilized. This study aims to determine the effectiveness of the inoculant fungi Phanerochaete chrysosphorium gamma irradiation and chemical pretreatment to accelerate delignification powder white teak (Gmelina arborea Roxb.. In this research
Czech Academy of Sciences Publication Activity Database
Pisanelli, I.; Kujawa, M.; Spadiut, O.; Kittl, R.; Halada, Petr; Volc, Jindřich; Mozuch, M. D.; Kersten, P.; Haltrich, D.; Peterbauer, C.
2009-01-01
Roč. 142, č. 2 (2009), s. 97-106 ISSN 0168-1656 Institutional research plan: CEZ:AV0Z50200510 Keywords : Pyranose 2-oxidase * Phanerochaete chrysosporium * Lignocellulose degradation Subject RIV: CE - Biochemistry Impact factor: 2.881, year: 2009
Chiaki Hori; Daniel Cullen
2016-01-01
Efficient and complete degradation of woody plant cell walls requires the concerted action of hydrolytic and oxidative systems possessed by a relatively small group of filamentous basidiomycetous fungi. Among these wood decay species, Phanerochaete chrysosporium was the first to be sequenced (Martinez et al. 2004). In...
Energy Technology Data Exchange (ETDEWEB)
Suzuki, Hitoshi; MacDonald, Jacqueline; Syed, Khajamohiddin; Salamov, Asaf; Hori, Chiaki; Aerts, Andrea; Henrissat, Bernard; Wiebenga, Ad; vanKuyk, Patricia A.; Barry, Kerrie; Lindquist, Erika; LaButti, Kurt; Lapidus, Alla; Lucas, Susan; Coutinho, Pedro; Gong, Yunchen; Samejima, Masahiro; Mahadevan, Radhakrishnan; Abou-Zaid, Mamdouh; de Vries, Ronald P.; Igarashi, Kiyohiko; Yadav, Jagit S.; Grigoriev, Igor V.; Master, Emma R.
2012-02-17
Background Softwood is the predominant form of land plant biomass in the Northern hemisphere, and is among the most recalcitrant biomass resources to bioprocess technologies. The white rot fungus, Phanerochaete carnosa, has been isolated almost exclusively from softwoods, while most other known white-rot species, including Phanerochaete chrysosporium, were mainly isolated from hardwoods. Accordingly, it is anticipated that P. carnosa encodes a distinct set of enzymes and proteins that promote softwood decomposition. To elucidate the genetic basis of softwood bioconversion by a white-rot fungus, the present study reports the P. carnosa genome sequence and its comparative analysis with the previously reported P. chrysosporium genome. Results P. carnosa encodes a complete set of lignocellulose-active enzymes. Comparative genomic analysis revealed that P. carnosa is enriched with genes encoding manganese peroxidase, and that the most divergent glycoside hydrolase families were predicted to encode hemicellulases and glycoprotein degrading enzymes. Most remarkably, P. carnosa possesses one of the largest P450 contingents (266 P450s) among the sequenced and annotated wood-rotting basidiomycetes, nearly double that of P. chrysosporium. Along with metabolic pathway modeling, comparative growth studies on model compounds and chemical analyses of decomposed wood components showed greater tolerance of P. carnosa to various substrates including coniferous heartwood. Conclusions The P. carnosa genome is enriched with genes that encode P450 monooxygenases that can participate in extractives degradation, and manganese peroxidases involved in lignin degradation. The significant expansion of P450s in P. carnosa, along with differences in carbohydrate- and lignin-degrading enzymes, could be correlated to the utilization of heartwood and sapwood preparations from both coniferous and hardwood species.
International Nuclear Information System (INIS)
Murugavelh, Somasundaram; Mohanty, Kaustubha
2012-01-01
In this work the potential of live and active Phanerochaete chrysosporium, a white rot fungi, to remove lower Cr(VI) concentration from aqueous solutions was reported for the first time. A medium pH had significant effect on the growth of the fungus and bioremoval of Cr(VI). Substrate inhibition on the growth of Phanerochaete chrysosporium was evident beyond 20 g L -1 of dextrose concentration. A maximum biomass concentration of 15.64 g L -1 was obtained for an initial dextrose concentration of 20 g L -1 in metal free medium at pH 6.0. An increase in Cr(VI) concentration beyond 10 mg L -1 inhibited the growth of the fungi, thereby, reducing the chromium bioremoval efficiency. A maximum reduction efficiency of 98.92% was reported for an initial metal concentration of 10 mg L -1 . A mathematical expression for the bioreduction of Cr(VI) considering the organic compounds in the cells was proposed. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Energy Technology Data Exchange (ETDEWEB)
Murugavelh, Somasundaram; Mohanty, Kaustubha [Department of Chemical Engineering, Indian Institute of Technology Guwahati, Guwahati, Assam (India)
2012-07-15
In this work the potential of live and active Phanerochaete chrysosporium, a white rot fungi, to remove lower Cr(VI) concentration from aqueous solutions was reported for the first time. A medium pH had significant effect on the growth of the fungus and bioremoval of Cr(VI). Substrate inhibition on the growth of Phanerochaete chrysosporium was evident beyond 20 g L{sup -1} of dextrose concentration. A maximum biomass concentration of 15.64 g L{sup -1} was obtained for an initial dextrose concentration of 20 g L{sup -1} in metal free medium at pH 6.0. An increase in Cr(VI) concentration beyond 10 mg L{sup -1} inhibited the growth of the fungi, thereby, reducing the chromium bioremoval efficiency. A maximum reduction efficiency of 98.92% was reported for an initial metal concentration of 10 mg L{sup -1}. A mathematical expression for the bioreduction of Cr(VI) considering the organic compounds in the cells was proposed. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Jill Gaskell; Amber Marty; Michael Mozuch; Philip J. Kersten; Sandra Splinter Bondurant; Grzegorz Sabat; Ali Azarpira; John Ralph; Oleksandr Skyba; Shawn D. Mansfield; Robert A. Blanchette; Dan Cullen
2014-01-01
We examined gene expression patterns in the lignin-degrading fungus Phanerochaete chrysosporium when it colonizes hybrid poplar (Populus alba tremula) and syringyl (S)-rich transgenic derivatives. Acombination ofmicroarrays and liquid chromatography- tandem mass spectrometry (LC-MS/MS) allowed detection of a total of 9,959 transcripts and 793...
Energy Technology Data Exchange (ETDEWEB)
Huang, Zhenzhen [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Chen, Guiqiu, E-mail: gqchen@hnu.edu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Zeng, Guangming, E-mail: zgming@hnu.edu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Chen, Anwei [College of Resources and Environment, Hunan Agricultural University, Changsha 410128 (China); Zuo, Yanan; Guo, Zhi; Tan, Qiong [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Song, Zhongxian [Faculty of Environmental Science and Engineering, Kunming University of Science and Technology, Kunming 650500 (China); Niu, Qiuya [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China)
2015-05-30
Graphical abstract: Schematic diagram of polyvinyl alcohol-immobilized Phanerochaete chrysosporium beads (PPBs) for Cd(II) removal and 2,4-DCP degradation. - Highlights: • PVA-immobilized P. chrysosporium beads (PPBs) were fit for wastewater treatment. • Removal rates of Cd(II) and 2,4-DCP at optimum conditions were up to 78% and 95.4%. • 2,4-DCP removal rates were beyond 90% with varying initial 2,4-DCP concentrations. • PVA was vital to Cd(II) removal besides the function groups in P. chrysosporium. • Maximum recovery of the Cd(II)-laden PPBs after reuse three times was 98.9%. - Abstract: A novel biosorbent, polyvinyl alcohol (PVA)-immobilized Phanerochaete chrysosporium, was applied to the bioremediation of composite-polluted wastewater, containing both cadmium and 2,4-dichlorophenol (2,4-DCP). The optimum removal efficiency achieved was 78% for Cd(II) and 95.4% for 2,4-DCP at initial concentrations of 20 mg/L Cd(II) and 40 mg/L 2,4-DCP. PPBs had significantly enhanced the resistance of P. chrysosporium to 2,4-DCP, leading to the degradation rates of 2,4-DCP beyond 90% with varying initial 2,4-DCP concentrations. This research demonstrated that 2,4-DCP and secreted proteins might be used as carbon and nitrogen sources by PVA-immobilized P. chrysosporium beads (PPBs) for Cd(II) removal. Fourier transform infrared spectroscopy analysis showed that hydroxyl and carboxyl groups on the surface of PPBs were dominant in Cd(II) binding. The mechanism underlying the degradation of 2,4-DCP into fumaric acid and 1-hexanol was investigated. The adsorption–desorption studies indicated that PPBs kept up to 98.9% of desorption efficiency over three cycles.
International Nuclear Information System (INIS)
Huang, Zhenzhen; Chen, Guiqiu; Zeng, Guangming; Chen, Anwei; Zuo, Yanan; Guo, Zhi; Tan, Qiong; Song, Zhongxian; Niu, Qiuya
2015-01-01
Graphical abstract: Schematic diagram of polyvinyl alcohol-immobilized Phanerochaete chrysosporium beads (PPBs) for Cd(II) removal and 2,4-DCP degradation. - Highlights: • PVA-immobilized P. chrysosporium beads (PPBs) were fit for wastewater treatment. • Removal rates of Cd(II) and 2,4-DCP at optimum conditions were up to 78% and 95.4%. • 2,4-DCP removal rates were beyond 90% with varying initial 2,4-DCP concentrations. • PVA was vital to Cd(II) removal besides the function groups in P. chrysosporium. • Maximum recovery of the Cd(II)-laden PPBs after reuse three times was 98.9%. - Abstract: A novel biosorbent, polyvinyl alcohol (PVA)-immobilized Phanerochaete chrysosporium, was applied to the bioremediation of composite-polluted wastewater, containing both cadmium and 2,4-dichlorophenol (2,4-DCP). The optimum removal efficiency achieved was 78% for Cd(II) and 95.4% for 2,4-DCP at initial concentrations of 20 mg/L Cd(II) and 40 mg/L 2,4-DCP. PPBs had significantly enhanced the resistance of P. chrysosporium to 2,4-DCP, leading to the degradation rates of 2,4-DCP beyond 90% with varying initial 2,4-DCP concentrations. This research demonstrated that 2,4-DCP and secreted proteins might be used as carbon and nitrogen sources by PVA-immobilized P. chrysosporium beads (PPBs) for Cd(II) removal. Fourier transform infrared spectroscopy analysis showed that hydroxyl and carboxyl groups on the surface of PPBs were dominant in Cd(II) binding. The mechanism underlying the degradation of 2,4-DCP into fumaric acid and 1-hexanol was investigated. The adsorption–desorption studies indicated that PPBs kept up to 98.9% of desorption efficiency over three cycles
Effects of selenium oxyanions on the white-rot fungus Phanerochaete chrysosporium
Espinosa-Ortiz, Erika J.
2014-10-24
The ability of Phanerochaete chrysosporium to reduce the oxidized forms of selenium, selenate and selenite, and their effects on the growth, substrate consumption rate, and pellet morphology of the fungus were assessed. The effect of different operational parameters (pH, glucose, and selenium concentration) on the response of P. chrysosporium to selenium oxyanions was explored as well. This fungal species showed a high sensitivity to selenium, particularly selenite, which inhibited the fungal growth and substrate consumption when supplied at 10 mg L−1 in the growth medium, whereas selenate did not have such a strong influence on the fungus. Biological removal of selenite was achieved under semi-acidic conditions (pH 4.5) with about 40 % removal efficiency, whereas less than 10 % selenium removal was achieved for incubations with selenate. P. chrysosporium was found to be a selenium-reducing organism, capable of synthesizing elemental selenium from selenite but not from selenate. Analysis with transmission electron microscopy, electron energy loss spectroscopy, and a 3D reconstruction showed that elemental selenium was produced intracellularly as nanoparticles in the range of 30–400 nm. Furthermore, selenite influenced the pellet morphology of P. chrysosporium by reducing the size of the fungal pellets and inducing their compaction and smoothness.
Shimizu, Motoyuki; Yuda, Naoki; Nakamura, Tomofumi; Tanaka, Hiroo; Wariishi, Hiroyuki
2005-10-01
A proteomic differential display technique was utilized to study cellular responses of Phanerochaete chrysosporium exposed to vanillin, one of the key intermediates found during lignin biodegradation. Intracellular proteins were resolved by 2-DE and target protein spots were identified using MALDI-MS after in-gel tryptic digestions. Upon addition of vanillin to P. chrysosporium, up-regulation of homogentisate 1,2-dioxygenase, 1,4-benzoquinone reductases, aldehyde dehydrogenase, and aryl-alcohol dehydrogenase, which seem to play roles in vanillin metabolism, was observed. Furthermore, enzymes involved in glycolysis, the tricarboxylic acid cycle, the pentose-phosphate cycle, and heme biosynthesis were also activated. Up-regulation of extracellular peroxidase was also observed. One of the most unique phenomena against exogenous vanillin was a switch from the glyoxylate cycle to the tricarboxylic acid cycle, where a drastic increase in isocitrate dehydrogenase activity was observed. The exogenous addition of other aromatic compounds also caused an increase in its activity, which in turn triggered NAD(P)H production via the action of dehydrogenases in the tricarboxylic acid cycle, heme biosynthesis via the action of aminolevulinic acid synthase on succinyl-CoA, and energy production via activation of the mitochondrial electron transfer system. These metabolic shifts seem to be required for activating a metabolic system for aromatic compounds.
Premsagar Korripally; Christopher G. Hunt; Carl J. Houtman; Don C. Jones; Peter J. Kitin; Dan Cullen; Kenneth E. Hammel; A. A. Brakhage
2015-01-01
Since uncertainty remains about how white rot fungi oxidize and degrade lignin in wood, it would be useful to monitor changes in fungal gene expression during the onset of ligninolysis on a natural substrate. We grew Phanerochaete chrysosporium on solid spruce wood and included oxidant-sensing beads bearing the fluorometric dye BODIPY 581/591 in...
Anak Ngadin , Andrew
2011-01-01
Phanerochaete chrysosporium is a ligninolytic fungus widely studied because of its capacities to degrade wood and xenobiotics through an extracellular enzymatic system. Its genome has been sequenced and has provided researchers with a complete inventory of the predicted proteins produced by this organism. This has allowed the description of many protein superfamilies. Among them, Glutathione S-transferases (GSTs) constitute a complex and widespread superfamily classified as enzymes of seconda...
Xu, Piao; Lai, Cui; Zeng, Guangming; Huang, Danlian; Chen, Ming; Song, Biao; Peng, Xin; Wan, Jia; Hu, Liang; Duan, Abing; Tang, Wangwang
2018-02-01
Composting is identified as an effective approach for solid waste disposal. The bioremediation of 4-nonylphenol (4NP) and cadmium (Cd) co-contaminated sediment was investigated by composting with Phanerochaete chrysosporium (P. chrysosporium) inocula. P. chrysosporium inocula and proper C/N ratios (25.51) accelerated the composting process accompanied with faster total organic carbon loss, 4NP degradation and Cd passivation. Microbiological analysis demonstrated that elevated activities of lignocellulolytic enzymes and sediment enzymes was conducive to organic chemical transformation. Bacterial community diversity results illustrated that Firmicutes and Proteobacteria were predominant species during the whole composting process. Aerobic cellulolytic bacteria and organic degrading species played significant roles. Toxicity characteristic leaching procedure (TCLP) extraction and germination indices results indicated the efficient detoxification of 4NP and Cd co-contaminated sediment after 120 days of composting. Overall, results demonstrated that P. chrysosporium enhanced composting was available for the bioremediation of 4NP and Cd co-contaminated sediment. Copyright © 2017 Elsevier Ltd. All rights reserved.
Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten
2004-01-01
Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...
International Nuclear Information System (INIS)
Kennedy, D.W.; Aust, S.D.; Bumpus, J.A.
1990-01-01
The ability of Phanerochaete chrysosporium to degrade six alkyl halide insecticides (aldrin, dieldrin, heptachlor, chlordane, lindane, and mirex) in liquid and soil-corncob matrices was compared by using 14 C-labeled compounds. Of these, only [ 14 C]lindane and [ 14 C]chlordane underwent extensive biodegradation, as evidenced by the fact that 9.4 to 23.4% of these compounds were degraded to 14 CO 2 in 30 days in liquid cultures and 60 days in soil-corncob cultures inoculated with P. chrysosporium. Although [ 14 C]aldrin, [ 14 C]dieldrin, [ 14 C]heptachlor, and [14D]mirex were poorly mineralized, substantial bioconversion occurred, as determined by substrate disappearance and metabolite formation. Nonbiological disappearance was observed only with chlordane and heptachlor
Extensive biodegradation of 1,1,1-trichloro-2,2-bis(4-chlorophenyl)ethane (DDT) by the white rot fungus Phanerochaete chrysosporium was demonstrated by disappearance and mineralization of [14C]DDT in nutrient nitrogen-deficient cultures. Mass balance studies demonstrated the form...
ABILITY OF Phanerochaete chrysosporium AND Trametes versicolor TO REMOVE Zn2+, Cr3+, Pb2+ METAL IONS
Directory of Open Access Journals (Sweden)
Josué Solís Pacheco
2015-07-01
Full Text Available The use of fungal biomass as an alternative for removing heavy metals has become increasingly important in recent years, replacing conventional methods based on chemical physical processes. In this study, we evaluated the biosorption of Zn2+, Cr3+ and Pb2+, which were analyzed to determine their effect on growth kinetic parameters of Phanerochaete chrysosporium strain ATCC 32629 and Trametes versicolor ATCC 1267. Growth kinetics were performed in four liquid culture media: 1 Yeast Nitrogen Base (YNB used as control, 2 YNB medium plus Pb2+ (0.25, 1 and 2 mg L-1, 3 YNB medium plus Zn2+ (5, 10 and 20 mg L-1 and 4 YNB medium plus Cr3+ (0.5, 1 and 2 mg L-1. The flasks were incubated at 25 °C with shaking at 150 rpm. Metal concentrations were determined by inductively coupled plasma atomic emission spectroscopy (ICP-AES with prior acid digestion of the sample. The results demonstrated that Phanerochaete chrysosporium ATCC 32629 and Trametes versicolor ATCC 12679 are able to grow in the culture medium with Pb2+, Zn2+ and Cr3+ ions at different concentrations. However, P. chrysosporium ATCC 32629 showed greater adaptability and ability to adsorb Cr3+ in the culture medium at concentrations of 0.5 and 1 mg L-1, whereas T. versicolor ATCC 12679 was capable of Pb2+ biosorption at concentrations of 0.25, 1 and 2 mg L-1.
DEFF Research Database (Denmark)
Manavalan, Arulmani
2006-01-01
Phanerochaete chrysosporium NCIM 1197 constitutively secretes considerable level of extracellular enzyme laccase in defined growth medium. Effect of several inducers on laccase production was attempted and found that copper sulphate alone at 30 mM concentration accelerate the laccase production...
Effect of peat extract on the hydrolytic enzymes of Phanerochaete chrysosporium
Energy Technology Data Exchange (ETDEWEB)
Nawaz, M; Gunasekaran, M
1988-08-01
Peat, a partially decomposed plant material rich in minerals and lignocellulose was tested as a substrate for the growth and production of hydrolytic enzymes viz. cellulase, cellobiase and xylanase in Phanerochaete chrysosporium. Three types of peat extracts such as cold, hot water and autoclaved were prepared and tested. Among them, autoclaved extract supported the maximal growth. The intracellular enzyme activities peaked on the fifth day after inoculation irrespective of the media and enzyme tested. Addition of cellobiose and lactose in the medium induced the production of cellulase, xylanase and to a lesser extent cellobiase. Addition of glucose and sucrose to the media resulted in the suppression of all the extracellular enzymes tested. 18 refs., 5 figs.
International Nuclear Information System (INIS)
De, Supriyo; Perkins, Michael; Dutta, Sisir K.
2006-01-01
Polychlorobiphenyl (PCB) degradation usually occurs through reductive dechlorination under anaerobic conditions and phenolic ring cleavage under aerobic conditions. In this paper, we provide evidence of nitrate reductase (NaR) mediated dechlorination of hexachlorobiphenyl (PCB-153) in Phanerochaete chrysosporium under non-ligninolytic condition and the gene involved. The NaR enzyme and its cofactor, molybdenum (Mo), were found to mediate reductive dechlorination of PCBs even in aerobic condition. Tungsten (W), a competitive inhibitor of this enzyme, was found to suppress this dechlorination. Chlorine release assay provided further evidence of this nitrate reductase mediated dechlorination. Commercially available pure NaR enzyme from Aspergillus was used to confirm these results. Through homology search using TBLASTN program, NaR gene was identified, primers were designed and the RT-PCR product was sequenced. The NaR gene was then annotated in the P. chrysosporium genome (GenBank accession no. AY700576). This is the first report regarding the presence of nitrate reductase gene in this fungus with the explanation why this fungus can dechlorinate PCBs even in aerobic condition. These fungal inoculums are used commercially as pellets in sawdust for enhanced bioremediation of PCBs at the risk of depleting soil nitrates. Hence, the addition of nitrates to the pellets will reduce this risk as well as enhance its activity
Kavakcıoğlu, Berna; Tongul, Burcu; Tarhan, Leman
2017-03-01
In the present work, the partitioning behavior of menadione-induced superoxide dismutase (SOD; EC 1.15.1.1), an antioxidant enzyme that has various applications in the medical and cosmetic industries, from the white rot fungus Phanerochaete chrysosporium has been characterized on different types of aqueous two-phase systems (ATPSs) (poly(ethylene glycol)/polypropylene glycol (PEG/PPG)-dextran, PEG-salt and PPG-salt). PEG-salt combinations were found most optimal systems for the purification of SOD. The best partition conditions were found using the PEG-3350 24% and K 2 HPO 4 5% (w/w) with pH 7.0 at 25 °C. The partition coefficient of total SOD activity and total protein concentration observed in this system were 0.17 and 6.65, respectively, with the recovery percentage as 78.90% in the bottom phase and 13.17% in the top phase. The highest purification fold for SOD from P. chrysosporium was found as 6.04 in the bottom phase of PEG 3350%24 - K 2 HPO 4 %5 (w/w) system with pH 7.0. SOD purified from P. chrysosporium was determined to be a homodimer in its native state with a molecular weight of 60 ± 4 kDa. Consequently, simple and only one step PEG-salt ATPS system was developed for SOD purification from P. chrysosporium.
The lignin degrading system of the white rot fungus Phanerochaete chrysosporium is able to degrade a wide variety of structurally diverse organopollutants to carbon dioxide. Current research is focused on ways to increase or optimize rates of biodegradation in order to a...
Miranda, Rita de Cássia M de; Gomes, Edelvio de Barros; Pereira, Nei; Marin-Morales, Maria Aparecida; Machado, Katia Maria Gomes; Gusmão, Norma Buarque de
2013-08-01
Investigations on biodegradation of textile effluent by filamentous fungi strains Curvularia lunata URM 6179 and Phanerochaete chrysosporium URM 6181 were performed in static bioreactors under aerated and non-aerated conditions. Spectrophotometric, HPLC/UV and LC-MS/MS analysis were performed as for to confirm, respectively, decolourisation, biodegradation and identity of compounds in the effluent. Enzymatic assays revealed higher production of enzymes laccase (Lac), lignin peroxidase (LiP) and manganese-dependent peroxidase (MnP) by P. chrysosporium URM 6181 in aerated bioreactor (2020; 39 and 392 U/l, respectively). Both strains decolourised completely the effluent after ten days and biodegradation of the most predominant indigo dye was superior in aerated bioreactor (96%). Effluent treated by P. chrysosporium URM 6181 accumulated a mutagenic metabolite derived from indigo. The C. lunata URM 6179 strain, showed to be more successful for assure the environmental quality of treated effluent. These systems were found very effective for efficient fungal treatment of textile effluent. Copyright © 2013 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Chen, Anwei; Zeng, Guangming; Chen, Guiqiu; Fan, Jiaqi; Zou, Zhengjun; Li, Hui; Hu, Xinjiang; Long, Fei [Hunan Univ., Changsha (China). College of Environmental Science and Engineering; Ministry of Education, Changsha (CN). Key Lab. of Environmental Biology and Pollution Control (Hunan Univ.)
2011-08-15
Phanerochaete chrysosporium has been recognised as an effective bioremediation agent due to its unique degradation to xenobiotic and biosorption ability to heavy metals. However, few studies have focused on the simultaneous removal of heavy metals and organic pollutants. The aim of this work was to study the feasibility of simultaneous cadmium removal and 2,4-dichlorophenol (2,4-DCP) degradation in P. chrysosporium liquid cultures. The removal efficiencies were pH dependent and the maximum removal efficiencies were observed at pH 6.5 under an initial cadmium concentration of 5 mg/L and an initial 2,4-DCP concentration of 20 mg/L. The removal efficiencies for cadmium and 2,4-DCP reached 63.62% and 83.90%, respectively, under the optimum conditions. The high production levels of lignin peroxidase (7.35 U/mL) and manganese peroxidase (8.30 U/mL) resulted in an increase in 2,4-DCP degradation. The protein content decreased with increasing cadmium concentration. The surface characteristics and functional groups of the biomass were studied by scanning electron microscopy and a Fourier-transformed infrared spectrometer. The results showed that the use of P. chrysosporium is promising for the simultaneous removal of cadmium and 2,4-DCP from liquid media. (orig.)
Anak-Ngadin, Andrew
2011-01-01
Phanerochaete chrysosporium est un champignon ligninolytique largement étudié pour ses capacités à dégrader la lignine et certains xénobiotiques grâce à un important système d'enzymes extracellulaires. Son génome est entièrement séquencé et constitue un inventaire de séquences protéiques prédites qui a permis la description de nombreuses superfamilles de protéines. Parmi elles, les Glutathion S-transférases sont essentiellement impliquées dans le métabolisme secondaire du champignon. Cependan...
Ligninolytic system of Phanerochaete chrysosporium: inhibition by o-phthalate
Energy Technology Data Exchange (ETDEWEB)
Fenn, P.; Kirk, T.K.
1979-01-01
The degradation rate of (synthetic/sup 14/C)-lignin to /sup 14/CO/sub 2/ by Phanerochaete chrysosporium in cultures buffered with 0.01 M 2,2-dimethylsuccinate (DMS) was twice that in 0.01 M o-phthalate-buffered cultures. This difference could be totally accounted for by o-phthalate inhibition of the activity of the ligninolytic system. /sup 14/CO/sub 2/ production from ring-, sidechain-, and methoyxl-labled lignins was inhibited, the degree of inhibition being dependent on o-phthalate concentration. Oxidations of /sup 14/C-glucose, /sup 14/C-acetovanillone, and /sup 14/C-apocynol were not inhibited; thus o-phthalate is not a general inhibitor, and might inhibit activities involved in attach of the lignin polymer. DMS is a suitable buffer for the ligninolytic system. Degradation rates of ring-labeled lignin to /sup 14/CO/sub 2/ of 10 to 15% in 24 h were obtained consistently over the pH range 3.6 to 4.5, with an optimum near pH 4.0.
Faraco, V; Pezzella, C; Miele, A; Giardina, P; Sannia, G
2009-04-01
The effect of Phanerochaete chrysosporium and Pleurotus ostreatus whole cells and their ligninolytic enzymes on models of colored industrial wastewaters was evaluated. Models of acid, direct and reactive dye wastewaters from textile industry have been defined on the basis of discharged amounts, economic relevance and representativeness of chemical structures of the contained dyes. Phanerochaete chrysosporium provided an effective decolourization of direct dye wastewater model, reaching about 45% decolourization in only 1 day of treatment, and about 90% decolourization within 7 days, whilst P. ostreatus was able to decolorize and detoxify acid dye wastewater model providing 40% decolourization in only 1 day, and 60% in 7 days. P. ostreatus growth conditions that induce laccase production (up to 130,000 U/l) were identified, and extra-cellular enzyme mixtures, with known laccase isoenzyme composition, were produced and used in wastewater models decolourization. The mixtures decolorized and detoxified the acid dye wastewater model, suggesting laccases as the main agents of wastewater decolourization by P. ostreatus. A laccase mixture was immobilized by entrapment in Cu-alginate beads, and the immobilized enzymes were shown to be effective in batch decolourization, even after 15 stepwise additions of dye for a total exposure of about 1 month.
Khiyami, Mohammad A; Pometto, Anthony L; Brown, Robert C
2005-04-20
Phanerochaete chrysosporium (ATCC 24725) shake flask culture with 3 mM veratryl alcohol addition on day 3 was able to grow and detoxify different concentrations of diluted corn stover (Dcs) and diluted corn starch (Dst) pyrolysis liquors [10, 25, and 50% (v/v)] in defined media. GC-MS analysis of reaction products showed a decrease and change in some compounds. In addition, the total phenolic assay with Dcs samples demonstrated a decrease in the phenolic compounds. A bioassay employing Lactobacillus casei growth and lactic acid production was developed to confirm the removal of toxic compounds from 10 and 25% (v/v) Dcs and Dst by the lignolytic enzymes, but not from 50% (v/v) Dcs and Dst. The removal did not occur when sodium azide or cycloheximide was added to Ph. chrysosporium culture media, confirming the participation of lignolytic enzymes in the detoxification process. A concentrated enzyme preparation decreased the phenolic compounds in 10% (v/v) corn stover and corn starch pyrolysis liquors to the same extent as the fungal cultures.
Directory of Open Access Journals (Sweden)
Jaqueline da Silva Coelho-Moreira
2013-01-01
Full Text Available The white-rot fungus Phanerochaete chrysosporium was investigated for its capacity to degrade the herbicide diuron in liquid stationary cultures. The presence of diuron increased the production of lignin peroxidase in relation to control cultures but only barely affected the production of manganese peroxidase. The herbicide at the concentration of 7 μg/mL did not cause any reduction in the biomass production and it was almost completely removed after 10 days. Concomitantly with the removal of diuron, two metabolites, DCPMU [1-(3,4-dichlorophenyl-3-methylurea] and DCPU [(3,4-dichlorophenylurea], were detected in the culture medium at the concentrations of 0.74 μg/mL and 0.06 μg/mL, respectively. Crude extracellular ligninolytic enzymes were not efficient in the in vitro degradation of diuron. In addition, 1-aminobenzotriazole (ABT, a cytochrome P450 inhibitor, significantly inhibited both diuron degradation and metabolites production. Significant reduction in the toxicity evaluated by the Lactuca sativa L. bioassay was observed in the cultures after 10 days of cultivation. In conclusion, P. chrysosporium can efficiently metabolize diuron without the accumulation of toxic products.
Coelho-Moreira, Jaqueline da Silva; Bracht, Adelar; de Souza, Aline Cristine da Silva; Oliveira, Roselene Ferreira; de Sá-Nakanishi, Anacharis Babeto; de Souza, Cristina Giatti Marques; Peralta, Rosane Marina
2013-01-01
The white-rot fungus Phanerochaete chrysosporium was investigated for its capacity to degrade the herbicide diuron in liquid stationary cultures. The presence of diuron increased the production of lignin peroxidase in relation to control cultures but only barely affected the production of manganese peroxidase. The herbicide at the concentration of 7 μ g/mL did not cause any reduction in the biomass production and it was almost completely removed after 10 days. Concomitantly with the removal of diuron, two metabolites, DCPMU [1-(3,4-dichlorophenyl)-3-methylurea] and DCPU [(3,4-dichlorophenyl)urea], were detected in the culture medium at the concentrations of 0.74 μ g/mL and 0.06 μ g/mL, respectively. Crude extracellular ligninolytic enzymes were not efficient in the in vitro degradation of diuron. In addition, 1-aminobenzotriazole (ABT), a cytochrome P450 inhibitor, significantly inhibited both diuron degradation and metabolites production. Significant reduction in the toxicity evaluated by the Lactuca sativa L. bioassay was observed in the cultures after 10 days of cultivation. In conclusion, P. chrysosporium can efficiently metabolize diuron without the accumulation of toxic products.
Degradation of wheat straw cell wall by white rot fungi Phanerochaete chrysosporium
Zeng, Jijiao
The main aim of this dissertation research was to understand the natural microbial degradation process of lignocellulosic materials in order to develop a new, green and more effective pretreatment technology for bio-fuel production. The biodegradation of wheat straw by white rot fungi Phanerochaete chrysosporium was investigated. The addition of nutrients significantly improved the performance of P.chrysosporium on wheat straw degradation. The proteomic analysis indicated that this fungus produced various pepetides related to cellulose and lignin degradation while grown on the biomass. The structural analysis of lignin further showed that P.chrysosporium preferentially degraded hydroxycinnamtes in order to access cellulose. In details, the effects of carbon resource and metabolic pathway regulating compounds on manganeses peroxidase (MnP) were studied. The results indicated that MnP activity of 4.7 +/- 0.31 U mL-1 was obtained using mannose as a carbon source. The enzyme productivity further reached 7.36 +/- 0.05 U mL-1 and 8.77 +/- 0.23 U mL -1 when the mannose medium was supplemented with cyclic adenosine monophosphate (cAMP) and S-adenosylmethionine (SAM) respectively, revealing highest MnP productivity obtained by optimizing the carbon sources and supplementation with small molecules. In addition, the effects of nutrient additives for improving biological pretreatment of lignocellulosic biomass were studied. The pretreatment of wheat straw supplemented with inorganic salts (salts group) and tween 80 was examined. The extra nutrient significantly improved the ligninase expression leading to improve digestibility of lignocellulosic biomass. Among the solid state fermentation groups, salts group resulted in a substantial degradation of wheat straw within one week, along with the highest lignin loss (25 %) and ˜ 250% higher efficiency for the total sugar release through enzymatic hydrolysis. The results were correlated with pyrolysis GC-MS (Py
International Nuclear Information System (INIS)
Jimenez T, Gloria Alicia; Mejia G, Amanda I; Lopez O, Betty Lucy
1999-01-01
The activity of the ligninolytic enzymes, lignin peroxidase (LiP), manganese peroxidase (MnP) and Laccase, in submerged cultures of Phanerochaete chrysosporium, with limited amounts of carbon and nitrogen, were affected by the addition of Mn+2. In cultures with o and 1,25 ppm of Mn+2, only the lip was detected and its higher activity level was observed in the cultures with 1.25 ppm of Mn+2. The cultures with 40 ppm of Mn+2 showed activities of lip, MnP and Laccase. The presence of the three enzymes in the same culture had not been reported and it is of great importance because is shows that the fungus and its lignolitic machinery can act sequentially
Aiken, B S; Logan, B E
1996-06-01
Removal and degradation of pentachlorophenol (PCP) by Phanerochaete chrysosporium in static flask cultures was studied using ammonium lignosulphonates (LS), a waste product of the papermill industry, as a carbon and nitrogen source. After 3 days, cultures of P. chrysosporium grown in either a 2% LS (nitrogen-sufficient) medium or a 0.23% LS and 2% glucose (nitrogen-deficient) medium removed 72 to 75% of PCP, slightly less than the 95% removal seen using nitrogen-deficient glucose and ammonia medium. PCP dehalogenation occurred despite the fact that extracellular enzyme (LiP) activity, measured by a veratryl alcohol oxidation assay and by PCP disappearance in cell-free extracts, was inhibited by LS. This inactivation of LiP likely contributed to the lower percent of PCP dehalogenation observed using the LS media. In order to better understand the relationship between PCP disappearance and dehalogenation, we measured the fate of the chlorine in PCP. After 13 days, only 1.8% of the initial PCP added was recoverable as PCP. The remainder of the PCP was either mineralized or transformed to breakdown intermediates collectively identified as organic halides. The largest fraction of the original chlorine (58%) was recovered as organic (non-PCP) halide, most of which (73%) was associated with the cell mass. Of the remaining chlorine, 40% was released as chloride ion, indicating a level of dehalogenation in agreement with previously reported values.
Directory of Open Access Journals (Sweden)
Margarita María Lopera Mesa
2005-01-01
Full Text Available Se evaluó la degradación del insecticida clorpirifos en muestras de suelo durante 21 días, utilizando el hongo Phanerochaete chrysosporium. En los ensayos se obtuvieron porcentajes de degradación, en promedio, para las muestras con hongo, de 96,3, 82,4 y 62,2% cuando se trabajaron, respectivamente, con concentraciones iniciales de clorpirifos de 0,95, 5,3 y 9,4 µg/g. Igualmente, los porcentajes de degradación estuvieron acompañados del aumento en la velocidad de degradación, cuando se partió de la concentración inicial de 0,95 µg/g.
Liu, Shan; Wu, Shubiao; Pang, Changle; Li, Wei; Dong, Renjie
2014-02-01
The microbial pretreatment of corn stover and corn stover silage was achieved via the solid-state cultivation of Phanerochaete chrysosporium; pretreatment effects on the biodegradability and subsequent anaerobic production of biogas were investigated. The peak levels of daily biogas production and CH₄ yield from corn stover silage were approximately twice that of corn stover. Results suggested that ensiling was a potential pretreatment method to stimulate biogas production from corn stover. Surface morphology and Fourier-transform infrared spectroscopy analyses demonstrated that the microbial pretreatment of corn stover silage improved biogas production by 10.5 to 19.7% and CH4 yield by 11.7 to 21.2% because pretreatment could decrease dry mass loss (14.2%) and increase substrate biodegradability (19.9% cellulose, 32.4% hemicellulose, and 22.6% lignin). By contrast, the higher dry mass loss in corn stover (55.3%) after microbial pretreatment was accompanied by 54.7% cellulose, 64.0% hemicellulose, and 61.1% lignin degradation but did not significantly influence biogas production.
Kavakçıoğlu, Berna; Tarhan, Leman
2014-10-01
In this study, in vitro and in vivo effects of some commonly used fungicides, antibiotics, and various chemicals on isolated and purified catalase from Phanerochaete chrysosporium were investigated. The catalase was purified 129.10-fold by using 60% ammonium sulfate and 60% ethanol precipitations, DEAE-cellulose anion exchange and Sephacryl-S-200 gel filtration chromatographies from P. chrysosporium growth in carbon- and nitrogen-limited medium for 12 days. The molecular weight of native purified catalase from P. chrysosporium was found to be 290 ± 10 kDa, and sodium dodecyl sulfate (SDS)-PAGE results indicated that enzyme consisted of four apparently identical subunits, with a molecular weight of 72.5 ± 2.5 kDa. Kinetic characterization studies showed that optimum pH and temperature, Km and Vmax values of the purified catalase which were stable in basic region and at comparatively high temperatures were 7.5, 30°C, 289.86 mM, and 250,000 U/mg, respectively. The activity of purified catalase from P. chrysosporium was significantly inhibited by dithiothreitol (DTT), 2-mercaptoethanol, iodoacetamide, EDTA, and sodium dodecyl sulfate (SDS). It was found that while antibiotics had no inhibitory effects, 45 ppm benomyl, 144 ppm captan, and 47.5 ppm chlorothalonil caused 14.52, 10.82, and 38.86% inhibition of purified catalase, respectively. The inhibition types of these three fungicides were found to be non-competitive inhibition with the Ki values of 1.158, 0.638, and 0.145 mM and IC50 values of 0.573, 0.158, 0.010 mM, respectively. The results of in vivo experiments also showed that benomyl, captan and chlorothalonil caused 15.25, 1.96, and 36.70% activity decreases after 24-h treatments compared to that of the control.
Biodegradation of TNT (2,4,6-Trinitrotoluene) by Phanerochaete chrysosporium
International Nuclear Information System (INIS)
Fernando, T.; Bumpus, J.A.; Aust, S.D.
1990-01-01
Extensive biodegradation of TNT (2,4,6-trinitrotoluene) by the white rot fungus Phanerochaete chrysosporium was observed. At an initial concentration of 1.3 mg/liter, 35.4 ± 3.6% of the [ 14 C]TNT was degraded to 14 CO 2 in 18 days. The addition of glucose 12 days after the addition of TNT did not stimulate mineralization, and, after 18 days of incubation with TNT only, about 3.3% of the initial TNT could be recovered. Mineralization of [ 14 C]TNT absorbed on soil was also examined. Ground corncobs served as the nutrient for slow but sustained degradation of [ 14 C]TNT to 14 CO 2 such that 6.3 ± 0.6% of the [ 14 C]TNT initially present was converted to 14 CO 2 during the 30-day incubation period. Mass balance analysis of liquid cultures and of soil-corncob cultures revealed that polar [ 14 C]TNT metabolites are formed in both systems, and high-performance liquid chromatography analyses revealed that less then 5% of the radioactivity remained as undegraded [ 14 C]TNT following incubation with the fungus in soil and liquid cultures. When the concentration of TNT in cultures (both liquid and soil) was adjusted to contamination levels that might be found in the environment, i.e., 10,000 mg/kg in soil and 100 mg/liter in water, mineralization studies showed that 18.4 ± 2.9% and 19.6 ± 3.5% of the initial TNT was converted to 14 CO 2 in 90 days in soil and liquid cultures, respectively. In both cases (90 days in water at 100 mg/liter and in soil at 10,000 mg/kg) approximately 85% of the TNT was degraded. These results suggest that this fungus may be useful for the decontamination of sites in the environment contaminated with TNT
Bio-softening of mature coconut husk for facile coir recovery.
Suganya, D S; Pradeep, S; Jayapriya, J; Subramanian, S
2007-06-01
Bio-softening of the mature coconut husk using Basidiomyceteous fungi was attempted to recover the soft and whiter fibers. The process was faster and more efficient in degrading lignin and toxic phenolics. Phanerochaete chrysosporium, Pleurotus eryngii and Ceriporiopsis subvermispora were found to degrade lignin efficiently without any appreciable loss of cellulose, yielding good quality fiber ideal for dyeing.
Components of the ligninolytic system of Fusarium oxysporum and Trichoderma atroviride
Energy Technology Data Exchange (ETDEWEB)
Moenkemann, H.; Hoelker, U.; Hoefer, M. [Universitaet Bonn, Bonn (Germany). Botanisches Institut
1997-11-01
The ligninolytic system in the two deuteromycetous fungi Fusarium oxysporum and Trichoderma atroviride, which are able to solubilize low-rank coal, has been proved to have several components. Analysis of the chromosomal DNA of these fungi revealed distinct bands with probes coding for three ligninase isoenzymes, glyoxal oxidase and arylalcohol dehydrogenase of the basidiomycete Phanerochaete chrysosporium. These data constitute a strong indication for the existence in F. oxysporum and T. atroviride of a ligninolytic system comparable to that in P. chrysosporium that may be involved in the process of coal solubilization. 11 refs., 3 figs.
Directory of Open Access Journals (Sweden)
Bjørge Westereng
Full Text Available Many fungi growing on plant biomass produce proteins currently classified as glycoside hydrolase family 61 (GH61, some of which are known to act synergistically with cellulases. In this study we show that PcGH61D, the gene product of an open reading frame in the genome of Phanerochaete chrysosporium, is an enzyme that cleaves cellulose using a metal-dependent oxidative mechanism that leads to generation of aldonic acids. The activity of this enzyme and its beneficial effect on the efficiency of classical cellulases are stimulated by the presence of electron donors. Experiments with reduced cellulose confirmed the oxidative nature of the reaction catalyzed by PcGH61D and indicated that the enzyme may be capable of penetrating into the substrate. Considering the abundance of GH61-encoding genes in fungi and genes encoding their functional bacterial homologues currently classified as carbohydrate binding modules family 33 (CBM33, this enzyme activity is likely to turn out as a major determinant of microbial biomass-degrading efficiency.
International Nuclear Information System (INIS)
Pometto, A.L. III; Crawford, D.L.
1986-01-01
Degradation of ground and hot-water-extracted corn stover (Zea mays) lignocellulose by Streptomyces viridosporus T7A generates a water-soluble lignin degradation intermediate termed acid-precipitable polymeric lignin (APPL). The further catabolism of T7A-APPL by S. viridosporus T7A, S. badius 252, and S. setonii75Vi2 was followed for 3 weeks. APPL catabolism by Phanerochaete chrysosporium was followed in stationary cultures in a low-nitrogen medium containing 1% (wt/vol) glucose and 0.05% (wt/vol) T7A-APPL. Metabolism of the APPL was followed by turbidometric assay (600 nm) and by direct measurement of APPL recoverable from the medium. Accumulation and disappearance of soluble low-molecular-weight products of APPL catabolism were followed by gas-liquid chromatography and by high-pressure liquid chromatography, utilizing a diode array detector. Mineralization of a [ 14 C-lignin]APPL was also followed. The percent 14 C recovered as 14 CO 2 , 14 C-APPL, 14 C-labeled water-soluble products, and cell mass-associated radioactivity, were determined for each microorganism after 1 and 3 weeks of incubation in bubbler tube cultures at 37 0 C. P. chrysosporium evolved the most 14 CO 2 , and S. viridosporus gave the greatest decrease in recoverable 14 C-APPL. The results show that S. badius was not able to significantly degrade the APPL, while the other microorganisms demonstrated various APPL-degrading abilities
International Nuclear Information System (INIS)
McFarland, M.J.; Xiu J, Qiu; Aprill, W.A.; Sims, R.C.
1990-01-01
Environmental enrichment of the white rot fungus Phanerochaete chrysosporium in biological compost soil reactors was effective in enhancing the rates of Benzo(a)pyrene removal over that observed under natural soil conditions. In contaminated soil compost systems amended with fungal inoculum and primary substrate, maximum Benzo(a)pyrene removal rates of 0.31 mg B(a)p/kg compost material-day (0.25 mgB(a)p/kg soil-day) were observed while in unamended soil conditions, maximum removal rates of 0.13 mg B(a)p/kg soil-day were recorded. Additions of primary substrate without any fungal inoculum gave compound removal rates similar to soil only conditions (i.e., 14 mg B(a)p/kg soil-day). Differences in contaminant and radioactivity ( 14 C) removal rates indicated that Benzo(a)pyrene derived carbon was being incorporated into nonvolatile materials within the compost environment. Contaminated soil pH had a significant effect on Benzo(a)pyrene removal rates during composting treatment. With acid soils (pH-4.8), a maximum Benzo(a)pyrene removal rate of 0.11 mg B(a)p/kg compost material-day was determined compared to 0.31 mg B(a)p/kg compost material-day in alkaline (pH-8.0) soil. Oxygen availability appeared to be one of the most important process variables influencing both fungal growth and Benzo(a)pyrene removal. Periodic pulses of oxygen equivalent to a three volume turnover of reactor headspace every three days resulted in increasing the Benzo(a)pyrene removal rate from 0.31 mg B(a)p/kg compost material-day to 0.85 mg B(a)p/kg compost material day
Energy Technology Data Exchange (ETDEWEB)
Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.
2014-03-14
Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.
International Nuclear Information System (INIS)
Zuo, Yanan; Chen, Guiqiu; Zeng, Guangming; Li, Zhongwu; Yan, Ming; Chen, Anwei; Guo, Zhi; Huang, Zhenzhen; Tan, Qiong
2015-01-01
Highlights: • Appropriate concentration of AgNPs can stimulate the biological removal of Cd(II). • Added AgNPs were oxidatively dissolved and transported to the surface of fungus. • AgNPs have undergone coarsening in the process of transport. • Amino, carboxyl, hydroxyl, and other reducing groups were involved in transportion. - Abstract: Despite the knowledge about increasing discharge of silver nanoparticles (AgNPs) into wastewater and its potential toxicity to microorganisms, the interaction of AgNPs with heavy metals in the biological removal process remains poorly understood. This study focused on the effect of AgNPs (hydrodynamic diameter about 24.3 ± 0.37 nm) on the removal of cadmium (Cd(II)) by using a model white rot fungus species, Phanerochaete chrysosporium. Results showed that the biological removal capacity of Cd(II) increased with the concentration of AgNPs increasing from 0.1 mg/L to 1 mg/L. The maximum removal capacity (4.67 mg/g) was located at 1 mg/L AgNPs, and then decreased with further increasing AgNPs concentration, suggesting that an appropriate concentration of AgNPs has a stimulating effect on the removal of Cd(II) by P. chrysosporium instead of an inhibitory effect. Results of Ag + and total Ag concentrations in the solutions together with those of SEM and XRD demonstrated that added AgNPs had undergone oxidative dissolution and transported from the solution to the surface of fungal mycelia (up to 94%). FTIR spectra confirmed that amino, carboxyl, hydroxyl, and other reducing functional groups were involved in Cd(II) removal, AgNPs transportation, and the reduction of Ag + to AgNPs
Energy Technology Data Exchange (ETDEWEB)
Zuo, Yanan [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Chen, Guiqiu, E-mail: gqchen@hnu.edu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Zeng, Guangming, E-mail: zgming@hnu.edu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Li, Zhongwu; Yan, Ming [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Chen, Anwei [College of Resources and Environment, Hunan Agricultural University, Changsha 410128 (China); Guo, Zhi; Huang, Zhenzhen; Tan, Qiong [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China)
2015-03-21
Highlights: • Appropriate concentration of AgNPs can stimulate the biological removal of Cd(II). • Added AgNPs were oxidatively dissolved and transported to the surface of fungus. • AgNPs have undergone coarsening in the process of transport. • Amino, carboxyl, hydroxyl, and other reducing groups were involved in transportion. - Abstract: Despite the knowledge about increasing discharge of silver nanoparticles (AgNPs) into wastewater and its potential toxicity to microorganisms, the interaction of AgNPs with heavy metals in the biological removal process remains poorly understood. This study focused on the effect of AgNPs (hydrodynamic diameter about 24.3 ± 0.37 nm) on the removal of cadmium (Cd(II)) by using a model white rot fungus species, Phanerochaete chrysosporium. Results showed that the biological removal capacity of Cd(II) increased with the concentration of AgNPs increasing from 0.1 mg/L to 1 mg/L. The maximum removal capacity (4.67 mg/g) was located at 1 mg/L AgNPs, and then decreased with further increasing AgNPs concentration, suggesting that an appropriate concentration of AgNPs has a stimulating effect on the removal of Cd(II) by P. chrysosporium instead of an inhibitory effect. Results of Ag{sup +} and total Ag concentrations in the solutions together with those of SEM and XRD demonstrated that added AgNPs had undergone oxidative dissolution and transported from the solution to the surface of fungal mycelia (up to 94%). FTIR spectra confirmed that amino, carboxyl, hydroxyl, and other reducing functional groups were involved in Cd(II) removal, AgNPs transportation, and the reduction of Ag{sup +} to AgNPs.
Yadav, J. S.; Reddy, C. A.
1993-01-01
Evidence is presented for mineralization of 2,4-dichlorophenoxyacetic acid (2,4-D) in nutrient-rich media (high-nitrogen and malt extract media) by wild-type Phanerochaete chrysosporium and by a peroxidase-negative mutant of this organism. Mass balance analysis of [U-ring-14C]2,4-D mineralization in malt extract cultures showed 82.7% recovery of radioactivity. Of this, 38.6% was released as 14CO2 and 27.0, 11.2, and 5.9% were present in the aqueous, methylene chloride, and mycelial fractions, respectively. 2,4-D and 2,4,5-trichlorophenoxyacetic acid (2,4,5-T) were simultaneously mineralized when presented as a mixture, and mutual inhibition of degradation was not observed. In contrast, a relatively higher rate of mineralization of 2,4-D and 2,4,5-T was observed when these compounds were tested as mixtures than when they were tested alone. PMID:16349039
De novo synthesis and decomposition of veratryl alcohol by a lignin-degrading basidiomycete
Energy Technology Data Exchange (ETDEWEB)
Lundquist, K; Kirk, T K
1978-01-01
In studies of the metabolism of lignin-related aromatics by the ligninolytic basidiomycete Phanerochaete chrysosporium (strain ME-446), a compound was consistently found (TLC) in chloroform extracts of cultures. The substance, identified as veratryl alcohol (1), was first suspected to be a non-metabilizable degradation product of the aromatics studied, which included various guaiacyl- and veratryl-type compounds. Veratryl alcohol itself, in fact, was included in the first experiments. Further investigation with cultures containing /sup 14/C-glucose as growth substrate revealed that 1 is synthesized de novo from glucose. Although the culture medium contained in addition to glucose 0.01 M phthalate or aconitate (buffers), and 0.6 mM L-asparagine (nutrient nitrogen), glucose was the sole source of veratryl alcohol carbon. Introduction of the purified biosynthetic /sup 14/C-veratryl alcohol into fresh cultures resulted in 40% decomposition to /sup 14/CO/sub 2/ in 20 days, showing that the fungus not only makes the compound, it also degrades it. Russell et al. found veratryl alcohol and veratraldehyde in cultures of a ligninolytic fungus (Polystictus versicolor), but considered them to be degradation products of the lignin-related aromatics or wood meal present in the cultures. Reports of synthesis or decomposition of veratryl alcohol by microorganisms were not found.
Microbial pretreatment of cotton stalks by Phanerochaete chrysosporium for bioethanol production
Shi, Jian
Lignocellulosic biomass has been recognized as a widespread, potentially low cost renewable source of mixed sugars for fermentation to fuel ethanol. Pretreatment, as the first step towards conversion of lignocellulose to ethanol, remains one of the main barriers to technical and commercial success of the processing technology. Existing pretreatment methods have largely been developed on the basis of physiochemical technologies which are considered relatively expensive and usually involve adverse environmental impacts. In this study, an environmentally benign alternative, microbial pretreatment using Phanerochaete chrysosporium, was explored to degrade lignin in cotton stalks and facilitate their conversion into ethanol. Two submerged liquid pretreatment techniques (SmC), shallow stationary and agitated cultivation, at three inorganic salt concentrations (no salts, modified salts without Mn2+, modified salts with Mn2+) were compared by evaluating their pretreatment efficiencies. Shallow stationary cultivation with no salt was superior to other pretreatment conditions and gave 20.7% lignin degradation along with 76.3% solids recovery and 29.0% carbohydrate availability over a 14 day period. The influence of substrate moisture content (65%, 75% and 80% M.C. wet-basis), inorganic salt concentration (no salts, modified salts without Mn2+ , modified salts with Mn2+) and culture time (0-14 days) on pretreatment effectiveness in solid state (SSC) systems was also examined. It was shown that solid state cultivation at 75% M.C. without salts was the most preferable pretreatment resulting in 27.6% lignin degradation, 71.1% solids recovery and 41.6% carbohydrate availability over a period of 14 days. A study on hydrolysis and fermentation of cotton stalks treated microbially using the most promising SmC (shallow stationary, no salts) and SSC (75% moisture content, no salts) methods resulted in no increase in cellulose conversion with direct enzyme application (10.98% and 3
Amber. Vanden Wymelenberg; Bernard. Janse; Jill. Gaskell; Diane. Dietrich; Marcelo. Vallim; Dan. Cullen
1998-01-01
We describe here recent methods for quantitative assessment of specific P. chrysosporium mRNAs in organopollutant contaminated soils and in Aspen wood chips. Magnetic capture techniques were used to rapidly purify poly(A)-RNA, and quantitative RT-PCR protocols were developed for all known lignin peroxidase (lip) and cellobiohydrolase (cbh1) genes. The methodology is...
Potensi kapang pelapuk putih Phanerochaeta chrysosporium dalam pengolahan limbah industri tekstil
Directory of Open Access Journals (Sweden)
Yulinah Trihadiningrum
2012-02-01
Full Text Available Phanerochaete chrysosporium was known as white rot mold which could biodegrade persistent organic pollutants. In this researchthe ability of the mold in biodegrading textile dye direct orange S and rhemazol yellow, which contained naphtol functional group, wasstudied. This research included characterization of the waste water and determination of optimum concentration of the waste water forbiodegradation. The optimum concentration for biodegradation was determined by measuring the radial growth of the mold in agarmedium containing various concentrations of textile dye. The final stage was the application of the mold for biodegrading the textiledye in aerobic batch reactor using the selected concentration.This research showed that P. chrysosporium could grow satisfactorily in minimum medium containing synthetic textile wastewaterin various concentrations. The highest colour removal efficiency of 93% was achieved in 3 days in the waste water with highest colorintensity (absorbance value l520 = 4.00, and 48% in the waste water with absorbance value l520 = 1.22. COD removal efficiency of87% was achieved within 12 days in the wastewater of 30% concentration, and 83% in the waste water of 100% concentration. The pHvalues decreased to 3.23 in the waste water with lower dye concentration and to 3.42 in the higher color intensity, from the initialvalues of 5.0-6.0. This research concluded that P. chrysosporium was capable to biodegrade naphtol textile dye with reasonably highefficiency.
Medina, A; Roldán, A; Azcón, R
2010-12-01
Arbuscular mycorrhizal (AM) fungi and a residue from dry olive cake (DOC) supplemented with rock phosphate (RP) and treated with either Aspergillus niger (DOC-A) or Phanerochaete chrysosporium (DOC-P), were assayed in a natural, semi-arid soil using Trifolium repens or Dorycnium pentaphyllum plants. The effects of the AM fungi and/or DOC-A were compared with P-fertilisation (P) over eleven successive harvests to evaluate the persistence of the effectiveness of the treatments. The biomass of dually-treated plants after four successive harvests was greater than that obtained for non-treated plants or those receiving the AM inoculum or DOC-A treatments after eleven yields. The AM inoculation was critical for obtaining plant growth benefit from the application of fermented DOC-A residue. The abilities of the treatments to prevent plant drought stress were also assayed. Drought-alleviating effects were evaluated in terms of plant growth, proline and total sugars concentration under alternative drought and re-watering conditions (8th and 9th harvests). The concentrations of both compounds in plant biomass increased under drought when DOC-A amendment and AM inoculation were employed together: they reinforced the plant drought-avoidance capabilities and anti-oxidative defence. Water stress was less compensated in P-fertilised than in DOC-A-treated plants. DOC-P increased D. pentaphyllum biomass, shoot P content, nodule number and AM colonisation, indicating the greater DOC-transforming ability of P. chrysosporium compared to A. niger. The lack of AM colonisation and nodulation in this soil was compensated by the application of DOC-P, particularly with AM inoculum. The management of natural resources (organic amendments and soil microorganisms) represents an important strategy that assured the growth, nutrition and plant establishment in arid, degraded soils, preventing the damage that arises from limited water and nutrient supply. Copyright © 2010 Elsevier Ltd. All rights
Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum
Energy Technology Data Exchange (ETDEWEB)
D/Souza, T.M.; Merritt, C.S.; Reddy, C.A.
1999-12-01
Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.
International Nuclear Information System (INIS)
Bonnarme, P.; Jeffries, T.W.
1990-01-01
Two families of peroxidases-lignin peroxidase (LiP) and manganese-dependent lignin peroxidase (MnP)-are formed by the lignin-degrading white rot basidiomycete Phanerochaete chrysosporium and other white rot fungi. Isoenzymes of these enzyme families carry out reactions important to the biodegradation of lignin. This research investigated the regulation of LiP and MnP production by Mn(II). In liquid culture, LiP titers varied as an inverse function of and MnP titers varied as a direct function of the Mn(II) concentration. The extracellular isoenzyme profiles differed radically at low and high Mn(II) levels, whereas other fermentation parameters, including extracellular protein concentrations, the glucose consumption rate, and the accumulation of cell dry weight, did not change significantly with the Mn(II) concentration. In the absence of Mn(II), extracellular LiP isoenzymes predominated, whereas in the presence of Mn(II), MnP isoenzymes were dominant. The release of 14 CO 2 from 14 C-labeled dehydrogenative polymerizate lignin was likewise affected by Mn(II). The rate of 14 CO 2 release increased at low Mn(II) and decreased at high Mn(II) concentrations. This regulatory effect of Mn(II) occurred with five strains of P. chrysosporium, two other species of Phanerochaete, three species of Phlebia, Lentinula edodes, and Phellinus pini
Son, Yu-Lim; Kim, Hyoun-Young; Thiyagarajan, Saravanakumar; Xu, Jing Jing
2012-01-01
cDNA of the glx1 gene encoding glyoxal oxidase (GLX) from Phanerochaete chrysosporium was isolated and expressed in Pichia pastoris. The recombinant GLX (rGLX) produces H2O2 over 7.0 nmol/min/mL using methyl glyoxal as a substrate. Use of rGLX as a generator of H2O2 improved the coupled reaction with recombinant manganese peroxidase resulting in decolorization of malachite green up to 150 µM within 90 min. PMID:23323052
Energy Technology Data Exchange (ETDEWEB)
Robledo-Narvaez, P. N.; Ortega-Clemente, L. A.; Ponce-Noyola, M. T.; Rinderknecht-Seijas, N. F.; Poggi-Varaldo, H. M.
2009-07-01
It is well known that fungi belonging to the Basidiomycetes (such as Trametes versicolor, Lentinus edodes, Phanerochaete chrysosporium) are microorganisms with a demonstrated capability of degrading lignin and its derivatives using a powerful and diverse group of enzymes. Because of these features, ligninolytic fungi have been used for the treatment or post-treatment of a variety of recalcitrant and toxic effluents, those of the Kraft industry among them. Yet, most of reported fungal treatments so far required the supplementation with glucose or other soluble carbohydrates, pH 4 to 4,5, and their effective performance was demonstrated only for short periods of operation time. (Author)
Solid State production of manganese peroxidases using arecanut husk as substrate
Directory of Open Access Journals (Sweden)
Akhila Rajan
2010-06-01
Full Text Available The lignocellulosic biomass from arecanut husk (Areca catechu Linnaeus was evaluated as a new substrate for cultivation of Phanerochaete chrysosporium and Phanerochaete sp for solid state fermentation of manganese peroxidase (MnP. Arecanut had a moisture content of 79.84 % for ripe nut husk whereas green nut husk had 68.39 % moisture and a pH of 5.0, 3.0 and 7.0 for raw, ripe and dry husk. Reducing sugar content was 14.31, 19.21 and 1.77(mg/g of husk for raw, ripe and dry nut husk, respectively. Non reducing sugar was 1.04(mg/g of husk for raw and 0.68 (mg/g of husk for dry husk. Solid state fermentation carried out at different pH showed optimum enzyme production at pH 6.0 (52.60 IU/g for P.chrysosporium and pH 5.0 (44.08 IU/g for Phanerochaete sp. Optimum temperature was 30 ± 2º C for both the organisms. Lower concentration of MnSO4 (0.1 mM MnSO4 induced maximum enzyme production in P.chrysosporium whereas Phanerochaete sp. required 1 mM MnSO4 for induction. Absence of carbon and nitrogen stimulated enzyme production in P.chrysosporium while Phanerochaete sp. needed nitrogen. Enzyme was partially purified by ammonium sulphate precipitation followed by ion exchange chromatography.
Biodegradation of the High Explosive Hexanitrohexaazaiso-wurtzitane (CL-20)
Karakaya, Pelin; Christodoulatos, Christos; Koutsospyros, Agamemnon; Balas, Wendy; Nicolich, Steve; Sidhoum, Mohammed
2009-01-01
The aerobic biodegradability of the high explosive CL-20 by activated sludge and the white rot fungus Phanerochaete chrysosporium has been investigated. Although activated sludge is not effective in degrading CL-20 directly, it can mineralize the alkaline hydrolysis products. Phanerochaete chrysosporium degrades CL-20 in the presence of supplementary carbon and nitrogen sources. Biodegradation studies were conducted using various nutrient media under diverse conditions. Variables included the...
Energy Technology Data Exchange (ETDEWEB)
Kuhar, S.; Nair, L.M.; Kuhad, R.C. [Delhi Univ., New Delhi (India). Dept. of Microbiology, Lignocellulose Biotechnology Laboratory
2008-04-15
Lignocellulosic biomass is the most abundant energy resource in the world and is a potential source of carbon substrate for the production of ethanol via fermentation. However, the presence of lignin restricts access to holocellulose. It is necessary to break or remove the lignin in plant residues prior to their hydrolysis. Pretreatment is needed to liberate cellulose and hemicellulose from the lignins. This paper discussed a biological delignification method that avoided the use of toxic and corrosive chemicals. The in situ microbial delignification process used white rot fungi as a basidiomycetes for biological pretreatment. The study examined the capability of 4 basidiomycetes fungi, notably: (1) Phanerochaete chrysosporium; (2) Pycnoporus cinnabarinus; (3) fungal isolate RCK-1; and (4) fungal isolate RCK-3. The fungi were used to delignify wheat straw and improve hydrolysis procedures. Attempts were also made to ferment the acid hydrolysates from fungal-pretreated lignocellulosic materials. Results of the experiment showed that higher yields of ethanol were obtained using selective lignin-degrading fungi as a pretreatment method. 39 refs., 3 tabs., 4 figs.
SOLID-PHASE TREATMENT OF A PENTACHLOROPHENOL- CONTAMINATED SOIL USING LIGNIN-DEGRADING FUNGI
The abilities of three lignin-degrading fungi, Phanerochaete chrysosporium, Phanerochaete sordida, and Trametes hirsuta, to deplete pentachlorophenol (PCP) from soil contaminated with PCP and creosote were evaluated. A total of seven fungal and three control treatments ...
Biodegradation of the High Explosive Hexanitrohexaazaiso-wurtzitane (CL-20
Directory of Open Access Journals (Sweden)
Steve Nicolich
2009-04-01
Full Text Available The aerobic biodegradability of the high explosive CL-20 by activated sludge and the white rot fungus Phanerochaete chrysosporium has been investigated. Although activated sludge is not effective in degrading CL-20 directly, it can mineralize the alkaline hydrolysis products. Phanerochaete chrysosporium degrades CL-20 in the presence of supplementary carbon and nitrogen sources. Biodegradation studies were conducted using various nutrient media under diverse conditions. Variables included the CL-20 concentration; levels of carbon (as glycerol and ammonium sulfate and yeast extract as sources of nitrogen. Cultures that received CL-20 at the time of inoculation transformed CL-20 completely under all nutrient conditions studied. When CL-20 was added to pre-grown cultures, degradation was limited. The extent of mineralization was monitored by the 14CO2 time evolution; up to 51% mineralization was achieved when the fungus was incubated with [14C]-CL-20. The kinetics of CL-20 biodegradation by Phanerochaete chrysosporium follows the logistic kinetic growth model.
Biotechnological modification of lignin
Energy Technology Data Exchange (ETDEWEB)
1989-01-01
A literature search of organisms capable of degrading lignin was conducted. Four fungi were selected for study and these were Phanerochaete chrysosporium, Chrysosporium pruinosum, Phlebia tremellosus and Trametes versicolor. Other organisms, Pleurotus ostreatus, Pleurotus florida and Lentinus edodes were also tested in preliminary experiments. All cultures were screened for their ability to degrade the lignin component of aspen sawdust and also lignin extracted from steam-exploded wood. This type of screen was followed by analysis of culture filtrates for the presence of ligninase, the marker enzyme for lignin degradation. Phanerochaete chrysosporium and consequently chosen for further studies in fermentors. Considerable efforts were directed to production of ligninase in fermentors. Only when Chrysosporium pruinosum was pre-cultured in a shake flask for 4 days and then transferred to a fermentor could ligninase activity be detected. The enzyme from shake flasks has been concentrated ready for use in bench-scale studies on cell-free depolymerization of lignin. 13 refs., 8 tabs.
The genus Phanerochaete (Corticiaceae, Basidiomycotina) sensu lato in Uruguay
Sebastian Martinez; Karen K. Nakasone
2005-01-01
Eight species of Phanerochaete are reported from Uruguay for the first time, including a new species, P. vesiculosa. Phanerochaete vesiculosa is characterized by thin-walled, clavate to cylindrical vesicles embedded in the subiculum. A key to the known species of Phanerochaete from Uruguay is provided.
Phanerochaete mutants with enhanced ligninolytic activity
International Nuclear Information System (INIS)
Kakar, S.N.; Perez, A.; Gonzales, J.
1994-01-01
In addition to lignin, the white rot fungus Phanerochaete chrysosporium has the ability to degrade a wide spectrum of recalcitrant organo pollutants in soils and aqueous media. Most of the organic compounds are degraded under ligninolytic conditions with the involvement of the extracellular enzymes, lignin peroxidases, and manganese-dependent peroxidases, which are produced as secondary metabolites triggered by conditions of nutrient starvation (e.g., nitrogen limitation). The fungus and its enzymes can thus provide alternative technologies for bioremediation, bio pulping, bio bleaching, and other industrial applications. The efficiency and effectiveness of the fungus can be enhanced by increasing production and secretion of the important enzymes in large quantities and as primary metabolites under enriched conditions. One way this can be achieved is through isolation of mutants that are deregulated, or are hyper producers or super secretors of key enzymes under enriched conditions. Through UV-light and γ-ray mutagenesis, we have isolated a variety of mutants, some of which produce key enzymes of the ligninolytic system under high-nitrogen growth conditions. One of the mutants, 76UV, produced 272 U of lignin peroxidases enzyme activity/L after 9 d under high nitrogen (although the parent strain does not produce this enzyme under these conditions). The mutant and the parent strains produced up to 54 and 62 U/L, respectively, of the enzyme activity under low nitrogen growth conditions during this period. In some experiments, the mutant showed 281 U/L of enzyme activity under high nitrogen after 17 d
Biodegradation of degradable plastic polyethylene by phanerochaete and streptomyces species.
Lee, B; Pometto, A L; Fratzke, A; Bailey, T B
1991-03-01
The ability of lignin-degrading microorganisms to attack degradable plastics was investigated in pure shake flask culture studies. The degradable plastic used in this study was produced commercially by using the Archer-Daniels-Midland POLYCLEAN masterbatch and contained pro-oxidant and 6% starch. The known lignin-degrading bacteria Streptomyces viridosporus T7A, S. badius 252, and S. setonii 75Vi2 and fungus Phanerochaete chrysosporium were used. Pro-oxidant activity was accelerated by placing a sheet of plastic into a drying oven at 70 degrees C under atmospheric pressure and air for 0, 4, 8, 12, 16, or 20 days. The effect of 2-, 4-, and 8-week longwave UV irradiation at 365 nm on plastic biodegradability was also investigated. For shake flask cultures, plastics were chemically disinfected and incubated-shaken at 125 rpm at 37 degrees C in 0.6% yeast extract medium (pH 7.1) for Streptomyces spp. and at 30 degrees C for the fungus in 3% malt extract medium (pH 4.5) for 4 weeks along with an uninoculated control for each treatment. Weight loss data were inconclusive because of cell mass accumulation. For almost every 70 degrees C heat-treated film, the Streptomyces spp. demonstrated a further reduction in percent elongation and polyethylene molecular weight average when compared with the corresponding uninoculated control. Significant (P < 0.05) reductions were demonstrated for the 4- and 8-day heat-treated films by all three bacteria. Heat-treated films incubated with P. chrysosporium consistently demonstrated higher percent elongation and molecular weight average than the corresponding uninoculated controls, but were lower than the corresponding zero controls (heat-treated films without 4-week incubation). The 2- and 4-week UV-treated films showed the greatest biodegradation by all three bacteria. Virtually no degradation by the fungus was observed. To our knowledge, this is the first report demonstrating bacterial degradation of these oxidized polyethylenes in
Biodegradation of Degradable Plastic Polyethylene by Phanerochaete and Streptomyces Species †
Lee, Byungtae; Pometto, Anthony L.; Fratzke, Alfred; Bailey, Theodore B.
1991-01-01
The ability of lignin-degrading microorganisms to attack degradable plastics was investigated in pure shake flask culture studies. The degradable plastic used in this study was produced commercially by using the Archer-Daniels-Midland POLYCLEAN masterbatch and contained pro-oxidant and 6% starch. The known lignin-degrading bacteria Streptomyces viridosporus T7A, S. badius 252, and S. setonii 75Vi2 and fungus Phanerochaete chrysosporium were used. Pro-oxidant activity was accelerated by placing a sheet of plastic into a drying oven at 70°C under atmospheric pressure and air for 0, 4, 8, 12, 16, or 20 days. The effect of 2-, 4-, and 8-week longwave UV irradiation at 365 nm on plastic biodegradability was also investigated. For shake flask cultures, plastics were chemically disinfected and incubated-shaken at 125 rpm at 37°C in 0.6% yeast extract medium (pH 7.1) for Streptomyces spp. and at 30°C for the fungus in 3% malt extract medium (pH 4.5) for 4 weeks along with an uninoculated control for each treatment. Weight loss data were inconclusive because of cell mass accumulation. For almost every 70°C heat-treated film, the Streptomyces spp. demonstrated a further reduction in percent elongation and polyethylene molecular weight average when compared with the corresponding uninoculated control. Significant (P < 0.05) reductions were demonstrated for the 4- and 8-day heat-treated films by all three bacteria. Heat-treated films incubated with P. chrysosporium consistently demonstrated higher percent elongation and molecular weight average than the corresponding uninoculated controls, but were lower than the corresponding zero controls (heat-treated films without 4-week incubation). The 2- and 4-week UV-treated films showed the greatest biodegradation by all three bacteria. Virtually no degradation by the fungus was observed. To our knowledge, this is the first report demonstrating bacterial degradation of these oxidized polyethylenes in pure culture. PMID:16348434
Influence Of Chrysosporium Spp. In The Prevalence Of Dermatophytes in Soil
Directory of Open Access Journals (Sweden)
Shankar Gokul S
2001-01-01
Full Text Available Eighty two soil samples were screened for the prevalence of Chrysosporium and dermatophytes. Out of the 75 positive samples 2 were M. gypseum and 73 were Chrysosporium spp.None of the soil samples yielded both Chrysosporium spp. and M. gypseum. The co- inoculation of Chrysosporium spp. with different species of dermatophytes (T. rubrum. T. Mentagrophytes. E. floccosum and M. gypseum in sterilized soil revealed that none of the dermatophytes except M. gypseum could be recovered after the 15th day of co- inoculation. Whereas, these organisms when inoculated alone in sterilized soil, could be recovered even upto 25 days. In the light of the above finding, we suggest that Chrysosporium spp. might pose a definite challenge to dermatophytes in their saprophytic existence in soil.
Czech Academy of Sciences Publication Activity Database
Gabriel, Jiří; Žižka, Zdeněk; Švec, Karel; Nasswettrová, A.; Šmíra, P.; Kofroňová, Olga; Benada, Oldřich
2016-01-01
Roč. 61, č. 2 (2016), s. 119-128 ISSN 0015-5632 Institutional support: RVO:61388971 Keywords : HEAVY-METALS * CELL-WALL * PHANEROCHAETE-CHRYSOSPORIUM Subject RIV: EE - Microbiology, Virology Impact factor: 1.521, year: 2016
Theodorus H. de Koker; Karen K. Nakasone; Jacques Haarhof; Harold H. Burdsall; Bernard J.H. Janse
2003-01-01
Phanerochaete is a genus of resupinate homobasidiomycetes that are saprophytic on woody debris and logs. Morphological studies in the past indicated that Phanerochaete is a heterogeneous assemblage of species. In this study the internal transcribed spacer (ITS) region of the nuclear ribosomal DNA was used to test the monophyly of the genus Phanerochaete and to infer...
Plant-Polysaccharide-Degrading Enzymes from Basidiomycetes
Rytioja, Johanna; Hildén, Kristiina; Yuzon, Jennifer; Hatakka, Annele; de Vries, Ronald P.
2014-01-01
SUMMARY Basidiomycete fungi subsist on various types of plant material in diverse environments, from living and dead trees and forest litter to crops and grasses and to decaying plant matter in soils. Due to the variation in their natural carbon sources, basidiomycetes have highly varied plant-polysaccharide-degrading capabilities. This topic is not as well studied for basidiomycetes as for ascomycete fungi, which are the main sources of knowledge on fungal plant polysaccharide degradation. Research on plant-biomass-decaying fungi has focused on isolating enzymes for current and future applications, such as for the production of fuels, the food industry, and waste treatment. More recently, genomic studies of basidiomycete fungi have provided a profound view of the plant-biomass-degrading potential of wood-rotting, litter-decomposing, plant-pathogenic, and ectomycorrhizal (ECM) basidiomycetes. This review summarizes the current knowledge on plant polysaccharide depolymerization by basidiomycete species from diverse habitats. In addition, these data are compared to those for the most broadly studied ascomycete genus, Aspergillus, to provide insight into specific features of basidiomycetes with respect to plant polysaccharide degradation. PMID:25428937
Czech Academy of Sciences Publication Activity Database
Šíma, J.; Milne, R.; Novotný, Čeněk; Hasal, P.
2017-01-01
Roč. 62, č. 4 (2017), s. 335-342 ISSN 0015-5632 Institutional support: RVO:61388971 Keywords : WHITE-ROT FUNGI * ROTATING BIOLOGICAL CONTACTOR * PHANEROCHAETE-CHRYSOSPORIUM Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 1.521, year: 2016
SACCHARIFICATION WITH Phanerochaete chrysosporium and ...
African Journals Online (AJOL)
cantocanche
2011-05-09
May 9, 2011 ... and Pleurotus ostreatus enzymatic extracts of pretreated banana ... reduction in the cost of production (Hahn-Hägerdal et al., ... economy, the saccharification of these materials is necessary ... To efficiently process lignocellulosic wastes, the lignin ..... industries depend on the success in saccharification.
Fungicide selective for basidiomycetes.
Edgington, L V; Walton, G S; Miller, P M
1966-07-15
Concentrations of 2,3-dihydro-5-carboxanilido-6-methyl-1,4-oxathiin lower than 8 parts per million prevented mycelial growth of a number of Basidiomycetes. By contrast, mycelial growth of various other fungi-Phycomycetes, Ascomycetes, and Deuteromycetes-was 50 percent inhibited only by concentrations of 32 ppm or higher. Two exceptions to this pattern of selective fungitoxicity were found:an isolate of Rhizoctonia solani was not as sensitive as other Basidiomycetes, and the deuteromycete Verticillium alboatrum was inhibited by lower concentrations than affected other fungi in this group. Spore germination of two Basidiomycetes, Uromyces phaseoli and Ustilago nuda, was inhibited 95 percent or more at 10 ppm.
Biodegradation of Phenol Adsorbed on Soil in the Presence of Polycyclic Aromatic Hydrocarbons.
Czech Academy of Sciences Publication Activity Database
Maléterová, Ywetta; Matějková, Martina; Demnerová, K.; Stiborová, H.; Kaštánek, František; Šolcová, Olga
2016-01-01
Roč. 3, č. 1 (2016), s. 87-98 ISSN 2397-2076 R&D Projects: GA TA ČR TA04020700 Institutional support: RVO:67985858 Keywords : polycyclic artomatic hydrocarbons * phenol * bioremediation * candida tropicalis * phanerochaete chrysosporium Subject RIV: CI - Industrial Chemistry, Chemical Engineering
Energy Technology Data Exchange (ETDEWEB)
Argumedo-Delira, R.; Alarcon, A.; Ferrera-Cerrato, R.; Pena-Cabriales, J. J.
2009-07-01
Petroleum hydrocarbons (PH) are major organic contaminants in soils, and are subjected to degradation process mediated by either rhizospheric or soil microorganisms. Filamentous fungi such as cunninghamella elegans and Phanerochaete chrysosporium have a significant role on degradation of organic contaminants in soils. (Author)
International Nuclear Information System (INIS)
Argumedo-Delira, R.; Alarcon, A.; Ferrera-Cerrato, R.; Pena-Cabriales, J. J.
2009-01-01
Petroleum hydrocarbons (PH) are major organic contaminants in soils, and are subjected to degradation process mediated by either rhizospheric or soil microorganisms. Filamentous fungi such as cunninghamella elegans and Phanerochaete chrysosporium have a significant role on degradation of organic contaminants in soils. (Author)
Cytochrome P450 monooxygenases (P450s) are known to oxidize hydrocarbons albeit with limited substrate specificity across classes of these compounds. Here we report a P450 monooxygenase (CYP63A2) from the model ligninolytic white rot fungus Phanerochaete chrysosporium that was fo...
Comparative Genome Analysis of Basidiomycete Fungi
Energy Technology Data Exchange (ETDEWEB)
Riley, Robert; Salamov, Asaf; Morin, Emmanuelle; Nagy, Laszlo; Manning, Gerard; Baker, Scott; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Hibbett, David; Martin, Francis; Grigoriev, Igor
2012-03-19
Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, symbionts, and plant and animal pathogens. To better understand the diversity of phenotypes in basidiomycetes, we performed a comparative analysis of 35 basidiomycete fungi spanning the diversity of the phylum. Phylogenetic patterns of lignocellulose degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay. Patterns of secondary metabolic enzymes give additional insight into the broad array of phenotypes found in the basidiomycetes. We suggest that the profile of an organism in lignocellulose-targeting genes can be used to predict its nutritional mode, and predict Dacryopinax sp. as a brown rot; Botryobasidium botryosum and Jaapia argillacea as white rots.
Biosorption characteristics of Aspergillus fumigatus in removal of ...
African Journals Online (AJOL)
STORAGESEVER
2009-09-01
Sep 1, 2009 ... in growth medium, thus about 20% of the isolates can grow up to 50 mg Cd/100 ml medium and only ... have the highest Cd biosorption, compared to yeast malt extract (YM) and sabourad (Sb) media. ... chemical parameters of the solution, say, temperature, ...... inactivated Phanerochaete chrysosporium.
Computational studies on LiP H isolated from Ganoderma lucidum GD88
Directory of Open Access Journals (Sweden)
Parambayil Nayana
2015-01-01
Full Text Available Ganoderma lucidum is a basidiomycete fungus that produces ligninase for the modification of lignin. Lignin peroxidase (LiP is a glycoprotein that acts on the recalcitrant cell wall component lignin. In the present study, the phylogenetic analysis of Ganoderma lucidum GD88 with the partial coding sequence (cds of other LiP isoforms was performed using MEGA6. After determination of the open reading frame, the +3 frame nucleotide sequence was converted to protein using the EMBOSS Transseq and the secondary structure was predicted using the Chou and Fasman Secondary Structure Prediction server (CFSSP. Protein modeling was also performed by SWISS-MODEL. The obtained result shows that the lipH partial cds of Ganoderma lucidum GD88 is homologous to the lipD gene of Phanerochaete chrysosporium. The secondary structure prediction result revealed that the percent content of the helix (67 is higher than the percent contents of sheet (53.4 and turns (13.6. According to the generated model, LiP H protein is a homodimer with chains A and B. The heme acts as a ligand and plays a major role in structure stabilization.
A new mechanism of biopulping : attachment of acid groups on fiber
William R. Kenealy; Chris Hunt; Eric Horn; Carl Houtman
2004-01-01
We analyzed the physical properties of wood chips incubated with Ceriporiopsis subvermispora and cultural parameters of biopulping incubations of Phanerochaete chrysosporium and C. subvermispora. Dynamic mechanical analyses indicated a reduction in the modulus of elasticity (MOE) and loss modulus of spruce during the time where the biopulping energy savings effect...
Characterisation of a chimeric Phanerochaete chrysosporium ...
African Journals Online (AJOL)
Fred
soaked tissue paper, the lid of the plastic box was closed and the reaction were incubated at 37oC for 3–4 days. The plastic box with soaked tissue paper provided a humid environment that prevented the media from drying-out. After incubation, the plates were ... cbhI.1 when it was cloned into a pET vector to generate.
Cloning and expression of Phanerochaete chrysosporium ...
African Journals Online (AJOL)
Owner
various industries such as chemicals, fuel, food, brewery and wine, animal-feed, .... and transformed into competent E. coli BL21 cells for vector amplification, repurified ..... Hydrolysis of lignocellulose material for ethanol production: A Review: ...
Saccharification with Phanerochaete chrysosporium and Pleurotus ...
African Journals Online (AJOL)
Lignocellulosic biomass has a great potential as raw material for second and third generation biofuels since it is the most abundant carbohydrate on earth and the main component of agricultural waste; however, saccharification of lignocellulosic biomass is crucial for the establishment of a carbohydratebased economy.
A series of Xerophilic Chrysosporium species
DEFF Research Database (Denmark)
Skou, Jens-Peder
1992-01-01
Xerophilic Chrysosporium species related to C. farinicola were often isolated from uneaten provisions (pollen-and-nectar mixture) of mason bees (Osmia spp.). The fungi have an optimal growth rate on media which are 2 to 3 molar in regard to glucose, exhibit some growth up to 3.6 molar glucose...
DEFF Research Database (Denmark)
Bertelsen, Mads Frost; Crawshaw, Graham J.; Sigler, Lynne
2005-01-01
The fungus Chrysosporium anamorph of Nannizziopsis vriesii was identified as the caurse of fatal, multifocal, heterophilic dermatitis in for freshwater aquatic captive-bred tentacled snakes......The fungus Chrysosporium anamorph of Nannizziopsis vriesii was identified as the caurse of fatal, multifocal, heterophilic dermatitis in for freshwater aquatic captive-bred tentacled snakes...
Idris, Z. M.; Dzahir, M. I. H. M.; Jamal, P.; Barkat, A. A.; Xian, R. L. W.
2017-06-01
In this study, two different types of macroporous resins known as XAD-7HP and HP-20 were evaluated for the adsorption and desorption properties against bioactive phenolics extracted from Phanerochaete chrysosporium. From the previous static sorption studies, it was found that the adsorption capacity for both resins had has no significant difference. Then, the kinetic adsorption data were analyzed with both pseudo-first-order and pseudo-second-order equations and the later performed better. The adsorption isotherm data were fitted well by both Langmuir and Freundlich models. Meanwhile in desorption study, HP-20 and XAD-7HP gave 90.52% and 88.28% recoveries, respectively. Considering the desorption results of the macroporous resins, HP-20 and XAD-7HP were packed in chromatography column to further purify the phenolics. For dynamic adsorption, breakthrough capacity of HP-20 (0.522) was found to be higher than XAD-7HP (0.131). Different ethanol concentrations (30% to 50% (v/v)) were investigated at fixed flowrate (1 ml/min) on phenolics recovery from both types of resins. The highest recovery of bioactive phenolics was 94.3% using XAD-7HP resins at 50% (v/v) of ethanol. Only 77.1% of bioactive phenolics were recovered using HP-20 resin at the same experimental conditions. The purified extract subsequently was analyzed using HPLC. The results showed that three phenolics (gallic acid 3,4-dihydroxybenzoic acid and 4-hydroxybenzoic acid) were identified with higher concentrations as compared to non-purified extract. Finally, the purified extract was tested for scavenging activity against DPPH, and it showed that the activity increased significantly to 90.80% from 59.94% in non-purified extract.
An update on organohalogen metabolites produced by basidiomycetes
Field, J.A.; Wijnberg, J.B.P.A.
2003-01-01
Basidiomycetes are an ecologically important group of higher fungi known for their widespread capacity to produce organohalogen metabolites. To date, 100 different organohalogen metabolites (mostly chlorinated) have been identified from strains in 70 genera of Basidiomycetes. This manuscript
Preservation of live cultures of basidiomycetes - recent methods.
Homolka, Ladislav
2014-02-01
Basidiomycetes are used in industrial processes, in basic or applied research, teaching, systematic and biodiversity studies. Efficient work with basidiomycete cultures requires their reliable source, which is ensured by their safe long-term storage. Repeated subculturing, frequently used for the preservation, is time-consuming, prone to contamination, and does not prevent genetic and physiological changes during long-term maintenance. Various storage methods have been developed in order to eliminate these disadvantages. Besides lyophilization (unsuitable for the majority of basidiomycetes), cryopreservation at low temperatures seems to be a very efficient way to attain this goal. Besides survival, another requirement for successful maintenance of fungal strains is the ability to preserve their features unchanged. An ideal method has not been created so far. Therefore it is highly desirable to develop new or improve the current preservation methods, combining advantages and eliminate disadvantages of individual techniques. Many reviews on preservation of microorganisms including basidiomycetes have been published, but the progress in the field requires an update. Although herbaria specimens of fungi (and of basidiomycetes in particular) are very important for taxonomic and especially typological studies, this review is limited to live fungal cultures. Copyright © 2013 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Yamabhai Montarop
2010-07-01
Full Text Available Abstract Background The flavin-dependent enzyme pyranose 2-oxidase (P2Ox has gained increased attention during the last years because of a number of attractive applications for this enzyme. P2Ox is a unique biocatalyst with high potential for biotransformations of carbohydrates and in synthetic carbohydrate chemistry. Recently, it was shown that P2Ox is useful as bioelement in biofuel cells, replacing glucose oxidase (GOx, which traditionally is used in these applications. P2Ox offers several advantages over GOx for this application, e.g., its much broader substrate specificity. Because of this renewed interest in P2Ox, knowledge on novel pyranose oxidases isolated from organisms other than white-rot fungi, which represent the traditional source of this enzyme, is of importance, as these novel enzymes might differ in their biochemical and physical properties. Results We isolated and over-expressed the p2ox gene encoding P2Ox from the ectomycorrhizal fungus Lyophyllum shimeji. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+ and successfully expressed in E. coli Rosetta 2. We obtained active, flavinylated recombinant P2Ox in yields of approximately 130 mg per L of medium. The enzyme was purified by a two-step procedure based on anion exchange chromatography and preparative native PAGE, yielding an apparently homogenous enzyme preparation with a specific activity of 1.92 U/mg (using glucose and air oxygen as the substrates. Recombinant P2Ox from L. shimeji was characterized in some detail with respect to its physical and catalytic properties, and compared to the well-characterised enzymes from Phanerochaete chrysosporium and Trametes multicolor. Conclusion L. shimeji P2Ox shows properties that are comparable to those of P2Ox from white-rot fungal origin, and is in general characterised by lower Km and kcat values both for electron donor (sugar as well as electron acceptor (ferrocenium ion, 1,4-benzoquinone, 2
Comparative genome analysis of Basidiomycete fungi
Energy Technology Data Exchange (ETDEWEB)
Riley, Robert; Salamov, Asaf; Henrissat, Bernard; Nagy, Laszlo; Brown, Daren; Held, Benjamin; Baker, Scott; Blanchette, Robert; Boussau, Bastien; Doty, Sharon L.; Fagnan, Kirsten; Floudas, Dimitris; Levasseur, Anthony; Manning, Gerard; Martin, Francis; Morin, Emmanuelle; Otillar, Robert; Pisabarro, Antonio; Walton, Jonathan; Wolfe, Ken; Hibbett, David; Grigoriev, Igor
2013-08-07
Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To better understand the genetic diversity of this phylum we compared the genomes of 35 basidiomycetes including 6 newly sequenced genomes. These genomes span extremes of genome size, gene number, and repeat content. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) found in only one organism. Correlations between lifestyle and certain gene families are evident. Phylogenetic patterns of plant biomass-degrading genes in Agaricomycotina suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. Based on phylogenetically-informed PCA analysis of wood decay genes, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has typical ligninolytic class II fungal peroxidases (PODs). This prediction is supported by growth assays in which both fungi exhibit wood decay with white rot-like characteristics. Based on this, we suggest that the white/brown rot dichotomy may be inadequate to describe the full range of wood decaying fungi. Analysis of the rate of discovery of proteins with no or few homologs suggests the value of continued sequencing of basidiomycete fungi.
In vitro effect of Chrysosporium indicum and Chrysosporium keratinophylum on Toxocara canis eggs.
Bojanich, María V; Basualdo, Juan A; Giusiano, Gustavo
2017-12-05
The degree of antagonism exercised by fungi on geohelminth development varies according to the morphological alterations caused by different fungal species. Saprophytic fungi may exert ovicidal or ovistatic effects. The aim of this study was to apply scanning electron microscopy (SEM) to observe the action of two soil saprophytic species of Chrysosporium (C. indicum and C. keratinophylum) on Toxocara canis eggs. The fungal strains to be tested were incubated for 28 days at 28°C in 2% water agar with a suspension of unembryonated T. canis eggs. A suspension of T. canis eggs in 2% water agar was used as control group. The assay was done in triplicate for each fungus and the control group. SEM observations were performed on the 4th, 7th, 14th, 21st, and 28th day after inoculation. The effect of the fungi on eggs was evaluated in accordance with the alterations observed on the surface and the changes in the normal characteristics of the eggs. Hyphae around the eggs, appresoria penetrating the shell and changes in the typical egg membrane were observed in this assay. Type 3 effect (alterations that occur both in the embryo and the shell, and hyphal penetration of the eggs) was the prevalent effect. SEM allowed us to observe clearly the morphological alterations in T. canis eggs due to the effect of C. indicum and C. keratinophylum. Both saprophytic species of Chrysosporium alter the egg structure and alterations increase as exposure increases. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
SEARCH PRODUCERS OF POLYPHENOLS AND SOME PIGMENTS AMONG BASIDIOMYCETES
Directory of Open Access Journals (Sweden)
Fedotov О. V.
2014-02-01
Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.
Schmidt-Ukaj, Silvana; Loncaric, Igor; Klang, Andrea; Spergser, Joachim; Häbich, Annett-Carolin; Knotek, Zdenek
2014-12-01
Description of clinical, microbiological and histopathological findings in a case of deep dermatitis in an inland bearded dragon (Pogona vitticeps) caused by Devriesea agamarum and Chrysosporium guarroi. A 4-year-old male inland bearded dragon, weighing 497 g, was presented at the clinic because the animal was suffering from dysecdysis and chronic skin lesions. Large numbers of bacilli, cocci and hyphal elements were diagnosed during the microscopic examination of the wound exudate. Microbiological analysis of a skin specimen revealed a moderate growth of Enterococcus sp. and D. agamarum. The condition of the bearded dragon improved with combined therapy consisting of ceftiofur hydrochloride, voriconazole and meloxicam. However, 3 months later recrudescence was observed. This time, Clostridium sp. and Chrysosporium sp. were isolated in large numbers. The bearded dragon was euthanized. Histopathology confirmed a severe granulomatous dermatitis with associated fungal hyphae and a severe granulomatous hepatitis with intralesional hyphae. Chrysosporium guarroi was identified by PCR and sequencing in two organs (skin and liver). This is the first case of an infection with D. agamarum and C. guarroi in an inland bearded dragon (P. vitticeps). It emphasizes the importance of mycological cultures and specific treatment. Samples of suspected Chrysosporium sp. should be cultured at 30°C for 10-14 days. Early antifungal treatment is necessary to prevent systemic and potentially fatal infection with C. guarroi. © 2014 ESVD and ACVD.
Chrysosporium guarroi sp. nov. a new emerging pathogen of pet green iguanas (Iguana iguana).
Abarca, M L; Castellá, G; Martorell, J; Cabañes, F J
2010-03-01
Chrysosporium guarroi sp. nov. represented by five strains isolated from cases of dermatomycosis in pet green iguanas (Iguana iguana) in Spain, is described and illustrated. This taxon is characterized by its ability to grow at temperatures from 15 to 37 degrees C and by the presence of arthroconidia and aleurioconidia. The latter are unicellular, smooth, pyriform or clavate, sessile or borne at the ends of narrow stalks. The analysis of the sequences of the D1/D2 and ITS regions confirm the separation of this new species from others of the genus Chrysosporium.
Diversity and evolution of ABC proteins in basidiomycetes.
Kovalchuk, Andriy; Lee, Yong-Hwan; Asiegbu, Fred O
2013-01-01
ABC proteins constitute one of the largest families of proteins. They are implicated in wide variety of cellular processes ranging from ribosome biogenesis to multidrug resistance. With the advance of fungal genomics, the number of known fungal ABC proteins increases rapidly but the information on their biological functions remains scarce. In this work we extended the previous analysis of fungal ABC proteins to include recently sequenced species of basidiomycetes. We performed an identification and initial cataloging of ABC proteins from 23 fungal species representing 10 orders within class Agaricomycotina. We identified more than 1000 genes coding for ABC proteins. Comparison of sets of ABC proteins present in basidiomycetes and ascomycetes revealed the existence of two groups of ABC proteins specific for basidiomycetes. Results of survey should contribute to the better understanding of evolution of ABC proteins in fungi and support further experimental work on their characterization.
Anderson, Ian C; Bastias, Brigitte A; Genney, David R; Parkin, Pamela I; Cairney, John W G
2007-04-01
Soil basidiomycetes play key roles in forest nutrient and carbon cycling processes, yet the diversity and structure of below ground basidiomycete communities remain poorly understood. Prescribed burning is a commonly used forest management practice and there is evidence that single fire events can have an impact on soil fungal communities but little is known about the effects of repeated prescribed burning. We have used internal transcribed spacer (ITS) terminal restriction fragment length polymorphism (T-RFLP) analysis to investigate the impacts of repeated prescribed burning every two or four years over a period of 30 years on soil basidiomycete communities in an Australian wet sclerophyll forest. Detrended correspondence analysis of ITS T-RFLP profiles separated basidiomycete communities in unburned control plots from those in burned plots, with those burned every two years being the most different from controls. Burning had no effect on basidiomycete species richness, thus these differences appear to be due to changes in community structure. Basidiomycete communities in the unburned control plots were vertically stratified in the upper 20 cm of soil, but no evidence was found for stratification in the burned plots, suggesting that repeated prescribed burning results in more uniform basidiomycete communities. Overall, the results demonstrate that repeated prescribed burning alters soil basidiomycete communities, with the effect being greater with more frequent burning.
Energy Technology Data Exchange (ETDEWEB)
NONE
2001-03-01
Efforts are made to develop a system to collectively detoxify dioxins and heavy metals in incinerator fly ash or in polluted soil using microbes and/or chemicals. In the use of chemicals, verification tests are conducted for a system to detoxify dioxins and toxic heavy metals simultaneously. In the use of microbes, an effort is made to develop a low cost energy conservation type treatment system based on what is provided by the study of microbes such as Phanerochaete chrysosporium. As for the treatment of fly ash, an effort is made to recycle it into resources usable in the development of marketable products. For the detoxification of dioxins using chemicals, they are dechlorinated in a chemical reduction reaction. For their detoxification with help of microbes, it is found in an experiment of ash fly dioxin decomposition using Phanerochaete chrysosporium that the microbe reduces dioxins in both liquid phase and solid phase systems. The result of verification tests using chemicals shows that the reference level of 3ng-TEQ/g is easily cleared in the treatment of high concentration ash fly. In the detoxification of heavy metals, data is obtained indicating that the elution level of lead in ash fly is found reduced by 70-85% after treatment. (NEDO)
Bacterial communities in the fruit bodies of ground basidiomycetes
Zagryadskaya, Yu. A.; Lysak, L. V.; Chernov, I. Yu.
2015-06-01
Fruit bodies of basidiomycetes at different stages of decomposition serve as specific habitats in forest biocenoses for bacteria and differ significantly with respect to the total bacterial population and abundance of particular bacterial genera. A significant increase in the total bacterial population estimated by the direct microscopic method with acridine orange staining and in the population of saprotrophic bacteria (inoculation of glucose peptone yeast agar) in fruit bodies of basidiomycetes Armillaria mellea and Coprinus comatus was recorded at the final stage of their decomposition in comparison with the initial stage. Gramnegative bacteria predominated in the tissues of fruit bodies at all the stages of decomposition and were represented at the final stage by the Aeromonas, Vibrio, and Pseudomonas genera (for fruit bodies of A. mellea) the Pseudomonas genus (for fruit bodies of C. comatus). The potential influence of bacterial communities in the fruit bodies of soil basidiomycetes on the formation of bacterial communities in the upper soil horizons in forest biocenoses is discussed. The loci connected with the development and decomposition of fruit bodies of basidiomycetes on the soil surface are promising for targeted search of Gram-negative bacteria, the important objects of biotechnology.
Phylogeny and comparative genome analysis of a Basidiomycete fungi
Energy Technology Data Exchange (ETDEWEB)
Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David
2011-03-14
Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.
Lectins from Mycelia of Basidiomycetes
Directory of Open Access Journals (Sweden)
Valentina E. Nikitina
2017-06-01
Full Text Available Lectins are proteins of a nonimmunoglobulin nature that are capable of specific recognition of and reversible binding to the carbohydrate moieties of complex carbohydrates, without altering the covalent structure of any of the recognized glycosyl ligands. They have a broad range of biological activities important for the functioning of the cell and the whole organism and, owing to the high specificity of reversible binding to carbohydrates, are valuable tools used widely in biology and medicine. Lectins can be produced by many living organisms, including basidiomycetes. Whereas lectins from the fruit bodies of basidiomycetes have been studied sufficiently well, mycelial lectins remain relatively unexplored. Here, we review and comparatively analyze what is currently known about lectins isolated from the vegetative mycelium of macrobasidiomycetes, including their localization, properties, and carbohydrate specificities. Particular attention is given to the physiological role of mycelial lectins in fungal growth and development.
Bioreduction of selenite and tellurite by Phanerochaete chrysosporium
Espinosa‐Ortiz, E.J.
2015-01-01
Selenium (Se) and tellurium (Te) are elements, they are part of the chalcogens (VI‐A group of the periodic table) and share common properties. These metalloids are of commercial interest due to their physicochemical properties, and they have been used in a broad range of applications in advanced
by Phanerochaete chrysosporium from a binary metal system
African Journals Online (AJOL)
drinie
2001-01-01
Jan 1, 2001 ... metal concentrations (Ci) increased, independent of initial pH (pHi) and generally the metal with ... The results also show that some portion of the metal ions sorbed by P. ... mechanisms, mainly ion exchange, chelation, adsorption, and ..... YU Q and KAEWSARN P (1999) Binary adsorption of copper(II) and.
Directory of Open Access Journals (Sweden)
Olorunnisola Kola Saheed
2016-04-01
Full Text Available The present generation of nutrient rich waste streams within the food and hospitality industry is inevitable and remained a matter of concern to stakeholders. Three white rot fungal strains were cultivated under submerged state bioconversion (SmB. Fermentable sugar conversion efficiency, biomass production and substrate utilization constant were indicators used to measure the success of the process. The substrates – banana peel (Bp, pineapple peel (PAp and papaya peel (Pp were prepared in wet and dried forms as substrates. Phanerochaete chrysosporium (P. chrysosporium, Panus tigrinus M609RQY, and RO209RQY were cultivated on sole fruit wastes and their composites. All fungal strains produced profound biomass on dry sole wet substrates, but wet composite substrates gave improved results. P. tigrinus RO209RQY was the most efficient in sugar conversion (99.6% on sole substrates while P. tigrinus M609RQY was efficient on composite substrates. Elevated substrate utilization constant (Ku and biomass production heralded wet composite substrates. P. chrysosporium was the most performing fungal strain for biomass production, while PApBp was the best composite substrate.
Use of molecular markers for the study of wild fungus basidiomycetes
Directory of Open Access Journals (Sweden)
Blanca Estela Gómez Luna
2012-09-01
Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.
Armillaria mellea: an ozonophilic basidiomycete
Energy Technology Data Exchange (ETDEWEB)
Berliner, M D
1963-01-19
Armillaria mellea, a luminescent basidiomycete grown in culture, had its light emission stimulated by high ozone concentrations and survived long ozone exposures without apparent lasting ill-effect. There is a strong possibility that a pigment acts as an ozone protecting substance by preventing the formation of free radicals and peroxides.
Abarca, M L; Martorell, J; Castellá, G; Ramis, A; Cabañes, F J
2009-08-01
A Chrysosporium sp. related to Nannizziopsis vriesii was isolated in pure culture from squames and biopsies of facial lesions in a pet inland bearded dragon (Pogona vitticeps) in Spain. The presence in histological sections of morphologically consistent fungal elements strongly incriminates this fungus as the aetiological agent of infection. Lesions regressed following treatment with oral ketoconazole and topical chlorhexidine and terbinafine until the lizard was lost to follow up 1 month later. The ITS-5.8S rRNA gene of the isolate was sequenced and a search on the GenBank database revealed a high match with the sequences of two Chrysosporium sp. strains recently isolated from green iguanas (Iguana iguana) with dermatomycosis, also in Spain. Phylogenetic analysis of the sequences revealed that all these strains are related to N. vriesii. This is the first report of dermatomycoses caused by a Chrysosporium species related to N. vriesii in a bearded dragon outside North America.
A highly conserved basidiomycete peptide synthetase produces a trimeric hydroxamate siderophore.
Brandenburger, Eileen; Gressler, Markus; Leonhardt, Robin; Lackner, Gerald; Habel, Andreas; Hertweck, Christian; Brock, Matthias; Hoffmeister, Dirk
2017-08-25
The model white-rot basidiomycete Ceriporiopsis ( Gelatoporia ) subvermispora B encodes putative natural product biosynthesis genes. Among them is the gene for the seven-domain nonribosomal peptide synthetase CsNPS2. It is a member of the as-yet uncharacterized fungal type VI siderophore synthetase family which is highly conserved and widely distributed among the basidiomycetes. These enzymes include only one adenylation (A) domain, i.e., one complete peptide synthetase module and two thiolation/condensation (T-C) di-domain partial modules which, together, constitute an AT 1 C 1 T 2 C 2 T 3 C 3 domain setup. The full-length CsNPS2 enzyme (274.5 kDa) was heterologously produced as polyhistidine fusion in Aspergillus niger as soluble and active protein. N 5 -acetyl- N 5 -hydroxy-l-ornithine (l-AHO) and N 5 - cis -anhydromevalonyl- N 5 -hydroxy-l-ornithine (l-AMHO) were accepted as substrates, as assessed in vitro using the substrate-dependent [ 32 P]ATP-pyrophosphate radioisotope exchange assay. Full-length holo -CsNPS2 catalyzed amide bond formation between three l-AHO molecules to release the linear l-AHO trimer, called basidioferrin, as product in vitro , which was verified by LC-HRESIMS. Phylogenetic analyses suggest that type VI family siderophore synthetases are widespread in mushrooms and have evolved in a common ancestor of basidiomycetes. Importance : The basidiomycete nonribosomal peptide synthetase CsNPS2 represents a member of a widely distributed but previously uninvestigated class (type VI) of fungal siderophore synthetases. Genes orthologous to CsNPS2 are highly conserved across various phylogenetic clades of the basidiomycetes. Hence, our work serves as a broadly applicable model for siderophore biosynthesis and iron metabolism in higher fungi. Also, our results on the amino acid substrate preference of CsNPS2 supports further understanding of the substrate selectivity of fungal adenylation domains. Methodologically, this report highlights the
Biotechnology of non-Saccharomyces yeasts-the basidiomycetes.
Johnson, Eric A
2013-09-01
Yeasts are the major producer of biotechnology products worldwide, exceeding production in capacity and economic revenues of other groups of industrial microorganisms. Yeasts have wide-ranging fundamental and industrial importance in scientific, food, medical, and agricultural disciplines (Fig. 1). Saccharomyces is the most important genus of yeast from fundamental and applied perspectives and has been expansively studied. Non-Saccharomyces yeasts (non-conventional yeasts) including members of the Ascomycetes and Basidiomycetes also have substantial current utility and potential applicability in biotechnology. In an earlier mini-review, "Biotechnology of non-Saccharomyces yeasts-the ascomycetes" (Johnson Appl Microb Biotechnol 97: 503-517, 2013), the extensive biotechnological utility and potential of ascomycetous yeasts are described. Ascomycetous yeasts are particularly important in food and ethanol formation, production of single-cell protein, feeds and fodder, heterologous production of proteins and enzymes, and as model and fundamental organisms for the delineation of genes and their function in mammalian and human metabolism and disease processes. In contrast, the roles of basidiomycetous yeasts in biotechnology have mainly been evaluated only in the past few decades and compared to the ascomycetous yeasts and currently have limited industrial utility. From a biotechnology perspective, the basidiomycetous yeasts are known mainly for the production of enzymes used in pharmaceutical and chemical synthesis, for production of certain classes of primary and secondary metabolites such as terpenoids and carotenoids, for aerobic catabolism of complex carbon sources, and for bioremediation of environmental pollutants and xenotoxicants. Notwithstanding, the basidiomycetous yeasts appear to have considerable potential in biotechnology owing to their catabolic utilities, formation of enzymes acting on recalcitrant substrates, and through the production of unique primary
Degradation of cellulose by basidiomycetous fungi
Czech Academy of Sciences Publication Activity Database
Baldrian, Petr; Valášková, Vendula
2008-01-01
Roč. 32, č. 3 (2008), s. 501-521 ISSN 0168-6445 R&D Projects: GA MŠk LC06066; GA MZe QH72216 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellobiohydrolase * cellulose dehydrogenase * basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 7.963, year: 2008
Directory of Open Access Journals (Sweden)
Chaika A. V.
2013-12-01
Full Text Available The tensio-rheometric characteristics of 63 strains belonging to 19 basidiomycetes species submerged culture filtrate were investigated by the axisymmetric pendent drop profile analysis. The method showed required high sensitivity with mycological material. It was found that the interfacial tensiometric and rheometric parameters depend significantly on culture species, hence it is proposed to use ones complex for systematic identification of cultures and as a selection criterion for biosurfactantsproducing strains of basidiomycetes. Correlations of tensio-rheometric characteristics both among themselves and with the culture growth and lipid peroxidation rates were found. This provides an integrated indicator of the submerged culture metabolic state. By the results of the study several strains of basidiomycetes — potential producers of biosurfactants with a high growth rate and intensity of lipid peroxidation were selected for biotechnological manufacture.
Ribera, Javier; Fink, Siegfried; Bas, Maria Del Carmen; Schwarze, Francis W M R
2017-01-01
The production of new generation of wood preservatives (without addition of a co-biocide) in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720) was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium). T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%). Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens previously exposed to T
Directory of Open Access Journals (Sweden)
Javier Ribera
Full Text Available The production of new generation of wood preservatives (without addition of a co-biocide in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720 was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium. T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%. Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens
Photochemical and microbial degradation technologies to remove toxic chemicals
International Nuclear Information System (INIS)
Matsumura, F.; Katayama, A.
1992-01-01
An effort was made to apply photochemical degradation technology on biodegradation processes to increase the bioremediation potential of microbial actions. For this purpose, we have chosen Phanerochaete chrysosporium, a wood decaying white-rot fungus and a variety of chlorinated pesticides and aromatics as study materials. By using UV-irradiation and benomyl (a commonly used fungicide) as selection methods, a strain of UV-resistant P. chrysosporium was developed. This strain was found to be capable of rapidly degrading these chlorinated chemicals when they were incubated in N-deficient medium which received 1 hr/day of UV-irradiation. UV-irradiation either at 300 or 254 nm showed the beneficial effect of speeding up the rate of degradation on most of test chemicals with the exception of toxaphene and HCH (hexachlorocyclohexane). By adding fresh glucose to the medium it was possible to maintain high degradation capacity for several weeks
International Nuclear Information System (INIS)
Luey, J.; Brouns, T.M.; Elliott, M.L.
1990-11-01
The white rot fungus Phanerochaete chrysosporium has been shown to effectively degrade pollutants such as trichlorophenol, polychlorinated biphenyls (PCBs), dioxins and other halogenated aromatic compounds. These refractory organic compounds and many others have been identified in the tank waste, groundwater and soil of various US Department of Energy (DOE) sites. The treatment of these refractory organic compounds has been identified as a high priority for DOE's Research, Development, Demonstration, Testing, and Evaluation (RDDT ampersand E) waste treatment programs. Unlike many bacteria, the white rot fungus P. chrysosporium is capable of degrading these types of refractory organics and may be valuable for the treatment of wastes containing multiple pollutants. The objectives of this project are to identify DOE waste problems amenable to white rot fungus treatment and to develop and demonstrate white rot fungus treatment process for these hazardous organic compounds. 32 refs., 6 figs., 7 tabs
Photochemical and microbial degradation technologies to remove toxic chemicals
Energy Technology Data Exchange (ETDEWEB)
Matsumura, F.; Katayama, A.
1992-07-01
An effort was made to apply photochemical degradation technology on biodegradation processes to increase the bioremediation potential of microbial actions. For this purpose, we have chosen Phanerochaete chrysosporium, a wood decaying white-rot fungus and a variety of chlorinated pesticides and aromatics as study materials. By using UV-irradiation and benomyl (a commonly used fungicide) as selection methods, a strain of UV-resistant P. chrysosporium was developed. This strain was found to be capable of rapidly degrading these chlorinated chemicals when they were incubated in N-deficient medium which received 1 hr/day of UV-irradiation. UV-irradiation either at 300 or 254 nm showed the beneficial effect of speeding up the rate of degradation on most of test chemicals with the exception of toxaphene and HCH (hexachlorocyclohexane). By adding fresh glucose to the medium it was possible to maintain high degradation capacity for several weeks.
Terekhova, V A; Semenova, T A
2005-01-01
We investigated the interactions between micromycetes and basidiomycete mycelium on plant substrates in the course of their 3-year incubation in the litter of ecologically intact spruce forests of the Central State Biosphere Forest Sanctuary (Nelidovo District, Tver oblast). Only 40-60% of the micromycetes were involved in direct antagonistic interactions with basidiomycetous fungi. In terms of the ratio between physiologically active strains and those which did not interact with basidiomycete mycelium, we revealed differences in the structure of micromycete communities developing on various types of substrates (xylem, bark, sphagnum, leaves, needles, litter, and cotton grass). The micromycetes tested belonged to 49 species. At the end of the observation period, the fraction of microscopic fungi that actively influenced basidiomycete mycelium was four times lower in the inactive litter fraction (lignin-containing xylem debris) than in the active fraction (grass substrates). The mechanisms of indirect regulation of the structure and functions of micromycete communities are discussed, which may be based on the accumulation of phenolic compounds in the medium and changes in the enzyme activities of basidiomycete mycelium.
Biotransformations of organic energetic materials
International Nuclear Information System (INIS)
Matousek, J.
2001-01-01
This paper reviews data on the acute eco-toxicity and delayed effects (mutagenicity) of the model substance (TNT) and of a wide spectrum of its biodegradation products in the wastewaters. It also suggests main metabolic pathways of biotransformation, involving biological reduction. Some possibilities of remediation of contaminated soils utilising microbial catabolic pathways leading to the hydroxy derivatives and up to the cleavage of the aromatic ring system in the presence of the soil bacteria Pseudomonas fluorescens are shown, as well as the practical utilisation of fungi Phanerochaete chrysosporium under aerobic conditions
Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum
Energy Technology Data Exchange (ETDEWEB)
Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.
2013-03-11
Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.
Sigler, Lynne; Hambleton, Sarah; Paré, Jean A
2013-10-01
In recent years, the Chrysosporium anamorph of Nannizziopsis vriesii (CANV), Chrysosporium guarroi, Chrysosporium ophiodiicola, and Chrysosporium species have been reported as the causes of dermal or deep lesions in reptiles. These infections are contagious and often fatal and affect both captive and wild animals. Forty-nine CANV isolates from reptiles and six isolates from human sources were compared with N. vriesii based on their cultural characteristics and DNA sequence data. Analyses of the sequences of the internal transcribed spacer and small subunit of the nuclear ribosomal gene revealed that the reptile pathogens and human isolates belong in well-supported clades corresponding to three lineages that are distinct from all other taxa within the family Onygenaceae of the order Onygenales. One lineage represents the genus Nannizziopsis and comprises N. vriesii, N. guarroi, and six additional species encompassing isolates from chameleons and geckos, crocodiles, agamid and iguanid lizards, and humans. Two other lineages comprise the genus Ophidiomyces, with the species Ophidiomyces ophiodiicola occurring only in snakes, and Paranannizziopsis gen. nov., with three new species infecting squamates and tuataras. The newly described species are Nannizziopsis dermatitidis, Nannizziopsis crocodili, Nannizziopsis barbata, Nannizziopsis infrequens, Nannizziopsis hominis, Nannizziopsis obscura, Paranannizziopsis australasiensis, Paranannizziopsis californiensis, and Paranannizziopsis crustacea. Chrysosporium longisporum has been reclassified as Paranannizziopsis longispora. N. guarroi causes yellow fungus disease, a common infection in bearded dragons and green iguanas, and O. ophiodiicola is an emerging pathogen of captive and wild snakes. Human-associated species were not recovered from reptiles, and reptile-associated species were recovered only from reptiles, thereby mitigating concerns related to zoonosis.
Oliver, Christine M; Mawson, Raymond; Melton, Laurence D; Dumsday, Geoff; Welch, Jessica; Sanguansri, Peerasak; Singh, Tanoj K; Augustin, Mary Ann
2014-10-13
The consequences of ultrasonic pre-treatment using low (40 kHz) and medium (270 kHz) frequency (40 kHz followed by 270 kHz) on the degradation of wheat chaff (8 g 100ml(-1) acetate buffer, pH 5) were evaluated. In addition, the effects of the ultrasonic pre-treatment on the degradation of the wheat chaff when subsequently exposed to enzyme extracts from two white rot fungi (Phanerochaete chrysosporium and Trametes sp.) were investigated. Pre-treatment by sequential low and medium frequency ultrasound had a disruptive effect on the lignocellulosic matrix. Analysis of the phenolic-derived volatiles after enzymatic hydrolysis showed that biodegradation with the enzyme extract obtained from P. chrysosporium was more pronounced compared to that of the Trametes sp. The efficacy of the ultrasonic pre-treatment was attributed to increased enzyme accessibility of the cellulose fibrils due to sonication-induced disruption of the plant surface structure, as shown by changes in the microstructure. Copyright © 2014 Elsevier Ltd. All rights reserved.
The biodiversity of microbial cytochromes P450.
Kelly, Steven L; Lamb, David C; Jackson, Colin J; Warrilow, Andrew G; Kelly, Diane E
2003-01-01
The cytochrome P450 (CYP) superfamily of genes and proteins are well known for their involvement in pharmacology and toxicology, but also increasingly for their importance and diversity in microbes. The extent of diversity has only recently become apparent with the emergence of data from whole genome sequencing projects and the coming years will reveal even more information on the diversity in microbial eukaryotes. This review seeks to describe the historical development of these studies and to highlight the importance of the genes and proteins. CYPs are deeply involved in the development of strategies for deterrence and attraction as well as detoxification. As such, there is intense interest in pathways of secondary metabolism that include CYPs in oxidative tailoring of antibiotics, sometimes influencing potency as bioactive compounds. Further to this is interest in CYPs in metabolism of xenobiotics for use as carbon sources for microbial growth and as biotransformation agents or in bioremediation. CYPs are also current and potential drug targets; compounds inhibiting CYP are antifungal and anti-protozoan agents, and potentially similar compounds may be useful against some bacterial diseases such as tuberculosis. Of note is the diversity of CYP requirements within an organism, ranging from Escherichia coli that has no CYPs as in many bacteria, to Mycobacterium smegmatis that has 40 representing 1% of coding genes. The basidiomycete fungus Phanerochaete chrysosporium surprised all when it was found to contain a hundred or more CYPs. The functional genomic investigation of these orphan CYPs is a major challenge for the future.
Yakovleva, Maria; Buzas, Orsolya; Matsumura, Hirotoshi; Samejima, Masahiro; Igarashi, Kiyohiko; Larsson, Per-Olof; Gorton, Lo; Danielsson, Bengt
2012-01-15
A novel method for lactose determination in milk is proposed. It is based on oxidation of lactose by cellobiose dehydrogenase (CDH) from the basidiomycete Phanerochaete chrysosporium, immobilised in an enzyme reactor. The reactor was prepared by cross-linking CDH onto aminopropyl-silanised controlled pore glass (CPG) beads using glutaraldehyde. The combined biosensor worked in flow injection analysis (FIA) mode and was developed for simultaneous monitoring of the thermometric signal associated with the enzymatic oxidation of lactose using p-benzoquinone as electron acceptor and the electrochemically generated current associated with the oxidation of the hydroquinone formed. A highly reproducible linear response for lactose was obtained between 0.05 mM and 30 mM. For a set of more than 500 samples an R.S.D. of less than 10% was achieved. The assay time was ca. 2 min per sample. The sensor was applied for the determination of lactose in dairy milk samples (milk with a fat content of 1.5% or 3% and also "lactose free" milk). No sample preparation except dilution with buffer was needed. The proposed method is rapid, suitable for repeated use and allows the possibility to compare results from two different detection methods, thus providing a built-in quality assurance. Some differences in the response observed between the methods indicate that the dual approach can be useful in mechanistic studies of redox enzymes. In addition, a dual system opens up interesting possibilities for studies of enzyme properties and mechanisms. Copyright © 2011 Elsevier B.V. All rights reserved.
Occurrence of indoor wood decay basidiomycetes in Europe
Czech Academy of Sciences Publication Activity Database
Gabriel, Jiří; Švec, Karel
2017-01-01
Roč. 31, č. 4 (2017), s. 212-217 ISSN 1749-4613 R&D Projects: GA ČR(CZ) GA17-05497S Institutional support: RVO:61388971 Keywords : Basidiomycetes * Fungi * Serpula lacrymans Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 3.231, year: 2016
Directory of Open Access Journals (Sweden)
Kátia M. G. Machado
2005-09-01
Full Text Available Remazol Brilliant Blue R (RBBR dye was used as substrate to evaluate ligninolytic activity in 125 basidiomycetous fungi isolated from tropical ecosystems. The extracellular RBBR decolorizing activity produced when selected fungi were grown in solid media and in soil contaminated with organochlorines was also evaluated. A total of 106 fungi decolorized the RBBR during the growth in malt extract agar (MEA, 2%; 96 fungi showed a mycelia growth and decolorization activity stronger than the P. chrysosporium used as reference. Extracellular extracts of 35 selected fungi grown on solid medium with sugar cane bagasse (BGS were evaluated for RBBR decolorization and peroxidase activity. All fungi showed peroxidase activities, but 5 of those were unable to decolorize the RBBR. Different patterns of ligninolytic enzymes were detected in 12 fungi extracts. Mn-dependent peroxidase (MnP was produced by Peniophora cinerea, Psilocybe castanella, three strains of Trametes villosa, T. versicolor, Melanoporia nigra and Trichaptum byssogenum. All 12 fungi had laccase activity. Trogia buccinalis showed the highest RBBR decolorization and did not produce MnP activity. RBBR decolorization without MnP production was also observed for three strains of Lentinum tested. Higher levels of peroxidase and laccase cannot be related to high RBBR decolorization. RBBR decolorization by extracellular extract was also detected during the growth of P. castanella, L. crinitus, P. cinerea and two strains of T. Villosa in pentachlorophenol- and hexachlorobenzene-contaminated soils. These fungi showed higher RBBR decolorization when grown in the presence of organochlorine compounds than when in non contaminated soil.O corante azul brilhante Remazol R (RBBR foi usado como substrato para avaliar 125 fungos basidiomicetos isolados de ecossistemas tropicais brasileiros quanto a atividade ligninolítica. A descoloração do RBBR por extratos obtidos do crescimento de fungos em meio sólido e
Koutrotsios, Georgios; Zervakis, Georgios I.
2014-01-01
Olive mill wastewater (OMW) constitutes a major cause of environmental pollution in olive-oil producing regions. Sixty wood-rot macrofungi assigned in 43 species were evaluated for their efficacy to colonize solidified OMW media at initially established optimal growth temperatures. Subsequently eight strains of the following species were qualified: Abortiporus biennis, Ganoderma carnosum, Hapalopilus croceus, Hericium erinaceus, Irpex lacteus, Phanerochaete chrysosporium, Pleurotus djamor, and P. pulmonarius. Fungal growth in OMW (25%v/v in water) resulted in marked reduction of total phenolic content, which was significantly correlated with the effluent's decolorization. A. biennis was the best performing strain (it decreased phenolics by 92% and color by 64%) followed by P. djamor and I. lacteus. Increase of plant seeds germination was less pronounced evidencing that phenolics are only partly responsible for OMW's phytotoxicity. Laccase production was highly correlated with all three biodegradation parameters for H. croceus, Ph. chrysosporium, and Pleurotus spp., and so were manganese-independent and manganese dependent peroxidases for A. biennis and I. lacteus. Monitoring of enzymes with respect to biomass production indicated that Pleurotus spp., H. croceus, and Ph. chrysosporium shared common patterns for all three activities. Moreover, generation of enzymes at the early biodegradation stages enhanced the efficiency of OMW treatment. PMID:24987685
Enhancement of Cotton Stalks Composting with Certain Microbial Inoculations
Directory of Open Access Journals (Sweden)
Osama Abdel-Twab Seoudi
2013-01-01
Full Text Available Effect of inoculation with Phanerochaete chrysosporium and Azotobacter chrococcum microbes on cotton stalks composting was studied in an attempt to achieve rapid maturity and desirable characteristics of produced compost. Composting process was maintained for 16 weeks under aerobic conditions with proper moisture content and turning piles. The C/N ratio of the mixtures was adjusted to about 30:1 before composting using chicken manure. Temperature evolution and its profile were monitored throughout the composting period. Mineralization rates of organic matter and changes in nitrogen content during composting stages were evaluated. Total plate count of mesophilic and thermophilic bacteria, cellulose decomposers and Azotobacter were determined during composting periods. The treatment of cotton stalks inoculated with both P. chrysosporium and Azotobacter gave the most desirable characteristics of the final product with respect to the narrow C/N ratio, high nitrogen content and high numbers of Azotobacter. The phytotoxicity test of compost extracts was evaluated. The use of P. chrysosporium in composting accelerated markedly decomposition process, so that 16 weeks composting enough to produce a stable and mature compost suitable for use as fertilizer while the fertilizer obtained by composting cotton stalks mixed with chicken manure and inoculated with microorganisms is highest quality Compost.
Directory of Open Access Journals (Sweden)
Georgios Koutrotsios
2014-01-01
Full Text Available Olive mill wastewater (OMW constitutes a major cause of environmental pollution in olive-oil producing regions. Sixty wood-rot macrofungi assigned in 43 species were evaluated for their efficacy to colonize solidified OMW media at initially established optimal growth temperatures. Subsequently eight strains of the following species were qualified: Abortiporus biennis, Ganoderma carnosum, Hapalopilus croceus, Hericium erinaceus, Irpex lacteus, Phanerochaete chrysosporium, Pleurotus djamor, and P. pulmonarius. Fungal growth in OMW (25%v/v in water resulted in marked reduction of total phenolic content, which was significantly correlated with the effluent’s decolorization. A. biennis was the best performing strain (it decreased phenolics by 92% and color by 64% followed by P. djamor and I. lacteus. Increase of plant seeds germination was less pronounced evidencing that phenolics are only partly responsible for OMW’s phytotoxicity. Laccase production was highly correlated with all three biodegradation parameters for H. croceus, Ph. chrysosporium, and Pleurotus spp., and so were manganese-independent and manganese dependent peroxidases for A. biennis and I. lacteus. Monitoring of enzymes with respect to biomass production indicated that Pleurotus spp., H. croceus, and Ph. chrysosporium shared common patterns for all three activities. Moreover, generation of enzymes at the early biodegradation stages enhanced the efficiency of OMW treatment.
Animal bioavailability of defined xenobiotic lignin metabolites
International Nuclear Information System (INIS)
Sandermann, H. Jr.; Arjmand, M.; Gennity, I.; Winkler, R.; Struble, C.B.; Aschbacher, P.W.
1990-01-01
Lignin has been recognized as a major component of bound pesticide residues in plants and is thought to be undigestible in animals. Two defined ring-U- 14 C-labeled chloroaniline/lignin metabolites have now been fed to rats, where a release of ∼66% of the bound xenobiotic occurred in the form of simple chloroaniline derivatives. The observed high degree of bioavailability indicates that bound pesticidal residues may possess ecotoxicological significance. In parallel studies, the white-rot fungus Phanerochaete chrysosporium was more efficient, and a soil system was much less efficient, in the degradation of the [ring-U- 14 C]chloroaniline/lignin metabolites
Understanding LiP Promoters from Phanerochaete chrysosporium: A Bioinformatic Analysis
Sergio Lobos; Rubén Polanco; Mario Tello; Dan Cullen; Daniela Seelenfreund; Rafael. Vicuña
2011-01-01
DNA contains the coding information for the entire set of proteins produced by an organism. The specific combination of proteins synthesized varies with developmental, metabolic and environmental circumstances. This variation is generated by regulatory mechanisms that direct the production of messenger ribonucleic acid (mRNA) and subsequent translation of the...
and Pb(ii) by Phanerochaete chrysosporium from a binary metal ...
African Journals Online (AJOL)
drinie
2001-01-01
Jan 1, 2001 ... Kinetic studies revealed that biosorption takes place in two stages: a rapid surface adsorption, within the ... With the help of multi-metal biosorption studies, these complex ..... bioreactor for color removal from bleach effluents.
Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade ...
Directory of Open Access Journals (Sweden)
Lehlohonolo Benedict Qhanya
Full Text Available Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s, heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence. Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea, Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala, revealed the presence of numerous putative P450s ranging from 267 (A. mellea to 14 (M. osmundae. Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host
Robert Riley; Asaf A. Salamov; Daren W. Brown; Laszlo G. Nagy; Dimitrios Floudas; Benjamin W. Held; Anthony Levasseur; Vincent Lombard; Emmanuelle Morin; Robert Otillar; Erika A. Lindquist; Hui Sun; Kurt M. LaButti; Jeremy Schmutz; Dina Jabbour; Hong Luo; Scott E. Baker; Antonio G. Pisabarro; Jonathan D. Walton; Robert A. Blanchette; Bernard Henrissat; Francis Martin; Daniel Cullen; David S. Hibbett; Igor V. Grigoriev
2014-01-01
Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood-decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic...
Energy Technology Data Exchange (ETDEWEB)
Labbe, Jessy L [ORNL; Murat, Claude [INRA, Nancy, France; Morin, Emmanuelle [INRA, Nancy, France; Le Tacon, F [UMR, France; Martin, Francis [INRA, Nancy, France
2011-01-01
It is becoming clear that simple sequence repeats (SSRs) play a significant role in fungal genome organization, and they are a large source of genetic markers for population genetics and meiotic maps. We identified SSRs in the Laccaria bicolor genome by in silico survey and analyzed their distribution in the different genomic regions. We also compared the abundance and distribution of SSRs in L. bicolor with those of the following fungal genomes: Phanerochaete chrysosporium, Coprinopsis cinerea, Ustilago maydis, Cryptococcus neoformans, Aspergillus nidulans, Magnaporthe grisea, Neurospora crassa and Saccharomyces cerevisiae. Using the MISA computer program, we detected 277,062 SSRs in the L. bicolor genome representing 8% of the assembled genomic sequence. Among the analyzed basidiomycetes, L. bicolor exhibited the highest SSR density although no correlation between relative abundance and the genome sizes was observed. In most genomes the short motifs (mono- to trinucleotides) were more abundant than the longer repeated SSRs. Generally, in each organism, the occurrence, relative abundance, and relative density of SSRs decreased as the repeat unit increased. Furthermore, each organism had its own common and longest SSRs. In the L. bicolor genome, most of the SSRs were located in intergenic regions (73.3%) and the highest SSR density was observed in transposable elements (TEs; 6,706 SSRs/Mb). However, 81% of the protein-coding genes contained SSRs in their exons, suggesting that SSR polymorphism may alter gene phenotypes. Within a L. bicolor offspring, sequence polymorphism of 78 SSRs was mainly detected in non-TE intergenic regions. Unlike previously developed microsatellite markers, these new ones are spread throughout the genome; these markers could have immediate applications in population genetics.
Directory of Open Access Journals (Sweden)
Martin Vohník
Full Text Available Ericaceae (the heath family are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed 'sheathed ericoid mycorrhiza', discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet
Assessment of wood-inhabiting Basidiomycetes for biokraft pulping of softwood chips
CSIR Research Space (South Africa)
Wolfaardt, F
2004-10-01
Full Text Available Wood-inhabiting Basidiomycetes have been screened for various applications in the pulp and paper industry and it is evident that different fungi need to be used to suit the specific requirements of each application. This study assessed...
Pouvreau, L.A.M.; Jonathan, M.C.; Kabel, M.A.; Hinz, S.W.A.; Gruppen, H.; Schols, H.A.
2011-01-01
Two novel acetyl xylan esterases, Axe2 and Axe3, from Chrysosporium lucknowense (C1), belonging to the carbohydrate esterase families 5 and 1, respectively, were purified and biochemically characterized. Axe2 and Axe3 are able to hydrolyze acetyl groups both from simple acetylated
DEGRADATION OF TEXTILE DYES BY WHITE ROT BASIDIOMYCETES
B.P. PARMAR, P.N. MERVANA B.R.M. VYAS*
2014-01-01
ABSTRACT: Dyes released by the textile industries pose a threat to environmental quality. Ligninolytic white-rot basidiomycetes can effectively degrade colored effluents and conventional dyes. White-rot fungi produce various isoforms of extracellular oxidases including laccase, Mn peroxidase and lignin peroxidase (LiP), which are involved in the degradation of lignin in their natural lignocellulosic substrates. The textile industry, by far the most avid user of synthetic dyes, is in need...
Effects of selenium oxyanions on the white-rot fungus Phanerochaete chrysosporium
Espinosa-Ortiz, Erika J.; Gonzalez-Gil, Graciela; Saikaly, Pascal; van Hullebusch, Eric D.; Lens, Piet N L
2014-01-01
and substrate consumption when supplied at 10 mg L−1 in the growth medium, whereas selenate did not have such a strong influence on the fungus. Biological removal of selenite was achieved under semi-acidic conditions (pH 4.5) with about 40 % removal efficiency
Mittelbach, Moritz; Yurkov, Andrey M; Nocentini, Daniele; Nepi, Massimo; Weigend, Maximilian; Begerow, Dominik
2015-02-01
Studies on the diversity of yeasts in floral nectar were first carried out in the late 19th century. A narrow group of fermenting, osmophilous ascomycetes were regarded as exclusive specialists able to populate this unique and species poor environment. More recently, it became apparent that microorganisms might play an important role in the process of plant pollination. Despite the importance of these nectar dwelling yeasts, knowledge of the factors that drive their diversity and species composition is scarce. In this study, we linked the frequencies of yeast species in floral nectars from various host plants on the Canary Islands to nectar traits and flower visitors. We estimated the structuring impact of pollination syndromes (nectar volume, sugar concentration and sugar composition) on yeast diversity.The observed total yeast diversity was consistent with former studies, however, the present survey yielded additional basidiomycetous yeasts in unexpectedly high numbers. Our results show these basidiomycetes are significantly associated with ornithophilous flowers. Specialized ascomycetes inhabit sucrose-dominant nectars, but are surprisingly rare in nectar dominated by monosaccharides. There are two conclusions from this study: (i) a shift of floral visitors towards ornithophily alters the likelihood of yeast inoculation in flowers, and (ii) low concentrated hexose-dominant nectar promotes colonization of flowers by basidiomycetes. In the studied floral system, basidiomycete yeasts are acknowledged as regular members of nectar. This challenges the current understanding that nectar is an ecological niche solely occupied by ascomycetous yeasts.
Kuhar, Sarika; Nair, Lavanya M; Kuhad, Ramesh Chander
2008-04-01
Phanerochaete chrysosporium, Pycnoporus cinnabarinus,and fungal isolates RCK-1 and RCK-3 were tested for their lignin degradation abilities when grown on wheat straw (WS) and Prosopis juliflora (PJ) under solid-state cultivation conditions. Fungal isolate RCK-1 degraded more lignin in WS (12.26% and 22.64%) and PJ (19.30% and 21.97%) and less holocellulose in WS (6.27% and 9.39%) and PJ (3.01% and 4.58%) after 10 and 20 days, respectively, than other fungi tested. Phanerochaete chrysosporium caused higher substrate mass loss and degraded more of holocellulosic content (WS: 55.67%; PJ: 48.89%) than lignin (WS: 18.89%; PJ: 20.20%) after 20 days. The fungal pretreatment of WS and PJ with a high-lignin-degrading and low-holocellulose-degrading fungus (fungal isolate RCK-1) for 10 days resulted in (i) reduction in acid load for hydrolysis of structural polysaccharides (from 3.5% to 2.5% in WS and from 4.5% to 2.5% in PJ), (ii) an increase in the release of fermentable sugars (from 30.27 to 40.82 g L(-1) in WS and from 18.18 to 26.00 g L(-1) in PJ), and (iii) a reduction in fermentation inhibitors (total phenolics) in acid hydrolysate of WS (from 1.31 to 0.63 g L(-1)) and PJ (from 2.05 to 0.80 g L(-1)). Ethanol yield and volumetric productivity from RCK-1-treated WS (0.48 g g(-1) and 0.54 g L(-1) h(-1), respectively) and PJ (0.46 g g(-1) and 0.33 g L(-1) h(-1), respectively) were higher than untreated WS (0.36 g g(-1) and 0.30 g L(-1) h(-1), respectively) and untreated PJ (0.42 g g(-1) and 0.21 g L(-1) h(-1), respectively).
Fungal degradation of organophosphorous insecticides
Energy Technology Data Exchange (ETDEWEB)
Bumpus, J.A. [Notre Dame Univ., IN (United States); Kakar, S.N.; Coleman, R.D. [Argonne National Lab., IL (United States)
1992-07-01
Organophosphorous insecticides are used extensively to treat a variety of pests and insects. Although as a group they are easily degraded by bacteria in the environment, a number of them have half-lives of several months. Little is known about their biodegradation by fungi. We have shown that Phanerochaete chrysosporium can substantially degrade chlorpyrifos, fonofos, and terbufos (27.5%, 12.2%, and 26.6%, respectively) during 18-day incubation in nitrogen-limited stationary cultures. The results demonstrate that the clorinated pyridinyl ring of chlorpyrifos and the phenyl ring of fonofos undergo ring cleavage during biodegradation by the fungus. The usefulness of the fungus system for bioremediation is discussed. 16 refs., 7 figs., 2 tabs.
Fungal degradation of organophosphorous insecticides
Energy Technology Data Exchange (ETDEWEB)
Bumpus, J.A. (Notre Dame Univ., IN (United States)); Kakar, S.N.; Coleman, R.D. (Argonne National Lab., IL (United States))
1992-01-01
Organophosphorous insecticides are used extensively to treat a variety of pests and insects. Although as a group they are easily degraded by bacteria in the environment, a number of them have half-lives of several months. Little is known about their biodegradation by fungi. We have shown that Phanerochaete chrysosporium can substantially degrade chlorpyrifos, fonofos, and terbufos (27.5%, 12.2%, and 26.6%, respectively) during 18-day incubation in nitrogen-limited stationary cultures. The results demonstrate that the clorinated pyridinyl ring of chlorpyrifos and the phenyl ring of fonofos undergo ring cleavage during biodegradation by the fungus. The usefulness of the fungus system for bioremediation is discussed. 16 refs., 7 figs., 2 tabs.
Energy Technology Data Exchange (ETDEWEB)
Cossar, D; Canevascini, G
1986-07-01
The cellulolytic fungus Sporotrichum (Chrysosporium) thermophile produces an extracellular cellobiose dehydrogenase during batch culture on cellulose or cellobiose. In chemostat culture at pH 5.6 on cellobiose this enzyme was produced in parallel with endo-cellulase. At pH 5.0 in continuous or fed-batch culture such a pattern was not evident. At constant growth rate in a chemostat with varying pH, activity of these enzymes was found to be poorly correlated. Thus the induction of cellobiose dehydrogenase shows a dependence on pH and cellobiose concentration which is different to that for endo-cellulase. The natural inducer of these enzymes and the role of cellubiose dehydrogenase remain to be elucidated.
Biological potential of extracts of the wild edible Basidiomycete mushroom Grifola frondosa
Klaus, A.; Kozarski, M.; Vunduk, N.; Todorovic, N.; Jakovlejevic, D.; Zizak, Z.; Pavlovic, V.; Levic, S.; Niksic, M.; Griensven, van L.J.L.D.
2015-01-01
Partially purified polysaccharides (FP) and hot alkali extract (FNa) obtained from fruiting bodies of the wild basidiomycete Grifola frondosa were examined for their antimicrobial, antioxidant and cytotoxic activity. The structural properties of FP and FNa samples were investigated by FT-IR and high
Fungal biodegradation of anthracene-polluted cork: A comparative study.
Jové, Patrícia; Olivella, Maria À; Camarero, Susana; Caixach, Josep; Planas, Carles; Cano, Laura; De Las Heras, Francesc X
2016-01-01
The efficiency of cork waste in adsorbing aqueous polycyclic aromatic hydrocarbons (PAHs) has been previously reported. Biodegradation of contaminated cork using filamentous fungi could be a good alternative for detoxifying cork to facilitate its final processing. For this purpose, the degradation efficiency of anthracene by three ligninolytic white-rot fungi (Phanerochaete chrysosporium, Irpex lacteus and Pleurotus ostreatus) and three non-ligninolytic fungi which are found in the cork itself (Aspergillus niger, Penicillium simplicissimum and Mucor racemosus) are compared. Anthracene degradation by all fungi was examined in solid-phase cultures after 0, 16, 30 and 61 days. The degradation products of anthracene by P. simplicissimum and I. lacteus were also identified by GC-MS and a metabolic pathway was proposed for P. simplicissimum. Results show that all the fungi tested degraded anthracene. After 61 days of incubation, approximately 86%, 40%, and 38% of the initial concentration of anthracene (i.e., 100 µM) was degraded by P. simplicissimum, P. chrysosporium and I. lacteus, respectively. The rest of the fungi degraded anthracene to a lesser extent (cork itself, could be used as an efficient degrader of PAH-contaminated cork.
Analysis of basidiomycete pigments in situ by Raman spectroscopy.
Tauber, James P; Matthäus, Christian; Lenz, Claudius; Hoffmeister, Dirk; Popp, Jürgen
2018-02-07
Basidiomycetes, that is, mushroom-type fungi, are known to produce pigments in response to environmental impacts. As antioxidants with a high level of unsaturation, these compounds can neutralize highly oxidative species. In the event of close contact with other microbes, the enzymatically controlled pigment production is triggered and pigment secretion is generated at the interaction zone. The identification and analysis of these pigments is important to understand the defense mechanism of fungi, which is essential to counteract an uncontrolled spread of harmful species. Usually, a detailed analysis of the pigments is time consuming as it depends on laborious sample preparation and isolation procedures. Furthermore, the applied protocols often influence the chemical integrity of the compound of interest. A possibility to noninvasively investigate the pigmentation is Raman microspectroscopy. The methodology has the potential to analyze the chemical composition of the sample spatially resolved at the interaction zone. After the acquisition of a representative spectroscopic library, the pigment production by basidiomycetes was monitored for during response to different fungi and bacteria. The presented results describe a very efficient noninvasive way of pigment analysis which can be applied with minimal sample preparation. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Biomass pyrolysis liquid to citric acid via 2-step bioconversion.
Yang, Zhiguang; Bai, Zhihui; Sun, Hongyan; Yu, Zhisheng; Li, Xingxing; Guo, Yifei; Zhang, Hongxun
2014-12-31
The use of fossil carbon sources for fuels and petrochemicals has serious impacts on our environment and is unable to meet the demand in the future. A promising and sustainable alternative is to substitute fossil carbon sources with microbial cell factories converting lignocellulosic biomass into desirable value added products. However, such bioprocesses require tolerance to inhibitory compounds generated during pretreatment of biomass. In this study, the process of sequential two-step bio-conversion of biomass pyrolysis liquid containing levoglucosan (LG) to citric acid without chemical detoxification has been explored, which can greatly improve the utilization efficiency of lignocellulosic biomass. The sequential two-step bio-conversion of corn stover pyrolysis liquid to citric acid has been established. The first step conversion by Phanerochaete chrysosporium (P. chrysosporium) is desirable to decrease the content of other compounds except levoglucosan as a pretreatment for the second conversion. The remaining levoglucosan in solution was further converted into citric acid by Aspergillus niger (A. niger) CBX-209. Thus the conversion of cellulose to citric acid is completed by both pyrolysis and bio-conversion technology. Under experimental conditions, levoglucosan yield is 12% based on the feedstock and the citric acid yield can reach 82.1% based on the levoglucosan content in the pyrolysis liquid (namely 82.1 g of citric acid per 100 g of levoglucosan). The study shows that P. chrysosporium and A. niger have the potential to be used as production platforms for value-added products from pyrolyzed lignocellulosic biomass. Selected P. chrysosporium is able to decrease the content of other compounds except levoglucosan and levoglucosan can be further converted into citric acid in the residual liquids by A. niger. Thus the conversion of cellulose to citric acid is completed by both pyrolysis and bio-conversion technology.
Extracellular oxidases and the transformation of solubilised low-rank coal by wood-rot fungi
Energy Technology Data Exchange (ETDEWEB)
Ralph, J.P. [Flinders Univ. of South Australia, Bedford Park (Australia). School of Biological Sciences; Graham, L.A. [Flinders Univ. of South Australia, Bedford Park (Australia). School of Biological Sciences; Catcheside, D.E.A. [Flinders Univ. of South Australia, Bedford Park (Australia). School of Biological Sciences
1996-12-31
The involvement of extracellular oxidases in biotransformation of low-rank coal was assessed by correlating the ability of nine white-rot and brown-rot fungi to alter macromolecular material in alkali-solubilised brown coal with the spectrum of oxidases they produce when grown on low-nitrogen medium. The coal fraction used was that soluble at 3.0{<=}pH{<=}6.0 (SWC6 coal). In 15-ml cultures, Gloeophyllum trabeum, Lentinus lepideus and Trametes versicolor produced little or no lignin peroxidase, manganese (Mn) peroxidase or laccase activity and caused no change to SWC6 coal. Ganoderma applanatum and Pycnoporus cinnabarinus also produced no detectable lignin or Mn peroxidases or laccase yet increased the absorbance at 400 nm of SWC6 coal. G. applanatum, which produced veratryl alcohol oxidase, also increased the modal apparent molecular mass. SWC6 coal exposed to Merulius tremellosus and Perenniporia tephropora, which secreted Mn peroxidases and laccase and Phanerochaete chrysosporium, which produced Mn and lignin peroxidases was polymerised but had unchanged or decreased absorbance. In the case of both P. chrysosporium and M. tremellosus, polymerisation of SWC6 coal was most extensive, leading to the formation of a complex insoluble in 100 mM NaOH. Rigidoporus ulmarius, which produced only laccase, both polymerised and reduced the A{sub 400} of SWC6 coal. P. chrysosporium, M. tremellosus and P. tephropora grown in 10-ml cultures produced a spectrum of oxidases similar to that in 15-ml cultures but, in each case, caused more extensive loss of A{sub 400}, and P. chrysosporium depolymerised SWC6 coal. It is concluded that the extracellular oxidases of white-rot fungi can transform low-rank coal macromolecules and that increased oxygen availability in the shallower 10-ml cultures favours catabolism over polymerisation. (orig.)
VITAMIN EFFECT ON THE SYNTHESIS ОF POLYPHENOLIC SUBSTANCES BY BASIDIOMYCETES
Directory of Open Access Journals (Sweden)
Veligodska A. K.
2013-12-01
Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.
[Oil degradation by basidiomycetes in soil and peat at low temperatures].
Kulikova, N A; Klein, O I; Pivchenko, D V; Landesman, E O; Pozdnyakova, N N; Turkovskaya, O V; Zaichik, B Ts; Ruzhitskii, A O; Koroleva, O V
2016-01-01
A total of 17 basidiomycete strains causing white rot and growing on oil-contaminated substrates have been screened. Three strains with high (Steccherinum murashkinskyi), average (Trametes maxima), and low (Pleurotus ostreatus) capacities for the colonization of oil-contaminated substrates have been selected. The potential for degrading crude oil hydrocarbons has been assessed with the use of fungi grown on nonsterile soil and peat at low temperatures. Candida sp. and Rhodococcus sp. commercial strains have been used as reference organisms with oil-degrading ability. All microorganisms introduced in oil-contaminated soil have proved to be ineffective, whereas the inoculation of peat with basidiomycetes and oil-degrading microorganisms accelerated the destruction of oil hydrocarbons. The greatest degradation potential of oil-aliphatic hydrocarbons has been found in S. murashlinskyi. T. maxima turned out to be the most successful in degrading aromatic hydrocarbons. It has been suggested that aboriginal microflora contributes importantly to the effectiveness of oil-destructing microorganisms. T. maxima and S. murashkinskyi strains are promising for further study as oil-oxidizing agents during bioremediation of oil-contaminated peat soil under conditions of low temperatures.
Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Griensven, van L.J.L.D.
2011-01-01
Antioxidant properties of hot water extract (HWE), hot water extracted polysaccharides (HWP) and hot alkali extracted polysaccharides (HWAE) were obtained from fruiting bodies of the wild basidiomycete Schizophyllum commune. All extracts contained both a- and ß-glucans as determined by Megazyme
Hirsutane Sesquiterpenes from Cultures of the Basidiomycete Marasmiellus sp. BCC 22389
Directory of Open Access Journals (Sweden)
Masahiko Isaka
2016-08-01
Full Text Available Abstract Two new hirsutane sesquiterpenes, marasmiellins A (1 and B (2, were isolated from cultures of the basidiomycete Marasmiellus sp. BCC 22389. The structures were elucidated on the basis of NMR spectroscopic and mass spectrometry data. The absolute configuration of marasmiellin B was determined by application of the modified Mosher’s method. Graphical Abstract
Abarca, M L; Martorell, J; Castellá, G; Ramis, A; Cabañes, F J
2008-06-01
This report describes the first isolation of a Chrysosporium species as the etiological agent of dermatomycosis in two green iguanas (Iguana iguana). The ITS-5.8S rRNA gene of the two strains was sequenced and a search on the GenBank database revealed that the closest match was Nannizziopsis vriesii. Treatment with oral ketoconazole, in combination with topical 2% chlorhexidine solution and terbinafine resulted in clinical cure.
Directory of Open Access Journals (Sweden)
Leeuwen, J.
2011-01-01
Full Text Available Three fungal species were evaluated for their abilities to saccharify pure cellulose. The three species chosen represented three major wood-rot molds; brown rot (Gloeophyllum trabeum, white rot (Phanerochaete chrysosporium and soft rot (Trichoderma reesei. After solid state fermentation of the fungi on the filter paper for four days, the saccharified cellulose was then fermented to ethanol by using Saccharomyces cerevisiae. The efficiency of the fungal species in saccharifying the filter paper was compared against a low dose (25 FPU/g cellulose of a commercial cellulase. Total sugar, cellobiose and glucose were monitored during the fermentation period, along with ethanol, acetic acid and lactic acid. Results indicated that the most efficient fungal species in saccharifying the filter paper was T. reesei with 5.13 g/100 g filter paper of ethanol being produced at days 5, followed by P. chrysosporium at 1.79 g/100 g filter paper. No ethanol was detected for the filter paper treated with G. trabeum throughout the five day fermentation stage. Acetic acid was only produced in the sample treated with T. reesei and the commercial enzyme, with concentration 0.95 and 2.57 g/100 g filter paper, respectively at day 5. Lactic acid production was not detected for all the fungal treated filter paper after day 5. Our study indicated that there is potential in utilizing in situ enzymatic saccharification of biomass by using T. reesei and P. chrysosporium that may lead to an economical simultaneous saccharification and fermentation process for the production of fuel ethanol.
The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery
International Nuclear Information System (INIS)
Bayles, C.J.; Aist, J.R.; Berns, M.W.
1993-01-01
Bayles, C. J., Aist, J. R., and Berns, M. W. 1993. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery. Experimental Mycology 17, 191-199. Cytoplasmic forces were found to be actively pulling on the spindle pole bodies during anaphase B in the dikaryotic, basidiomycete fungus, Helicobasidium mompa. When the spindle of one nucleus was severed with a laser microbeam at mid anaphase B, its two spindle pole bodies separated at a much faster rate than did those of the intact spindle in the other nucleus of the same cell. Since astral microtubule populations apparently reach their maximum during anaphase B in this fungus, we suggest that these microtubules may be involved in the cytoplasmic pulling forces. The spindle appears to act primarily as a governor, regulating the rate at which the spindle pole bodies are separated
A Comparative Study of the Cell Wall Structure of Basidiomycetous and Related Yeasts
Kreger-van Rij, N.J.W.; Veenhuis, M.
1971-01-01
The wall of basidiomycetous and related yeasts showed a lamellar structure in sections of both budding cells and hyphae fixed with potassium permanganate. The yeasts also had a typical way of bud formation and septation. These features differ from those recorded for ascomycetous yeasts. In the
The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans
Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.
2005-01-01
Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype i...
Directory of Open Access Journals (Sweden)
Chandran M. Ajila
2015-06-01
Full Text Available Apple pomace is a by-product from the apple processing industry and can be used for the production of many value-added compounds such as enzymes, proteins, and nutraceuticals, among others. An investigation was carried out to study the improvement in the protein content in apple pomace by solid-state fermentation using the fungus Phanerochaete chrysosporium by tray fermentation method. The effect of this protein in terms of how it enriched apple pomace as animal feed for pigs has also been studied. There was a 36% increase in protein content in the experimental diet with 5% w/w fermented apple pomace. The efficiency of conversion of ingested food was increased from 43.5 ± 2.5 to 83.1 ± 4.4 in the control group and the efficiency of conversion of feed increased from 55.4 ± 4.5 to 92.1 ± 3.6 in the experimental group during the animal feed experiment. Similarly, the effect of a protein enriched diet on odor emission and greenhouse gas emission has also been studied. The results demonstrated that the protein enrichment of apple pomace by solid state cultivation of the fungus P. chrysosporium makes it possible to use it as a dietary supplement for pigs.
Son, E; Kim, J-J; Lim, Y W; Au-Yeung, T T; Yang, C Y H; Breuil, C
2011-01-01
When lodgepole pines (Pinus contorta Douglas ex Louden var. latifolia Engelm. ex S. Watson) that are killed by the mountain pine beetle (Dendroctonus ponderosae) and its fungal associates are not harvested, fungal decay can affect wood and fibre properties. Ophiostomatoids stain sapwood but do not affect the structural properties of wood. In contrast, white or brown decay basidiomycetes degrade wood. We isolated both staining and decay fungi from 300 lodgepole pine trees killed by mountain pine beetle at green, red, and grey stages at 10 sites across British Columbia. We retained 224 basidiomycete isolates that we classified into 34 species using morphological and physiological characteristics and rDNA large subunit sequences. The number of basidiomycete species varied from 4 to 14 species per site. We assessed the ability of these fungi to degrade both pine sapwood and heartwood using the soil jar decay test. The highest wood mass losses for both sapwood and heartwood were measured for the brown rot species Fomitopsis pinicola and the white rot Metulodontia and Ganoderma species. The sap rot species Trichaptum abietinum was more damaging for sapwood than for heartwood. A number of species caused more than 50% wood mass losses after 12 weeks at room temperature, suggesting that beetle-killed trees can rapidly lose market value due to degradation of wood structural components.
Evaluation of the types of starch for preparation of LDPE/starch blends
Directory of Open Access Journals (Sweden)
Glória Maria Vinhas
2007-05-01
Full Text Available This study evaluated in relation the growth, and the amylolytic activity of mixed and isolated cultures of Phanerochaete chrysosporium and Talaromyces wortmanni on different types of starch. The thermal and mechanical properties in polyethylene/starch blends (proportion: 80/20 (w/w before and after inoculation of the mixed cultures were evaluated. The regular starch Amidex 3 and the modified starch Fox5901 stood out in relation to the cellular growth and production of the amylase enzyme. In spite of the short time that the blends were exposed to the fungi, the microorganisms promoted physical and chemical changes in the structure of the blend, modifying its thermal and mechanical properties. The alteration of the degree of crystallinity and mechanical properties of the blends could be indications of the modification caused by the biodegradation process.Nesse trabalho foi realizado um estudo sobre diferentes tipos de amido quanto ao crescimento, e a atividade amilolítica de culturas mistas e isoladas dos fungos Phanerochaete chrysosporium e Talaromyces wortmannii. Avaliaram-se também as propriedades térmicas e mecânicas das blendas de polietileno/amido anfótero (na proporção 80/20 (m/m antes e apos a inoculação das culturas mistas desses fungos.O amido regular Amidex 3 e o amido modificado Fox5901 foram os que se destacaram quanto ao crescimento celular e produção da enzima amilase. Apesar do pouco tempo de exposição dos filmes com os fungos, pode-se concluir que os microrganismos promovem mudanças físicas e químicas na estrutura da blenda, modificando suas propriedades térmicas e mecânicas. A alteração do grau de cristalinidade e das propriedades mecânicas das blendas podem ser indícios da modificação provocada pelo processo de biodegradação.
Energy Technology Data Exchange (ETDEWEB)
Valentine, Nancy B.(BATTELLE (PACIFIC NW LAB)); Wahl, Jon H.(BATTELLE (PACIFIC NW LAB)); Kingsley, Mark T.(BATTELLE (PACIFIC NW LAB)); Wahl, Karen L.(BATTELLE (PACIFIC NW LAB))
2001-12-01
Intact spores and/or hyphae of Aspergillus niger, Rhizopus oryzae, Trichoderma reesei and Phanerochaete chrysosporium are analyzed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS). This study investigates various methods of sample preparation and matrices to determine optimum collection and analysis criteria for fungal analysis by MALDI-MS. Fungi are applied to the MALDI sample target as untreated, sonicated, acid/heat treated, or blotted directly from the fungal culture with double-stick tape. Ferulic acid or sinapinic acid matrix solution is layered over the dried samples and analyzed by MALDI-MS. Statistical analysis of the data show that simply using double stick tape to collect and transfer to a MALDI sample plate typically worked as well as the other preparation methods, but requires the least sample handling.
Removal of Cr(VI) from aqueous solution by fungal biomass
Energy Technology Data Exchange (ETDEWEB)
Ahluwalia, Sarabjeet Singh [Department of Biotechnology, General Shivdev Singh Diwan Gurbachan Singh Khalsa College, Patiala, Punjab (India); Goyal, Dinesh [Department of Biotechnology and Environmental Sciences, Thapar University, Patiala, Punjab (India)
2010-10-15
Chromium compounds are released by industrial processes including leather production, mining, petroleum refining, in textile industry and dyeing. They are a significant threat to the environment and public health because of their toxicity. Removal of hexavalent chromium by living biomass of different fungi was effective in the order of Aspergillus terricola>Aspergillus niger>Acremonium strictum>Aureobasidium pullulans>Paecilomyces variotii>Aspergillus foetidus>Cladosporium resinae>Phanerochaete chrysosporium. Non-living dried fungal biomass showed higher potential for metal removal than living cells. Among all fungi dead biomass of P. chrysosporium, C. resinae and P. variotii had the maximum specific chromium uptake capacity, which was 11.02, 10.69 and 10.35 mg/g of dry biomass respectively at pH 4.0-5.0 in batch sorption. Removal of Cr(VI) by P. chrysosporium from multi-metallic synthetic solution as well as chrome effluent was significant by bringing down the residual concentration to 0.1 mg/L in the effluent, which falls within the permissible range and its removal was not affected by the presence of other metal ions such as Fe, Zn and Ni. Fourier transform infrared spectral analysis revealed the presence of carboxylate (C=O) and amine (-NH{sup +}{sub 3}-NH{sup +}{sub 2}) functional groups commonly present on the cell surface of all fungi, with possible involvement in chromium binding. The result indicates that non-living fungal biomass either obtained as a by-product of fermentation industry or mass produced using inexpensive culture media can be used for bioremediation of Cr(VI) from chrome effluent on large scale. (Copyright copyright 2010 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Casieri, Leonardo; Anastasi, Antonella; Prigione, Valeria; Varese, Giovanna Cristina
2010-11-01
Basidiomycetes are essential in forest ecology, being deeply involved in wood and litter decomposition, humification, and mineralization of soil organic matter. The fungal oxidoreductases involved in these processes are today the focus of much attention with a view to their applications. The ecological role and potential biotechnological applications of 300 isolates of Basidiomycetes were assessed, taking into account the degradation of model dyes in different culture conditions and the production of oxidoreductase enzymes. The tested isolates belong to different ecophysiological groups (wood-degrading, litter-degrading, ectomycorrhizal, and coprophilous fungi) and represent a broad systematic and functional biodiversity among Basidiomycetes occurring in deciduous and evergreen forests of northwest Italy (Piedmont Region). The high number of species tested and the use of different culture conditions allowed the investigation of the degradation activity of several novel species, neglected to date. Oxidative enzyme activities varied widely among all ecophysiological groups and laccases were the most commonly detected enzymes. A large number of isolates (86%), belonging to all ecophysiological groups, were found to be active against at least one model dye; the wood-degrading fungi represented the most efficient group. Noteworthily, also some isolates of litter-degrading and ectomycorrhizal fungi achieved good decolorization yield. The 25 best isolates were then tested against nine industrial dyes commonly employed in textile industries. Three isolates of Bjerkandera adusta efficiently decolorized the dyes on all media and can be considered important candidates for application in textile wastewater treatment.
Muller, L.; LAMBAERTS, Marc; VANGRONSVELD, Jaco; COLPAERT, Jan
2006-01-01
Eight microsatellite loci were isolated from the ectomycorrhizal basidiomycete Suillus luteus using a dual-suppression-polymerase chain reaction (PCR) method. In a test sample of 40 isolates, the total number of alleles per locus and the expected heterozygosities ranged from five to 16 and from 0.532 to 0.811, respectively. These highly polymorphic markers allow an accurate description of the genetic diversity and structure of S. luteus populations.
Semarjit Shary; Alexander N. Kapich; Ellen A. Panisko; Jon K. Magnuson; Daniel Cullen; Kenneth E. Hammel
2008-01-01
Fungal lignin-degrading systems likely include membrane-associated proteins that participate in diverse processes such as uptake and oxidation of lignin fragments, production of ligninolytic secondary metabolites, and defense of the mycelium against ligninolytic oxidants. Little is known about the nature or regulation of these membrane-associated components. We grew...
Gusakov, A.V.; Sinitsyn, A.P.; Salanovich, T.N.; Bukhtojarov, F.E.; Markov, A.V.; Ustinov, B.B.; Zeijl, C.V.; Punt, P.; Burlingame, R.
2005-01-01
Two forms of cellobiohydrolase I (CBH I, Cel7A) were purified from the culture ultrafiltrate of a mutant strain of the fungus Chrysosporium lucknowense, an industrial producer of cellulases and hemicellulases. The enzymes had different molecular masses (52 and 65 kDa, SDS-PAGE data) but the same pI
Ivan P. Edwards; Jennifer L. Cripliver; Andrew R. Gillespie; Kurt H. Johnsen; M. Scholler; Ronald F. Turco
2004-01-01
We investigated the effect of an optimal nutrition strategy designed to maximize loblolly pine (Pinus taeda) growth on the rank abundance structure and diversity of associated basidiomycete communities.We conducted both small- and large-scale below-ground surveys 10 years after the initiation of optimal...
Directory of Open Access Journals (Sweden)
Zdzisław Tagoński
2014-08-01
Full Text Available Studies were carried-out on the ability of 18 strains of 15 white-rot and brown-rot basidiomycetons fungi to degrade wood components and to synthesize cellulolytic enzymes and laccase. 28,5% lignin and 26,1% carbohydrates of pine wood meal, 46,2% lignin and 67,8% carbohydrates of beech wood meal was degraded after 6 weeks incubation by the white-rot fungus Phanerochate chrysosporium. The highest activity of laccase was obtained in from fungi Coriotus zonatus and Fomes fomentarius.
Steffen, K T; Hofrichter, M; Hatakka, A
2000-12-01
Within a screening program, 27 soil litter-decomposing basidiomycetes were tested for ligninolytic enzyme activities using agar-media containing 2,2'-azinobis(3-ethylbenzthiazoline-6-sulphonate), a humic acid or Mn2+ ions as indicator substrates. Most active species were found within the family Strophariaceae (Agrocybe praecox, Stropharia coronilla, S. rugosoannulata) and used for mineralisation experiments with a 14C-ring-labelled synthetic lignin (14C-DHP). The fungi mineralised around 25% of the lignin to 14CO2 within 12 weeks of incubation in a straw environment; about 20% of the lignin was converted to water-soluble fragments. Mn-peroxidase was found to be the predominant ligninolytic enzyme of all three fungi in liquid culture and its production was strongly enhanced in the presence of Mn2+ ions. The results of this study demonstrate that certain ubiquitous litter-decomposing basidiomycetes possess ligninolytic activities similar to the wood-decaying white-rot fungi, the most efficient lignin degraders in nature.
Improving the yield and quality of DNA isolated from white-rot fungi.
Kuhad, R C; Kapoor, R K; Lal, R
2004-01-01
A new simple method used to eliminate polysaccharides that cause problems during DNA isolation was established for 6 different white-rot fungi using 1% hexadecyltrimethylammonium bromide (CTAB) as wash buffer and followed by centrifugation. Variation in the DNA yield and quality was ascertained using precipitating agents, detergents and cell-wall-hydrolyzing chitinase. Considerable amount of exopolysaccharides from fungal biomass was removed with the use of 1% CTAB wash buffer followed by centrifugation. The DNA varied in terms of yield and quality. For the DNA extraction use of 2% SDS in extraction buffer worked best for Pycnoporus cinnabarinus, Cyathus bulleri, Cyathus striatus and Cyathus stercoreus, while 2% CTAB worked best for Phanerochaete chrysosporium and Pleurotus ostreatus. Elimination of phenol and use of absolute ethanol for precipitating DNA resulted in good yield and quality of DNA. This DNA was amenable to restriction endonuclease digestion.
Bioremediation of lignosulphonates by lignin-degrading basidiomycetous fungi.
Eugenio, M E; Carbajo, J M; Terrón, M C; González, A E; Villar, J C
2008-07-01
The capability of some ligninolytic fungi to degrade lignosulphonates has been studied. Three lignosulphonates concentrations, three culture media and seven different basidiomycetes in solid-cultures have been assayed to select the conditions for further experiments on submerged cultures. The best results of growth and lignosulphonate decolourization in solid-cultures were obtained with Pycnoporus sanguineus, Coriolus pubescens and Trametes sp. I-62 on Kirk's medium and 1% and 2% of lignosulphonate concentrations. In submerged cultures the lignosulphonate decolourization rate was generally higher when it was added on the 6th day, rather than when it was added from the beginning of the incubation and C. pubescens and P. sanguineus showed again the optimum results of decolourization. Extracellular laccase activity increased with lignosulphonate concentration in all assayed fungi, suggesting that lignosulphonate act as inductors of laccase activity.
Directory of Open Access Journals (Sweden)
FELIPE B. VALER
2016-01-01
Full Text Available ABSTRACT Drosophilidae is one of the most representative families of insects that occurs in fungal fruiting bodies of Basidiomycetes; however, the diversity and community structure of mycophagous Drosophilidae in the Neotropical region is poorly known. The aims of the present study were to describe the diversity of mycophagous Drosophilidae and to investigate its colonization of fungal hosts in a forest of southern Brazil. From 120 fungal samples (patches of mushrooms of 17 Basidiomycetes genera, flies were recorded emerging from 70 samples and collected in adult stages of 25 fungal samples, for a total of 4897 drosophilids belonging to 31 species and 5 genera. Drosophila Fallén was the most species-rich genus, whereas Hirtodrosophila Duda was the dominant genus. Studies performed in the Holarctic region indicate that mycophagous drosophilid have generalist habits; however, our results showed that most drosophilids use fewer than two fungal hosts, and most species of Hirtodrosophila and Leucophenga were restricted to abundant fungal species, suggesting a specialization for these resources. The most specialized fauna emerged from Auricularia, which was the most frequent fungal genus in our collection, and this result supports the assumption that specialization depends on the availability of fungal resources over time.
Roni Cohen; Melissa R. Suzuki; Kenneth E. Hammel
2004-01-01
Quinone reductases (QRDs) have two important functions in the basidiomycete Gloeophyllum trabeum, which causes brown rot of wood. First, a QRD is required to generate biodegradative hydroxyl radicals via redox cycling between two G. trabeum extracellular metabolites, 2,5-dimethoxyhydroquinone (2,5-DMHQ) and 2,5-dimethoxy-1,4-benzoquinone (2,5- DMBQ). Second, because 2,...
ENDOGENOUS CYTOKININS IN MEDICINAL BASIDIOMYCETES MYCELIAL BIOMASS
Directory of Open Access Journals (Sweden)
N. P.
2016-02-01
Full Text Available The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species (Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa using HPLC. Trans- and cis-zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species (G. lucidum, strain 1900 contained all these substances. The greatest total cytokinin quantity was detected in F. officinalis, strain 5004. S. crispa, strain 314, and F. officinalis, strain 5004, mycelial biomass was revealed to have the highest level of cytokinin riboside forms (zeatin riboside and isopentenyladenosine. The possible connection between medicinal properties of investigated basidiomycetes and of cytokinins is discussed. S. crispa, strain 314, and F. officinalis, strain 5004, are regarded as promising species for developing biotechnological techniques to produce biologically active drugs from their mycelial biomass. As one of the potential technological approaches there is proposed fungal material drying.
Shrestha, Prachand
This research aims at developing a biorefinery platform to convert corn-ethanol coproduct, corn fiber, into fermentable sugars at a lower temperature with minimal use of chemicals. White-rot (Phanerochaete chrysosporium), brown-rot (Gloeophyllum trabeum) and soft-rot (Trichoderma reesei) fungi were used in this research to biologically break down cellulosic and hemicellulosic components of corn fiber into fermentable sugars. Laboratory-scale simultaneous saccharification and fermentation (SSF) process proceeded by in-situ cellulolytic enzyme induction enhanced overall enzymatic hydrolysis of hemi/cellulose from corn fiber into simple sugars (mono-, di-, tri-saccharides). The yeast fermentation of hydrolyzate yielded 7.1, 8.6 and 4.1 g ethanol per 100 g corn fiber when saccharified with the white-, brown-, and soft-rot fungi, respectively. The highest corn-to-ethanol yield (8.6 g ethanol/100 g corn fiber) was equivalent to 42 % of the theoretical ethanol yield from starch and cellulose in corn fiber. Cellulase, xylanase and amylase activities of these fungi were also investigated over a week long solid-substrate fermentation of corn fiber. G. trabeum had the highest activities for starch (160 mg glucose/mg protein.min) and on day three of solid-substrate fermentation. P. chrysosporium had the highest activity for xylan (119 mg xylose/mg protein.min) on day five and carboxymethyl cellulose (35 mg glucose/mg protein.min) on day three of solid-substrate fermentation. T. reesei showed the highest activity for Sigma cell 20 (54.8 mg glucose/mg protein.min) on day 5 of solid-substrate fermentation. The effect of different pretreatments on SSF of corn fiber by fungal processes was examined. Corn fiber was treated at 30 °C for 2 h with alkali [2% NaOH (w/w)], alkaline peroxide [2% NaOH (w/w) and 1% H2O 2 (w/w)], and by steaming at 100 °C for 2 h. Mild pretreatment resulted in improved ethanol yields for brown- and soft-rot SSF, while white-rot and Spezyme CP SSFs showed
Fungi of the phylum Basidiomycota (basidiomycetes) make up some 37% of the described fungi and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To b...
Jang, Yeongseon; Jang, Seokyoon; Min, Mihee; Hong, Joo-Hyun; Lee, Hanbyul; Lee, Hwanhwi; Lim, Young Woon; Kim, Jae-Jin
2015-10-01
In this study, three different methods (fruiting body collection, mycelial isolation, and 454 sequencing) were implemented to determine the diversity of wood-inhabiting basidiomycetes from dead Manchurian fir (Abies holophylla). The three methods recovered similar species richness (26 species from fruiting bodies, 32 species from mycelia, and 32 species from 454 sequencing), but Fisher's alpha, Shannon-Wiener, Simpson's diversity indices of fungal communities indicated fruiting body collection and mycelial isolation displayed higher diversity compared with 454 sequencing. In total, 75 wood-inhabiting basidiomycetes were detected. The most frequently observed species were Heterobasidion orientale (fruiting body collection), Bjerkandera adusta (mycelial isolation), and Trichaptum fusco-violaceum (454 sequencing). Only two species, Hymenochaete yasudae and Hypochnicium karstenii, were detected by all three methods. This result indicated that Manchurian fir harbors a diverse basidiomycetous fungal community and for complete estimation of fungal diversity, multiple methods should be used. Further studies are required to understand their ecology in the context of forest ecosystems.
Inmovilización de hongos ligninolíticos para la remoción del colorante negro reactivo 5
Directory of Open Access Journals (Sweden)
Jorge Andrés Fernández
2009-01-01
Full Text Available La presencia de colorantes azoicos en aguas residuales de la industria textil es un problema ambiental y sanitario, porque muchos de estos compuestos son cancerígenos. Los tratamientos biológicos son una alternativa para la remoción de ese tipo de colorantes. En el presente trabajo se evaluó el efecto de tres hongos de podredumbre blanca, Trametes versicolor, Pleurotus ostreatus y Phanerochaete chrysosporium sobre la decoloración de un agua que contiene colorante negro reactivo 5 (NR5, ampliamente usado en la industria textil. Se estudió la inmovilización de estos hongos en dos soportes, espuma de poliuretano y estropajo (L. cylíndrica para seleccionar el mejor soporte y el hongo con mayor capacidad para la decoloración. Ambos soportes fueron igualmente efectivos, pero se seleccionó estropajo por ser un producto natural. El hongo que generó los mayores porcentajes de decoloración en 4 días fue Trametes versicolor, con 96%, 98% y 98% para agua con concentración de NR5 300 ppm, 150 ppm y 75 ppm, respectivamente. La actividad lacasa para cada concentración de NR5 fue 8 U L-1, 7 U L-1 y 5 U L-1. Waste water from the textile industry represents a major environmental and health problem because it contains azo dyes whose carcirogenic effect has been tested in research. Biological treatment represents a valuable alternative for removing these dyes. The effect of Trametes versicolor, Pleurotus ostreatus and Phanerochaete chrysosporium rot fungi on decoloration of water containing reactive black five (NR5 textile dye was evaluated in this work. Immobilising the fungi on polyurethane foam and luffa sponge (Luffa cylindrica supports was studied in order to select the best support and the fungi having the best decolorisation. Both supports were equally effective; however, the luffa sponge was selected as being a natural product. Trametes versicolor produced the highest decolorisation percentages in four days (96%, 98% and 98% for 300 ppm, 150
Wang, Min; Lu, Xuefeng
2016-01-01
Recent demands for the production of lignocellulose biofuels boosted research on cellulase. Hydrolysis efficiency and production cost of cellulase are two bottlenecks in biomass to biofuels process. The Trichoderma cellulase mixture is one of the most commonly used enzymes for cellulosic hydrolysis. During hydrolytic process cellobiose accumulation causes feedback inhibition against most cellobiohydrolases and endoglucanases. In this study, we demonstrated the synergism effects between cellob...
Gamma-ray induced delay of fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum
International Nuclear Information System (INIS)
Takimoto, K.
1980-01-01
The effect of gamma-radiation on fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum, was investigated. Fruiting of this fungus is induced by visible light, but irradiation of the mycelium before or after light treatment delayed fruiting body initiation. The time required for fruiting body initiation increased with the radiation dose. The induction of fruiting bodies had two gamma-radiation sensitive stages, one immediately before fruiting body initiation and the other 15 to 20 h after the start of photoinduction. (author)
Sabarez, Henry; Oliver, Christine Maree; Mawson, Raymond; Dumsday, Geoff; Singh, Tanoj; Bitto, Natalie; McSweeney, Chris; Augustin, Mary Ann
2014-11-01
Lignocellulosic biomass samples (wheat chaff) were pretreated by ultrasound (US) (40kHz/0.5Wcm(-2)/10min and 400kHz/0.5Wcm(-2)/10min applied sequentially) prior to digestion by enzyme extracts obtained from fermentation of the biomass with white rot fungi (Phanerochaete chrysosporium or Trametes sp.). The accessibility of the cellulosic components in wheat chaff was increased, as demonstrated by the increased concentration of sugars produced by exposure to the ultrasound treatment prior to enzyme addition. Pretreatment with ultrasound increased the concentration of lignin degradation products (guaiacol and syringol) obtained from wheat chaff after enzyme addition. In vitro digestibility of wheat chaff was also enhanced by the ultrasonics pretreatment in combination with treatment with enzyme extracts. Degradation was enhanced with the use of a mixture of the enzyme extracts compared to that for a single enzyme extract. Copyright © 2014. Published by Elsevier B.V.
Solubilization of Australian lignites by fungi and other microorganisms
Energy Technology Data Exchange (ETDEWEB)
Catcheside, D.E.A.; Mallett, K.J. (Flinders University, Bedford Park, SA (Australia). School of Biological Sciences)
Lignites (brown coals) from the Latrobe Valley in Victoria are solubilized by {ital Coriolus versicolor}, {ital Phanerochaete chrysosporium}, and five other species known to be active on Leonardite and various acid-treated North America lignites. Run-of-mine coal from Morwell and Loy Yang is refractory but is soluble after pretreatment with acid. A weathered deposit at Loy Yang, like Leonardite, is susceptible to biosolubilization without pretreatment. The white rot fungi {ital Ganoderma applanatum}, {ital Perenniporia tephropora} ({ital Fomes lividus}), {ital Pleurotus ostreatus}, {ital Pycnoporus cinnabarinus}, {ital Rigidoporus ulmarius}, and {ital Xylaria hypoxylon} were found to be capable of solubilizing lignite. In contrast, brown rot fungi were weakly active or inactive under the same test conditions. Lignite-degrading fungi, actinomycetes, and other bacteria, including some active on untreated run-of-mine coal, were isolated from natural lignite exposures and mining sites. 15 refs., 5 tabs.
Czech Academy of Sciences Publication Activity Database
Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr
2010-01-01
Roč. 114, 11-12 (2010), s. 929-935 ISSN 1878-6146 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : Basidiomycetes * Cryopreservation * Enzymes Subject RIV: EE - Microbiology, Virology
The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans
Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.; Donlin, Maureen J.; D’Souza, Cletus A.; Fox, Deborah S.; Grinberg, Viktoriya; Fu, Jianmin; Fukushima, Marilyn; Haas, Brian J.; Huang, James C.; Janbon, Guilhem; Jones, Steven J. M.; Koo, Hean L.; Krzywinski, Martin I.; Kwon-Chung, June K.; Lengeler, Klaus B.; Maiti, Rama; Marra, Marco A.; Marra, Robert E.; Mathewson, Carrie A.; Mitchell, Thomas G.; Pertea, Mihaela; Riggs, Florenta R.; Salzberg, Steven L.; Schein, Jacqueline E.; Shvartsbeyn, Alla; Shin, Heesun; Shumway, Martin; Specht, Charles A.; Suh, Bernard B.; Tenney, Aaron; Utterback, Terry R.; Wickes, Brian L.; Wortman, Jennifer R.; Wye, Natasja H.; Kronstad, James W.; Lodge, Jennifer K.; Heitman, Joseph; Davis, Ronald W.; Fraser, Claire M.; Hyman, Richard W.
2012-01-01
Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype instability and phenotypic variation. C. neoformans encodes unique genes that may contribute to its unusual virulence properties, and comparison of two phenotypically distinct strains reveals variation in gene content in addition to sequence polymorphisms between the genomes. PMID:15653466
Degenkolb, Thomas; Vilcinskas, Andreas
2016-05-01
In this second section of a two-part mini-review article, we introduce 101 further nematicidal and non-nematicidal secondary metabolites biosynthesized by nematophagous basidiomycetes or non-nematophagous ascomycetes and basidiomycetes. Several of these compounds have promising nematicidal activity and deserve further and more detailed analysis. Thermolides A and B, omphalotins, ophiobolins, bursaphelocides A and B, illinitone A, pseudohalonectrins A and B, dichomitin B, and caryopsomycins A-C are excellent candidates or lead compounds for the development of biocontrol strategies for phytopathogenic nematodes. Paraherquamides, clonostachydiol, and nafuredins offer promising leads for the development of formulations against the intestinal nematodes of ruminants.
Salvachúa, Davinia; Martínez, Angel T; Tien, Ming; López-Lucendo, María F; García, Francisco; de Los Ríos, Vivian; Martínez, María Jesús; Prieto, Alicia
2013-08-10
Identifying new high-performance enzymes or enzyme complexes to enhance biomass degradation is the key for the development of cost-effective processes for ethanol production. Irpex lacteus is an efficient microorganism for wheat straw pretreatment, yielding easily hydrolysable products with high sugar content. Thus, this fungus was selected to investigate the enzymatic system involved in lignocellulose decay, and its secretome was compared to those from Phanerochaete chrysosporium and Pleurotus ostreatus which produced different degradation patterns when growing on wheat straw. Extracellular enzymes were analyzed through 2D-PAGE, nanoLC/MS-MS, and homology searches against public databases. In wheat straw, I. lacteus secreted proteases, dye-decolorizing and manganese-oxidizing peroxidases, and H2O2 producing-enzymes but also a battery of cellulases and xylanases, excluding those implicated in cellulose and hemicellulose degradation to their monosaccharides, making these sugars poorly available for fungal consumption. In contrast, a significant increase of β-glucosidase production was observed when I. lacteus grew in liquid cultures. P. chrysosporium secreted more enzymes implicated in the total hydrolysis of the polysaccharides and P. ostreatus produced, in proportion, more oxidoreductases. The protein pattern secreted during I. lacteus growth in wheat straw plus the differences observed among the different secretomes, justify the fitness of I. lacteus for biopretreatment processes in 2G-ethanol production. Furthermore, all these data give insight into the biological degradation of lignocellulose and suggest new enzyme mixtures interesting for its efficient hydrolysis.
Mori, Toshio; Wang, Jianqiao; Tanaka, Yusuke; Nagai, Kaoru; Kawagishi, Hirokazu; Hirai, Hirofumi
2017-01-05
Clothianidin (CLO) is a member of the neonicotinoid pesticides, which have been widely used worldwide over the last two decades. However, its toxicity for bees and neurological toxicity for humans are urgent problems. Here, the degradation of CLO by the white-rot fungus Phanerochaete sordida was examined in nitrogen-limited liquid medium. After incubation for 20days at 30°C, 37% of CLO was degraded in the cultures. High-resolution ESI-MS and NMR analyses of the culture supernatant identified N-(2-chlorothiazol-5-yl-methyl)-N'-methylurea (TZMU) as a metabolite of CLO degradation. The addition of cytochrome P450 inhibitors to the culture medium markedly reduced the degradation of CLO by P. sordida. And manganese peroxidase, a major ligninolytic enzyme secreted by this fungus, were not carried out CLO degradation. The effects of CLO and TZMU on the viability of the neuronal cell line Neuro2a demonstrated that P. sordida effectively degrades CLO into a metabolite that lacks neurotoxicity. Copyright © 2016 Elsevier B.V. All rights reserved.
SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES
Directory of Open Access Journals (Sweden)
A. K. Veligodska
2015-11-01
Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and
BASIDIOMYCETE-BASED METHOD FOR BIOCONTROL OF PHYTOPATHOGENIC NEMATODES
Directory of Open Access Journals (Sweden)
Tiberius BALAEŞ
2015-12-01
Full Text Available Phytopathogenic nematodes represent one of the most important groups of pathogens in crops. The use of chemical to control the nematodes attack in crops is decreasing every year due to the concern of the toxicity and side effects of such compounds. In the course for finding alternatives to the use of chemicals, biological control of nematodes is gaining much attention. Some saprotrophic fungi are able to feed on invertebrates, thus becoming efficient agents of control. In this study, three species of basidiomycetes were analyzed for their potential to be used as control agents of phytopathogenic nematodes. Through on in vitro investigation of these potential, one strain – Gymnopilus junonius was further selected for a pot test against Meloidogyne incognita, a very important phytopathogenic species of nematodes. The fungal treatment strongly decreased the M. incognita population on the tested pots, proving the potential of G. junonius strain to be used in biocontrol.
Czech Academy of Sciences Publication Activity Database
Vohník, Martin; Sadowsky, J. J.; Kohout, Petr; Lhotáková, Z.; Nestby, R.; Kolařík, Miroslav
2012-01-01
Roč. 7, č. 6 (2012), e39524 E-ISSN 1932-6203 R&D Projects: GA ČR GP206/09/P340 Institutional support: RVO:67985939 ; RVO:61388971 Keywords : ericoid mycorrhiza * Ericaceae * Basidiomycetes Subject RIV: EF - Botanics; EE - Microbiology, Virology (MBU-M) Impact factor: 3.730, year: 2012
Directory of Open Access Journals (Sweden)
Andrej Liner
2013-01-01
Full Text Available The dry rot basidiomycete Serpula lacrymans is the most common and destructive wood decay fungus, which attacks and damages houses and other wooden construction worldwide [1], [2]. Effective chemicals have been developed for remediation and treatment of dry rot outbreaks and for wood preservation against dry rot, but in most cases, control is most economically achieved by environmental management to avoid creating favourable growth conditions for the fungus [3]. Thermal treatment using microwaves represents one of possible approaches in fungal growth control and refurbishment of damaged wooden constructions. One of the possibilities, how to monitor this whole process seems to be the use of Optical fiber DTS (Distribution Temperature Systems. The Optical fiber DTS are unique distributed temperature systems using optical fiber as a sensor. Due to the electromagnetic resistance is this system suitable for the monitoring of these processes. This article deals with application of optical meanders in the temperature measurement during the extermination of basidiomycete Serpula lacrymans using microwave heating. Because of the adverse effect of microwave radiation on all other types of temperature sensors.
Parasitic macrofungi (Basidiomycetes on fruit shrubs and trees in the Tarnów town (S Poland
Directory of Open Access Journals (Sweden)
Marcin Piątek
2014-08-01
Full Text Available Results of 6 years of research carried out in the Tarnów town, southern Poland, are presented. Total number of 27 species of Basidiomycetes were recorded on 7 species of fruit shrubs and trees. Some of them were found on hosts new for Poland, on Malus domestica - Abortiporus biennis, Ganoderma australe, Meripilus giganteus, Stereum hirsutum and Volvariella bombycina; on Juglans regia - Ganoderma applanalum and Hineola auricula-judae.
DNA quantification of basidiomycetous fungi during storage of logging residues
Directory of Open Access Journals (Sweden)
Isabella Børja
2015-04-01
Full Text Available The demand for bioenergy caused an increased use of logging residues, branches and treetops that were previously left on the ground after harvesting. Residues are stored outdoors in piles and it is unclear to what extent fungi transform this material. Our objective was to quantify the amount of wood degrading fungi during storage using quantitative real-time PCR (qPCR to detect basidiomycetous DNA in logging residues, a novel approach in this field. We found that the qPCR method was accurate in quantifying the fungal DNA during storage. As the moisture content of the piled logging residues decreased during the storage period, the fungal DNA content also decreased. Scots pine residues contained more fungal DNA than residues from Norway spruce. Loose piles had generally more fungal DNA than bundled ones.
DEFF Research Database (Denmark)
Cruys-Bagger, Nicolaj; Guilin, Ren; Tatsumi, Hirosuke
2012-01-01
An amperometric enzyme biosensor for continuous detection of cellobiose has been implemented as an enzyme assay for cellulases. We show that the initial kinetics for cellobiohydrolase I, Cel7A from Trichoderma reesei, acting on different types of cellulose substrates, semi-crystalline and amorphous......, can be monitored directly and in real-time by an enzyme-modified electrode based on cellobiose dehydrogenase (CDH) from Phanerochaete chrysosporium (Pc). PcCDH was cross-linked and immobilized on the surface of a carbon paste electrode which contained a mediator, benzoquinone. An oxidation current...... of the reduced mediator, hydroquinone, produced by the CDH-catalyzed reaction with cellobiose, was recorded under constant-potential amperometry at +0.5 V (vs. Ag/AgCl). The CDH-biosensors showed high sensitivity (87.7 µA mM−1 cm−2), low detection limit (25 nM), and fast response time (t95% ∼ 3 s...
Enhanced bioremediation of PAH contaminated soils from coal processing sites
International Nuclear Information System (INIS)
Joshi, M.M.; Lee, S.
1995-01-01
The polycyclic aromatic hydrocarbons (PAH) are a potential hazard to health due to their carcinogenic, mutagenic nature and acute toxicity and there is an imminent need for remediation of PAH contaminated soils abounding the several coke oven and town gas sites. Aerobic biological degradation of PAHs is an innovative technology and has shown high decontamination efficiencies, complete mineralization of contaminants, and is environmentally safe. The present study investigates the remediation of PAH contaminated soils achieved using Acinetobacter species and fungal strain Phanerochaete Chrysosporium. The soil used for the experiments was an industrially contaminated soil obtained from Alberta Research Council (ARC) primary cleanup facility, Alberta, Canada. Soil characterization was done using High Performance Liquid Chromatography (HPLC) to qualitatively and quantitatively determine the contaminants in the soil. Artificially contaminated soil was also used for some experiments. All the experiments were conducted under completely mixed conditions with suitable oxygen and nutrient amendments. The removal efficiency obtained for various PAHs using the two microorganisms was compared
Toplon, D E; Terrell, S P; Sigler, L; Jacobson, E R
2013-07-01
An epizootic of ulcerative to nodular ventral dermatitis was observed in a large breeding colony of 8-month to 5-year-old leopard geckos (Eublepharis macularius) of both sexes. Two representative mature male geckos were euthanized for diagnostic necropsy. The Chrysosporium anamorph of Nannizziopsis vriesii (CANV) was isolated from the skin lesions, and identification was confirmed by sequencing of the internal transcribed spacer region of the rRNA gene. Histopathology revealed multifocal to coalescing dermal and subcutaneous heterophilic granulomas that contained septate fungal hyphae. There was also multifocal epidermal hyperplasia with hyperkeratosis, and similar hyphae were present within the stratum corneum, occasionally with terminal chains of arthroconidia consistent with the CANV. In one case, there was focal extension of granulomatous inflammation into the underlying masseter muscle. This is the first report of dermatitis and cellulitis due to the CANV in leopard geckos.
Johnson, R S P; Sangster, C R; Sigler, L; Hambleton, S; Paré, J A
2011-12-01
Deep fungal dermatitis caused by the Chrysosporium anamorph of Nannizziopsis vriesii (CANV) was diagnosed in a group of coastal bearded dragons (Pogona barbata). The outbreak extended over a 6-month period, with four of six lizards from the same zoological outdoor enclosure succumbing to infection. A fifth case of dermatomycosis was identified in a pet lizard originally sourced from the wild. Diagnosis of infection with the CANV was based on similar clinical signs and histopathology in all animals and confirmed by culture and sequencing of the fungus from one animal. This is the first report of the CANV causing disease in a terrestrial reptile species in Australia and the first in the coastal bearded dragon. © 2011 The Authors. Australian Veterinary Journal © 2011 Australian Veterinary Association.
Glycosylated yellow laccases of the basidiomycete Stropharia aeruginosa.
Daroch, Maurycy; Houghton, Catharine A; Moore, Jonathan K; Wilkinson, Mark C; Carnell, Andrew J; Bates, Andrew D; Iwanejko, Lesley A
2014-05-10
Here we describe the identification, purification and characterisation of glycosylated yellow laccase proteins from the basidiomycete fungus Stropharia aeruginosa. Biochemical characterisation of two yellow laccases, Yel1p and Yel3p, show that they are both secreted, monomeric, N-glycosylated proteins of molecular weight around 55kDa with substrate specificities typical of laccases, but lacking the absorption band at 612nm typical of the blue laccase proteins. Low coverage, high throughput 454 transcriptome sequencing in combination with inverse-PCR was used to identify cDNA sequences. One of the cDNA sequences has been assigned to the Yel1p protein on the basis of identity between the translated protein sequence and the peptide data from the purified protein, and the full length gene sequence has been obtained. Biochemical properties, substrate specificities and protein sequence data have been used to discuss the unusual spectroscopic properties of S. aeruginosa proteins in the context of recent theories about the differences between yellow and blue laccases. Copyright © 2014 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Erika B. Laconi
2015-03-01
Full Text Available Cocoa pod is among the by-products of cocoa (Theobroma cacao plantations. The aim of this study was to apply a number of treatments in order to improve nutritional quality of cocoa pod for feeding of ruminants. Cocoa pod was subjected to different treatments, i.e. C (cocoa pod without any treatment or control, CAm (cocoa pod+1.5% urea, CMo (cocoa pod+3% molasses, CRu (cocoa pod+3% rumen content and CPh (cocoa pod+3% molasses+Phanerochaete chrysosporium inoculum. Analysis of proximate and Van Soest’s fiber fraction were performed on the respective treatments. The pods were then subjected to an in vitro digestibility evaluation by incubation in rumen fluid-buffer medium, employing a randomized complete block design (n = 3 replicates. Further, an in vivo evaluation of the pods (35% inclusion level in total mixed ration was conducted by feeding to young Holstein steers (average body weight of 145±3.6 kg with a 5×5 latin square design arrangement (n = 5 replicates. Each experimental period lasted for 30 d; the first 20 d was for feed adaptation, the next 3 d was for sampling of rumen liquid, and the last 7 d was for measurements of digestibility and N balance. Results revealed that lignin content was reduced significantly when cocoa pod was treated with urea, molasses, rumen content or P. chrysosporium (pCAm>CRu>CMo. Among all treatments, CAm and CPh treatments significantly improved the in vitro dry matter and organic matter digestibility (p<0.05 of cocoa pod. Average daily gain of steers receiving CAm or CPh treatment was significantly higher than that of control (p<0.01 with an increase of 105% and 92%, respectively. Such higher daily gain was concomitant with higher N retention and proportion of N retention to N intake in CAm and CPh treatments than those of control (p<0.05. It can be concluded from this study that treatment with either urea or P. chrysosporium is effective in improving the nutritive value of cocoa pod.
International Nuclear Information System (INIS)
Wariishi, Hiroyuki; Valli, K.; Gold, M.H.
1989-01-01
In the presence of Mn II and H 2 O 2 , homogeneous manganese peroxidase oxidized 1-(3,5-dimethoxy-4-hydroxyphenyl)-2-(4-methoxyphenyl)-1,3-dihydroxypropane (I) to yield 1-(3,5-dimethoxy-4-hydroxyphenyl)-2-(4-methoxyphenyl)-1-oxo-3-hydroxypropane (II), 2,6-dimethoxy-1,4-benzoquinone (III), 2,6-dimethoxy-1,4-dihydroxybenzene (IV), 1-(4-methoxyphenyl)-1-oxo-2-hydroxyethane (V), 1-(4-methoxyphenyl)-1,2-dihydroxyethane (VI), syringaldehyde (VIII), and 2-(4-methoxyphenyl)-3-hydroxypropanal (IX). Chemically prepared manganese(III) malonate catalyzed the same reactions. Oxidation of I in H 2 18 O under argon resulted in >80% incorporation of 18 O into the phenylglycol VI, the hydroquinone IV, and the quinone III. Oxidation of I in H 2 18 O under aerobic conditions resulted in 40% incorporation of 18 O into VI but no 18 O incorporation into V. Finally, oxidation of I under 18 O 2 resulted in 89% and 28% incorporation of 18 O into V and VI, respectively. These results are explained by mechanisms involving the one-electron oxidation of the substrate I by enzyme-generated Mn III to produce a phenoxy radical intermediate I'. Subsequent C α -C β bond cleavage of the radical intermediate yields syringaldehyde (VIII) and a C 6 -C 2 benzylic radical. Syringaldehyde is oxidized by Mn III in several steps to a cyclohexadiene cation intermediate I double-prime, which is attacked by water to yield the benzoquinone III. The C 6 -C 2 radical is scavenged by O 2 to form a peroxy radical that decomposes to V and VI. In these reactions, Mn III generated by manganese peroxidase catalyzes both formation of the substrate phenoxy radical and oxidation of carbon-centered radical intermediates, to yield reactive cations
Directory of Open Access Journals (Sweden)
Nadjane S. Coelho
2008-09-01
Full Text Available O crescimento do consumo de plásticos vem gerando grandes problemas ambientais, pois um polímero, uma vez descartado no ambiente, necessita de mais de cem anos para se degradar. O plástico ideal deve apresentar propriedades industriais desejáveis e, ao mesmo tempo ser degradável num período considerado satisfatório. Busca-se desenvolver plásticos com boas propriedades para embalagens e que possam ser biodegradados quando descartados ao ambiente. Neste trabalho avaliamos a biodegradação da blenda do copolímero poli(β-hidroxibutirato-co-valerato, PHB-HV, que é um termoplástico natural, biodegradável e biocompatível, e do amido anfótero, na proporção de 75 e 25% m/m, respectivamente. Os resultados foram obtidos através do teste de Sturm, uma metodologia para a avaliação da biodegradação na presença de uma cultura mista dos fungos Phanerochaete chrysosporium e Talaromyces wortmannii. Os resultados evidenciam a biodegradação da blenda em função do tempo, de acordo com os resultados do teste de Sturm, com o aparecimento de grupos carboxílicos terminais. Foi detectado também o aparecimento de nova simetria cristalina na estrutura polimérica.The increasing consumption of plastics has generated environmental problems because it takes more than a hundred years for a discarded polymer to degrade. The ideal plastic should present desirable industrial properties and be degradable within a satisfactory time period. Researches is conducted to plastics with good properties for packaging, but that are biodegradable when discarded to the environment. In this work we evaluated the biodegradation of the blend of the copolymer poly(hydroxybutyrate-hydroxyvalerate, PHB-HV, which is a natural, biodegradable and biocompatible thermoplastic, and of the starch amphiprotic, in the proportion of 75 and 25% m/m, respectively. The results were obtained through the Sturm test, a methodology for the evaluation of biodegradation in the presence
A kingdom-specific protein domain HMM library for improved annotation of fungal genomes
Directory of Open Access Journals (Sweden)
Oliver Stephen G
2007-04-01
Full Text Available Abstract Background Pfam is a general-purpose database of protein domain alignments and profile Hidden Markov Models (HMMs, which is very popular for the annotation of sequence data produced by genome sequencing projects. Pfam provides models that are often very general in terms of the taxa that they cover and it has previously been suggested that such general models may lack some of the specificity or selectivity that would be provided by kingdom-specific models. Results Here we present a general approach to create domain libraries of HMMs for sub-taxa of a kingdom. Taking fungal species as an example, we construct a domain library of HMMs (called Fungal Pfam or FPfam using sequences from 30 genomes, consisting of 24 species from the ascomycetes group and two basidiomycetes, Ustilago maydis, a fungal pathogen of maize, and the white rot fungus Phanerochaete chrysosporium. In addition, we include the Microsporidion Encephalitozoon cuniculi, an obligate intracellular parasite, and two non-fungal species, the oomycetes Phytophthora sojae and Phytophthora ramorum, both plant pathogens. We evaluate the performance in terms of coverage against the original 30 genomes used in training FPfam and against five more recently sequenced fungal genomes that can be considered as an independent test set. We show that kingdom-specific models such as FPfam can find instances of both novel and well characterized domains, increases overall coverage and detects more domains per sequence with typically higher bitscores than Pfam for the same domain families. An evaluation of the effect of changing E-values on the coverage shows that the performance of FPfam is consistent over the range of E-values applied. Conclusion Kingdom-specific models are shown to provide improved coverage. However, as the models become more specific, some sequences found by Pfam may be missed by the models in FPfam and some of the families represented in the test set are not present in FPfam
ENZIME ACTIVITY OF HIGHER BASIDIOMYCETES MUSHROOM GRIFOLA FRONDOSA
Directory of Open Access Journals (Sweden)
А. Бухало
2011-02-01
Full Text Available The purpose of this work was a revelation and evaluation of spectrum and activity of hydrolytic enzymes of higher basidiomycetes Grifola frondosa in a surface and submerged culture. 8 strains of Gf. frondosa, mushrooms from culture collection of mushrooms at the M.G. Kholodny Institute of Вotany National Academy of Sciences of the Ukraine were object of investigation. Researches were conducted by standard microbiological, biochemical and biotechnological methods. All strains on agar mediums were shown the following enzymes: amylase, caseinase, polygalacturonase, pectattranselyminase, glucosidase, urease, xylanase, lipase and endoglucanase. The demonstration of oxidizing enzymes of laccase and tyrosinase depended on a culture and did not depend on composition of medium. The estimation of presence and level of activity of hydrolytic enzymes at submerged cultivation indicate primary influence of components of complex nourishing medium on enzyme activity of Gr. frondosa. Strains biochemical features show up in the case of oxidizing enzymes on agar mediums and for endo-1,4-β-glucanase on liquid mediums with glucose and molasses.
Bioactive metabolites from the mycelia of the basidiomycete Hericium erinaceum.
Lu, Qiang-Qiang; Tian, Jun-Mian; Wei, Jing; Gao, Jin-Ming
2014-01-01
Seven known compounds, three diketopiperazine alkaloids, 12β-hydroxyverruculogen TR-2 (1), fumitremorgin C (2) and methylthiogliotoxin (5), two hetero-spirocyclic γ-lactam alkaloids, pseurotin A (3) and FD-838 (4), and cerevisterol (6) and herierin IV (7), were isolated from the mycelia of the basidiomycete Hericium erinaceum and identified by spectroscopic analyses. The antioxidant and antifungal activities of compounds 1-6 were evaluated. The results indicated that compounds 1, 3 and 6 exhibited potential antioxidant activity against DPPH (2, 2-diphenyl-1-picrylhydrazyl) radical with their IC50 data of ca. 12 μM, compared with positive control tertiary butylhydroquinone. In addition, compound 4 significantly inhibited the growth of two plant fungal pathogens Botrytis cinerea and Glomerella cingulata with an minimum inhibitory concentration of 6.25 μM for each, similar to that of the positive fungicide, carbendazim. Compounds 1-5 were isolated from the genus Hericium for the first time.
Rivera-Mariani, Félix E.; Vysyaraju, Kranthi; Negherbon, Jesse; Levetin, Estelle; Horner, W. Elliot; Hartung, Thomas; Breysse, Patrick N.
2014-01-01
Background Spores from basidiomycete fungi (basidiospores) are highly prevalent in the atmosphere of urban and rural settings. Studies have confirmed their potential to affect human health as allergens. Less is known about their potential to serve as stimuli of the innate immune system and induce pro-inflammatory reactions. Methods In this study, we evaluated the pro-inflammatory potential of spores from 11 allergenic gilled (Pleurotus ostreatus, Oudemansiella radicata, Armillaria tabescens, Coprinus micaceus, Pluteus cervinus, Chlorophyllum molybdites) and non-gilled (Pisolithus arhizus, Merulius tremullosus, Calvatia cyathiformis, Lycoperdon pyriforme, Boletus bicolor) basidiomycetes fungi based on their potency to induce the release of the pro-inflammatory cytokine interleukin (IL)-1β in a cryopreserved human whole blood system. In addition, the role of morphological features of the spores (surface area, shape, and pigmentation) were examined for their role in the spores’ interleukin (IL)-1β-including potency. Peripheral blood from healthy volunteers was collected, pooled, and cryopreserved. After stimulating the cryopreserved pooled blood with 106 to 103 basidiospores/ml, the concentration of IL-1β in culture supernatants was determined with ELISA. Results Basidiospores manifested concentration-dependent IL-1β-inducing potency, which was more noteworthy among basidiospores from gilled basidiomycetes. At higher concentrations of basidiospores, the IL-1β-inducing potency was able to be differentiated in the cryopreserved human whole blood system. Morphological features did not correlate with the IL-1β-inducing potency of the basidiospores, suggesting that non-morphological properties modulate the IL-1β-inducing potency. Conclusion Our data provides evidence of the pro-inflammatory potential of basidiospores, and the utility of cryopreserved human whole blood as a human-based in-vitro system to study the immune reactivity of allergenic basidiospores. PMID
Directory of Open Access Journals (Sweden)
Daniil N. Olennikov
2014-03-01
Full Text Available The fatty acid (FA compositions of 14 wild wood-decaying basidiomycete species (Bjerkandera adusta, Daedaleopsis septentrionalis, Dichomitus squalens, Inonotus hispidus, I.radiatus, Irpex lacteus, Fomitopsis cajanderi, F.pinicola, F. rosea, Gloeophyllum protractum, Lenzites betulina, Phellinus pini, Trametes gibbosa, T. ochracea growing in permafrost conditions in Katanga region (Russian Federation were investigated using GC-MS. Generally, C18:2 ω 6 (linoleic acid, C18:1 ω 9 (oleic acid, C16:0 (palmitic acid and C20:0 (arachinic acid were found to be the major FA in fungal species. Data about chemical components of Daedaleopsis septentrionalis , Fomitopsis cajanderi and Gloeophyllum protractum were obtained at the first time. Increased level of degree of FA unsaturation was probably a result of extreme environmental conditions.
Laich, Federico; Vaca, Inmaculada; Chávez, Renato
2013-10-01
During the characterization of the mycobiota associated with shallow-water marine environments from Antarctic sea, a novel pink yeast species was isolated. Sequence analysis of the D1/D2 domain of the LSU rDNA gene and 5.8S-ITS regions revealed that the isolated yeast was closely related to Rhodotorula pallida CBS 320(T) and Rhodotorula benthica CBS 9124(T). On the basis of morphological, biochemical and physiological characterization and phylogenetic analyses, a novel basidiomycetous yeast species, Rhodotorula portillonensis sp. nov., is proposed. The type strain is Pi2(T) ( = CBS 12733(T) = CECT 13081(T)) which was isolated from shallow-water marine sediment in Fildes Bay, King George Island, Antarctica.
Microbial Biofertilizer Decreases Nicotine Content by Improving Soil Nitrogen Supply.
Shang, Cui; Chen, Anwei; Chen, Guiqiu; Li, Huanke; Guan, Song; He, Jianmin
2017-01-01
Biofertilizers have been widely used in many countries for their benefit to soil biological and physicochemical properties. A new microbial biofertilizer containing Phanerochaete chrysosporium and Bacillus thuringiensis was prepared to decrease nicotine content in tobacco leaves by regulating soil nitrogen supply. Soil NO 3 - -N, NH 4 + -N, nitrogen supply-related enzyme activities, and nitrogen accumulation in plant leaves throughout the growing period were investigated to explore the mechanism of nicotine reduction. The experimental results indicated that biofertilizer can reduce the nicotine content in tobacco leaves, with a maximum decrement of 16-18 % in mature upper leaves. In the meantime, the total nitrogen in mature lower and middle leaves increased with the application of biofertilizer, while an opposite result was observed in upper leaves. Protein concentration in leaves had similar fluctuation to that of total nitrogen in response to biofertilizer. NO 3 - -N content and nitrate reductase activity in biofertilizer-amended soil increased by 92.3 and 42.2 %, respectively, compared to those in the control, whereas the NH 4 + -N and urease activity decreased by 37.8 and 29.3 %, respectively. Nitrogen uptake was improved in the early growing stage, but this phenomenon was not observed during the late growth period. Nicotine decrease is attributing to the adjustment of biofertilizer in soil nitrogen supply and its uptake in tobacco, which result in changes of nitrogen content as well as its distribution in tobacco leaves. The application of biofertilizer containing P. chrysosporium and B. thuringiensis can reduce the nicotine content and improve tobacco quality, which may provide some useful information for tobacco cultivation.
Laconi, Erika B; Jayanegara, Anuraga
2015-03-01
Cocoa pod is among the by-products of cocoa (Theobroma cacao) plantations. The aim of this study was to apply a number of treatments in order to improve nutritional quality of cocoa pod for feeding of ruminants. Cocoa pod was subjected to different treatments, i.e. C (cocoa pod without any treatment or control), CAm (cocoa pod+1.5% urea), CMo (cocoa pod+3% molasses), CRu (cocoa pod+3% rumen content) and CPh (cocoa pod+3% molasses+Phanerochaete chrysosporium inoculum). Analysis of proximate and Van Soest's fiber fraction were performed on the respective treatments. The pods were then subjected to an in vitro digestibility evaluation by incubation in rumen fluid-buffer medium, employing a randomized complete block design (n = 3 replicates). Further, an in vivo evaluation of the pods (35% inclusion level in total mixed ration) was conducted by feeding to young Holstein steers (average body weight of 145±3.6 kg) with a 5×5 latin square design arrangement (n = 5 replicates). Each experimental period lasted for 30 d; the first 20 d was for feed adaptation, the next 3 d was for sampling of rumen liquid, and the last 7 d was for measurements of digestibility and N balance. Results revealed that lignin content was reduced significantly when cocoa pod was treated with urea, molasses, rumen content or P. chrysosporium (pCAm>CRu>CMo. Among all treatments, CAm and CPh treatments significantly improved the in vitro dry matter and organic matter digestibility (pcocoa pod. Average daily gain of steers receiving CAm or CPh treatment was significantly higher than that of control (pcocoa pod.
Enzymatic formation of gold nanoparticles by submerged culture of the basidiomycete Lentinus edodes.
Vetchinkina, Elena P; Loshchinina, Ekaterina A; Burov, Andrey M; Dykman, Lev A; Nikitina, Valentina E
2014-07-20
We report for the first time that the medicinal basidiomycete Lentinus edodes can reduce Au(III) from chloroauric acid (HAuCl4) to elemental Au [Au(0)], forming nanoparticles. Several methods, including transmission electron microscopy, electron energy loss spectroscopy, X-ray fluorescence, and dynamic light scattering, were used to show that when the fungus was grown submerged, colloidal gold accumulated on the surface of and inside the mycelial hyphae as electron-dense particles mostly spherical in shape, with sizes ranging from 5 to 50nm. Homogeneous proteins (the fungal enzymes laccase, tyrosinase, and Mn-peroxidase) were found for the first time to be involved in the reduction of Au(III) to Au(0) from HAuCl4. A possible mechanism forming Au nanoparticles is discussed. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Aza Kobakhidze
2016-09-01
Full Text Available This paper reports regulation of endoglucanase (EC 3.2.1.4 and xylanase (EC 3.2.1.8 production in submerged cultivation of four white-rot basidiomycetes. Among carbon sources tested, the Avicel-based medium provided the highest levels of both hydrolases activities in all fungal cultures. However, the maximum endoglucanase and xylanase activities of the tested basidiomycetes varied from 3.9 U/ml and 7.4 U/ml in Fomes fomentarius to 34.2 U/ml and 29.5 U/ml in Pseudotrametes gibbosa, respectively (P. gibbosa specific cellulase and xylanase activities achieved 8.55 and 7.38 U/mg, respectively. Replacement of Avicel in the medium with carboxymethyl cellulose or xylan significantly lowered the enzyme yield of the tested fungi. Moreover, xylan did not ensure high xylanase activity of these fungi. Lignocellulosic substrates used as a carbon source provided poorer productivity (the specific CMCase activity was 1.12–3.62 U/mg and the specific xylanase activity was 1.95–3.32 U/mg. Expression of endoglucanase and xylanase synthesis in Panus lecometei and P. gibbosa was inducible; supplementation of the glycerol-containing medium with Avicel accompanied with a sharp increase of the fungal specific CMCase and xylanase activities from 0.02–0.04 U/mg to 1.30–8.55 U/mg. Supplementation of the Avicel-induced cultures with glucose or glycerol caused a catabolite repression of the cellulase and xylanase formation by P. gibbosa and P. lecometei. The enzyme synthesis resumed only after depletion of easily metabolizable carbon source, glucose or glycerol, from the medium. The data received suggest that in the tested fungi endoglucanase and xylanase synthesis is under control by a common regulatory mechanism.
Directory of Open Access Journals (Sweden)
Sônia C. Melo
2015-06-01
Full Text Available Heterologous expression of a putative manganese superoxide dismutase gene (SOD2 of the basidiomycete Moniliophthora perniciosa complemented the phenotypes of a Saccharomyces cerevisiae sod2Δ mutant. Sequence analysis of the cloned M. perniciosa cDNA revealed an open reading frame (ORF coding for a 176 amino acid polypeptide with the typical metal-binding motifs of a SOD2 gene, named MpSOD2. Phylogenetic comparison with known manganese superoxide dismutases (MnSODs located the protein of M. perniciosa (MpSod2p in a clade with the basidiomycete fungi Coprinopsis cinerea and Laccaria bicolor. Haploid wild-type yeast transformants containing a single copy of MpSOD2 showed increased resistance phenotypes against oxidative stress-inducing hydrogen peroxide and paraquat, but had unaltered phenotype against ultraviolet–C (UVC radiation. The same transformants exhibited high sensitivity against treatment with the pro-mutagen diethylnitrosamine (DEN that requires oxidation to become an active mutagen/carcinogen. Absence of MpSOD2 in the yeast sod2Δ mutant led to DEN hyper-resistance while introduction of a single copy of this gene restored the yeast wild-type phenotype. The haploid yeast wild-type transformant containing two SOD2 gene copies, one from M. perniciosa and one from its own, exhibited DEN super-sensitivity. This transformant also showed enhanced growth at 37 °C on the non-fermentable carbon source lactate, indicating functional expression of MpSod2p. The pro-mutagen dihydroethidium (DHE-based fluorescence assay monitored basal level of yeast cell oxidative stress. Compared to the wild type, the yeast sod2Δ mutant had a much higher level of intrinsic oxidative stress, which was reduced to wild type (WT level by introduction of one copy of the MpSOD2 gene. Taken together our data indicates functional expression of MpSod2 protein in the yeast S. cerevisiae.
Directory of Open Access Journals (Sweden)
Nubia Grijalva Vallejos
2013-06-01
Full Text Available (Received: 2013/03/31 - Accepted: 2013/06/02Vegetal waste treatment product of urban, agricultural and industrial processes has severaltechnical problems and constitutes a significant environmental concern. Among them are thepersistence of crop protection products in high concentrations in plant material and the lack ofmicroorganisms that can tolerate such compounds and efficiently decompose the substrate.Bacteria and mainly white rot fungi are the main decomposers of lignin because of their ability tosynthesize extracellular hydrolytic and oxidative enzymes in large quantities. Trichodermareesei, Aspergillus niger, Penicillium sp. and Phanerochaete chrysosporium strains are modelstrains whose hight degradation efficiency with lignocellulose materials even in the presence ofpollutants has been proven. Several studies such as directed mutagenesis, co-culturing andheterologous expression have been done in order to improve the content of some enzymes(cellulase, xylanase, and β-glucosidase in model strains, additionally it has been done newgenetic searches to find other microorganisms with this potential. Its main applications are theindustrial production of ethanol and some seconday metabolites under controlled conditions infermentation processes. This review provides an overview about strategies and methodologiescurrently used for vegetal waste utilization by inoculation of microbial strains.(Recibido: 2013/03/31 - Aceptado: 2013/06/02El tratamiento de los residuos vegetales producto de desechos urbanos, procesos agrícolas eindustriales enfrenta varios problemas técnicos y constituye una preocupación ambientalimportante. Entre ellos se destacan la permanencia de productos fitosanitarios en altasconcentraciones en el material vegetal unido a la carencia de microorganismos que puedantolerar dichos compuestos y logren descomponer eficientemente el sustrato. Las bacterias yprincipalmente los hongos de la podredumbre blanca son los mejores
Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains
Directory of Open Access Journals (Sweden)
R.L. Arakaki
2013-12-01
Full Text Available Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L-1 of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.
Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains.
Arakaki, R L; Monteiro, D A; Boscolo, M; Dasilva, R; Gomes, E
2013-12-01
Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L(-1) of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.
Biodegradation of volatile organic compounds by five fungal species
Energy Technology Data Exchange (ETDEWEB)
Qi, B.; Moe, W.M. [Dept. of Civil and Environmental Engineering, Louisiana State Univ., Baton Rouge, LA (United States); Kinney, K.A. [Dept. of Civil Engineering, Univ. of Texas, Austin (United States)
2002-07-01
Five fungal species, Cladosporium resinae (ATCC 34066), Cladosporium sphaerospermum (ATCC 200384), Exophiala lecanii-corni (CBS 102400), Mucor rouxii (ATCC 44260), and Phanerochaete chrysosporium (ATCC 24725), were tested for their ability to degrade nine compounds commonly found in industrial off-gas emissions. Fungal cultures inoculated on ceramic support media were provided with volatile organic compounds (VOCs) via the vapor phase as their sole carbon and energy sources. Compounds tested included aromatic hydrocarbons (benzene, ethylbenzene, toluene, and styrene), ketones (methyl ethyl ketone, methyl isobutyl ketone, and methyl propyl ketone), and organic acids (n-butyl acetate, ethyl 3-ethoxypropionate). Experiments were conducted using three pH values ranging from 3.5 to 6.5. Fungal ability to degrade each VOC was determined by observing the presence or absence of visible growth on the ceramic support medium during a 30-day test period. Results indicate that E. lecanii-corni and C. sphaerospermum can readily utilize each of the nine VOCs as a sole carbon and energy source. P. chrysosporium was able to degrade all VOCs tested except for styrene under the conditions imposed. C. resinae was able to degrade both organic acids, all of the ketones, and some of the aromatic compounds (ethylbenzene and toluene); however, it was not able to grow utilizing benzene or styrene under the conditions tested. With the VOCs tested, M. rouxii produced visible growth only when supplied with n-butyl acetate or ethyl 3-ethoxypropionate. Maximum growth for most fungi was observed at a pH of approximately 5.0. The experimental protocol utilized in these studies is a useful tool for assessing the ability of different fungal species to degrade gas-phase VOCs under conditions expected in a biofilter application. (orig.)
Effects of pH and Temperature on Recombinant Manganese Peroxidase Production and Stability
Jiang, Fei; Kongsaeree, Puapong; Schilke, Karl; Lajoie, Curtis; Kelly, Christine
The enzyme manganese peroxidase (MnP) is produced by numerous white-rot fungi to overcome biomass recalcitrance caused by lignin. MnP acts directly on lignin and increases access of the woody structure to synergistic wood-degrading enzymes such as cellulases and xylanases. Recombinant MnP (rMnP) can be produced in the yeast Pichia pastoris αMnP1-1 in fed-batch fermentations. The effects of pH and temperature on recombinant manganese peroxidase (rMnP) production by P. pastoris αMnP1-1 were investigated in shake flask and fed-batch fermentations. The optimum pH and temperature for a standardized fed-batch fermentation process for rMnP production in P. pastoris ctMnP1-1 were determined to be pH 6 and 30 °C, respectively. P. pastoris αMnP1-1 constitutively expresses the manganese peroxidase (mnp1) complementary DNA from Phanerochaete chrysosporium, and the rMnP has similar kinetic characteristics and pH activity and stability ranges as the wild-type MnP (wtMnP). Cultivation of P. chrysosporium mycelia in stationary flasks for production of heme peroxidases is commonly conducted at low pH (pH 4.2). However, shake flask and fed-batch fermentation experiments with P. pastoris αMnP1-1 demonstrated that rMnP production is highest at pH 6, with rMnP concentrations in the medium declining rapidly at pH less than 5.5, although cell growth rates were similar from pH 4-7. Investigations of the cause of low rMnP production at low pH were consistent with the hypothesis that intracellular proteases are released from dead and lysed yeast cells during the fermentation that are active against rMnP at pH less than 5.5.
Chandel, Anuj K; Gonçalves, Bruna C M; Strap, Janice L; da Silva, Silvio S
2015-01-01
Lignocellulosic biomass (LB) is a promising sugar feedstock for biofuels and other high-value chemical commodities. The recalcitrance of LB, however, impedes carbohydrate accessibility and its conversion into commercially significant products. Two important factors for the overall economization of biofuel production is LB pretreatment to liberate fermentable sugars followed by conversion into ethanol. Sustainable biofuel production must overcome issues such as minimizing water and energy usage, reducing chemical usage and process intensification. Amongst available pretreatment methods, microorganism-mediated pretreatments are the safest, green, and sustainable. Native biodelignifying agents such as Phanerochaete chrysosporium, Pycnoporous cinnabarinus, Ceriporiopsis subvermispora and Cyathus stercoreus can remove lignin, making the remaining substrates amenable for saccharification. The development of a robust, integrated bioprocessing (IBP) approach for economic ethanol production would incorporate all essential steps including pretreatment, cellulase production, enzyme hydrolysis and fermentation of the released sugars into ethanol. IBP represents an inexpensive, environmentally friendly, low energy and low capital approach for second-generation ethanol production. This paper reviews the advancements in microbial-assisted pretreatment for the delignification of lignocellulosic substrates, system metabolic engineering for biorefineries and highlights the possibilities of process integration for sustainable and economic ethanol production.
Belal, Elsayed B.; El-Mahrouk, M. E.
2010-11-01
This work was conducted at a private nursery in Kafr El-Sheikh governorate to investigate the bioconversion of rice straw into a soil-like substrate (SLS) by Phanerochaete chrysosporium and Trichoderma hazianum and the possibility of using rice straw compost in ornamental nurseries as a partial or total replacement of coconut peat (CP) and vermiculite (V) in the growing medium. The results showed that rice straw could be treated better by aerobic fermentation. The authors used five mixtures as follows: (1) Control (CP+V at 1:1 v/v), (2) SLS (100%), (3) SLS+CP (1:1 v/v), (4) SLS+V (1:1 v/v), and (5) SLS+CP+V (1:1:1 v/v/v). Data were recorded as seedling height, no. of leaves, shoot fresh and dry weights, root length and root fresh and dry weights in order to assess the quality of both transplants of Althea rosea (hollyhock) and Calendula officinalis (scotch marigold). Hollyhock seedlings grown in medium containing a mixture of SLS+CP+V displayed quality traits similar to those recorded from the control treatment, while scotch marigold seedlings in the same medium followed the control medium in quality.
Pozdnyakova, N. N.; Balandina, S. A.; Dubrovskaya, E. V.; Golubev, C. N.; Turkovskaya, O. V.
2018-01-01
Primary screening of ligninolytic fungi belonging to wood- and soil-inhabiting basidiomycetes revealed their ability to degrade three-ringed PAHs with formation of quinone metabolites at the first stage. The degradative activity was both species and strain specific, and some differences in the “chances” for the formed quinones were found. They were the main end metabolites in the degradation of PAHs by Stropharia rugosoannulata and Agaricus bisporus. During PAH degradation by strains of Trametes versicolor, Pleurotus ostreatus, Schizophyllum commune, and Bjerkandera adusta similar metabolites were detected during the cultivation, but they were utilized further. The results supported the hypothesis that the degree of PAH degradation may depend on the composition of the extracellular ligninolytic complex of the fungi: in the presence of a single ligninolytic enzyme, laccase, the accumulation of quinone metabolites takes place; their further utilization is possible with the participation of ligninolytic peroxidases. The data obtained showed the necessity not only to identify the metabolites formed, but also to study the activity of the basic ligninolytic enzymes. It is important for the correct selection of fungal strains for mycoremediation.
Directory of Open Access Journals (Sweden)
E.P. Vetchinkina
2017-05-01
Full Text Available The ability of the medicinal xylotrophic basidiomycetes Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum and Grifola frondosa to produce typical and atypical fruiting bodies with viable basidiospores in submerged and solid-phase culture under stationary conditions in a beer wort-containing medium under cold stress was shown. The examined mushrooms, when not exposed to temperature stress, did not form fruiting bodies. In solid-phase culture in an agarized medium after cold treatment, the basidiome formation period was shortened by 1.5–2 times. Furthermore, the use of a mycelium subjected to temperature stress for inoculation induced and accelerated the formation of fruiting bodies on an industrial wood substrate, which is of great biotechnological importance.
SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES
Directory of Open Access Journals (Sweden)
Veligodska A. K.
2015-12-01
Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and
Directory of Open Access Journals (Sweden)
Liang Huo
2018-02-01
Full Text Available Circular RNAs (circRNAs, a novel class of ubiquitous and intriguing noncoding RNA, have been found in a number of eukaryotes but not yet basidiomycetes. In this study, we identified 73 circRNAs from 39.28 million filtered RNA reads from the basidiomycete Cryptococcus neoformans JEC21 using next-generation sequencing (NGS and the bioinformatics tool circular RNA identification (CIRI. Furthermore, mapping of newly found circRNAs to the genome showed that 73.97% of the circRNAs originated from exonic regions, whereas 20.55% were from intergenic regions and 5.48% were from intronic regions. Enrichment analysis of circRNA host genes was conducted based on the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway databases. The results reveal that host genes are mainly responsible for primary metabolism and, interestingly, ribosomal protein production. Furthermore, we uncovered a high-level circRNA that was a transcript from the guanosine triphosphate (GTPase gene CNM01190 (gene ID: 3255052 in our yeast. Coincidentally, YPT5, CNM01190′s ortholog of the GTPase in Schizosaccharomyces pombe, protists, and humans, has already been proven to generate circRNAs. Additionally, overexpression of RNA debranching enzyme DBR1 had varied influence on the expression of circRNAs, indicating that multiple circRNA biosynthesis pathways exist in C. neoformans. Our study provides evidence for the existence of stable circRNAs in the opportunistic human pathogen C. neoformans and raises a question regarding their role related to pathogenesis in this yeast.
Effects of glucose on the Reactive Black 5 (RB5 decolorization by two white rot basidiomycetes
Directory of Open Access Journals (Sweden)
Tony Hadibarata
2011-11-01
Full Text Available The capacities of glucose in the decolorization process of an azo dye, Reactive Black 5 (RB5, by two white rot basidiomycetes, Pleurotus sp. F019 and Trametes sp. F054 were investigated. The results indicated that the dye degradation by the two fungi was extremely correlated with the presence of glucose in the culture and the process of fungi growth. Decolorization of 200 mg dye/l was increased from 62% and 69% to 100% within 20–25 h with the increase of glucose from 5 to 15 g/l, and the activity of manganese dependent peroxidase (MnP increased by 2–9 fold in this case. Hydrogen peroxide of 0.55 mg/l and 0.43 mg/l were detected in 10 h in Pleurotus sp. F019 and Trametes sp. F054 cultures.
International Nuclear Information System (INIS)
Roemmelt, R.; Hiersche, L.; Schaller, G.; Wirth, E.
1990-01-01
During the first three years after the Chernobyl event high Cs 134 + 137 activities in fruitbodies of basidiomycetes have been measured. A decline of activities with time has not yet been observed. The activities are considerably higher compared to agricultural products from the same area. In order to study the movement of radiocesium in coniferous forest sites, the activities in soil, fungi, and plants have been measured. Based on these results a model to describe the cesium cycling in coniferous forest ecosystems is proposed with special emphasis on the influence of soil fungi and plants on the migration of cesium. As measurements of Sr 90 in forest ecosystems are rare this nuclide has been included in the investigations. (author)
Chen, Yu-Han; Yeh, Ting-Feng; Chu, Fang-Hua; Hsu, Fu-Lan; Chang, Shang-Tzen
2015-01-14
Ferruginol has antifungal activity against wood-rot fungi (basidiomycetes). However, specific research on the antifungal mechanisms of ferruginol is scarce. Two-dimensional gel electrophoresis and fluorescent image analysis were employed to evaluate the differential protein expression of wood-rot fungus Trametes versicolor treated with or without ferruginol. Results from protein identification of tryptic peptides via liquid chromatography–electrospray ionization tandem mass spectrometry (LC–ESI-MS/MS) analyses revealed 17 protein assignments with differential expression. Downregulation of cytoskeleton β-tubulin 3 indicates that ferruginol has potential to be used as a microtubule-disrupting agent. Downregulation of major facilitator superfamily (MFS)–multiple drug resistance (MDR) transporter and peroxiredoxin TSA1 were observed, suggesting reduction in self-defensive capabilities of T. versicolor. In addition, the proteins involved in polypeptide sorting and DNA repair were also downregulated, while heat shock proteins and autophagy-related protein 7 were upregulated. These observations reveal that such cellular dysfunction and damage caused by ferruginol lead to growth inhibition and autophagic cell death of fungi.
Studies on the enzymes produced by Basidiomycetes. Part 1. The production of crude enzymes
Energy Technology Data Exchange (ETDEWEB)
Hong, J. S.; Kim, D.H.
1981-01-01
Cellulase, protease, and xylanase, formation by the basidiomycetes, Pleurotus ostreatus 301 and Lentinus edodes 3-1 in growth on rice straw medium were studied. Cultural conditions adequate for enzyme production and effects of various materials and inorganic salts added to the rice straw media were investigated. Lentinus edodes 3-1 was an excellent producer of cellulase and xylanase, and Pleurotus ostreatus 301 of protease. The optimum conditions for enzyme production were 30 degrees for cellulase production and at 25 degrees for xylanase and protease production, with 75% moisture content and initial pH of 5.0-6.0. The appropriate incubation times for enzyme production were 30 days and 35 days for Pleurotus ostreatus 301 and Lentinus edodes 3-1, respectively. Among the various materials added, defatted soybean, defatted rape seed, or defatted sesame were all effective in enzyme production but reduced mycelial growth. Rice bran was also effective, particularly at a 30% concentration. The addition of inorganic salts enhanced enzyme production. Among inorganic salts, the optimum concentration of CaCO3 was 5%, and that of CaSO4 was 2%.
Zahmatkesh, Mostafa; Spanjers, Henri; van Lier, Jules B
2017-11-01
This paper presents the results of fungal treatment of a real industrial wastewater (WW), providing insight into the main mechanisms involved and clarifying some ambiguities and uncertainties in the previous reports. In this regard, the mycoremediation potentials of four strains of white rot fungi (WRF): Phanerochaete chrysosporium, Trametes versicolor, Pleurotus ostreatus and Pleurotus pulmonarius were tested to remove humic acids (HA) from a real humic-rich industrial treated WW of a food-processing plant. The HA removal was assessed by color measurement and size-exclusion chromatography (SEC) analysis. T. versicolor showed the best decolorization efficiency of 90% and yielded more than 45% degradation of HA, which was the highest among the tested fungal strains. The nitrogen limitation was studied and results showed that it affected the fungal extracellular laccase and manganese peroxidase (MnP) activities. The results of the SEC analysis revealed that the mechanism of HA removal by WRF involves degradation of large HA molecules to smaller molecules, conversion of HA to fulvic acid-like molecules and also biosorption of HA by fungal mycelia. The effect of HS on the growth of WRF was investigated and results showed that the inhibition or stimulation of growth differs among the fungal strains.
Directory of Open Access Journals (Sweden)
Cinzia Pezzella
Full Text Available Endocrine disrupting chemicals (EDCs are environmental contaminants causing increasing concerns due to their toxicity, persistence and ubiquity. In the present study, degradative capabilities of Trametes versicolor, Pleurotus ostreatus and Phanerochaete chrysosporium to act on five EDCs, which represent different classes of chemicals (phenols, parabens and phthalate and were first applied as single compounds, were assessed. T. versicolor was selected due to its efficiency against target EDCs and its potentialities were exploited against a mixture of EDCs in a cost-effective bioremediation process. A fed-batch approach as well as a starvation strategy were applied in order to reduce the need for input of 'fresh' biomass, and avoid the requirement for external nutrients. The fungus was successfully operated in two different bioreactors over one week. Semi-batch cultures were carried out by daily adding a mixture of EDCs to the bioreactors in a total of five consecutive degradation cycles. T. versicolor was able to efficiently remove all compounds during each cycle converting up to 21 mg L-1 day-1 of the tested EDCs. The maintained ability of T. versicolor to remove EDCs without any additional nutrients represents the main outcome of this study, which enables to forecast its application in a water treatment process.
Biodegradation of Aged Residues of Atrazine and Alachlor in a Mix-Load Site Soil by Fungal Enzymes
Directory of Open Access Journals (Sweden)
Anastasia E. M. Chirnside
2011-01-01
Full Text Available Soils from bulk pesticide mixing and loading (mix-load sites are often contaminated with a complex mixture of pesticides, herbicides, and other organic compounds used in pesticide formulations that limits the success of remediation efforts. Therefore, there is a need to find remediation strategies that can successfully clean up these mix-load site soils. This paper examined the degradation of atrazine (2-chloro-4-ethylamino-6-isopropylamino-S-triazine; AT and alachlor (2-chloro-2, 6-diethyl-N-[methoxymethyl]-acetanilide in contaminated mix-load site soil utilizing an extracellular fungal enzyme solution derived from the white rot fungus, Phanerochaete chrysosporium, grown in a packed bed bioreactor. Thirty-two percent of AT and 54% of AL were transformed in the biometers. The pseudo first-order rate constant for AT and AL biodegradation was 0.0882 d−1 and 0.2504 d−1, respectively. The half-life (1/2 for AT and AL was 8.0 and 3.0 days, respectively. Compared to AT, the initial disappearance of AL proceeded at a faster rate and resulted in a greater amount of AL transformed. Based on the net Co2 evolved from the biometers, about 4% of the AT and AL initially present in the soil was completely mineralized.
Vetchinkina, Elena; Kupryashina, Maria; Gorshkov, Vladimir; Ageeva, Marina; Gogolev, Yuri; Nikitina, Valentina
2017-04-01
The morphogenesis of macromycetes is a complex multilevel process resulting in a set of molecular-genetic, physiological-biochemical, and morphological-ultrastructural changes in the cells. When the xylotrophic basidiomycetes Lentinus edodes, Grifola frondosa, and Ganoderma lucidum were grown on wood waste as the substrate, the ultrastructural morphology of the mycelial hyphal cell walls differed considerably between mycelium and morphostructures. As the macromycetes passed from vegetative to generative development, the expression of the tyr1, tyr2, chi1, chi2, exg1, exg2, and exg3 genes was activated. These genes encode enzymes such as tyrosinase, chitinase, and glucanase, which play essential roles in cell wall growth and morphogenesis.
Garvie, Laurence A. J.; Wilkens, Barry; Groy, Thomas L.; Glaeser, Jessie A.
2015-04-01
Toxic organohalogen pollutants produced as by-products of industrial processes, such as chloroform and polychlorinated dibenzo- p-dioxins, also have significant natural sources. A substantial terrestrial source of halogenated organics originates from fungal decay of wood and leaf litter. Here we show that the lignicolous basidiomycete Phellinus badius deposits up to 30,000 mg of the halogenated metabolite drosophilin A methyl ether (DAME, tetrachloro-1,4-dimethoxybenzene) per kilogram of decayed heartwood in the mesquite Prosopis juliflora. DAME occurs as clusters of glassy crystals up to 1 mm long within the decayed heartwood. In addition, the Phellinus badius basidiocarps contain an average of 24,000 mg DAME/kg dried fruiting body, testifying to the significant translocation and accumulation of Cl accompanied by DAME biosynthesis. The high DAME concentrations attest to the substantial Cl content of the heartwood, which averages near 5,000 ppm, with Cl/K near 1:1, consistent with an inorganic chloride precursor. Phellinus badius has a circumglobal distribution in the tropics and subtropics, where it is widely distributed on hardwoods and commonly associated with decay of mesquite. There is the potential for extensive DAME formation within decayed heartwood worldwide given the extensive range of Phellinus badius and its propensity to form DAME within mesquites. Further, DAME production is not limited to Phellinus badius but occurs in a range of lignicolous basidiomycetes, suggesting a significant natural reservoir for this chloroaromatic with potential environmental implications.
Gupta, Asheesh; Kirar, Vandana; Keshri, Gaurav Kr; Gola, Shefali; Yadav, Anju; Negi, Prem Singh; Misra, Kshipra
2014-01-01
The Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes) is popular because of its health-promoting properties. The effects of G. lucidum extract on cancer, hypertension, hypercholesterolemia, and hepatitis have been reported by many researchers. This investigation was undertaken to evaluate the healing efficacy of an aqueous lyophilized extract of G. lucidum from the Indian Himalayan region on dermal excision wound in experimental rats. The extract used in the study was found to be rich in total polyphenol and flavonoid contents. The healing efficacy was comparatively assessed with a reference povidone-iodine ointment. The G. lucidum extract showed significant enhanced healing activity, evidenced by an increase in wound contraction, collagen accumulation (hydroxyproline), hexosamine, and total protein contents. Histopathological findings further supported the biochemical indices. The results suggest that aqueous lyophilized extract of G. lucidum possesses significant wound-healing activity.
Biomass measurement by flow cytometry during solid-state fermentation of basidiomycetes.
Steudler, Susanne; Böhmer, Ulrike; Weber, Jost; Bley, Thomas
2015-02-01
Solid-state fermentation (SSF) is a robust process that is well suited to the on-site cultivation of basidiomycetes that produce enzymes for the treatment of lignocellulosics. Reliable methods for biomass quantification are essential for the analysis of fungal growth kinetics. However, direct biomass determination is not possible during SSF because the fungi grow into the substrate and use it as a nutrient source. This necessitates the use of indirect methods that are either very laborious and time consuming or can only provide biomass measurements during certain growth periods. Here, we describe the development and optimization of a new rapid method for fungal biomass determination during SSF that is based on counting fungal nuclei by flow cytometry. Fungal biomass was grown on an organic substrate and its concentration was measured by isolating the nuclei from the fungal hyphae after cell disruption, staining them with SYTOX(®) Green, and then counting them using a flow cytometer. A calibration curve relating the dry biomass of the samples to their concentrations of nuclei was established. Multiple buffers and disruption methods were tested. The results obtained were compared with values determined using the method of ergosterol determination, a classical technique for fungal biomass measurement during SSF. Our new approach can be used to measure fungal biomass on a range of different scales, from 15 mL cultures to a laboratory reactor with a working volume of 10 L (developed by the Research Center for Medical Technology and Biotechnology (fzmb GmbH)). © 2014 International Society for Advancement of Cytometry. © 2014 International Society for Advancement of Cytometry.
Ali, Shawkat
2014-09-19
The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi.
Oleksandr Skyba; Daniel Cullen; Carl J. Douglas; Shawn D. Mansfield
2016-01-01
Identification of the specific genes and enzymes involved in the fungal degradation of lignocellulosic biomass derived from feedstocks with various compositions is essential to the development of improved bioenergy processes. In order to elucidate the effect of substrate composition on gene expression in wood-rotting fungi, we employed microarrays based on the...
Directory of Open Access Journals (Sweden)
Grażyna Końska
2014-01-01
Full Text Available Preliminary investigations were conducted to determine the presence of active lectins in carpophores of fungi from the class Basidiomycetes, collected from natural localities in southern and south-eastern Poland. The degree of agglutination activity (expressed as the titre of agglutination of aqueous extracts was determined at room temperature (18-20°C and at +4°C in respect to human and animal erythrocytes suspended in physiological saline, part of which were additionally treated with proteolytic enzymes. From among the 104 tested species, extracts from 41 of them showed agglutination activity, among which 18 were high. In six cases, specific activity against human ABH group antigens was found. Extracts from 5 species agglutinated only animal erythrocytes, with pigeon erythrocytes being exceptionally sensitive to the lectins. Extracts from two species had distinctly higher agglutination activity at 4°C, which suggests that lectins of the "cold" agglutinin type are present in these species. Analysis of extracts from caps and stems showed that caps had a higher lectin content.
Directory of Open Access Journals (Sweden)
Olga A. Glazunova
2018-04-01
Full Text Available Laccases are copper-containing oxidases that catalyze a one-electron abstraction from various phenolic and non-phenolic compounds with concomitant reduction of molecular oxygen to water. It is well-known that laccases from various sources have different substrate specificities, but it is not completely clear what exactly provides these differences. The purpose of this work was to study the features of the substrate specificity of four laccases from basidiomycete fungi Trametes hirsuta, Coriolopsis caperata, Antrodiella faginea, and Steccherinum murashkinskyi, which have different redox potentials of the T1 copper center and a different structure of substrate-binding pockets. Enzyme activity toward 20 monophenolic substances and 4 phenolic dyes was measured spectrophotometrically. The kinetic parameters of oxidation of four lignans and lignan-like substrates were determined by monitoring of the oxygen consumption. For the oxidation of the high redox potential (>700 mV monophenolic substrates and almost all large substrates, such as phenolic dyes and lignans, the redox potential difference between the enzyme and the substrate (ΔE played the defining role. For the low redox potential monophenolic substrates, ΔE did not directly influence the laccase activity. Also, in the special cases, the structure of the large substrates, such as dyes and lignans, as well as some structural features of the laccases (flexibility of the substrate-binding pocket loops and some amino acid residues in the key positions affected the resulting catalytic efficiency.
Vieira, Gabriela A L; Magrini, Mariana Juventina; Bonugli-Santos, Rafaella C; Rodrigues, Marili V N; Sette, Lara D
2018-05-03
Pyrene and benzo[a]pyrene (BaP) are high molecular weight polycyclic aromatic hydrocarbons (PAHs) recalcitrant to microbial attack. Although studies related to the microbial degradation of PAHs have been carried out in the last decades, little is known about degradation of these environmental pollutants by fungi from marine origin. Therefore, this study aimed to select one PAHs degrader among three marine-derived basidiomycete fungi and to study its pyrene detoxification/degradation. Marasmiellus sp. CBMAI 1062 showed higher levels of pyrene and BaP degradation and was subjected to studies related to pyrene degradation optimization using experimental design, acute toxicity, organic carbon removal (TOC), and metabolite evaluation. The experimental design resulted in an efficient pyrene degradation, reducing the experiment time while the PAH concentration applied in the assays was increased. The selected fungus was able to degrade almost 100% of pyrene (0.08mgmL -1 ) after 48h of incubation under saline condition, without generating toxic compounds and with a TOC reduction of 17%. Intermediate metabolites of pyrene degradation were identified, suggesting that the fungus degraded the compound via the cytochrome P450 system and epoxide hydrolases. These results highlight the relevance of marine-derived fungi in the field of PAH bioremediation, adding value to the blue biotechnology. Copyright © 2018. Published by Elsevier Editora Ltda.
Turbe-Doan, Annick; Arfi, Yonathan; Record, Eric; Estrada-Alvarado, Isabel; Levasseur, Anthony
2013-06-01
Cellobiose dehydrogenases (CDHs) are extracellular glycosylated haemoflavoenzymes produced by many different wood-degrading and phytopathogenic fungi. Putative cellobiose dehydrogenase genes are recurrently discovered by genome sequencing projects in various phylogenetically distinct fungi. The genomes from the basidiomycete Coprinopsis cinerea and the ascomycete Podospora anserina were screened for candidate cdh genes, and one and three putative gene models were evidenced, respectively. Two putative cdh genes were selected and successfully expressed for the first time in Aspergillus niger. CDH activity was measured for both constructions (CDHcc and CDHpa), and both recombinant CDHs were purified to homogeneity and subsequently characterised. Kinetic constants were determined for several carbohydrates including β-1,4-linked di- and oligosaccharides. Optimal temperature and pH were 60 °C and 5 for CDHcc and 65-70 °C and 6 for CDHpa. Both CDHs showed a broad range of pH stability between 4 and 8. The effect of both CDHs on saccharification of micronized wheat straw by an industrial Trichoderma reesei secretome was determined. The addition of each CDH systematically decreased the release of total reducing sugars, but to different extents and according to the CDH concentration. Analytical methods were carried out to quantify the release of glucose, xylose and gluconic acid. An increase of glucose and xylose was measured at a low CDHcc concentration. At moderated and high CDHcc and CDHpa concentrations, glucose was severely reduced with a concomitant increase of gluconic acid. In conclusion, these results give new insights into the physical and chemical parameters and diversity of basidiomycetous and ascomycetous CDHs. These findings also demonstrated that CDH drastically influenced the saccharification on a natural substrate, and thus, CDH origin, concentration and potential enzymatic partners should be carefully considered in future artificial secretomes for
Directory of Open Access Journals (Sweden)
Jerico Alcantara
2017-06-01
Full Text Available Conventional bio-based succinic acid production involves anaerobic bacterial fermentation of pure sugars. This study explored a new route for directly producing succinic acid from minimally-pretreated lignocellulosic biomass via a consolidated bioprocessing technology employing a mixed lignocellulolytic and acidogenic fungal co-culture. The process involved a solid-state pre-fermentation stage followed by a two-phase slurry fermentation stage. During the solid-state pre-fermentation stage, Aspergillus niger and Trichoderma reesei were co-cultured in a nitrogen-rich substrate (e.g., soybean hull to induce cellulolytic enzyme activity. The ligninolytic fungus Phanerochaete chrysosporium was grown separately on carbon-rich birch wood chips to induce ligninolytic enzymes, rendering the biomass more susceptible to cellulase attack. The solid-state pre-cultures were then combined in a slurry fermentation culture to achieve simultaneous enzymatic cellulolysis and succinic acid production. This approach generated succinic acid at maximum titers of 32.43 g/L after 72 h of batch slurry fermentation (~10 g/L production, and 61.12 g/L after 36 h of addition of fresh birch wood chips at the onset of the slurry fermentation stage (~26 g/L production. Based on this result, this approach is a promising alternative to current bacterial succinic acid production due to its minimal substrate pretreatment requirements, which could reduce production costs.
Energy Technology Data Exchange (ETDEWEB)
Hammel, Kenneth E. [Univ. of Wisconsin, Madison, WI (United States); Ralph, John [Univ. of Wisconsin, Madison, WI (United States); Hunt, Christopher G. [U.S. Forest Products Lab., Madison, WI (United States); Houtman, Carl J. [U.S. Forest Products Lab., Madison, WI (United States)
2016-09-06
This work focused on new methods for the detection of oxidation in natural substrates during the deconstruction of lignocellulose by microoganisms. Oxidation was the focus because all known biological systems that degrade lignin are oxidative. The detection methods involved the used of (a) micrometer-scale beads carrying a fluorescent dye that is sensitive to oxidation, (b) 13C-labeled synthetic lignins whose breakdown products can be assessed using mass spectrometry and nuclear magnetic resonance spectroscopy, and (c) a fluorometric stain that is highly sensitive to incipient oxidation during microbial attack. The results showed (a) that one white rot fungus, Phanerochaete chrysosporium, produces diffusible oxidants on wood, and that the onset of oxidation is coincident with the marked up-regulation of genes that encode ligninolytic peroxidases and auxiliary oxidative enzymes; (b) that a more selectively ligninolytic white rot fungus, Ceriporiopsis subvermispora, produces a highly diastereoselective oxidative system for attack on lignin; (c) that a brown rot fungus, Serpula lacrymans, uses extracellular hydroquinone metabolites to drive the production of lignocellulose-oxidizing free radicals; (d) that both white rot and brown rot fungi produce highly diffusible mild oxidants that modify lignocellulose at the earliest stage of substrate deconstruction; and (e) that lignin degradation in a tropical soil is not inhibited as much as expected during periods of flooding-induced hypoxia, which indicates that unknown mechanisms for attack on lignin remain to be discovered.
Babot, Esteban D.; del Río, José C.; Cañellas, Marina; Sancho, Ferran; Lucas, Fátima; Guallar, Víctor; Kalum, Lisbeth; Lund, Henrik; Gröbe, Glenn; Scheibner, Katrin; Ullrich, René; Hofrichter, Martin; Martínez, Angel T.
2015-01-01
The goal of this study is the selective oxyfunctionalization of steroids under mild and environmentally friendly conditions using fungal enzymes. With this purpose, peroxygenases from three basidiomycete species were tested for the hydroxylation of a variety of steroidal compounds, using H2O2 as the only cosubstrate. Two of them are wild-type enzymes from Agrocybe aegerita and Marasmius rotula, and the third one is a recombinant enzyme from Coprinopsis cinerea. The enzymatic reactions on free and esterified sterols, steroid hydrocarbons, and ketones were monitored by gas chromatography, and the products were identified by mass spectrometry. Hydroxylation at the side chain over the steroidal rings was preferred, with the 25-hydroxyderivatives predominating. Interestingly, antiviral and other biological activities of 25-hydroxycholesterol have been reported recently (M. Blanc et al., Immunity 38:106–118, 2013, http://dx.doi.org/10.1016/j.immuni.2012.11.004). However, hydroxylation in the ring moiety and terminal hydroxylation at the side chain also was observed in some steroids, the former favored by the absence of oxygenated groups at C-3 and by the presence of conjugated double bonds in the rings. To understand the yield and selectivity differences between the different steroids, a computational study was performed using Protein Energy Landscape Exploration (PELE) software for dynamic ligand diffusion. These simulations showed that the active-site geometry and hydrophobicity favors the entrance of the steroid side chain, while the entrance of the ring is energetically penalized. Also, a direct correlation between the conversion rate and the side chain entrance ratio could be established that explains the various reaction yields observed. PMID:25862224
Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum
Energy Technology Data Exchange (ETDEWEB)
C.A.Reddy, PI
2005-06-30
and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity
Han, Jianrong
2003-01-15
The ability of the basidiomycete Hericium erinaceum to degrade starch and upgrade nutritional value of cornmeal during solid-state fermentation was studied. On the basal medium which consisted of cornmeal and salt solution, H. erinaceum produced a strong alpha-amylase on the 15th day after inoculation, which resulted in a 52% degradation of the starch. By supplementation with 5-15 g soybean meal per 100 g cornmeal the alpha-amylase activity and degradation rate of starch was raised significantly (P cornmeal, the starch content in the product decreased from 63% to 22% (P < 0.001) and protein content increased from 12% to 17% (P < 0.01). In the protein in the product, the lysine content was increased from 36 to 56 mg/ g and tryptophan from 9 to 13 mg/g. Using egg protein as a standard, an evaluation on the protein quality of the fermented product showed that it was superior to that of the nonfermented control and to other cereals, was close to that of soybean and chicken, but was inferior to that of milk and red meats.
Energy Technology Data Exchange (ETDEWEB)
Steffen, K T; Hatakka, A [Dept. of Applied Chemistry and Microbiology, Univ. of Helsinki (Finland); Hofrichter, M [Unit of Environmental Biotechnology, International Graduate School Zittau, Zittau (Germany)
2003-07-01
Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l{sup -1}) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 {mu}M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l{sup -1} in the absence of Mn(II) to 320 U l{sup -1} in Mn(II)-supplemented cultures. The latter degraded about 6% of a {sup 14}C-labeled BaP into {sup 14}CO{sub 2} whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of {sup 14}C-labeled BaP within 12 weeks. (orig.)
Steffen, K T; Hatakka, A; Hofrichter, M
2002-10-01
Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l(-1)) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 micro M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l(-1) in the absence of Mn(II) to 320 U l(-1) in Mn(II)-supplemented cultures. The latter degraded about 6% of a (14)C-labeled BaP into (14)CO(2) whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of (14)C-labeled BaP within 12 weeks.
Directory of Open Access Journals (Sweden)
Erni Martani
2011-07-01
Full Text Available ABSTRAK Industri tekstil tidak saja menghasilkan sandang yang merupakan kebutuhan primer manusia, tetapi juga mengeluarkan limbah yang berpotensi sebagai penyebab pencemaran lingkungan. Komponen utama limbah industri ini adalah berbagai jenis zat pewarna tekstil. Penelitian ini bertujuan untuk memperoleh isolat-isolat jamur yang mampu mendegradasi beberapa jenis zat pewarna tekstil. Isolasi dilakukan menggunakan metode surface plating di atas medium Potato Dextrose Agar, dan seleksi kemampuan degradasi pewarna berdasarkan atas toleransi terhadap konsentrasi zat pewarna, serta besar dan kecepatan dekolorisasi beberapa jenis zat pewarna. Sebagai parameter awal digunakan enam zat pewarna tekstil. Isolat-isolat unggul kemudian diidentifikasi awal berdasar atas morfologi mikroskopis terhadap miseliumnya. Dalam penelitian ini juga digunakan beberapa kultur murni jamur pembusuk putih sebagai pembanding. Dalam penelitian ini digunakan limbah cair dan padat beberapa industri tekstil dan industri pulp & paper, tanah gambut dari Kalimantan Tengah dan Riau, tanah sekitar Tempat Pembuangan Sampah Akhir, serta tanah seresah hutan. Dari berbagai sumber tersebut diperoleh 101 isolat jamur. Uji dekolorisasi kualitatif terhadap 6 zat pewarna menghasilkan 6 isolat unggul yang mampu mendekolorisasi lebih dari tiga jenis pewarna dengan kecepatan relatif tinggi. Masing-masing isolat unggul memiliki spesifikasi dalam daya dekolorisasi terhadap ke 6 jenis pewarna. Identifikasi awal terhadap isolat unggul menunjukkan bahwa mereka berasal dari genus Aspergillus, Cladosporium, Penicillium dan Stachybotrys. Sedangkan uji terhadap kultur jamur pembusuk putih sebagai pembanding menghasilkan 2 kultur unggul, yaitu: Phanerochaete chrysosporium dan Pleurotus ostreatus. Secara umum kemampuan dekolorisasi isolat-isolat jamur kebanyakan masih di bawah kemampuan kedua kultur murni tersebut, namun beberapa isolat justru memiliki kemampuan lebih tinggi dibandingkan kultur pembanding
Van Waeyenberghe, L; Baert, K; Pasmans, F; van Rooij, P; Hellebuyck, T; Beernaert, L; de Backer, P; Haesebrouck, F; Martel, A
2010-09-01
Dermal and systemic infections caused by the Chrysosporium anamorph of Nannizziopsis vriesii (CANV) are highly prevalent in reptiles and may result in severe disease and high mortality. Due to the high incidence of therapeutic failures, optimizing treatment is required. We first determined in this study the minimal inhibitory concentrations (MIC) of itraconazole, voriconazole, amphotericin B and terbinafine against 32 CANV isolates. For voriconazole, amphotericin B and terbinafine a monomodal MIC distribution was seen, whereas a bimodal MIC distribution was present for itraconazole, indicating acquired resistance in one isolate. Fourteen naturally-infected bearded dragons (Pogona vitticeps), from the same owner, were treated orally with either itraconazole (5 mg/kg q24h) or voriconazole (10 mg/kg q24h). The clinical condition, drug plasma concentrations and the presence of CANV in skin samples were followed. The animals were treated until complete clearance of the fungus. The plasma concentrations of voriconazole and itraconazole exceeded the minimal inhibitory concentrations of the CANV isolates. Elimination of CANV was achieved on average after 27 and 47 days of treatment with itraconazole and voriconazole, respectively. Whereas only 2 out of 7 survived after itraconazole treatment, only a single animal died in the voriconazole treated group. In conclusion, based on a limited number of animals, voriconazole applied at a regimen of 10 mg/kg bodyweight (BW) q24h seems to be a safe and effective antimycotic drug to eliminate CANV infections in bearded dragons.
Rodriguez, Russell J.; Connell, L.; Redman, R.; Barrett, A.; Iszard, M.; Fonseca, A.
2010-01-01
During a survey of the culturable soil fungal population in samples collected in Taylor Valley, South Victoria Land, Antarctica, 13 basidiomycetous yeast strains with orange-coloured colonies were isolated. Phylogenetic analyses of internal transcribed spacer (ITS) and partial LSU rRNA gene sequences showed that the strains belong to the Dioszegia clade of the Tremellales (Tremellomycetes, Agaricomycotina), but did not correspond to any of the hitherto recognized species. Two novel species, Dioszegia antarctica sp. nov. (type strain ANT-03-116T =CBS 10920T =PYCC 5970T) and Dioszegia cryoxerica sp. nov. (type strain ANT-03-071T =CBS 10919T =PYCC 5967T), are described to accommodate ten and three of these strains, respectively. Analysis of ITS sequences demonstrated intrastrain sequence heterogeneity in D. cryoxerica. The latter species is also notable for producing true hyphae with clamp connections and haustoria. However, no sexual structures were observed. The two novel species can be considered obligate psychrophiles, since they failed to grow above 20 °C and grew best between 10 and 15 °C.
Directory of Open Access Journals (Sweden)
Francesca Mancianti
2010-02-01
Full Text Available The occurrence of dermatophytes and keratinophilic fungi was investigated by hair-brush technique on the coat of 986 apparently healthy brown hares (Lepus europaeus, Pallas 1778 caught in 9 restocking and capture zones in Central Italy. Overall, 7.5% hair samples gave positive results. Trichophyton terrestre (2.1%, Chrysosporium sp, Chrysosporium keratinophilum, Microsporum gypseum, Trichophyton gloriae and Trichophyton mentagrophytes (0.6% each, Trichophyton erinacei and Scopulariopsis brevicaulis (0.4% each, Chrysosporium asperatum (0.3%, Arthroderma sp and Microsporum canis (0.1% each were identified in cultures with single isolates, whereas Chrysosporium sp/T. mentagrophytes (0.3%, Chrysosporium sp/T. terrestre and M. gypseum/T. terrestre (0.2% each, Chrysosporium tropicum/T. terrestre, M. canis/T. terrestre and T. ajelloi/T. terrestre (0.1% each were identified in cultures with mixed isolates. T. erinacei and M. canis have not previously been isolated from hares. M. canis, T. erinacei and T. mentagrophytes were the most clinically important dermatophytes found. Altogether, they were isolated only from 1.5% hair samples. Thus, it is concluded that brown hares may play a limited epidemiological role as carriers of zoonotic dermatophytes. Nevertheless, this should be taken into consideration as many people may be exposed to zoonotic agents from brown hares during hunting and trapping activities.
Artz, Rebekka R E; Reid, Eileen; Anderson, Ian C; Campbell, Colin D; Cairney, John W G
2009-03-01
Repeated prescribed burning alters the biologically labile fraction of nutrients and carbon of soil organic matter (SOM). Using a long-term (30 years) repeated burning experiment where burning has been carried out at a 2- or 4-year frequency, we analysed the effect of prescribed burning on gross potential C turnover rates and phenol oxidase activity in relation to shifts in SOM composition as observed using Fourier-transform infrared spectroscopy. In tandem, we assessed the genetic diversity of basidiomycete laccases. While the overall effect of burning was a decline in phenol oxidase activity, Shannon diversity and evenness of laccases was significantly higher in burned sites. Co-correspondence analysis of SOM composition and laccase operational taxonomic unit frequency data also suggested a strong correlation. While this correlation could indicate that the observed increase in laccase genetic diversity due to burning is due to increased resource diversity, a temporal replacement of the most abundant members of the assembly by an otherwise dormant pool of fungi cannot be excluded. As such, our results fit the intermediate disturbance hypothesis. Effects were stronger in plots burned in 2-year rotations, suggesting that the 4-year burn frequency may be a more sustainable practice to ensure the long-term stability of C cycling in such ecosystems.
Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa
2016-01-01
The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636
Sharma, Abha; Shrivastava, Bhuvnesh; Kuhad, Ramesh Chander
2015-10-01
Statistical designs were applied for optimizing laccase production from a white-rot fungus, Ganoderma sp. rckk-02 under solid-state fermentation (SSF). Compared to unoptimized conditions [2,154 U/gds (Unit per gram of dry substrate)], the optimization process resulted in a 17.3-fold increase in laccase production (37,423 U/gds). The laccase produced was evaluated for its potential to decolorize a recalcitrant synthetic dye, malachite green. Laccase at dosage of 30 U/ml in presence of 1 mM of 1-hydroxybenzotriazole (HBT) almost completely decolorized 100 and 200 mg/l of malachite green in 16 and 20 h, respectively, at 30 °C, pH 5.5 and 150 rpm. While, higher dyes concentrations of 300, 400 and 500 mg/l were decolorized to 72, 62 and 55 % in 24, 28 and 32 h, respectively, under similar conditions. Furthermore, it was observed that the decolorized malachite green was less toxic towards the growth of five white-rot fungi tested viz. Crinipellis sp. RCK-1, Ganoderma sp. rckk-02, Coriolopsis Caperata RCK 2011, Phanerochaete chrysosporium K3 and Pycnoporous cinnabarinus PB. The present study demonstrates the potential of Ganoderma sp. rckk-02 to produce high titres of laccase under SSF, which can be exploited in conjunction with redox mediator for the decolorization of high concentrations of malachite green from water bodies.
Directory of Open Access Journals (Sweden)
Eris Septiana
2017-01-01
Full Text Available Turmeric (Curcuma longa L. is a medicinal plant that is commonly used as spice and preservative. Many types of endophytic fungi have been reported as being associated with medicinal plants and able to synthesize secondary metabolites. In this study, endophytic fungi were isolated from all plant parts of turmeric plants. Identification of the endophytic fungi was done using morphological characteristics and sequencing of the internal transcribed spacer (ITS region of ribosomal DNA. The dual culture method was used for screening antibacterial activity of the endophytic fungi against Morganella morganii, a common histamine-producing bacteria. The disc diffusion method was used to test the ability of water fractions of selected endophytic fungi to inhibit M. morganii growth. Two-dimensional thin layer chromatography was used to determine the fungal extract inhibition activity on histamine formation. In total, 11 endophytic fungi were successfully isolated and identified as Arthrobotrys foliicola, Cochliobolus kusanoi, Daldinia eschscholzii, Fusarium oxysporum, Fusarium proliferatum, Fusarium solani, Fusarium verticillioides, Phanerochaete chrysosporium, and Phaeosphaeria ammophilae. Five isolates showed inhibition activity against M. morganii in the dual culture tests. Based on the disc diffusion assay, A. foliicola and F. verticillioides inhibited the growth of M. morganii as a histamine-producing bacteria, and inhibiting histamine formation in fish. The best effects in inhibiting growth of the histamine-producing bacteria and histamine formation inhibition in fish were produced with F. verticillioides water fraction at 0°C incubation.
Winery biomass waste degradation by sequential sonication and mixed fungal enzyme treatments.
Karpe, Avinash V; Dhamale, Vijay V; Morrison, Paul D; Beale, David J; Harding, Ian H; Palombo, Enzo A
2017-05-01
To increase the efficiency of winery-derived biomass biodegradation, grape pomace was ultrasonicated for 20min in the presence of 0.25M, 0.5Mand1.0MKOH and 1.0MNaOH. This was followed by treatment with a 1:1 (v/v) mix of crude enzyme preparation derived from Phanerochaete chrysosporium and Trametes versicolor for 18h and a further 18h treatment with a 60:14:4:2 percent ratio combination of enzymes derived from Aspergillus niger: Penicillium chrysogenum: Trichoderma harzianum: P. citrinum, repsectively. Process efficiency was evaluated by its comparison to biological only mixed fungal degradation over 16days. Ultrasonication treatment with 0.5MKOH followed by mixed enzyme treatment yielded the highest lignin degradation of about 13%. Cellulase, β-glucosidase, xylanase, laccase and lignin peroxidase activities of 77.9, 476, 5,390.5, 66.7 and 29,230.7U/mL, respectively, were observed during biomass degradation. Gas chromatography-mass spectrometry (GC-MS) analysis of the degraded material identified commercially important compounds such as gallic acid, lithocholic acid, glycolic acid and lactic acid which were generated in considerable quantities. Thus, the combination of sonication pre-treatment and enzymatic degradation has the potential to considerably improve the breakdown of agricultural biomass and produce commercially useful compounds in markedly less time (<40h) with respect to biological only degradation (16days). Copyright © 2016 Elsevier Inc. All rights reserved.
Juneidi, Ibrahim; Hayyan, Maan; Mohd Ali, Ozair
2016-04-01
An investigation on the toxicological assessment of 10 choline chloride (ChCl)-based deep eutectic solvents (DESs) towards four fungi strains and Cyprinus carpio fish was conducted. ChCl was combined with materials from different chemical groups such as alcohols, sugars, acids and others to form DESs. The study was carried out on the individual DES components, their aqueous mixture before DES formation and their formed DESs. The agar disc diffusion method was followed to investigate their toxicity on four fungi strains selected as a model of eukaryotic microorganisms (Phanerochaete chrysosporium, Aspergillus niger, Lentinus tigrinus and Candida cylindracea). Among these DESs, ChCl:ZnCl2 exhibited the highest inhibition zone diameter towards the tested fungi growth in vitro, followed by the acidic group (malonic acid and p-toluenesulfonic acid). Another study was conducted to test the acute toxicity and determine the lethal concentration at 50 % (LC50) of the same DESs on C. carpio fish. The inhibition range and LC50 of DESs were found to be different from their individual components. DESs were found to be less toxic than their mixture or individual components. The LC50 of ChCl:MADES is much higher than that of ChCl:MAMix. Moreover, the DESs acidic group showed a lower inhibition zone on fungi growth. Thus, DESs should be considered as new components with different physicochemical properties and toxicological profiles, and not merely compositions of compounds.
Directory of Open Access Journals (Sweden)
S. Lupo
2006-04-01
Full Text Available Inocutis jamaicensis (Murrill Gottlieb, J.E. Wright & Moncalvo was identified as the basidiomycetous species associated with ‘hoja de malvón’ grapevine disease in Argentina. Macro and micro-morphological characteristics of fruit bodies corresponded to those described for the white-rotting fungus associated with native plant species and Eucalyptus globulus Labill. planted in Uruguay. Monokariotic isolates were obtained from basidiospores produced by fruit bodies of I. jamaicensis collected from Vitis vinifera L. and E. globulus. Dikaryons and fruit bodies produced by pairing monokaryotic mycelium suggest that all these isolates belong to the same species. The analysis of RFLP of the dikaryon produced by pairing monokaryons derived from V. vinifera and E. globulus revealed fragments that corresponded to each monokaryon, confirming that isolates from Vitis mated with those from Eucalyptus. In order to compare grapevine and Uruguayan isolates, RFLPs from ITS region generated by restriction digestion with Alu I, Hae III, Hha I, Msp I and Taq I were performed. Differences found in some restriction pattern could reflect a certain degree of variability between dikariotic isolates, probably related with a particular lifestyle, host specificity or geographic origin.
Inducción fúngica de la biorremediación de suelos contaminados con combustibles
Directory of Open Access Journals (Sweden)
Mary Lopretti
2011-04-01
Full Text Available La biorremediación de suelos ha sido en los últimos años una de las aplicaciones de los procesos de la biotecnología industrial que se ha desarrollado en busca de soluciones naturales y eficientes al problema de la contaminación.Varios son los microorganismos que viven en condiciones extremas, desarrollando estrategias metabólicas que les permiten tener sus vías metabólicas aptas para vivir y reproducirse. Dentro de estas estrategias se encuentra la acción de enzimas hidrolíticas, oxidativas y depolimerizantes que permiten modificar sustratos complejos como lo son los derivados del petróleo y entre ellos los combustibles.En el presente trabajo se estudió la acción de dos hongos Gloeophylum trabeum y Phanerochaetes chrysosporium actuando en forma consorcial sobre sustratos contaminados con gasoil y nafta.Se prepararon 4 reactores de fermentación sólida: dos de ellos blanco, contaminados sin inducción, y de los otros dos uno con nafta y el otro con gasoil inoculados ambos con 100cc de medio de propagación con micelios de P.chrysosporium y 50cc de medio de crecimiento con pellets de G. trabeum. Se extrajeron muestras cada 15 días y se evaluó en el material de cada reactor características fisicoquímicas como %C, humedad y pH.También se realizó la evaluación microbiológica por siembra en placa y dilución en placa con agar malta al 1,25%. En todos los casos se obtuvieron micelios.Por último se determinó la actividad de enzimas lacasa y peroxidasa. La actividad lacasa se determinó por espectrometría usando 0.5mM de ABTS como sustrato en 0,1M de buffer acetato de sodio pH5 y 1 ml de extracto obtenido por extracción salina. La determinación de actividad Mn peroxidasa se realizó con 0.01% de rojo fenol como sustrato en buffer succinato de sodio 0.1M en presencia de 1 ml de extracto enzimático, MnSO4 0.1M y H2O2 0.1M.Las actividad de éstas enzimas permitió obtener moléculas mas pequeñas producto de la
Han, J R; An, C H; Yuan, J M
2005-01-01
The objective of this research was to study the ability of the basidiomycete Ganoderma lucidum to degrade starch and upgrade nutritional value of cornmeal during solid-state fermentation (SSF). On the basal medium that consisted of cornmeal and salt solution, alpha-amylase activity of G. lucidum reached its maximum value of 267 U g(-1) of culture on day 20 after inoculation. Prolongation of fermentation time from 10 to 25 days increased significantly the degradation rate of starch and ergosterol yield (a kind of physiologically active substances of G. lucidum, also as an indicator of mycelial biomass) (P cornmeal, ground to 30-mesh powder, moistened with 67 ml of nutrient salt solution supplemented with 3 g yeast extract and 7.5 g glucose per litre. Under the optimum culture condition, the degradation rate of starch reached its maximum values of 70.4%; the starch content of the fermented product decreased from 64.5 to 25.3%, while the reducing sugar content increased from 4.2 to 20.6%. SSF also produced a significant increase (P cornmeal was strikingly increased and some active substances originated from G. lucidum remained in the fermented product. This implied that cornmeal could be processed into many kinds of special functional foods by SSF of G. lucidum.
Zhao, Jing; Liu, Wei; Chen, Dong; Zhou, Chunli; Song, Yi; Zhang, Yuyu; Ni, Yuanying; Li, Quanhong
2015-02-01
A new protocol for processing of pumpkin juice was set up which included fermentation by the basidiomycete Ganoderma lucidum at 28 °C for 7 d. The growth curve of G. lucidum in pumpkin juice was successfully (R(2) = 0.99) fitted by a 4-parameter logistic model and the ideal highest biomass was estimated to be 4.79 g/L. G. lucidum was found to have a significant acidification effect on pumpkin juice. The lowest pH (4.05 ± 0.05) and highest total titratable acidity (14.31 ± 0.16 mL 0.1 M NaOH/100 mL) were found on the 4th day during fermentation. Sugars in pumpkin juice fermented with G. lucidum showed a significant decrease, especially glucose and fructose. On the contrary, the release of exo-polysaccharides and free amino acids greatly enriched the pumpkin juice. The variation of color index and viscosity also mirrored the above behavior. Based on headspace solid phase microextraction and gas chromatography-mass spectrometry, 68 volatile compounds were identified, including 17 esters, 14 alcohols, 13 phenyl compounds, 11 aldehydes, 8 ketones, 3 acids, 1 furan, and 1 benzothiazole. The pumpkin juices fermented for different days were markedly differentiated with principal component analysis and the fermentation process was tentatively divided into 3 periods: the booming (from the 1st to 4th day), steady (from the 5th to 6th day), and decline (the 7th day) period. © 2014 Institute of Food Technologists®
Vetchinkina, Elena P; Loshchinina, Ekaterina A; Vodolazov, Ilya R; Kursky, Viktor F; Dykman, Lev A; Nikitina, Valentina E
2017-02-01
The work shows the ability of cultured Basidiomycetes of different taxonomic groups-Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum, and Grifola frondosa-to recover gold, silver, selenium, and silicon, to elemental state with nanoparticles formation. It examines the effect of these metal and metalloid compounds on the parameters of growth and accumulation of biomass; the optimal cultivation conditions and concentrations of the studied ion-containing compounds for recovery of nanoparticles have been identified. Using the techniques of transmission electron microscopy, dynamic light scattering, X-ray fluorescence and X-ray phase analysis, the degrees of oxidation of the bioreduced elements, the ζ-potential of colloidal solutions uniformity, size, shape, and location of the nanoparticles in the culture fluid, as well as on the surface and the inside of filamentous hyphae have been determined. The study has found the part played by homogeneous chromatographically pure fungal phenol-oxidizing enzymes (laccases, tyrosinases, and Mn-peroxidases) in the recovery mechanism with formation of electrostatically stabilized colloidal solutions. A hypothetical mechanism of gold(III) reduction from HAuCl 4 to gold(0) by phenol oxidases with gold nanoparticles formation of different shapes and sizes has been introduced.
Munir, E.; Priyani, N.; Suryanto, D.; Naimah, Z.
2017-03-01
A study of basidiomycetous fungi in decolorization of wastewater of textile industry has been started in our laboratory. The objective of this study was to obtain potential isolates and to examine their decolorization acitity. The fungi were isolated from local forest, Gunung Barus Forest, in North Sumatera and screened their ligninolytic activity qualitatively by bavendam method and the waste was obtained from local textile industry in Medan. Nineteen fungal isolates grew on plate agar medium containing 100% of waste supplemented with 2% glucose, and 6 of those exhibited good growth when glucose in the media was reduced to 1%. Surprisingly, these six potential isolates grew, although relatively at lower rate, when glucose was not included in the media. Meanwhile, there was no substantial decolorization of media could be observed on all plates cultures. Analyses of decolorization on liquid condition containing 25% of wastewater and no glucose showed that fungal grew at the bottom culture flask. All 6 isolates exhibited decolorization activity. Interestingly, mass of mycelia growth at the bottom absorbed dyes and dissolved suspended solid which was seemingly separated from very clean solution medium surrounding. These results indicated that the cultures utilized carbon source from waste and the extracellular matrixes produced by fungal isolates might involve in decolorization of textile wastewater.
Morita, Tomotake; Takashima, Masako; Fukuoka, Tokuma; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai
2010-10-01
The producers of glycolipid biosurfactant, mannosylerythritol lipid-B (MEL-B), were isolated from leaves of Perilla frutescens on Ibaraki in Japan. Four isolates, 1D9, 1D10, 1D11, and 1E5, were identified as basidiomycetous yeast Pseudozyma tsukubaensis by rDNA sequence and biochemical properties. The structure of MEL-B produced by these strains was analyzed by (1)H nuclear magnetic resonance and gas chromatography-mass spectrometry methods, and was determined to be the same as the diastereomer MEL-B produced by P. tsukubaensis NBRC 1940. Of these isolates, P. tsukubaensis 1E5 (JCM 16987) is capable of producing the largest amount of the diastereomer MEL-B from vegetable oils. In order to progress the diastereomer MEL-B production by strain 1E5, factors affecting the production, such as carbon and organic nutrient sources, were further examined. Olive oil and yeast extract were the best carbon and nutrient sources, respectively. Under the optimal conditions, a maximum yield, productivity, and yield coefficient of 73.1 g/L, 10.4 g L(-1) day(-1), and 43.5 g/g were achieved by feeding of olive oil in a 5-L jar-fermenter culture using strain 1E5.
Deshmukh, S K; Verekar, S A
2014-12-01
One hundred and twenty-five samples were collected from eight different sites in the vicinity of Sanjay Gandhi National Park (SGNP) and screened for the presence of keratinophilic fungi using hair baiting technique for isolation. Seventy-three isolates were recovered and identified. The cultures were identified using macro- and micro-morphological features. Their identification was also confirmed by the BLAST search of sequences of the ITS1-5.8S-ITS2 rDNA region against the NCBI/Genbank data and compared with deposited sequences for identification purpose. Thirteen species of nine genera were isolated viz. Aphanoascus durus (2.4%), Arthroderma corniculatum (1.6%), Auxarthron umbrinum (0.8%), Chrysosporium evolceanui (1.6%), Chrysosporium indicum (16.0%), Chrysosporium tropicum (2.4%), Chrysosporium zonatum (4.0%), Chrysosporium states of Arthroderma tuberculatum (0.8%), Chrysosporium state of Ctenomyces serratus (11.2%), Gymnascella dankaliensis (3.2%), Microsporum gypseum (12.0%), Myriodontium keratinophilum (0.8%) and Trichophyton mentagrophytes (1.6%). Representative of all thirteen species can release the protein in the range of 152.2-322.4 μg/mL in liquid media when grown on human hair in shake flask culture and also decompose 18.4-40.2% of human hair after four weeks of incubation. This study indicates that the soils of SGNP, Mumbai may be significant reservoirs of certain keratinophilic fungi. The keratinolytic activity of these fungi may be playing significant role in superficial infections to man and animals and recycling of keratinic material of this environment. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Hirotoshi Sato
Full Text Available Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL region and fungal internal transcribed spacer 2 (ITS2 region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity.
Karas, Panagiotis A; Perruchon, Chiara; Exarhou, Katerina; Ehaliotis, Constantinos; Karpouzas, Dimitrios G
2011-02-01
Wastewaters from the fruit packaging industry contain a high pesticide load and require treatment before their environmental discharge. We provide first evidence for the potential bioremediation of these wastewaters. Three white rot fungi (WRF) (Phanerochaete chrysosporium, Trametes versicolor, Pleurotus ostreatus) and an Aspergillus niger strain were tested in straw extract medium (StEM) and soil extract medium (SEM) for degrading the pesticides thiabendazole (TBZ), imazalil (IMZ), thiophanate methyl (TM), ortho-phenylphenol (OPP), diphenylamine (DPA) and chlorpyrifos (CHL). Peroxidase (LiP, MnP) and laccase (Lac) activity was also determined to investigate their involvement in pesticide degradation. T. versicolor and P. ostreatus were the most efficient degraders and degraded all pesticides (10 mg l⁻¹) except TBZ, with maximum efficiency in StEM. The phenolic pesticides OPP and DPA were rapidly degraded by these two fungi with a concurrent increase in MnP and Lac activity. In contrast, these enzymes were not associated with the degradation of CHL, IMZ and TM implying the involvement of other enzymes. T. versicolor degraded spillage-level pesticide concentrations (50 mg l⁻¹) either fully (DPA, OPP) or partially (TBZ, IMZ). The fungus was also able to rapidly degrade a mixture of TM/DPA (50 mg l⁻¹), whereas it failed to degrade IMZ and TBZ when supplied in a mixture with OPP. Overall, T. versicolor and P. ostreatus showed great potential for the bioremediation of wastewaters from the fruit packaging industry. However, degradation of TBZ should be also achieved before further scaling up.
Directory of Open Access Journals (Sweden)
Hanieh Soleimanifar
2012-12-01
Full Text Available Acid mine drainage (AMD containing high concentrations of iron and sulphate, low pH and variableconcentrations of heavy metals leads to many environmental problems. The concentrations of Cu and Mnare high in the AMD of the Sarcheshmeh porphyry copper mine, Kerman province, south of Iran. In thisstudy, the bio-remediation of Cu and Mn ions from acid mine drainage was investigated using two nativefungi called Aspergillus niger and Phanerochaete chrysosporium which were extracted from the soil andsediment samples of the Shour River at the Sarcheshmeh mine. The live fungi was first harvested andthen killed by boiling in 0.5 N NaOH solution. The biomass was finally dried at 60 C for 24 h andpowdered. The optimum biosorption parameters including pH, temperature, the amount of biosorbent andcontact time were determined in a batch system. The optimum pH varied between 5 and 6. It was foundthat the biosorption process increased with an increase in temperature and the amount of biosorbent.Biosorption data were attempted by Langmuir and Freundlich isotherm models and showed a good match.Kinetic studies were also carried out in the present study. The results show that the second-order kineticsmodel fits well the experimental data. The biosorption experiments were further investigated with acontinuous system to compare the biosorption capacities of two systems. The results show thatbiosorption process using a continuous system increases efficiency up to 99%. A desorption process waseventually performed in order to recover Copper and Manganese ions. This process was successful andfungi could be used again.
Comparative Analysis of Secretome Profiles of Manganese(II-Oxidizing Ascomycete Fungi.
Directory of Open Access Journals (Sweden)
Carolyn A Zeiner
Full Text Available Fungal secretomes contain a wide range of hydrolytic and oxidative enzymes, including cellulases, hemicellulases, pectinases, and lignin-degrading accessory enzymes, that synergistically drive litter decomposition in the environment. While secretome studies of model organisms such as Phanerochaete chrysosporium and Aspergillus species have greatly expanded our knowledge of these enzymes, few have extended secretome characterization to environmental isolates or conducted side-by-side comparisons of diverse species. Thus, the mechanisms of carbon degradation by many ubiquitous soil fungi remain poorly understood. Here we use a combination of LC-MS/MS, genomic, and bioinformatic analyses to characterize and compare the protein composition of the secretomes of four recently isolated, cosmopolitan, Mn(II-oxidizing Ascomycetes (Alternaria alternata SRC1lrK2f, Stagonospora sp. SRC1lsM3a, Pyrenochaeta sp. DS3sAY3a, and Paraconiothyrium sporulosum AP3s5-JAC2a. We demonstrate that the organisms produce a rich yet functionally similar suite of extracellular enzymes, with species-specific differences in secretome composition arising from unique amino acid sequences rather than overall protein function. Furthermore, we identify not only a wide range of carbohydrate-active enzymes that can directly oxidize recalcitrant carbon, but also an impressive suite of redox-active accessory enzymes that suggests a role for Fenton-based hydroxyl radical formation in indirect, non-specific lignocellulose attack. Our findings highlight the diverse oxidative capacity of these environmental isolates and enhance our understanding of the role of filamentous Ascomycetes in carbon turnover in the environment.
Extracellular oxidative metabolism of wood decay fungi
Energy Technology Data Exchange (ETDEWEB)
Daniel Cullen
2010-04-21
Substantial progress has been made toward understanding the fundamental physiology and genetics of wood decay fungi, microbes that are capable of degrading all major components of plant cell walls. Efficient utilization of lignocellulosic biomass has been hampered in part by limitations in our understanding of enzymatic mechanisms of plant cell wall degradation. This is particularly true of woody substrates where accessibility and high lignin content substantially complicate enzymatic 'deconstruction'. The interdisciplinary research has illuminated enzymatic mechanisms essential for the conversion of lignocellulosics to simple carbohydrates and other small molecular weight products. Progress was in large part dependent on substantial collaborations with the Department of Energy's Joint Genome Institute (JGI) in Walnut Creek and Los Alamos, as well as the Catholic University, Santiago, Chile, the Royal Institute of Technology, Stockholm, the University of Minnesota, St. Paul, and colleagues at the University of Wisconsin and the Forest Products Laboratory. Early accomplishments focused on the development of experimental tools (2, 7, 22, 24-26, 32) and characterization of individual genes and enzymes (1, 3-5, 8, 9, 11, 14, 15, 17, 18, 23, 27, 33). In 2004, the genome of the most intensively studied lignin-degrading fungus, Phanerochaete chrysosporium, was published (21). This milestone lead to additional progress on this important model system (6, 10, 12, 13, 16, 28-31) and was further complemented by genome analysis of other important cellulose-degrading fungi (19, 20). These accomplishments have been highly cited and have paved the way for whole new research areas.
Irradiation of Liquid Fungi Isolated Media from Contaminated Sources with Heavy Metals Additive
International Nuclear Information System (INIS)
Tawfiq, E.; Mohamed, A.A.; El-Kabbany, H.M.
2012-01-01
Occupational lead exposure is an important health issue in Egyptian workers, employees of paint factories, workers of copying centres, drivers, and tile making factories are in higher risk of lead toxicity. Wastewater, particularly from electroplating, paint, leather, metal and tanning industries, contain enormous amount of heavy metals. Microorganisms including fungi have been reported to exclude heavy metals from wastewater through bioaccumulation and bio sorption at low cost and in eco-friendly way. Low level lead exposure can significantly induce motor dis functions and cognitive impairment in children. Seventy six fungal isolates tolerant to heavy metals like Pb, Cd, Cr and Ni were isolated from sewage, sludge and industrial effluents containing heavy metals. Four fungi (Phanerochaete chrysosporium, Aspergillus awamori, Aspergillus flavus, Trichoderma viride) were included in this study. The majority of the fungal isolates were able to tolerate up to 400 ppm concentration of Pb, Cd, Cr and Ni. The most heavy metal tolerant fungi were studied for removal of heavy metals from liquid media at 50 ppm concentration. Results indicated removal of substantial amount of heavy metals by some of the fungi with respect to Pb, Cd, Cr and Ni with maximum uptake of 59.67, 16.25, 0.55 and 0.55 mg/g by fungi Pb 3 (Aspergillus terreus), Trichoderma viride, C r 8 (Trichoderma longibrachiatum), and isolate Ni 27 (A. niger), respectively. This indicated the potential of these fungi as bio sorbent for removal of heavy metals from wastewater and industrial effluents containing higher concentration of heavy metals. The F-ratio was 0.55 and gives non-significant as irradiated
Hammel, K E; Mozuch, M D; Jensen, K A; Kersten, P J
1994-11-15
Oxidative C alpha-C beta cleavage of the arylglycerol beta-aryl ether lignin model 1-(3,4-dimethoxy-phenyl)-2-phenoxypropane-1,3-diol (I) by Phanerochaete chrysosporium lignin peroxidase in the presence of limiting H2O2 was enhanced 4-5-fold by glyoxal oxidase from the same fungus. Further investigation showed that each C alpha-C beta cleavage reaction released 0.8-0.9 equiv of glycolaldehyde, a glyoxal oxidase substrate. The identification of glycolaldehyde was based on 13C NMR spectrometry of reaction product obtained from beta-, gamma-, and beta,gamma-13C-substituted I, and quantitation was based on an enzymatic NADH-linked assay. The oxidation of glycolaldehyde by glyoxal oxidase yielded 0.9 oxalate and 2.8 H2O2 per reaction, as shown by quantitation of oxalate as 2,3-dihydroxyquinoxaline after derivatization with 1,2-diaminobenzene and by quantitation of H2O2 in coupled spectrophotometric assays with veratryl alcohol and lignin peroxidase. These results suggest that the C alpha-C beta cleavage of I by lignin peroxidase in the presence of glyoxal oxidase should regenerate as many as 3 H2O2. Calculations based on the observed enhancement of LiP-catalyzed C alpha-C beta cleavage by glyoxal oxidase showed that approximately 2 H2O2 were actually regenerated per cleavage of I when both enzymes were present. The cleavage of arylglycerol beta-aryl ether structures by ligninolytic enzymes thus recycles H2O2 to support subsequent cleavage reactions.
Comparative Analysis of Secretome Profiles of Manganese(II)-Oxidizing Ascomycete Fungi
Energy Technology Data Exchange (ETDEWEB)
Zeiner, Carolyn A.; Purvine, Samuel O.; Zink, Erika M.; Paša-Tolić, Ljiljana; Chaput, Dominique L.; Haridas, Sajeet; Wu, Si; LaButti, Kurt; Grigoriev, Igor V.; Henrissat, Bernard; Santelli, Cara M.; Hansel, Colleen M.; Pöggeler, Stefanie
2016-07-19
Fungal secretomes contain a wide range of hydrolytic and oxidative enzymes, including cellulases, hemicellulases, pectinases, and lignin-degrading accessory enzymes, that synergistically drive litter decomposition in the environment. While secretome studies of model organisms such as Phanerochaete chrysosporium and Aspergillus species have greatly expanded our knowledge of these enzymes, few have extended secretome characterization to environmental isolates or conducted side-by-side comparisons of diverse species. Thus, the mechanisms of carbon degradation by many ubiquitous soil fungi remain poorly understood. Here we use a combination of LC-MS/MS, genomic, and bioinformatic analyses to characterize and compare the protein composition of the secretomes of four recently isolated, cosmopolitan, Mn(II)-oxidizing Ascomycetes (Alternaria alternata SRC1lrK2f, Stagonospora sp. SRC1lsM3a, Pyrenochaeta sp. DS3sAY3a, and Paraconiothyrium sporulosum AP3s5-JAC2a). We demonstrate that the organisms produce a rich yet functionally similar suite of extracellular enzymes, with species-specific differences in secretome composition arising from unique amino acid sequences rather than overall protein function. Furthermore, we identify not only a wide range of carbohydrate-active enzymes that can directly oxidize recalcitrant carbon, but also an impressive suite of redox-active accessory enzymes that suggests a role for Fenton-based hydroxyl radical formation in indirect, non-specific lignocellulose attack. Our findings highlight the diverse oxidative capacity of these environmental isolates and enhance our understanding of the role of filamentous Ascomycetes in carbon turnover in the environment.
Yao, Lu; Zhu, Li-Ping; Xu, Xiao-Yan; Tan, Ling-Ling; Sadilek, Martin; Fan, Huan; Hu, Bo; Shen, Xiao-Ting; Yang, Jie; Qiao, Bin; Yang, Song
2016-09-01
Transcriptomic analysis of cultured fungi suggests that many genes for secondary metabolite synthesis are presumably silent under standard laboratory condition. In order to investigate the expression of silent genes in symbiotic systems, 136 fungi-fungi symbiotic systems were built up by co-culturing seventeen basidiomycetes, among which the co-culture of Trametes versicolor and Ganoderma applanatum demonstrated the strongest coloration of confrontation zones. Metabolomics study of this co-culture discovered that sixty-two features were either newly synthesized or highly produced in the co-culture compared with individual cultures. Molecular network analysis highlighted a subnetwork including two novel xylosides (compounds 2 and 3). Compound 2 was further identified as N-(4-methoxyphenyl)formamide 2-O-β-D-xyloside and was revealed to have the potential to enhance the cell viability of human immortalized bronchial epithelial cell line of Beas-2B. Moreover, bioinformatics and transcriptional analysis of T. versicolor revealed a potential candidate gene (GI: 636605689) encoding xylosyltransferases for xylosylation. Additionally, 3-phenyllactic acid and orsellinic acid were detected for the first time in G. applanatum, which may be ascribed to response against T.versicolor stress. In general, the described co-culture platform provides a powerful tool to discover novel metabolites and help gain insights into the mechanism of silent gene activation in fungal defense.
Metreveli, Eka; Kachlishvili, Eva; Singer, Steven W; Elisashvili, Vladimir
2017-10-01
Mono and dual cultures of four white-rot basidiomycete species were evaluated for cellulase and xylanase activity under submerged fermentation conditions. Co-cultivation of Pycnoporus coccineus or Trametes hirsuta with Schizophyllum commune displayed antagonistic interactions resulting in the decrease of endoglucanase and total cellulase activities. In contrast, increases in cellulase and xylanase activity were revealed through the compatible interactions of Irpex lacteus with S. commune. Co-cultivation conditions were optimized for maximum enzyme production by I. lacteus and S. commune, the best producers of cellulase/xylanase and β-glucosidase, respectively. An optimized medium for the target enzyme production by the mixed culture was established in a laboratory fermenter yielding 7U/mL total cellulase, 142U/mL endoglucanase, 104U/mL xylanase, and 5.2U/mL β-glucosidase. The dual culture approach resulted in an enzymatic mixture with 11% improved lignocellulose saccharification potential compared to enzymes from a monoculture of I. lacteus. Copyright © 2017 Elsevier Ltd. All rights reserved.
Physical Damages of Wood Fiber in Acacia Mangium due to Biopulping Treatment
Directory of Open Access Journals (Sweden)
Ridwan Yahya
2016-05-01
chrysosporium to Acacia mangium Willd can reduce lignin and improve holocellulose and cellulose content of the material. Fiber dimension recognized as other important factor for paper properties. The question is how the integrity and dimensions of the wood fiber that has been pretreated with the fungus. The objectives of present study were to know effect of pretreatment of P. chrysosporium to the integrity and dimensions of the fiber. The P. chrysosporium was cultured for 14 days in growth medium, and inoculated to wood chips 5% (w/v and incubated for 0, 15 and 30 days. The inoculated wood chips were chipped into 1 mm x 1 mm x 20 mm and macerated using franklin solution at 60 oC for 48 hours. Forty fibers from each incubated time were analized their physical damages using a light microscope at a 400 magnification. The inoculated fibers were measured theirs dimensions. The physical damage percentage of fibers pretreated using P. chrysosporium was 0%. Length and wall thickness of the pretreated fibers were can be categorized as middle class and thin fibers, respectively.
Toxicity of organic and inorganic nanoparticles to four species of white-rot fungi
International Nuclear Information System (INIS)
Galindo, T.P.S.; Pereira, R.; Freitas, A.C.; Santos-Rocha, T.A.P.; Rasteiro, M.G.; Antunes, F.; Rodrigues, D.; Soares, A.M.V.M.; Gonçalves, F.
2013-01-01
The rapid development of nanoparticles (NP) for industrial applications and large-volume manufacturing, with its subsequent release into the environment, raised the need to understand and characterize the potential effects of NP to biota. Accordingly, this work aimed to assess sublethal effects of five NP to the white-rot fungi species Trametes versicolor, Lentinus sajor caju, Pleurotus ostreatus, and Phanerochaete chrysosporium. Each species was exposed to serial dilutions of the following NP: organic-vesicles of SDS/DDAB and of Mo/NaO; gold-NP, quantum dot CdSe/ZnS, and Fe/Co. Fungi growth rate was monitored every day, and at the end of assay the mycelium from each replicate was collected to evaluate possible changes in its chemical composition. For all NP-suspensions the following parameters were characterized: hydrodynamic diameter, surface charge, aggregation index, zeta potential, and conductivity. All tested NP tended to aggregate when suspended in aqueous media. The obtained results showed that gold-NP, CdSe/ZnS, Mo/NaO, and SDS/DDAB significantly inhibited the growth of fungi with effects on the mycelium chemical composition. Among the tested NP, gold-NP and CdSe/ZnS were the ones exerting a higher effect on the four fungi. Finally to our knowledge, this is the first study reporting that different types of NP induce changes in the chemical composition of fungi mycelium. - Highlights: • Nanoparticles (NP) tend to aggregate when in aqueous suspensions. • Chemical composition revealed to be very important in the ecotoxicity of NP. • Observed effects suggested diversified modes of action of different NP. • White-rot fungi species exhibit great differences in their sensitivity to NP
Energy Technology Data Exchange (ETDEWEB)
Martinez, Diego [Los Alamos National Laboratory; Challacombe, Jean F [Los Alamos National Laboratory; Misra, Monica [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Brettin, Thomas [Los Alamos National Laboratory; Morgenstern, Ingo [CLARK UNIV; Hibbett, David [CLARK UNIV.; Schmoll, Monika [UNIV WIEN; Kubicek, Christian P [UNIV WIEN; Ferreira, Patricia [CIB, CSIC, MADRID; Ruiz - Duenase, Francisco J [CIB, CSIC, MADRID; Martinez, Angel T [CIB, CSIC, MADRID; Kersten, Phil [FOREST PRODUCTS LAB; Hammel, Kenneth E [FOREST PRODUCTS LAB; Vanden Wymelenberg, Amber [U. WISCONSIN; Gaskell, Jill [FOREST PRODUCTS LAB; Lindquist, Erika [DOE JGI; Sabati, Grzegorz [U. WISCONSIN; Bondurant, Sandra S [U. WISCONSIN; Larrondo, Luis F [U. CATHOLICA DE CHILE; Canessa, Paulo [U. CATHOLICA DE CHILE; Vicunna, Rafael [U. CATHOLICA DE CHILE; Yadavk, Jagiit [U. CINCINATTI; Doddapaneni, Harshavardhan [U. CINCINATTI; Subramaniank, Venkataramanan [U. CINCINATTI; Pisabarro, Antonio G [PUBLIC U. NAVARRE; Lavin, Jose L [PUBLIC U. NAVARRE; Oguiza, Jose A [PUBLIC U. NAVARRE; Master, Emma [U. TORONTO; Henrissat, Bernard [CNRS, MARSEILLE; Coutinho, Pedro M [CNRS, MARSEILLE; Harris, Paul [NOVOZYMES, INC.; Magnuson, Jon K [PNNL; Baker, Scott [PNNL; Bruno, Kenneth [PNNL; Kenealy, William [MASCOMA, INC.; Hoegger, Patrik J [GEORG-AUGUST-U.; Kues, Ursula [GEORG-AUGUST-U; Ramaiva, Preethi [NOVOZYMES, INC.; Lucas, Susan [DOE JGI; Salamov, Asaf [DOE JGI; Shapiro, Harris [DOE JGI; Tuh, Hank [DOE JGI; Chee, Christine L [UNM; Teter, Sarah [NOVOZYMES, INC.; Yaver, Debbie [NOVOZYMES, INC.; James, Tim [MCMASTER U.; Mokrejs, Martin [CHARLES U.; Pospisek, Martin [CHARLES U.; Grigoriev, Igor [DOE JGI; Rokhsar, Dan [DOE JGI; Berka, Randy [NOVOZYMES; Cullen, Dan [FOREST PRODUCTS LAB
2008-01-01
Brown-rot fungi such as Postia placenta are common inhabitants of forest ecosystems and are also largely responsible for the destructive decay of wooden structures. Rapid depolymerization of cellulose is a distinguishing feature of brown-rot, but the biochemical mechanisms and underlying genetics are poorly understood. Systematic examination of the P. placenta genome, transcriptome and secretome revealed unique extracellular enzyme systems, including an unusual repertoire of extracellular glycoside hydrolases. Genes encoding exocellobiohydrolases and cellulose-binding domains, typical of cellulolytic microbes, are absent in this efficient cellulose-degrading fungus. When P. placenta was grown in medium containing cellulose as sole carbon source, transcripts corresponding to many hemicellulases and to a single putative {beta}-1-4 endoglucanase were expressed at high levels relative to glucose grown cultures. These transcript profiles were confirmed by direct identification of peptides by liquid chromatography-tandem mass spectrometry (LC{center_dot}MSIMS). Also upregulated during growth on cellulose medium were putative iron reductases, quinone reductase, and structurally divergent oxidases potentially involved in extracellular generation of Fe(II) and H202. These observations are consistent with a biodegradative role for Fenton chemistry in which Fe(II) and H202 react to form hydroxyl radicals, highly reactive oxidants capable of depolymerizing cellulose. The P. placenta genome resources provide unparalleled opportunities for investigating such unusual mechanisms of cellulose conversion. More broadly, the genome offers insight into the diversification of lignocellulose degrading mechanisms in fungi. Comparisons to the closely related white-rot fungus Phanerochaete chrysosporium support an evolutionary shift from white-rot to brown-rot during which the capacity for efficient depolymerization of lignin was lost.
Toxicity of organic and inorganic nanoparticles to four species of white-rot fungi
Energy Technology Data Exchange (ETDEWEB)
Galindo, T.P.S., E-mail: pgalindo@ua.pt [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Biologia, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Pereira, R. [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Biologia, Faculdade de Ciências, Universidade do Porto, Rua do Campo Alegre 4169-007 Porto (Portugal); Freitas, A.C.; Santos-Rocha, T.A.P. [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Química, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); ISEIT, Instituto Piaget Viseu, Estrada do Alto do Gaio, Lordosa, 3515-776 Viseu (Portugal); Rasteiro, M.G.; Antunes, F. [Department of Chemical Engineering, University of Coimbra, 3030-290 Coimbra (Portugal); Rodrigues, D. [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Química, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); ISEIT, Instituto Piaget Viseu, Estrada do Alto do Gaio, Lordosa, 3515-776 Viseu (Portugal); Soares, A.M.V.M.; Gonçalves, F. [CESAM, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Biologia, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); and others
2013-08-01
The rapid development of nanoparticles (NP) for industrial applications and large-volume manufacturing, with its subsequent release into the environment, raised the need to understand and characterize the potential effects of NP to biota. Accordingly, this work aimed to assess sublethal effects of five NP to the white-rot fungi species Trametes versicolor, Lentinus sajor caju, Pleurotus ostreatus, and Phanerochaete chrysosporium. Each species was exposed to serial dilutions of the following NP: organic-vesicles of SDS/DDAB and of Mo/NaO; gold-NP, quantum dot CdSe/ZnS, and Fe/Co. Fungi growth rate was monitored every day, and at the end of assay the mycelium from each replicate was collected to evaluate possible changes in its chemical composition. For all NP-suspensions the following parameters were characterized: hydrodynamic diameter, surface charge, aggregation index, zeta potential, and conductivity. All tested NP tended to aggregate when suspended in aqueous media. The obtained results showed that gold-NP, CdSe/ZnS, Mo/NaO, and SDS/DDAB significantly inhibited the growth of fungi with effects on the mycelium chemical composition. Among the tested NP, gold-NP and CdSe/ZnS were the ones exerting a higher effect on the four fungi. Finally to our knowledge, this is the first study reporting that different types of NP induce changes in the chemical composition of fungi mycelium. - Highlights: • Nanoparticles (NP) tend to aggregate when in aqueous suspensions. • Chemical composition revealed to be very important in the ecotoxicity of NP. • Observed effects suggested diversified modes of action of different NP. • White-rot fungi species exhibit great differences in their sensitivity to NP.
Ethanol production from lignocellulosic materials. Fermentation and on-line analysis
Energy Technology Data Exchange (ETDEWEB)
Olsson, L.
1994-04-01
The fermentation performance of bacteria, yeast and fungi was investigated in lignocellulosic hydrolysates with the aim of finding microorganisms which both withstand the inhibitors and that have the ability to ferment pentoses. Firstly, the performance of Saccharomyces cidri, Saccharomyces cerevisiae, Lactobacillus brevis, Lactococcus lactis ssp lactis, Escherichia coli and Zymomonas mobilis was investigated in spent sulphite liquor and enzymatic hydrolysate of steam-pretreated willow. Secondly, the performance of natural and recombinant E. coli, Pichia stipitis, recombinant S. cerevisiae, S. cerevisiae in combination with xylose isomerase and Fusarium oxysporum was investigated in a xylose-rich acid hydrolysate of corn cob. Recombinant E. coli was the best alternative for fermentation of lignocellulosic hydrolysates, giving both high yields and productivities. The main drawback was that detoxification was necessary. The kinetics of the fermentation with recombinant E. coli KO11 was investigated in the condensate of steam-pretreated willow. A cost analysis of the ethanol production from willow was made, which predicted an ethanol production cost of 3.9 SEK/l for the pentose fermentation. The detoxification cost constituted 22% of this cost. The monitoring of three monosaccharides and ethanol in lignocellulosic hydro lysates is described. The monosaccharides were determined using immobilized pyranose oxidase in an on-line amperometric analyser. Immobilization and characterization of pyranose oxidase from Phanerochaete chrysosporium is also described. The ethanol was monitored on-line using a micro dialysis probe as an in situ sampling device. The dialysate components were then separated in a column liquid chromatographic system and the ethanol was selectively detected by an amperometric alcohol bio sensor. The determinations with on-line analysis methods agreed well with off-line methods. 248 refs, 4 figs, 12 tabs
Microbial liquefaction of peat for the production of synthetic fuels
Energy Technology Data Exchange (ETDEWEB)
Gunasekaran, M.
1988-01-01
Objectives of this study were: to evaluate the potential of using various microorganisms to hydrolyse and liquify peat; to determine the optimal conditions for peat hydrolysis and liquefaction; to study the co-metabolizable substances; to separate the compounds present in liquified peat by alumina and silica acid chromatography and capillary gas chromatography; and to identify the compounds in liquified peat by capillary GC-Mass spectrometry. Organisms used in the study include: Coprinus comatus, Coriolus hirsutus, Ganoderma lucidum, Lentinus edodes, Lenzites trabea, Phanerochaete chrysosporium, Pleurotus ostreatus, P. sapidus, Polyporus adjustus, Neurospora sitophila, Rhizophus arrhizus, Bacillus subtilis, Acinetobacter sp. and Alcaligenes sp. The fungi were maintained and cultivated in potato dextrose agar at 30 C. The bacteria were maintained in nutrient agar at 30 C. We have also initiated work on coal solubilization in addition to the studies on peat liquefaction. A relatively new substratum or semi-solid base for culture media called Pluronic F-127, or Polyol (BASF, New Jersey). Objectives of this study were: (1) to study the growth patterns of Candida ML 13 on pluronic as substratum; (2) to determine the rate of microbial coal solubilization on pluronic F-127 amended in different growth media; (3) to separate the mycelial mat of Candida ML 13 from unsolubilized coal particles and solubilized coal products from pluronic F-127; (4) to determine the effects of pH on microbial coal solubilization in pluronic F-127 media; (5) the effect of concentration of pluronic F-127 in media on coal solubilization; and, (6) to study the role of extracellular factors secreted by Candida ML 13 on coal solubilization in pluronic F-127 media. Results are discussed. 4 refs.
Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P
1996-01-01
Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234
Directory of Open Access Journals (Sweden)
Sujatha eKandhasamy
2016-05-01
Full Text Available Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modelling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7 with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5 % respectively. Such high level secretion, thermal and solvent stability of LccH make H.hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications.
Occurrence of keratinophilic fungi on Indian birds.
Dixit, A K; Kushwaha, R K
1991-01-01
Keratinophilic fungi were isolated from feathers of most common Indian birds, viz. domestic chicken (Gallus domesticus), domestic pigeon (Columba livia), house sparrow (Passer domesticus), house crow (Corvus splendens), duck (Anas sp.), rose-ringed parakeet (Psittacula krameri). Out of 87 birds, 58 yielded 4 keratinophilic fungal genera representing 13 fungal species and one sterile mycelium. The isolated fungi were cultured on Sabouraud's dextrose agar at 28 +/- 2 degrees C. Chrysosporium species were isolated on most of the birds. Chrysosporium lucknowense and Chrysosporium tropicum were the most common fungal species associated with these Indian birds. Maximum occurrence of fungi (47%) was recorded on domestic chickens and the least number of keratinophilic fungi was isolated from the domestic pigeon and duck. The average number of fungi per bird was found to be the 0.44.
DEFF Research Database (Denmark)
Godoy, Andre S.; Pereira, Caroline S.; Ramia, Marina Paglione
2018-01-01
The glycoside hydrolase family 45 (GH45) of carbohydrate modifying enzymes is mostly comprised of ß-1,4-endoglucanases. Significant diversity between the GH45 members has prompted the division of this family into three subfamilies: A, B and C, which may differ in terms of the mechanism, general a...
Simulated nitrogen deposition affects wood decomposition by cord-forming fungi.
Bebber, Daniel P; Watkinson, Sarah C; Boddy, Lynne; Darrah, Peter R
2011-12-01
Anthropogenic nitrogen (N) deposition affects many natural processes, including forest litter decomposition. Saprotrophic fungi are the only organisms capable of completely decomposing lignocellulosic (woody) litter in temperate ecosystems, and therefore the responses of fungi to N deposition are critical in understanding the effects of global change on the forest carbon cycle. Plant litter decomposition under elevated N has been intensively studied, with varying results. The complexity of forest floor biota and variability in litter quality have obscured N-elevation effects on decomposers. Field experiments often utilize standardized substrates and N-levels, but few studies have controlled the decay organisms. Decomposition of beech (Fagus sylvatica) blocks inoculated with two cord-forming basidiomycete fungi, Hypholoma fasciculare and Phanerochaete velutina, was compared experimentally under realistic levels of simulated N deposition at Wytham Wood, Oxfordshire, UK. Mass loss was greater with P. velutina than with H. fasciculare, and with N treatment than in the control. Decomposition was accompanied by growth of the fungal mycelium and increasing N concentration in the remaining wood. We attribute the N effect on wood decay to the response of cord-forming wood decay fungi to N availability. Previous studies demonstrated the capacity of these fungi to scavenge and import N to decaying wood via a translocating network of mycelium. This study shows that small increases in N availability can increase wood decomposition by these organisms. Dead wood is an important carbon store and habitat. The responses of wood decomposers to anthropogenic N deposition should be considered in models of forest carbon dynamics.
Perspectives on the use of transcriptomics to advance biofuels
Directory of Open Access Journals (Sweden)
Siseon Lee
2015-11-01
Full Text Available As a field within the energy research sector, bioenergy is continuously expanding. Although much has been achieved and the yields of both ethanol and butanol have been improved, many avenues of research to further increase these yields still remain. This review covers current research related with transcriptomics and the application of this high-throughput analytical tool to engineer both microbes and plants with the penultimate goal being better biofuel production and yields. The initial focus is given to the responses of fermentative microbes during the fermentative production of acids, such as butyric acid, and solvents, including ethanol and butanol. As plants offer the greatest natural renewable source of fermentable sugars within the form of lignocellulose, the second focus area is the transcriptional responses of microbes when exposed to plant hydrolysates and lignin-related compounds. This is of particular importance as the acid/base hydrolysis methods commonly employed to make the plant-based cellulose available for enzymatic hydrolysis to sugars also generates significant amounts of lignin-derivatives that are inhibitory to fermentative bacteria and microbes. The article then transitions to transcriptional analyses of lignin-degrading organisms, such as Phanerochaete chrysosporium, as an alternative to acid/base hydrolysis. The final portion of this article will discuss recent transcriptome analyses of plants and, in particular, the genes involved in lignin production. The rationale behind these studies is to eventually reduce the lignin content present within these plants and, consequently, the amount of inhibitors generated during the acid/base hydrolysis of the lignocelluloses. All four of these topics represent key areas where transcriptomic research is currently being conducted to identify microbial genes and their responses to products and inhibitors as well as those related with lignin degradation/formation.
Waghmare, Pankajkumar R; Watharkar, Anuprita D; Jeon, Byong-Hun; Govindwar, Sanjay P
2018-03-01
In this study, we have described three steps to produce ethanol from Pogonatherum crinitum , which was derived after the treatment of textile wastewater. (a) Production of biomass: biomass samples collected from a hydroponic P. crinitum phytoreactor treating dye textile effluents and augmented with Ca-alginate immobilized growth-promoting bacterium, Bacillus pumilus strain PgJ (consortium phytoreactor), and waste sorghum husks were collected and dried. Compositional analysis of biomass (consortium phytoreactor) showed that the concentration of cellulose, hemicelluloses and lignin was 42, 30 and 17%, respectively, whereas the biomass samples without the growth-promoting bacterium (normal phytoreactor) was slightly lower, 40, 29 and 16%, respectively. (b) Hydrolysate (sugar) production: a crude sample of the fungus, Phanerochaete chrysosporium containing hydrolytic enzymes such as endoglucanase (53.25 U/ml), exoglucanase (8.38 U/ml), glucoamylase (115.04 U/ml), xylanase (83.88 U/ml), LiP (0.972 U/ml) and MnP (0.459 U/ml) was obtained, and added to consortium, normal and control phytoreactor derived biomass supplemented with Tween-20 (0.2% v/v). The hydrolysate of biomass from consortium phytoreactor produced maximum reducing sugar (0.93 g/l) than hydrolysates of normal phytoreactor biomass (0.82 g/l) and control phytoreactor biomass (0.79 g/l). FTIR and XRD analysis confirmed structural changes in treated biomass. (c) Ethanol production: the bioethanol produced from enzymatic hydrolysates of waste biomass of consortium and normal phytoreactor using Saccharomyces cerevisiae (KCTC 7296) was 42.2 and 39.4 g/l, respectively, while control phytoreactor biomass hydrolysate showed only 25.5 g/l. Thus, the amalgamation of phytoremediation and bioethanol production can be the truly environment-friendly way to eliminate the problem of textile dye along with bioenergy generation.
Nguyen, Hoai; Rineau, François; Vangronsveld, Jaco; Cuypers, Ann; Colpaert, Jan V; Ruytinx, Joske
2017-07-01
The basidiomycete Suillus luteus is an important member of the ectomycorrhizal community that thrives in heavy metal polluted soils covered with pioneer pine forests. This study aimed to identify potential heavy metal chelators in S. luteus. Two metallothionein (MT) coding genes, SlMTa and SlMTb, were identified. When heterologously expressed in yeast, both SlMTa and SlMTb can rescue the Cu sensitive mutant from Cu toxicity. In S. luteus, transcription of both SlMTa and SlMTb is induced by Cu but not Cd or Zn. Several putative Cu-sensing and metal-response elements are present in the promoter sequences. These results indicate that SlMTa and SlMTb function as Cu-thioneins. Homologs of the S. luteus MTs are present in 49 species belonging to 10 different orders of the subphylum Agaricomycotina and are remarkably conserved. The length of the proteins, number and distribution of cysteine residues indicate a novel family of fungal MTs. The ubiquitous and highly conserved features of these MTs suggest that they are important for basic cellular functions in species in the subphylum Agaricomycotina. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
The evolution of non-reciprocal nuclear exchange in mushrooms as a consequence of genomic conflict
DEFF Research Database (Denmark)
Aanen, Duur Kornelis; Kuyper, T.W.; Debets, A.J.M.
2004-01-01
nucleo-mitochondrial conflict, mitochondrial inheritance, doubly uniparental inheritance, basidiomycetes, cytoplasmic male sterility......nucleo-mitochondrial conflict, mitochondrial inheritance, doubly uniparental inheritance, basidiomycetes, cytoplasmic male sterility...
Influence of pH on the growth, laccase activity and RBBR decolorization by tropical basidiomycetes
Directory of Open Access Journals (Sweden)
Sérgio Luiz Moreira Neto
2009-10-01
Full Text Available The basidiomycete fungi Lentinus crinitus and Psilocybe castanella are being evaluated in a bioremediation process of soils contaminated with organochlorine industrial residues in the Baixada Santista, São Paulo. The aim of the present study was to determine the influence of pH on the fungal growth, in vitro decolorization of anthraquinonic dye Remazol Brilliant Blue R (RBBR and laccase activity. The pH of the culture medium influenced the growth of L. crinitus and P. castanella, which presented less growth at pH 5.9 and pH 2.7, respectively. The fungi were able to modify the pH of the culture medium, adjusting it to the optimum pH for growth which was close to 4.5. Decolorization of the RBBR was maximal at a pH of 2.5 to 3.5. Higher laccase activity was observed at pH 3.5 and pH 4.5 for L. crinitus and P. castanella, respectively. pH was found to be an important parameter for both the growth of these fungi and the enzymatic system involved in RBBR decolorization.Os fungos basidiomicetos Lentinus crinitus e Psilocybe castanella estão sendo avaliados em processo de biorremediação de solos contaminados com resíduos industriais organoclorados, na Baixada Santista, SP. O presente estudo avaliou a influência do pH no crescimento, na descoloração in vitro do corante Azul Brilhante de Remazol R (RBBR e na atividade de lacase durante cultivo destes fungos, de forma a subsidiar a otimização do processo. O pH do meio influenciou o crescimento de L. crinitus e de P. castanella, com menor biomassa em pH 5,9 e pH 2,7, respectivamente. Os fungos foram capazes de modificar o pH inicial do meio de cultura, de modo a ajustá-lo ao valor ótimo de crescimento, próximo a 4,5. Descoloração in vitro do RBBR foi máxima em pH 2,5 e 3,5. Maiores atividades de lacase foram obtidas em pH 3,5 e em pH 4,5 para L. crinitus e P. castanella, respectivamente. Evidenciou-se que o pH é um parâmetro importante para o crescimento destes fungos, atividade de lacase
Effect of Trichoderma-enriched organic charcoal in the integrated wood protection strategy.
Directory of Open Access Journals (Sweden)
Javier Ribera
Full Text Available The gradual elimination of chromium from wood preservative formulations results in higher Cu leaching and increased susceptibility to wood decay fungi. Finding a sustainable strategy in wood protection has become of great interest among researchers. The objective of these in vitro studies was to demonstrate the effect of T-720-enriched organic charcoal (biochar against five wood decay basidiomycetes isolated from strongly damaged poles. For this purpose, the antagonistic potential of Trichoderma harzianum (strain T-720 was confirmed among other four Trichoderma spp. against five brown-rot basidiomycetes in dual culture tests. T-720 was genetically transformed and tagged with the green fluorescent protein (GFP in order to study its antagonistic mechanism against wood decay basidiomycetes. It was also demonstrated that T-720 inhibits the oxalic acid production by basidiomycetes, a well-known mechanism used by brown-rot fungi to detoxify Cu from impregnated wood. Additionally, this study evaluated the effect of biochar, alone or in combination with T-720, on Cu leaching by different preservatives, pH stabilization and prevention of wood decay caused by five basidiomycetes. Addition of biochar resulted in a significant Cu binding released from impregnated wood specimens. T-720-enriched biochar showed a significant reduction of wood decay caused by four basidiomycetes. The addition of T-720-enriched biochar to the soil into which utility poles are placed may improve the efficiency of Cr-free wood preservatives.
Thomas, Sarah E; Crozier, Jayne; Catherine Aime, M; Evans, Harry C; Holmes, Keith A
2008-07-01
Fungal endophytes were isolated from healthy stems and pods of Theobroma gileri, an alternative host of the frosty pod rot pathogen of cacao. Non-sporulating isolates were grouped into 46 different morphological species according to their colony morphology. Many of these morphospecies were assumed to be basidiomycetes and, therefore, were of particular interest. Basidiomycetous endophytes have received far less attention than ascomycetes and also have potential as biological control agents of the basidiomycetous pathogens of T. cacao: Moniliophthora roreri (frosty pod rot pathogen) and M. perniciosa (witches' broom disease). The morphospecies were further characterised by molecular analyses. Amplification of the nuLSU was undertaken for phylogenetic placement of these non-sporulating cultures and revealed a total of 31 different taxa of which 15 were basidiomycetes belonging to the class Agaricomycetes, and 16 ascomycetes primarily belonging to the Sordariomycetes.
Higher marine fungi from mangroves (Manglicolous fungi)
Digital Repository Service at National Institute of Oceanography (India)
ChinnaRaj, S.
of higher marine fungi which included 23 Ascomycetes, 2 Basidiomycetes and 17 Deuteromycetes (Kohlmeyer and Kohlmeyer, 1979). Hyde (1990a) listed 120 species from 29 mangroves from all over the World this includes 87 Ascomycetes, 2 Basidiomycetes and 31...
Books received by the Rijksherbarium library
NN,
1982-01-01
A new systematic arrangement of the Basidiomycetes is presented. The first fifty pages are devoted to special characters found in Basidiomycetes, and to a discussion of previous classifications. The major part of the book (c. 300 pp.) gives descriptions of the recognized orders and families as well
In vitro decomposition of Sphagnum by some microfungi resembles white rot of wood.
Rice, Adrianne V; Tsuneda, Akihiko; Currah, Randolph S
2006-06-01
The abilities of some ascomycetes (Myxotrichaceae) from a Sphagnum bog in Alberta to degrade cellulose, phenolics, and Sphagnum tissue were compared with those of two basidiomycetes. Most Myxotrichaceae degraded cellulose and tannic acid, and removed cell-wall components simultaneously from Sphagnum tissues, whereas the basidiomycetes degraded cellulose and insoluble phenolics, and preferentially removed the polyphenolic matrix from Sphagnum cell walls. Mass losses from Sphagnum varied from up to 50% for some ascomycetes to a maximum of 35% for the basidiomycetes. The decomposition of Sphagnum by the Myxotrichaceae was analogous to the white rot of wood and indicates that these fungi have the potential to cause significant mineralization of carbon in bogs.
Energy Technology Data Exchange (ETDEWEB)
Zeng Guangming, E-mail: zgming@hnu.cn [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Li Zhen, E-mail: happylizhen@yeah.ne [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China); Tang Lin; Wu Mengshi; Lei Xiaoxia; Liu Yuanyuan; Liu Can; Pang Ya; Zhang Yi [College of Environmental Science and Engineering, Hunan University, Changsha 410082 (China); Key Laboratory of Environmental Biology and Pollution Control (Hunan University), Ministry of Education, Changsha 410082 (China)
2011-05-01
Highlights: > Gold nanoparticles/multiwalled carbon nanotubes/poly (1,5-naphthalenediamine) modified electrode was fabricated. > The sensor was applied for the detection of cellobiose dehydrogenase genes. > An effective method to distribute MWCNTs and attach to the electrode was proposed. > The composite films greatly improved the sensitivity and enhanced the DNA immobilization. > The DNA biosensor exhibited fairly high sensitivity and quite low detection limit. - Abstract: An electrochemical sensor based on gold nanoparticles (GNPs)/multiwalled carbon nanotubes (MWCNTs)/poly (1,5-naphthalenediamine) films modified glassy carbon electrode (GCE) was fabricated. The effectiveness of the sensor was confirmed by sensitive detection of cellobiose dehydrogenase (CDH) gene which was extracted from Phanerochaete chrysosporium using polymerase chain reaction (PCR). The monomer of 1,5-naphthalenediamine was electropolymerized on the GCE surface with abundant free amino groups which enhanced the stability of MWCNTs modified electrode. Congo red (CR)-functionalized MWCNTs possess excellent conductivity as well as high solubility in water which enabled to form the uniform and stable network nanostructures easily and created a large number of binding sites for electrodeposition of GNPs. The continuous GNPs together with MWCNTs greatly increased the surface area, conductivity and electrocatalytic activity. This electrode structure significantly improved the sensitivity of sensor and enhanced the DNA immobilization and hybridization. The thiol modified capture probes were immobilized onto the composite films-modified GCE by a direct formation of thiol-Au bond and horseradish peroxidase-streptavidin (HRP-SA) conjugates were labeled to the biotinylated detection probes through biotin-streptavidin bond. Scanning electron microscopy (SEM), electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV) were used to investigate the film assembly and DNA hybridization processes
African Journals Online (AJOL)
DR. AMINU
wood popularly known as white rot. Wood and root rot basidiomycetes are occasional problem in desert plants including cliff rose, Canotia (Canotia holacantha) e.t.c (P.D.P, 2011). Also cacti which have a large amount of solid wood tissues may be invaded and decayed by wood rotting basidiomycetes (Uno et al., 2008).
Gramss, Gerhard; Bergmann, Hans
2007-08-01
Non-symbiotic soil microorganisms which have been expensively engineered or selected to support plant nutrition, control root diseases, degrade xenobiotic hydrocarbons, and repress or stimulate heavy metal uptake of plants fail to survive in target soils. This prompted studies into the role of chemistry and microbial pre-colonization of 23 top soils in long-term growth of basidiomycetes. Fungi are seen as auxiliary agents in soil remediation. Untreated soils (1.5 L) were colonized by lignocellulose preferring ground fungi such as Agaricus aestivalis, A. bisporus, A. campestris, A. edulis, A. macrocarpus, A. porphyrizon, Agrocybe dura, A. praecox, Clitocybe sp., Coprinus comatus, Lepista nuda, L. sordida, Macrolepiota excoriata, M. procera, Stropharia coronilla, and S. rugoso-annulata. Spawn mycelia of fairy-ring-type fungi such as Agaricus arvensis, A. fissuratus, A. langei, A. lanipes, A. pilatianus, Lyophyllum sp., and Marasmius oreades died back in contact with non-sterile soils. Fungal growth correlated positively with the soils' Ct Ca K Mg content and negatively with microbial CO2 evolution. Pasteurization and autoclaving increased mycelial growth and life span in soils pH 6.6-8.2. Growth of pH-sensitive but not of pH-tolerant fungi was inhibited on the Ca-deficient soils pH 4-4.4 (-5.6) and was not improved by autoclaving. The pretended fungistasis of acid soils to pH-sensitive fungi was controlled by N P K mineral (pH not altering) or organic (pH increasing) fertilizing as well as by neutralization with NaOH or CaCO3. Although microbial competition was mortal to 33% of the fungal mycelia inserted into natural unplanted soils, further seriously antifungal effects beyond those pretended by low pH conditions and shortage in mineral macronutrients were not identified.
Pohleven, Jure; Renko, Miha; Magister, Špela; Smith, David F.; Künzler, Markus; Štrukelj, Borut; Turk, Dušan; Kos, Janko; Sabotič, Jerica
2012-01-01
Lectins are carbohydrate-binding proteins that exert their biological activity by binding to specific cell glycoreceptors. We have expressed CNL, a ricin B-like lectin from the basidiomycete Clitocybe nebularis in Escherichia coli. The recombinant lectin, rCNL, agglutinates human blood group A erythrocytes and is specific for the unique glycan N,N′-diacetyllactosediamine (GalNAcβ1–4GlcNAc, LacdiNAc) as demonstrated by glycan microarray analysis. We here describe the crystal structures of rCNL in complex with lactose and LacdiNAc, defining its interactions with the sugars. CNL is a homodimeric lectin, each of whose monomers consist of a single ricin B lectin domain with its β-trefoil fold and one carbohydrate-binding site. To study the mode of CNL action, a nonsugar-binding mutant and nondimerizing monovalent CNL mutants that retain carbohydrate-binding activity were prepared. rCNL and the mutants were examined for their biological activities against Jurkat human leukemic T cells and the hypersensitive nematode Caenorhabditis elegans mutant strain pmk-1. rCNL was toxic against both, although the mutants were inactive. Thus, the bivalent carbohydrate-binding property of homodimeric CNL is essential for its activity, providing one of the rare pieces of evidence that certain activities of lectins are associated with their multivalency. PMID:22298779
Directory of Open Access Journals (Sweden)
Azusa Saika
Full Text Available Mannosylerythritol lipids (MELs belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S-erythritol (R-form as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R-erythritol (S-form as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL.
African Journals Online (AJOL)
Vol 12, No 47 (2013), Bioconversion of ferulic acid to vanillin by combined action of Aspergillus niger K8 and Phanerochaete crysosporium ATCC 24725, Abstract ... of rice straw by thermotolerant cellulolytic Streptomyces viridiochromogenes under solid-state fermentation conditions for bioethanol production, Abstract PDF.
Luzia Doretto Paccola-Meirelles; Cristina Sayuri Maki
2002-01-01
Wild mushrooms were collected close to cattle manure in pasture areas in Tamarana (Paraná/Brazil), with the objective of finding and domesticating new non-exploited basidiomycetes. An edible basidiomycete of the Agaricales order was classified as belonging to the Macrolepiota bonaerensis species (=Lepiota procera, form bonaerensis (Speg.) Rick or M. procera (Scop.:Fr) Sing.). The mycelia was isolated and characterized for growth rate in different culture media. A vigorous growth was observed ...
African Journal of Biotechnology - Vol 12, No 47 (2013)
African Journals Online (AJOL)
Bioconversion of ferulic acid to vanillin by combined action of Aspergillus niger K8 and Phanerochaete crysosporium ATCC 24725 · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Nazila Motedayen, Maznah B. T. Ismail, Forough Nazarpour, 6618-6624 ...
The Role of Drosophila Merlin in the Control of Mitosis Exit and Development
2008-07-01
chrysosporium --- http://genome.jgi-p Aspergillus flavus --- http://www.tigr.or Arabidopsis thaliana --- http://www.tigr.or Oryza sativa --- http...distinguish colon and ovarian adenocarcinomas: identi- fication, genomic, proteomic , and tissue array profiling. Cancer Res 2003;63:5243–50. 108
Decolorization of laundry effluent by filamentous fungi | Miranda ...
African Journals Online (AJOL)
After selecting, the best fungi were subjected to an experimental design and evaluation of the production of the ligninolytics enzymes. Fungi Phanerochaete chrysosporum CCT 1999, Lentinula edodes CCT 4519 and Curvularia lunata UFPEDA 885 reduced 100% the color of the effluent during growth under agitation while ...
Effect of biotic lignin decomposition on the fate of radiocesium-contaminated plant litter
Energy Technology Data Exchange (ETDEWEB)
Hashida, Shin-nosuke; Yoshihara, Toshihiro [Environmental Science Research Laboratory, Central Research Institute of Electric Power Industry, Abiko 1646, Abiko-shi, Chiba (Japan)
2014-07-01
.e., Phanerochaete chrysosporium (ATCC32629), Pleurotus pulmonarius (ATCC32078), Stropharia rugosoannulata (ATCC60010), and Trametes versicolor (ATCC96186). Quantitative assessment of mass loss, lignin degradation, and radiocesium distribution in the inoculated litter indicated that leaching of radiocesium could be facilitated by biotic lignin decomposition with white-rot fungi. Further data are required to elucidate the lignin substructure that allows absorption of radiocesium. (authors)
Directory of Open Access Journals (Sweden)
Khajamohiddin Syed
Full Text Available The model white rot fungus Phanerochaete chrysosporium, which is known for its versatile pollutant-biodegradation ability, possesses an extraordinarily large repertoire of P450 monooxygenases in its genome. However, the majority of these P450s have hitherto unknown function. Our initial studies using a genome-wide gene induction strategy revealed multiple P450s responsive to individual classes of xenobiotics. Here we report functional characterization of a cytochrome P450 monooxygenase, CYP5136A3 that showed common responsiveness and catalytic versatility towards endocrine-disrupting alkylphenols (APs and mutagenic/carcinogenic polycyclic aromatic hydrocarbons (PAHs. Using recombinant CYP5136A3, we demonstrated its oxidation activity towards APs with varying alkyl side-chain length (C3-C9, in addition to PAHs (3-4 ring size. AP oxidation involves hydroxylation at the terminal carbon of the alkyl side-chain (ω-oxidation. Structure-activity analysis based on a 3D model indicated a potential role of Trp(129 and Leu(324 in the oxidation mechanism of CYP5136A3. Replacing Trp(129 with Leu (W129L and Phe (W129F significantly diminished oxidation of both PAHs and APs. The W129L mutation caused greater reduction in phenanthrene oxidation (80% as compared to W129F which caused greater reduction in pyrene oxidation (88%. Almost complete loss of oxidation of C3-C8 APs (83-90% was observed for the W129L mutation as compared to W129F (28-41%. However, the two mutations showed a comparable loss (60-67% in C9-AP oxidation. Replacement of Leu(324 with Gly (L324G caused 42% and 54% decrease in oxidation activity towards phenanthrene and pyrene, respectively. This mutation also caused loss of activity towards C3-C8 APs (20-58%, and complete loss of activity toward nonylphenol (C9-AP. Collectively, the results suggest that Trp(129 and Leu(324 are critical in substrate recognition and/or regio-selective oxidation of PAHs and APs. To our knowledge, this is the first
Juvvadi, Praveen Rao; Seshime, Yasuyo; Kitamoto, Katsuhiko
2005-12-01
Fungal secondary metabolites constitute a wide variety of compounds which either play a vital role in agricultural, pharmaceutical and industrial contexts, or have devastating effects on agriculture, animal and human affairs by virtue of their toxigenicity. Owing to their beneficial and deleterious characteristics, these complex compounds and the genes responsible for their synthesis have been the subjects of extensive investigation by microbiologists and pharmacologists. A majority of the fungal secondary metabolic genes are classified as type I polyketide synthases (PKS) which are often clustered with other secondary metabolism related genes. In this review we discuss on the significance of our recent discovery of chalcone synthase (CHS) genes belonging to the type III PKS superfamily in an industrially important fungus, Aspergillus oryzae. CHS genes are known to play a vital role in the biosynthesis of flavonoids in plants. A comparative genome analyses revealed the unique character of A. oryzae with four CHS-like genes (csyA, csyB, csyC and csyD) amongst other Aspergilli (Aspergillus nidulans and Aspergillus fumigatus) which contained none of the CHS-like genes. Some other fungi such as Neurospora crassa, Fusarium graminearum, Magnaporthe grisea, Podospora anserina and Phanerochaete chrysosporium also contained putative type III PKSs, with a phylogenic distinction from bacteria and plants. The enzymatically active nature of these newly discovered homologues is expected owing to the conservation in the catalytic residues across the different species of plants and fungi, and also by the fact that a majority of these genes (csyA, csyB and csyD) were expressed in A. oryzae. While this finding brings filamentous fungi closer to plants and bacteria which until recently were the only ones considered to possess the type III PKSs, the presence of putative genes encoding other principal enzymes involved in the phenylpropanoid and flavonoid biosynthesis (viz
Decolorization of six synthetic dyes by fungi
Hartikainen, E. Samuel; Miettinen, Otto; Hatakka, Annele; Kähkönen, Mika A.
2016-01-01
To find out ability of fourteen basidiomycetes and four ascomycetes strains to grow in the presence of synthetic colour dyes and to degrade them, fungi were cultivated on the malt agar plates containing 0.5 g kg-1 dye, either Remazol Brilliant Blue R, Remazol Brilliant Yellow GL, Remazol Brilliant Orange 3 R, Reactive Blue 4, Remazol Brilliant Red F3B or Reactive Black 5. Fungi representing basidiomycetes were Phlebia radiata (FBCC 43), Tremella encephala (FBCC 1145), Dichomitus squalens (FBC...
International Nuclear Information System (INIS)
Lyashenko, Andrey V.; Belova, Oksana; Gabdulkhakov, Azat G.; Lashkov, Alexander A.; Lisov, Alexandr V.; Leontievsky, Alexey A.; Mikhailov, Al’bert M.
2011-01-01
The purification, crystallization and preliminary X-ray structure analysis of the laccase from G. lucidum are reported. The ligninolytic enzymes of the basidiomycetes play a key role in the global carbon cycle. A characteristic property of these enzymes is their broad substrate specificity, which has led to their use in various biotechnologies, thus stimulating research into the three-dimensional structures of ligninolytic enzymes. This paper presents the purification, crystallization and preliminary X-ray analysis of the laccase from the ligninolytic basidiomycete Ganoderma lucidum
Directory of Open Access Journals (Sweden)
Widya Fatriasari
2013-10-01
Full Text Available Previous research on anatomical structures of pretreated large (betung bamboo (Dendrocalamusasper using single culture of white-rot fungi has been investigated, which revealed that the pretreatment caused the decrease in the Runkel ratioas well as the coefficient rigidity and the increase in the flexibility ratio of their corresponding bamboo fibers. However, there is no study reported on the anatomical structure changes of them caused by pretreatment using mixed culture of white-rot fungi. This paper reports the results of the research on paper/pulp quality after different treatments. Pretreatment that used Trametes versicolor fungi and lasted for 45 days inflicted intensive fiber damages compared with those of untreated bamboo (control. Fresh and barkless large (betung bamboo chips of 2 year's old, and 1.6 cm in length, were inoculated by 10% of mixed culture of white-rot fungi inoculums stock for 30 and 45 days in room temperature. There were four treatment groups of mixed culture, i.e T. versi color and P. ostreatus (TVPO; P. ostreatus and P. chrysosporium (POPC; P. chrysosporium and T.versi color (PCTV; and P.chrysosporium, T.versicolorand P.ostreatus (TVPCPO.After the inoculation period, the chips weremacerated into separate fibers using Scultze method to analyze the fiber dimension and its derived values. The fibers were then observed regarding their macro and microscopic structures by optical microscope. Mixed culture pretreatment of white-rot fungi accelerated improvement of fiber morphology and fiber derived value characteristics, except for Muhlsteph ratio. The fiber derived values oftreated bamboo tended to improve compared to those of untreated bamboo, there by requiring milder pulping conditions. Accordingly, the treated bamboo would indicatively produce a good quality pulp (grade I based on FAO and LPHH (Forest Product Research Report requirements. Co-culture treatment using P. chrysosporium and P. ostreatus for
Enzymatic saccharification of biologically pre-treated wheat straw with white-rot fungi.
Dias, Albino A; Freitas, Gil S; Marques, Guilhermina S M; Sampaio, Ana; Fraga, Irene S; Rodrigues, Miguel A M; Evtuguin, Dmitry V; Bezerra, Rui M F
2010-08-01
Wheat straw was submitted to a pre-treatment by the basidiomycetous fungi Euc-1 and Irpex lacteus, aiming to improve the accessibility of cellulose towards enzymatic hydrolysis via previous selective bio-delignification. This allowed the increase of substrate saccharification nearly four and three times while applying the basidiomycetes Euc-1 and I. lacteus, respectively. The cellulose/lignin ratio increased from 2.7 in the untreated wheat straw to 5.9 and 4.6 after the bio-treatment by the basidiomycetes Euc-1 and I. lacteus, respectively, thus evidencing the highly selective lignin biodegradation. The enzymatic profile of both fungi upon bio-treatment of wheat straw have been assessed including laccase, manganese-dependent peroxidase, lignin peroxidase, carboxymethylcellulase, xylanase, avicelase and feruloyl esterase activities. The difference in efficiency and selectivity of delignification within the two fungi treatments was interpreted in terms of specific lignolytic enzyme profiles and moderate xylanase and cellulolytic activities. (c) 2010 Elsevier Ltd. All rights reserved.
Franco, Sulamita de Freitas; Baroni, Renata Moro; Carazzolle, Marcelo Falsarella; Teixeira, Paulo José Pereira Lima; Reis, Osvaldo; Pereira, Gonçalo Amarante Guimarães; Mondego, Jorge Maurício Costa
2015-10-30
Thaumatin-like proteins (TLPs) are found in diverse eukaryotes. Plant TLPs, known as Pathogenicity Related Protein (PR-5), are considered fungal inhibitors. However, genes encoding TLPs are frequently found in fungal genomes. In this work, we have identified that Moniliophthora perniciosa, a basidiomycete pathogen that causes the Witches' Broom Disease (WBD) of cacao, presents thirteen putative TLPs from which four are expressed during WBD progression. One of them is similar to small TLPs, which are present in phytopathogenic basidiomycete, such as wheat stem rust fungus Puccinia graminis. Fungi genomes annotation and phylogenetic data revealed a larger number of TLPs in basidiomycetes when comparing with ascomycetes, suggesting that these proteins could be involved in specific traits of mushroom-forming species. Based on the present data, we discuss the contribution of TLPs in the combat against fungal competitors and hypothesize a role of these proteins in M. perniciosa pathogenicity. Copyright © 2015 Elsevier Inc. All rights reserved.
Bailey, Andy M.; Alberti, Fabrizio; Kilaru, Sreedhar; Collins, Catherine M.; de Mattos-Shipley, Kate; Hartley, Amanda J.; Hayes, Patrick; Griffin, Alison; Lazarus, Colin M.; Cox, Russell J.; Willis, Christine L.; O'Dwyer, Karen; Spence, David W.; Foster, Gary D.
2016-05-01
Semi-synthetic derivatives of the tricyclic diterpene antibiotic pleuromutilin from the basidiomycete Clitopilus passeckerianus are important in combatting bacterial infections in human and veterinary medicine. These compounds belong to the only new class of antibiotics for human applications, with novel mode of action and lack of cross-resistance, representing a class with great potential. Basidiomycete fungi, being dikaryotic, are not generally amenable to strain improvement. We report identification of the seven-gene pleuromutilin gene cluster and verify that using various targeted approaches aimed at increasing antibiotic production in C. passeckerianus, no improvement in yield was achieved. The seven-gene pleuromutilin cluster was reconstructed within Aspergillus oryzae giving production of pleuromutilin in an ascomycete, with a significant increase (2106%) in production. This is the first gene cluster from a basidiomycete to be successfully expressed in an ascomycete, and paves the way for the exploitation of a metabolically rich but traditionally overlooked group of fungi.
Gong, Xiaoqiang; Wei, Le; Yu, Xin; Li, Suyan; Sun, Xiangyang; Wang, Xinyu
2017-01-01
The effects of adding the biosurfactant rhamnolipid, the lignolytic and cellulolytic fungus Phanerochete chrysosporium, and the free-living nitrogen-fixing bacterium Azotobacter chrococcum on vermicomposting of green waste with Eisenia fetida was investigated. The addition of rhamnolipid and/or either microorganism alone or in all combinations significantly increased E. fetida growth rate, the number of E. fetida juveniles and cocoons, the population densities of cellulolytic fungi and Azotobacter bacteria, and cellulase and urease activities in the vermicomposts. The quality of the final vermicompost (in terms of electrical conductivity, nutrient content, C/N ratio, humic acid content, lignin and cellulose contents, and phytotoxicity to germinating seeds) was enhanced by addition of rhamnolipid and/or microorganisms. The physical characteristics of vermicomposts produced with rhamnolipid and/or microorganisms were acceptable for agricultural application. The best quality vermicompost was obtained with the combined addition of P. chrysosporium, A. chrococcum, and rhamnolipid.
Tsivileva, O M; Nikitina, V E; Makarov, O E
2008-01-01
Submerged mycelium of a xylotrophic basidiomycete Lentinus edodes produces an extracellular glycolipid, S3, associated with a lectin. Galactose glycan residue, as well as the lipid pool composition, which includes nonhydroxylated short-chain fatty acids, is uncommon for basidiomycetes. The glycolipid consists of D-galactopyranose (15% of S3 contains galactose sulfate) acylated by octadecanoic and nonadecanoic fatty acid residues (28 and 72%, respectively). The glycolipid structure and composition are confirmed by physicochemical analysis. The glycolipid is assumed to be a regulator of lectin activity.
African Journals Online (AJOL)
Motedayen, Nazila. Vol 12, No 47 (2013) - Articles Bioconversion of ferulic acid to vanillin by combined action of Aspergillus niger K8 and Phanerochaete crysosporium ATCC 24725. Abstract PDF. ISSN: 1684-5315. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's ...
Mohanty, Suman Sundar; Prakash, Soam
2010-09-01
Out of seven fungal species belonging to four genera isolated from pond and wallow soils using feathers of Pavo cristatus as bait, four species viz., Aspergillus flavus, Aspergillus niger, Chrysosporium pseudomerdarium and Trichophyton ajelloi were most frequent. Chrysosporium and Trichophyton spp. were more pathogenic on Culex quinquefasciatus larvae than Aspergillus and Penicillium. The bioefficacy tests conducted as per the protocol of World Health Organization and the LC(50) values calculated by the Probit analysis showed that 3(rd)-instar C. quinquefasciatus were more susceptible to the conidia of above fungi. Highest mortality was observed in the larvae of C. quinquefasciatus when exposed to T. ajelloi. The density of fungal conidia was greatest on the ventral brush, palmate hair and anal region of the mosquito larvae after exposing for 72 hours. The potentiality of these fungi for use in the control of C. quinquefasciatus is discussed which can be exploited as a suitable biocontrol agent in the tropics.
Biosoftening of coir fiber using selected microorganisms.
Rajan, Akhila; Senan, Resmi C; Pavithran, C; Abraham, T Emilia
2005-12-01
Coir fiber belongs to the group of hard structural fibers obtained from coconut husk. As lignin is the main constituent of coir responsible for its stiffness, microbes that selectively remove lignin without loss of appreciable amounts of cellulose are extremely attractive in biosoftening. Five isolated strains were compared with known strains of bacteria and fungi. The raw fiber treated with Pseudomonas putida and Phanerocheate chrysosporium produced better softened fiber at 30+/-2 degrees C and neutral pH. FeSO4 and humic acid were found to be the best inducers for P. chrysosporium and P. putida, respectively, while sucrose and dextrose were the best C-sources for both. Biosoftening of unretted coir fibers was more advantageous than the retted fibers. Unlike the weak chemically softened fiber, microbial treatment produced soft, whiter fibers having better tensile strength and elongation (44.6-44.8%) properties. Scanning electron microscopy photos showed the mycelia penetrating the pores of the fiber, removing the tylose plug and degrading lignin.
Effect of Saprotrophic Soil Fungi on Toxocara canis Eggs
Directory of Open Access Journals (Sweden)
Ciarmela, M. L.
2010-01-01
Full Text Available The purpose of this work was to assess the ovicidal activity of Chrysosporium merdarium, Trichoderma harzianum, Fusarium oxysporum, F. moniliforme and F. sulphureum isolated from public areas in the city of La Plata, Argentina, on Toxocara canis eggs in vitro. Each species were cultured on water agar 2% with a suspension of immature-stage T. canis eggs. At 4, 7, 14, 21 and 28 days post-culture, they were observed by light and scanning electron microscopy. One hundred eggs were evaluated and scored according to Lỳsek’s ovicidal effect classification. These procedures were repeated three times which each fungal species. Chrysosporium merdarium and F. oxysporum showed very high ovicidal activity, F. sulphureum high ovicidal activity, F. moniliforme intermediate ovicidal activity and T. harzianum did not affect the viability of T. canis eggs. Taking into account the effects on human and animal health and the environment, the species with better prospects for studying its potential use as biological control was F. sulphureum.
Czech Academy of Sciences Publication Activity Database
Cajthaml, Tomáš
2015-01-01
Roč. 17, č. 12 (2015), s. 4822-4834 ISSN 1462-2912 R&D Projects: GA TA ČR TE01020218; GA ČR GA13-28283S Institutional support: RVO:61388971 Keywords : WHITE-ROT FUNGUS * PHANEROCHAETE-SORDIDA YK-624 * POLYCYCLIC AROMATIC-HYDROCARBONS Subject RIV: EE - Microbiology, Virology Impact factor: 5.932, year: 2015
Directory of Open Access Journals (Sweden)
Evelyne Coppin
Full Text Available Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures.
Coppin, Evelyne; Berteaux-Lecellier, Véronique; Bidard, Frédérique; Brun, Sylvain; Ruprich-Robert, Gwenaël; Espagne, Eric; Aït-Benkhali, Jinane; Goarin, Anne; Nesseir, Audrey; Planamente, Sara; Debuchy, Robert; Silar, Philippe
2012-01-01
Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures.
Natural Protection of Wood with Antagonism Fungi
Directory of Open Access Journals (Sweden)
Alba ZAREMSKI
2011-03-01
Full Text Available Biological environments contain a certain number of microbial populations which, within a givenecological niche, display various relations ranging from symbiosis to parasitism. Researchers have beeninterested in these types of relations for around fifty years, especially in one very particular type ofrelationship: the antagonism exerted between individuals of the same microbial population.Today, the role played by biological agents, bringing into play inhibitive or destructive antibioticsubstances, reveals a certain potential for their use in controlling microorganisms associated with suchdegradation processes.The work undertaken by HydroQuébec and CIRAD involved two types of experiment: 1 in Petri dishes toassess and characterize the antagonistic capacity of Trichoderma against white rot and brown rot fungi; 2on pieces taken from untreated poles in order to study confrontation between the basidiomycete and theantagonistic strain in wood.This study investigated the antagonism of three ascomycetes of the genus Trichoderma against two whiterot basidiomycetes, Pycnoporus sanguineus and Coriolus versicolor, and two brown rot basidiomycetes,Antrodia sp. and Coniophora puteana, through direct confrontation in Petri dishes and in the wood ofHydroQuébec poles.The results obtained seemed to complete each other coherently. They revealed that the Trichodermagroup of fungi was not aggressive to wood and the results obtained after direct confrontation in Petri disheswere confirmed in wood.By directly exposing the different basidiomycetes and antagonists to each other in Petri dishes, two bytwo, we effectively revealed an antagonism effect for a large majority of the pairs. However, there wassubstantial variability in reactions from one pair to the next.
Ultrastructure of the dikaryotic form of Cyathus bulleri Brodie.
Kozar, F; MacDonald, B R; Weijer, J
1977-01-01
The fine structure of the dikaryotic form of Cyathus bulleri Brodie was generally found to be similar to that of other hyphal forms of the Basidiomycetes. The nuclear walls were doubled, porous and in some cases connected to the endoplasmic reticulum. The presence of typical as well as filamentous and U-shaped mitochondria was confirmed. Other cellular structures and organelles, among them vacuoles, vesicular and myelinoid-like bodies, often associated with the cell membranes, glycogen and ribosomes were also observed in the cytoplasm. The presence of the dolipore/parenthesome apparatus and clamp connections typical of the Basidiomycetes was established.
CELLULASES FROM THE BASIDIO - MYCETES CULTURAL LIQUID
Directory of Open Access Journals (Sweden)
К. G. Dreval
2013-04-01
Full Text Available Adsorption of cellulases on substrate taking place during the cultivation process was determined. Adsorbed enzymes can be eluted by buffer solution with high ionic strength, but for determine their activity they should be transferred into the aqueous solution. On the basis of the results a method for obtaining of cellulases preparations from cultural liquids of basidiomycetes was developed. This method is the elution of cellulases from the cultivation substrate of basidiomycetes. It was found that using of the last allows to obtain enzymatic preparations with a high degree of purification in 3 stages (salting out of proteins — dialysis — gelchromatography. Cellulase preparations received original products of basidiomycetes strains К-1, А-Дон-02, Д-1 Irpex lacteus and AnSc-1 Daedaleopsis confragosa f. confragosa were obtained. They contained different proteins, enzymes with specific peaks out of column and their activity. However, common to them was a distinct maximum of outing from the column by endoglucanases or cellobiases, which may indicate that the studied cellulolytic complexes of basidiomycetes do not contain multiple forms of cellulases with different molecular mass. This method allowed to obtain preparations with different degree of purification in comparing with the original culture filtrate 7,3 for endoglucanase and 33,3 for cellobiase of strain А-Дон-02 I. lacteus; 13,1 for endoglucanase and 25,5 for cellobiase of strain Д-1 I. lacteus; 29,9 for endoglucanase and 90,1 for cellobiase of strain К-1 I. lacteus; 2,1 for endoglucanase and 30,6 for cellobiase of strain AnSc-1 D. confragosa f. confragosa.
Le Donne, Viviana; Crossland, Nicholas; Brandão, João; Sokolova, Yuliya; Fowlkes, Natalie; Nevarez, Javier G; Langohr, Ingeborg M; Gaunt, Stephen D
2016-06-01
Chrysosporium-related infections have been increasingly reported in reptiles over the last 2 decades. In this report, we describe clinical, cytologic, histopathologic, and ultrastructural aspects of Chrysosporium-related infection in 2 Inland Bearded Dragons (Pogona vitticeps). Case 1 was presented for an enlarging raised lesion over the left eye and multiple additional masses over the dorsum. Case 2 was submitted to necropsy by the referring veterinarian for suspected yellow fungus disease. Impression smears of the nodules in case 1 revealed granulomatous to pyogranulomatous inflammation and many septate, variably long, 4-10 μm wide, often undulated hyphae, and very rare conidia. Postmortem impression smears of the superficial lesions of case 2 contained large numbers of solitary conidia and arthroconidia and low numbers of hyphae with similar morphology to case 1. Histopathology of the 2 cases revealed severe, multifocal, chronic, ulcerative, nodular pyogranulomatous dermatitis, with myriad intralesional septate hyphae, and arthroconidia. Fungal culture and molecular sequencing in both cases indicated infection with Nannizziopsis guarroi. © 2016 American Society for Veterinary Clinical Pathology.
Antibiotics in the chemical communication of fungi.
Kettering, Melanie; Sterner, Olov; Anke, Timm
2004-01-01
In dual cultures Oudemansiella mucida and Xerula melanotricha (basidiomycetes) react to the presence of living Penicillium notatum or P. turbatum with an increased production of strobilurin A (1) or X (2). P. notatum in turn reacts to the two basidiomycetes or their antibiotic strobilurin A alone with the production of N-(2-hydroxypropanoyl)-2-aminobenzoic acid amide (3) or chrysogine (4). P. melinii and P. urticae overgrow O. mucida due to complete resistance to strobilurin A. P. brevicompactum, P. citrinum, P. janczewskii and the other Penicillium strains are all sensitive but apparently do not induce O. mucida to produce the amounts of strobilurin A needed to inhibit their growth.
Biodegradation aspects of Polycyclic Aromatic Hydrocarbons (PAHs): A review
Energy Technology Data Exchange (ETDEWEB)
Haritash, A.K., E-mail: akharitash@gmail.com [Department of Environmental Science and Engineering, Guru Jambheshwar University of Science and Technology, Hisar, Haryana (India); Kaushik, C.P. [Department of Environmental Science and Engineering, Guru Jambheshwar University of Science and Technology, Hisar, Haryana (India)
2009-09-30
PAHs are aromatic hydrocarbons with two or more fused benzene rings with natural as well as anthropogenic sources. They are widely distributed environmental contaminants that have detrimental biological effects, toxicity, mutagenecity and carcinogenicity. Due to their ubiquitous occurrence, recalcitrance, bioaccumulation potential and carcinogenic activity, the PAHs have gathered significant environmental concern. Although PAH may undergo adsorption, volatilization, photolysis, and chemical degradation, microbial degradation is the major degradation process. PAH degradation depends on the environmental conditions, number and type of the microorganisms, nature and chemical structure of the chemical compound being degraded. They are biodegraded/biotransformed into less complex metabolites, and through mineralization into inorganic minerals, H{sub 2}O, CO{sub 2} (aerobic) or CH{sub 4} (anaerobic) and rate of biodegradation depends on pH, temperature, oxygen, microbial population, degree of acclimation, accessibility of nutrients, chemical structure of the compound, cellular transport properties, and chemical partitioning in growth medium. A number of bacterial species are known to degrade PAHs and most of them are isolated from contaminated soil or sediments. Pseudomonas aeruginosa, Pseudomons fluoresens, Mycobacterium spp., Haemophilus spp., Rhodococcus spp., Paenibacillus spp. are some of the commonly studied PAH-degrading bacteria. Lignolytic fungi too have the property of PAH degradation. Phanerochaete chrysosporium, Bjerkandera adusta, and Pleurotus ostreatus are the common PAH-degrading fungi. Enzymes involved in the degradation of PAHs are oxygenase, dehydrogenase and lignolytic enzymes. Fungal lignolytic enzymes are lignin peroxidase, laccase, and manganese peroxidase. They are extracellular and catalyze radical formation by oxidation to destabilize bonds in a molecule. The biodegradation of PAHs has been observed under both aerobic and anaerobic conditions
Biodegradation aspects of Polycyclic Aromatic Hydrocarbons (PAHs): A review
International Nuclear Information System (INIS)
Haritash, A.K.; Kaushik, C.P.
2009-01-01
PAHs are aromatic hydrocarbons with two or more fused benzene rings with natural as well as anthropogenic sources. They are widely distributed environmental contaminants that have detrimental biological effects, toxicity, mutagenecity and carcinogenicity. Due to their ubiquitous occurrence, recalcitrance, bioaccumulation potential and carcinogenic activity, the PAHs have gathered significant environmental concern. Although PAH may undergo adsorption, volatilization, photolysis, and chemical degradation, microbial degradation is the major degradation process. PAH degradation depends on the environmental conditions, number and type of the microorganisms, nature and chemical structure of the chemical compound being degraded. They are biodegraded/biotransformed into less complex metabolites, and through mineralization into inorganic minerals, H 2 O, CO 2 (aerobic) or CH 4 (anaerobic) and rate of biodegradation depends on pH, temperature, oxygen, microbial population, degree of acclimation, accessibility of nutrients, chemical structure of the compound, cellular transport properties, and chemical partitioning in growth medium. A number of bacterial species are known to degrade PAHs and most of them are isolated from contaminated soil or sediments. Pseudomonas aeruginosa, Pseudomons fluoresens, Mycobacterium spp., Haemophilus spp., Rhodococcus spp., Paenibacillus spp. are some of the commonly studied PAH-degrading bacteria. Lignolytic fungi too have the property of PAH degradation. Phanerochaete chrysosporium, Bjerkandera adusta, and Pleurotus ostreatus are the common PAH-degrading fungi. Enzymes involved in the degradation of PAHs are oxygenase, dehydrogenase and lignolytic enzymes. Fungal lignolytic enzymes are lignin peroxidase, laccase, and manganese peroxidase. They are extracellular and catalyze radical formation by oxidation to destabilize bonds in a molecule. The biodegradation of PAHs has been observed under both aerobic and anaerobic conditions and the rate can
Directory of Open Access Journals (Sweden)
Md. Zahangir Alam, A. H. Molla and A. Fakhru’l-Razi
2012-10-01
Full Text Available The study of biotransformation of domestic wastewater treatment plant (DWTP sludge was conducted in laboratory-scale by two-stage integrated process i.e. liquid state bioconversion (LSB and solid state bioconversion (SSB processes. The liquid wastewater sludge [4% w/w of total suspended solids (TSS] was treated by mixed filamentous fungi Penicillium corylophilum and Aspergillus niger, isolated, screened and mixed cultured in terms of their higher biodegradation potential to wastewater sludge. The biosolids was increased to about 10% w/w. Conversely, the soluble [i.e. Total dissolve solid (TDS] and insoluble substances (TSS in treated supernatant were decreased effectively in the LSB process. In the developed LSB process, 93.8 g kg-1of biosolids were enriched with fungal biomass protein and nutrients (NPK, and 98.8% of TSS, 98.2% of TDS, 97.3% of turbidity, 80.2% of soluble protein, 98.8% of reducing sugar and 92.7% of chemical oxygen demand (COD in treated sludge supernatant were removed after 8 days of treatment. Specific resistance to filtration (1.39x1012 m/kg was decreased tremendously by the microbial treatment of DWTP sludge after 6 days of fermentation. The treated biosolids in DWTP sludge was considered as pretreated resource materials for composting and converted into compost by SSB process. The SSB process was evaluated for composting by monitoring the microbial growth and its subsequent roles in biodegradation in composting bin (CB. The process was conducted using two mixed fungal cultures, Trichoderma harzianum with Phanerochaete chrysosporium 2094 and (T/P and T. harzianum and Mucor hiemalis (T/M; and two bulking materials, sawdust (SD and rice straw (RS. The most encouraging results of microbial growth and subsequent solid state bioconversion were exhibited in the RS than the SD. Significant decrease of the C/N ratio and germination index (GI were attained as well as the higher value of glucosamine was exhibited in compost; which
Energy Technology Data Exchange (ETDEWEB)
Cooper, P.; Albright, M.; Srinivasan, U.; Ung, A. [New Brunswick Univ., Fredericton, NB (Canada). Wood Science and Technology Centre
2002-07-01
The application of chromated copper arsenate (CCA) treatment and fixation and drying under the conditions of the study to large red pine poles left for an air seasoning period of 10 months in Quebec, Canada progressively reduced the number of micro-organisms present. A large number of microfungi isolations were effected before the treatment from the sapwood and heartwood of all poles and wood decay fungi on 8 selected poles from the 20 test poles. They originated from the sapwood zone. A reduction of approximately 50 per cent in the number of microfungi isolated from the sapwood was noted after the CCA treatment. In the case of 9 of 30 poles, basidiomycetes were isolated after treatment primarily from the untreated heartwood. There were a few instances where basidiomycetes were isolated from unpenetrated sapwood (wet pockets). Temperatures of 55 to 60 degrees Celsius were achieved under moderate temperature fixation schedules (20 hours) for approximately 5 hours at full sapwood depth. Only by the end of the schedule was a temperature of 55 degrees celsius achieved at the centre of the poles. Most of the microfungi were eliminated by this temperature regime. Trichoderma was eliminated, and only one isolation of basidiomycetes was left from the heartwood of one pole. Temperatures of 55 to 60 degrees Celsius were achieved in the wood core for 9 to 10 days during kiln drying. No basidiomycete isolations remained after this exposure. In several of the poles, there was evidence of Paecilomyces variotii, a thermo-tolerant species and a number of species of Penicillium moulds. It was concluded that there was a negligible probability of decay fungi surviving the sequence of processes as described, given the effectiveness of the fixation exposure and the higher wood temperatures sustained for longer periods. 16 refs., 5 tabs., 2 figs.
Directory of Open Access Journals (Sweden)
D Tagu
2009-12-01
Full Text Available Hydrophobins are fungal cell wall proteins involved in aggregation of hyphae. Upon the development of the ectomycorrhizal symbiosis between tree roots and fungal hyphae, the transcripts of hydrophobin genes markedly accumulated. As the precise role of these proteins in symbiosis is not yet known, we develop heterologous expression system of the Pisolithus hydrophobin HYDPt-1. This gene has been introduced in Saccharomyces cerevisiae and in the ectomycorrhizal basidiomycete Hebeloma cylindrosporum. Introns were required for hydPt-1 transcript accumulation in the basidiomycete H. cylindrosporum. Heterologous transcript accumulation did not alter the phenotype of either species. The lack of altered phenotype resulted from the absence of HYDPt-1 polypeptide accumulation in transformed strains.
Microbial Degradation of RDX and HMX
2004-02-01
cultivated in the M-succinate medium as previously described (Coleman et al., 1998). P. chrysosporium ATCC 24725 was provided by Ian Reid (Paprican...Sunahara. 1999. Ecotoxicological Evaluation of a Bench–Scale Bioslurry Treating Explosives – Spiked Soil. Bioremediation J. 3(3), 233-245. 217...1999. Ecotoxicological characterization of energetic substances using a soil extraction procedure. Ecotoxicol. Environ. Safety 43, 138-148
Directory of Open Access Journals (Sweden)
Marie Desnos-Ollivier
Full Text Available New molecular identification techniques and the increased number of patients with various immune defects or underlying conditions lead to the emergence and/or the description of novel species of human and animal fungal opportunistic pathogens. Antifungal susceptibility provides important information for ecological, epidemiological and therapeutic issues. The aim of this study was to assess the potential risk of the various species based on their antifungal drug resistance, keeping in mind the methodological limitations. Antifungal susceptibility profiles to the five classes of antifungal drugs (polyens, azoles, echinocandins, allylamines and antimetabolites were determined for 1698 yeast reference strains belonging to 992 species (634 Ascomycetes and 358 Basidiomycetes. Interestingly, geometric mean minimum inhibitory concentrations (MICs of all antifungal drugs tested were significantly higher for Basidiomycetes compared to Ascomycetes (p<0.001. Twenty four strains belonging to 23 species of which 19 were Basidiomycetes seem to be intrinsically "resistant" to all drugs. Comparison of the antifungal susceptibility profiles of the 4240 clinical isolates and the 315 reference strains belonging to 53 shared species showed similar results. Even in the absence of demonstrated in vitro/in vivo correlation, knowing the in vitro susceptibility to systemic antifungal agents and the putative intrinsic resistance of yeast species present in the environment is important because they could become opportunistic pathogens.
Directory of Open Access Journals (Sweden)
Cheng-Siang Wong
2013-09-01
Full Text Available Proteobacteria produce N-acylhomoserine lactones as signaling molecules, which will bind to their cognate receptor and activate quorum sensing-mediated phenotypes in a population-dependent manner. Although quorum sensing signaling molecules can be degraded by bacteria or fungi, there is no reported work on the degradation of such molecules by basidiomycetous yeast. By using a minimal growth medium containing N-3-oxohexanoylhomoserine lactone as the sole source of carbon, a wetland water sample from Malaysia was enriched for microbial strains that can degrade N-acylhomoserine lactones, and consequently, a basidiomycetous yeast strain WW1C was isolated. Morphological phenotype and molecular analyses confirmed that WW1C was a strain of Trichosporon loubieri. We showed that WW1C degraded AHLs with N-acyl side chains ranging from 4 to 10 carbons in length, with or without oxo group substitutions at the C3 position. Re-lactonisation bioassays revealed that WW1C degraded AHLs via a lactonase activity. To the best of our knowledge, this is the first report of degradation of N-acyl-homoserine lactones and utilization of N-3-oxohexanoylhomoserine as carbon and nitrogen source for growth by basidiomycetous yeast from tropical wetland water; and the degradation of bacterial quorum sensing molecules by an eukaryotic yeast.
African Journals Online (AJOL)
DR GATSING
Cantharellus miomboensis is a new basidiomycete fungus recently found in Miombo woodlands in. Tanzania. .... bacterial and fungal contamination and ..... functions of secondary metabolites. In ... metabolites from marine actinomycetes. Curr.
Ligninolytic Activity of Ganoderma strains on Different Carbon Sources
Directory of Open Access Journals (Sweden)
TYPUK ARTININGSIH
2006-10-01
Full Text Available Lignin is a phenylpropanoid polymers with only few carbon bonds might be hydrolized. Due to its complexity, lignin is particularly difficult to decompose. Ganoderma is one of white rot fungi capable of lignin degradation. The ligninolytic of several species Ganoderma growing under different carbon sources was studied under controlled conditions which P. chrysosporium was used as standard comparison.Three types of ligninolytic, namely LiP, MnP, and laccase were assessed quantitatively and qualitatively. Ratio between clear zone and diameter of fungal colony was used for measuring specific activity qualitatively.Four sspecies of Ganoderma showed positive ligninolytic qualitatively that G. lucidum KT2-32 gave the highest ligninolytic. Activity of LiP and MnP in different carbon sources was consistently resulted by G. lucidum KT2-32, while the highest activity of laccase was shown by G. ochrolaccatum SA2-14. Medium of Indulin AT affected production of protein extracellular and induced ligninolytic. Glucose, BMC, and pine sawdust did not affect the activity of ligninolytic. The specific activity of Ganoderma species was found to be higher than the one of P. chrysosporium.
Type studies in Basidiomycetes. X
Singer, R.
1961-01-01
For the first time a systematic study of the types and authentic specimens of agarics and boletes preserved in the Persoon Herbarium has been carried out. Some aspects of the possibilities of type analysis with regard to specimens over 130 year old are discussed. 137 species were analyzed. The
Tauber, James P; Gallegos-Monterrosa, Ramses; Kovács, Ákos T; Shelest, Ekaterina; Hoffmeister, Dirk
2018-01-01
Production of basidiomycete atromentin-derived pigments like variegatic acid (pulvinic acid-type) and involutin (diarylcyclopentenone) from the brown-rotter Serpula lacrymans and the ectomycorrhiza-forming Paxillus involutus, respectively, is induced by complex nutrition, and in the case of S. lacrymans, bacteria. Pigmentation in S. lacrymans was stimulated by 13 different bacteria and cell-wall-damaging enzymes (lytic enzymes and proteases), but not by lysozyme or mechanical damage. The use of protease inhibitors with Bacillus subtilis or heat-killed bacteria during co-culturing with S. lacrymans significantly reduced pigmentation indicating that enzymatic hyphal damage and/or released peptides, rather than mechanical injury, was the major cause of systemic pigment induction. Conversely, no significant pigmentation by bacteria was observed from P. involutus. We found additional putative transcriptional composite elements of atromentin synthetase genes in P. involutus and other ectomycorrhiza-forming species that were absent from S. lacrymans and other brown-rotters. Variegatic and its precursor xerocomic acid, but not involutin, in return inhibited swarming and colony biofilm spreading of Bacillus subtilis, but did not kill B. subtilis. We suggest that dissimilar pigment regulation by fungal lifestyle was a consequence of pigment bioactivity and additional promoter motifs. The focus on basidiomycete natural product gene induction and regulation will assist in future studies to determine global regulators, signalling pathways and associated transcription factors of basidiomycetes.
Directory of Open Access Journals (Sweden)
Jorge E. Wright
2005-07-01
Full Text Available A check-list of the fungi recorded from Iguazú National Park, one of the best known preserved areas in South America, has been compiled mainly on the basis of Rolf Singer´s and our own collections and publications. Ten species of Dictyosteliales, 4 of Myxomycetes, 4 of Pezizales, 9 of Hypocreales, 31 of other Ascomycetes, 3 Deuteromycotina and 314 of Basidiomycetes are annotated. This last group is by far the best known, and includes 13 species of jelly-fungi, 6 coral fungi, 84 resupinates, 90 Agaricales s. l., 111 polypores of which 26 are poroid Hymenochaetaceae, and 11 of Gasteromycetes. Furthermore, 8 Ascomycetes, 58 Basidiomycetes and 2 Deuteromycotina were determined to genus. Lichens have been excluded. The microfungi of the Park have hardly been explored, and no phycomycetes are recorded, so the number of species included in this checklist is but a mere sample of the rich mycobiota of the Park.Este catálogo de los hongos registrados para el Parque Nacional Iguazú, una de las áreas preservadas mejor conocidas en América del Sur, ha sido confeccionado principalmente sobre la base de las colecciones y publicaciones de Rolf Singer y las propias. Diez especies de Dictyosteliales, 4 de Myxomycetes, 4 de Pezizales, 9 de Hypocreales, 31 de otros Ascomycetes, 3 Deuteromycotina, y 314 de Basidiomycetes han sido anotadas. Este último grupo es de lejos el mejor conocido, e incluye 13 especies de hongos gelatinosos, 6 de hongos clavarioides, 84 de resupinados, 90 de Agaricales s. l., 111 de políporos, de los cuales 26 son Hymenochaetaceae poroides, y 11 de Gasteromycetes. Además, 8 Ascomycetes, 58 Basidiomycetes y 2 Deuteromycotina fueron solo determinados a nivel de género. Los líquenes han sido excluídos. Los microhongos del Parque apenas han sido explorados, y no se han registrado 'ficomicetes', de modo que el número de especies que se presenta aquí son tan sólo un mero muestreo de la micobiota del Parque.
Digital Repository Service at National Institute of Oceanography (India)
DeSouza-Ticlo, D.; Garg, S.; Raghukumar, C.
The effects of various synthetic medium components and their interactions with each other ultimately impact laccase production in fungi. This was studied using a laccase-hyper-producing marine-derived basidiomycete, Cerrena unicolor MTCC 5159...
DEFF Research Database (Denmark)
Tauber, James P.; Gallegos-Monterrosa, Ramses; Kovács, Ákos T.
2018-01-01
Production of basidiomycete atromentin-derived pigments like variegatic acid (pulvinic acid-type) and involutin (diarylcyclopentenone) from the brown-rotter Serpula lacrymans and the ectomycorrhiza-forming Paxillus involutus, respectively, is induced by complex nutrition, and in the case of S...... of Bacillus subtilis, but did not kill B. subtilis. We suggest that dissimilar pigment regulation by fungal lifestyle was a consequence of pigment bioactivity and additional promoter motifs. The focus on basidiomycete natural product gene induction and regulation will assist in future studies to determine....... lacrymans, bacteria. Pigmentation in S. lacrymans was stimulated by 13 different bacteria and cell-wall-damaging enzymes (lytic enzymes and proteases), but not by lysozyme or mechanical damage. The use of protease inhibitors with Bacillus subtilis or heat-killed bacteria during co-culturing with S...
DEFF Research Database (Denmark)
Selosse, Marc-Andre; Brundrett, Mark; Dearnaley, John
2017-01-01
A recent publication in Botany introduced two new taxa: a fossil orchid seed (Mycophoris) and a fossilized basidiomycete fungus (Synaptomitus) in an alleged relationship with this orchid, encased in 15–20 million year old Dominican amber (Poinar, G. 2017. Two new genera, Mycophoris gen. nov......., (Orchidaceae) and Synaptomitus gen. nov. (Basidiomycota) based on a fossil seed with developing embryo and associated fungus in Dominican amber. Botany, 95: 1–8). From the working knowledge of extant orchid seeds, seedlings, and mycorrhiza shared among us, we cannot support these interpretations. Here we...... analyse: (i) why Mycophoris may not be an orchid seed, (ii) why Mycophoris is not a germinating seed, (iii) why fungal hyphae and a symbiotic fungus are absent in Mycophoris, and (iv) why Synaptomitus is likely not a fossil basidiomycete....
Czech Academy of Sciences Publication Activity Database
Hiscox, J.; Baldrian, Petr; Rogers, H. J.; Boddy, L.
2010-01-01
Roč. 47, č. 6 (2010), s. 562-571 ISSN 1087-1845 Institutional research plan: CEZ:AV0Z50200510 Keywords : Interactions * Basidiomycetes * Trametes Subject RIV: EE - Microbiology, Virology Impact factor: 3.333, year: 2010
Manglicolous fungi from atolls of Maldives, Indian Ocean
Digital Repository Service at National Institute of Oceanography (India)
Chinnaraj, S.
Thirty nine species represented by 29 species of Ascomycetes, 2 of Basidiomycetes and 8 of Deuteromycetes were collected from partially submerged, dead and decayed parts of 5 mangrove species. The dominant species were Dactylospora haliotrepha...
Bioleaching of copper, aluminum, magnesium and manganese from ...
African Journals Online (AJOL)
Administrator
2011-09-12
Sep 12, 2011 ... Takao screened organic acid producing strains of basidiomycetes and found that oxalic acid was the main acid along with citric and tartaric acid. .... process by using nitric acid and hydrogen peroxide. Statistical analysis.
Lignin peroxidase isoenzyme: a novel approach to biodegrade the toxic synthetic polymer waste.
Khatoon, Nazia; Jamal, Asif; Ali, Muhammad Ishtiaq
2018-01-05
Fungal metabolites are playing an immense role in developing various sustainable waste treatment processes. The present study aimed at production and characterization of fungal lignin peroxidase (EC 1.11.1.14) with a potential to degrade Polyvinyl Chloride. Optimization studies revealed that the maximum enzyme production occurred at a temperature 25°C, pH 5 in the 4th week of the incubation period with fungal strain. Enzyme assay was performed to find out the dominating enzyme in the culture broth. The molecular weight of the enzyme was found to be 46 kDa. Partially purified lignin peroxidase from Phanerocheate chrysosporium was used for the degradation of PVC films. A significant reduction in the weight of PVC film was observed (31%) in shake flask experiment. FTIR spectra of the enzyme-treated plastic film revealed structural changes in the chemical composition, indicating a specific peak at 2943 cm -1 that corresponded to alkenyl C-H stretch. Moreover, deterioration on the surface of PVC films was confirmed by Scanning Electron Microscopy tracked through activity assay for the lignin peroxidase. Extracellular lignin peroxidases from P. chrysosporium play a significant role in the degradation of complex polymeric compounds like PVC.
African Journals Online (AJOL)
User
bly involved in plant defense responses is synthesized in tomato fruits and subjected to metabo- lism. Its catabolism or .... stored at -20°C. Enzymatic in vitro synthesis of radiolabeled ..... with nematicidal activity from Culture of basidiomycetes.
DEFF Research Database (Denmark)
Poulsen, M; Cafaro, M; Boomsma, J J
2005-01-01
Acromyrmex leaf-cutting ants maintain two highly specialized, vertically transmitted mutualistic ectosymbionts: basidiomycete fungi that are cultivated for food in underground gardens and actinomycete Pseudonocardia bacteria that are reared on the cuticle to produce antibiotics that suppress...
Daly, Paul; Slaghek, Gillian G; Casado López, Sara; Wiebenga, Ad; Hilden, Kristiina S; de Vries, Ronald P; Mäkelä, Miia R
2017-12-01
D. squalens, a white-rot fungus that efficiently degrades lignocellulose in nature, can be used in various biotechnological applications and has several strains with sequenced and annotated genomes. Here we present a method for the transformation of this basidiomycete fungus, using a recently introduced commercial ascomycete protoplasting enzyme cocktail, Protoplast F. In protoplasting of D. squalens mycelia, Protoplast F outperformed two other cocktails while releasing similar amounts of protoplasts to a third cocktail. The protoplasts released using Protoplast F had a regeneration rate of 12.5% (±6 SE). Using Protoplast F, the D. squalens monokaryon CBS464.89 was conferred with resistance to the antibiotics hygromycin and G418 via polyethylene glycol mediated protoplast transformation with resistance cassettes expressing the hygromycin phosphotransferase (hph) and neomycin phosphotransferase (nptII) genes, respectively. The hph gene was expressed in D. squalens using heterologous promoters from genes encoding β-tubulin or glyceraldehyde 3-phosphate dehydrogenase. A Southern blot confirmed integration of a resistance cassette into the D. squalens genome. An average of six transformants (±2 SE) were obtained when at least several million protoplasts were used (a transformation efficiency of 0.8 (±0.3 SE) transformants per μg DNA). Transformation of D. squalens demonstrates the suitability of the Protoplast F cocktail for basidiomycete transformation and furthermore can facilitate understanding of basidiomycete gene function and development of improved strains for biotechnological applications. Copyright © 2017 Elsevier B.V. All rights reserved.
12038_2016_9614_Article_print 265..275
Indian Academy of Sciences (India)
2016-05-13
May 13, 2016 ... The stimulatory effect of the aqueous extract of G. lucidum, a basidiomycetes class fungus ... activity of GL extract was observed through the inhibition of ...... ides and its effect on antioxidant enzymes and immunity activities in.
Digital Repository Service at National Institute of Oceanography (India)
DeSouza-Ticlo, D.; Verma, A.K.; Mathew, M.; Raghukumar, C.
Carbon and nitrogen sources in the growth medium play an important role in the production of lignin-degrading enzymes in the white-rot basidiomyceteous fungi. The role of nutrient nitrogen sources in growth media on production of lignin...
Linke, Diana; Leonhardt, Robin; Eisele, Nadine; Petersen, Laura M; Riemer, Stephanie; Nimtz, Manfred; Berger, Ralf G
2015-06-01
Four extracellular enzymes, a versatile peroxidase, a manganese peroxidase, a dye-decolorizing peroxidase and a lignin peroxidase were discovered in liquid cultures of the basidiomycete Bjerkandera adusta. All of them cleaved β-carotene effectively. Expression was enhanced in the presence of β-carotene or Coomassie Brilliant Blue and peaked after 7-9 days. The monomeric proteins were purified by ion exchange and size exclusion chromatography and exhibited molecular masses of 41, 43, 51 and 43 kDa, respectively. The coding sequences showed homologies from 61 to 89 % to peroxidases from other basidiomycetes. The novel enzymes retained strong activity even in the absence of hydrogen peroxide and at alkaline pH. De-staining of fabrics using detergent-tolerant enzymes may help to save the most important bio-resources, energy and water, in washing processes and led to green processes in textile cleaning.
Oxidoreductases from Trametes spp. in Biotechnology: A Wealth of Catalytic Activity
Directory of Open Access Journals (Sweden)
Gibson S. Nyanhongo
2007-01-01
Full Text Available Those oxidoreductases that are part of the ligninolytic complex of basidiomycete and ascomycete fungi have played an increasingly important role in biotechnological applications during the last decade. The stability of these extracellular enzymes, their good solubility, and a multitude of catalyzed reactions contribute to this trend. This review focuses on a single genus of white-rot basidiomycetes, Trametes, to highlight the numerous possibilities for the application of this microorganism as well as three of its enzymes: laccase, cellobiose dehydrogenase, and pyranose 2-oxidase. Whereas laccase is without doubt a major player in biotechnology, the two other enzymes are less well known, but represent emerging biocatalysts with potential. Both cellobiose dehydrogenase and pyranose 2-oxidase are presumed to participate in lignin breakdown and will be used to exemplify the potential of less prominent oxidoreductases from this genus.
Digital Repository Service at National Institute of Oceanography (India)
Raghukumar, C.; Rivonkar, G.
Flavodon flavus (Klotzsch) Ryvarden, a basidiomycete (NIOCC strain 312) isolated from decomposing leaves of a sea grass, decolorized pigments in molasses spent wash (MSW) by 80% after 8 days of incubation, when used at concentrations of 10% and 50...
Kizilcik, M.; Yamaç, M.; Griensven, van L.J.L.D.
2010-01-01
The present study investigates the exopolysaccharide (EPS) and biomass production of 18 strains of 15 species of culinary-medicinal higher Basidiomycetes in submerged culture under four different media. Gloeophyllum abietinum and Schizophyllum commune produced the highest EPS and biomass
Books received by the Rijksherbarium library
NN,
1993-01-01
Pleurotus ostreatus and P. pulmonarius, wood-destroying and edible basidiomycetes, were the subject of an ecophysiological study with regard to the connection between water household in the fruitbody and sporulation. Field observations were combined with controlled laboratory experiments on
How (post-)genomic insights can provide new leads for improvements of mushroom cultivation
Patyshakuliyeva, A.; Post, H.; Zhou, Miaomiao; Jurak, E.; Heck, A.; Hildén, K.; Kabel, M.A.; Makela, M.R.; Altelaar, Maarten; Vries, De Ronald P.
2016-01-01
The economically important edible basidiomycete mushroom Agaricus bisporus thrives on
decaying plant material in forests and grasslands of North America and Europe. It degrades forest
litter and contributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in
How (post-)genomic insights can provide new leads for improvements of mushroom cultivation
Patyshakuliyeva, A.; Post, Harm; Zhou, Miaomiao; Jurak, Edita; Heck, Albert; Hildén, Kristiina S.; Kabel, Mirjam; Mäkelä, Miia R.; Altelaar, Maarten; de Vries, R.P.
2016-01-01
The economically important edible basidiomycete mushroom Agaricus bisporus thrives on decaying plant material in forests and grasslands of North America and Europe. It degrades forest litter and contributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in plant biomass.
The basidiomycetous soilborne fungus Rhizoctonia (sensu lato) is an economically important pathogen of worldwide distribution and it is known to attack at least 188 species of higher plants, including agronomic crops, vegetables, ornamentals, forest trees and turfgrasses. The pathogenic isolates may...
Uncovering the abilities of Agaricus bisporus to degrade plant biomass throughout its life cycle
Patyshakuliyeva, A.; Post, H.; Zhou, M.; Jurak, E.; Heck, A.J.R.; Hilden, K.S.; Kabel, M.A.; Makela, M.R.; Altenaar, M.A.F.; Vries, de R.P.
2015-01-01
The economically important edible basidiomycete mushroom Agaricus bisporus thrives on decaying plant material in forests and grasslands of North America and Europe. It degrades forest litter and con-tributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in plant biomass.
The edible mushroom Laetiporus sulphureus as potential source of natural antioxidants
Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Stefanoska, I.; Griensven, van L.J.L.D.
2013-01-01
Hot water extract (LN), partially purified polysaccharides (LP) and hot alkali extracted polysaccharides (LNa) obtained from fruiting bodies of the wild basidiomycete Laetiporus sulphureus were examined for their antioxidant activities. LNa was the most active antioxidant, as shown by the median
The yeast flora of some decaying mushrooms on trunks of living trees
Middelhoven, W.J.
2004-01-01
Several ascomycetous and basidiomycetous yeasts were isolated from rotten mushrooms on the trunks of beech and tamarisk trees. One strain, identified as the novel species Cryptococcus allantoinivorans, assimilated allantoin as the sole carbon source. Phylogenetically it belongs to the C. laurentii
Aanen, D.K.; Ros, V.I.D.; Fine Licht, de H.H.; Mitchell, J.; Beer, de Z.W.; Slippers, B.; Rouland-Lefevre, C.; Boomsma, J.J.
2007-01-01
Background Termites of the subfamily Macrotermitinae live in a mutualistic symbiosis with basidiomycete fungi of the genus Termitomyces. Here, we explored interaction specificity in fungus-growing termites using samples from 101 colonies in South-Africa and Senegal, belonging to eight species
Dynamic disease management in trachymyrmex fungus-growing ants (Attini: Formicidae)
DEFF Research Database (Denmark)
Fernández-Marín, Hermógenes; Bruner, Gaspar; Gomez, Ernesto B.
2013-01-01
Abstract Multipartner mutualisms have potentially complex dynamics, with compensatory responses when one partner is lost or relegated to a minor role. Fungus-growing ants (Attini) are mutualistic associates of basidiomycete fungi and antibiotic-producing actinomycete bacteria; the former are atta...
Formation and cell wall regeneration of protoplasts from Schizophyllum commune
de Vries, Onno Minne Hotze
1974-01-01
Osmotically sensitive protoplasts were released from the mycelium of the basidiomycete Schizophyllum commune through the action ofan extracellular enzyme preparation isolated from the culture filtrate of Trichoderma viride (recently renamed T. harzianum) grown on hyphal walls of the former organism.
Novel Phialophora species from leaf-cutting ants (tribe Attini)
Attili-Angelis, D.; Duarte, A.P.M.; Pagnocca, F.C.; Nagamoto, N.S.; de Vries, M.; Stielow, J.B.; de Hoog, G.S.
2014-01-01
Ants in the tribe Attini (Hymenoptera, Formicidae) maintain a 50 million-year-old lifestyle of co-evolution with symbiotic basidiomycetous fungi which they cultivate as essential source of nutrition. However, other microorganisms have been reported from ant habitats indicating a higher diversity of
Novel mandibular gland volatiles from Apterostigma ants
DEFF Research Database (Denmark)
Hogan, Conor T.; Jones, Tappey H.; Zhukova, Mariya
2017-01-01
The fungus-farming ants are a well-studied evolutionary radiation within the subfamily Myrmicinae that associate with a web of symbionts that span kingdoms. Members of the Apterostigma pilosum species group cultivate unique basidiomycete fungi belonging to the coral-mushroom family Pterulaceae...
On the asymmetry of mating in natural populations of the mushroom fungus Schizophyllum commune
Nieuwenhuis, B.P.S.; Nieuwhof, S.; Aanen, D.K.
2013-01-01
Before a mycelium of a mushroom-forming basidiomycete develops mushrooms, the monokaryotic mycelium needs to become fertilized. Although the mechanistic details of mating in mushrooms have been studied thoroughly in laboratory research, very little is known on mating patterns in nature. In this
Czech Academy of Sciences Publication Activity Database
Eichlerová, Ivana; Homolka, Ladislav; Tomšovský, M.; Lisá, Ludmila
2015-01-01
Roč. 119, č. 12 (2015), s. 1345-1353 ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Basidiomycetes * Cryopreservant * Liquid nitrogen Subject RIV: EE - Microbiology, Virology Impact factor: 2.244, year: 2015
DEFF Research Database (Denmark)
Aanen, Duur K; Ros, Vera I D; de Fine Licht, Henrik H
2007-01-01
BACKGROUND: Termites of the subfamily Macrotermitinae live in a mutualistic symbiosis with basidiomycete fungi of the genus Termitomyces. Here, we explored interaction specificity in fungus-growing termites using samples from 101 colonies in South-Africa and Senegal, belonging to eight species di...
Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.
2002-01-01
Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The
Epidemiologische trends in cryptokokkose : De Cryptococcus gattii-uitbraak in Canada
Hagen, F; Boekhout, T
2006-01-01
Cryptococcosis is, when untreated, a fatal disease, which in the Netherlands is mainly caused by the basidiomycetous yeast Cryptococcus neoformans, and in more rare cases by Cryptococcus gattii. Infections with C. gattii occur almost only in immunocompetent individuals, while C. neoformans has a
Suabjakyong, Papawee; Saiki, Ryotaro; Griensven, Van Leo J.L.D.; Higashi, Kyohei; Nishimura, Kazuhiro; Igarashi, Kazuei; Toida, Toshihiko
2015-01-01
The basidiomycetous mushroom Phellinus igniarius (L.) Quel. has been used as traditional medicine in various Asian countries for many years. Although many reports exist on its antioxidative and anti-inflammatory activities and therapeutic effects against various diseases, our current knowledge of
DEFF Research Database (Denmark)
Sitarz, Anna Katarzyna; Mikkelsen, Jørn Dalgaard; Højrup, Peter
2013-01-01
Based on a differential pre-screening of 44 white-rot fungi on a lignocellulose-supplemented minimal medium, four basidiomycetes were selected for further study: Ganoderma lucidum, Polyporus brumalis, Polyporus ciliatus and Trametes versicolor. Only G. lucidum was able to grow vividly on malt...
Various Stages of Pink Fungus (Upasia salmonicolor in Java
Directory of Open Access Journals (Sweden)
Ambarwati Harsojo Tjokrosoedarmo
1995-12-01
Full Text Available Pink fungus in Java is classified as Upasia salmonicolor (Basidiomycetes: Corticiaceae and its anamorph is Necator decretus. This fungus is a serious pathogen which attacks many woody plants. The pink fungus in Java exhibits five developmental stages on the surface of the host bark: I. An initial cobweb stage as thin, white, cobweb-like hyphal layer, which creeps over the surface of the bark, during which penetration of the host occurs; II. Pseudonodular stage, as conical white pustules occurring only on lenticels or cracks, and only on shady side of branches; III. Teleomorph, occurs as pink incrustation and pink pustules on shady side of branches; IV. Nodular stages, as globose white pustules occurring chiefly on intact bark, but also on the lenticels or cracks, on exposed side of branches; V. Anamorph, as small orange-red sporodochium, on exposed side of branches. Key words: pink fungus, Corticiaceae, Basidiomycetes, Necator
Fungal Sex: The Basidiomycota.
Coelho, Marco A; Bakkeren, Guus; Sun, Sheng; Hood, Michael E; Giraud, Tatiana
2017-06-01
Fungi of the Basidiomycota, representing major pathogen lineages and mushroom-forming species, exhibit diverse means to achieve sexual reproduction, with particularly varied mechanisms to determine compatibilities of haploid mating partners. For species that require mating between distinct genotypes, discrimination is usually based on both the reciprocal exchange of diffusible mating pheromones, rather than sexes, and the interactions of homeodomain protein signals after cell fusion. Both compatibility factors must be heterozygous in the product of mating, and genetic linkage relationships of the mating pheromone/receptor and homeodomain genes largely determine the complex patterns of mating-type variation. Independent segregation of the two compatibility factors can create four haploid mating genotypes from meiosis, referred to as tetrapolarity. This condition is thought to be ancestral to the basidiomycetes. Alternatively, cosegregation by linkage of the two mating factors, or in some cases the absence of the pheromone-based discrimination, yields only two mating types from meiosis, referred to as bipolarity. Several species are now known to have large and highly rearranged chromosomal regions linked to mating-type genes. At the population level, polymorphism of the mating-type genes is an exceptional aspect of some basidiomycete fungi, where selection under outcrossing for rare, intercompatible allelic variants is thought to be responsible for numbers of mating types that may reach several thousand. Advances in genome sequencing and assembly are yielding new insights by comparative approaches among and within basidiomycete species, with the promise to resolve the evolutionary origins and dynamics of mating compatibility genetics in this major eukaryotic lineage.
DEFF Research Database (Denmark)
Schiøtt, Morten; Rogowska-Wrzesinska, Adelina; Roepstorff, Peter
2010-01-01
Leaf-cutting (attine) ants use their own fecal material to manure fungus gardens, which consist of leaf material overgrown by hyphal threads of the basidiomycete fungus Leucocoprinus gongylophorus that lives in symbiosis with the ants. Previous studies have suggested that the fecal droplets conta...
Chiaki Hori; Jill Gaskell; Kiyohiko Igarashi; Phil Kersten; Michael Mozuch; Masahiro Samejima; Dan Cullen
2014-01-01
The white-rot basidiomycetes efficiently degrade all wood cell wall polymers. Generally, these fungi simultaneously degrade cellulose and lignin, but certain organisms, such as Ceriporiopsis subvermispora, selectively remove lignin in advance of cellulose degradation. However, relatively little is known about themechanismof selective ligninolysis. To...
HYDROPHOBIN GENES INVOLVED IN FORMATION OF AERIAL HYPHAE AND FRUIT BODIES IN SCHIZOPHYLLUM
WESSELS, JGH; DEVRIES, OMH; ASGEIRSDOTTIR, SA; SCHUREN, FHJ
Fungi typically grow by apical extension of hyphae that penetrate moist substrates. After establishing a branched feeding mycelium, the hyphae differentiate and grow away from the substrate into the air where they form various structures such as aerial hyphae and mushrooms. In the basidiomycete
WESSELS, JGH; DEVRIES, OMH; ASGEIRSDOTTIR, SA; SPRINGER, J
1991-01-01
The spontaneous and recessive mutation thn in the basidiomycete Schizophyllum commune suppresses the formation of aerial hyphae in the monokaryon and, if present as a double dose, the formation of both aerial hyphae and fruit-bodies in the dikaryon. In the monokaryon, the mutation prevents
Lugones, L G; de Jong, J F; de Vries, O M H; Jalving, R; Dijksterhuis, J; Wösten, H A B
Disruption of the SC3 gene in the basidiomycete Schizophyllum commune affected not only formation of aerial hyphae but also attachment to hydrophobic surfaces. However, these processes were not completely abolished, indicating involvement of other molecules. We here show that the SC15 protein
A rare case of urinary tract infection due to Trichosporonasahii in a ...
African Journals Online (AJOL)
Trichosporonasahii is a basidiomycete yeast responsible for white piedra and onychomycosis in the immunocompetent host. In the immunocompromised patients, invasive infections are reported; their diagnosis is difficult and they are associated with high mortality rate. Urinary infection due to Trichosporon Asahi is rare but ...
Fungal Systematics and Evolution: FUSE 2
Hernández-Restrepo, Margarita; Schumacher, René K.; Wingfield, Michael J.; Ahmad, Ishtiaq; Cai, Lei; Duong, Tuan A.; Edwards, Jacqueline; Gené, Josepa; Groenewald, Johannes Z.; Jabeen, Sana; Nasir Khalid, Abdul; Lombard, Lorenzo; Madrid, Hugo; Marin-Felix, Yasmina; Marincowitz, Seonju; Miller, Andrew N.; Rajeshkumar, Kunhiraman C.; Rashid, Abdul; Sarwar, Samina; Stchigel, Alberto M.; Taylor, Paul W.J.; Zhou, Nan; Crous, Pedro W.
2016-01-01
The present study introduces two new genera, 14 new species, five new combinations and 12 interesting host and/or geographical records. A majority of the fungi are Ascomycetes, but the study also includes a Basidiomycete, Xerocomellus fulvus described from Pakistan. Under single name nomenclature
Yurkov, A M; Kachalkin, A V; Daniel, H M; Groenewald, M; Libkind, D; de Garcia, V; Zalar, P; Gouliamova, D E; Boekhout, T; Begerow, D
Many species of dimorphic basidiomycetes are known only in their asexual phase and typically those pigmented in different hues of red have been classified in the large polyphyletic genus Rhodotorula. These yeasts are ubiquitous and include a few species of some clinical relevance. The phylogenetic
[First report of Montagnea arenaria (D.C.) Zeller (Agaricales) in Chile].
Madrid Lorca, Hugo; Muñoz, Mélica
2006-06-01
Montagnea arenaria (D.C.) Zeller (Agaricales), an interesting basidiomycete adapted to arid environments is recorded for the first time from a sample collected on sandy soil in the northern zone of Chile. Its mature fruiting body is described. Taxonomic and ecological comments are also addressed.
Fungal Systematics and Evolution: FUSE 3
Krisai-Greilhuber, Irmgard; Chen, Yun; Jabeen, Sana; Madrid, Hugo; Marincowitz, Seonju; Razaq, Abdul; Sevcíková, Hana; Voglmayr, Hermann; Yazici, Kenan; Aptroot, André; Aslan, Ali; Boekhout, T.; Borovicka, Jan; Crous, P.W.; Ilyas, Sobia; Jami, Fahimeh; Jiang, Yu-Lan; Nasir Khalid, Abdul; Kolecka, Anna; Konvalinková, Tereza; Norphanphoun, Chada; Shaheen, Shabnum; Wang, Yong; Wingfield, Michael J.; Wu, Shi-Ping; Wu, Yue-Ming; Yu, Jie-Ying
2017-01-01
The present study introduces seven new species, one new combination, one new variety and several interesting taxonomical notes and/or geographical records. Most of the new taxa are Ascomycetes, but the study also includes a new variety of a Basidiomycete. Novel species include Gyromitra
Long-term Maintenance of Fungal Cultures on Perlite in Cryovials – an Alternative for Agar Slants
Czech Academy of Sciences Publication Activity Database
Homolka, Ladislav; Lisá, Ludmila
2008-01-01
Roč. 53, č. 6 (2008), s. 534-536 ISSN 0015-5632 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : basidiomycete * perlite * long-term maintenance Subject RIV: EE - Microbiology, Virology Impact factor: 1.172, year: 2008
Draft Genome Sequence of the Animal and Human Pathogen Malassezia pachydermatis Strain CBS 1879
Triana, Sergio; González, Andrés; Ohm, Robin A.; Wösten, Han A. B.; de Cock, Hans; Restrepo, Silvia
2015-01-01
Malassezia pachydermatis is a basidiomycetous yeast that causes infections in humans and animals. Here, we report the genome sequence of Malassezia pachydermatis strain CBS 1879, which will facilitate the study of mechanisms underlying pathogenicity of the only non-lipid-dependent Malasezzia species. PMID:26472839
Cultural characteristics, sexuality and ligninolytic enzyme production of Trametes cervina
Czech Academy of Sciences Publication Activity Database
Tomšovský, Michal; Homolka, Ladislav
2004-01-01
Roč. 25, č. 1 (2004), s. 49-55 ISSN 0181-1584 R&D Projects: GA ČR GA526/02/1216 Institutional research plan: CEZ:AV0Z5020903 Keywords : basidiomycetes * trametes * culture Subject RIV: EE - Microbiology, Virology Impact factor: 0.250, year: 2004
Taxonomic studies in Chrysoderma, Corneromyces, Dendrophsellum, Hyphoradulum, and Mycobonia
Karen K. Nakasone
2015-01-01
Eight poorly known or unusual crustose and pileate basidiomycete species were studied. These included the type specimens of three monotypic genera: Chrysoderma alboluteum from Réunion is conspecific with Cerocorticium molle; Dendrophysellum amurense from the Russian Far East is a species of Vararia; and ...
Biodegradation of Jet Fuel-4 (JP-4) in Sequencing Batch Reactors
1992-06-01
nalw~eo %CUMENTATION PAGE__ _ _ _ _ _ _ _ _O 74S Ab -A258 020 L AW POi~W6 DATI .~ TYP AIMqm ,-& 0 U. glbs A~ I ma"&LFUN Mu BIODEGRADATION OF JET FUEL...Specific Objectives of This Proposal Are: 1. To assess the ability of C. resinae , P. chrysosporium and selected bacterial consortia to degrade individual...chemical components of JP-4. 2. To develop a sequencing batch reactor that utilizes C. resinae to degrade chemical components of JP-4 in contaminated
ASSIGNMENT OF GENES TO PULSE-FIELD SEPARATED CHROMOSOMES OF SCHIZOPHYLLUM-COMMUNE
ASGEIRSDOTTIR, SA; SCHUREN, FHJ; WESSELS, JGH
Chromosomal DNAs of the basidiomycete Schizophyllum commune were separated by Contour-Clamped Homogeneous Electric Field Electrophoresis (CHEF). The estimated sizes of the chromosomal DNAs ranged from 4.7 Megabase pairs (Mbp) to 1.6 Mbp, totalling 35.6 Mbp. Using sequences from 20 cloned genes we
The genus Actiniceps Berk. & Br
Boedijn, K.B.
1959-01-01
The genus Actiniceps Berk. & Br. is shown to be a Basidiomycete. Wiesnerina Höhn. and Dimorphocystis Corner are regarded synonymous. The type species A. thwaitesii Berk. & Br. is redescribed with D. capitatus Corner as synonym. The following new combinations are proposed: A. horrida (Höhn.) Boedijn,
Phylogenetic position and physiology of Cerinosterus cyanescens
Middelhoven, W.J.; Gueho, E.; Hoog, de G.S.
2000-01-01
Partial 25S rRNA sequencing of Cerinosterus cyanescens showed it to be a close relative of Microstroma juglandis, a member of the basidiomycetous order Microstromatales. It is unrelated to the generic type species, C. luteoalba, which is a member of the order Dacrymycetales. The clinical occurrence
Carriconde, Fabian; Gilgado, Félix; Arthur, Ian; Ellis, David; Malik, Richard; van de Wiele, Nathalie; Robert, Vincent; Currie, Bart J.; Meyer, Wieland
2011-01-01
Cryptococcus gattii is a basidiomycetous yeast that causes life-threatening disease in humans and animals. Within C. gattii, four molecular types are recognized (VGI to VGIV). The Australian VGII population has been in the spotlight since 2005, when it was suggested as the possible origin for the
Bioconcentration of manganese and iron in Panaeoloideae Sing
Stijve, T.; Blake, C.
1994-01-01
According to literature, the manganese content of most basidiomycetes fluctuates between 10 and 60 mg/kg, whereas the iron levels range from 100-500 mg/kg (both expressed on dry weight). The present authors report that bioconcentration of manganese is a distinguishing feature of the Panaeoloideae,
First report of frosty pod rot caused by Moniliophthora roreri on cacao in Bolivia
Frosty pod rot (FPR) is a devastating cacao disease caused by the basidiomycete Moniliophthora roreri (Aime and Phillips-Mora, 2005). The disease is confined to 13 countries in Central and South America and constitutes a permanent threat for cacao cultivation worldwide. In July 2012, FPR was detect...
Wei, S.; Helsper, J.P.F.G.; Griensven, van L.J.L.D.
2008-01-01
Hot-water extracts of the higher Basidiomycetes Agaricus bisporus (J. Lge) Imbach, A. brasiliensis S. Wasser et al., Coprinus comatus (O.F. Mull.) Pers., Ganoderma lucidum (W. Curt.: Fr.) P. Karst., and Phellinus linteus (Berk. et Curt.) Teng were made, and the resulting polysaccharide mixtures were
Rust diseases caused by Puccinia spp. pose a major threat to global wheat production. Puccinia triticina (Pt), an obligate basidiomycete biotroph, causes leaf rust disease which incurs yield losses of up to 50% in wheat. Historically, resistant wheat cultivars have been used to control leaf rust, bu...
A novel expansin protein from the white-rot fungus Schizophyllum commune.
Directory of Open Access Journals (Sweden)
Omar Eduardo Tovar-Herrera
Full Text Available A novel expansin protein (ScExlx1 was found, cloned and expressed from the Basidiomycete fungus Schizophylum commune. This protein showed the canonical features of plant expansins. ScExlx1 showed the ability to form "bubbles" in cotton fibers, reduce the size of avicel particles and enhance reducing sugar liberation from cotton fibers pretreated with the protein and then treated with cellulases. ScExlx1 was able to bind cellulose, birchwood xylan and chitin and this property was not affected by different sodium chloride concentrations. A novel property of ScExlx1 is its capacity to enhance reducing sugars (N-acetyl glucosamine liberation from pretreated chitin and further added with chitinase, which has not been reported for any expansin or expansin-like protein. To the best of our knowledge, this is the first report of a bona fide fungal expansin found in a basidiomycete and we could express the bioactive protein in Pichia pastoris.
Institute of Scientific and Technical Information of China (English)
吴丹; 王之盛; 薛白; 邹华围; 余群莲
2011-01-01
本文旨在研究不同加工方法对白酒糟营养价值和体外瘤胃发酵特性的影响.以未处理白酒糟作为对照(CK组),按白酒糟的加工方式不同设4个试验组:黄孢原毛平革菌发酵白酒糟(发酵,F组)、黄孢原毛平革菌发酵粉碎白酒糟(粉碎+发酵,CF组)、黄孢原毛平革菌发酵氨化白酒糟(氨化+发酵,AF组)、黄孢原毛平革菌发酵粉碎、氨化白酒糟(粉碎+氨化+发酵,CAF组).测定各组白酒糟常规营养成分及体外瘤胃发酵指标.结果表明:1)黄孢原毛平革菌发酵能极显著降低白酒糟酸性洗涤木质素(ADL)含量、极显著提高粗蛋白质(CP)含量(P<0.01),粉碎+氨化+发酵3种加工方式联合处理效果最好.2)与CK组相比,CF组、AF组和CAF组理论最大产气量和产气速率极显著提高、产气延滞时间极显著降低(P<0.01);CAF组产气量、理论最大产气量和产气速率极显著高于其他各试验组(P<0.01).3)CAF组菌体蛋白(MCP)含量显著高于其他各组(P<0.05);AF组和CAF组氨态氮(NH3 -N)浓度(P<0.05)、总挥发性脂肪酸(TVFA)浓度(P<0.05)、丙酸比例(P<0.01)显著或极显著高于其他各组,乙酸/丙酸极显著低于其他各组(P<0.01).结果提示:对白酒糟进行粉碎、氨化处理,可促进黄孢原毛平革菌对白酒糟木质素的降解,进而提高其营养价值、改善瘤胃发酵,粉碎、氨化、发酵复合加工效果最好.%This experiment was conducted to study the effects of different processing methods on nutritive value and in vitro ruminal fermentation characteristics of distilled grain ( DG). The unprocessed DG was used as the control (CK group) , and 4 experimental groups were set by the different processing methods, which were DG fermented with P. Chrysosporium (ferment, F group), crushed DG fermented with P. Chrysosporium (crush + ferment, CF group) , ammoniated DG fermented with P. Chrysosporium (ammoniate + ferment, AF group), as well as crushed
The hemibiotrophic basidiomycete fungus Moniliophthora perniciosa, the causal agent of witches’ broom disease (WBD) of cacao, is able to grow in methanol as sole carbon source. In plants, one of the main sources of methanol is the pectin present in the structure of cell walls. Pectin is composed b...
D.A. Sutton; E.H. Thompson; M.G. Rinaldi; P.C. Iwen; K.K. Nakasone; H.S. Jung; H.M. Rosenblatt; M.E. Paul
2005-01-01
Although isolates of filamentous basidiomycetes can usually be recognized in a clinical laboratory setting, identification is problematic, as they seldom exhibit diagnostic morphological features formed in nature. This paper is the first report of Inonotus (Phellinus ) tropicalis inciting human disease and describes the methods used to support the identification.
Jae San Ryu; Semarjit Shary; Carl J. Houtman; Ellen A. Panisko; Premsagar Korripally; Franz J. St. John; Casey Crooks; Matti Siika-aho; Jon K. Magnuson; Kenneth E. Hammel
2011-01-01
Brown rot basidiomycetes have an important ecological role in lignocellulose recycling and are notable for their rapid degradation of wood polymers via oxidative and hydrolytic mechanisms. However, most of these fungi apparently lack processive (exo-acting) cellulases, such as cellobiohydrolases, which are generally required for efficient cellulolysis. The recent...
INSOLUBLE HYDROPHOBIN COMPLEXES IN THE WALLS OF SCHIZOPHYLLUM-COMMUNE AND OTHER FILAMENTOUS FUNGI
DEVRIES, OMH; FEKKES, MP; WOSTEN, HAB; WESSELS, JGH
Two closely related cysteine-rich hydrophobic proteins, Sc3p and Sc4p, of the basidiomycete Schizophyllum commune are developmentally regulated and associated with the walls of aerial hyphae and fruit-body hyphae. They are present in the walls as hot-SDS-insoluble complexes which can be extracted
Chiaki Hori; Takuya Ishida; Kiyohiko Igarashi; Masahiro Samejima; Hitoshi Suzuki; Emma Master; Patricia Ferreira; Francisco J. Ruiz-Duenas; Benjamin Held; Paulo Canessa; Luis F. Larrondo; Monika Schmoll; Irina S. Druzhinina; Christian P. Kubicek; Jill A. Gaskell; Phil Kersten; Franz St. John; Jeremy Glasner; Grzegorz Sabat; Sandra Splinter Bondurant; Khajamohiddin Syed; Jagjit Yadav; Anthony C. Mgbeahuruike; Andriy Kovalchuk; Fred O. Asiegbu; Gerald Lackner; Dirk Hoffmeister; Jorge Recoret; Ana Gutierrez; Hui Sun; Erika Lindquist; Kerrie Barry; Robert Riley; Igor V. Grigoriev; Bernard Henrissat; Ursula Kues; Randy M. Berka; Angel T. Martinez; Sarah F. Covert; Robert A. Blanchette; Daniel Cullen
2014-01-01
Collectively classified as white-rot fungi, certain basidiomycetes efficiently degrade the major structural polymers of wood cell walls. A small subset of these Agaricomycetes, exemplified by Phlebiopsis gigantea, is capable of colonizing freshly exposed conifer sapwood despite its high content of extractives, which retards the establishment of other...
African Journals Online (AJOL)
Goud, MJP. Vol 2, No 3 (2007) - Articles Antibacterial activity and biomolecular composition of certain fresh water micro-algae from River Godavari (India) Abstract PDF · Vol 3, No 1 (2008) - Articles Replica plate screening method for detecting phosphatase activity in basidiomycetes using 1-Napthyl Phosphate as a ...
Basidiomycosis: a review of the literature Basidiomicoses: revisão da literatura
Directory of Open Access Journals (Sweden)
Carlos da Silva Lacaz
1996-10-01
Full Text Available The basidiomycosis, fungal infections provoked by basidiomycetes or agaric fungi have been recorded at growing frequencies in the medical literature, especially after the advent of AIDS in 1991. The basidiospores of these fungi, scattered in the atmosphere and transported by winds or air currents, reach the maxillary sinuses through the nasal route, most of the times causing signs and symptoms of chronic sinusitis. Basidiomycetes have also been isolated from sputum, especially Schizophyllum commune. Lesions of the buccal mucosa, brain abscesses, onychomycosis and endocarditis have been described, with a growing interest in this type of deep mycosis on the part of mycologists and infectologists. The present paper reports descriptions of mycetism as well as infectious processes caused by basidiomycetes, such as Schizophyllum commune, Ustilago maydis (= Ustilago zeae and Coprinus cinereusAs basidiomicoses, infecções fúngicas provocadas por basidiomicetos ou agáricos vêm sendo registradas cada vez com maior frequência na literatura médica, principalmente após o advento da AIDS/SIDA, em 1981. Os basidiosporos desses fungos, espalhados na atmosfera e veiculados através do vento ou de correntes aéreas, atingem por via nasal os seios maxilares, provocando quadros de sinusite crônica, na maioria das vezes. Do escarro também têm sido isolados basidiomicetos, principalmente o Schizophyllum commune. Lesões da mucosa da boca, abscessos cerebrais, onicomicoses e endocardites já foram descritas, aumentando o interesse dos micologistas e infectologistas para este tipo de micose profunda. O presente trabalho assinala, ao lado dos quadros dc micetismo, processos infecciosos provocados por basidiomicetos, a exemplo do Schizophyllum commune, Ustilago maydis (= Ustilago zeae e Coprinus cinereus.
Enzyme activities of fungi associated with Picea abies needles
Czech Academy of Sciences Publication Activity Database
Žifčáková, Lucia; Dobiášová, Petra; Kolářová, Zuzana; Koukol, O.; Baldrian, Petr
2011-01-01
Roč. 4, č. 6 (2011), s. 427-436 ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA ČR GA526/08/0751 Institutional research plan: CEZ:AV0Z50200510 Keywords : Ascomycetes * Decomposition * Basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 2.507, year: 2011
Emmanuel Ebanyenle; Andrew J. Burton; Andrew J. Storer; Dana L. Richter; Jessie A. Glaeser
2016-01-01
We examined the effects of elevated CO2 and/or O3 on the wood-decaying basidiomycete fungal community and wood decomposition rates at the Aspen Free-Air CO2 and O3 Enrichment (Aspen FACE) project. Mass loss rates were determined after one year of log decomposition on the soil...
Czech Academy of Sciences Publication Activity Database
Hršelová, Hana; Soukupová, Lucie; Gryndler, Milan
2007-01-01
Roč. 52, č. 6 (2007), s. 627-630 ISSN 0015-5632 R&D Projects: GA ČR GA526/06/0540 Institutional research plan: CEZ:AV0Z50200510 Keywords : ectomycorrhizal basidiomycetes * sewage sludge * humic-acid-like materials Subject RIV: EE - Microbiology, Virology Impact factor: 0.989, year: 2007
Functional foods from mushroom
Mushrooms are defined as “a macro fungus with distinctive fruiting bodies that could be hypogeous or epigeous, large enough to be seen by naked eyes and to be picked by hands.” The Basidiomycetes and some species of Ascomycetes are categorized as mushrooms. Mushrooms constitute 22,000 known species ...
Directory of Open Access Journals (Sweden)
Yaoming Cui
2015-04-01
Full Text Available The objective of this work was to degrade lignocellulosic components in un-pretreated vinegar residue (VR using a fungal consortium. Consortium-29, consisting of P. chrysosporium, T. koningii, A. niger, and A. ficuum NTG-23, was constructed using orthogonal design combined with two-way interaction analysis. After seven days of cultivation, the reducing sugar yield reached 35.57 mg per gram of dry substrate (gds-1, which was 108.01% higher than the control (17.10 mg gds-1. Additionally, the xylanase and CMCase activity reached 439.07 U gds-1 and 8.15 U gds-1, which were 432.08% and 243.88% higher than that of pure cultures of A. niger (82.52 U gds-1 and P. chrysosporium (2.37 U gds-1, respectively. The cellulose, hemicellulose, and lignin contents decreased by 17.11%, 68.61%, and 14.44%, respectively, compared with that of the raw VR. The optimal fermentation conditions of consortium-29 were as follows: incubation temperature 25 °C, initial pH 6, initial moisture content 70%, inoculum size 1 x 10^6 spores/mL, incubation time 5 days, urea/VR 1%, and MnSO4 . H2O/VR 0.03%. This study suggests that consortium-29 is an efficient fungal consortium for un-pretreated VR degradation and has a potential application in lignocellulosic waste utilization with a low cost of operation.
A New Perspective on Radiation Resistance Based on Deinococcus radiodurans
2009-03-01
tolerate 3,000–5000 Gy, but are rendered sterile. As a haploid, the basidiomycete fungus Ustilago maydis carries a single set of chromosomes per...salinarum NRC-1. Environ. Microbiol. 5 Jan 2009 (doi:10.1111/j.1462-2920.2008.01828.x). 21. Chan, H. L. et al. Proteomic analysis of UVC irradiation
Jill Gaskell; Robert A. Blanchette; Philip E. Stewart; Sandra Splinter BonDurant; Marie Adams; Grzegorz Sabat; Philip Kersten; Daniel Cullen
2016-01-01
Certain wood decay basidiomycetes, collectively referred to as brown rot fungi, rapidly depolymerize cellulose while leaving behind the bulk of cell wall lignin as a modified residue. The mechanism(s) employed is unclear, but considerable evidence implicates the involvement of diffusible oxidants generated via Fenton-like chemistry. Toward a better understanding of...
Moniliophthora roreri Genome and Transcriptome
Frosty pod rot disease of cacao is one of the most destructive diseases of cacao and at this time is limited to regions in South America and Central America. Frosty pod rot is caused by a fungal pathogen Moniliophthora roreri, a basidiomycete that is closely related to another cacao pathogen that ca...
Draft genome sequence of the white-rot fungus Obba rivulosa 3A-2
Otto Miettinen; Robert Riley; Kerrie Barry; Daniel Cullen; Ronald P. de Vries; Matthieu Hainaut; Annele Hatakka; Bernard Henrissat; Kristiina Hilden; Rita Kuo; Kurt LaButti; Anna Lipzen; Miia R. Makela; Laura Sandor; Joseph W. Spatafora; Igor V. Grigoriev; David S. Hibbett
2016-01-01
We report here the first genome sequence of the white-rot fungus Obba rivulsa (Polyporales, Basidiomycota), a polypore known for its lignin-decomposing ability. The genome is based on the homokaryon 3A-2 originating in Finland. The genome is typical in size and carbohydrate active enzyme (CAZy) content for wood-decomposing basidiomycetes.
Mycorrhizal fungi of aspen forests: Natural occurrence and potential applications
Cathy L. Cripps
2001-01-01
Native mycorrhizal fungi associated with aspen were surveyed on three soil types in the north-central Rocky Mountains. Selected isolates were tested for the ability to enhance aspen seedling growth in vitro. Over 50 species of ectomycorrhizal fungi occur with Populus tremuloides in this region, primarily basidiomycete fungi in the Agaricales. Almost one-third (30%)...
Shimokawa, Tomoko; Shibuya, Hajime; Nojiri, Masanobu; Yoshida, Shigeki; Ishihara, Mitsuro
2008-09-01
A family 12 endoglucanase with a molecular mass of 23,926 Da (EG-II) from the brown-rot basidiomycete Fomitopsis palustris was purified and characterized. One of the roles of EG-II in wood degradation is thought to be to loosen the polysaccharide network in cell walls by disentangling hemicelluloses that are associated with cellulose.
Directory of Open Access Journals (Sweden)
Henrissat Bernard
2011-01-01
Full Text Available Abstract Background Rhizopus oryzae is a zygomycete filamentous fungus, well-known as a saprobe ubiquitous in soil and as a pathogenic/spoilage fungus, causing Rhizopus rot and mucomycoses. Results Carbohydrate Active enzyme (CAZy annotation of the R. oryzae identified, in contrast to other filamentous fungi, a low number of glycoside hydrolases (GHs and a high number of glycosyl transferases (GTs and carbohydrate esterases (CEs. A detailed analysis of CAZy families, supported by growth data, demonstrates highly specialized plant and fungal cell wall degrading abilities distinct from ascomycetes and basidiomycetes. The specific genomic and growth features for degradation of easily digestible plant cell wall mono- and polysaccharides (starch, galactomannan, unbranched pectin, hexose sugars, chitin, chitosan, β-1,3-glucan and fungal cell wall fractions suggest specific adaptations of R. oryzae to its environment. Conclusions CAZy analyses of the genome of the zygomycete fungus R. oryzae and comparison to ascomycetes and basidiomycete species revealed how evolution has shaped its genetic content with respect to carbohydrate degradation, after divergence from the Ascomycota and Basidiomycota.
Directory of Open Access Journals (Sweden)
Irina A. Gorbunova
2017-08-01
Full Text Available The article presents new data on agaricoid basidiomycetes of the Katunsky State Nature Reserve (Republic of Altai, Russia, including data on rare species. Besides the paper contains characteristics of some rare ascomycetes and basidiomycetes found in the Katunsky Reserve and in the Republic of Altai as well as about species recommended for inclusion in the new edition of the Red Data Book of the Republic of Altai. In total descriptions of 17 species of macromycetes are presented. These are Chroogomphus sibiricus, Cortinarius violaceus, Floccularia luteovirens, Ganoderma lucidum, Grifola frondosa, Lactarius lignyotus, Leucoagaricus nympharum, Leucopholiota lignicola, Gastrosporium simplex, Gyromitra sphaerospora, Laricifomes officinalis, Bovista acuminata, Hydropus atramentosus, Leucopaxillus rhodoleucus, Phallus costatus, Polyozellus multiplex and Polyporus rhizophilus. We present data on species' distribution throughout the Republic of Altai, Russia and the world; some ecological and biological features of species; major threats and their conservation status. Arguments for exclusion of Amanita echinocephala, Hericium coralloides, Cystoderma rugosoreticulatum, Leccinum percandidum, Mutinus caninus from the list of rare species of the region are presented.
Global warming and mycoflora in the Baltic Region
Directory of Open Access Journals (Sweden)
Hanns Kreisel
2013-12-01
Full Text Available The author discusses possible effects of global warming on distribution and ecology of larger fungi, and presents examples of suggested indicator species which apparently are spreading from south to north. Only Basidiomycetes are corncerned, while actually no case of non-lichenized Ascomycetes is known. A continued monitoring of the mentioned species is recommended.
Enzymology and molecular biology of lignin degradation
D. Cullen; P.J. Kersten
2004-01-01
This review provides an overview of the physiology and genetics of lignin degradation by white rot basidiomycetes. Emphasis is on recent advances and the reader is referred to earlier comprehensive reviews for historical perspective and background (Kirk and Farrell 1987; Gold and Alic 1993; Higuchi 1993; Cullen and Kersten 1996; Cullen 1997). Recent completion of a...
Czech Academy of Sciences Publication Activity Database
Byss, Marius; Elhottová, Dana; Tříska, Jan; Baldrian, Petr
2008-01-01
Roč. 2008, č. 73 (2008), s. 1518-1523 ISSN 0045-6535 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z60870520; CEZ:AV0Z60660521; CEZ:AV0Z50200510 Keywords : Wood-rotting basidiomycetes * Soil microbial community * PLFA, PAH Subject RIV: EH - Ecology, Behaviour Impact factor: 3.054, year: 2008
SECONDARY METABOLITES FROM MARINE PENICILLIUM BREVICOMPACTUM
ROVIROSA, JUANA; DIAZ-MARRERO, ANA; DARIAS, JOSE; PAINEMAL, KARIN; SAN MARTIN, AURELIO
2006-01-01
In a screening of Basidiomycete cultures isolated from marine invertebrates collected along the Chilean coastline for the production of antibiotics we identified a Penicillium brevicompactum strain as a producer of metabolites inhibiting the growth of bacteria and fungi. Bioactivity guided purification resulted in the isolation of four known metabolites. Their structures were elucidated by spectroscopic methods.
Selected emerging infectious diseases of squamata.
Latney, La'toya V; Wellehan, James
2013-05-01
It is important that reptile clinicians have an appreciation for the epidemiology, clinical signs, pathology, diagnostic options, and prognostic parameters for novel and emerging infectious diseases in squamates. This article provides an update on emerging squamate diseases reported in the primary literature within the past decade. Updates on adenovirus, iridovirus, rhabdovirus, arenavirus, and paramyxovirus epidemiology, divergence, and host fidelity are presented. A new emerging bacterial disease of Uromastyx species, Devriesea agamarum, is reviewed. Chrysosporium ophiodiicola-associated mortality in North American snakes is discussed. Cryptosporidium and pentastomid infections in squamates are highlighted among emerging parasitic infections. Copyright © 2013 Elsevier Inc. All rights reserved.
Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger
International Nuclear Information System (INIS)
Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.
2009-01-01
The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 laccase gene contains a putative site for xenobiotics (XRE). (Author)
Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger
Energy Technology Data Exchange (ETDEWEB)
Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.
2009-07-01
The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 kaccase gene contains a putative site for xenobiotics (XRE). (Author)
2012-07-01
canned and prepared foods with gamma rays in an effort to kill micro -organisms, trichina in pork, and food-infesting insects (DPG 2001). The Avery...microcommunity consisting of fungi (Basidiomycetes), lichens, soil algae , and mosses typically occurring in semiarid regions. Cyanobacteria-dominated soil... ponds , playas, and wetlands. Constructed surface water features include wastewater lagoons, evaporation ponds , an excavated pond , a bermed pond , and
Potočnik, Ivana; Stepanović, Miloš; Rekanović, Emil; Todorović, Biljana; Milijašević-Marčić, Svetlana
2015-01-01
The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus), oyster mushroom (Pleurotus sp.) and shiitake (Lentinus edodes). Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal a...
Vasilchenko, Liliya G; Karapetyan, Karen N; Yershevich, Olga P; Ludwig, Roland; Zamocky, Marcel; Peterbauer, Clemens K; Haltrich, Dietmar; Rabinovich, Mikhail L
2011-05-01
Cellobiose dehydrogenase (CDH) is an extracellular fungal flavocytochrome specifically oxidizing cellooligosaccharides and lactose to corresponding (-lactones by a variety of electron acceptors. In contrast to basidiomycetous CDHs, CDHs of ascomycetes also display certain activity toward glucose. The objective of this study was to establish the structural reasons of such an activity of CDH from mesophilic ascomycete Chaetomium sp. INBI 2-26 (ChCDH). The complete amino acid sequence of ChCDH displayed high levels of similarity with the amino acid sequences of CDHs from the thermophilic fungi Thielavia heterotallica and Myriococcum thermophilum. Peptide mass fingerprinting of purified ChCDH provided evidence for the oxidation of methionine residues in the FAD-domain. Comparative homology modeling of the structure of the ChCDH FAD-domain in complex with the transition state analog based on the structure of the same complex of basidiomycetous CDH (1NAA) as template indicated possible structural reasons for the enhanced activity of ascomycetous CDHs toward glucose at neutral pH, which is a prerequisite for application of CDH in a variety of biocompatible biosensors and biofuel cells. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Septal Pore Caps in Basidiomycetes, Composition and Ultrastructure
Driel, K.G.A. van
2007-01-01
Filamentous fungi, including Ascomycota and Basidiomycota, form mycelia that consist of a network of apical growing hyphae. These hyphae are separated into cellular compartments by septa that have pores of about 70 to 500 nm in diameter. The cytoplasm within the mycelium is thus continuous
New records of truffle fungi (Basidiomycetes) from Turkey
Aziz Turkoglu; Michael Angelo. Castellano
2013-01-01
We report the first records of 5 truffle taxa in Turkey: Gymnomyces xanthosporus (Hawker) A.H.Sm., Hymenogaster griseus Vittad., Hymenogaster olivaceous Vittad., Hymenogaster thwaitesii Berk. & Broome, and Hymenogaster vulgaris Tul. & C.Tul. We also report a new...
Chapter 5: Organopollutant Degradation by Wood Decay Basidiomycetes
Yitzhak Hadar; Daniel Cullen
2013-01-01
Wood decay fungi are obligate aerobes, deriving nutrients from the biological âcombustionâ of wood, using molecular oxygen as terminal electron acceptor (Kirk and Farrell 1987; Blanchette 1991). Non-specific extracellular enzymes are generally viewed as key components in lignin depolymerization. The major enzymes implicated in lignin degradation are lignin peroxidase (...
Preservation of live cultures of basidiomycetes - Recent methods
Czech Academy of Sciences Publication Activity Database
Homolka, Ladislav
2014-01-01
Roč. 118, č. 2 (2014), s. 107-125 ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Fungi * Maintenance methods * Long-term preservation Subject RIV: EE - Microbiology, Virology Impact factor: 2.342, year: 2014
Diane Dietrich; Casey Crooks
2009-01-01
A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5âUTR...
Secretome-based Manganese(II) Oxidation by Filamentous Ascomycete Fungi
Zeiner, C. A.; Purvine, S.; Zink, E.; Paša-Tolić, L.; Chaput, D.; Wu, S.; Santelli, C. M.; Hansel, C. M.
2017-12-01
Manganese (Mn) oxides are among the strongest oxidants in the environment, and Mn(II) oxidation to Mn(III/IV) (hydr)oxides includes both abiotic and microbially-mediated processes. While white-rot Basidiomycete fungi oxidize Mn(II) using laccases and Mn peroxidases in association with lignocellulose degradation, the mechanisms by which filamentous Ascomycete fungi oxidize Mn(II) and a physiological role for Mn(II) oxidation in these organisms remain poorly understood. Through a combination of chemical and in-gel assays, bulk mass spectrometry, and iTRAQ proteomics, we demonstrate enzymatic Mn(II) oxidation in the secretomes of three phylogenetically diverse Ascomycetes that were isolated from Mn-laden sediments. Candidate Mn(II)-oxidizing enzymes were species-specific and included bilirubin oxidase and tyrosinase in Stagonospora sp. SRC1lsM3a, GMC oxidoreductase in Paraconiothyrium sporulosum AP3s5-JAC2a, and FAD-binding oxidoreductases in Pyrenochaeta sp. DS3sAY3a. These findings were supported by full proteomic characterization of the secretomes, which revealed a lack of Mn, lignin, and versatile peroxidases in these Ascomycetes but a substantially higher proportion of LMCOs and GMC oxidoreductases compared to wood-rot Basidiomycetes. We also identified the potential for indirect enzymatic Mn(II) oxidation by hydroxyl radical, as the secretomes were rich in diverse lignocellulose-degrading enzymes that could participate in Fenton chemistry. A link between Mn(II) oxidation and carbon oxidation analogous to white-rot Basidiomycetes remains unknown in these Ascomycetes. Interestingly, growth rates on rich medium were unaffected by the presence of Mn(II), and the production of Mn(II)-oxidizing proteins in the secretome was constitutive and not inducible by Mn(II). Thus, no physiological benefit of Mn(II) oxidation in these Ascomycetes has yet been identified, and Mn(II) oxidation appears to be a side reaction. Future work will explore the lignin-degrading capacity of
Directory of Open Access Journals (Sweden)
Mohsen Nosratabadi
2017-06-01
Full Text Available Background and Purpose: Keratinophilic fungi are among the important groups of fungi living in the soil. This study aimed to isolate and identify keratinophilic fungi from the soil of three Iranian islands, namely Greater Tunb, Abu Musa, and Sirri, located in the Persian Gulf using morphological and molecular (polymerase chain reaction methods. Materials and Methods: In this study, a total of 60 soil samples were collected from the three islands of Greater Tunb, Abu Musa, and Sirri. The samples were analyzed for the presence of the keratinophilic fungi using a hair baiting technique. Furthermore, the identification of keratinophilic fungi was accomplished through the employment of molecular and sequencing techniques. Results: A total of 130 fungal isolates, including 11 genera with 24 species, were collected. Accordingly, Chrysosporium tropicum (24;18.5%, C. keratinophilum (17; 13.1%, Chrysosporium species (15; 11.5%, Aspergillus species ( 8;6.1%, Aspergillus flavus (8; 6.1%, Penicillium species (8;6.1%, Alternaria spp ( 6; 4.6%, Phoma species (5; 3.8%, Aphanoascus verrucosus (4;3.1%, Fusarium chlamydosporum (4; 3.1%, Aspergillus trreus (4;3.1%, Acremonium species (4; 3.1%, and other fungi( 23; 17.8 % isolates were identified . All isolates of keratinophilic fungi were isolated from the soils with the pH range of 7-9. Conclusion: The results of this study contributed towards a better conceptualization of the incidence pattern of keratinophilic fungi in the regions of Iran. Given that no study has investigated this issue, the findings of the present study can be beneficial for the management of public health surveillance, physicians, and epidemiologists.
MULLER, Ludo; Craciun, A. R.; RUYTINX, Joske; LAMBAERTS, Marc; Verbruggen, N.; VANGRONSVELD, Jaco; COLPAERT, Jan
2007-01-01
Complementary DNA (cDNA)-amplified fragment-length polymorphism (AFLP) was applied to analyze transcript profiles of a Zn-tolerant and a Zn-sensitive isolate of the ectomycorrhizal basidiomycete Suillus luteus, both cultured with and without increased external zinc concentrations. From the obtained transcript profiles that covered approximately 2% of the total expected complement of genes in S. luteus, 144 nonredundant, differentially expressed transcript-derived fragments (TDFs), falling in ...
The yeast flora of some decaying mushrooms on trunks of living trees
Middelhoven, W.J.
2004-01-01
Several ascomycetous and basidiomycetous yeasts were isolated from rotten mushrooms on the trunks of beech and tamarisk trees. One strain, identified as the novel species Cryptococcus allantoinivorans, assimilated allantoin as the sole carbon source. Phylogenetically it belongs to the C. laurentii complex, Papiliotrema bandonii being the closest relative. Some ascomycetous strains could not be distinguished from Pichia guillermondii, but deviated considerably in rDNA sequences. In addition to...
Directory of Open Access Journals (Sweden)
Eleni Gomes
2009-03-01
Full Text Available Wood rotting Basidiomycetes collected in the "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo State, Brazil, concerning Aphyllophorales order and identified as Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp SXS48, Picnoporus sanguineus SXS 43 and Phellinus rimosus SXS47 were tested for ligninases production by solid state fermentation (SSF using wheat bran or rice straw as culture media. C. byrsina produced the highest laccase (200 U mL-1 and Lentinus sp produced the highest activities of manganese peroxidase (MnP and lignin peroxidase (LiP (7 and 8 U mL-1, respectively, when cultivated on wheat bran. The effect of N addition on enzyme production was studied in medium containing rice straw and the data showed an increase of 3 up to 4-fold in the laccase production compared to that obtained in SSF on wheat bran. The laccases presented optimum pH at 3.0-3.5 and were stable at neutral pH values. Optimum pH for MnP and LiP activities was at 3.5 and between 4.5 and 6.0, respectively. All the strains produced laccase with optimum activities between 55-60°C while the peroxidases presented maximum activity at temperatures of 30 to 55°C. The crude enzymes promoted decolorization of chemically different dyes with around 70% of decolorization of RBBR and cybacron blue 3GA in 6h of treatment. The data indicated that enzymes from these basidiomycetes strains are able to decolorize synthetic dyes.Fungos decompositores de madeira, do grupo Basidiomicetes, coletados na "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo, Brasil, pertencentes a ordem Aphyllophorales e identificados como Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp. SXS48, Picnoporus sanguineus SXS 43 e Phellinus rimosus SXS47 foram estudados para a produção de ligninases por FES (fermentação em estado sólido usando farelo de trigo ou palha de arroz como meio de cultura. A espécie C
Microbial community analysis of field-grown soybeans with different nodulation phenotypes.
Ikeda, Seishi; Rallos, Lynn Esther E; Okubo, Takashi; Eda, Shima; Inaba, Shoko; Mitsui, Hisayuki; Minamisawa, Kiwamu
2008-09-01
Microorganisms associated with the stems and roots of nonnodulated (Nod(-)), wild-type nodulated (Nod(+)), and hypernodulated (Nod(++)) soybeans [Glycine max (L.) Merril] were analyzed by ribosomal intergenic transcribed spacer analysis (RISA) and automated RISA (ARISA). RISA of stem samples detected no bands specific to the nodulation phenotype, whereas RISA of root samples revealed differential bands for the nodulation phenotypes. Pseudomonas fluorescens was exclusively associated with Nod(+) soybean roots. Fusarium solani was stably associated with nodulated (Nod(+) and Nod(++)) roots and less abundant in Nod(-) soybeans, whereas the abundance of basidiomycetes was just the opposite. The phylogenetic analyses suggested that these basidiomycetous fungi might represent a root-associated group in the Auriculariales. Principal-component analysis of the ARISA results showed that there was no clear relationship between nodulation phenotype and bacterial community structure in the stem. In contrast, both the bacterial and fungal community structures in the roots were related to nodulation phenotype. The principal-component analysis further suggested that bacterial community structure in roots could be classified into three groups according to the nodulation phenotype (Nod(-), Nod(+), or Nod(++)). The analysis of root samples indicated that the microbial community in Nod(-) soybeans was more similar to that in Nod(++) soybeans than to that in Nod(+) soybeans.
Microbial Community Analysis of Field-Grown Soybeans with Different Nodulation Phenotypes▿
Ikeda, Seishi; Rallos, Lynn Esther E.; Okubo, Takashi; Eda, Shima; Inaba, Shoko; Mitsui, Hisayuki; Minamisawa, Kiwamu
2008-01-01
Microorganisms associated with the stems and roots of nonnodulated (Nod−), wild-type nodulated (Nod+), and hypernodulated (Nod++) soybeans [Glycine max (L.) Merril] were analyzed by ribosomal intergenic transcribed spacer analysis (RISA) and automated RISA (ARISA). RISA of stem samples detected no bands specific to the nodulation phenotype, whereas RISA of root samples revealed differential bands for the nodulation phenotypes. Pseudomonas fluorescens was exclusively associated with Nod+ soybean roots. Fusarium solani was stably associated with nodulated (Nod+ and Nod++) roots and less abundant in Nod− soybeans, whereas the abundance of basidiomycetes was just the opposite. The phylogenetic analyses suggested that these basidiomycetous fungi might represent a root-associated group in the Auriculariales. Principal-component analysis of the ARISA results showed that there was no clear relationship between nodulation phenotype and bacterial community structure in the stem. In contrast, both the bacterial and fungal community structures in the roots were related to nodulation phenotype. The principal-component analysis further suggested that bacterial community structure in roots could be classified into three groups according to the nodulation phenotype (Nod−, Nod+, or Nod++). The analysis of root samples indicated that the microbial community in Nod− soybeans was more similar to that in Nod++ soybeans than to that in Nod+ soybeans. PMID:18658280
The use of secondary metabolite profiling in chemotaxonomy of filamentous fungi
DEFF Research Database (Denmark)
Frisvad, Jens Christian; Andersen, Birgitte; Thrane, Ulf
2008-01-01
A secondary metabolite is a chemical compound produced by a limited number of fungal species in a genus, an order, or even phylum. A profile of secondary metabolites consists of all the different compounds a fungus can produce on a given substratum and includes toxins, antibiotics and other outwa......, Xylaria and in few basidiomycete genera, but not in Zygomycota and Chytridiomycota. (C) 2007 The British Mycological Society. Published by Elsevier Ltd. All rights reserved....
New phenyl-ethanediols from the culture broth of Boletus edulis.
Yang, Wan-Qiu; Qin, Xiang-Dong; Shao, Hong-Jun; Fang, Li-Zhen; Wang, Fei; Ding, Zhi-Hui; Dong, Ze-Jun; Liu, Ji-Kai
2007-04-01
A new phenyl-ethanediol, (1S)-(4-acetylphenyl)-1, 2-ethanediol (1), and a new natural product, (1S)-(3-ethenylphenyl)-1, 2-ethanediol (2), were isolated from the culture broth of the basidiomycete Boletus edulis together with three related known compounds, 1-(4-ethylphenyl)-1, 2-ethanediol (3), 1-(3-ethylphenyl)-1, 2-ethanediol (4) and 1-(3-formylphenyl)-ethanone (5). Their structures were elucidated by spectroscopic methods including extensive 2D-NMR techniques.
Rupcic, Zeljka; Rascher, Monique; Kanaki, Sae; Köster, Reinhard W.; Stadler, Marc; Wittstein, Kathrin
2018-01-01
Basidiomycetes of the genus Hericium are among the most praised medicinal and edible mushrooms, which are known to produce secondary metabolites with the potential to treat neurodegenerative diseases. This activity has been attributed to the discovery of various terpenoids that can stimulate the production of nerve growth factor (NGF) or (as established more recently) brain-derived neurotrophic factor (BDNF) in cell-based bioassays. The present study reports on the metabolite profiles of a Li...
The Mycoflora of Hot Spring Soil in Northern Taiwan
Directory of Open Access Journals (Sweden)
Kuei-Yu Chen
2003-09-01
Full Text Available An investigation of the mycoflora in northern Taiwan from August 1999 to June 2000, particularly of thermophilic and thermotolerant fungi inhabiting sulfurous hot spring soils, resulted in identification 12 taxa: Aspergillus fumigatus var. fumigatus (66.85 %, A. fumigatus var. 1 with green colony (7.86 %, A. fumigatus var. 2 with brown colony (4.81 %, A. niger (1.14 %, unidentified Asperigillus sp. (0.045 %, Chrysosporium sp. (0.18 %, Papulaspora thermophila (2.72 %, Scytalidium thermophilum (0.045 %, Sporotrichum sp. (0.045 %, Mycelia sterilia sp.1 with white colony (6.63 %, Mycelia sterilia sp.2 with yellow colony (5.27 % and Mycelia sterilia sp. 3 with gray colony (4.405 %. A total of 2202 colonies were isolated from three sampling sites: site 1 (hot springhead, site 2 (2 m from site 1 and site 3 (4 m from site 1. Fungal colonies isolated as well as species percentage at three sites were as follows: 32.92 % in 9 taxa from site 1, 37.87 % in 11 taxa from site 2, and 29.21 % in 8 taxa from site 3. The dominant species was Aspergillus fumigatus var. fumigatus, which was isolated year around from three sampling sites. A. fumigatus var. 1 appeared from February to June 2000. A. fumigatus var. 2 was isolated only in August and October 1999. Within the sampling range of hot spring niches, there was evidence of the presence of ecotypes in the A. fumigatus complex. Chrysosporium sp. and Sporotrichum sp. were isolated only from the soils without hot water treatment, but Aspergillus sp. and Scytalidium thermophilum were isolated only from the soils pre-treated with hot water for 30 min. at 60℃. The significance level (P value of fungal communities between hot water treatment and no treatment was 0.866, indicating that no significant difference between both treatments.
Interspecific interactions between wood-inhabiting basidiomycetes in boreal forests
Energy Technology Data Exchange (ETDEWEB)
Holmer, L.
1996-05-01
Studies of competition and succession in communities of wood-decomposing fungi were carried out using laboratory tests with different approaches. Based on results of these tests, an attempt to biologically control Heterobasidion annosum was made in field. Competitive interactions between six species of wood decay fungi were studied using a system of preinoculated wood blocks in unsterilized soil. Two of the species were root-rotting pathogens with a primary resource capture strategy, and four were primarily saprotrophic cord-forming species assumed to use secondary resource capture strategy. Of the species tested, Resinicium bicolor was the most successful in spreading through the soil, and it replaced other species, including the pathogens. When R. bicolor was absent other cord-forming species were able to expand their domain. A new system for measuring competitive success was developed. `Pie slices` were cut from round wood-discs, and after preinoculation, the pieces were paired in all possible combinations on water agar. In this way, inoculum size could be varied while the size of the contact area remained the same. Large mycelia had more competitive success than did smaller ones when paired with the same species. In a pilot study, R. bicolor was most successful in replacing the opposing species and H. annosum had the least success. In general, species found late in the succession were strong competitors, while earlier colonizers had less success. Species acting as selective replacers of primary decay species were found to be more competitive than the latter. 134 refs, 8 figs, 1 tab
Biologically Active Metabolites Produced by the Basidiomycete Quambalaria cyanescens
Czech Academy of Sciences Publication Activity Database
Stodůlková, Eva; Císařová, I.; Kolařík, Miroslav; Chudíčková, Milada; Novák, Petr; Man, Petr; Kuzma, Marek; Pavlů, B.; Černý, J.; Flieger, Miroslav
2015-01-01
Roč. 10, č. 2 (2015) E-ISSN 1932-6203 R&D Projects: GA ČR GA13-16565S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : ENDOPHYTIC FUNGUS * SP NOV * NAPHTHOQUINONE Subject RIV: EE - Microbiology, Virology Impact factor: 3.057, year: 2015
Rate Growth comparison of basidiomycetous fungi isolated in Mexico
International Nuclear Information System (INIS)
Rivera-Rios, J. M.; Cruz Ramirez, M. G.; Cruz Madrid, L. C.; Medina Moreno, S. A.; Tellez-Jurado, A.; Mercado-Flores, Y.; Arana-Cuenca, A.
2009-01-01
Huejutla de Reyes is a place with a warm-humid climate and counts on an annual average temperature of 30 degree centigrade. We collected fungi that growth in wood or trees with the purpose of isolation this lignionolytic fungi in two seasons (one is spring, before raining station and another one in autumn, during raining station). (Author)
Preservation of basidiomycete strains on perlite using different protocols
Czech Academy of Sciences Publication Activity Database
Eichlerová, Ivana; Homolka, Ladislav
2014-01-01
Roč. 55, č. 6 (2014), s. 439-448 ISSN 1340-3540 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Cryopreservation * Laccase * Liquid nitrogen Subject RIV: EE - Microbiology, Virology Impact factor: 1.418, year: 2014
Effects of some added carbohydrates on cellulases and ligninase and decomposition of whole bagasse
Energy Technology Data Exchange (ETDEWEB)
Nigam, P; Prabhu, K A
1986-01-01
Two basidiomycetes mould isolates were studied for the production of extracellular cellulases and ligninase in submerged shake culture using whole bagasse as substrate. The effects of some added carbohydrates on enzyme production, substrate decomposition and biomass formation were examined. In both cultures the addition of lactose stimulated biomass production and increased the decomposition of total carbohydrate and lignin contents of bagasse. Lactose was the only sugar which stimulated cellulase and ligninase in both cultures. 19 references.
Bioconcentration of manganese and iron in Panaeoloideae Sing
Stijve, T.; Blake, C.
1994-01-01
According to literature, the manganese content of most basidiomycetes fluctuates between 10 and 60 mg/kg, whereas the iron levels range from 100-500 mg/kg (both expressed on dry weight). The present authors report that bioconcentration of manganese is a distinguishing feature of the Panaeoloideae, as demonstrated by the analysis of 44 collections representing 15 taxons. Carpophores generally contain between 250 and 2500 mg/kg on dry weight, and, with the notable exception of Panaeolus semiova...
Suciatmih, Suciatmih
2001-01-01
In order to know the capability of lignin and cellulose degradation and phosphate solubilization by soil fungi of Gunung Halimun National Park, a study was carried out to qualitatively analyse its physiological properties. Out of 35 soil fungi tested, 1 species that belonged to Basidiomycetes degraded lignin, 32 species degraded cellulose, and 31 species dissolved inorganic phosphate.The presence of soil fungi that degraded cellulose and dissolved phosphate could be used as a candidate for bi...
Cultivation of shear stress sensitive microorganisms in disposable bag reactor systems.
Jonczyk, Patrick; Takenberg, Meike; Hartwig, Steffen; Beutel, Sascha; Berger, Ralf G; Scheper, Thomas
2013-09-20
Technical scale (≥5l) cultivations of shear stress sensitive microorganisms are often difficult to perform, as common bioreactors are usually designed to maximize the oxygen input into the culture medium. This is achieved by mechanical stirrers, causing high shear stress. Examples for shear stress sensitive microorganisms, for which no specific cultivation systems exist, are many anaerobic bacteria and fungi, such as basidiomycetes. In this work a disposable bag bioreactor developed for cultivation of mammalian cells was investigated to evaluate its potential to cultivate shear stress sensitive anaerobic Eubacterium ramulus and shear stress sensitive basidiomycetes Flammulina velutipes and Pleurotus sapidus. All cultivations were compared with conventional stainless steel stirred tank reactors (STR) cultivations. Good growth of all investigated microorganisms cultivated in the bag reactor was found. E. ramulus showed growth rates of μ=0.56 h⁻¹ (bag) and μ=0.53 h⁻¹ (STR). Differences concerning morphology, enzymatic activities and growth in fungal cultivations were observed. In the bag reactor growth in form of small, independent pellets was observed while STR cultivations showed intense aggregation. F. velutipes reached higher biomass concentrations (21.2 g l⁻¹ DCW vs. 16.8 g l⁻¹ DCW) and up to 2-fold higher peptidolytic activities in comparison to cell cultivation in stirred tank reactors. Copyright © 2013 Elsevier B.V. All rights reserved.
Bandoniozyma gen. nov., a genus of fermentative and non-fermentative tremellaceous yeast species.
Directory of Open Access Journals (Sweden)
Patricia Valente
Full Text Available BACKGROUND: Independent surveys across the globe led to the proposal of a new basidiomycetous yeast genus within the Bulleromyces clade of the Tremellales, Bandoniozyma gen. nov., with seven new species. METHODOLOGY/PRINCIPAL FINDINGS: The species were characterized by multiple methods, including the analysis of D1/D2 and ITS nucleotide sequences, and morphological and physiological/biochemical traits. Most species can ferment glucose, which is an unusual trait among basidiomycetous yeasts. CONCLUSIONS/SIGNIFICANCE: In this study we propose the new yeast genus Bandoniozyma, with seven species Bandoniozyma noutii sp. nov. (type species of genus; CBS 8364(T = DBVPG 4489(T, Bandoniozyma aquatica sp. nov. (UFMG-DH4.20(T = CBS 12527(T = ATCC MYA-4876(T, Bandoniozyma complexa sp. nov. (CBS 11570(T = ATCC MYA-4603(T = MA28a(T, Bandoniozyma fermentans sp. nov. (CBS 12399(T = NU7M71(T = BCRC 23267(T, Bandoniozyma glucofermentans sp. nov. (CBS 10381(T = NRRL Y-48076(T = ATCC MYA-4760(T = BG 02-7-15-015A-1-1(T, Bandoniozyma tunnelae sp. nov. (CBS 8024(T = DBVPG 7000(T, and Bandoniozyma visegradensis sp. nov. (CBS 12505(T = NRRL Y-48783(T = NCAIM Y.01952(T.
In memoriam Rudolf Arnold Maas Geesteranus Den Haag, 20 january 1911-Oegstgeest, 18 may 2003
NN
2003-01-01
On 18 May 2003 Rudolf Maas Geesteranus died peacefully at the age of 92. With him the mycological world has lost a remarkable and versatile personality, who worked on the taxonomy of fungi for almost 60 years producing papers and books on a wide range of topics, including both asco- and basidiomycetes. The bibliographical notes and publication list printed in this journal on his retirement from active service at the Rijksherbarium in 1976, and on his eightieth birthday in 1991 (Bas, Persoonia...
DEFF Research Database (Denmark)
Hennessy, Rosanna Catherine; Phippen, Christopher; Nielsen, Kristian F.
Pseudomonas spp. are a rich source of secondary metabolites including bioactive non-ribosomal peptides (NRPs) and polyketides. NRPs are synthesised in large assembly lines by multi-domain modular enzymes known as NRP-synthetases (NRPS). Nunamycin and nunapeptin are two cyclic NRPs synthesised...... by the Greenlandic isolate P. fluorescens In5. Nunamycin shows antifungal activity against the basidiomycete Rhizoctonia solani whereas the only partially structure elucidated nunapeptin appears most active against the ascomycete Fusarium graminearum and the oomycete Pythium aphanidermatum. Originally isolated from...
Overproduction of ligninolytic enzymes
Elisashvili, Vladimir; Kachlishvili, Eva; Torok, Tamas
2014-06-17
Methods, compositions, and systems for overproducing ligninolytic enzymes from the basidiomycetous fungus are described herein. As described, the method can include incubating a fungal strain of Cerrena unicolor IBB 303 in a fermentation system having growth medium which includes lignocellulosic material and then cultivating the fungal strain in the fermentation system under conditions wherein the fungus expresses the ligninolytic enzymes. In some cases, the lignocellulosic material is mandarin peel, ethanol production residue, walnut pericarp, wheat bran, wheat straw, or banana peel.
Fungal cellulases as an aid for the saccharification of cassava
Energy Technology Data Exchange (ETDEWEB)
De Menezes, T J.B.; Arakaki, T; DeLamo, P R; Sales, A M
1978-04-01
Culture broths of cellulolytic fungi were used together with commercial anylases to enhance the saccharification of cassava starch slurry. It was found that the addition of appropriate concentration of the cellulases Trichoderma viride and a soil isolated Basidiomycete, increased both the rate of sugar formation and the degree of solubilization, and decreased the viscosity of the hydrolyzates. Owing to the improvement of the rheological properties of the must, and the additional sugar produced, an increased ethanol yield would be expected from the alcoholic fermentation of this hydrolyzate.
Biology stage of Moniliophthora roreri in Colombia
Correa Álvarez, Javier; Castro Martínez, Sergio; Coy, Jairo
2014-01-01
La moniliasis es una enfermedad fúngica que ataca el cultivo de cacao, causada por el basidiomycete Moniliophthora roreri -- Está presente en la mayoría de los países latinoamericanos y se adapta a diversidad de ambientes -- En Colombia la enfermedad es devastadora y las estrategias de control tradicional han generado resultados colaterales como el fortalecimiento de la resistencia genética de cepas del hongo en algunas regiones -- En esta revisión, se recopilan los aspectos biológicos y agro...
Hydrolysis of residuals of barley straw using white-rot basidiomycetes
International Nuclear Information System (INIS)
Lazaro-Anell, A. C.; Arana-Cuenca, A.; Tellez-Jurado, A.
2009-01-01
The imminent term of the fossil fuels has generated different initiatives focused to the development of a alternative fuels in the entire world, one of the main alternatives for the bio combustible production is the agricultural waste, all they have as main characteristic those of being compound for 3 biopolymers that represent, one of the biggest renewable sources of energy. (Author)
Indole compounds in some culinary-medicinal higher basidiomycetes from Poland.
Muszynska, Bozena; Sutkowska-Ziaja, Katarzyna; Ekiert, Halina
2011-01-01
Methanolic extracts of two species collected from natural habitats in Poland, Boletus edulis and Suillus luteus, and one species from a commercial source, Pleurotus ostreatus, were analyzed for the presence of non-hallucinogenic indole compounds. The contents of indole compounds in these species were both qualitatively and quantitatively diverse, ranging from 0.01 to 34.11 mg/100 g d.w. Two of 11 tested indole compounds, 5-hydroxytryptophan (0.18, 2.08, 1.63 mg/100 g d.w.) and serotonin (6.52, 10.14, 34.11 mg/100 g d.w.), were present in all three species under study. B. edulis and S. luteus were found to contain L-tryptophan (0.39 and 2.61 mg/100g d.w.) and melatonin (0.68 and 0.71 mg/100 g d.w.). Tryptamine was present in two species, i.e., B. edulis (1.17 mg/100 g d.w.) and in P. ostreatus (0.91 mg/100 g d.w.), in which slight amounts of indole acetonitrile (0.04 and 0.01 mg/100 g d.w., respectively) were also identified. Indoleacetic acid was a common metabolite for P. ostreatus and S. luteus and its contents amounted to 0.21 and 0.04 mg/100 g d.w., respectively. Indole compounds degradation products kynurenic acid (2.63 mg/100 g d.w.) and kynurenine sulfate were (19.57 mg/100 g d.w.) were observed only in S. luteus.
Decolorization of synthetic dyes and textile effluents by basidiomycetous fungi
Digital Repository Service at National Institute of Oceanography (India)
Diwaniyan, S.; Kharb, D.; Raghukumar, C.; Kuhad, R.C.
of their ability to degrade xenobiotic compounds. Owing to extra- cellular non-specific free-radical-based ligninolytic system of WRF, they can completely eliminate a variety of xenobiotics, including synthetic dyes, giving rise to non-toxic compounds (Kuhad et al... and decolorization and ligninolytic enzymes activity was determined in the cell-free supernatant (CS). 2.5 Decolorization Assays The fungal biomass from each 250-ml Erlenmeyer flask was taken after respective incubation period. It was crushed into a paste...
Growth of the mycelium of different basidiomycetes on various media
International Nuclear Information System (INIS)
Nasreen, Z.; Kausar, T.; Baig, S.; Bajwa, R.
2008-01-01
Potato dextrose extract as solid or liquid static media was found best medium tested for both rate and amount of fungal growth of Pleurotus ostreatus, Ganoderma lucidum, Coriolus versicolor and Schizophyllum commune strains. Malt, Yeast and kirk + glucose making second and third respectively, for rate and amount of fungal growth. Kirk+ molasses was the fourth best medium. Addition of sucrose, glucose and molasses as carbon sources, increased the mycelial growth in each fungal species. Similarly, the Highest fresh and dry weight in submerged fermentation was observed for P.ostreatus, G.lucidum. C.versicolor and S.commune in sucrose and glucose as compared to molasses media. (author)
Gram-scale production of a basidiomycetous laccase in Aspergillus niger.
Mekmouche, Yasmina; Zhou, Simeng; Cusano, Angela M; Record, Eric; Lomascolo, Anne; Robert, Viviane; Simaan, A Jalila; Rousselot-Pailley, Pierre; Ullah, Sana; Chaspoul, Florence; Tron, Thierry
2014-01-01
We report on the expression in Aspergillus niger of a laccase gene we used to produce variants in Saccharomyces cerevisiae. Grams of recombinant enzyme can be easily obtained. This highlights the potential of combining this generic laccase sequence to the yeast and fungal expression systems for large-scale productions of variants. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Voigt, K; Wöstemeyer, J
2001-05-30
True fungi (Eumycota) are heterotrophic eukaryotic microorganisms encompassing ascomycetes, basidiomycetes, chytridiomycetes and zygomycetes. The natural systematics of the latter group, Zygomycota, are very poorly understood due to the lack of distinguishing morphological characters. We have determined sequences for the nuclear-encoded genes actin (act) from 82 zygomycetes representing all 54 currently recognized genera from the two zygomycetous orders Mucorales and Mortierellales. We also determined sequences for translation elongation factor EF-1alpha (tef) from 16 zygomycetes (total of 96,837 bp). Phylogenetic analysis in the context of available sequence data (total 2,062 nucleotide positions per species) revealed that current classification schemes for the mucoralean fungi are highly unnatural at the family and, to a large extent, at the genus level. The data clearly indicate a deep, ancient and distinct dichotomy of the orders Mucorales and Mortierellales, which are recognized only in some zygomycete systems. Yet at the same time the data show that two genera - Umbelopsis and Micromucor - previously placed within the Mortierellales on the basis of their weakly developed columella (a morphological structure of the sporangiophore well-developed within all Mucorales) are in fact members of the Mucorales. Phylogenetic analyses of the encoded amino acid sequences in the context of homologues from eukaryotes and archaebacterial outgroups indicate that the Eumycota studied here are a natural group but provide little or no support for the monophyly of either zygomycetes, ascomycetes or basidiomycetes. The data clearly indicate that a complete revision of zygomycete natural systematics is necessary.
Itoh, Nobuya; Takagi, Shinya; Miki, Asami; Kurokawa, Junji
2016-01-01
Epitheaflagallin 3-O-gallate (ETFGg) is a minor polyphenol found in black tea extract, which has good physiological functions. It is synthesized from epigallocatechin gallate (EGCg) with gallic acid via laccase oxidation. Various basidiomycetes and fungi were screened to find a suitable laccase for the production of ETFGg. A basidiomycete, Hericium coralloides NBRC 7716, produced an appropriate extracellular laccase. The purified laccase produced twice the level of ETFGg compared with commercially available laccase from Trametes sp. The enzyme, termed Lcc2, is a monomeric protein with an apparent molecular mass of 67.2 kDa. The N-terminal amino acid sequence of Lcc2 is quite different from laccase isolated from the fruiting bodies of Hericium. Lcc2 showed similar substrate specificity to known laccases and could oxidize various phenolic substrates, including pyrogallol, gallic acid, and 2,6-dimethoxyphenol. The full-length lcc2 gene was obtained by PCR using degenerate primers, which were designed based on the N-terminal amino acid sequence of Lcc2 and conserved copper-binding sites of laccases, and 5'-, and 3'-RACE PCR with mRNA. The Lcc2 gene showed homology with Lentinula edodes laccase (sharing 77% amino acid identity with Lcc6). We successfully produced extracellular Lcc2 using a heterologous expression system with Saccharomyces cerevisiae. Moreover, it was confirmed that the recombinant laccase generates similar levels of ETFGg as the native enzyme. Copyright © 2015 Elsevier Inc. All rights reserved.
Application of Chinese Jun-Cao technique for the production of Brazilian Ganoderma lucidum strains
Directory of Open Access Journals (Sweden)
Leonardo do Nascimento Rolim
2014-06-01
Full Text Available Ganoderma lucidum is a medicinal mushroom traditionally used in China against a wide range of diseases such as cancer and also for its prevention. In this work, commercial Chinese strains G. lucidum were compared to wild Brazilian strains aiming to determine the cultivation potential through the use of Jun-Cao. Six formulations were tested and the strains presented good response to the applied method. In general, the mixture between the grass and wood was well suited for the basidiomycetes, contributing to the preparation of substrates that generated better results in Jun Cao.
Directory of Open Access Journals (Sweden)
A. P. Kiecksee
2012-08-01
Full Text Available Agaricomycetes are major components of extant terrestrial ecosystems; however, their fruiting bodies are exceedingly rare as fossils. Reinvestigation of a peculiar fossil from Late Triassic sediments of southern Germany interpreted as a bracket fungus revealed that this fossil in fact represents a wood abnormality, resulting from injury to the cambium and subsequent callus growth in a Baieroxylon -like ginkgoalean wood. As a result, the fossil record of the Agaricomycetes does not yet pre-date the Early Cretaceous, suggesting a late diversification of basidiomycetes possessing large fruiting bodies. doi:10.1002/mmng.201200006
Zapata, Paula; Rojas, Diego; Fernández, Carlos; Ramírez, David; Restrepo, Gloria; Orjuela, Viviana; Arroyave, Marcela; Gómez, Tatiana; Atehortüa, Lucía
2007-01-01
Grifóla frondosa es un hongo Basidiomycete comestible y medicinal que produce polisacáridos tipo glucanos (β-1,6 y β-1,3) con actividad antitumoral e inmunomoduladora. Para el presente trabajo, el objetivo fue evaluar la incidencia de diferentes fuentes de carbono (FC) en la producción de biomasa y exopolisacári-dos (EPS), bajo condiciones de cultivo sumergido, utilizando un diseño estadístico factorial con dos factores: fuente de carbono (FC(1-7)) y medio (MB y MS). La máxima produ...
Estado de la moniliasis del cacao causada por moniliophthora roreri en colombia
Correa Alvarez, Javier; Castro Martínez, Sergio; Coy, Jairo
2014-01-01
La Moniliasis es una enfermedad fúngica que ataca el cultivo de cacao, causada por el basidiomycete Mo-niliophthora roreri. Está presente en la mayoría de los países latinoamericanos y se adapta a diversidad de ambientes. En Colombia la enfermedad es devastadora y las estrategias de control tradicional han generado resultados colaterales como el fortalecimiento de la resistencia genética de cepas del hongo en algunas regiones. En esta revisión, se recopilan los aspectos biológicos y agronó...
Biological pretreatment and ethanol production from olive cake
DEFF Research Database (Denmark)
Jurado, Esperanza; Gavala, Hariklia N.; Baroi, George Nabin
2010-01-01
Olive oil is one of the major Mediterranean products, whose nutritional and economic importance is well-known. However the extraction of olive oil yields a highly contaminating residue that causes serious environmental concerns in the olive oil producing countries. The olive cake (OC) coming out...... of the three-phase olive oil production process could be used as low price feedstock for lignocellulosic ethanol production due to its high concentration in carbohydrates. However, the binding of the carbohydrates with lignin may significantly hinder the necessary enzymatic hydrolysis of the polymeric sugars...... before ethanol fermentation. Treatment with three white rot fungi, Phaneroachaete chrysosporium, Ceriporiopsis subvermispora and Ceriolopsis polyzona has been applied on olive cake in order to investigate the potential for performing delignification and thus enhancing the efficiency of the subsequent...
Microbial degradation of coconut coir dust for biomass production
Energy Technology Data Exchange (ETDEWEB)
Uyenco, F.R.; Ochoa, J.A.K.
Several species of white-rot fungi were studied for its ability to degrade the lignocellulose components of coir dust at optimum conditions. The most effective fungi was Phanerochaeta chrysosporium UPCC 4003. This organism degraded the lignocellulose complex of coir dust at a rate of about 25 percent in 4 weeks. The degradation process was carried on with minimal nitrogen concentration, coconut water supplementation and moisture levels between 85-90 percent. Shake flask cultures of the degraded coir dust using cellulolytic fungi were not effective. In fermentor cultures with Chaetomium cellulolyticum UPCC 3934, supplemented coir dust was converted into a microbial biomass product (MBP) with 15.58 percent lignin, 19.20 percent cellulose and 18.87 percent protein. More work is being done on the utilization of coir dust on a low technology.
Microbiological analysis of a mummy from the archeological museum in Zagreb.
Cavka, Mislav; Glasnović, Anton; Janković, Ivor; Sikanjić, Petra Rajić; Perić, Berislav; Brkljacić, Boris; Mlinarić-Missoni, Emilija; Skrlin, Jasenka
2010-09-01
In this paper we report the results of the microbiological analysis of the samples taken from the mummy from the collection of the Archaeological museum in Zagreb, Croatia. Samples were taken from specific places such as oral, orbital, abdominal cavity and bandages surrounding the mummy, and analyzed in Department of Microbiology and Hospital Infections in University Hospital "Dubrava" in Zagreb and in National Reference Laboratory for systemic mycoses of Croatian National Institute of Public Health in Zagreb. The analysis indicated that all of the found organisms were non-primary pathogenic and are not harmful for healthy humans. Isolated microorganisms mainly belonged to the group of saprophytic fungi as listed: Monilia spp., Penicillium spp., Alternaria spp., Aspergillus fumigatus, Aspergillus nidulans, Rhizopus spp. and Chrysosporium spp. and to the genus of saprophytic bacteria, Bacillus spp.
Auriculariopsis albomellea (Agaricales, Schizophyllaceae new for Poland
Directory of Open Access Journals (Sweden)
Władysław Wojewoda
2013-12-01
Full Text Available The article deals with the taxonomy, ecology, general distribution and threatened status of Auriculariopsis albomellea Bondartsev Kotl. (Basidiomycetes. In Europe it is known only from Czech Republic, France, Sweden and Ukraine, in Africa from Canary Islands, in North America from Canada and United States. In Poland the fungus was found for the first time in NE part of the country, in a pine forest, on dead twigs of Pinus sylvestris. Habitat and distribution of this saprobic fungus in Africa, Europe and North America are described, list of synonyms and important references are cited, Polish name is proposed.
Applied modern biotechnology for cultivation of Ganoderma and development of their products.
Zhou, Xuan-Wei; Su, Kai-Qi; Zhang, Yong-Ming
2012-02-01
A white-rot basidiomycete Ganoderma spp. has long been used as a medicinal mushroom in Asia, and it has an array of pharmacological properties for immunomodulatory activity. There have been many reports about the bioactive components and their pharmacological properties. In order to analyze the current status of Ganoderma products, the detailed process of cultivation of Ganoderma spp. and development of their products are restated in this review article. These include the breeding, cultivating, extracting bioactive component, and processing Ganoderma products, etc. This article will expand people's common knowledge on Ganoderma, and provide a beneficial reference for research and industrial production.