Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.
Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M
1997-01-01
RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620
Identification of coupling DNA motif pairs on long-range chromatin interactions in human K562 cells
Wong, Ka-Chun; Li, Yue; Peng, Chengbin
2015-01-01
Motivation: The protein-DNA interactions between transcription factors (TFs) and transcription factor binding sites (TFBSs, also known as DNA motifs) are critical activities in gene transcription. The identification of the DNA motifs is a vital task for downstream analysis. Unfortunately, the long-range coupling information between different DNA motifs is still lacking. To fill the void, as the first-of-its-kind study, we have identified the coupling DNA motif pairs on long-range chromatin interactions in human. Results: The coupling DNA motif pairs exhibit substantially higher DNase accessibility than the background sequences. Half of the DNA motifs involved are matched to the existing motif databases, although nearly all of them are enriched with at least one gene ontology term. Their motif instances are also found statistically enriched on the promoter and enhancer regions. Especially, we introduce a novel measurement called motif pairing multiplicity which is defined as the number of motifs that are paired with a given motif on chromatin interactions. Interestingly, we observe that motif pairing multiplicity is linked to several characteristics such as regulatory region type, motif sequence degeneracy, DNase accessibility and pairing genomic distance. Taken into account together, we believe the coupling DNA motif pairs identified in this study can shed lights on the gene transcription mechanism under long-range chromatin interactions. © The Author 2015. Published by Oxford University Press.
Identification of coupling DNA motif pairs on long-range chromatin interactions in human K562 cells
Wong, Ka-Chun
2015-09-27
Motivation: The protein-DNA interactions between transcription factors (TFs) and transcription factor binding sites (TFBSs, also known as DNA motifs) are critical activities in gene transcription. The identification of the DNA motifs is a vital task for downstream analysis. Unfortunately, the long-range coupling information between different DNA motifs is still lacking. To fill the void, as the first-of-its-kind study, we have identified the coupling DNA motif pairs on long-range chromatin interactions in human. Results: The coupling DNA motif pairs exhibit substantially higher DNase accessibility than the background sequences. Half of the DNA motifs involved are matched to the existing motif databases, although nearly all of them are enriched with at least one gene ontology term. Their motif instances are also found statistically enriched on the promoter and enhancer regions. Especially, we introduce a novel measurement called motif pairing multiplicity which is defined as the number of motifs that are paired with a given motif on chromatin interactions. Interestingly, we observe that motif pairing multiplicity is linked to several characteristics such as regulatory region type, motif sequence degeneracy, DNase accessibility and pairing genomic distance. Taken into account together, we believe the coupling DNA motif pairs identified in this study can shed lights on the gene transcription mechanism under long-range chromatin interactions. © The Author 2015. Published by Oxford University Press.
Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.
Directory of Open Access Journals (Sweden)
Michael F Sloma
2017-11-01
Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.
Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.
Sloma, Michael F; Mathews, David H
2017-11-01
Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.
Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs
Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.
2011-01-01
We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.
Non-Watson Crick base pairs might stabilize RNA structural motifs in ...
Indian Academy of Sciences (India)
Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...
Sequence-specific high mobility group box factors recognize 10-12-base pair minor groove motifs
DEFF Research Database (Denmark)
van Beest, M; Dooijes, D; van De Wetering, M
2000-01-01
Sequence-specific high mobility group (HMG) box factors bind and bend DNA via interactions in the minor groove. Three-dimensional NMR analyses have provided the structural basis for this interaction. The cognate HMG domain DNA motif is generally believed to span 6-8 bases. However, alignment...
Automated classification of RNA 3D motifs and the RNA 3D Motif Atlas
Petrov, Anton I.; Zirbel, Craig L.; Leontis, Neocles B.
2013-01-01
The analysis of atomic-resolution RNA three-dimensional (3D) structures reveals that many internal and hairpin loops are modular, recurrent, and structured by conserved non-Watson–Crick base pairs. Structurally similar loops define RNA 3D motifs that are conserved in homologous RNA molecules, but can also occur at nonhomologous sites in diverse RNAs, and which often vary in sequence. To further our understanding of RNA motif structure and sequence variability and to provide a useful resource for structure modeling and prediction, we present a new method for automated classification of internal and hairpin loop RNA 3D motifs and a new online database called the RNA 3D Motif Atlas. To classify the motif instances, a representative set of internal and hairpin loops is automatically extracted from a nonredundant list of RNA-containing PDB files. Their structures are compared geometrically, all-against-all, using the FR3D program suite. The loops are clustered into motif groups, taking into account geometric similarity and structural annotations and making allowance for a variable number of bulged bases. The automated procedure that we have implemented identifies all hairpin and internal loop motifs previously described in the literature. All motif instances and motif groups are assigned unique and stable identifiers and are made available in the RNA 3D Motif Atlas (http://rna.bgsu.edu/motifs), which is automatically updated every four weeks. The RNA 3D Motif Atlas provides an interactive user interface for exploring motif diversity and tools for programmatic data access. PMID:23970545
Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences
König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.
2013-01-01
G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141
Motif statistics and spike correlations in neuronal networks
International Nuclear Information System (INIS)
Hu, Yu; Shea-Brown, Eric; Trousdale, James; Josić, Krešimir
2013-01-01
Motifs are patterns of subgraphs of complex networks. We studied the impact of such patterns of connectivity on the level of correlated, or synchronized, spiking activity among pairs of cells in a recurrent network of integrate and fire neurons. For a range of network architectures, we find that the pairwise correlation coefficients, averaged across the network, can be closely approximated using only three statistics of network connectivity. These are the overall network connection probability and the frequencies of two second order motifs: diverging motifs, in which one cell provides input to two others, and chain motifs, in which two cells are connected via a third intermediary cell. Specifically, the prevalence of diverging and chain motifs tends to increase correlation. Our method is based on linear response theory, which enables us to express spiking statistics using linear algebra, and a resumming technique, which extrapolates from second order motifs to predict the overall effect of coupling on network correlation. Our motif-based results seek to isolate the effect of network architecture perturbatively from a known network state. (paper)
Motifs in triadic random graphs based on Steiner triple systems
Winkler, Marco; Reichardt, Jörg
2013-08-01
Conventionally, pairwise relationships between nodes are considered to be the fundamental building blocks of complex networks. However, over the last decade, the overabundance of certain subnetwork patterns, i.e., the so-called motifs, has attracted much attention. It has been hypothesized that these motifs, instead of links, serve as the building blocks of network structures. Although the relation between a network's topology and the general properties of the system, such as its function, its robustness against perturbations, or its efficiency in spreading information, is the central theme of network science, there is still a lack of sound generative models needed for testing the functional role of subgraph motifs. Our work aims to overcome this limitation. We employ the framework of exponential random graph models (ERGMs) to define models based on triadic substructures. The fact that only a small portion of triads can actually be set independently poses a challenge for the formulation of such models. To overcome this obstacle, we use Steiner triple systems (STSs). These are partitions of sets of nodes into pair-disjoint triads, which thus can be specified independently. Combining the concepts of ERGMs and STSs, we suggest generative models capable of generating ensembles of networks with nontrivial triadic Z-score profiles. Further, we discover inevitable correlations between the abundance of triad patterns, which occur solely for statistical reasons and need to be taken into account when discussing the functional implications of motif statistics. Moreover, we calculate the degree distributions of our triadic random graphs analytically.
Chawla, Mohit
2015-06-27
Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.
Chawla, Mohit; Oliva, R.; Bujnicki, J. M.; Cavallo, Luigi
2015-01-01
Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.
Mechanisms of zero-lag synchronization in cortical motifs.
Directory of Open Access Journals (Sweden)
Leonardo L Gollo
2014-04-01
Full Text Available Zero-lag synchronization between distant cortical areas has been observed in a diversity of experimental data sets and between many different regions of the brain. Several computational mechanisms have been proposed to account for such isochronous synchronization in the presence of long conduction delays: Of these, the phenomenon of "dynamical relaying"--a mechanism that relies on a specific network motif--has proven to be the most robust with respect to parameter mismatch and system noise. Surprisingly, despite a contrary belief in the community, the common driving motif is an unreliable means of establishing zero-lag synchrony. Although dynamical relaying has been validated in empirical and computational studies, the deeper dynamical mechanisms and comparison to dynamics on other motifs is lacking. By systematically comparing synchronization on a variety of small motifs, we establish that the presence of a single reciprocally connected pair--a "resonance pair"--plays a crucial role in disambiguating those motifs that foster zero-lag synchrony in the presence of conduction delays (such as dynamical relaying from those that do not (such as the common driving triad. Remarkably, minor structural changes to the common driving motif that incorporate a reciprocal pair recover robust zero-lag synchrony. The findings are observed in computational models of spiking neurons, populations of spiking neurons and neural mass models, and arise whether the oscillatory systems are periodic, chaotic, noise-free or driven by stochastic inputs. The influence of the resonance pair is also robust to parameter mismatch and asymmetrical time delays amongst the elements of the motif. We call this manner of facilitating zero-lag synchrony resonance-induced synchronization, outline the conditions for its occurrence, and propose that it may be a general mechanism to promote zero-lag synchrony in the brain.
Chawla, Mohit
2013-10-10
The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).
Gao, J.; Berden, G.; Rodgers, M.T.; Oomens, J.
2016-01-01
The Watson-Crick structure of DNA is among the most well-known molecular structures of our time. However, alternative base-pairing motifs are also known to occur, often depending on base sequence, pH, or the presence of cations. Pairing of cytosine (C) bases induced by the sharing of a single proton
Leucine-based receptor sorting motifs are dependent on the spacing relative to the plasma membrane
DEFF Research Database (Denmark)
Geisler, C; Dietrich, J; Nielsen, B L
1998-01-01
Many integral membrane proteins contain leucine-based motifs within their cytoplasmic domains that mediate internalization and intracellular sorting. Two types of leucine-based motifs have been identified. One type is dependent on phosphorylation, whereas the other type, which includes an acidic...... amino acid, is constitutively active. In this study, we have investigated how the spacing relative to the plasma membrane affects the function of both types of leucine-based motifs. For phosphorylation-dependent leucine-based motifs, a minimal spacing of 7 residues between the plasma membrane...... and the phospho-acceptor was required for phosphorylation and thereby activation of the motifs. For constitutively active leucine-based motifs, a minimal spacing of 6 residues between the plasma membrane and the acidic residue was required for optimal activity of the motifs. In addition, we found that the acidic...
BayesMotif: de novo protein sorting motif discovery from impure datasets.
Hu, Jianjun; Zhang, Fan
2010-01-18
Protein sorting is the process that newly synthesized proteins are transported to their target locations within or outside of the cell. This process is precisely regulated by protein sorting signals in different forms. A major category of sorting signals are amino acid sub-sequences usually located at the N-terminals or C-terminals of protein sequences. Genome-wide experimental identification of protein sorting signals is extremely time-consuming and costly. Effective computational algorithms for de novo discovery of protein sorting signals is needed to improve the understanding of protein sorting mechanisms. We formulated the protein sorting motif discovery problem as a classification problem and proposed a Bayesian classifier based algorithm (BayesMotif) for de novo identification of a common type of protein sorting motifs in which a highly conserved anchor is present along with a less conserved motif regions. A false positive removal procedure is developed to iteratively remove sequences that are unlikely to contain true motifs so that the algorithm can identify motifs from impure input sequences. Experiments on both implanted motif datasets and real-world datasets showed that the enhanced BayesMotif algorithm can identify anchored sorting motifs from pure or impure protein sequence dataset. It also shows that the false positive removal procedure can help to identify true motifs even when there is only 20% of the input sequences containing true motif instances. We proposed BayesMotif, a novel Bayesian classification based algorithm for de novo discovery of a special category of anchored protein sorting motifs from impure datasets. Compared to conventional motif discovery algorithms such as MEME, our algorithm can find less-conserved motifs with short highly conserved anchors. Our algorithm also has the advantage of easy incorporation of additional meta-sequence features such as hydrophobicity or charge of the motifs which may help to overcome the limitations of
URS DataBase: universe of RNA structures and their motifs.
Baulin, Eugene; Yacovlev, Victor; Khachko, Denis; Spirin, Sergei; Roytberg, Mikhail
2016-01-01
The Universe of RNA Structures DataBase (URSDB) stores information obtained from all RNA-containing PDB entries (2935 entries in October 2015). The content of the database is updated regularly. The database consists of 51 tables containing indexed data on various elements of the RNA structures. The database provides a web interface allowing user to select a subset of structures with desired features and to obtain various statistical data for a selected subset of structures or for all structures. In particular, one can easily obtain statistics on geometric parameters of base pairs, on structural motifs (stems, loops, etc.) or on different types of pseudoknots. The user can also view and get information on an individual structure or its selected parts, e.g. RNA-protein hydrogen bonds. URSDB employs a new original definition of loops in RNA structures. That definition fits both pseudoknot-free and pseudoknotted secondary structures and coincides with the classical definition in case of pseudoknot-free structures. To our knowledge, URSDB is the first database supporting searches based on topological classification of pseudoknots and on extended loop classification.Database URL: http://server3.lpm.org.ru/urs/. © The Author(s) 2016. Published by Oxford University Press.
Computational analyses of synergism in small molecular network motifs.
Directory of Open Access Journals (Sweden)
Yili Zhang
2014-03-01
Full Text Available Cellular functions and responses to stimuli are controlled by complex regulatory networks that comprise a large diversity of molecular components and their interactions. However, achieving an intuitive understanding of the dynamical properties and responses to stimuli of these networks is hampered by their large scale and complexity. To address this issue, analyses of regulatory networks often focus on reduced models that depict distinct, reoccurring connectivity patterns referred to as motifs. Previous modeling studies have begun to characterize the dynamics of small motifs, and to describe ways in which variations in parameters affect their responses to stimuli. The present study investigates how variations in pairs of parameters affect responses in a series of ten common network motifs, identifying concurrent variations that act synergistically (or antagonistically to alter the responses of the motifs to stimuli. Synergism (or antagonism was quantified using degrees of nonlinear blending and additive synergism. Simulations identified concurrent variations that maximized synergism, and examined the ways in which it was affected by stimulus protocols and the architecture of a motif. Only a subset of architectures exhibited synergism following paired changes in parameters. The approach was then applied to a model describing interlocked feedback loops governing the synthesis of the CREB1 and CREB2 transcription factors. The effects of motifs on synergism for this biologically realistic model were consistent with those for the abstract models of single motifs. These results have implications for the rational design of combination drug therapies with the potential for synergistic interactions.
Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.
Takezawa, Yusuke; Shionoya, Mitsuhiko
2012-12-18
With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional
Report on Pairing-based Cryptography.
Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily
2015-01-01
This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.
Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix
Phan, Anh Tuân; Mergny, Jean-Louis
2002-01-01
Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451
Efficient sequential and parallel algorithms for finding edit distance based motifs.
Pal, Soumitra; Xiao, Peng; Rajasekaran, Sanguthevar
2016-08-18
Motif search is an important step in extracting meaningful patterns from biological data. The general problem of motif search is intractable and there is a pressing need to develop efficient, exact and approximation algorithms to solve this problem. In this paper, we present several novel, exact, sequential and parallel algorithms for solving the (l,d) Edit-distance-based Motif Search (EMS) problem: given two integers l,d and n biological strings, find all strings of length l that appear in each input string with atmost d errors of types substitution, insertion and deletion. One popular technique to solve the problem is to explore for each input string the set of all possible l-mers that belong to the d-neighborhood of any substring of the input string and output those which are common for all input strings. We introduce a novel and provably efficient neighborhood exploration technique. We show that it is enough to consider the candidates in neighborhood which are at a distance exactly d. We compactly represent these candidate motifs using wildcard characters and efficiently explore them with very few repetitions. Our sequential algorithm uses a trie based data structure to efficiently store and sort the candidate motifs. Our parallel algorithm in a multi-core shared memory setting uses arrays for storing and a novel modification of radix-sort for sorting the candidate motifs. The algorithms for EMS are customarily evaluated on several challenging instances such as (8,1), (12,2), (16,3), (20,4), and so on. The best previously known algorithm, EMS1, is sequential and in estimated 3 days solves up to instance (16,3). Our sequential algorithms are more than 20 times faster on (16,3). On other hard instances such as (9,2), (11,3), (13,4), our algorithms are much faster. Our parallel algorithm has more than 600 % scaling performance while using 16 threads. Our algorithms have pushed up the state-of-the-art of EMS solvers and we believe that the techniques introduced in
STUDYING THE INFLUENCE OF THE PYRENE INTERCALATOR TINA ON THE STABILITY OF DNA i-MOTIFS
DEFF Research Database (Denmark)
El-Sayed, Ahmed A.; Pedersen, Erik Bjerregaard; Khaireldin, Nahid A.
2012-01-01
Certain cytosine-rich (C-rich) DNA sequences can fold into secondary structures as four-stranded i-motifs with hemiprotonated base pairs. Here we synthesized C-rich TINA-intercalating oligonucleotides by inserting a nonnucleotide pyrene moiety between two C-rich regions. The stability of their i-...
MotifMark: Finding regulatory motifs in DNA sequences.
Hassanzadeh, Hamid Reza; Kolhe, Pushkar; Isbell, Charles L; Wang, May D
2017-07-01
The interaction between proteins and DNA is a key driving force in a significant number of biological processes such as transcriptional regulation, repair, recombination, splicing, and DNA modification. The identification of DNA-binding sites and the specificity of target proteins in binding to these regions are two important steps in understanding the mechanisms of these biological activities. A number of high-throughput technologies have recently emerged that try to quantify the affinity between proteins and DNA motifs. Despite their success, these technologies have their own limitations and fall short in precise characterization of motifs, and as a result, require further downstream analysis to extract useful and interpretable information from a haystack of noisy and inaccurate data. Here we propose MotifMark, a new algorithm based on graph theory and machine learning, that can find binding sites on candidate probes and rank their specificity in regard to the underlying transcription factor. We developed a pipeline to analyze experimental data derived from compact universal protein binding microarrays and benchmarked it against two of the most accurate motif search methods. Our results indicate that MotifMark can be a viable alternative technique for prediction of motif from protein binding microarrays and possibly other related high-throughput techniques.
CompariMotif: quick and easy comparisons of sequence motifs.
Edwards, Richard J; Davey, Norman E; Shields, Denis C
2008-05-15
CompariMotif is a novel tool for making motif-motif comparisons, identifying and describing similarities between regular expression motifs. CompariMotif can identify a number of different relationships between motifs, including exact matches, variants of degenerate motifs and complex overlapping motifs. Motif relationships are scored using shared information content, allowing the best matches to be easily identified in large comparisons. Many input and search options are available, enabling a list of motifs to be compared to itself (to identify recurring motifs) or to datasets of known motifs. CompariMotif can be run online at http://bioware.ucd.ie/ and is freely available for academic use as a set of open source Python modules under a GNU General Public License from http://bioinformatics.ucd.ie/shields/software/comparimotif/
Chiu, Yi-Yuan; Lin, Chun-Yu; Lin, Chih-Ta; Hsu, Kai-Cheng; Chang, Li-Zen; Yang, Jinn-Moon
2012-01-01
To discover a compound inhibiting multiple proteins (i.e. polypharmacological targets) is a new paradigm for the complex diseases (e.g. cancers and diabetes). In general, the polypharmacological proteins often share similar local binding environments and motifs. As the exponential growth of the number of protein structures, to find the similar structural binding motifs (pharma-motifs) is an emergency task for drug discovery (e.g. side effects and new uses for old drugs) and protein functions. We have developed a Space-Related Pharmamotifs (called SRPmotif) method to recognize the binding motifs by searching against protein structure database. SRPmotif is able to recognize conserved binding environments containing spatially discontinuous pharma-motifs which are often short conserved peptides with specific physico-chemical properties for protein functions. Among 356 pharma-motifs, 56.5% interacting residues are highly conserved. Experimental results indicate that 81.1% and 92.7% polypharmacological targets of each protein-ligand complex are annotated with same biological process (BP) and molecular function (MF) terms, respectively, based on Gene Ontology (GO). Our experimental results show that the identified pharma-motifs often consist of key residues in functional (active) sites and play the key roles for protein functions. The SRPmotif is available at http://gemdock.life.nctu.edu.tw/SRP/. SRPmotif is able to identify similar pharma-interfaces and pharma-motifs sharing similar binding environments for polypharmacological targets by rapidly searching against the protein structure database. Pharma-motifs describe the conservations of binding environments for drug discovery and protein functions. Additionally, these pharma-motifs provide the clues for discovering new sequence-based motifs to predict protein functions from protein sequence databases. We believe that SRPmotif is useful for elucidating protein functions and drug discovery.
DistAMo: A web-based tool to characterize DNA-motif distribution on bacterial chromosomes
Directory of Open Access Journals (Sweden)
Patrick eSobetzko
2016-03-01
Full Text Available Short DNA motifs are involved in a multitude of functions such as for example chromosome segregation, DNA replication or mismatch repair. Distribution of such motifs is often not random and the specific chromosomal pattern relates to the respective motif function. Computational approaches which quantitatively assess such chromosomal motif patterns are necessary. Here we present a new computer tool DistAMo (Distribution Analysis of DNA Motifs. The algorithm uses codon redundancy to calculate the relative abundance of short DNA motifs from single genes to entire chromosomes. Comparative genomics analyses of the GATC-motif distribution in γ-proteobacterial genomes using DistAMo revealed that (i genes beside the replication origin are enriched in GATCs, (ii genome-wide GATC distribution follows a distinct pattern and (iii genes involved in DNA replication and repair are enriched in GATCs. These features are specific for bacterial chromosomes encoding a Dam methyltransferase. The new software is available as a stand-alone or as an easy-to-use web-based server version at http://www.computational.bio.uni-giessen.de/distamo.
Argo_CUDA: Exhaustive GPU based approach for motif discovery in large DNA datasets.
Vishnevsky, Oleg V; Bocharnikov, Andrey V; Kolchanov, Nikolay A
2018-02-01
The development of chromatin immunoprecipitation sequencing (ChIP-seq) technology has revolutionized the genetic analysis of the basic mechanisms underlying transcription regulation and led to accumulation of information about a huge amount of DNA sequences. There are a lot of web services which are currently available for de novo motif discovery in datasets containing information about DNA/protein binding. An enormous motif diversity makes their finding challenging. In order to avoid the difficulties, researchers use different stochastic approaches. Unfortunately, the efficiency of the motif discovery programs dramatically declines with the query set size increase. This leads to the fact that only a fraction of top "peak" ChIP-Seq segments can be analyzed or the area of analysis should be narrowed. Thus, the motif discovery in massive datasets remains a challenging issue. Argo_Compute Unified Device Architecture (CUDA) web service is designed to process the massive DNA data. It is a program for the detection of degenerate oligonucleotide motifs of fixed length written in 15-letter IUPAC code. Argo_CUDA is a full-exhaustive approach based on the high-performance GPU technologies. Compared with the existing motif discovery web services, Argo_CUDA shows good prediction quality on simulated sets. The analysis of ChIP-Seq sequences revealed the motifs which correspond to known transcription factor binding sites.
Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K
2017-03-17
Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
MotifNet: a web-server for network motif analysis.
Smoly, Ilan Y; Lerman, Eugene; Ziv-Ukelson, Michal; Yeger-Lotem, Esti
2017-06-15
Network motifs are small topological patterns that recur in a network significantly more often than expected by chance. Their identification emerged as a powerful approach for uncovering the design principles underlying complex networks. However, available tools for network motif analysis typically require download and execution of computationally intensive software on a local computer. We present MotifNet, the first open-access web-server for network motif analysis. MotifNet allows researchers to analyze integrated networks, where nodes and edges may be labeled, and to search for motifs of up to eight nodes. The output motifs are presented graphically and the user can interactively filter them by their significance, number of instances, node and edge labels, and node identities, and view their instances. MotifNet also allows the user to distinguish between motifs that are centered on specific nodes and motifs that recur in distinct parts of the network. MotifNet is freely available at http://netbio.bgu.ac.il/motifnet . The website was implemented using ReactJs and supports all major browsers. The server interface was implemented in Python with data stored on a MySQL database. estiyl@bgu.ac.il or michaluz@cs.bgu.ac.il. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
SiteBinder: an improved approach for comparing multiple protein structural motifs.
Sehnal, David; Vařeková, Radka Svobodová; Huber, Heinrich J; Geidl, Stanislav; Ionescu, Crina-Maria; Wimmerová, Michaela; Koča, Jaroslav
2012-02-27
There is a paramount need to develop new techniques and tools that will extract as much information as possible from the ever growing repository of protein 3D structures. We report here on the development of a software tool for the multiple superimposition of large sets of protein structural motifs. Our superimposition methodology performs a systematic search for the atom pairing that provides the best fit. During this search, the RMSD values for all chemically relevant pairings are calculated by quaternion algebra. The number of evaluated pairings is markedly decreased by using PDB annotations for atoms. This approach guarantees that the best fit will be found and can be applied even when sequence similarity is low or does not exist at all. We have implemented this methodology in the Web application SiteBinder, which is able to process up to thousands of protein structural motifs in a very short time, and which provides an intuitive and user-friendly interface. Our benchmarking analysis has shown the robustness, efficiency, and versatility of our methodology and its implementation by the successful superimposition of 1000 experimentally determined structures for each of 32 eukaryotic linear motifs. We also demonstrate the applicability of SiteBinder using three case studies. We first compared the structures of 61 PA-IIL sugar binding sites containing nine different sugars, and we found that the sugar binding sites of PA-IIL and its mutants have a conserved structure despite their binding different sugars. We then superimposed over 300 zinc finger central motifs and revealed that the molecular structure in the vicinity of the Zn atom is highly conserved. Finally, we superimposed 12 BH3 domains from pro-apoptotic proteins. Our findings come to support the hypothesis that there is a structural basis for the functional segregation of BH3-only proteins into activators and enablers.
Fine-tuning of T-cell development by the CD3γ di-leucine-based TCR-sorting motif
DEFF Research Database (Denmark)
Lauritsen, Jens Peter Holst; Boding, Lasse; Buus, Terkild B
2015-01-01
The CD3γ di-leucine-based (diL) receptor-sorting motif plays a central role in TCR down-regulation and in clonal expansion of virus-specific T cells. However, the role of the CD3γ diL motif in T-cell development is not known. In this study, we show that protein kinase C-induced TCR down-regulatio......The CD3γ di-leucine-based (diL) receptor-sorting motif plays a central role in TCR down-regulation and in clonal expansion of virus-specific T cells. However, the role of the CD3γ diL motif in T-cell development is not known. In this study, we show that protein kinase C-induced TCR down...
Transduction motif analysis of gastric cancer based on a human signaling network
Energy Technology Data Exchange (ETDEWEB)
Liu, G.; Li, D.Z.; Jiang, C.S.; Wang, W. [Fuzhou General Hospital of Nanjing Command, Department of Gastroenterology, Fuzhou, China, Department of Gastroenterology, Fuzhou General Hospital of Nanjing Command, Fuzhou (China)
2014-04-04
To investigate signal regulation models of gastric cancer, databases and literature were used to construct the signaling network in humans. Topological characteristics of the network were analyzed by CytoScape. After marking gastric cancer-related genes extracted from the CancerResource, GeneRIF, and COSMIC databases, the FANMOD software was used for the mining of gastric cancer-related motifs in a network with three vertices. The significant motif difference method was adopted to identify significantly different motifs in the normal and cancer states. Finally, we conducted a series of analyses of the significantly different motifs, including gene ontology, function annotation of genes, and model classification. A human signaling network was constructed, with 1643 nodes and 5089 regulating interactions. The network was configured to have the characteristics of other biological networks. There were 57,942 motifs marked with gastric cancer-related genes out of a total of 69,492 motifs, and 264 motifs were selected as significantly different motifs by calculating the significant motif difference (SMD) scores. Genes in significantly different motifs were mainly enriched in functions associated with cancer genesis, such as regulation of cell death, amino acid phosphorylation of proteins, and intracellular signaling cascades. The top five significantly different motifs were mainly cascade and positive feedback types. Almost all genes in the five motifs were cancer related, including EPOR, MAPK14, BCL2L1, KRT18, PTPN6, CASP3, TGFBR2, AR, and CASP7. The development of cancer might be curbed by inhibiting signal transductions upstream and downstream of the selected motifs.
Radical-pair based avian magnetoreception
Procopio, Maria; Ritz, Thorsten
2014-03-01
Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.
Nomura, Yusuke; Tanaka, Yoichiro; Fukunaga, Jun-ichi; Fujiwara, Kazuya; Chiba, Manabu; Iibuchi, Hiroaki; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Kozu, Tomoko; Sakamoto, Taiichi
2013-12-01
AML1/RUNX1 is an essential transcription factor involved in the differentiation of hematopoietic cells. AML1 binds to the Runt-binding double-stranded DNA element (RDE) of target genes through its N-terminal Runt domain. In a previous study, we obtained RNA aptamers against the AML1 Runt domain by systematic evolution of ligands by exponential enrichment and revealed that RNA aptamers exhibit higher affinity for the Runt domain than that for RDE and possess the 5'-GCGMGNN-3' and 5'-N'N'CCAC-3' conserved motif (M: A or C; N and N' form Watson-Crick base pairs) that is important for Runt domain binding. In this study, to understand the structural basis of recognition of the Runt domain by the aptamer motif, the solution structure of a 22-mer RNA was determined using nuclear magnetic resonance. The motif contains the AH(+)-C mismatch and base triple and adopts an unusual backbone structure. Structural analysis of the aptamer motif indicated that the aptamer binds to the Runt domain by mimicking the RDE sequence and structure. Our data should enhance the understanding of the structural basis of DNA mimicry by RNA molecules.
International Nuclear Information System (INIS)
Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun
2017-01-01
Two identical 5′GACG3′ tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5′ end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5′GACG3′) forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5′A·U3′ for H3, 5′U·A3′ for H2) to 5′G·C3’/5′C·G3′ has significant effect on the stability of the kissing complexes: the substitution to 5′C·G3′ significantly decreases both thermal and mechanical stability, while switching to the 5′G·C3′ significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5′A·U3′ for H3 and 5′U·A3′ for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. - Highlights: • Thermodynamic parameters of the smallest RNA kissing interactions were measured. • The effects of loop-closing base pairs on the RNA kissing complex was investigated. • Changing the base pair to 5′CG3′ decreases the stability of the kissing complex. • Changing it to 5′GC3′ increases the mechanical resilience of the kissing complex. • Difference in its stem sequence also affects the stability of the kissing complex.
DEFF Research Database (Denmark)
Dietrich, J; Geisler, C
1998-01-01
The leucine-based motif in the T cell receptor (TCR) subunit CD3gamma constitutes a strong internalization signal. In fully assembled TCR this motif is inactive unless phosphorylated. In contrast, the motif is constitutively active in CD4/CD3gamma and Tac/CD3gamma chimeras independently of phosph......The leucine-based motif in the T cell receptor (TCR) subunit CD3gamma constitutes a strong internalization signal. In fully assembled TCR this motif is inactive unless phosphorylated. In contrast, the motif is constitutively active in CD4/CD3gamma and Tac/CD3gamma chimeras independently...... of phosphorylation and leads to rapid internalization and sorting of these chimeras to lysosomal degradation. Because the TCRzeta chain rescues incomplete TCR complexes from lysosomal degradation and allows stable surface expression of fully assembled TCR, we addressed the question whether TCRzeta has the potential...... to mask the CD3gamma leucine-based motif. By studying CD4/CD3gamma and CD16/CD3gamma chimeras, we found that CD16/CD3gamma chimeras associated with TCRzeta. The CD16/CD3gamma-TCRzeta complexes were stably expressed at the cell surface and had a low spontaneous internalization rate, indicating...
Identify Beta-Hairpin Motifs with Quadratic Discriminant Algorithm Based on the Chemical Shifts.
Directory of Open Access Journals (Sweden)
Feng YongE
Full Text Available Successful prediction of the beta-hairpin motif will be helpful for understanding the of the fold recognition. Some algorithms have been proposed for the prediction of beta-hairpin motifs. However, the parameters used by these methods were primarily based on the amino acid sequences. Here, we proposed a novel model for predicting beta-hairpin structure based on the chemical shift. Firstly, we analyzed the statistical distribution of chemical shifts of six nuclei in not beta-hairpin and beta-hairpin motifs. Secondly, we used these chemical shifts as features combined with three algorithms to predict beta-hairpin structure. Finally, we achieved the best prediction, namely sensitivity of 92%, the specificity of 94% with 0.85 of Mathew's correlation coefficient using quadratic discriminant analysis algorithm, which is clearly superior to the same method for the prediction of beta-hairpin structure from 20 amino acid compositions in the three-fold cross-validation. Our finding showed that the chemical shift is an effective parameter for beta-hairpin prediction, suggesting the quadratic discriminant analysis is a powerful algorithm for the prediction of beta-hairpin.
Sequence-based classification using discriminatory motif feature selection.
Directory of Open Access Journals (Sweden)
Hao Xiong
Full Text Available Most existing methods for sequence-based classification use exhaustive feature generation, employing, for example, all k-mer patterns. The motivation behind such (enumerative approaches is to minimize the potential for overlooking important features. However, there are shortcomings to this strategy. First, practical constraints limit the scope of exhaustive feature generation to patterns of length ≤ k, such that potentially important, longer (> k predictors are not considered. Second, features so generated exhibit strong dependencies, which can complicate understanding of derived classification rules. Third, and most importantly, numerous irrelevant features are created. These concerns can compromise prediction and interpretation. While remedies have been proposed, they tend to be problem-specific and not broadly applicable. Here, we develop a generally applicable methodology, and an attendant software pipeline, that is predicated on discriminatory motif finding. In addition to the traditional training and validation partitions, our framework entails a third level of data partitioning, a discovery partition. A discriminatory motif finder is used on sequences and associated class labels in the discovery partition to yield a (small set of features. These features are then used as inputs to a classifier in the training partition. Finally, performance assessment occurs on the validation partition. Important attributes of our approach are its modularity (any discriminatory motif finder and any classifier can be deployed and its universality (all data, including sequences that are unaligned and/or of unequal length, can be accommodated. We illustrate our approach on two nucleosome occupancy datasets and a protein solubility dataset, previously analyzed using enumerative feature generation. Our method achieves excellent performance results, with and without optimization of classifier tuning parameters. A Python pipeline implementing the approach is
Directory of Open Access Journals (Sweden)
Girgis Hani Z
2012-02-01
Full Text Available Abstract Background Researchers seeking to unlock the genetic basis of human physiology and diseases have been studying gene transcription regulation. The temporal and spatial patterns of gene expression are controlled by mainly non-coding elements known as cis-regulatory modules (CRMs and epigenetic factors. CRMs modulating related genes share the regulatory signature which consists of transcription factor (TF binding sites (TFBSs. Identifying such CRMs is a challenging problem due to the prohibitive number of sequence sets that need to be analyzed. Results We formulated the challenge as a supervised classification problem even though experimentally validated CRMs were not required. Our efforts resulted in a software system named CrmMiner. The system mines for CRMs in the vicinity of related genes. CrmMiner requires two sets of sequences: a mixed set and a control set. Sequences in the vicinity of the related genes comprise the mixed set, whereas the control set includes random genomic sequences. CrmMiner assumes that a large percentage of the mixed set is made of background sequences that do not include CRMs. The system identifies pairs of closely located motifs representing vertebrate TFBSs that are enriched in the training mixed set consisting of 50% of the gene loci. In addition, CrmMiner selects a group of the enriched pairs to represent the tissue-specific regulatory signature. The mixed and the control sets are searched for candidate sequences that include any of the selected pairs. Next, an optimal Bayesian classifier is used to distinguish candidates found in the mixed set from their control counterparts. Our study proposes 62 tissue-specific regulatory signatures and putative CRMs for different human tissues and cell types. These signatures consist of assortments of ubiquitously expressed TFs and tissue-specific TFs. Under controlled settings, CrmMiner identified known CRMs in noisy sets up to 1:25 signal-to-noise ratio. CrmMiner was
Directory of Open Access Journals (Sweden)
Ye Ping
2005-12-01
Full Text Available Abstract Background Synthetic lethality experiments identify pairs of genes with complementary function. More direct functional associations (for example greater probability of membership in a single protein complex may be inferred between genes that share synthetic lethal interaction partners than genes that are directly synthetic lethal. Probabilistic algorithms that identify gene modules based on motif discovery are highly appropriate for the analysis of synthetic lethal genetic interaction data and have great potential in integrative analysis of heterogeneous datasets. Results We have developed Genetic Interaction Motif Finding (GIMF, an algorithm for unsupervised motif discovery from synthetic lethal interaction data. Interaction motifs are characterized by position weight matrices and optimized through expectation maximization. Given a seed gene, GIMF performs a nonlinear transform on the input genetic interaction data and automatically assigns genes to the motif or non-motif category. We demonstrate the capacity to extract known and novel pathways for Saccharomyces cerevisiae (budding yeast. Annotations suggested for several uncharacterized genes are supported by recent experimental evidence. GIMF is efficient in computation, requires no training and automatically down-weights promiscuous genes with high degrees. Conclusion GIMF effectively identifies pathways from synthetic lethality data with several unique features. It is mostly suitable for building gene modules around seed genes. Optimal choice of one single model parameter allows construction of gene networks with different levels of confidence. The impact of hub genes the generic probabilistic framework of GIMF may be used to group other types of biological entities such as proteins based on stochastic motifs. Analysis of the strongest motifs discovered by the algorithm indicates that synthetic lethal interactions are depleted between genes within a motif, suggesting that synthetic
Physical-chemical property based sequence motifs and methods regarding same
Braun, Werner [Friendswood, TX; Mathura, Venkatarajan S [Sarasota, FL; Schein, Catherine H [Friendswood, TX
2008-09-09
A data analysis system, program, and/or method, e.g., a data mining/data exploration method, using physical-chemical property motifs. For example, a sequence database may be searched for identifying segments thereof having physical-chemical properties similar to the physical-chemical property motifs.
Fast social-like learning of complex behaviors based on motor motifs
Calvo Tapia, Carlos; Tyukin, Ivan Y.; Makarov, Valeri A.
2018-05-01
Social learning is widely observed in many species. Less experienced agents copy successful behaviors exhibited by more experienced individuals. Nevertheless, the dynamical mechanisms behind this process remain largely unknown. Here we assume that a complex behavior can be decomposed into a sequence of n motor motifs. Then a neural network capable of activating motor motifs in a given sequence can drive an agent. To account for (n -1 )! possible sequences of motifs in a neural network, we employ the winnerless competition approach. We then consider a teacher-learner situation: one agent exhibits a complex movement, while another one aims at mimicking the teacher's behavior. Despite the huge variety of possible motif sequences we show that the learner, equipped with the provided learning model, can rewire "on the fly" its synaptic couplings in no more than (n -1 ) learning cycles and converge exponentially to the durations of the teacher's motifs. We validate the learning model on mobile robots. Experimental results show that the learner is indeed capable of copying the teacher's behavior composed of six motor motifs in a few learning cycles. The reported mechanism of learning is general and can be used for replicating different functions, including, for example, sound patterns or speech.
Motif discovery in ranked lists of sequences
DEFF Research Database (Denmark)
Nielsen, Morten Muhlig; Tataru, Paula; Madsen, Tobias
2016-01-01
Motif analysis has long been an important method to characterize biological functionality and the current growth of sequencing-based genomics experiments further extends its potential. These diverse experiments often generate sequence lists ranked by some functional property. There is therefore...... advantage of the regular expression feature, including enrichments for combinations of different microRNA seed sites. The method is implemented and made publicly available as an R package and supports high parallelization on multi-core machinery....... a growing need for motif analysis methods that can exploit this coupled data structure and be tailored for specific biological questions. Here, we present an exploratory motif analysis tool, Regmex (REGular expression Motif EXplorer), which offers several methods to evaluate the correlation of motifs...
Hosaka, Shuto; Honda, Takuto; Lee, Seon Hwa; Oe, Tomoyuki
2018-06-01
Candidate drugs that can be metabolically transformed into reactive electrophilic products, such as epoxides, quinones, and nitroso compounds, are of special concern because subsequent covalent binding to bio-macromolecules can cause adverse drug reactions, such as allergic reactions, hepatotoxicity, and genotoxicity. Several strategies have been reported for screening reactive metabolites, such as a covalent binding assay with radioisotope-labeled drugs and a trapping method followed by LC-MS/MS analyses. Of these, a trapping method using glutathione is the most common, especially at the early stage of drug development. However, the cysteine of glutathione is not the only nucleophilic site in vivo; lysine, histidine, arginine, and DNA bases are also nucleophilic. Indeed, the glutathione trapping method tends to overlook several types of reactive metabolites, such as aldehydes, acylglucuronides, and nitroso compounds. Here, we introduce an alternate way for screening reactive metabolites as follows: A mixture of the light and heavy isotopes of simplified amino acid motifs and a DNA motif is used as a biomimetic trapping cocktail. This mixture consists of [ 2 H 0 ]/[ 2 H 3 ]-1-methylguanidine (arginine motif, Δ 3 Da), [ 2 H 0 ]/[ 2 H 4 ]-2-mercaptoethanol (cysteine motif, Δ 4 Da), [ 2 H 0 ]/[ 2 H 5 ]-4-methylimidazole (histidine motif, Δ 5 Da), [ 2 H 0 ]/[ 2 H 9 ]-n-butylamine (lysine motif, Δ 9 Da), and [ 13 C 0 , 15 N 0 ]/[ 13 C 1 , 15 N 2 ]-2'-deoxyguanosine (DNA motif, Δ 3 Da). Mass tag triggered data-dependent acquisition is used to find the characteristic doublet peaks, followed by specific identification of the light isotope peak using MS/MS. Forty-two model drugs were examined using an in vitro microsome experiment to validate the strategy. Graphical abstract Biomimetic trapping cocktail to screen reactive metabolites.
Gao, Juehan; Berden, Giel; Rodgers, M T; Oomens, Jos
2016-03-14
The Watson-Crick structure of DNA is among the most well-known molecular structures of our time. However, alternative base-pairing motifs are also known to occur, often depending on base sequence, pH, or the presence of cations. Pairing of cytosine (C) bases induced by the sharing of a single proton (C-H(+)-C) may give rise to the so-called i-motif, which occurs primarily in expanded trinucleotide repeats and the telomeric region of DNA, particularly at low pH. At physiological pH, silver cations were recently found to stabilize C dimers in a C-Ag(+)-C structure analogous to the hemiprotonated C-dimer. Here we use infrared ion spectroscopy in combination with density functional theory calculations at the B3LYP/6-311G+(2df,2p) level to show that copper in the 1+ oxidation state induces an analogous formation of C-Cu(+)-C structures. In contrast to protons and these transition metal ions, alkali metal ions induce a different dimer structure, where each ligand coordinates the alkali metal ion in a bidentate fashion in which the N3 and O2 atoms of both cytosine ligands coordinate to the metal ion, sacrificing hydrogen-bonding interactions between the ligands for improved chelation of the metal cation.
Kopi dan Kakao dalam Kreasi Motif Batik Khas Jember
Directory of Open Access Journals (Sweden)
Irfa'ina Rohana Salma
2015-06-01
, design motifs creation and the embodiment of batik. From the creation of this art successfully created into 6 (six motif, namely: (1 Motif Uwoh Kopi; (2 Motif Godhong Kopi; (3 Motif Ceplok Kakao; (4 Motif Kakao Raja; (5 Motif Kakao Biru; and (6 Motif Wiji Mukti. Based on the results of the “Aesthetics assessment taste" has been noticed that the most widely preferred motif is a Uwoh Kopi motif and Kakao Raja motif. Keywords: Motif Uwoh Kopi, Motif Godong Kopi, Motif Ceplok Kakao, Motif Kakao Raja, Motif Kakao Biru, Motif Wiji Mukti
Analisis Unsur Matematika pada Motif Sulam Usus
Directory of Open Access Journals (Sweden)
Fredi Ganda Putra
2017-12-01
Full Text Available Based on interviews with researchers sources said that the beginning of the intestine embroidery is an art of genuine crafts. Called the intestine embroidery because this technique is a technique of combining a strand of cloth resembling the intestine formed according to the pattern by means of embroidered using a thread. Intestinal embroidery techniques were originally used to create a cover of the women's customary wardrobe of Lampung or often referred to as bebe. But not many people in Lampung, especially people who live in Lampung are still many who do not know and recognize the intestine embroidery because most only know tapis only characteristic of Lampung, besides that there are other cultural results that is embroidered intestine. There are still many who do not know that the intestine motif there is a knowledge of mathematics. The researcher's problem formulation is whether there are mathematical elements contained in the intestine embroidery motif based on the concept of geometry. The purpose of this study is to determine whether there are elements of mathematics contained in the intestine motif based on the concept of geometry. Subjects in this study consisted of 4 people obtained by purposive sampling technique. From the results of data analysis conducted by using descriptive analysis and discussion as follows: (1 Intestinal embroidery motif contains the meaning of mathematics and culture or often called Etnomatematika. On the meaning of culture there is a link between the embroidery intestine with a culture that has been there before as the existence of cultural linkage between Hindu belief Buddhism and there are similarities of motifs and decorative patterns contained in the motif embroidery intestine with ornamental variety in Indonesia. (2 The relationship between the intestine with mathematical motifs there are elements of mathematics such as geometry elements in the form of geometry of dimension one and dimension two, and the
Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki
2009-03-18
It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.
Nicholson, Judith; Scherl, Alex; Way, Luke; Blackburn, Elizabeth A; Walkinshaw, Malcolm D; Ball, Kathryn L; Hupp, Ted R
2014-06-01
Linear motifs mediate protein-protein interactions (PPI) that allow expansion of a target protein interactome at a systems level. This study uses a proteomics approach and linear motif sub-stratifications to expand on PPIs of MDM2. MDM2 is a multi-functional protein with over one hundred known binding partners not stratified by hierarchy or function. A new linear motif based on a MDM2 interaction consensus is used to select novel MDM2 interactors based on Nutlin-3 responsiveness in a cell-based proteomics screen. MDM2 binds a subset of peptide motifs corresponding to real proteins with a range of allosteric responses to MDM2 ligands. We validate cyclophilin B as a novel protein with a consensus MDM2 binding motif that is stabilised by Nutlin-3 in vivo, thus identifying one of the few known interactors of MDM2 that is stabilised by Nutlin-3. These data invoke two modes of peptide binding at the MDM2 N-terminus that rely on a consensus core motif to control the equilibrium between MDM2 binding proteins. This approach stratifies MDM2 interacting proteins based on the linear motif feature and provides a new biomarker assay to define clinically relevant Nutlin-3 responsive MDM2 interactors. Copyright © 2014 Elsevier Inc. All rights reserved.
Theoretical study of GC+/GC base pair derivatives
International Nuclear Information System (INIS)
Meng Fancui; Wang Huanjie; Xu Weiren; Liu Chengbu
2005-01-01
The geometries of R (R=CH 3 , CH 3 O, F, NO 2 ) substituted GC base pair derivatives and their cations have been optimized at B3LYP/6-31G* level and the substituent effects on the neutral and cationic geometric structures and energies have been discussed. The inner reorganization energies of various base pair derivatives and the native GC base pair have been calculated to discuss the substituent effects on the reorganization energy. NBO (natural bond orbital) analysis has been carried out on both the neutral and the cationic systems to investigate the differences of the charge distributions and the electronic structures. The outcomes indicate that 8-CH 3 O-G:C has the greatest reorganization energy and 8-NO 2 -G:C has the least, while the other substituted base pairs have a reorganization energy close to that of G:C. The one charge is mostly localized on guanine part after ionization and as high as 0.95e. The bond distances of N1-N3'andN2-O2' in the cationic base pair derivatives shortened and that of O6-N4' elongated as compared with the corresponding bond distances of the neutral GC base pair derivatives
Theoretical analysis of noncanonical base pairing interactions in ...
Indian Academy of Sciences (India)
PRAKASH KUMAR
Noncanonical base pairs in RNA have strong structural and functional implications but are currently not considered ..... Full optimizations of the systems were also carried out using ... of the individual bases in the base pair through the equation.
Automatic annotation of protein motif function with Gene Ontology terms
Directory of Open Access Journals (Sweden)
Gopalakrishnan Vanathi
2004-09-01
Full Text Available Abstract Background Conserved protein sequence motifs are short stretches of amino acid sequence patterns that potentially encode the function of proteins. Several sequence pattern searching algorithms and programs exist foridentifying candidate protein motifs at the whole genome level. However, amuch needed and importanttask is to determine the functions of the newly identified protein motifs. The Gene Ontology (GO project is an endeavor to annotate the function of genes or protein sequences with terms from a dynamic, controlled vocabulary and these annotations serve well as a knowledge base. Results This paperpresents methods to mine the GO knowledge base and use the association between the GO terms assigned to a sequence and the motifs matched by the same sequence as evidence for predicting the functions of novel protein motifs automatically. The task of assigning GO terms to protein motifsis viewed as both a binary classification and information retrieval problem, where PROSITE motifs are used as samples for mode training and functional prediction. The mutual information of a motif and aGO term association isfound to be a very useful feature. We take advantageof the known motifs to train a logistic regression classifier, which allows us to combine mutual information with other frequency-based features and obtain a probability of correctassociation. The trained logistic regression model has intuitively meaningful and logically plausible parameter values, and performs very well empirically according to our evaluation criteria. Conclusions In this research, different methods for automatic annotation of protein motifs have been investigated. Empirical result demonstrated that the methods have a great potential for detecting and augmenting information about thefunctions of newly discovered candidate protein motifs.
A survey of motif finding Web tools for detecting binding site motifs in ChIP-Seq data.
Tran, Ngoc Tam L; Huang, Chun-Hsi
2014-02-20
ChIP-Seq (chromatin immunoprecipitation sequencing) has provided the advantage for finding motifs as ChIP-Seq experiments narrow down the motif finding to binding site locations. Recent motif finding tools facilitate the motif detection by providing user-friendly Web interface. In this work, we reviewed nine motif finding Web tools that are capable for detecting binding site motifs in ChIP-Seq data. We showed each motif finding Web tool has its own advantages for detecting motifs that other tools may not discover. We recommended the users to use multiple motif finding Web tools that implement different algorithms for obtaining significant motifs, overlapping resemble motifs, and non-overlapping motifs. Finally, we provided our suggestions for future development of motif finding Web tool that better assists researchers for finding motifs in ChIP-Seq data.
Overlapping ETS and CRE Motifs (G/CCGGAAGTGACGTCA) Preferentially Bound by GABPα and CREB Proteins
Chatterjee, Raghunath; Zhao, Jianfei; He, Ximiao; Shlyakhtenko, Andrey; Mann, Ishminder; Waterfall, Joshua J.; Meltzer, Paul; Sathyanarayana, B. K.; FitzGerald, Peter C.; Vinson, Charles
2012-01-01
Previously, we identified 8-bps long DNA sequences (8-mers) that localize in human proximal promoters and grouped them into known transcription factor binding sites (TFBS). We now examine split 8-mers consisting of two 4-mers separated by 1-bp to 30-bps (X4-N1-30-X4) to identify pairs of TFBS that localize in proximal promoters at a precise distance. These include two overlapping TFBS: the ETS⇔ETS motif (C/GCCGGAAGCGGAA) and the ETS⇔CRE motif (C/GCGGAAGTGACGTCAC). The nucleotides in bold are part of both TFBS. Molecular modeling shows that the ETS⇔CRE motif can be bound simultaneously by both the ETS and the B-ZIP domains without protein-protein clashes. The electrophoretic mobility shift assay (EMSA) shows that the ETS protein GABPα and the B-ZIP protein CREB preferentially bind to the ETS⇔CRE motif only when the two TFBS overlap precisely. In contrast, the ETS domain of ETV5 and CREB interfere with each other for binding the ETS⇔CRE. The 11-mer (CGGAAGTGACG), the conserved part of the ETS⇔CRE motif, occurs 226 times in the human genome and 83% are in known regulatory regions. In vivo GABPα and CREB ChIP-seq peaks identified the ETS⇔CRE as the most enriched motif occurring in promoters of genes involved in mRNA processing, cellular catabolic processes, and stress response, suggesting that a specific class of genes is regulated by this composite motif. PMID:23050235
Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.
2012-01-01
The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427
Chakraborty, Mohua; Dhar, Bishal; Ghosh, Sankar Kumar
2017-11-01
The DNA barcodes are generally interpreted using distance-based and character-based methods. The former uses clustering of comparable groups, based on the relative genetic distance, while the latter is based on the presence or absence of discrete nucleotide substitutions. The distance-based approach has a limitation in defining a universal species boundary across the taxa as the rate of mtDNA evolution is not constant throughout the taxa. However, character-based approach more accurately defines this using a unique set of nucleotide characters. The character-based analysis of full-length barcode has some inherent limitations, like sequencing of the full-length barcode, use of a sparse-data matrix and lack of a uniform diagnostic position for each group. A short continuous stretch of a fragment can be used to resolve the limitations. Here, we observe that a 154-bp fragment, from the transversion-rich domain of 1367 COI barcode sequences can successfully delimit species in the three most diverse orders of freshwater fishes. This fragment is used to design species-specific barcode motifs for 109 species by the character-based method, which successfully identifies the correct species using a pattern-matching program. The motifs also correctly identify geographically isolated population of the Cypriniformes species. Further, this region is validated as a species-specific mini-barcode for freshwater fishes by successful PCR amplification and sequencing of the motif (154 bp) using the designed primers. We anticipate that use of such motifs will enhance the diagnostic power of DNA barcode, and the mini-barcode approach will greatly benefit the field-based system of rapid species identification. © 2017 John Wiley & Sons Ltd.
DNA motif alignment by evolving a population of Markov chains.
Bi, Chengpeng
2009-01-30
Deciphering cis-regulatory elements or de novo motif-finding in genomes still remains elusive although much algorithmic effort has been expended. The Markov chain Monte Carlo (MCMC) method such as Gibbs motif samplers has been widely employed to solve the de novo motif-finding problem through sequence local alignment. Nonetheless, the MCMC-based motif samplers still suffer from local maxima like EM. Therefore, as a prerequisite for finding good local alignments, these motif algorithms are often independently run a multitude of times, but without information exchange between different chains. Hence it would be worth a new algorithm design enabling such information exchange. This paper presents a novel motif-finding algorithm by evolving a population of Markov chains with information exchange (PMC), each of which is initialized as a random alignment and run by the Metropolis-Hastings sampler (MHS). It is progressively updated through a series of local alignments stochastically sampled. Explicitly, the PMC motif algorithm performs stochastic sampling as specified by a population-based proposal distribution rather than individual ones, and adaptively evolves the population as a whole towards a global maximum. The alignment information exchange is accomplished by taking advantage of the pooled motif site distributions. A distinct method for running multiple independent Markov chains (IMC) without information exchange, or dubbed as the IMC motif algorithm, is also devised to compare with its PMC counterpart. Experimental studies demonstrate that the performance could be improved if pooled information were used to run a population of motif samplers. The new PMC algorithm was able to improve the convergence and outperformed other popular algorithms tested using simulated and biological motif sequences.
Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A
2018-03-26
DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Codon based co-occurrence network motifs in human mitochondria
Directory of Open Access Journals (Sweden)
Pramod Shinde
2017-10-01
Full Text Available The nucleotide polymorphism in human mitochondrial genome (mtDNA tolled by codon position bias plays an indispensable role in human population dispersion and expansion. Herein, we constructed genome-wide nucleotide co-occurrence networks using a massive data consisting of five different geographical regions and around 3000 samples for each region. We developed a powerful network model to describe complex mitochondrial evolutionary patterns between codon and non-codon positions. It was interesting to report a different evolution of Asian genomes than those of the rest which is divulged by network motifs. We found evidence that mtDNA undergoes substantial amounts of adaptive evolution, a finding which was supported by a number of previous studies. The dominance of higher order motifs indicated the importance of long-range nucleotide co-occurrence in genomic diversity. Most notably, codon motifs apparently underpinned the preferences among codon positions for co-evolution which is probably highly biased during the origin of the genetic code. Our analyses manifested that codon position co-evolution is very well conserved across human sub-populations and independently maintained within human sub-populations implying the selective role of evolutionary processes on codon position co-evolution. Ergo, this study provided a framework to investigate cooperative genomic interactions which are critical in underlying complex mitochondrial evolution.
Directory of Open Access Journals (Sweden)
Mark D McDonnell
Full Text Available Complex networks are frequently characterized by metrics for which particular subgraphs are counted. One statistic from this category, which we refer to as motif-role fingerprints, differs from global subgraph counts in that the number of subgraphs in which each node participates is counted. As with global subgraph counts, it can be important to distinguish between motif-role fingerprints that are 'structural' (induced subgraphs and 'functional' (partial subgraphs. Here we show mathematically that a vector of all functional motif-role fingerprints can readily be obtained from an arbitrary directed adjacency matrix, and then converted to structural motif-role fingerprints by multiplying that vector by a specific invertible conversion matrix. This result demonstrates that a unique structural motif-role fingerprint exists for any given functional motif-role fingerprint. We demonstrate a similar result for the cases of functional and structural motif-fingerprints without node roles, and global subgraph counts that form the basis of standard motif analysis. We also explicitly highlight that motif-role fingerprints are elemental to several popular metrics for quantifying the subgraph structure of directed complex networks, including motif distributions, directed clustering coefficient, and transitivity. The relationships between each of these metrics and motif-role fingerprints also suggest new subtypes of directed clustering coefficients and transitivities. Our results have potential utility in analyzing directed synaptic networks constructed from neuronal connectome data, such as in terms of centrality. Other potential applications include anomaly detection in networks, identification of similar networks and identification of similar nodes within networks. Matlab code for calculating all stated metrics following calculation of functional motif-role fingerprints is provided as S1 Matlab File.
RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts
International Nuclear Information System (INIS)
Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E.; Eghbalnia, Hamid R.
2012-01-01
The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ( 1 H– 15 N 2D HMQC) and proton–proton nuclear Overhauser enhancement spectroscopy ( 1 H– 1 H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino resonances for a
RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts
Energy Technology Data Exchange (ETDEWEB)
Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E. [National Magnetic Resonance Facility at Madison (United States); Eghbalnia, Hamid R., E-mail: eghbalhd@uc.edu [University of Cincinnati, Department of Molecular and Cellular Physiology (United States)
2012-04-15
The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ({sup 1}H-{sup 15}N 2D HMQC) and proton-proton nuclear Overhauser enhancement spectroscopy ({sup 1}H-{sup 1}H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino
Probing structural changes of self assembled i-motif DNA
Lee, Iljoon; Patil, Sachin; Fhayli, Karim; Alsaiari, Shahad K.; Khashab, Niveen M.
2015-01-01
We report an i-motif structural probing system based on Thioflavin T (ThT) as a fluorescent sensor. This probe can discriminate the structural changes of RET and Rb i-motif sequences according to pH change. This journal is
Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E
2012-12-04
The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.
Learning preferences from paired opposite-based semantics
DEFF Research Database (Denmark)
Franco de los Ríos, Camilo; Rodríguez, J. Tinguaro; Montero, Javier
2017-01-01
Preference semantics examine the meaning of the preference predicate, according to the way that alternatives can be understood and organized for decision making purposes. Through opposite-based semantics, preference structures can be characterized by their paired decomposition of preference...... on the character of opposition, the compound meaning of preference emerges from the fuzzy reinforcement of paired opposite concepts, searching for significant evidence for affirming dominance among the decision objects. Here we propose a general model for the paired decomposition of preference, examining its...
A proposed vestigial translation initiation motif in VP1 of hepatitis A virus.
Kang, Jeong-Ah; Funkhouser, Ann W
2002-07-01
The internal ribosome entry site (IRES) of picornaviruses has a 3' polypyrimidine tract (PPT) 16-24 bases upstream of an AUG triplet (PPT/AUG motif). This motif is critical in determining the efficiency of cap-independent translation. HAV has a conserved PPT/AUG motif consisting of a nine base sequence (AGGUUUUUC) 23 bases upstream of the preferred AUG start codon. This HAV-specific PPT/AUG motif is repeated and conserved in VP1 of HAV, but not of other picornaviruses. We proposed that the PPT/AUG motif in the open reading frame initiated translation and/or had an impact on the life cycle of the virus. In vitro translation of mutant bicistronic mRNAs and growth in cell culture of mutant viruses provided no evidence that the VP1 PPT/AUG motif had any impact on either translation or growth. HAV differs from other picornaviruses in its inefficient growth in cell culture. Since the HAV-specific PPT/AUG motif is found in only 1 in 300,000 reported viral sequences outside the hepatovirus genus, this motif may be a vestigial translation initiation element and may have played a role in determining the unusual phenotype of HAV.
Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.
2015-01-01
Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517
DMINDA: an integrated web server for DNA motif identification and analyses.
Ma, Qin; Zhang, Hanyuan; Mao, Xizeng; Zhou, Chuan; Liu, Bingqiang; Chen, Xin; Xu, Ying
2014-07-01
DMINDA (DNA motif identification and analyses) is an integrated web server for DNA motif identification and analyses, which is accessible at http://csbl.bmb.uga.edu/DMINDA/. This web site is freely available to all users and there is no login requirement. This server provides a suite of cis-regulatory motif analysis functions on DNA sequences, which are important to elucidation of the mechanisms of transcriptional regulation: (i) de novo motif finding for a given set of promoter sequences along with statistical scores for the predicted motifs derived based on information extracted from a control set, (ii) scanning motif instances of a query motif in provided genomic sequences, (iii) motif comparison and clustering of identified motifs, and (iv) co-occurrence analyses of query motifs in given promoter sequences. The server is powered by a backend computer cluster with over 150 computing nodes, and is particularly useful for motif prediction and analyses in prokaryotic genomes. We believe that DMINDA, as a new and comprehensive web server for cis-regulatory motif finding and analyses, will benefit the genomic research community in general and prokaryotic genome researchers in particular. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Motif finding in DNA sequences based on skipping nonconserved positions in background Markov chains.
Zhao, Xiaoyan; Sze, Sing-Hoi
2011-05-01
One strategy to identify transcription factor binding sites is through motif finding in upstream DNA sequences of potentially co-regulated genes. Despite extensive efforts, none of the existing algorithms perform very well. We consider a string representation that allows arbitrary ignored positions within the nonconserved portion of single motifs, and use O(2(l)) Markov chains to model the background distributions of motifs of length l while skipping these positions within each Markov chain. By focusing initially on positions that have fixed nucleotides to define core occurrences, we develop an algorithm to identify motifs of moderate lengths. We compare the performance of our algorithm to other motif finding algorithms on a few benchmark data sets, and show that significant improvement in accuracy can be obtained when the sites are sufficiently conserved within a given sample, while comparable performance is obtained when the site conservation rate is low. A software program (PosMotif ) and detailed results are available online at http://faculty.cse.tamu.edu/shsze/posmotif.
Pan, Xiaoyong; Shen, Hong-Bin
2017-02-28
RNAs play key roles in cells through the interactions with proteins known as the RNA-binding proteins (RBP) and their binding motifs enable crucial understanding of the post-transcriptional regulation of RNAs. How the RBPs correctly recognize the target RNAs and why they bind specific positions is still far from clear. Machine learning-based algorithms are widely acknowledged to be capable of speeding up this process. Although many automatic tools have been developed to predict the RNA-protein binding sites from the rapidly growing multi-resource data, e.g. sequence, structure, their domain specific features and formats have posed significant computational challenges. One of current difficulties is that the cross-source shared common knowledge is at a higher abstraction level beyond the observed data, resulting in a low efficiency of direct integration of observed data across domains. The other difficulty is how to interpret the prediction results. Existing approaches tend to terminate after outputting the potential discrete binding sites on the sequences, but how to assemble them into the meaningful binding motifs is a topic worth of further investigation. In viewing of these challenges, we propose a deep learning-based framework (iDeep) by using a novel hybrid convolutional neural network and deep belief network to predict the RBP interaction sites and motifs on RNAs. This new protocol is featured by transforming the original observed data into a high-level abstraction feature space using multiple layers of learning blocks, where the shared representations across different domains are integrated. To validate our iDeep method, we performed experiments on 31 large-scale CLIP-seq datasets, and our results show that by integrating multiple sources of data, the average AUC can be improved by 8% compared to the best single-source-based predictor; and through cross-domain knowledge integration at an abstraction level, it outperforms the state-of-the-art predictors by 6
The Runt domain of AML1 (RUNX1) binds a sequence-conserved RNA motif that mimics a DNA element.
Fukunaga, Junichi; Nomura, Yusuke; Tanaka, Yoichiro; Amano, Ryo; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Sakamoto, Taiichi; Kozu, Tomoko
2013-07-01
AML1 (RUNX1) is a key transcription factor for hematopoiesis that binds to the Runt-binding double-stranded DNA element (RDE) of target genes through its N-terminal Runt domain. Aberrations in the AML1 gene are frequently found in human leukemia. To better understand AML1 and its potential utility for diagnosis and therapy, we obtained RNA aptamers that bind specifically to the AML1 Runt domain. Enzymatic probing and NMR analyses revealed that Apt1-S, which is a truncated variant of one of the aptamers, has a CACG tetraloop and two stem regions separated by an internal loop. All the isolated aptamers were found to contain the conserved sequence motif 5'-NNCCAC-3' and 5'-GCGMGN'N'-3' (M:A or C; N and N' form Watson-Crick base pairs). The motif contains one AC mismatch and one base bulged out. Mutational analysis of Apt1-S showed that three guanines of the motif are important for Runt binding as are the three guanines of RDE, which are directly recognized by three arginine residues of the Runt domain. Mutational analyses of the Runt domain revealed that the amino acid residues used for Apt1-S binding were similar to those used for RDE binding. Furthermore, the aptamer competed with RDE for binding to the Runt domain in vitro. These results demonstrated that the Runt domain of the AML1 protein binds to the motif of the aptamer that mimics DNA. Our findings should provide new insights into RNA function and utility in both basic and applied sciences.
RMOD: a tool for regulatory motif detection in signaling network.
Directory of Open Access Journals (Sweden)
Jinki Kim
Full Text Available Regulatory motifs are patterns of activation and inhibition that appear repeatedly in various signaling networks and that show specific regulatory properties. However, the network structures of regulatory motifs are highly diverse and complex, rendering their identification difficult. Here, we present a RMOD, a web-based system for the identification of regulatory motifs and their properties in signaling networks. RMOD finds various network structures of regulatory motifs by compressing the signaling network and detecting the compressed forms of regulatory motifs. To apply it into a large-scale signaling network, it adopts a new subgraph search algorithm using a novel data structure called path-tree, which is a tree structure composed of isomorphic graphs of query regulatory motifs. This algorithm was evaluated using various sizes of signaling networks generated from the integration of various human signaling pathways and it showed that the speed and scalability of this algorithm outperforms those of other algorithms. RMOD includes interactive analysis and auxiliary tools that make it possible to manipulate the whole processes from building signaling network and query regulatory motifs to analyzing regulatory motifs with graphical illustration and summarized descriptions. As a result, RMOD provides an integrated view of the regulatory motifs and mechanism underlying their regulatory motif activities within the signaling network. RMOD is freely accessible online at the following URL: http://pks.kaist.ac.kr/rmod.
DNA regulatory motif selection based on support vector machine ...
African Journals Online (AJOL)
... machine (SVM) and its application in microarray experiment of Kashin-Beck disease. ... speed and amount of the corresponding mRNA in gene replication process. ... and revealed that some motifs may be related to the immune reactions.
A novel pseudo-complementary PNA G-C base pair
DEFF Research Database (Denmark)
Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn
2011-01-01
Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...
Identification of sequence motifs significantly associated with antisense activity
Directory of Open Access Journals (Sweden)
Peek Andrew S
2007-06-01
Full Text Available Abstract Background Predicting the suppression activity of antisense oligonucleotide sequences is the main goal of the rational design of nucleic acids. To create an effective predictive model, it is important to know what properties of an oligonucleotide sequence associate significantly with antisense activity. Also, for the model to be efficient we must know what properties do not associate significantly and can be omitted from the model. This paper will discuss the results of a randomization procedure to find motifs that associate significantly with either high or low antisense suppression activity, analysis of their properties, as well as the results of support vector machine modelling using these significant motifs as features. Results We discovered 155 motifs that associate significantly with high antisense suppression activity and 202 motifs that associate significantly with low suppression activity. The motifs range in length from 2 to 5 bases, contain several motifs that have been previously discovered as associating highly with antisense activity, and have thermodynamic properties consistent with previous work associating thermodynamic properties of sequences with their antisense activity. Statistical analysis revealed no correlation between a motif's position within an antisense sequence and that sequences antisense activity. Also, many significant motifs existed as subwords of other significant motifs. Support vector regression experiments indicated that the feature set of significant motifs increased correlation compared to all possible motifs as well as several subsets of the significant motifs. Conclusion The thermodynamic properties of the significantly associated motifs support existing data correlating the thermodynamic properties of the antisense oligonucleotide with antisense efficiency, reinforcing our hypothesis that antisense suppression is strongly associated with probe/target thermodynamics, as there are no enzymatic
Evolutionarily conserved bias of amino-acid usage refines the definition of PDZ-binding motif
Directory of Open Access Journals (Sweden)
Launey Thomas
2011-06-01
Full Text Available Abstract Background The interactions between PDZ (PSD-95, Dlg, ZO-1 domains and PDZ-binding motifs play central roles in signal transductions within cells. Proteins with PDZ domains bind to PDZ-binding motifs almost exclusively when the motifs are located at the carboxyl (C- terminal ends of their binding partners. However, it remains little explored whether PDZ-binding motifs show any preferential location at the C-terminal ends of proteins, at genome-level. Results Here, we examined the distribution of the type-I (x-x-S/T-x-I/L/V or type-II (x-x-V-x-I/V PDZ-binding motifs in proteins encoded in the genomes of five different species (human, mouse, zebrafish, fruit fly and nematode. We first established that these PDZ-binding motifs are indeed preferentially present at their C-terminal ends. Moreover, we found specific amino acid (AA bias for the 'x' positions in the motifs at the C-terminal ends. In general, hydrophilic AAs were favored. Our genomics-based findings confirm and largely extend the results of previous interaction-based studies, allowing us to propose refined consensus sequences for all of the examined PDZ-binding motifs. An ontological analysis revealed that the refined motifs are functionally relevant since a large fraction of the proteins bearing the motif appear to be involved in signal transduction. Furthermore, co-precipitation experiments confirmed two new protein interactions predicted by our genomics-based approach. Finally, we show that influenza virus pathogenicity can be correlated with PDZ-binding motif, with high-virulence viral proteins bearing a refined PDZ-binding motif. Conclusions Our refined definition of PDZ-binding motifs should provide important clues for identifying functional PDZ-binding motifs and proteins involved in signal transduction.
Direct AUC optimization of regulatory motifs.
Zhu, Lin; Zhang, Hong-Bo; Huang, De-Shuang
2017-07-15
The discovery of transcription factor binding site (TFBS) motifs is essential for untangling the complex mechanism of genetic variation under different developmental and environmental conditions. Among the huge amount of computational approaches for de novo identification of TFBS motifs, discriminative motif learning (DML) methods have been proven to be promising for harnessing the discovery power of accumulated huge amount of high-throughput binding data. However, they have to sacrifice accuracy for speed and could fail to fully utilize the information of the input sequences. We propose a novel algorithm called CDAUC for optimizing DML-learned motifs based on the area under the receiver-operating characteristic curve (AUC) criterion, which has been widely used in the literature to evaluate the significance of extracted motifs. We show that when the considered AUC loss function is optimized in a coordinate-wise manner, the cost function of each resultant sub-problem is a piece-wise constant function, whose optimal value can be found exactly and efficiently. Further, a key step of each iteration of CDAUC can be efficiently solved as a computational geometry problem. Experimental results on real world high-throughput datasets illustrate that CDAUC outperforms competing methods for refining DML motifs, while being one order of magnitude faster. Meanwhile, preliminary results also show that CDAUC may also be useful for improving the interpretability of convolutional kernels generated by the emerging deep learning approaches for predicting TF sequences specificities. CDAUC is available at: https://drive.google.com/drive/folders/0BxOW5MtIZbJjNFpCeHlBVWJHeW8 . dshuang@tongji.edu.cn. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
Wang, Yin; Li, Rudong; Zhou, Yuhua; Ling, Zongxin; Guo, Xiaokui; Xie, Lu; Liu, Lei
2016-01-01
Text data of 16S rRNA are informative for classifications of microbiota-associated diseases. However, the raw text data need to be systematically processed so that features for classification can be defined/extracted; moreover, the high-dimension feature spaces generated by the text data also pose an additional difficulty. Here we present a Phylogenetic Tree-Based Motif Finding algorithm (PMF) to analyze 16S rRNA text data. By integrating phylogenetic rules and other statistical indexes for classification, we can effectively reduce the dimension of the large feature spaces generated by the text datasets. Using the retrieved motifs in combination with common classification methods, we can discriminate different samples of both pneumonia and dental caries better than other existing methods. We extend the phylogenetic approaches to perform supervised learning on microbiota text data to discriminate the pathological states for pneumonia and dental caries. The results have shown that PMF may enhance the efficiency and reliability in analyzing high-dimension text data.
Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine
Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.
2006-01-01
Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which
International Nuclear Information System (INIS)
Staiger, D.; Kaulen, H.; Schell, J.
1989-01-01
In the chalcone synthase gene of Antirrhinum majus (snapdragon), 150 base pairs of the 5' flanking region contain cis-acting signals for UV light-induced expression. A nuclear factor, designated CG-1, specifically recognizes a hexameric motif with internal dyad symmetry, CACGTG, located within this light-responsive sequence. Binding of CG-1 is influenced by C-methylation of the CpG dinucleotide in the recognition sequence. CG-1 is a factor found in a variety of dicotyledonous plant species including Nicotiana tabacum, A. majus, Petunia hybrida, Arabidopsis thaliana, and Glycine max. CACGTG motifs contained within trans-acting factor recognition sites in various other plant promoters can interact with CG-1. In addition, the binding site of the human adenovirus major late transcription factor USF can compete for CG-1 binding to the chalcone synthase promoter. This suggests an evolutionary conservation of trans-acting factor recognition sites involved in divergent mechanisms of gene control. (author)
Envisaging quantum transport phenomenon in a muddled base pair of DNA
Vohra, Rajan; Sawhney, Ravinder Singh
2018-05-01
The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.
The MHC motif viewer: a visualization tool for MHC binding motifs
DEFF Research Database (Denmark)
Rapin, Nicolas; Hoof, Ilka; Lund, Ole
2010-01-01
is hampered by the lack of tools for browsing and comparing specificity of these molecules. We have developed a Web server, MHC Motif Viewer, which allows the display of the binding motif for MHC class I proteins for human, chimpanzee, rhesus monkey, mouse, and swine, as well as HLA-DR protein sequences...
Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P
2015-02-10
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.
2016-01-01
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825
DNA motif elucidation using belief propagation.
Wong, Ka-Chun; Chan, Tak-Ming; Peng, Chengbin; Li, Yue; Zhang, Zhaolei
2013-09-01
Protein-binding microarray (PBM) is a high-throughout platform that can measure the DNA-binding preference of a protein in a comprehensive and unbiased manner. A typical PBM experiment can measure binding signal intensities of a protein to all the possible DNA k-mers (k=8∼10); such comprehensive binding affinity data usually need to be reduced and represented as motif models before they can be further analyzed and applied. Since proteins can often bind to DNA in multiple modes, one of the major challenges is to decompose the comprehensive affinity data into multimodal motif representations. Here, we describe a new algorithm that uses Hidden Markov Models (HMMs) and can derive precise and multimodal motifs using belief propagations. We describe an HMM-based approach using belief propagations (kmerHMM), which accepts and preprocesses PBM probe raw data into median-binding intensities of individual k-mers. The k-mers are ranked and aligned for training an HMM as the underlying motif representation. Multiple motifs are then extracted from the HMM using belief propagations. Comparisons of kmerHMM with other leading methods on several data sets demonstrated its effectiveness and uniqueness. Especially, it achieved the best performance on more than half of the data sets. In addition, the multiple binding modes derived by kmerHMM are biologically meaningful and will be useful in interpreting other genome-wide data such as those generated from ChIP-seq. The executables and source codes are available at the authors' websites: e.g. http://www.cs.toronto.edu/∼wkc/kmerHMM.
DNA motif elucidation using belief propagation
Wong, Ka-Chun; Chan, Tak-Ming; Peng, Chengbin; Li, Yue; Zhang, Zhaolei
2013-01-01
Protein-binding microarray (PBM) is a high-throughout platform that can measure the DNA-binding preference of a protein in a comprehensive and unbiased manner. A typical PBM experiment can measure binding signal intensities of a protein to all the possible DNA k-mers (k = 8 ?10); such comprehensive binding affinity data usually need to be reduced and represented as motif models before they can be further analyzed and applied. Since proteins can often bind to DNA in multiple modes, one of the major challenges is to decompose the comprehensive affinity data into multimodal motif representations. Here, we describe a new algorithm that uses Hidden Markov Models (HMMs) and can derive precise and multimodal motifs using belief propagations. We describe an HMM-based approach using belief propagations (kmerHMM), which accepts and preprocesses PBM probe raw data into median-binding intensities of individual k-mers. The k-mers are ranked and aligned for training an HMM as the underlying motif representation. Multiple motifs are then extracted from the HMM using belief propagations. Comparisons of kmerHMM with other leading methods on several data sets demonstrated its effectiveness and uniqueness. Especially, it achieved the best performance on more than half of the data sets. In addition, the multiple binding modes derived by kmerHMM are biologically meaningful and will be useful in interpreting other genome-wide data such as those generated from ChIP-seq. The executables and source codes are available at the authors' websites: e.g. http://www.cs.toronto.edu/?wkc/kmerHMM. 2013 The Author(s).
DNA motif elucidation using belief propagation
Wong, Ka-Chun
2013-06-29
Protein-binding microarray (PBM) is a high-throughout platform that can measure the DNA-binding preference of a protein in a comprehensive and unbiased manner. A typical PBM experiment can measure binding signal intensities of a protein to all the possible DNA k-mers (k = 8 ?10); such comprehensive binding affinity data usually need to be reduced and represented as motif models before they can be further analyzed and applied. Since proteins can often bind to DNA in multiple modes, one of the major challenges is to decompose the comprehensive affinity data into multimodal motif representations. Here, we describe a new algorithm that uses Hidden Markov Models (HMMs) and can derive precise and multimodal motifs using belief propagations. We describe an HMM-based approach using belief propagations (kmerHMM), which accepts and preprocesses PBM probe raw data into median-binding intensities of individual k-mers. The k-mers are ranked and aligned for training an HMM as the underlying motif representation. Multiple motifs are then extracted from the HMM using belief propagations. Comparisons of kmerHMM with other leading methods on several data sets demonstrated its effectiveness and uniqueness. Especially, it achieved the best performance on more than half of the data sets. In addition, the multiple binding modes derived by kmerHMM are biologically meaningful and will be useful in interpreting other genome-wide data such as those generated from ChIP-seq. The executables and source codes are available at the authors\\' websites: e.g. http://www.cs.toronto.edu/?wkc/kmerHMM. 2013 The Author(s).
Panczyk, Tomasz; Wolski, Pawel
2018-06-01
This work deals with a molecular dynamics analysis of the protonated and deprotonated states of the natural sequence d[(CCCTAA) 3 CCCT] of the telomeric DNA forming the intercalated i-motif or paired with the sequence d[(CCCTAA) 3 CCCT] and forming the Watson-Crick (WC) duplex. By utilizing the amber force field for nucleic acids we built the i-motif and the WC duplex either with native cytosines or using their protonated forms. We studied, by applying molecular dynamics simulations, the role of hydrogen bonds between cytosines or in cytosine-guanine pairs in the stabilization of both structures in the physiological fluid. We found that hydrogen bonds exist in the case of protonated i-motif and in the standard form of the WC duplex. They, however, vanish in the case of the deprotonated i-motif and protonated form of the WC duplex. By determining potentials of mean force in the enforced unwrapping of these structures we found that the protonated i-motif is thermodynamically the most stable. Its deprotonation leads to spontaneous and observed directly in the unbiased calculations unfolding of the i-motif to the hairpin structure at normal temperature. The WC duplex is stable in its standard form and its slight destabilization is observed at the acidic pH. However, the protonated WC duplex unwraps very slowly at 310 K and its decomposition was not observed in the unbiased calculations. At higher temperatures (ca. 400 K or more) the WC duplex unwraps spontaneously. Copyright © 2018. Published by Elsevier B.V.
Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo
2012-11-01
Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier
CMD: A Database to Store the Bonding States of Cysteine Motifs with Secondary Structures
Directory of Open Access Journals (Sweden)
Hamed Bostan
2012-01-01
Full Text Available Computational approaches to the disulphide bonding state and its connectivity pattern prediction are based on various descriptors. One descriptor is the amino acid sequence motifs flanking the cysteine residue motifs. Despite the existence of disulphide bonding information in many databases and applications, there is no complete reference and motif query available at the moment. Cysteine motif database (CMD is the first online resource that stores all cysteine residues, their flanking motifs with their secondary structure, and propensity values assignment derived from the laboratory data. We extracted more than 3 million cysteine motifs from PDB and UniProt data, annotated with secondary structure assignment, propensity value assignment, and frequency of occurrence and coefficiency of their bonding status. Removal of redundancies generated 15875 unique flanking motifs that are always bonded and 41577 unique patterns that are always nonbonded. Queries are based on the protein ID, FASTA sequence, sequence motif, and secondary structure individually or in batch format using the provided APIs that allow remote users to query our database via third party software and/or high throughput screening/querying. The CMD offers extensive information about the bonded, free cysteine residues, and their motifs that allows in-depth characterization of the sequence motif composition.
CombiMotif: A new algorithm for network motifs discovery in protein-protein interaction networks
Luo, Jiawei; Li, Guanghui; Song, Dan; Liang, Cheng
2014-12-01
Discovering motifs in protein-protein interaction networks is becoming a current major challenge in computational biology, since the distribution of the number of network motifs can reveal significant systemic differences among species. However, this task can be computationally expensive because of the involvement of graph isomorphic detection. In this paper, we present a new algorithm (CombiMotif) that incorporates combinatorial techniques to count non-induced occurrences of subgraph topologies in the form of trees. The efficiency of our algorithm is demonstrated by comparing the obtained results with the current state-of-the art subgraph counting algorithms. We also show major differences between unicellular and multicellular organisms. The datasets and source code of CombiMotif are freely available upon request.
MSDmotif: exploring protein sites and motifs
Directory of Open Access Journals (Sweden)
Henrick Kim
2008-07-01
Full Text Available Abstract Background Protein structures have conserved features – motifs, which have a sufficient influence on the protein function. These motifs can be found in sequence as well as in 3D space. Understanding of these fragments is essential for 3D structure prediction, modelling and drug-design. The Protein Data Bank (PDB is the source of this information however present search tools have limited 3D options to integrate protein sequence with its 3D structure. Results We describe here a web application for querying the PDB for ligands, binding sites, small 3D structural and sequence motifs and the underlying database. Novel algorithms for chemical fragments, 3D motifs, ϕ/ψ sequences, super-secondary structure motifs and for small 3D structural motif associations searches are incorporated. The interface provides functionality for visualization, search criteria creation, sequence and 3D multiple alignment options. MSDmotif is an integrated system where a results page is also a search form. A set of motif statistics is available for analysis. This set includes molecule and motif binding statistics, distribution of motif sequences, occurrence of an amino-acid within a motif, correlation of amino-acids side-chain charges within a motif and Ramachandran plots for each residue. The binding statistics are presented in association with properties that include a ligand fragment library. Access is also provided through the distributed Annotation System (DAS protocol. An additional entry point facilitates XML requests with XML responses. Conclusion MSDmotif is unique by combining chemical, sequence and 3D data in a single search engine with a range of search and visualisation options. It provides multiple views of data found in the PDB archive for exploring protein structures.
Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA
International Nuclear Information System (INIS)
Mendel, D.; Dervan, P.B.
1987-01-01
Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired
Lee, Il Joon; Kim, Byeang Hyean
2012-02-18
Pairs of pyrene-modified deoxyadenosine ((Py)A) units induce a stable interstrand i-motif structure, which can be characterized by a change in the fluorescence λ(max), with an exciplex emission that is not observable in its single-strand structure. This journal is © The Royal Society of Chemistry 2012
WildSpan: mining structured motifs from protein sequences
Directory of Open Access Journals (Sweden)
Chen Chien-Yu
2011-03-01
Full Text Available Abstract Background Automatic extraction of motifs from biological sequences is an important research problem in study of molecular biology. For proteins, it is desired to discover sequence motifs containing a large number of wildcard symbols, as the residues associated with functional sites are usually largely separated in sequences. Discovering such patterns is time-consuming because abundant combinations exist when long gaps (a gap consists of one or more successive wildcards are considered. Mining algorithms often employ constraints to narrow down the search space in order to increase efficiency. However, improper constraint models might degrade the sensitivity and specificity of the motifs discovered by computational methods. We previously proposed a new constraint model to handle large wildcard regions for discovering functional motifs of proteins. The patterns that satisfy the proposed constraint model are called W-patterns. A W-pattern is a structured motif that groups motif symbols into pattern blocks interleaved with large irregular gaps. Considering large gaps reflects the fact that functional residues are not always from a single region of protein sequences, and restricting motif symbols into clusters corresponds to the observation that short motifs are frequently present within protein families. To efficiently discover W-patterns for large-scale sequence annotation and function prediction, this paper first formally introduces the problem to solve and proposes an algorithm named WildSpan (sequential pattern mining across large wildcard regions that incorporates several pruning strategies to largely reduce the mining cost. Results WildSpan is shown to efficiently find W-patterns containing conserved residues that are far separated in sequences. We conducted experiments with two mining strategies, protein-based and family-based mining, to evaluate the usefulness of W-patterns and performance of WildSpan. The protein-based mining mode
Motif-Based Text Mining of Microbial Metagenome Redundancy Profiling Data for Disease Classification
Directory of Open Access Journals (Sweden)
Yin Wang
2016-01-01
Full Text Available Background. Text data of 16S rRNA are informative for classifications of microbiota-associated diseases. However, the raw text data need to be systematically processed so that features for classification can be defined/extracted; moreover, the high-dimension feature spaces generated by the text data also pose an additional difficulty. Results. Here we present a Phylogenetic Tree-Based Motif Finding algorithm (PMF to analyze 16S rRNA text data. By integrating phylogenetic rules and other statistical indexes for classification, we can effectively reduce the dimension of the large feature spaces generated by the text datasets. Using the retrieved motifs in combination with common classification methods, we can discriminate different samples of both pneumonia and dental caries better than other existing methods. Conclusions. We extend the phylogenetic approaches to perform supervised learning on microbiota text data to discriminate the pathological states for pneumonia and dental caries. The results have shown that PMF may enhance the efficiency and reliability in analyzing high-dimension text data.
Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex
International Nuclear Information System (INIS)
Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.
1989-01-01
The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed
Statistical tests to compare motif count exceptionalities
Directory of Open Access Journals (Sweden)
Vandewalle Vincent
2007-03-01
Full Text Available Abstract Background Finding over- or under-represented motifs in biological sequences is now a common task in genomics. Thanks to p-value calculation for motif counts, exceptional motifs are identified and represent candidate functional motifs. The present work addresses the related question of comparing the exceptionality of one motif in two different sequences. Just comparing the motif count p-values in each sequence is indeed not sufficient to decide if this motif is significantly more exceptional in one sequence compared to the other one. A statistical test is required. Results We develop and analyze two statistical tests, an exact binomial one and an asymptotic likelihood ratio test, to decide whether the exceptionality of a given motif is equivalent or significantly different in two sequences of interest. For that purpose, motif occurrences are modeled by Poisson processes, with a special care for overlapping motifs. Both tests can take the sequence compositions into account. As an illustration, we compare the octamer exceptionalities in the Escherichia coli K-12 backbone versus variable strain-specific loops. Conclusion The exact binomial test is particularly adapted for small counts. For large counts, we advise to use the likelihood ratio test which is asymptotic but strongly correlated with the exact binomial test and very simple to use.
Brovarets', O O
2013-01-01
At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.
Cooperative interactions between paired domain and homeodomain.
Jun, S; Desplan, C
1996-09-01
The Pax proteins are a family of transcriptional regulators involved in many developmental processes in all higher eukaryotes. They are characterized by the presence of a paired domain (PD), a bipartite DNA binding domain composed of two helix-turn-helix (HTH) motifs,the PAI and RED domains. The PD is also often associated with a homeodomain (HD) which is itself able to form homo- and hetero-dimers on DNA. Many of these proteins therefore contain three HTH motifs each able to recognize DNA. However, all PDs recognize highly related DNA sequences, and most HDs also recognize almost identical sites. We show here that different Pax proteins use multiple combinations of their HTHs to recognize several types of target sites. For instance, the Drosophila Paired protein can bind, in vitro, exclusively through its PAI domain, or through a dimer of its HD, or through cooperative interaction between PAI domain and HD. However, prd function in vivo requires the synergistic action of both the PAI domain and the HD. Pax proteins with only a PD appear to require both PAI and RED domains, while a Pax-6 isoform and a new Pax protein, Lune, may rely on the RED domain and HD. We propose a model by which Pax proteins recognize different target genes in vivo through various combinations of their DNA binding domains, thus expanding their recognition repertoire.
Positional bias of general and tissue-specific regulatory motifs in mouse gene promoters
Directory of Open Access Journals (Sweden)
Farré Domènec
2007-12-01
Full Text Available Abstract Background The arrangement of regulatory motifs in gene promoters, or promoter architecture, is the result of mutation and selection processes that have operated over many millions of years. In mammals, tissue-specific transcriptional regulation is related to the presence of specific protein-interacting DNA motifs in gene promoters. However, little is known about the relative location and spacing of these motifs. To fill this gap, we have performed a systematic search for motifs that show significant bias at specific promoter locations in a large collection of housekeeping and tissue-specific genes. Results We observe that promoters driving housekeeping gene expression are enriched in particular motifs with strong positional bias, such as YY1, which are of little relevance in promoters driving tissue-specific expression. We also identify a large number of motifs that show positional bias in genes expressed in a highly tissue-specific manner. They include well-known tissue-specific motifs, such as HNF1 and HNF4 motifs in liver, kidney and small intestine, or RFX motifs in testis, as well as many potentially novel regulatory motifs. Based on this analysis, we provide predictions for 559 tissue-specific motifs in mouse gene promoters. Conclusion The study shows that motif positional bias is an important feature of mammalian proximal promoters and that it affects both general and tissue-specific motifs. Motif positional constraints define very distinct promoter architectures depending on breadth of expression and type of tissue.
PISMA: A Visual Representation of Motif Distribution in DNA Sequences
Directory of Open Access Journals (Sweden)
Rogelio Alcántara-Silva
2017-03-01
Full Text Available Background: Because the graphical presentation and analysis of motif distribution can provide insights for experimental hypothesis, PISMA aims at identifying motifs on DNA sequences, counting and showing them graphically. The motif length ranges from 2 to 10 bases, and the DNA sequences range up to 10 kb. The motif distribution is shown as a bar-code–like, as a gene-map–like, and as a transcript scheme. Results: We obtained graphical schemes of the CpG site distribution from 91 human papillomavirus genomes. Also, we present 2 analyses: one of DNA motifs associated with either methylation-resistant or methylation-sensitive CpG islands and another analysis of motifs associated with exosome RNA secretion. Availability and Implementation: PISMA is developed in Java; it is executable in any type of hardware and in diverse operating systems. PISMA is freely available to noncommercial users. The English version and the User Manual are provided in Supplementary Files 1 and 2, and a Spanish version is available at www.biomedicas.unam.mx/wp-content/software/pisma.zip and www.biomedicas.unam.mx/wp-content/pdf/manual/pisma.pdf .
Identity and functions of CxxC-derived motifs.
Fomenko, Dmitri E; Gladyshev, Vadim N
2003-09-30
Two cysteines separated by two other residues (the CxxC motif) are employed by many redox proteins for formation, isomerization, and reduction of disulfide bonds and for other redox functions. The place of the C-terminal cysteine in this motif may be occupied by serine (the CxxS motif), modifying the functional repertoire of redox proteins. Here we found that the CxxC motif may also give rise to a motif, in which the C-terminal cysteine is replaced with threonine (the CxxT motif). Moreover, in contrast to a view that the N-terminal cysteine in the CxxC motif always serves as a nucleophilic attacking group, this residue could also be replaced with threonine (the TxxC motif), serine (the SxxC motif), or other residues. In each of these CxxC-derived motifs, the presence of a downstream alpha-helix was strongly favored. A search for conserved CxxC-derived motif/helix patterns in four complete genomes representing bacteria, archaea, and eukaryotes identified known redox proteins and suggested possible redox functions for several additional proteins. Catalytic sites in peroxiredoxins were major representatives of the TxxC motif, whereas those in glutathione peroxidases represented the CxxT motif. Structural assessments indicated that threonines in these enzymes could stabilize catalytic thiolates, suggesting revisions to previously proposed catalytic triads. Each of the CxxC-derived motifs was also observed in natural selenium-containing proteins, in which selenocysteine was present in place of a catalytic cysteine.
Motif decomposition of the phosphotyrosine proteome reveals a new N-terminal binding motif for SHIP2
DEFF Research Database (Denmark)
Miller, Martin Lee; Hanke, S.; Hinsby, A. M.
2008-01-01
set of 481 unique phosphotyrosine (Tyr(P)) peptides by sequence similarity to known ligands of the Src homology 2 (SH2) and the phosphotyrosine binding (PTB) domains. From 20 clusters we extracted 16 known and four new interaction motifs. Using quantitative mass spectrometry we pulled down Tyr......(P)-specific binding partners for peptides corresponding to the extracted motifs. We confirmed numerous previously known interaction motifs and found 15 new interactions mediated by phosphosites not previously known to bind SH2 or PTB. Remarkably, a novel hydrophobic N-terminal motif ((L/V/I)(L/V/I)pY) was identified...
Phyloproteomic Analysis of 11780 Six-Residue-Long Motifs Occurrences
Directory of Open Access Journals (Sweden)
O. V. Galzitskaya
2015-01-01
Full Text Available How is it possible to find good traits for phylogenetic reconstructions? Here, we present a new phyloproteomic criterion that is an occurrence of simple motifs which can be imprints of evolution history. We studied the occurrences of 11780 six-residue-long motifs consisting of two randomly located amino acids in 97 eukaryotic and 25 bacterial proteomes. For all eukaryotic proteomes, with the exception of the Amoebozoa, Stramenopiles, and Diplomonadida kingdoms, the number of proteins containing the motifs from the first group (one of the two amino acids occurs once at the terminal position made about 20%; in the case of motifs from the second (one of two amino acids occurs one time within the pattern and third (the two amino acids occur randomly groups, 30% and 50%, respectively. For bacterial proteomes, this relationship was 10%, 27%, and 63%, respectively. The matrices of correlation coefficients between numbers of proteins where a motif from the set of 11780 motifs appears at least once in 9 kingdoms and 5 phyla of bacteria were calculated. Among the correlation coefficients for eukaryotic proteomes, the correlation between the animal and fungi kingdoms (0.62 is higher than between fungi and plants (0.54. Our study provides support that animals and fungi are sibling kingdoms. Comparison of the frequencies of six-residue-long motifs in different proteomes allows obtaining phylogenetic relationships based on similarities between these frequencies: the Diplomonadida kingdoms are more close to Bacteria than to Eukaryota; Stramenopiles and Amoebozoa are more close to each other than to other kingdoms of Eukaryota.
A speedup technique for (l, d-motif finding algorithms
Directory of Open Access Journals (Sweden)
Dinh Hieu
2011-03-01
Full Text Available Abstract Background The discovery of patterns in DNA, RNA, and protein sequences has led to the solution of many vital biological problems. For instance, the identification of patterns in nucleic acid sequences has resulted in the determination of open reading frames, identification of promoter elements of genes, identification of intron/exon splicing sites, identification of SH RNAs, location of RNA degradation signals, identification of alternative splicing sites, etc. In protein sequences, patterns have proven to be extremely helpful in domain identification, location of protease cleavage sites, identification of signal peptides, protein interactions, determination of protein degradation elements, identification of protein trafficking elements, etc. Motifs are important patterns that are helpful in finding transcriptional regulatory elements, transcription factor binding sites, functional genomics, drug design, etc. As a result, numerous papers have been written to solve the motif search problem. Results Three versions of the motif search problem have been proposed in the literature: Simple Motif Search (SMS, (l, d-motif search (or Planted Motif Search (PMS, and Edit-distance-based Motif Search (EMS. In this paper we focus on PMS. Two kinds of algorithms can be found in the literature for solving the PMS problem: exact and approximate. An exact algorithm identifies the motifs always and an approximate algorithm may fail to identify some or all of the motifs. The exact version of PMS problem has been shown to be NP-hard. Exact algorithms proposed in the literature for PMS take time that is exponential in some of the underlying parameters. In this paper we propose a generic technique that can be used to speedup PMS algorithms. Conclusions We present a speedup technique that can be used on any PMS algorithm. We have tested our speedup technique on a number of algorithms. These experimental results show that our speedup technique is indeed very
Gerevich, József
2015-01-01
One of the basic questions of the art psychology is whether a personal motif is to be found behind works of art and if so, how openly or indirectly it appears in the work itself. Analysis of examples and documents from the fine arts and literature allow us to conclude that the personal motif that can be identified by the viewer through symbols, at times easily at others with more difficulty, gives an emotional plus to the artistic product. The personal motif may be found in traumatic experiences, in communication to the model or with other emotionally important persons (mourning, disappointment, revenge, hatred, rivalry, revolt etc.), in self-searching, or self-analysis. The emotions are expressed in artistic activity either directly or indirectly. The intention nourished by the artist's identity (Kunstwollen) may stand in the way of spontaneous self-expression, channelling it into hidden paths. Under the influence of certain circumstances, the artist may arouse in the viewer, consciously or unconsciously, an illusionary, misleading image of himself. An examination of the personal motif is one of the important research areas of art therapy.
Temporal motifs in time-dependent networks
International Nuclear Information System (INIS)
Kovanen, Lauri; Karsai, Márton; Kaski, Kimmo; Kertész, János; Saramäki, Jari
2011-01-01
Temporal networks are commonly used to represent systems where connections between elements are active only for restricted periods of time, such as telecommunication, neural signal processing, biochemical reaction and human social interaction networks. We introduce the framework of temporal motifs to study the mesoscale topological–temporal structure of temporal networks in which the events of nodes do not overlap in time. Temporal motifs are classes of similar event sequences, where the similarity refers not only to topology but also to the temporal order of the events. We provide a mapping from event sequences to coloured directed graphs that enables an efficient algorithm for identifying temporal motifs. We discuss some aspects of temporal motifs, including causality and null models, and present basic statistics of temporal motifs in a large mobile call network
Blatti, Charles; Sinha, Saurabh
2014-07-01
The Motif Enrichment Tool (MET) provides an online interface that enables users to find major transcriptional regulators of their gene sets of interest. MET searches the appropriate regulatory region around each gene and identifies which transcription factor DNA-binding specificities (motifs) are statistically overrepresented. Motif enrichment analysis is currently available for many metazoan species including human, mouse, fruit fly, planaria and flowering plants. MET also leverages high-throughput experimental data such as ChIP-seq and DNase-seq from ENCODE and ModENCODE to identify the regulatory targets of a transcription factor with greater precision. The results from MET are produced in real time and are linked to a genome browser for easy follow-up analysis. Use of the web tool is free and open to all, and there is no login requirement. ADDRESS: http://veda.cs.uiuc.edu/MET/. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Gene Isolation Using Degenerate Primers Targeting Protein Motif: A Laboratory Exercise
Yeo, Brandon Pei Hui; Foong, Lian Chee; Tam, Sheh May; Lee, Vivian; Hwang, Siaw San
2018-01-01
Structures and functions of protein motifs are widely included in many biology-based course syllabi. However, little emphasis is placed to link this knowledge to applications in biotechnology to enhance the learning experience. Here, the conserved motifs of nucleotide binding site-leucine rich repeats (NBS-LRR) proteins, successfully used for the…
Anion induced conformational preference of Cα NN motif residues in functional proteins.
Patra, Piya; Ghosh, Mahua; Banerjee, Raja; Chakrabarti, Jaydeb
2017-12-01
Among different ligand binding motifs, anion binding C α NN motif consisting of peptide backbone atoms of three consecutive residues are observed to be important for recognition of free anions, like sulphate or biphosphate and participate in different key functions. Here we study the interaction of sulphate and biphosphate with C α NN motif present in different proteins. Instead of total protein, a peptide fragment has been studied keeping C α NN motif flanked in between other residues. We use classical force field based molecular dynamics simulations to understand the stability of this motif. Our data indicate fluctuations in conformational preferences of the motif residues in absence of the anion. The anion gives stability to one of these conformations. However, the anion induced conformational preferences are highly sequence dependent and specific to the type of anion. In particular, the polar residues are more favourable compared to the other residues for recognising the anion. © 2017 Wiley Periodicals, Inc.
Finding a Leucine in a Haystack: Searching the Proteome for ambigous Leucine-Aspartic Acid motifs
Arold, Stefan T.
2016-01-25
Leucine-aspartic acid (LD) motifs are short helical protein-protein interaction motifs involved in cell motility, survival and communication. LD motif interactions are also implicated in cancer metastasis and are targeted by several viruses. LD motifs are notoriously difficult to detect because sequence pattern searches lead to an excessively high number of false positives. Hence, despite 20 years of research, only six LD motif–containing proteins are known in humans, three of which are close homologues of the paxillin family. To enable the proteome-wide discovery of LD motifs, we developed LD Motif Finder (LDMF), a web tool based on machine learning that combines sequence information with structural predictions to detect LD motifs with high accuracy. LDMF predicted 13 new LD motifs in humans. Using biophysical assays, we experimentally confirmed in vitro interactions for four novel LD motif proteins. Thus, LDMF allows proteome-wide discovery of LD motifs, despite a highly ambiguous sequence pattern. Functional implications will be discussed.
Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise
International Nuclear Information System (INIS)
Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael
2009-01-01
The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.
Low-dimensional morphospace of topological motifs in human fMRI brain networks
Directory of Open Access Journals (Sweden)
Sarah E. Morgan
2018-06-01
Full Text Available We present a low-dimensional morphospace of fMRI brain networks, where axes are defined in a data-driven manner based on the network motifs. The morphospace allows us to identify the key variations in healthy fMRI networks in terms of their underlying motifs, and we observe that two principal components (PCs can account for 97% of the motif variability. The first PC of the motif distribution is correlated with efficiency and inversely correlated with transitivity. Hence this axis approximately conforms to the well-known economical small-world trade-off between integration and segregation in brain networks. Finally, we show that the economical clustering generative model proposed by Vértes et al. (2012 can approximately reproduce the motif morphospace of the real fMRI brain networks, in contrast to other generative models. Overall, the motif morphospace provides a powerful way to visualize the relationships between network properties and to investigate generative or constraining factors in the formation of complex human brain functional networks. Motifs have been described as the building blocks of complex networks. Meanwhile, a morphospace allows networks to be placed in a common space and can reveal the relationships between different network properties and elucidate the driving forces behind network topology. We combine the concepts of motifs and morphospaces to create the first motif morphospace of fMRI brain networks. Crucially, the morphospace axes are defined by the motifs, in a data-driven manner. We observe strong correlations between the networks’ positions in morphospace and their global topological properties, suggesting that motif morphospaces are a powerful way to capture the topology of networks in a low-dimensional space and to compare generative models of brain networks. Motif morphospaces could also be used to study other complex networks’ topologies.
Discovery of cell-type specific DNA motif grammar in cis-regulatory elements using random Forest.
Wang, Xin; Lin, Peijie; Ho, Joshua W K
2018-01-19
It has been observed that many transcription factors (TFs) can bind to different genomic loci depending on the cell type in which a TF is expressed in, even though the individual TF usually binds to the same core motif in different cell types. How a TF can bind to the genome in such a highly cell-type specific manner, is a critical research question. One hypothesis is that a TF requires co-binding of different TFs in different cell types. If this is the case, it may be possible to observe different combinations of TF motifs - a motif grammar - located at the TF binding sites in different cell types. In this study, we develop a bioinformatics method to systematically identify DNA motifs in TF binding sites across multiple cell types based on published ChIP-seq data, and address two questions: (1) can we build a machine learning classifier to predict cell-type specificity based on motif combinations alone, and (2) can we extract meaningful cell-type specific motif grammars from this classifier model. We present a Random Forest (RF) based approach to build a multi-class classifier to predict the cell-type specificity of a TF binding site given its motif content. We applied this RF classifier to two published ChIP-seq datasets of TF (TCF7L2 and MAX) across multiple cell types. Using cross-validation, we show that motif combinations alone are indeed predictive of cell types. Furthermore, we present a rule mining approach to extract the most discriminatory rules in the RF classifier, thus allowing us to discover the underlying cell-type specific motif grammar. Our bioinformatics analysis supports the hypothesis that combinatorial TF motif patterns are cell-type specific.
UKIRAN KERAWANG ACEH GAYO SEBAGAI INSPIRASI PENCIPTAAN MOTIF BATIK KHAS GAYO
Directory of Open Access Journals (Sweden)
Irfa ina Rohana Salma
2016-12-01
Full Text Available ABSTRAK Industri batik mulai berkembang di Gayo, tetapi belum memiliki motif batik khas daerah. Oleh karena itu perlu diciptakan motif batik khas Gayo, dengan mengambil inspirasi dari ukiran yang terdapat pada rumah tradisional yang biasa disebut ukiran kerawang Gayo. Tujuan penciptaan seni ini adalah untuk menciptakan motif batik yang memiliki ciri khas Gayo. Metode yang digunakan yaitu eksplorasi ide, perancangan, dan perwujudan menjadi motif batik. Dalam kegiatan ini telah diciptakan enam motif batik khas Gayo yaitu: (1 Motif Ceplok Gayo; (2 Motif Gayo Tegak; (3 Motif Gayo Lurus; (4 Motif Parang Gayo; (5 Motif Gayo Lembut; dan (6 Motif Geometris Gayo. Hasil uji kesukaan terhadap motif kepada lima puluh responden menunjukkan bahwa Motif Ceplok Gayo paling banyak dipilih oleh responden yaitu sebesar 19%, sedangkan Motif Parang Gayo 18%, Motif Gayo Lembut 17%, Motif Geometris Gayo 17%, Motif Gayo Lurus 15% dan Motif Gayo Tegak 14%. Rata-rata motif yang dihasilkan mendapatkan apresiasi yang baik dari responden, sehingga semua motif layak diproduksi sebagai batik khas Gayo.Kata kunci: batik Gayo, Motif Ceplok Gayo, Motif Parang Gayo.ABSTRACTBatik industry began to develop in Gayo, but have not had a typical batik motif itself. Therefore, it is necessary to create batik motifs of Gayo, by taking inspiration from the carvings found in traditional houses commonly called kerawang Gayo. The purpose of this art is to create motifs those have a Gayo characteristic. The method used are the idea exploration, design, and motifs embodiment. In this activity has created six Gayo batik motifs, namely: (1 Motif Ceplok Gayo; (2 Motif Gayo Tegak; (3 Motif GayoLurus; (4 Motif Parang Gayo; (5 Motif Gayo Lembut; dan (6 Motif Geometris Gayo. The test results fondness of the motives to fifty respondents indicated that the Motif Ceplok Gayo most preferred by respondents ie 19%, while Motif Parang Gayo 18%, Motif Gayo Lembut 17%, Motif Geometris Gayo 17%, Motif Gayo
Nomme, Julian; Renodon-Corniè re, Axelle; Asanomi, Yuya; Sakaguchi, Kazuyasu; Stasiak, Alicja Z; Stasiak, Andrzej; Norden, Bengt; Tran, Vinh; Takahashi, Masayuki
2010-01-01
We have previously shown that a 28-amino acid peptide derived from the BRC4 motif of BRCA2 tumor suppressor inhibits selectively human RAD51 recombinase (HsRad51). With the aim of designing better inhibitors for cancer treatment, we combined an in silico docking approach with in vitro biochemical testing to construct a highly efficient chimera peptide from eight existing human BRC motifs. We built a molecular model of all BRC motifs complexed with HsRad51 based on the crystal structure of the BRC4 motif-HsRad51 complex, computed the interaction energy of each residue in each BRC motif, and selected the best amino acid residue at each binding position. This analysis enabled us to propose four amino acid substitutions in the BRC4 motif. Three of these increased the inhibitory effect in vitro, and this effect was found to be additive. We thus obtained a peptide that is about 10 times more efficient in inhibiting HsRad51-ssDNA complex formation than the original peptide.
Nomme, Julian
2010-08-01
We have previously shown that a 28-amino acid peptide derived from the BRC4 motif of BRCA2 tumor suppressor inhibits selectively human RAD51 recombinase (HsRad51). With the aim of designing better inhibitors for cancer treatment, we combined an in silico docking approach with in vitro biochemical testing to construct a highly efficient chimera peptide from eight existing human BRC motifs. We built a molecular model of all BRC motifs complexed with HsRad51 based on the crystal structure of the BRC4 motif-HsRad51 complex, computed the interaction energy of each residue in each BRC motif, and selected the best amino acid residue at each binding position. This analysis enabled us to propose four amino acid substitutions in the BRC4 motif. Three of these increased the inhibitory effect in vitro, and this effect was found to be additive. We thus obtained a peptide that is about 10 times more efficient in inhibiting HsRad51-ssDNA complex formation than the original peptide.
DEFF Research Database (Denmark)
Andreatta, Massimo; Schafer-Nielsen, Claus; Lund, Ole
2011-01-01
Recent advances in high-throughput technologies have made it possible to generate both gene and protein sequence data at an unprecedented rate and scale thereby enabling entirely new "omics"-based approaches towards the analysis of complex biological processes. However, the amount and complexity...... to interpret large data sets. We have recently developed a method, NNAlign, which is generally applicable to any biological problem where quantitative peptide data is available. This method efficiently identifies underlying sequence patterns by simultaneously aligning peptide sequences and identifying motifs...... associated with quantitative readouts. Here, we provide a web-based implementation of NNAlign allowing non-expert end-users to submit their data (optionally adjusting method parameters), and in return receive a trained method (including a visual representation of the identified motif) that subsequently can...
Annotating RNA motifs in sequences and alignments.
Gardner, Paul P; Eldai, Hisham
2015-01-01
RNA performs a diverse array of important functions across all cellular life. These functions include important roles in translation, building translational machinery and maturing messenger RNA. More recent discoveries include the miRNAs and bacterial sRNAs that regulate gene expression, the thermosensors, riboswitches and other cis-regulatory elements that help prokaryotes sense their environment and eukaryotic piRNAs that suppress transposition. However, there can be a long period between the initial discovery of a RNA and determining its function. We present a bioinformatic approach to characterize RNA motifs, which are critical components of many RNA structure-function relationships. These motifs can, in some instances, provide researchers with functional hypotheses for uncharacterized RNAs. Moreover, we introduce a new profile-based database of RNA motifs--RMfam--and illustrate some applications for investigating the evolution and functional characterization of RNA. All the data and scripts associated with this work are available from: https://github.com/ppgardne/RMfam. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.
Hirao, Ichiro; Kimoto, Michiko
2012-01-01
Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.
Goncharova, Iryna
2014-01-24
Ag(I)-containing compounds are attractive as antibacterial and antifungal agents. The renewed interest in the application of silver(I) compounds has led to the need for detailed knowledge of the mechanism of their action. One of the possible ways is the coordination of Ag(I) to G-C pairs of DNA, where Ag(+) ions form Ag(I)-mediated base pairs and inhibit the transcription. Herein, a systematic chiroptical study on silver(I)-mediated homo and mixed pairs of the C-G complementary-base derivatives cytidine(C) and 5'-guanosine monophosphate(G) in water is presented. Ag(I)-mediated homo and hetero pairs of G and C and their self-assembled species were studied under two pH levels (7.0 and 10.0) by vibrational (VCD) and electronic circular dichroism(ECD). VCD was used for the first time in this field and showed itself to be a powerful method for obtaining specific structural information in solution. Based on results of the VCD experiments, the different geometries of the homo pairs were proposed under pH 7.0 and 10.0. ECD was used as a diagnostic tool to characterize the studied systems and as a contact point between the previously defined structures of the metal or proton mediated pairs of nucleobases and the systems studied here. On the basis of the obtained data, the formation of the self-assembled species of cytidine with a structure similar to the i-motif structure in DNA was proposed at pH 10.0. Copyright © 2013 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Sergei Kuchin
2011-03-01
Full Text Available Explaining base pairing is an important element in teaching undergraduate genetics. I propose a teaching approach that aims to close the gap between the mantra “A pairs with T, and G pairs with C” and the “intimidating” chemical diagrams. The approach offers a set of simple “shorthands” for the key bases that can be used to quickly deduce all canonical and wobble pairs that the students need to know. The approach can be further developed to analyze mutagenic mismatch pairing.
Large-scale discovery of promoter motifs in Drosophila melanogaster.
Directory of Open Access Journals (Sweden)
Thomas A Down
2007-01-01
Full Text Available A key step in understanding gene regulation is to identify the repertoire of transcription factor binding motifs (TFBMs that form the building blocks of promoters and other regulatory elements. Identifying these experimentally is very laborious, and the number of TFBMs discovered remains relatively small, especially when compared with the hundreds of transcription factor genes predicted in metazoan genomes. We have used a recently developed statistical motif discovery approach, NestedMICA, to detect candidate TFBMs from a large set of Drosophila melanogaster promoter regions. Of the 120 motifs inferred in our initial analysis, 25 were statistically significant matches to previously reported motifs, while 87 appeared to be novel. Analysis of sequence conservation and motif positioning suggested that the great majority of these discovered motifs are predictive of functional elements in the genome. Many motifs showed associations with specific patterns of gene expression in the D. melanogaster embryo, and we were able to obtain confident annotation of expression patterns for 25 of our motifs, including eight of the novel motifs. The motifs are available through Tiffin, a new database of DNA sequence motifs. We have discovered many new motifs that are overrepresented in D. melanogaster promoter regions, and offer several independent lines of evidence that these are novel TFBMs. Our motif dictionary provides a solid foundation for further investigation of regulatory elements in Drosophila, and demonstrates techniques that should be applicable in other species. We suggest that further improvements in computational motif discovery should narrow the gap between the set of known motifs and the total number of transcription factors in metazoan genomes.
DEFF Research Database (Denmark)
Rapin, Nicolas Philippe Jean-Pierre; Hoof, Ilka; Lund, Ole
2008-01-01
. Algorithms that predict which peptides MHC molecules bind have recently been developed and cover many different alleles, but the utility of these algorithms is hampered by the lack of tools for browsing and comparing the specificity of these molecules. We have, therefore, developed a web server, MHC motif....... A special viewing feature, MHC fight, allows for display of the specificity of two different MHC molecules side by side. We show how the web server can be used to discover and display surprising similarities as well as differences between MHC molecules within and between different species. The MHC motif...
Memetic algorithms for de novo motif-finding in biomedical sequences.
Bi, Chengpeng
2012-09-01
The objectives of this study are to design and implement a new memetic algorithm for de novo motif discovery, which is then applied to detect important signals hidden in various biomedical molecular sequences. In this paper, memetic algorithms are developed and tested in de novo motif-finding problems. Several strategies in the algorithm design are employed that are to not only efficiently explore the multiple sequence local alignment space, but also effectively uncover the molecular signals. As a result, there are a number of key features in the implementation of the memetic motif-finding algorithm (MaMotif), including a chromosome replacement operator, a chromosome alteration-aware local search operator, a truncated local search strategy, and a stochastic operation of local search imposed on individual learning. To test the new algorithm, we compare MaMotif with a few of other similar algorithms using simulated and experimental data including genomic DNA, primary microRNA sequences (let-7 family), and transmembrane protein sequences. The new memetic motif-finding algorithm is successfully implemented in C++, and exhaustively tested with various simulated and real biological sequences. In the simulation, it shows that MaMotif is the most time-efficient algorithm compared with others, that is, it runs 2 times faster than the expectation maximization (EM) method and 16 times faster than the genetic algorithm-based EM hybrid. In both simulated and experimental testing, results show that the new algorithm is compared favorably or superior to other algorithms. Notably, MaMotif is able to successfully discover the transcription factors' binding sites in the chromatin immunoprecipitation followed by massively parallel sequencing (ChIP-Seq) data, correctly uncover the RNA splicing signals in gene expression, and precisely find the highly conserved helix motif in the transmembrane protein sequences, as well as rightly detect the palindromic segments in the primary micro
Deciphering functional glycosaminoglycan motifs in development.
Townley, Robert A; Bülow, Hannes E
2018-03-23
Glycosaminoglycans (GAGs) such as heparan sulfate, chondroitin/dermatan sulfate, and keratan sulfate are linear glycans, which when attached to protein backbones form proteoglycans. GAGs are essential components of the extracellular space in metazoans. Extensive modifications of the glycans such as sulfation, deacetylation and epimerization create structural GAG motifs. These motifs regulate protein-protein interactions and are thereby repsonsible for many of the essential functions of GAGs. This review focusses on recent genetic approaches to characterize GAG motifs and their function in defined signaling pathways during development. We discuss a coding approach for GAGs that would enable computational analyses of GAG sequences such as alignments and the computation of position weight matrices to describe GAG motifs. Copyright © 2018 Elsevier Ltd. All rights reserved.
Fitness for synchronization of network motifs
DEFF Research Database (Denmark)
Vega, Y.M.; Vázquez-Prada, M.; Pacheco, A.F.
2004-01-01
We study the synchronization of Kuramoto's oscillators in small parts of networks known as motifs. We first report on the system dynamics for the case of a scale-free network and show the existence of a non-trivial critical point. We compute the probability that network motifs synchronize, and fi...... that the fitness for synchronization correlates well with motifs interconnectedness and structural complexity. Possible implications for present debates about network evolution in biological and other systems are discussed....
Identification of group specific motifs in Beta-lactamase family of proteins
Directory of Open Access Journals (Sweden)
Saxena Akansha
2009-12-01
Full Text Available Abstract Background Beta-lactamases are one of the most serious threats to public health. In order to combat this threat we need to study the molecular and functional diversity of these enzymes and identify signatures specific to these enzymes. These signatures will enable us to develop inhibitors and diagnostic probes specific to lactamases. The existing classification of beta-lactamases was developed nearly 30 years ago when few lactamases were available. DLact database contain more than 2000 beta-lactamase, which can be used to study the molecular diversity and to identify signatures specific to this family. Methods A set of 2020 beta-lactamase proteins available in the DLact database http://59.160.102.202/DLact were classified using graph-based clustering of Best Bi-Directional Hits. Non-redundant (> 90 percent identical protein sequences from each group were aligned using T-Coffee and annotated using information available in literature. Motifs specific to each group were predicted using PRATT program. Results The graph-based classification of beta-lactamase proteins resulted in the formation of six groups (Four major groups containing 191, 726, 774 and 73 proteins while two minor groups containing 50 and 8 proteins. Based on the information available in literature, we found that each of the four major groups correspond to the four classes proposed by Ambler. The two minor groups were novel and do not contain molecular signatures of beta-lactamase proteins reported in literature. The group-specific motifs showed high sensitivity (> 70% and very high specificity (> 90%. The motifs from three groups (corresponding to class A, C and D had a high level of conservation at DNA as well as protein level whereas the motifs from the fourth group (corresponding to class B showed conservation at only protein level. Conclusion The graph-based classification of beta-lactamase proteins corresponds with the classification proposed by Ambler, thus there is
DEFF Research Database (Denmark)
Lauritsen, Jens Peter H; Bonefeld, Charlotte Menné; von Essen, Marina
2004-01-01
containing the di-leucine-based endocytosis motif of the TCR subunit CD3 gamma have indicated that the zeta chain can mask this motif. In this study, we show that successive truncations of the cytoplasmic tail of zeta led to reduced surface expression levels of completely assembled TCR complexes. The reduced...... TCR expression levels were caused by an increase in the TCR endocytic rate constant in combination with an unaffected exocytic rate constant. Furthermore, the TCR degradation rate constant was increased in cells with truncated zeta. Introduction of a CD3 gamma chain with a disrupted di-leucine...
Aplikasi Ornamen Khas Maluku untuk Pengembangan Desain Motif Batik
Directory of Open Access Journals (Sweden)
Masiswo Masiswo
2016-04-01
Full Text Available ABSTRAKMaluku memiliki banyak ragam hias budaya warisan nilai leluhur berupa ornamen etnis yang merupakan kesenian dan keterampilan kerajinan. Hasil warisan tersebut sampai saat ini masih lestari hidup serta dapat dinikmati sebagai konsumsi rohani yang memuaskan manusia. Berkaitan dengan keberlangsungan nilai-nilai tradisi etnis yang berwujud pada ornamen-ornamen daerah Maluku, maka dikembangkan untuk kebutuhan manusia berupa motif batik pada kain. Pengembangan ornamen ini lebih menekankan pada representasi akan bentuk-bentuk ornamen yang diterapkan pada kerajinan batik berupa motif khas Maluku. Pengembangan alternatif desain motif batik dibuat tiga variasi yang bersumber dari ornamen khas Maluku dibuat prototipe produknya dan diuji ketahanan luntur warnanya. Hasil uji ketahanan luntur warna terhadap gosokan basah dari tiga prototipe produk berpredikat baik sekali terdapat pada “Motif Siwa” dan predikat baik pada motif “Siwa Talang” dan motif “Matahari Siwa Talang”.Kata kunci: desain, Maluku, motif batik, ornamenABSTRACTMaluku has much decorative ancestral cultural heritage value in the form of ornament ethnic arts and crafts skills. The result of the legacy is still sustainable living can be enjoyed as well as satisfying spiritual human consumption.Related to the sustainability of traditional values in the form of ethnic ornaments Maluku, it was developed for human needs in the form of batik cloth . The development of these ornaments will be more emphasis on the representation forms of ornamentation that is applied to a batik motif Maluku. Development of alternative design motif made three variations. The development of three alternative design motifs derived from the Maluku ornaments made and tested a prototype product color fastness. The test results of color fastness to wet rubbing of the three prototypes are excellent products predicated on the "Motif Siwa" and a good rating on the motif "Siwa Talang" and motif "Matahari Siwa
The limits of de novo DNA motif discovery.
Directory of Open Access Journals (Sweden)
David Simcha
Full Text Available A major challenge in molecular biology is reverse-engineering the cis-regulatory logic that plays a major role in the control of gene expression. This program includes searching through DNA sequences to identify "motifs" that serve as the binding sites for transcription factors or, more generally, are predictive of gene expression across cellular conditions. Several approaches have been proposed for de novo motif discovery-searching sequences without prior knowledge of binding sites or nucleotide patterns. However, unbiased validation is not straightforward. We consider two approaches to unbiased validation of discovered motifs: testing the statistical significance of a motif using a DNA "background" sequence model to represent the null hypothesis and measuring performance in predicting membership in gene clusters. We demonstrate that the background models typically used are "too null," resulting in overly optimistic assessments of significance, and argue that performance in predicting TF binding or expression patterns from DNA motifs should be assessed by held-out data, as in predictive learning. Applying this criterion to common motif discovery methods resulted in universally poor performance, although there is a marked improvement when motifs are statistically significant against real background sequences. Moreover, on synthetic data where "ground truth" is known, discriminative performance of all algorithms is far below the theoretical upper bound, with pronounced "over-fitting" in training. A key conclusion from this work is that the failure of de novo discovery approaches to accurately identify motifs is basically due to statistical intractability resulting from the fixed size of co-regulated gene clusters, and thus such failures do not necessarily provide evidence that unfound motifs are not active biologically. Consequently, the use of prior knowledge to enhance motif discovery is not just advantageous but necessary. An implementation of
Dragon polya spotter: Predictor of poly(A) motifs within human genomic DNA sequences
Kalkatawi, Manal M.
2011-11-15
Motivation: Recognition of poly(A) signals in mRNA is relatively straightforward due to the presence of easily recognizable polyadenylic acid tail. However, the task of identifying poly(A) motifs in the primary genomic DNA sequence that correspond to poly(A) signals in mRNA is a far more challenging problem. Recognition of poly(A) signals is important for better gene annotation and understanding of the gene regulation mechanisms. In this work, we present one such poly(A) motif prediction method based on properties of human genomic DNA sequence surrounding a poly(A) motif. These properties include thermodynamic, physico-chemical and statistical characteristics. For predictions, we developed Artificial Neural Network and Random Forest models. These models are trained to recognize 12 most common poly(A) motifs in human DNA. Our predictors are available as a free web-based tool accessible at http://cbrc.kaust.edu.sa/dps. Compared with other reported predictors, our models achieve higher sensitivity and specificity and furthermore provide a consistent level of accuracy for 12 poly(A) motif variants. The Author(s) 2011. Published by Oxford University Press. All rights reserved.
Parole, Sintagmatik, dan Paradigmatik Motif Batik Mega Mendung
Directory of Open Access Journals (Sweden)
Rudi - Nababan
2012-04-01
Full Text Available ABSTRACT Discussing traditional batik is related a lot to the organization system of fine arts element ac- companying it, either the pattern of the motif or the technique of the making. In this case, the motif of Mega Mendung Cirebon certainly has patterns and rules which are traditionally different from the other motifs in other areas. Through semiotics analysis especially with Saussure and Pierce concept, it can be traced that batik with Cirebon motif, in this case Mega Mendung motif, has parole and langue system, as unique fine arts language in batik, and structure of visual syntagmatic and paradigmatic. In the context of batik motif as fine arts language, it is surely related to sign system as symbol and icon. Keywords: visual semiotic, Cirebon’s batik.
Proteome-level assessment of origin, prevalence and function of Leucine-Aspartic Acid (LD) motifs
Alam, Tanvir
2018-03-11
Short Linear Motifs (SLiMs) contribute to almost every cellular function by connecting appropriate protein partners. Accurate prediction of SLiMs is difficult due to their shortness and sequence degeneracy. Leucine-aspartic acid (LD) motifs are SLiMs that link paxillin family proteins to factors controlling (cancer) cell adhesion, motility and survival. The existence and importance of LD motifs beyond the paxillin family is poorly understood. To enable a proteome-wide assessment of these motifs, we developed an active-learning based framework that iteratively integrates computational predictions with experimental validation. Our analysis of the human proteome identified a dozen proteins that contain LD motifs, all being involved in cell adhesion and migration, and revealed a new type of inverse LD motif consensus. Our evolutionary analysis suggested that LD motif signalling originated in the common unicellular ancestor of opisthokonts and amoebozoa by co-opting nuclear export sequences. Inter-species comparison revealed a conserved LD signalling core, and reveals the emergence of species-specific adaptive connections, while maintaining a strong functional focus of the LD motif interactome. Collectively, our data elucidate the mechanisms underlying the origin and adaptation of an ancestral SLiM.
Directory of Open Access Journals (Sweden)
Lopez-Vergès Sandra
2006-09-01
Full Text Available Abstract Background Retrovirus particles emerge from the assembly of two structural protein components, Gag that is translated as a soluble protein in the cytoplasm of the host cells, and Env, a type I transmembrane protein. Because both components are translated in different intracellular compartments, elucidating the mechanisms of retrovirus assembly thus requires the study of their intracellular trafficking. Results We used a CD25 (Tac chimera-based approach to study the trafficking of Moloney murine leukemia virus and Mason-Pfizer monkey virus Env proteins. We found that the cytoplasmic tails (CTs of both Env conserved two major signals that control a complex intracellular trafficking. A dileucine-based motif controls the sorting of the chimeras from the trans-Golgi network (TGN toward endosomal compartments. Env proteins then follow a retrograde transport to the TGN due to the action of a tyrosine-based motif. Mutation of either motif induces the mis-localization of the chimeric proteins and both motifs are found to mediate interactions of the viral CTs with clathrin adaptors. Conclusion This data reveals the unexpected complexity of the intracellular trafficking of retrovirus Env proteins that cycle between the TGN and endosomes. Given that Gag proteins hijack endosomal host proteins, our work suggests that the endosomal pathway may be used by retroviruses to ensure proper encountering of viral structural Gag and Env proteins in cells, an essential step of virus assembly.
Signature scheme based on bilinear pairs
Tong, Rui Y.; Geng, Yong J.
2013-03-01
An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.
Triple helical DNA in a duplex context and base pair opening
Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra
2014-01-01
It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466
Bayesian centroid estimation for motif discovery.
Carvalho, Luis
2013-01-01
Biological sequences may contain patterns that signal important biomolecular functions; a classical example is regulation of gene expression by transcription factors that bind to specific patterns in genomic promoter regions. In motif discovery we are given a set of sequences that share a common motif and aim to identify not only the motif composition, but also the binding sites in each sequence of the set. We propose a new centroid estimator that arises from a refined and meaningful loss function for binding site inference. We discuss the main advantages of centroid estimation for motif discovery, including computational convenience, and how its principled derivation offers further insights about the posterior distribution of binding site configurations. We also illustrate, using simulated and real datasets, that the centroid estimator can differ from the traditional maximum a posteriori or maximum likelihood estimators.
Bayesian centroid estimation for motif discovery.
Directory of Open Access Journals (Sweden)
Luis Carvalho
Full Text Available Biological sequences may contain patterns that signal important biomolecular functions; a classical example is regulation of gene expression by transcription factors that bind to specific patterns in genomic promoter regions. In motif discovery we are given a set of sequences that share a common motif and aim to identify not only the motif composition, but also the binding sites in each sequence of the set. We propose a new centroid estimator that arises from a refined and meaningful loss function for binding site inference. We discuss the main advantages of centroid estimation for motif discovery, including computational convenience, and how its principled derivation offers further insights about the posterior distribution of binding site configurations. We also illustrate, using simulated and real datasets, that the centroid estimator can differ from the traditional maximum a posteriori or maximum likelihood estimators.
Temporal motifs reveal collaboration patterns in online task-oriented networks
Xuan, Qi; Fang, Huiting; Fu, Chenbo; Filkov, Vladimir
2015-05-01
Real networks feature layers of interactions and complexity. In them, different types of nodes can interact with each other via a variety of events. Examples of this complexity are task-oriented social networks (TOSNs), where teams of people share tasks towards creating a quality artifact, such as academic research papers or software development in commercial or open source environments. Accomplishing those tasks involves both work, e.g., writing the papers or code, and communication, to discuss and coordinate. Taking into account the different types of activities and how they alternate over time can result in much more precise understanding of the TOSNs behaviors and outcomes. That calls for modeling techniques that can accommodate both node and link heterogeneity as well as temporal change. In this paper, we report on methodology for finding temporal motifs in TOSNs, limited to a system of two people and an artifact. We apply the methods to publicly available data of TOSNs from 31 Open Source Software projects. We find that these temporal motifs are enriched in the observed data. When applied to software development outcome, temporal motifs reveal a distinct dependency between collaboration and communication in the code writing process. Moreover, we show that models based on temporal motifs can be used to more precisely relate both individual developer centrality and team cohesion to programmer productivity than models based on aggregated TOSNs.
Regad, Leslie; Martin, Juliette; Camproux, Anne-Claude
2011-06-20
One of the strategies for protein function annotation is to search particular structural motifs that are known to be shared by proteins with a given function. Here, we present a systematic extraction of structural motifs of seven residues from protein loops and we explore their correspondence with functional sites. Our approach is based on the structural alphabet HMM-SA (Hidden Markov Model - Structural Alphabet), which allows simplification of protein structures into uni-dimensional sequences, and advanced pattern statistics adapted to short sequences. Structural motifs of interest are selected by looking for structural motifs significantly over-represented in SCOP superfamilies in protein loops. We discovered two types of structural motifs significantly over-represented in SCOP superfamilies: (i) ubiquitous motifs, shared by several superfamilies and (ii) superfamily-specific motifs, over-represented in few superfamilies. A comparison of ubiquitous words with known small structural motifs shows that they contain well-described motifs as turn, niche or nest motifs. A comparison between superfamily-specific motifs and biological annotations of Swiss-Prot reveals that some of them actually correspond to functional sites involved in the binding sites of small ligands, such as ATP/GTP, NAD(P) and SAH/SAM. Our findings show that statistical over-representation in SCOP superfamilies is linked to functional features. The detection of over-represented motifs within structures simplified by HMM-SA is therefore a promising approach for prediction of functional sites and annotation of uncharacterized proteins.
Directory of Open Access Journals (Sweden)
Martin Juliette
2011-06-01
Full Text Available Abstract Background One of the strategies for protein function annotation is to search particular structural motifs that are known to be shared by proteins with a given function. Results Here, we present a systematic extraction of structural motifs of seven residues from protein loops and we explore their correspondence with functional sites. Our approach is based on the structural alphabet HMM-SA (Hidden Markov Model - Structural Alphabet, which allows simplification of protein structures into uni-dimensional sequences, and advanced pattern statistics adapted to short sequences. Structural motifs of interest are selected by looking for structural motifs significantly over-represented in SCOP superfamilies in protein loops. We discovered two types of structural motifs significantly over-represented in SCOP superfamilies: (i ubiquitous motifs, shared by several superfamilies and (ii superfamily-specific motifs, over-represented in few superfamilies. A comparison of ubiquitous words with known small structural motifs shows that they contain well-described motifs as turn, niche or nest motifs. A comparison between superfamily-specific motifs and biological annotations of Swiss-Prot reveals that some of them actually correspond to functional sites involved in the binding sites of small ligands, such as ATP/GTP, NAD(P and SAH/SAM. Conclusions Our findings show that statistical over-representation in SCOP superfamilies is linked to functional features. The detection of over-represented motifs within structures simplified by HMM-SA is therefore a promising approach for prediction of functional sites and annotation of uncharacterized proteins.
Accurate interaction energies of base pairing and base stacking. The final chapter
Czech Academy of Sciences Publication Activity Database
Šponer, Jiří; Jurečka, Petr; Hobza, Pavel
2005-01-01
Roč. 22, č. 6 (2005), s. 767 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : base pairing * base stacking * nucleic acids Subject RIV: BO - Biophysics
AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis
Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian
2016-01-01
Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...
iFORM: Incorporating Find Occurrence of Regulatory Motifs.
Ren, Chao; Chen, Hebing; Yang, Bite; Liu, Feng; Ouyang, Zhangyi; Bo, Xiaochen; Shu, Wenjie
2016-01-01
Accurately identifying the binding sites of transcription factors (TFs) is crucial to understanding the mechanisms of transcriptional regulation and human disease. We present incorporating Find Occurrence of Regulatory Motifs (iFORM), an easy-to-use and efficient tool for scanning DNA sequences with TF motifs described as position weight matrices (PWMs). Both performance assessment with a receiver operating characteristic (ROC) curve and a correlation-based approach demonstrated that iFORM achieves higher accuracy and sensitivity by integrating five classical motif discovery programs using Fisher's combined probability test. We have used iFORM to provide accurate results on a variety of data in the ENCODE Project and the NIH Roadmap Epigenomics Project, and the tool has demonstrated its utility in further elucidating individual roles of functional elements. Both the source and binary codes for iFORM can be freely accessed at https://github.com/wenjiegroup/iFORM. The identified TF binding sites across human cell and tissue types using iFORM have been deposited in the Gene Expression Omnibus under the accession ID GSE53962.
CONTEMPORARY USAGE OF TRADITIONAL TURKISH MOTIFS IN PRODUCT DESIGNS
Directory of Open Access Journals (Sweden)
Tulay Gumuser
2012-12-01
Full Text Available The aim of this study is to identify the traditional Turkish motifs and its relations among present industrial designs. Traditional Turkish motifs played a very important role in 16th century onwards. The arts of the Ottoman Empire were used because of their symbolic meanings and unique styles. When we examine these motifs we encounter; Tiger Stripe, Three Spot (Çintemani, Rumi, Hatayi, Penç, Cloud, Crescent, Star, Crown, Hyacinth, Tulip and Carnation motifs. Nowadays, Turkish designers have begun to use these traditional Turkish motifs in their designs so as to create differences and awareness in the world design. The examples of these industrial designs, using the Turkish motifs, have survived and have Ottoman heritage and historical value. In this study, the Turkish motifs will be examined along with their focus on contemporary Turkish industrial designs used today.
Huo, Tong; Liu, Wei; Guo, Yu; Yang, Cheng; Lin, Jianping; Rao, Zihe
2015-03-26
Emergence of multiple drug resistant strains of M. tuberculosis (MDR-TB) threatens to derail global efforts aimed at reigning in the pathogen. Co-infections of M. tuberculosis with HIV are difficult to treat. To counter these new challenges, it is essential to study the interactions between M. tuberculosis and the host to learn how these bacteria cause disease. We report a systematic flow to predict the host pathogen interactions (HPIs) between M. tuberculosis and Homo sapiens based on sequence motifs. First, protein sequences were used as initial input for identifying the HPIs by 'interolog' method. HPIs were further filtered by prediction of domain-domain interactions (DDIs). Functional annotations of protein and publicly available experimental results were applied to filter the remaining HPIs. Using such a strategy, 118 pairs of HPIs were identified, which involve 43 proteins from M. tuberculosis and 48 proteins from Homo sapiens. A biological interaction network between M. tuberculosis and Homo sapiens was then constructed using the predicted inter- and intra-species interactions based on the 118 pairs of HPIs. Finally, a web accessible database named PATH (Protein interactions of M. tuberculosis and Human) was constructed to store these predicted interactions and proteins. This interaction network will facilitate the research on host-pathogen protein-protein interactions, and may throw light on how M. tuberculosis interacts with its host.
Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands
Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree
2018-05-01
In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.
RNA motif search with data-driven element ordering.
Rampášek, Ladislav; Jimenez, Randi M; Lupták, Andrej; Vinař, Tomáš; Brejová, Broňa
2016-05-18
In this paper, we study the problem of RNA motif search in long genomic sequences. This approach uses a combination of sequence and structure constraints to uncover new distant homologs of known functional RNAs. The problem is NP-hard and is traditionally solved by backtracking algorithms. We have designed a new algorithm for RNA motif search and implemented a new motif search tool RNArobo. The tool enhances the RNAbob descriptor language, allowing insertions in helices, which enables better characterization of ribozymes and aptamers. A typical RNA motif consists of multiple elements and the running time of the algorithm is highly dependent on their ordering. By approaching the element ordering problem in a principled way, we demonstrate more than 100-fold speedup of the search for complex motifs compared to previously published tools. We have developed a new method for RNA motif search that allows for a significant speedup of the search of complex motifs that include pseudoknots. Such speed improvements are crucial at a time when the rate of DNA sequencing outpaces growth in computing. RNArobo is available at http://compbio.fmph.uniba.sk/rnarobo .
DFT study on metal-mediated uracil base pair complexes
Directory of Open Access Journals (Sweden)
Ayhan Üngördü
2017-11-01
Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.
Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair
Chawla, Mohit
2018-01-02
The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.
Fauteux, François; Strömvik, Martina V
2009-01-01
Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs
Directory of Open Access Journals (Sweden)
Fauteux François
2009-10-01
Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination
Motif signatures of transcribed enhancers
Kleftogiannis, Dimitrios
2017-09-14
In mammalian cells, transcribed enhancers (TrEn) play important roles in the initiation of gene expression and maintenance of gene expression levels in spatiotemporal manner. One of the most challenging questions in biology today is how the genomic characteristics of enhancers relate to enhancer activities. This is particularly critical, as several recent studies have linked enhancer sequence motifs to specific functional roles. To date, only a limited number of enhancer sequence characteristics have been investigated, leaving space for exploring the enhancers genomic code in a more systematic way. To address this problem, we developed a novel computational method, TELS, aimed at identifying predictive cell type/tissue specific motif signatures. We used TELS to compile a comprehensive catalog of motif signatures for all known TrEn identified by the FANTOM5 consortium across 112 human primary cells and tissues. Our results confirm that distinct cell type/tissue specific motif signatures characterize TrEn. These signatures allow discriminating successfully a) TrEn from random controls, proxy of non-enhancer activity, and b) cell type/tissue specific TrEn from enhancers expressed and transcribed in different cell types/tissues. TELS codes and datasets are publicly available at http://www.cbrc.kaust.edu.sa/TELS.
DEFF Research Database (Denmark)
Bonefeld, Charlotte Menné; Rasmussen, B. A.; Lauritsen, J P
2003-01-01
of comodulation. Like internalization of engaged TCR, comodulation was dependent on protein tyrosine kinase activity. Finally, we found that in contrast to internalization of engaged TCR, comodulation was highly dependent on protein kinase C activity and the CD3 gamma di-leucine-based motif. Based...
Plasmodium vivax antigen discovery based on alpha-helical coiled coil protein motif
DEFF Research Database (Denmark)
Céspedes, Nora; Habel, Catherine; Lopez-Perez, Mary
2014-01-01
Protein α-helical coiled coil structures that elicit antibody responses, which block critical functions of medically important microorganisms, represent a means for vaccine development. By using bioinformatics algorithms, a total of 50 antigens with α-helical coiled coil motifs orthologous to Pla...
International Nuclear Information System (INIS)
Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.
1988-01-01
High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met
Triadic motifs in the dependence networks of virtual societies
Xie, Wen-Jie; Li, Ming-Xia; Jiang, Zhi-Qiang; Zhou, Wei-Xing
2014-06-01
In friendship networks, individuals have different numbers of friends, and the closeness or intimacy between an individual and her friends is heterogeneous. Using a statistical filtering method to identify relationships about who depends on whom, we construct dependence networks (which are directed) from weighted friendship networks of avatars in more than two hundred virtual societies of a massively multiplayer online role-playing game (MMORPG). We investigate the evolution of triadic motifs in dependence networks. Several metrics show that the virtual societies evolved through a transient stage in the first two to three weeks and reached a relatively stable stage. We find that the unidirectional loop motif (M9) is underrepresented and does not appear, open motifs are also underrepresented, while other close motifs are overrepresented. We also find that, for most motifs, the overall level difference of the three avatars in the same motif is significantly lower than average, whereas the sum of ranks is only slightly larger than average. Our findings show that avatars' social status plays an important role in the formation of triadic motifs.
Triadic motifs in the dependence networks of virtual societies.
Xie, Wen-Jie; Li, Ming-Xia; Jiang, Zhi-Qiang; Zhou, Wei-Xing
2014-06-10
In friendship networks, individuals have different numbers of friends, and the closeness or intimacy between an individual and her friends is heterogeneous. Using a statistical filtering method to identify relationships about who depends on whom, we construct dependence networks (which are directed) from weighted friendship networks of avatars in more than two hundred virtual societies of a massively multiplayer online role-playing game (MMORPG). We investigate the evolution of triadic motifs in dependence networks. Several metrics show that the virtual societies evolved through a transient stage in the first two to three weeks and reached a relatively stable stage. We find that the unidirectional loop motif (M9) is underrepresented and does not appear, open motifs are also underrepresented, while other close motifs are overrepresented. We also find that, for most motifs, the overall level difference of the three avatars in the same motif is significantly lower than average, whereas the sum of ranks is only slightly larger than average. Our findings show that avatars' social status plays an important role in the formation of triadic motifs.
Micromechanics of base pair unzipping in the DNA duplex
International Nuclear Information System (INIS)
Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V
2012-01-01
All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)
Liu, Bingqiang; Zhang, Hanyuan; Zhou, Chuan; Li, Guojun; Fennell, Anne; Wang, Guanghui; Kang, Yu; Liu, Qi; Ma, Qin
2016-08-09
Phylogenetic footprinting is an important computational technique for identifying cis-regulatory motifs in orthologous regulatory regions from multiple genomes, as motifs tend to evolve slower than their surrounding non-functional sequences. Its application, however, has several difficulties for optimizing the selection of orthologous data and reducing the false positives in motif prediction. Here we present an integrative phylogenetic footprinting framework for accurate motif predictions in prokaryotic genomes (MP(3)). The framework includes a new orthologous data preparation procedure, an additional promoter scoring and pruning method and an integration of six existing motif finding algorithms as basic motif search engines. Specifically, we collected orthologous genes from available prokaryotic genomes and built the orthologous regulatory regions based on sequence similarity of promoter regions. This procedure made full use of the large-scale genomic data and taxonomy information and filtered out the promoters with limited contribution to produce a high quality orthologous promoter set. The promoter scoring and pruning is implemented through motif voting by a set of complementary predicting tools that mine as many motif candidates as possible and simultaneously eliminate the effect of random noise. We have applied the framework to Escherichia coli k12 genome and evaluated the prediction performance through comparison with seven existing programs. This evaluation was systematically carried out at the nucleotide and binding site level, and the results showed that MP(3) consistently outperformed other popular motif finding tools. We have integrated MP(3) into our motif identification and analysis server DMINDA, allowing users to efficiently identify and analyze motifs in 2,072 completely sequenced prokaryotic genomes. The performance evaluation indicated that MP(3) is effective for predicting regulatory motifs in prokaryotic genomes. Its application may enhance
Efficient motif finding algorithms for large-alphabet inputs
Directory of Open Access Journals (Sweden)
Pavlovic Vladimir
2010-10-01
Full Text Available Abstract Background We consider the problem of identifying motifs, recurring or conserved patterns, in the biological sequence data sets. To solve this task, we present a new deterministic algorithm for finding patterns that are embedded as exact or inexact instances in all or most of the input strings. Results The proposed algorithm (1 improves search efficiency compared to existing algorithms, and (2 scales well with the size of alphabet. On a synthetic planted DNA motif finding problem our algorithm is over 10× more efficient than MITRA, PMSPrune, and RISOTTO for long motifs. Improvements are orders of magnitude higher in the same setting with large alphabets. On benchmark TF-binding site problems (FNP, CRP, LexA we observed reduction in running time of over 12×, with high detection accuracy. The algorithm was also successful in rapidly identifying protein motifs in Lipocalin, Zinc metallopeptidase, and supersecondary structure motifs for Cadherin and Immunoglobin families. Conclusions Our algorithm reduces computational complexity of the current motif finding algorithms and demonstrate strong running time improvements over existing exact algorithms, especially in important and difficult cases of large-alphabet sequences.
NOTE TAKING PAIRS TO IMPROVE STUDENTS‟ SENTENCE BASED WRITING ACHIEVEMENT
Directory of Open Access Journals (Sweden)
Testiana Deni Wijayatiningsih
2017-04-01
Full Text Available Students had skill to actualize their imagination and interpret their knowledge through writing which could be combined with good writing structure. Moreover, their writing skill still had low motivation and had not reached the standard writing structure. Based on the background above, this research has purpose to know the influence Note Taking Pairs in improving students‘sentence based writing achievement. The subject of this research was the second semester of English Department in Muhammadiyah University of Semarang. It also used statistic non parametric method to analyze the students‘ writing achievement. The result of this research showed that Note Taking Pairs strategy could improve students‘sentence based writing achievement. Hopefully this research is recommended into learning process to improve students‘writing skill especially in sentence-based writing subject.
AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.
Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej
2005-05-04
The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.
AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions
International Nuclear Information System (INIS)
Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.
2005-01-01
The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible
The Verrucomicrobia LexA-binding Motif: Insights into the Evolutionary Dynamics of the SOS Response
Directory of Open Access Journals (Sweden)
Ivan Erill
2016-07-01
Full Text Available The SOS response is the primary bacterial mechanism to address DNA damage, coordinating multiple cellular processes that include DNA repair, cell division and translesion synthesis. In contrast to other regulatory systems, the composition of the SOS genetic network and the binding motif of its transcriptional repressor, LexA, have been shown to vary greatly across bacterial clades, making it an ideal system to study the co-evolution of transcription factors and their regulons. Leveraging comparative genomics approaches and prior knowledge on the core SOS regulon, here we define the binding motif of the Verrucomicrobia, a recently described phylum of emerging interest due to its association with eukaryotic hosts. Site directed mutagenesis of the Verrucomicrobium spinosum recA promoter confirms that LexA binds a 14 bp palindromic motif with consensus sequence TGTTC-N4-GAACA. Computational analyses suggest that recognition of this novel motif is determined primarily by changes in base-contacting residues of the third alpha helix of the LexA helix-turn-helix DNA binding motif. In conjunction with comparative genomics analysis of the LexA regulon in the Verrucomicrobia phylum, electrophoretic shift assays reveal that LexA binds to operators in the promoter region of DNA repair genes and a mutagenesis cassette in this organism, and identify previously unreported components of the SOS response. The identification of tandem LexA-binding sites generating instances of other LexA-binding motifs in the lexA gene promoter of Verrucomicrobia species leads us to postulate a novel mechanism for LexA-binding motif evolution. This model, based on gene duplication, successfully addresses outstanding questions in the intricate co-evolution of the LexA protein, its binding motif and the regulatory network it controls.
The Verrucomicrobia LexA-Binding Motif: Insights into the Evolutionary Dynamics of the SOS Response.
Erill, Ivan; Campoy, Susana; Kılıç, Sefa; Barbé, Jordi
2016-01-01
The SOS response is the primary bacterial mechanism to address DNA damage, coordinating multiple cellular processes that include DNA repair, cell division, and translesion synthesis. In contrast to other regulatory systems, the composition of the SOS genetic network and the binding motif of its transcriptional repressor, LexA, have been shown to vary greatly across bacterial clades, making it an ideal system to study the co-evolution of transcription factors and their regulons. Leveraging comparative genomics approaches and prior knowledge on the core SOS regulon, here we define the binding motif of the Verrucomicrobia, a recently described phylum of emerging interest due to its association with eukaryotic hosts. Site directed mutagenesis of the Verrucomicrobium spinosum recA promoter confirms that LexA binds a 14 bp palindromic motif with consensus sequence TGTTC-N4-GAACA. Computational analyses suggest that recognition of this novel motif is determined primarily by changes in base-contacting residues of the third alpha helix of the LexA helix-turn-helix DNA binding motif. In conjunction with comparative genomics analysis of the LexA regulon in the Verrucomicrobia phylum, electrophoretic shift assays reveal that LexA binds to operators in the promoter region of DNA repair genes and a mutagenesis cassette in this organism, and identify previously unreported components of the SOS response. The identification of tandem LexA-binding sites generating instances of other LexA-binding motifs in the lexA gene promoter of Verrucomicrobia species leads us to postulate a novel mechanism for LexA-binding motif evolution. This model, based on gene duplication, successfully addresses outstanding questions in the intricate co-evolution of the LexA protein, its binding motif and the regulatory network it controls.
Michael, Sushama; Travé, Gilles; Ramu, Chenna; Chica, Claudia; Gibson, Toby J
2008-02-15
KEN-box-mediated target selection is one of the mechanisms used in the proteasomal destruction of mitotic cell cycle proteins via the APC/C complex. While annotating the Eukaryotic Linear Motif resource (ELM, http://elm.eu.org/), we found that KEN motifs were significantly enriched in human protein entries with cell cycle keywords in the UniProt/Swiss-Prot database-implying that KEN-boxes might be more common than reported. Matches to short linear motifs in protein database searches are not, per se, significant. KEN-box enrichment with cell cycle Gene Ontology terms suggests that collectively these motifs are functional but does not prove that any given instance is so. Candidates were surveyed for native disorder prediction using GlobPlot and IUPred and for motif conservation in homologues. Among >25 strong new candidates, the most notable are human HIPK2, CHFR, CDC27, Dab2, Upf2, kinesin Eg5, DNA Topoisomerase 1 and yeast Cdc5 and Swi5. A similar number of weaker candidates were present. These proteins have yet to be tested for APC/C targeted destruction, providing potential new avenues of research.
Pipeline for the Analysis of ChIP-seq Data and New Motif Ranking Procedure
Ashoor, Haitham
2011-06-01
This thesis presents a computational methodology for ab-initio identification of transcription factor binding sites based on ChIP-seq data. This method consists of three main steps, namely ChIP-seq data processing, motif discovery and models selection. A novel method for ranking the models of motifs identified in this process is proposed. This method combines multiple factors in order to rank the provided candidate motifs. It combines the model coverage of the ChIP-seq fragments that contain motifs from which that model is built, the suitable background data made up of shuffled ChIP-seq fragments, and the p-value that resulted from evaluating the model on actual and background data. Two ChIP-seq datasets retrieved from ENCODE project are used to evaluate and demonstrate the ability of the method to predict correct TFBSs with high precision. The first dataset relates to neuron-restrictive silencer factor, NRSF, while the second one corresponds to growth-associated binding protein, GABP. The pipeline system shows high precision prediction for both datasets, as in both cases the top ranked motif closely resembles the known motifs for the respective transcription factors.
GPUmotif: an ultra-fast and energy-efficient motif analysis program using graphics processing units.
Zandevakili, Pooya; Hu, Ming; Qin, Zhaohui
2012-01-01
Computational detection of TF binding patterns has become an indispensable tool in functional genomics research. With the rapid advance of new sequencing technologies, large amounts of protein-DNA interaction data have been produced. Analyzing this data can provide substantial insight into the mechanisms of transcriptional regulation. However, the massive amount of sequence data presents daunting challenges. In our previous work, we have developed a novel algorithm called Hybrid Motif Sampler (HMS) that enables more scalable and accurate motif analysis. Despite much improvement, HMS is still time-consuming due to the requirement to calculate matching probabilities position-by-position. Using the NVIDIA CUDA toolkit, we developed a graphics processing unit (GPU)-accelerated motif analysis program named GPUmotif. We proposed a "fragmentation" technique to hide data transfer time between memories. Performance comparison studies showed that commonly-used model-based motif scan and de novo motif finding procedures such as HMS can be dramatically accelerated when running GPUmotif on NVIDIA graphics cards. As a result, energy consumption can also be greatly reduced when running motif analysis using GPUmotif. The GPUmotif program is freely available at http://sourceforge.net/projects/gpumotif/
GPUmotif: an ultra-fast and energy-efficient motif analysis program using graphics processing units.
Directory of Open Access Journals (Sweden)
Pooya Zandevakili
Full Text Available Computational detection of TF binding patterns has become an indispensable tool in functional genomics research. With the rapid advance of new sequencing technologies, large amounts of protein-DNA interaction data have been produced. Analyzing this data can provide substantial insight into the mechanisms of transcriptional regulation. However, the massive amount of sequence data presents daunting challenges. In our previous work, we have developed a novel algorithm called Hybrid Motif Sampler (HMS that enables more scalable and accurate motif analysis. Despite much improvement, HMS is still time-consuming due to the requirement to calculate matching probabilities position-by-position. Using the NVIDIA CUDA toolkit, we developed a graphics processing unit (GPU-accelerated motif analysis program named GPUmotif. We proposed a "fragmentation" technique to hide data transfer time between memories. Performance comparison studies showed that commonly-used model-based motif scan and de novo motif finding procedures such as HMS can be dramatically accelerated when running GPUmotif on NVIDIA graphics cards. As a result, energy consumption can also be greatly reduced when running motif analysis using GPUmotif. The GPUmotif program is freely available at http://sourceforge.net/projects/gpumotif/
McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F
2015-01-01
Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.
Estimating the Per-Base-Pair Mutation Rate in the Yeast Saccharomyces cerevisiae
Lang, Gregory I.; Murray, Andrew W.
2008-01-01
Although mutation rates are a key determinant of the rate of evolution they are difficult to measure precisely and global mutations rates (mutations per genome per generation) are often extrapolated from the per-base-pair mutation rate assuming that mutation rate is uniform across the genome. Using budding yeast, we describe an improved method for the accurate calculation of mutation rates based on the fluctuation assay. Our analysis suggests that the per-base-pair mutation rates at two genes...
Sequence alignment reveals possible MAPK docking motifs on HIV proteins.
Directory of Open Access Journals (Sweden)
Perry Evans
Full Text Available Over the course of HIV infection, virus replication is facilitated by the phosphorylation of HIV proteins by human ERK1 and ERK2 mitogen-activated protein kinases (MAPKs. MAPKs are known to phosphorylate their substrates by first binding with them at a docking site. Docking site interactions could be viable drug targets because the sequences guiding them are more specific than phosphorylation consensus sites. In this study we use multiple bioinformatics tools to discover candidate MAPK docking site motifs on HIV proteins known to be phosphorylated by MAPKs, and we discuss the possibility of targeting docking sites with drugs. Using sequence alignments of HIV proteins of different subtypes, we show that MAPK docking patterns previously described for human proteins appear on the HIV matrix, Tat, and Vif proteins in a strain dependent manner, but are absent from HIV Rev and appear on all HIV Nef strains. We revise the regular expressions of previously annotated MAPK docking patterns in order to provide a subtype independent motif that annotates all HIV proteins. One revision is based on a documented human variant of one of the substrate docking motifs, and the other reduces the number of required basic amino acids in the standard docking motifs from two to one. The proposed patterns are shown to be consistent with in silico docking between ERK1 and the HIV matrix protein. The motif usage on HIV proteins is sufficiently different from human proteins in amino acid sequence similarity to allow for HIV specific targeting using small-molecule drugs.
Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.
Directory of Open Access Journals (Sweden)
Jie Zhu
Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.
Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif
Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can
2013-01-01
DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889
Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.
Zhu, Jie; Feng, Xiaolu; Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can
2013-01-01
DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone
DEFF Research Database (Denmark)
Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.
2013-01-01
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....
The identification of functional motifs in temporal gene expression analysis
Directory of Open Access Journals (Sweden)
Michael G. Surette
2005-01-01
Full Text Available The identification of transcription factor binding sites is essential to the understanding of the regulation of gene expression and the reconstruction of genetic regulatory networks. The in silico identification of cis-regulatory motifs is challenging due to sequence variability and lack of sufficient data to generate consensus motifs that are of quantitative or even qualitative predictive value. To determine functional motifs in gene expression, we propose a strategy to adopt false discovery rate (FDR and estimate motif effects to evaluate combinatorial analysis of motif candidates and temporal gene expression data. The method decreases the number of predicted motifs, which can then be confirmed by genetic analysis. To assess the method we used simulated motif/expression data to evaluate parameters. We applied this approach to experimental data for a group of iron responsive genes in Salmonella typhimurium 14028S. The method identified known and potentially new ferric-uptake regulator (Fur binding sites. In addition, we identified uncharacterized functional motif candidates that correlated with specific patterns of expression. A SAS code for the simulation and analysis gene expression data is available from the first author upon request.
Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain
2012-10-11
Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.
Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.
2015-01-01
Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079
The BsaHI restriction-modification system: Cloning, sequencing and analysis of conserved motifs
Directory of Open Access Journals (Sweden)
Roberts Richard J
2008-05-01
Full Text Available Abstract Background Restriction and modification enzymes typically recognise short DNA sequences of between two and eight bases in length. Understanding the mechanism of this recognition represents a significant challenge that we begin to address for the BsaHI restriction-modification system, which recognises the six base sequence GRCGYC. Results The DNA sequences of the genes for the BsaHI methyltransferase, bsaHIM, and restriction endonuclease, bsaHIR, have been determined (GenBank accession #EU386360, cloned and expressed in E. coli. Both the restriction endonuclease and methyltransferase enzymes share significant similarity with a group of 6 other enzymes comprising the restriction-modification systems HgiDI and HgiGI and the putative HindVP, NlaCORFDP, NpuORFC228P and SplZORFNP restriction-modification systems. A sequence alignment of these homologues shows that their amino acid sequences are largely conserved and highlights several motifs of interest. We target one such conserved motif, reading SPERRFD, at the C-terminal end of the bsaHIR gene. A mutational analysis of these amino acids indicates that the motif is crucial for enzymatic activity. Sequence alignment of the methyltransferase gene reveals a short motif within the target recognition domain that is conserved among enzymes recognising the same sequences. Thus, this motif may be used as a diagnostic tool to define the recognition sequences of the cytosine C5 methyltransferases. Conclusion We have cloned and sequenced the BsaHI restriction and modification enzymes. We have identified a region of the R. BsaHI enzyme that is crucial for its activity. Analysis of the amino acid sequence of the BsaHI methyltransferase enzyme led us to propose two new motifs that can be used in the diagnosis of the recognition sequence of the cytosine C5-methyltransferases.
A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif
Directory of Open Access Journals (Sweden)
Asita Elengoe
2015-01-01
Full Text Available Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD of heat shock 70 kDa protein (PDB: 1HJO with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD simulation. Human DNA binding domain of p53 motif (SCMGGMNR retrieved from UniProt (UniProtKB: P04637 was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were −0.44 Kcal/mol and −9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy.
Conserved binding of GCAC motifs by MEC-8, couch potato, and the RBPMS protein family
Soufari, Heddy
2017-01-01
Precise regulation of mRNA processing, translation, localization, and stability relies on specific interactions with RNA-binding proteins whose biological function and target preference are dictated by their preferred RNA motifs. The RBPMS family of RNA-binding proteins is defined by a conserved RNA recognition motif (RRM) domain found in metazoan RBPMS/Hermes and RBPMS2, Drosophila couch potato, and MEC-8 from Caenorhabditis elegans. In order to determine the parameters of RNA sequence recognition by the RBPMS family, we have first used the N-terminal domain from MEC-8 in binding assays and have demonstrated a preference for two GCAC motifs optimally separated by >6 nucleotides (nt). We have also determined the crystal structure of the dimeric N-terminal RRM domain from MEC-8 in the unbound form, and in complex with an oligonucleotide harboring two copies of the optimal GCAC motif. The atomic details reveal the molecular network that provides specificity to all four bases in the motif, including multiple hydrogen bonds to the initial guanine. Further studies with human RBPMS, as well as Drosophila couch potato, confirm a general preference for this double GCAC motif by other members of the protein family and the presence of this motif in known targets. PMID:28003515
Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.
Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu
2004-03-01
A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non
Zhang, Yuetao
2012-01-01
Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C 6F 5) 3 with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl- α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C 6F 5) 3-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C 6F 5) 3, can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P tBu 3), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P 4- tBu). The P 4- tBu/Al(C 6F 5) 3 pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10 4 h -1 (0.125 mol% catalyst, 100% MMA conversion in 30 s, M n = 2.12 × 10 5 g mol -1, PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P γMMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C 6F 5) 3 adduct with P tBu 3 and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the tBu 3P/ Al(C 6F 5) 3 pair is zero-order in monomer concentration after an initial induction period, and the polymerization
Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition
Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.
2016-01-01
DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and
Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion
Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.
2014-01-01
The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089
Directory of Open Access Journals (Sweden)
Hirata Yoko
2010-11-01
Full Text Available Abstract Background Recently, we identified cysteine-rich with EGF-like domains 2 (CRELD2 as a novel endoplasmic reticulum (ER stress-inducible gene and characterized its transcriptional regulation by ATF6 under ER stress conditions. Interestingly, the CRELD2 and asparagine-linked glycosylation 12 homolog (ALG12 genes are arranged as a bidirectional (head-to-head gene pair and are separated by less than 400 bp. In this study, we characterized the transcriptional regulation of the mouse CRELD2 and ALG12 genes that is mediated by a common bidirectional promoter. Results This short intergenic region contains an ER stress response element (ERSE sequence and is well conserved among the human, rat and mouse genomes. Microarray analysis revealed that CRELD2 and ALG12 mRNAs were induced in Neuro2a cells by treatment with thapsigargin (Tg, an ER stress inducer, in a time-dependent manner. Other ER stress inducers, tunicamycin and brefeldin A, also increased the expression of these two mRNAs in Neuro2a cells. We then tested for the possible involvement of the ERSE motif and other regulatory sites of the intergenic region in the transcriptional regulation of the mouse CRELD2 and ALG12 genes by using variants of the bidirectional reporter construct. With regards to the promoter activities of the CRELD2-ALG12 gene pair, the entire intergenic region hardly responded to Tg, whereas the CRELD2 promoter constructs of the proximal region containing the ERSE motif showed a marked responsiveness to Tg. The same ERSE motif of ALG12 gene in the opposite direction was less responsive to Tg. The direction and the distance of this motif from each transcriptional start site, however, has no impact on the responsiveness of either gene to Tg treatment. Additionally, we found three putative sequences in the intergenic region that antagonize the ERSE-mediated transcriptional activation. Conclusions These results show that the mouse CRELD2 and ALG12 genes are arranged as a
An evolutionarily conserved glycine-tyrosine motif forms a folding core in outer membrane proteins.
Directory of Open Access Journals (Sweden)
Marcin Michalik
Full Text Available An intimate interaction between a pair of amino acids, a tyrosine and glycine on neighboring β-strands, has been previously reported to be important for the structural stability of autotransporters. Here, we show that the conservation of this interacting pair extends to nearly all major families of outer membrane β-barrel proteins, which are thought to have originated through duplication events involving an ancestral ββ hairpin. We analyzed the function of this motif using the prototypical outer membrane protein OmpX. Stopped-flow fluorescence shows that two folding processes occur in the millisecond time regime, the rates of which are reduced in the tyrosine mutant. Folding assays further demonstrate a reduction in the yield of folded protein for the mutant compared to the wild-type, as well as a reduction in thermal stability. Taken together, our data support the idea of an evolutionarily conserved 'folding core' that affects the folding, membrane insertion, and thermal stability of outer membrane protein β-barrels.
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-08
The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-01
The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194
A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs
International Nuclear Information System (INIS)
Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.
2011-01-01
Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.
Energy Technology Data Exchange (ETDEWEB)
Gao, Zhong Feng; Chen, Dong Mei [Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China); Lei, Jing Lei [School of Chemistry and Chemical Engineering, Chongqing University, Chongqing 400044 (China); Luo, Hong Qun, E-mail: luohq@swu.edu.cn [Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China); Li, Nian Bing, E-mail: linb@swu.edu.cn [Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China)
2015-10-15
Improving the reproducibility of electrochemical signal remains a great challenge over the past decades. In this work, i-motif oligonucleotide probe-based electrochemical DNA (E-DNA) sensor is introduced for the first time as a regenerated sensing platform, which enhances the reproducibility of electrochemical signal, for label-free detection of glucose and urea. The addition of glucose or urea is able to activate glucose oxidase-catalyzed or urease-catalyzed reaction, inducing or destroying the formation of i-motif oligonucleotide probe. The conformational switch of oligonucleotide probe can be recorded by electrochemical impedance spectroscopy. Thus, the difference of electron transfer resistance is utilized for the quantitative determination of glucose and urea. We further demonstrate that the E-DNA sensor exhibits high selectivity, excellent stability, and remarkable regenerated ability. The human serum analysis indicates that this simple and regenerated strategy holds promising potential in future biosensing applications. - Highlights: • Conformational switch of i-motif is used for the detection of glucose and urea. • The sensor can be regenerated. • The proposed method is successfully applied in real sample assay. • Our method is label-free and inexpensive.
Hybrid DNA i-motif: Aminoethylprolyl-PNA (pC5) enhance the stability of DNA (dC5) i-motif structure.
Gade, Chandrasekhar Reddy; Sharma, Nagendra K
2017-12-15
This report describes the synthesis of C-rich sequence, cytosine pentamer, of aep-PNA and its biophysical studies for the formation of hybrid DNA:aep-PNAi-motif structure with DNA cytosine pentamer (dC 5 ) under acidic pH conditions. Herein, the CD/UV/NMR/ESI-Mass studies strongly support the formation of stable hybrid DNA i-motif structure with aep-PNA even near acidic conditions. Hence aep-PNA C-rich sequence cytosine could be considered as potential DNA i-motif stabilizing agents in vivo conditions. Copyright © 2017 Elsevier Ltd. All rights reserved.
Charge transfer in DNA: role of base pairing
Czech Academy of Sciences Publication Activity Database
Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan
2009-01-01
Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009
Verification of the MOTIF code version 3.0
International Nuclear Information System (INIS)
Chan, T.; Guvanasen, V.; Nakka, B.W.; Reid, J.A.K.; Scheier, N.W.; Stanchell, F.W.
1996-12-01
As part of the Canadian Nuclear Fuel Waste Management Program (CNFWMP), AECL has developed a three-dimensional finite-element code, MOTIF (Model Of Transport In Fractured/ porous media), for detailed modelling of groundwater flow, heat transport and solute transport in a fractured rock mass. The code solves the transient and steady-state equations of groundwater flow, solute (including one-species radionuclide) transport, and heat transport in variably saturated fractured/porous media. The initial development was completed in 1985 (Guvanasen 1985) and version 3.0 was completed in 1986. This version is documented in detail in Guvanasen and Chan (in preparation). This report describes a series of fourteen verification cases which has been used to test the numerical solution techniques and coding of MOTIF, as well as demonstrate some of the MOTIF analysis capabilities. For each case the MOTIF solution has been compared with a corresponding analytical or independently developed alternate numerical solution. Several of the verification cases were included in Level 1 of the International Hydrologic Code Intercomparison Project (HYDROCOIN). The MOTIF results for these cases were also described in the HYDROCOIN Secretariat's compilation and comparison of results submitted by the various project teams (Swedish Nuclear Power Inspectorate 1988). It is evident from the graphical comparisons presented that the MOTIF solutions for the fourteen verification cases are generally in excellent agreement with known analytical or numerical solutions obtained from independent sources. This series of verification studies has established the ability of the MOTIF finite-element code to accurately model the groundwater flow and solute and heat transport phenomena for which it is intended. (author). 20 refs., 14 tabs., 32 figs
Purification and functional motifs of the recombinant ATPase of orf virus.
Lin, Fong-Yuan; Chan, Kun-Wei; Wang, Chi-Young; Wong, Min-Liang; Hsu, Wei-Li
2011-10-01
Our previous study showed that the recombinant ATPase encoded by the A32L gene of orf virus displayed ATP hydrolysis activity as predicted from its amino acids sequence. This viral ATPase contains four known functional motifs (motifs I-IV) and a novel AYDG motif; they are essential for ATP hydrolysis reaction by binding ATP and magnesium ions. The motifs I and II correspond with the Walker A and B motifs of the typical ATPase, respectively. To examine the biochemical roles of these five conserved motifs, recombinant ATPases of five deletion mutants derived from the Taiping strain were expressed and purified. Their ATPase functions were assayed and compared with those of two wild type strains, Taiping and Nantou isolated in Taiwan. Our results showed that deletions at motifs I-III or IV exhibited lower activity than that of the wild type. Interestingly, deletion of AYDG motif decreased the ATPase activity more significantly than those of motifs I-IV deletions. Divalent ions such as magnesium and calcium were essential for ATPase activity. Moreover, our recombinant proteins of orf virus also demonstrated GTPase activity, though weaker than the original ATPase activity. Copyright © 2011 Elsevier Inc. All rights reserved.
Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L
2012-07-01
Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the
Photochemical selectivity in guanine-cytosine base-pair structures
Czech Academy of Sciences Publication Activity Database
Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.
2005-01-01
Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005
Identification and characterization of gene-based SSR markers in date palm (Phoenix dactylifera L.
Directory of Open Access Journals (Sweden)
Zhao Yongli
2012-12-01
Full Text Available Abstract Background Date palm (Phoenix dactylifera L. is an important tree in the Middle East and North Africa due to the nutritional value of its fruit. Molecular Breeding would accelerate genetic improvement of fruit tree through marker assisted selection. However, the lack of molecular markers in date palm restricts the application of molecular breeding. Results In this study, we analyzed 28,889 EST sequences from the date palm genome database to identify simple-sequence repeats (SSRs and to develop gene-based markers, i.e. expressed sequence tag-SSRs (EST-SSRs. We identified 4,609 ESTs as containing SSRs, among which, trinucleotide motifs (69.7% were the most common, followed by tetranucleotide (10.4% and dinucleotide motifs (9.6%. The motif AG (85.7% was most abundant in dinucleotides, while motifs AGG (26.8%, AAG (19.3%, and AGC (16.1% were most common among trinucleotides. A total of 4,967 primer pairs were designed for EST-SSR markers from the computational data. In a follow up laboratory study, we tested a sample of 20 random selected primer pairs for amplification and polymorphism detection using genomic DNA from date palm cultivars. Nearly one-third of these primer pairs detected DNA polymorphism to differentiate the twelve date palm cultivars used. Functional categorization of EST sequences containing SSRs revealed that 3,108 (67.4% of such ESTs had homology with known proteins. Conclusion Date palm EST sequences exhibits a good resource for developing gene-based markers. These genic markers identified in our study may provide a valuable genetic and genomic tool for further genetic research and varietal development in date palm, such as diversity study, QTL mapping, and molecular breeding.
Directory of Open Access Journals (Sweden)
Sergio eTofanelli
2014-11-01
Full Text Available Several authors have proposed haplotype motifs based on site variants at the mitochondrial genome (mtDNA and the non-recombining portion of the Y chromosome (NRY to trace the genealogies of Jewish people. Here, we analyzed their main approaches and test the feasibility of adopting motifs as ancestry markers through construction of a large database of mtDNA and NRY haplotypes from public genetic genealogical repositories. We verified the reliability of Jewish ancestry prediction based on the Cohen and Levite Modal Haplotypes in their classical 6 STR marker format or in the extended 12 STR format, as well as four founder mtDNA lineages (HVS-I segments accounting for about 40% of the current population of Ashkenazi Jews. For this purpose we compared haplotype composition in individuals of self-reported Jewish ancestry with the rest of European, African or Middle Eastern samples, to test for non-random association of ethno-geographic groups and haplotypes. Overall, NRY and mtDNA based motifs, previously reported to differentiate between groups, were found to be more represented in Jewish compared to non-Jewish groups. However, this seems to stem from common ancestors of Jewish lineages being rather recent respect to ancestors of non-Jewish lineages with the same haplotype signatures. Moreover, the polyphyly of haplotypes which contain the proposed motifs and the misuse of constant mutation rates heavily affected previous attempts to correctly dating the origin of common ancestries. Accordingly, our results stress the limitations of using the above haplotype motifs as reliable Jewish ancestry predictors and show its inadequacy for forensic or genealogical purposes.
An experimental test of a fundamental food web motif.
Rip, Jason M K; McCann, Kevin S; Lynn, Denis H; Fawcett, Sonia
2010-06-07
Large-scale changes to the world's ecosystem are resulting in the deterioration of biostructure-the complex web of species interactions that make up ecological communities. A difficult, yet crucial task is to identify food web structures, or food web motifs, that are the building blocks of this baroque network of interactions. Once identified, these food web motifs can then be examined through experiments and theory to provide mechanistic explanations for how structure governs ecosystem stability. Here, we synthesize recent ecological research to show that generalist consumers coupling resources with different interaction strengths, is one such motif. This motif amazingly occurs across an enormous range of spatial scales, and so acts to distribute coupled weak and strong interactions throughout food webs. We then perform an experiment that illustrates the importance of this motif to ecological stability. We find that weak interactions coupled to strong interactions by generalist consumers dampen strong interaction strengths and increase community stability. This study takes a critical step by isolating a common food web motif and through clear, experimental manipulation, identifies the fundamental stabilizing consequences of this structure for ecological communities.
Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.
Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T
2012-02-15
We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A
Mas-Moruno, Carlos; Fraioli, Roberta; Albericio, Fernando; Manero, José María; Gil, F Javier
2014-05-14
Biofunctionalization of metallic materials with cell adhesive molecules derived from the extracellular matrix is a feasible approach to improve cell-material interactions and enhance the biointegration of implant materials (e.g., osseointegration of bone implants). However, classical biomimetic strategies may prove insufficient to elicit complex and multiple biological signals required in the processes of tissue regeneration. Thus, newer strategies are focusing on installing multifunctionality on biomaterials. In this work, we introduce a novel peptide-based divalent platform with the capacity to simultaneously present distinct bioactive peptide motifs in a chemically controlled fashion. As a proof of concept, the integrin-binding sequences RGD and PHSRN were selected and introduced in the platform. The biofunctionalization of titanium with this platform showed a positive trend towards increased numbers of cell attachment, and statistically higher values of spreading and proliferation of osteoblast-like cells compared to control noncoated samples. Moreover, it displayed statistically comparable or improved cell responses compared to samples coated with the single peptides or with an equimolar mixture of the two motifs. Osteoblast-like cells produced higher levels of alkaline phosphatase on surfaces functionalized with the platform than on control titanium; however, these values were not statistically significant. This study demonstrates that these peptidic structures are versatile tools to convey multiple biofunctionality to biomaterials in a chemically defined manner.
Highly scalable Ab initio genomic motif identification
Marchand, Benoit; Bajic, Vladimir B.; Kaushik, Dinesh
2011-01-01
We present results of scaling an ab initio motif family identification system, Dragon Motif Finder (DMF), to 65,536 processor cores of IBM Blue Gene/P. DMF seeks groups of mutually similar polynucleotide patterns within a set of genomic sequences and builds various motif families from them. Such information is of relevance to many problems in life sciences. Prior attempts to scale such ab initio motif-finding algorithms achieved limited success. We solve the scalability issues using a combination of mixed-mode MPI-OpenMP parallel programming, master-slave work assignment, multi-level workload distribution, multi-level MPI collectives, and serial optimizations. While the scalability of our algorithm was excellent (94% parallel efficiency on 65,536 cores relative to 256 cores on a modest-size problem), the final speedup with respect to the original serial code exceeded 250,000 when serial optimizations are included. This enabled us to carry out many large-scale ab initio motiffinding simulations in a few hours while the original serial code would have needed decades of execution time. Copyright 2011 ACM.
ANALYSIS OF STABILITY OF TRINUCLEOTIDE TTC MOTIFS IN COMMON FLAX PLANTED IN THE CHERNOBYL AREA
Directory of Open Access Journals (Sweden)
Veronika Lancíková
2015-02-01
Full Text Available Flax (Linum usitatissimum L. is one of the oldest domesticated plants — it was cultivated as early as in ancient Egypt and Samaria 10,000 years ago to serve as a source of fiber and oil, whence it later spread around the world. Compared with other plants, the flax genome consists of a high number of repetitive sequences, middle repetitive sequences and small repetitive sequences of nucleotides. The aim of the study was to analyze the stability of the existing trinucleotides motifs of microsatellite DNA of the flax genome (genotype Kyivskyi, growing in the Chernobyl conditions. The Chernobyl area is the most extensive “natural” laboratory suitable for the study of radiation effects. Over the last 20 years, the researches collected important knowledge about the effects of low and high radiation doses on the DNA isolated from the plant material growing on the remediated fields near Chernobyl and the plant material from fields contaminated by radioactive cesium 137Cs and strontium 90Sr. Using eight pairs of microsatellite primers, we successfully amplified the samples from the remediated fields. For each primer in the control samples and remediated samples, we detected 1 to 3 fragments per locus, each in size up to 120 to 250 base pairs. The applied microsatellite primers confirmed the monomorphic condition of microsatellite loci.
Phylogeny based discovery of regulatory elements
Directory of Open Access Journals (Sweden)
Cohen Barak A
2006-05-01
Full Text Available Abstract Background Algorithms that locate evolutionarily conserved sequences have become powerful tools for finding functional DNA elements, including transcription factor binding sites; however, most methods do not take advantage of an explicit model for the constrained evolution of functional DNA sequences. Results We developed a probabilistic framework that combines an HKY85 model, which assigns probabilities to different base substitutions between species, and weight matrix models of transcription factor binding sites, which describe the probabilities of observing particular nucleotides at specific positions in the binding site. The method incorporates the phylogenies of the species under consideration and takes into account the position specific variation of transcription factor binding sites. Using our framework we assessed the suitability of alignments of genomic sequences from commonly used species as substrates for comparative genomic approaches to regulatory motif finding. We then applied this technique to Saccharomyces cerevisiae and related species by examining all possible six base pair DNA sequences (hexamers and identifying sequences that are conserved in a significant number of promoters. By combining similar conserved hexamers we reconstructed known cis-regulatory motifs and made predictions of previously unidentified motifs. We tested one prediction experimentally, finding it to be a regulatory element involved in the transcriptional response to glucose. Conclusion The experimental validation of a regulatory element prediction missed by other large-scale motif finding studies demonstrates that our approach is a useful addition to the current suite of tools for finding regulatory motifs.
Alanine substitutions in the GXXXG motif alter C99 cleavage by γ-secretase but not its dimerization.
Higashide, Hidekazu; Ishihara, Seiko; Nobuhara, Mika; Ihara, Yasuo; Funamoto, Satoru
2017-03-01
The amyloid β (Aβ) protein is a major component of senile plaques, one of the neuropathological hallmarks of Alzheimer's disease. Amyloidogenic processing of amyloid precursor protein (APP) by β- and γ-secretases leads to production of Aβ. APP contains tandem triple repeats of the GXXXG motif in its extracellular juxtamembrane and transmembrane regions. It is reported that the GXXXG motif is related to protein-protein interactions, but it remains controversial whether the GXXXG motif in APP is involved in substrate dimerization and whether dimerization affects γ-secretase-dependent cleavage. Therefore, the relationship between the GXXXG motifs, substrate dimerization, and γ-secretase-dependent cleavage sites remains unclear. Here, we applied blue native poly acrylamide gel electrophoresis to examine the effect of alanine substitutions within the GXXXG motifs of APP carboxyl terminal fragment (C99) on its dimerization and Aβ production. Surprisingly, alanine substitutions in the motif failed to alter C99 dimerization in detergent soluble state. Cell-based and solubilized γ-secretase assays demonstrated that increasing alanine substitutions in the motif tended to decrease long Aβ species such as Aβ42 and Aβ43 and to increase in short Aβ species concomitantly. Our data suggest that the GXXXG motif is crucial for Aβ production, but not for C99 dimerization. © 2016 International Society for Neurochemistry.
Armadillo motifs involved in vesicular transport.
Directory of Open Access Journals (Sweden)
Harald Striegl
Full Text Available Armadillo (ARM repeat proteins function in various cellular processes including vesicular transport and membrane tethering. They contain an imperfect repeating sequence motif that forms a conserved three-dimensional structure. Recently, structural and functional insight into tethering mediated by the ARM-repeat protein p115 has been provided. Here we describe the p115 ARM-motifs for reasons of clarity and nomenclature and show that both sequence and structure are highly conserved among ARM-repeat proteins. We argue that there is no need to invoke repeat types other than ARM repeats for a proper description of the structure of the p115 globular head region. Additionally, we propose to define a new subfamily of ARM-like proteins and show lack of evidence that the ARM motifs found in p115 are present in other long coiled-coil tethering factors of the golgin family.
Czech Academy of Sciences Publication Activity Database
Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří
2005-01-01
Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics
Characterizing Motif Dynamics of Electric Brain Activity Using Symbolic Analysis
Directory of Open Access Journals (Sweden)
Massimiliano Zanin
2014-10-01
Full Text Available Motifs are small recurring circuits of interactions which constitute the backbone of networked systems. Characterizing motif dynamics is therefore key to understanding the functioning of such systems. Here we propose a method to define and quantify the temporal variability and time scales of electroencephalogram (EEG motifs of resting brain activity. Given a triplet of EEG sensors, links between them are calculated by means of linear correlation; each pattern of links (i.e., each motif is then associated to a symbol, and its appearance frequency is analyzed by means of Shannon entropy. Our results show that each motif becomes observable with different coupling thresholds and evolves at its own time scale, with fronto-temporal sensors emerging at high thresholds and changing at fast time scales, and parietal ones at low thresholds and changing at slower rates. Finally, while motif dynamics differed across individuals, for each subject, it showed robustness across experimental conditions, indicating that it could represent an individual dynamical signature.
Discriminative motif discovery via simulated evolution and random under-sampling.
Directory of Open Access Journals (Sweden)
Tao Song
Full Text Available Conserved motifs in biological sequences are closely related to their structure and functions. Recently, discriminative motif discovery methods have attracted more and more attention. However, little attention has been devoted to the data imbalance problem, which is one of the main reasons affecting the performance of the discriminative models. In this article, a simulated evolution method is applied to solve the multi-class imbalance problem at the stage of data preprocessing, and at the stage of Hidden Markov Models (HMMs training, a random under-sampling method is introduced for the imbalance between the positive and negative datasets. It is shown that, in the task of discovering targeting motifs of nine subcellular compartments, the motifs found by our method are more conserved than the methods without considering data imbalance problem and recover the most known targeting motifs from Minimotif Miner and InterPro. Meanwhile, we use the found motifs to predict protein subcellular localization and achieve higher prediction precision and recall for the minority classes.
Discriminative motif discovery via simulated evolution and random under-sampling.
Song, Tao; Gu, Hong
2014-01-01
Conserved motifs in biological sequences are closely related to their structure and functions. Recently, discriminative motif discovery methods have attracted more and more attention. However, little attention has been devoted to the data imbalance problem, which is one of the main reasons affecting the performance of the discriminative models. In this article, a simulated evolution method is applied to solve the multi-class imbalance problem at the stage of data preprocessing, and at the stage of Hidden Markov Models (HMMs) training, a random under-sampling method is introduced for the imbalance between the positive and negative datasets. It is shown that, in the task of discovering targeting motifs of nine subcellular compartments, the motifs found by our method are more conserved than the methods without considering data imbalance problem and recover the most known targeting motifs from Minimotif Miner and InterPro. Meanwhile, we use the found motifs to predict protein subcellular localization and achieve higher prediction precision and recall for the minority classes.
Improved i-motif thermal stability by insertion of anthraquinone monomers
DEFF Research Database (Denmark)
Gouda, Alaa S; Amine, Mahasen S.; Pedersen, Erik Bjerregaard
2017-01-01
In order to gain insight into how to improve thermal stability of i-motifs when used in the context of biomedical and nanotechnological applications, novel anthraquinone-modified i-motifs were synthesized by insertion of 1,8-, 1,4-, 1,5- and 2,6-disubstituted anthraquinone monomers into the TAA...... loops of a 22mer cytosine-rich human telomeric DNA sequence. The influence of the four anthraquinone linkers on the i-motif thermal stability was investigated at 295 nm and pH 5.5. Anthraquinone monomers modulate the i-motif stability in a position-depending manner and the modulation also depends...... unlocked nucleic acid monomers or twisted intercalating nucleic acid. The 2,6-disubstituted anthraquinone linker replacing T10 enabled a significant increase of i-motif thermal melting by 8.2 °C. A substantial increase of 5.0 °C in i-motif thermal melting was recorded when both A6 and T16 were modified...
Kondo, Jiro; Westhof, Eric
2011-10-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.
Kondo, Jiro; Westhof, Eric
2011-01-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431
A Simple Decision Rule for Recognition of Poly(A) Tail Signal Motifs in Human Genome
AbouEisha, Hassan M.
2015-05-12
Background is the numerous attempts were made to predict motifs in genomic sequences that correspond to poly (A) tail signals. Vast portion of this effort has been directed to a plethora of nonlinear classification methods. Even when such approaches yield good discriminant results, identifying dominant features of regulatory mechanisms nevertheless remains a challenge. In this work, we look at decision rules that may help identifying such features. Findings are we present a simple decision rule for classification of candidate poly (A) tail signal motifs in human genomic sequence obtained by evaluating features during the construction of gradient boosted trees. We found that values of a single feature based on the frequency of adenine in the genomic sequence surrounding candidate signal and the number of consecutive adenine molecules in a well-defined region immediately following the motif displays good discriminative potential in classification of poly (A) tail motifs for samples covered by the rule. Conclusions is the resulting simple rule can be used as an efficient filter in construction of more complex poly(A) tail motifs classification algorithms.
Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark
2003-01-01
Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251
Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs
Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias
2012-01-01
We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have
Energy Technology Data Exchange (ETDEWEB)
Hamdani, Hazrina Yusof, E-mail: hazrina@mfrlab.org [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 UKM Bangi (Malaysia); Advanced Medical and Dental Institute, Universiti Sains Malaysia, Bertam, Kepala Batas (Malaysia); Artymiuk, Peter J., E-mail: p.artymiuk@sheffield.ac.uk [Dept. of Molecular Biology and Biotechnology, Firth Court, University of Sheffield, S10 T2N Sheffield (United Kingdom); Firdaus-Raih, Mohd, E-mail: firdaus@mfrlab.org [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 UKM Bangi (Malaysia)
2015-09-25
A fundamental understanding of the atomic level interactions in ribonucleic acid (RNA) and how they contribute towards RNA architecture is an important knowledge platform to develop through the discovery of motifs from simple arrangements base pairs, to more complex arrangements such as triples and larger patterns involving non-standard interactions. The network of hydrogen bond interactions is important in connecting bases to form potential tertiary motifs. Therefore, there is an urgent need for the development of automated methods for annotating RNA 3D structures based on hydrogen bond interactions. COnnection tables Graphs for Nucleic ACids (COGNAC) is automated annotation system using graph theoretical approaches that has been developed for the identification of RNA 3D motifs. This program searches for patterns in the unbroken networks of hydrogen bonds for RNA structures and capable of annotating base pairs and higher-order base interactions, which ranges from triples to sextuples. COGNAC was able to discover 22 out of 32 quadruples occurrences of the Haloarcula marismortui large ribosomal subunit (PDB ID: 1FFK) and two out of three occurrences of quintuple interaction reported by the non-canonical interactions in RNA (NCIR) database. These and several other interactions of interest will be discussed in this paper. These examples demonstrate that the COGNAC program can serve as an automated annotation system that can be used to annotate conserved base-base interactions and could be added as additional information to established RNA secondary structure prediction methods.
International Nuclear Information System (INIS)
Hamdani, Hazrina Yusof; Artymiuk, Peter J.; Firdaus-Raih, Mohd
2015-01-01
A fundamental understanding of the atomic level interactions in ribonucleic acid (RNA) and how they contribute towards RNA architecture is an important knowledge platform to develop through the discovery of motifs from simple arrangements base pairs, to more complex arrangements such as triples and larger patterns involving non-standard interactions. The network of hydrogen bond interactions is important in connecting bases to form potential tertiary motifs. Therefore, there is an urgent need for the development of automated methods for annotating RNA 3D structures based on hydrogen bond interactions. COnnection tables Graphs for Nucleic ACids (COGNAC) is automated annotation system using graph theoretical approaches that has been developed for the identification of RNA 3D motifs. This program searches for patterns in the unbroken networks of hydrogen bonds for RNA structures and capable of annotating base pairs and higher-order base interactions, which ranges from triples to sextuples. COGNAC was able to discover 22 out of 32 quadruples occurrences of the Haloarcula marismortui large ribosomal subunit (PDB ID: 1FFK) and two out of three occurrences of quintuple interaction reported by the non-canonical interactions in RNA (NCIR) database. These and several other interactions of interest will be discussed in this paper. These examples demonstrate that the COGNAC program can serve as an automated annotation system that can be used to annotate conserved base-base interactions and could be added as additional information to established RNA secondary structure prediction methods
Systematic discovery of regulatory motifs in Fusarium graminearum by comparing four Fusarium genomes
Directory of Open Access Journals (Sweden)
Kistler Corby
2010-03-01
Full Text Available Abstract Background Fusarium graminearum (Fg, a major fungal pathogen of cultivated cereals, is responsible for billions of dollars in agriculture losses. There is a growing interest in understanding the transcriptional regulation of this organism, especially the regulation of genes underlying its pathogenicity. The generation of whole genome sequence assemblies for Fg and three closely related Fusarium species provides a unique opportunity for such a study. Results Applying comparative genomics approaches, we developed a computational pipeline to systematically discover evolutionarily conserved regulatory motifs in the promoter, downstream and the intronic regions of Fg genes, based on the multiple alignments of sequenced Fusarium genomes. Using this method, we discovered 73 candidate regulatory motifs in the promoter regions. Nearly 30% of these motifs are highly enriched in promoter regions of Fg genes that are associated with a specific functional category. Through comparison to Saccharomyces cerevisiae (Sc and Schizosaccharomyces pombe (Sp, we observed conservation of transcription factors (TFs, their binding sites and the target genes regulated by these TFs related to pathways known to respond to stress conditions or phosphate metabolism. In addition, this study revealed 69 and 39 conserved motifs in the downstream regions and the intronic regions, respectively, of Fg genes. The top intronic motif is the splice donor site. For the downstream regions, we noticed an intriguing absence of the mammalian and Sc poly-adenylation signals among the list of conserved motifs. Conclusion This study provides the first comprehensive list of candidate regulatory motifs in Fg, and underscores the power of comparative genomics in revealing functional elements among related genomes. The conservation of regulatory pathways among the Fusarium genomes and the two yeast species reveals their functional significance, and provides new insights in their
Structure-Based Mutational Analysis of the Hepatitis C Virus NS3 Helicase
Tai, Chun-Ling; Pan, Wen-Ching; Liaw, Shwu-Huey; Yang, Ueng-Cheng; Hwang, Lih-Hwa; Chen, Ding-Shinn
2001-01-01
The carboxyl terminus of the hepatitis C virus (HCV) nonstructural protein 3 (NS3) possesses ATP-dependent RNA helicase activity. Based on the conserved sequence motifs and the crystal structures of the helicase domain, 17 mutants of the HCV NS3 helicase were generated. The ATP hydrolysis, RNA binding, and RNA unwinding activities of the mutant proteins were examined in vitro to determine the functional role of the mutated residues. The data revealed that Lys-210 in the Walker A motif and Asp-290, Glu-291, and His-293 in the Walker B motif were crucial to ATPase activity and that Thr-322 and Thr-324 in motif III and Arg-461 in motif VI significantly influenced ATPase activity. When the pairing between His-293 and Gln-460, referred to as gatekeepers, was replaced with the Asp-293/His-460 pair, which makes the NS3 helicase more like the DEAD helicase subgroup, ATPase activity was not restored. It thus indicated that the whole microenvironment surrounding the gatekeepers, rather than the residues per se, was important to the enzymatic activities. Arg-461 and Trp-501 are important residues for RNA binding, while Val-432 may only play a coadjutant role. The data demonstrated that RNA helicase activity was possibly abolished by the loss of ATPase activity or by reduced RNA binding activity. Nevertheless, a low threshold level of ATPase activity was found sufficient for helicase activity. Results in this study provide a valuable reference for efforts under way to develop anti-HCV therapeutic drugs targeting NS3. PMID:11483774
KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.
Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas
2012-07-01
Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.
Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...
Indian Academy of Sciences (India)
The design and synthesis of molecules containing non-interacting Lewis base and Lewis acid groups. [Frustrated Lewis pairs (FLP's)] have received intense attention due to their potential applications in the area of molecular catalysis.1–3. For example,. Stephen's and co-workers have demonstrated that the unquenched ...
Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo
2009-11-23
Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.
Convergent evolution and mimicry of protein linear motifs in host-pathogen interactions.
Chemes, Lucía Beatriz; de Prat-Gay, Gonzalo; Sánchez, Ignacio Enrique
2015-06-01
Pathogen linear motif mimics are highly evolvable elements that facilitate rewiring of host protein interaction networks. Host linear motifs and pathogen mimics differ in sequence, leading to thermodynamic and structural differences in the resulting protein-protein interactions. Moreover, the functional output of a mimic depends on the motif and domain repertoire of the pathogen protein. Regulatory evolution mediated by linear motifs can be understood by measuring evolutionary rates, quantifying positive and negative selection and performing phylogenetic reconstructions of linear motif natural history. Convergent evolution of linear motif mimics is widespread among unrelated proteins from viral, prokaryotic and eukaryotic pathogens and can also take place within individual protein phylogenies. Statistics, biochemistry and laboratory models of infection link pathogen linear motifs to phenotypic traits such as tropism, virulence and oncogenicity. In vitro evolution experiments and analysis of natural sequences suggest that changes in linear motif composition underlie pathogen adaptation to a changing environment. Copyright © 2015 Elsevier Ltd. All rights reserved.
Concealed d-wave pairs in the s± condensate of iron-based superconductors.
Ong, Tzen; Coleman, Piers; Schmalian, Jörg
2016-05-17
A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.
Methods and statistics for combining motif match scores.
Bailey, T L; Gribskov, M
1998-01-01
Position-specific scoring matrices are useful for representing and searching for protein sequence motifs. A sequence family can often be described by a group of one or more motifs, and an effective search must combine the scores for matching a sequence to each of the motifs in the group. We describe three methods for combining match scores and estimating the statistical significance of the combined scores and evaluate the search quality (classification accuracy) and the accuracy of the estimate of statistical significance of each. The three methods are: 1) sum of scores, 2) sum of reduced variates, 3) product of score p-values. We show that method 3) is superior to the other two methods in both regards, and that combining motif scores indeed gives better search accuracy. The MAST sequence homology search algorithm utilizing the product of p-values scoring method is available for interactive use and downloading at URL http:/(/)www.sdsc.edu/MEME.
MOCCS: Clarifying DNA-binding motif ambiguity using ChIP-Seq data.
Ozaki, Haruka; Iwasaki, Wataru
2016-08-01
As a key mechanism of gene regulation, transcription factors (TFs) bind to DNA by recognizing specific short sequence patterns that are called DNA-binding motifs. A single TF can accept ambiguity within its DNA-binding motifs, which comprise both canonical (typical) and non-canonical motifs. Clarification of such DNA-binding motif ambiguity is crucial for revealing gene regulatory networks and evaluating mutations in cis-regulatory elements. Although chromatin immunoprecipitation sequencing (ChIP-seq) now provides abundant data on the genomic sequences to which a given TF binds, existing motif discovery methods are unable to directly answer whether a given TF can bind to a specific DNA-binding motif. Here, we report a method for clarifying the DNA-binding motif ambiguity, MOCCS. Given ChIP-Seq data of any TF, MOCCS comprehensively analyzes and describes every k-mer to which that TF binds. Analysis of simulated datasets revealed that MOCCS is applicable to various ChIP-Seq datasets, requiring only a few minutes per dataset. Application to the ENCODE ChIP-Seq datasets proved that MOCCS directly evaluates whether a given TF binds to each DNA-binding motif, even if known position weight matrix models do not provide sufficient information on DNA-binding motif ambiguity. Furthermore, users are not required to provide numerous parameters or background genomic sequence models that are typically unavailable. MOCCS is implemented in Perl and R and is freely available via https://github.com/yuifu/moccs. By complementing existing motif-discovery software, MOCCS will contribute to the basic understanding of how the genome controls diverse cellular processes via DNA-protein interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.
Factoring local sequence composition in motif significance analysis.
Ng, Patrick; Keich, Uri
2008-01-01
We recently introduced a biologically realistic and reliable significance analysis of the output of a popular class of motif finders. In this paper we further improve our significance analysis by incorporating local base composition information. Relying on realistic biological data simulation, as well as on FDR analysis applied to real data, we show that our method is significantly better than the increasingly popular practice of using the normal approximation to estimate the significance of a finder's output. Finally we turn to leveraging our reliable significance analysis to improve the actual motif finding task. Specifically, endowing a variant of the Gibbs Sampler with our improved significance analysis we demonstrate that de novo finders can perform better than has been perceived. Significantly, our new variant outperforms all the finders reviewed in a recently published comprehensive analysis of the Harbison genome-wide binding location data. Interestingly, many of these finders incorporate additional information such as nucleosome positioning and the significance of binding data.
DEFF Research Database (Denmark)
Dietrich, J; Hou, X; Wegener, A M
1994-01-01
-regulation of the TCR. Furthermore, analysis of a series of CD3 gamma truncation mutants indicated that in addition to S126 phosphorylation a motif C-terminal of S126 was required for TCR down-regulation. Point mutation analyses confirmed this observation and demonstrated that a membrane-proximal di-leucine motif (L131......, indicating that the TCR was down-regulated by endocytosis via clathrin coated pits. Based on the present results and previously published observations on intracellular receptor sorting, a general model for intracellular sorting of receptors containing di-leucine- or tyrosine-based motifs is proposed....
Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing
Directory of Open Access Journals (Sweden)
Shu-ichi Nakano
2014-08-01
Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.
An entropy-based improved k-top scoring pairs (TSP) method for ...
African Journals Online (AJOL)
An entropy-based improved k-top scoring pairs (TSP) (Ik-TSP) method was presented in this study for the classification and prediction of human cancers based on gene-expression data. We compared Ik-TSP classifiers with 5 different machine learning methods and the k-TSP method based on 3 different feature selection ...
Zhang, Guo-Qiang; Luo, Lingyun; Ogbuji, Chime; Joslyn, Cliff; Mejino, Jose; Sahoo, Satya S
2012-01-01
The interaction of multiple types of relationships among anatomical classes in the Foundational Model of Anatomy (FMA) can provide inferred information valuable for quality assurance. This paper introduces a method called Motif Checking (MOCH) to study the effects of such multi-relation type interactions for detecting logical inconsistencies as well as other anomalies represented by the motifs. MOCH represents patterns of multi-type interaction as small labeled (with multiple types of edges) sub-graph motifs, whose nodes represent class variables, and labeled edges represent relational types. By representing FMA as an RDF graph and motifs as SPARQL queries, fragments of FMA are automatically obtained as auditing candidates. Leveraging the scalability and reconfigurability of Semantic Web Technology, we performed exhaustive analyses of a variety of labeled sub-graph motifs. The quality assurance feature of MOCH comes from the distinct use of a subset of the edges of the graph motifs as constraints for disjointness, whereby bringing in rule-based flavor to the approach as well. With possible disjointness implied by antonyms, we performed manual inspection of the resulting FMA fragments and tracked down sources of abnormal inferred conclusions (logical inconsistencies), which are amendable for programmatic revision of the FMA. Our results demonstrate that MOCH provides a unique source of valuable information for quality assurance. Since our approach is general, it is applicable to any ontological system with an OWL representation. PMID:23304382
Zhang, Guo-Qiang; Luo, Lingyun; Ogbuji, Chime; Joslyn, Cliff; Mejino, Jose; Sahoo, Satya S
2012-01-01
The interaction of multiple types of relationships among anatomical classes in the Foundational Model of Anatomy (FMA) can provide inferred information valuable for quality assurance. This paper introduces a method called Motif Checking (MOCH) to study the effects of such multi-relation type interactions for detecting logical inconsistencies as well as other anomalies represented by the motifs. MOCH represents patterns of multi-type interaction as small labeled (with multiple types of edges) sub-graph motifs, whose nodes represent class variables, and labeled edges represent relational types. By representing FMA as an RDF graph and motifs as SPARQL queries, fragments of FMA are automatically obtained as auditing candidates. Leveraging the scalability and reconfigurability of Semantic Web Technology, we performed exhaustive analyses of a variety of labeled sub-graph motifs. The quality assurance feature of MOCH comes from the distinct use of a subset of the edges of the graph motifs as constraints for disjointness, whereby bringing in rule-based flavor to the approach as well. With possible disjointness implied by antonyms, we performed manual inspection of the resulting FMA fragments and tracked down sources of abnormal inferred conclusions (logical inconsistencies), which are amendable for programmatic revision of the FMA. Our results demonstrate that MOCH provides a unique source of valuable information for quality assurance. Since our approach is general, it is applicable to any ontological system with an OWL representation.
Discovering Motifs in Biological Sequences Using the Micron Automata Processor.
Roy, Indranil; Aluru, Srinivas
2016-01-01
Finding approximately conserved sequences, called motifs, across multiple DNA or protein sequences is an important problem in computational biology. In this paper, we consider the (l, d) motif search problem of identifying one or more motifs of length l present in at least q of the n given sequences, with each occurrence differing from the motif in at most d substitutions. The problem is known to be NP-complete, and the largest solved instance reported to date is (26,11). We propose a novel algorithm for the (l,d) motif search problem using streaming execution over a large set of non-deterministic finite automata (NFA). This solution is designed to take advantage of the micron automata processor, a new technology close to deployment that can simultaneously execute multiple NFA in parallel. We demonstrate the capability for solving much larger instances of the (l, d) motif search problem using the resources available within a single automata processor board, by estimating run-times for problem instances (39,18) and (40,17). The paper serves as a useful guide to solving problems using this new accelerator technology.
Aggregation of topological motifs in the Escherichia coli transcriptional regulatory network
Directory of Open Access Journals (Sweden)
Barabási Albert-László
2004-01-01
Full Text Available Abstract Background Transcriptional regulation of cellular functions is carried out through a complex network of interactions among transcription factors and the promoter regions of genes and operons regulated by them.To better understand the system-level function of such networks simplification of their architecture was previously achieved by identifying the motifs present in the network, which are small, overrepresented, topologically distinct regulatory interaction patterns (subgraphs. However, the interaction of such motifs with each other, and their form of integration into the full network has not been previously examined. Results By studying the transcriptional regulatory network of the bacterium, Escherichia coli, we demonstrate that the two previously identified motif types in the network (i.e., feed-forward loops and bi-fan motifs do not exist in isolation, but rather aggregate into homologous motif clusters that largely overlap with known biological functions. Moreover, these clusters further coalesce into a supercluster, thus establishing distinct topological hierarchies that show global statistical properties similar to the whole network. Targeted removal of motif links disintegrates the network into small, isolated clusters, while random disruptions of equal number of links do not cause such an effect. Conclusion Individual motifs aggregate into homologous motif clusters and a supercluster forming the backbone of the E. coli transcriptional regulatory network and play a central role in defining its global topological organization.
Parallel motif extraction from very long sequences
Sahli, Majed
2013-01-01
Motifs are frequent patterns used to identify biological functionality in genomic sequences, periodicity in time series, or user trends in web logs. In contrast to a lot of existing work that focuses on collections of many short sequences, modern applications require mining of motifs in one very long sequence (i.e., in the order of several gigabytes). For this case, there exist statistical approaches that are fast but inaccurate; or combinatorial methods that are sound and complete. Unfortunately, existing combinatorial methods are serial and very slow. Consequently, they are limited to very short sequences (i.e., a few megabytes), small alphabets (typically 4 symbols for DNA sequences), and restricted types of motifs. This paper presents ACME, a combinatorial method for extracting motifs from a single very long sequence. ACME arranges the search space in contiguous blocks that take advantage of the cache hierarchy in modern architectures, and achieves almost an order of magnitude performance gain in serial execution. It also decomposes the search space in a smart way that allows scalability to thousands of processors with more than 90% speedup. ACME is the only method that: (i) scales to gigabyte-long sequences; (ii) handles large alphabets; (iii) supports interesting types of motifs with minimal additional cost; and (iv) is optimized for a variety of architectures such as multi-core systems, clusters in the cloud, and supercomputers. ACME reduces the extraction time for an exact-length query from 4 hours to 7 minutes on a typical workstation; handles 3 orders of magnitude longer sequences; and scales up to 16, 384 cores on a supercomputer. Copyright is held by the owner/author(s).
Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki
2011-03-14
We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.
MODA: an efficient algorithm for network motif discovery in biological networks.
Omidi, Saeed; Schreiber, Falk; Masoudi-Nejad, Ali
2009-10-01
In recent years, interest has been growing in the study of complex networks. Since Erdös and Rényi (1960) proposed their random graph model about 50 years ago, many researchers have investigated and shaped this field. Many indicators have been proposed to assess the global features of networks. Recently, an active research area has developed in studying local features named motifs as the building blocks of networks. Unfortunately, network motif discovery is a computationally hard problem and finding rather large motifs (larger than 8 nodes) by means of current algorithms is impractical as it demands too much computational effort. In this paper, we present a new algorithm (MODA) that incorporates techniques such as a pattern growth approach for extracting larger motifs efficiently. We have tested our algorithm and found it able to identify larger motifs with more than 8 nodes more efficiently than most of the current state-of-the-art motif discovery algorithms. While most of the algorithms rely on induced subgraphs as motifs of the networks, MODA is able to extract both induced and non-induced subgraphs simultaneously. The MODA source code is freely available at: http://LBB.ut.ac.ir/Download/LBBsoft/MODA/
Dynamic motifs in socio-economic networks
Zhang, Xin; Shao, Shuai; Stanley, H. Eugene; Havlin, Shlomo
2014-12-01
Socio-economic networks are of central importance in economic life. We develop a method of identifying and studying motifs in socio-economic networks by focusing on “dynamic motifs,” i.e., evolutionary connection patterns that, because of “node acquaintances” in the network, occur much more frequently than random patterns. We examine two evolving bi-partite networks: i) the world-wide commercial ship chartering market and ii) the ship build-to-order market. We find similar dynamic motifs in both bipartite networks, even though they describe different economic activities. We also find that “influence” and “persistence” are strong factors in the interaction behavior of organizations. When two companies are doing business with the same customer, it is highly probable that another customer who currently only has business relationship with one of these two companies, will become customer of the second in the future. This is the effect of influence. Persistence means that companies with close business ties to customers tend to maintain their relationships over a long period of time.
Watson-Crick base pairing controls excited-state decay in natural DNA.
Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang
2014-10-13
Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Zimmermann, Nils E. R.; Horton, Matthew K.; Jain, Anubhav; Haranczyk, Maciej
2017-11-01
Structure-property relationships form the basis of many design rules in materials science, including synthesizability and long-term stability of catalysts, control of electrical and optoelectronic behavior in semiconductors as well as the capacity of and transport properties in cathode materials for rechargeable batteries. The immediate atomic environments (i.e., the first coordination shells) of a few atomic sites are often a key factor in achieving a desired property. Some of the most frequently encountered coordination patterns are tetrahedra, octahedra, body and face-centered cubic as well as hexagonal closed packed-like environments. Here, we showcase the usefulness of local order parameters to identify these basic structural motifs in inorganic solid materials by developing classification criteria. We introduce a systematic testing framework, the Einstein crystal test rig, that probes the response of order parameters to distortions in perfect motifs to validate our approach. Subsequently, we highlight three important application cases. First, we map basic crystal structure information of a large materials database in an intuitive manner by screening the Materials Project (MP) database (61,422 compounds) for element-specific motif distributions. Second, we use the structure-motif recognition capabilities to automatically find interstitials in metals, semiconductor, and insulator materials. Our Interstitialcy Finding Tool (InFiT) facilitates high-throughput screenings of defect properties. Third, the order parameters are reliable and compact quantitative structure descriptors for characterizing diffusion hops of intercalants as our example of magnesium in MnO2-spinel indicates. Finally, the tools developed in our work are readily and freely available as software implementations in the pymatgen library, and we expect them to be further applied to machine-learning approaches for emerging applications in materials science.
Performance of various density functionals for the hydrogen bonds in DNA base pairs
van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.
2006-01-01
We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been
Composite Structural Motifs of Binding Sites for Delineating Biological Functions of Proteins
Kinjo, Akira R.; Nakamura, Haruki
2012-01-01
Most biological processes are described as a series of interactions between proteins and other molecules, and interactions are in turn described in terms of atomic structures. To annotate protein functions as sets of interaction states at atomic resolution, and thereby to better understand the relation between protein interactions and biological functions, we conducted exhaustive all-against-all atomic structure comparisons of all known binding sites for ligands including small molecules, proteins and nucleic acids, and identified recurring elementary motifs. By integrating the elementary motifs associated with each subunit, we defined composite motifs that represent context-dependent combinations of elementary motifs. It is demonstrated that function similarity can be better inferred from composite motif similarity compared to the similarity of protein sequences or of individual binding sites. By integrating the composite motifs associated with each protein function, we define meta-composite motifs each of which is regarded as a time-independent diagrammatic representation of a biological process. It is shown that meta-composite motifs provide richer annotations of biological processes than sequence clusters. The present results serve as a basis for bridging atomic structures to higher-order biological phenomena by classification and integration of binding site structures. PMID:22347478
Specificity and affinity motifs for Grb2 SH2-ligand interactions
Kessels, Helmut W. H. G.; Ward, Alister C.; Schumacher, Ton N. M.
2002-01-01
Protein-protein interactions are often mediated by the recognition of short continuous amino acid stretches on target proteins by specific binding domains. Affinity-based selection strategies have successfully been used to define recognition motifs for a large series of such protein domains.
Genome-wide conserved consensus transcription factor binding motifs are hyper-methylated
Directory of Open Access Journals (Sweden)
Down Thomas A
2010-09-01
Full Text Available Abstract Background DNA methylation can regulate gene expression by modulating the interaction between DNA and proteins or protein complexes. Conserved consensus motifs exist across the human genome ("predicted transcription factor binding sites": "predicted TFBS" but the large majority of these are proven by chromatin immunoprecipitation and high throughput sequencing (ChIP-seq not to be biological transcription factor binding sites ("empirical TFBS". We hypothesize that DNA methylation at conserved consensus motifs prevents promiscuous or disorderly transcription factor binding. Results Using genome-wide methylation maps of the human heart and sperm, we found that all conserved consensus motifs as well as the subset of those that reside outside CpG islands have an aggregate profile of hyper-methylation. In contrast, empirical TFBS with conserved consensus motifs have a profile of hypo-methylation. 40% of empirical TFBS with conserved consensus motifs resided in CpG islands whereas only 7% of all conserved consensus motifs were in CpG islands. Finally we further identified a minority subset of TF whose profiles are either hypo-methylated or neutral at their respective conserved consensus motifs implicating that these TF may be responsible for establishing or maintaining an un-methylated DNA state, or whose binding is not regulated by DNA methylation. Conclusions Our analysis supports the hypothesis that at least for a subset of TF, empirical binding to conserved consensus motifs genome-wide may be controlled by DNA methylation.
Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju
2017-02-01
Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.
BlockLogo: Visualization of peptide and sequence motif conservation
DEFF Research Database (Denmark)
Olsen, Lars Rønn; Kudahl, Ulrich Johan; Simon, Christian
2013-01-01
BlockLogo is a web-server application for the visualization of protein and nucleotide fragments, continuous protein sequence motifs, and discontinuous sequence motifs using calculation of block entropy from multiple sequence alignments. The user input consists of a multiple sequence alignment, se...
Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps
International Nuclear Information System (INIS)
Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas
2012-01-01
We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)
Santamaría-Hernando, Saray; Krell, Tino; Ramos-González, María-Isabel
2012-01-01
Proteins of the animal heme peroxidase (ANP) superfamily differ greatly in size since they have either one or two catalytic domains that match profile PS50292. The orf PP_2561 of Pseudomonas putida KT2440 that we have called PepA encodes a two-domain ANP. The alignment of these domains with those of PepA homologues revealed a variable number of insertions with the consensus G-x-D-G-x-x-[GN]-[TN]-x-D-D. This motif has also been detected in the structure of pseudopilin (pdb 3G20), where it was found to be involved in Ca(2+) coordination although a sequence analysis did not reveal the presence of any known calcium binding motifs in this protein. Isothermal titration calorimetry revealed that a peptide containing this consensus motif bound specifically calcium ions with affinities ranging between 33-79 µM depending on the pH. Microcalorimetric titrations of the purified N-terminal ANP-like domain of PepA revealed Ca(2+) binding with a K(D) of 12 µM and stoichiometry of 1.25 calcium ions per protein monomer. This domain exhibited peroxidase activity after its reconstitution with heme. These data led to the definition of a novel calcium binding motif that we have termed PERCAL and which was abundantly present in animal peroxidase-like domains of bacterial proteins. Bacterial heme peroxidases thus possess two different types of calcium binding motifs, namely PERCAL and the related hemolysin type calcium binding motif, with the latter being located outside the catalytic domains and in their C-terminal end. A phylogenetic tree of ANP-like catalytic domains of bacterial proteins with PERCAL motifs, including single domain peroxidases, was divided into two major clusters, representing domains with and without PERCAL motif containing insertions. We have verified that the recently reported classification of bacterial heme peroxidases in two families (cd09819 and cd09821) is unrelated to these insertions. Sequences matching PERCAL were detected in all kingdoms of life.
Directory of Open Access Journals (Sweden)
Saray Santamaría-Hernando
Full Text Available Proteins of the animal heme peroxidase (ANP superfamily differ greatly in size since they have either one or two catalytic domains that match profile PS50292. The orf PP_2561 of Pseudomonas putida KT2440 that we have called PepA encodes a two-domain ANP. The alignment of these domains with those of PepA homologues revealed a variable number of insertions with the consensus G-x-D-G-x-x-[GN]-[TN]-x-D-D. This motif has also been detected in the structure of pseudopilin (pdb 3G20, where it was found to be involved in Ca(2+ coordination although a sequence analysis did not reveal the presence of any known calcium binding motifs in this protein. Isothermal titration calorimetry revealed that a peptide containing this consensus motif bound specifically calcium ions with affinities ranging between 33-79 µM depending on the pH. Microcalorimetric titrations of the purified N-terminal ANP-like domain of PepA revealed Ca(2+ binding with a K(D of 12 µM and stoichiometry of 1.25 calcium ions per protein monomer. This domain exhibited peroxidase activity after its reconstitution with heme. These data led to the definition of a novel calcium binding motif that we have termed PERCAL and which was abundantly present in animal peroxidase-like domains of bacterial proteins. Bacterial heme peroxidases thus possess two different types of calcium binding motifs, namely PERCAL and the related hemolysin type calcium binding motif, with the latter being located outside the catalytic domains and in their C-terminal end. A phylogenetic tree of ANP-like catalytic domains of bacterial proteins with PERCAL motifs, including single domain peroxidases, was divided into two major clusters, representing domains with and without PERCAL motif containing insertions. We have verified that the recently reported classification of bacterial heme peroxidases in two families (cd09819 and cd09821 is unrelated to these insertions. Sequences matching PERCAL were detected in all kingdoms of
International Nuclear Information System (INIS)
Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo
2012-01-01
Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.
Genome Analysis of Conserved Dehydrin Motifs in Vascular Plants
Directory of Open Access Journals (Sweden)
Ahmad A. Malik
2017-05-01
Full Text Available Dehydrins, a large family of abiotic stress proteins, are defined by the presence of a mostly conserved motif known as the K-segment, and may also contain two other conserved motifs known as the Y-segment and S-segment. Using the dehydrin literature, we developed a sequence motif definition of the K-segment, which we used to create a large dataset of dehydrin sequences by searching the Pfam00257 dehydrin dataset and the Phytozome 10 sequences of vascular plants. A comprehensive analysis of these sequences reveals that lysine residues are highly conserved in the K-segment, while the amino acid type is often conserved at other positions. Despite the Y-segment name, the central tyrosine is somewhat conserved, but can be substituted with two other small aromatic amino acids (phenylalanine or histidine. The S-segment contains a series of serine residues, but in some proteins is also preceded by a conserved LHR sequence. In many dehydrins containing all three of these motifs the S-segment is linked to the K-segment by a GXGGRRKK motif (where X can be any amino acid, suggesting a functional linkage between these two motifs. An analysis of the sequences shows that the dehydrin architecture and several biochemical properties (isoelectric point, molecular mass, and hydrophobicity score are dependent on each other, and that some dehydrin architectures are overexpressed during certain abiotic stress, suggesting that they may be optimized for a specific abiotic stress while others are involved in all forms of dehydration stress (drought, cold, and salinity.
RegRNA: an integrated web server for identifying regulatory RNA motifs and elements
Huang, Hsi-Yuan; Chien, Chia-Hung; Jen, Kuan-Hua; Huang, Hsien-Da
2006-01-01
Numerous regulatory structural motifs have been identified as playing essential roles in transcriptional and post-transcriptional regulation of gene expression. RegRNA is an integrated web server for identifying the homologs of regulatory RNA motifs and elements against an input mRNA sequence. Both sequence homologs and structural homologs of regulatory RNA motifs can be recognized. The regulatory RNA motifs supported in RegRNA are categorized into several classes: (i) motifs in mRNA 5′-untra...
Enrichment of Circular Code Motifs in the Genes of the Yeast Saccharomyces cerevisiae
Directory of Open Access Journals (Sweden)
Christian J. Michel
2017-12-01
Full Text Available A set X of 20 trinucleotides has been found to have the highest average occurrence in the reading frame, compared to the two shifted frames, of genes of bacteria, archaea, eukaryotes, plasmids and viruses. This set X has an interesting mathematical property, since X is a maximal C 3 self-complementary trinucleotide circular code. Furthermore, any motif obtained from this circular code X has the capacity to retrieve, maintain and synchronize the original (reading frame. Since 1996, the theory of circular codes in genes has mainly been developed by analysing the properties of the 20 trinucleotides of X , using combinatorics and statistical approaches. For the first time, we test this theory by analysing the X motifs, i.e., motifs from the circular code X , in the complete genome of the yeast Saccharomyces cerevisiae. Several properties of X motifs are identified by basic statistics (at the frequency level, and evaluated by comparison to R motifs, i.e., random motifs generated from 30 different random codes R . We first show that the frequency of X motifs is significantly greater than that of R motifs in the genome of S. cerevisiae. We then verify that no significant difference is observed between the frequencies of X and R motifs in the non-coding regions of S. cerevisiae, but that the occurrence number of X motifs is significantly higher than R motifs in the genes (protein-coding regions. This property is true for all cardinalities of X motifs (from 4 to 20 and for all 16 chromosomes. We further investigate the distribution of X motifs in the three frames of S. cerevisiae genes and show that they occur more frequently in the reading frame, regardless of their cardinality or their length. Finally, the ratio of X genes, i.e., genes with at least one X motif, to non- X genes, in the set of verified genes is significantly different to that observed in the set of putative or dubious genes with no experimental evidence. These results, taken together
Enrichment of Circular Code Motifs in the Genes of the Yeast Saccharomyces cerevisiae.
Michel, Christian J; Ngoune, Viviane Nguefack; Poch, Olivier; Ripp, Raymond; Thompson, Julie D
2017-12-03
A set X of 20 trinucleotides has been found to have the highest average occurrence in the reading frame, compared to the two shifted frames, of genes of bacteria, archaea, eukaryotes, plasmids and viruses. This set X has an interesting mathematical property, since X is a maximal C3 self-complementary trinucleotide circular code. Furthermore, any motif obtained from this circular code X has the capacity to retrieve, maintain and synchronize the original (reading) frame. Since 1996, the theory of circular codes in genes has mainly been developed by analysing the properties of the 20 trinucleotides of X, using combinatorics and statistical approaches. For the first time, we test this theory by analysing the X motifs, i.e., motifs from the circular code X, in the complete genome of the yeast Saccharomyces cerevisiae . Several properties of X motifs are identified by basic statistics (at the frequency level), and evaluated by comparison to R motifs, i.e., random motifs generated from 30 different random codes R. We first show that the frequency of X motifs is significantly greater than that of R motifs in the genome of S. cerevisiae . We then verify that no significant difference is observed between the frequencies of X and R motifs in the non-coding regions of S. cerevisiae , but that the occurrence number of X motifs is significantly higher than R motifs in the genes (protein-coding regions). This property is true for all cardinalities of X motifs (from 4 to 20) and for all 16 chromosomes. We further investigate the distribution of X motifs in the three frames of S. cerevisiae genes and show that they occur more frequently in the reading frame, regardless of their cardinality or their length. Finally, the ratio of X genes, i.e., genes with at least one X motif, to non-X genes, in the set of verified genes is significantly different to that observed in the set of putative or dubious genes with no experimental evidence. These results, taken together, represent the first
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.
Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul
2013-06-17
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Visualizing RNA Secondary Structure Base Pair Binding Probabilities using Nested Concave Hulls
Sansen , Joris; Bourqui , Romain; Thebault , Patricia; Allali , Julien; Auber , David
2015-01-01
International audience; The challenge 1 of the BIOVIS 2015 design contest consists in designing an intuitive visual depiction of base pairs binding probabilities for secondary structure of ncRNA. Our representation depicts the potential nucleotide pairs binding using nested concave hulls over the computed MFE ncRNA secondary structure. Thus, it allows to identify regions with a high level of uncertainty in the MFE computation and the structures which seem to match to reality.
Directory of Open Access Journals (Sweden)
Nils E. R. Zimmermann
2017-11-01
Full Text Available Structure–property relationships form the basis of many design rules in materials science, including synthesizability and long-term stability of catalysts, control of electrical and optoelectronic behavior in semiconductors, as well as the capacity of and transport properties in cathode materials for rechargeable batteries. The immediate atomic environments (i.e., the first coordination shells of a few atomic sites are often a key factor in achieving a desired property. Some of the most frequently encountered coordination patterns are tetrahedra, octahedra, body and face-centered cubic as well as hexagonal close packed-like environments. Here, we showcase the usefulness of local order parameters to identify these basic structural motifs in inorganic solid materials by developing classification criteria. We introduce a systematic testing framework, the Einstein crystal test rig, that probes the response of order parameters to distortions in perfect motifs to validate our approach. Subsequently, we highlight three important application cases. First, we map basic crystal structure information of a large materials database in an intuitive manner by screening the Materials Project (MP database (61,422 compounds for element-specific motif distributions. Second, we use the structure-motif recognition capabilities to automatically find interstitials in metals, semiconductor, and insulator materials. Our Interstitialcy Finding Tool (InFiT facilitates high-throughput screenings of defect properties. Third, the order parameters are reliable and compact quantitative structure descriptors for characterizing diffusion hops of intercalants as our example of magnesium in MnO2-spinel indicates. Finally, the tools developed in our work are readily and freely available as software implementations in the pymatgen library, and we expect them to be further applied to machine-learning approaches for emerging applications in materials science.
Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard
2012-11-01
8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.
Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard
2012-01-01
8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127
Vujaklija, Ivan; Bielen, Ana; Paradžik, Tina; Biđin, Siniša; Goldstein, Pavle; Vujaklija, Dušica
2016-02-18
The massive accumulation of protein sequences arising from the rapid development of high-throughput sequencing, coupled with automatic annotation, results in high levels of incorrect annotations. In this study, we describe an approach to decrease annotation errors of protein families characterized by low overall sequence similarity. The GDSL lipolytic family comprises proteins with multifunctional properties and high potential for pharmaceutical and industrial applications. The number of proteins assigned to this family has increased rapidly over the last few years. In particular, the natural abundance of GDSL enzymes reported recently in plants indicates that they could be a good source of novel GDSL enzymes. We noticed that a significant proportion of annotated sequences lack specific GDSL motif(s) or catalytic residue(s). Here, we applied motif-based sequence analyses to identify enzymes possessing conserved GDSL motifs in selected proteomes across the plant kingdom. Motif-based HMM scanning (Viterbi decoding-VD and posterior decoding-PD) and the here described PD/VD protocol were successfully applied on 12 selected plant proteomes to identify sequences with GDSL motifs. A significant number of identified GDSL sequences were novel. Moreover, our scanning approach successfully detected protein sequences lacking at least one of the essential motifs (171/820) annotated by Pfam profile search (PfamA) as GDSL. Based on these analyses we provide a curated list of GDSL enzymes from the selected plants. CLANS clustering and phylogenetic analysis helped us to gain a better insight into the evolutionary relationship of all identified GDSL sequences. Three novel GDSL subfamilies as well as unreported variations in GDSL motifs were discovered in this study. In addition, analyses of selected proteomes showed a remarkable expansion of GDSL enzymes in the lycophyte, Selaginella moellendorffii. Finally, we provide a general motif-HMM scanner which is easily accessible through
RNA recognition motif (RRM)-containing proteins in Bombyx mori
African Journals Online (AJOL)
STORAGESEVER
2009-03-20
Mar 20, 2009 ... Recognition Motif (RRM), sometimes referred to as. RNP1, is one of the first identified domains for RNA interaction. RRM is very common ..... Apart from the RRM motif, eIF3-S9 has a Trp-Asp. (WD) repeat domain, Poly (A) ...
Zhang, Yanju; Lameijer, Eric-Wubbo; 't Hoen, Peter A C; Ning, Zemin; Slagboom, P Eline; Ye, Kai
2012-02-15
RNA-seq is a powerful technology for the study of transcriptome profiles that uses deep-sequencing technologies. Moreover, it may be used for cellular phenotyping and help establishing the etiology of diseases characterized by abnormal splicing patterns. In RNA-Seq, the exact nature of splicing events is buried in the reads that span exon-exon boundaries. The accurate and efficient mapping of these reads to the reference genome is a major challenge. We developed PASSion, a pattern growth algorithm-based pipeline for splice site detection in paired-end RNA-Seq reads. Comparing the performance of PASSion to three existing RNA-Seq analysis pipelines, TopHat, MapSplice and HMMSplicer, revealed that PASSion is competitive with these packages. Moreover, the performance of PASSion is not affected by read length and coverage. It performs better than the other three approaches when detecting junctions in highly abundant transcripts. PASSion has the ability to detect junctions that do not have known splicing motifs, which cannot be found by the other tools. Of the two public RNA-Seq datasets, PASSion predicted ≈ 137,000 and 173,000 splicing events, of which on average 82 are known junctions annotated in the Ensembl transcript database and 18% are novel. In addition, our package can discover differential and shared splicing patterns among multiple samples. The code and utilities can be freely downloaded from https://trac.nbic.nl/passion and ftp://ftp.sanger.ac.uk/pub/zn1/passion.
Native characterization of nucleic acid motif thermodynamics via non-covalent catalysis
Wang, Chunyan; Bae, Jin H.; Zhang, David Yu
2016-01-01
DNA hybridization thermodynamics is critical for accurate design of oligonucleotides for biotechnology and nanotechnology applications, but parameters currently in use are inaccurately extrapolated based on limited quantitative understanding of thermal behaviours. Here, we present a method to measure the ΔG° of DNA motifs at temperatures and buffer conditions of interest, with significantly better accuracy (6- to 14-fold lower s.e.) than prior methods. The equilibrium constant of a reaction with thermodynamics closely approximating that of a desired motif is numerically calculated from directly observed reactant and product equilibrium concentrations; a DNA catalyst is designed to accelerate equilibration. We measured the ΔG° of terminal fluorophores, single-nucleotide dangles and multinucleotide dangles, in temperatures ranging from 10 to 45 °C. PMID:26782977
Lock, Antonia; Forfar, Rachel; Weston, Cathryn; Bowsher, Leo; Upton, Graham J G; Reynolds, Christopher A; Ladds, Graham; Dixon, Ann M
2014-12-01
G protein-coupled receptors (GPCRs) are the largest family of cell-surface receptors in mammals and facilitate a range of physiological responses triggered by a variety of ligands. GPCRs were thought to function as monomers, however it is now accepted that GPCR homo- and hetero-oligomers also exist and influence receptor properties. The Schizosaccharomyces pombe GPCR Mam2 is a pheromone-sensing receptor involved in mating and has previously been shown to form oligomers in vivo. The first transmembrane domain (TMD) of Mam2 contains a small-XXX-small motif, overrepresented in membrane proteins and well-known for promoting helix-helix interactions. An ortholog of Mam2 in Saccharomyces cerevisiae, Ste2, contains an analogous small-XXX-small motif which has been shown to contribute to receptor homo-oligomerization, localization and function. Here we have used experimental and computational techniques to characterize the role of the small-XXX-small motif in function and assembly of Mam2 for the first time. We find that disruption of the motif via mutagenesis leads to reduction of Mam2 TMD1 homo-oligomerization and pheromone-responsive cellular signaling of the full-length protein. It also impairs correct targeting to the plasma membrane. Mutation of the analogous motif in Ste2 yielded similar results, suggesting a conserved mechanism for assembly. Using co-expression of the two fungal receptors in conjunction with computational models, we demonstrate a functional change in G protein specificity and propose that this is brought about through hetero-dimeric interactions of Mam2 with Ste2 via the complementary small-XXX-small motifs. This highlights the potential of these motifs to affect a range of properties that can be investigated in other GPCRs. Copyright © 2014. Published by Elsevier B.V.
LENUS (Irish Health Repository)
Casey, Fergal
2011-08-22
Abstract Background Gene and protein interactions are commonly represented as networks, with the genes or proteins comprising the nodes and the relationship between them as edges. Motifs, or small local configurations of edges and nodes that arise repeatedly, can be used to simplify the interpretation of networks. Results We examined triplet motifs in a network of quantitative epistatic genetic relationships, and found a non-random distribution of particular motif classes. Individual motif classes were found to be associated with different functional properties, suggestive of an underlying biological significance. These associations were apparent not only for motif classes, but for individual positions within the motifs. As expected, NNN (all negative) motifs were strongly associated with previously reported genetic (i.e. synthetic lethal) interactions, while PPP (all positive) motifs were associated with protein complexes. The two other motif classes (NNP: a positive interaction spanned by two negative interactions, and NPP: a negative spanned by two positives) showed very distinct functional associations, with physical interactions dominating for the former but alternative enrichments, typical of biochemical pathways, dominating for the latter. Conclusion We present a model showing how NNP motifs can be used to recognize supportive relationships between protein complexes, while NPP motifs often identify opposing or regulatory behaviour between a gene and an associated pathway. The ability to use motifs to point toward underlying biological organizational themes is likely to be increasingly important as more extensive epistasis mapping projects in higher organisms begin.
Fingerprint motifs of phytases | Fan | African Journal of Biotechnology
African Journals Online (AJOL)
Among the total of potential 173 phytases gained in 11 plant genomes through MAST, PAPhys are the major phytases, and HAPhys are the minor, and other phytase groups are not found in planta. Keywords: Phytase, fingerprint motif, multiple EM for motif elicitation (MEME), MAST African Journal of Biotechnology Vol.
Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2015-11-02
Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Gao, Zhong-Ke; Jin, Ning-De; Wang, Wen-Xu; Lai, Ying-Cheng
2010-07-01
The dynamics of two-phase flows have been a challenging problem in nonlinear dynamics and fluid mechanics. We propose a method to characterize and distinguish patterns from inclined water-oil flow experiments based on the concept of network motifs that have found great usage in network science and systems biology. In particular, we construct from measured time series phase-space complex networks and then calculate the distribution of a set of distinct network motifs. To gain insight, we first test the approach using time series from classical chaotic systems and find a universal feature: motif distributions from different chaotic systems are generally highly heterogeneous. Our main finding is that the distributions from experimental two-phase flows tend to be heterogeneous as well, suggesting the underlying chaotic nature of the flow patterns. Calculation of the maximal Lyapunov exponent provides further support for this. Motif distributions can thus be a feasible tool to understand the dynamics of realistic two-phase flow patterns.
Time series regression-based pairs trading in the Korean equities market
Kim, Saejoon; Heo, Jun
2017-07-01
Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.
Short Arginine Motifs Drive Protein Stickiness in the Escherichia coli Cytoplasm.
Kyne, Ciara; Crowley, Peter B
2017-09-19
Although essential to numerous biotech applications, knowledge of molecular recognition by arginine-rich motifs in live cells remains limited. 1 H, 15 N HSQC and 19 F NMR spectroscopies were used to investigate the effects of C-terminal -GR n (n = 1-5) motifs on GB1 interactions in Escherichia coli cells and cell extracts. While the "biologically inert" GB1 yields high-quality in-cell spectra, the -GR n fusions with n = 4 or 5 were undetectable. This result suggests that a tetra-arginine motif is sufficient to drive interactions between a test protein and macromolecules in the E. coli cytoplasm. The inclusion of a 12 residue flexible linker between GB1 and the -GR 5 motif did not improve detection of the "inert" domain. In contrast, all of the constructs were detectable in cell lysates and extracts, suggesting that the arginine-mediated complexes were weak. Together these data reveal the significance of weak interactions between short arginine-rich motifs and the E. coli cytoplasm and demonstrate the potential of such motifs to modify protein interactions in living cells. These interactions must be considered in the design of (in vivo) nanoscale assemblies that rely on arginine-rich sequences.
A rule of seven in Watson-Crick base-pairing of mismatched sequences.
Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip
2012-05-13
Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.
Gene regulatory and signaling networks exhibit distinct topological distributions of motifs
Ferreira, Gustavo Rodrigues; Nakaya, Helder Imoto; Costa, Luciano da Fontoura
2018-04-01
The biological processes of cellular decision making and differentiation involve a plethora of signaling pathways and gene regulatory circuits. These networks in turn exhibit a multitude of motifs playing crucial parts in regulating network activity. Here we compare the topological placement of motifs in gene regulatory and signaling networks and observe that it suggests different evolutionary strategies in motif distribution for distinct cellular subnetworks.
Gaur, Pallavi; Chaturvedi, Anoop
2017-07-22
The clustering pattern and motifs give immense information about any biological data. An application of machine learning algorithms for clustering and candidate motif detection in miRNAs derived from exosomes is depicted in this paper. Recent progress in the field of exosome research and more particularly regarding exosomal miRNAs has led much bioinformatic-based research to come into existence. The information on clustering pattern and candidate motifs in miRNAs of exosomal origin would help in analyzing existing, as well as newly discovered miRNAs within exosomes. Along with obtaining clustering pattern and candidate motifs in exosomal miRNAs, this work also elaborates the usefulness of the machine learning algorithms that can be efficiently used and executed on various programming languages/platforms. Data were clustered and sequence candidate motifs were detected successfully. The results were compared and validated with some available web tools such as 'BLASTN' and 'MEME suite'. The machine learning algorithms for aforementioned objectives were applied successfully. This work elaborated utility of machine learning algorithms and language platforms to achieve the tasks of clustering and candidate motif detection in exosomal miRNAs. With the information on mentioned objectives, deeper insight would be gained for analyses of newly discovered miRNAs in exosomes which are considered to be circulating biomarkers. In addition, the execution of machine learning algorithms on various language platforms gives more flexibility to users to try multiple iterations according to their requirements. This approach can be applied to other biological data-mining tasks as well.
Dietz, Andrea N; Villinger, Clarissa; Becker, Stefan; Frick, Manfred; von Einem, Jens
2018-01-01
The human cytomegalovirus (HCMV) tegument protein pUL71 is required for efficient secondary envelopment and accumulates at the Golgi compartment-derived viral assembly complex (vAC) during infection. Analysis of various C-terminally truncated pUL71 proteins fused to enhanced green fluorescent protein (eGFP) identified amino acids 23 to 34 as important determinants for its Golgi complex localization. Sequence analysis and mutational verification revealed the presence of an N-terminal tyrosine-based trafficking motif (YXXΦ) in pUL71. This led us to hypothesize a requirement of the YXXΦ motif for the function of pUL71 in infection. Mutation of both the tyrosine residue and the entire YXXΦ motif resulted in an altered distribution of mutant pUL71 at the plasma membrane and in the cytoplasm during infection. Both YXXΦ mutant viruses exhibited similarly decreased focal growth and reduced virus yields in supernatants. Ultrastructurally, mutant-virus-infected cells exhibited impaired secondary envelopment manifested by accumulations of capsids undergoing an envelopment process. Additionally, clusters of capsid accumulations surrounding the vAC were observed, similar to the ultrastructural phenotype of a UL71-deficient mutant. The importance of endocytosis and thus the YXXΦ motif for targeting pUL71 to the Golgi complex was further demonstrated when clathrin-mediated endocytosis was inhibited either by coexpression of the C-terminal part of cellular AP180 (AP180-C) or by treatment with methyl-β-cyclodextrin. Both conditions resulted in a plasma membrane accumulation of pUL71. Altogether, these data reveal the presence of a functional N-terminal endocytosis motif that is an important determinant for intracellular localization of pUL71 and that is furthermore required for the function of pUL71 during secondary envelopment of HCMV capsids at the vAC. IMPORTANCE Human cytomegalovirus (HCMV) is the leading cause of birth defects among congenital virus infections and can
Prediction of plant promoters based on hexamers and random triplet pair analysis
Directory of Open Access Journals (Sweden)
Noman Nasimul
2011-06-01
Full Text Available Abstract Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA. In FDAFSA, adjacent triplet-pairs (hexamer sequences were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM, a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies
Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding
2013-07-16
Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.
Lenka, Sangram K; Lohia, Bikash; Kumar, Abhay; Chinnusamy, Viswanathan; Bansal, Kailash C
2009-02-01
Abscisic acid (ABA), the popular plant stress hormone, plays a key role in regulation of sub-set of stress responsive genes. These genes respond to ABA through specific transcription factors which bind to cis-regulatory elements present in their promoters. We discovered the ABA Responsive Element (ABRE) core (ACGT) containing CGMCACGTGB motif as over-represented motif among the promoters of ABA responsive co-expressed genes in rice. Targeted gene prediction strategy using this motif led to the identification of 402 protein coding genes potentially regulated by ABA-dependent molecular genetic network. RT-PCR analysis of arbitrarily chosen 45 genes from the predicted 402 genes confirmed 80% accuracy of our prediction. Plant Gene Ontology (GO) analysis of ABA responsive genes showed enrichment of signal transduction and stress related genes among diverse functional categories.
BEAM web server: a tool for structural RNA motif discovery.
Pietrosanto, Marco; Adinolfi, Marta; Casula, Riccardo; Ausiello, Gabriele; Ferrè, Fabrizio; Helmer-Citterich, Manuela
2018-03-15
RNA structural motif finding is a relevant problem that becomes computationally hard when working on high-throughput data (e.g. eCLIP, PAR-CLIP), often represented by thousands of RNA molecules. Currently, the BEAM server is the only web tool capable to handle tens of thousands of RNA in input with a motif discovery procedure that is only limited by the current secondary structure prediction accuracies. The recently developed method BEAM (BEAr Motifs finder) can analyze tens of thousands of RNA molecules and identify RNA secondary structure motifs associated to a measure of their statistical significance. BEAM is extremely fast thanks to the BEAR encoding that transforms each RNA secondary structure in a string of characters. BEAM also exploits the evolutionary knowledge contained in a substitution matrix of secondary structure elements, extracted from the RFAM database of families of homologous RNAs. The BEAM web server has been designed to streamline data pre-processing by automatically handling folding and encoding of RNA sequences, giving users a choice for the preferred folding program. The server provides an intuitive and informative results page with the list of secondary structure motifs identified, the logo of each motif, its significance, graphic representation and information about its position in the RNA molecules sharing it. The web server is freely available at http://beam.uniroma2.it/ and it is implemented in NodeJS and Python with all major browsers supported. marco.pietrosanto@uniroma2.it. Supplementary data are available at Bioinformatics online.
Moddemeijer, R
In the case of two signals with independent pairs of observations (x(n),y(n)) a statistic to estimate the variance of the histogram based mutual information estimator has been derived earlier. We present such a statistic for dependent pairs. To derive this statistic it is necessary to avail of a
Review article: The mountain motif in the plot of Matthew
Directory of Open Access Journals (Sweden)
Gert J. Volschenk
2010-09-01
Full Text Available This article reviewed T.L. Donaldson’s book, Jesus on the mountain: A study in Matthean theology, published in 1985 by JSOT Press, Sheffield, and focused on the mountain motif in the structure and plot of the Gospel of Matthew, in addition to the work of Donaldson on the mountain motif as a literary motif and as theological symbol. The mountain is a primary theological setting for Jesus’ ministry and thus is an important setting, serving as one of the literary devices by which Matthew structured and progressed his narrative. The Zion theological and eschatological significance and Second Temple Judaism serve as the historical and theological background for the mountain motif. The last mountain setting (Mt 28:16–20 is the culmination of the three theological themes in the plot of Matthew, namely Christology, ecclesiology and salvation history.
Perception Enhancement using Visual Attributes in Sequence Motif Visualization
Oon, Yin; Lee, Nung; Kok, Wei
2016-01-01
Sequence logo is a well-accepted scientific method to visualize the conservation characteristics of biological sequence motifs. Previous studies found that using sequence logo graphical representation for scientific evidence reports or arguments could seriously cause biases and misinterpretation by users. This study investigates on the visual attributes performance of a sequence logo in helping users to perceive and interpret the information based on preattentive theories and Gestalt principl...
On the origin of distribution patterns of motifs in biological networks
Directory of Open Access Journals (Sweden)
Lesk Arthur M
2008-08-01
Full Text Available Abstract Background Inventories of small subgraphs in biological networks have identified commonly-recurring patterns, called motifs. The inference that these motifs have been selected for function rests on the idea that their occurrences are significantly more frequent than random. Results Our analysis of several large biological networks suggests, in contrast, that the frequencies of appearance of common subgraphs are similar in natural and corresponding random networks. Conclusion Indeed, certain topological features of biological networks give rise naturally to the common appearance of the motifs. We therefore question whether frequencies of occurrences are reasonable evidence that the structures of motifs have been selected for their functional contribution to the operation of networks.
NMR and molecular modeling evidence for a G·A mismatch base pair in a purine-rich DNA duplex
International Nuclear Information System (INIS)
Li, Ying; Wilson, W.D.; Zon, G.
1991-01-01
1 H NMR experiments indicate that the oligomer 5'-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G·A base pairs and a 3' unpaired adenosine. NMR results indicate that guanoxine imino protons of the F·A mismatches are not hydrogen bonded but are stacked in the helix. A G→ I substitution in either G·A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1' of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G·A base pairs containing A-NH 2 to GN3 and G-NH 2 to AN7 hydrogen bonds and B-form base pairs on both sides of the G·A pairs [5'-d(ATGAGC)]. The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH 2 of the mismatch to a phosphate oxygen is predicted
Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes
Directory of Open Access Journals (Sweden)
Ji-Jian Chin
2014-01-01
Full Text Available Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user’s secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.
Efficient and provable secure pairing-free security-mediated identity-based identification schemes.
Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W
2014-01-01
Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.
Systematic comparison of the response properties of protein and RNA mediated gene regulatory motifs.
Iyengar, Bharat Ravi; Pillai, Beena; Venkatesh, K V; Gadgil, Chetan J
2017-05-30
We present a framework enabling the dissection of the effects of motif structure (feedback or feedforward), the nature of the controller (RNA or protein), and the regulation mode (transcriptional, post-transcriptional or translational) on the response to a step change in the input. We have used a common model framework for gene expression where both motif structures have an activating input and repressing regulator, with the same set of parameters, to enable a comparison of the responses. We studied the global sensitivity of the system properties, such as steady-state gain, overshoot, peak time, and peak duration, to parameters. We find that, in all motifs, overshoot correlated negatively whereas peak duration varied concavely with peak time. Differences in the other system properties were found to be mainly dependent on the nature of the controller rather than the motif structure. Protein mediated motifs showed a higher degree of adaptation i.e. a tendency to return to baseline levels; in particular, feedforward motifs exhibited perfect adaptation. RNA mediated motifs had a mild regulatory effect; they also exhibited a lower peaking tendency and mean overshoot. Protein mediated feedforward motifs showed higher overshoot and lower peak time compared to the corresponding feedback motifs.
International Nuclear Information System (INIS)
Hsu, Y.-Y.; Liu, Y.-N.; Wang Wenyen; Kao, Fu-Jen; Kung, S.-H.
2007-01-01
An in vivo protease assay suitable for analysis by fluorescence resonance energy transfer (FRET) was developed on the basis of a novel FRET pair. The specifically designed fusion substrate consists of green fluorescent protein 2 (GFP 2 )-peptide-red fluorescent protein 2 (DsRed2), with a cleavage motif for the enterovirus 2A protease (2A pro ) embedded within the peptide region. FRET can be readily visualized in real-time from cells expressing the fusion substrate until a proteolytic cleavage by 2A pro from the input virus. The level of FRET decay is a function of the amount and infection duration of the inoculated virus as measured by a fluorometer assay. The FRET biosensor also responded well to other related enteroviruses but not to a phylogenetically distant virus. Western blot analysis confirmed the physical cleavage of the fusion substrate upon the infections. The study provides proof of principle for applying the FRET technology to diagnostics, screening procedures, and cell biological research
The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study
Czech Academy of Sciences Publication Activity Database
Burda, J. V.; Šponer, Jiří; Leszczynski, J.
2001-01-01
Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001
Fragment-based modelling of single stranded RNA bound to RNA recognition motif containing proteins
de Beauchene, Isaure Chauvot; de Vries, Sjoerd J.; Zacharias, Martin
2016-01-01
Abstract Protein-RNA complexes are important for many biological processes. However, structural modeling of such complexes is hampered by the high flexibility of RNA. Particularly challenging is the docking of single-stranded RNA (ssRNA). We have developed a fragment-based approach to model the structure of ssRNA bound to a protein, based on only the protein structure, the RNA sequence and conserved contacts. The conformational diversity of each RNA fragment is sampled by an exhaustive library of trinucleotides extracted from all known experimental protein–RNA complexes. The method was applied to ssRNA with up to 12 nucleotides which bind to dimers of the RNA recognition motifs (RRMs), a highly abundant eukaryotic RNA-binding domain. The fragment based docking allows a precise de novo atomic modeling of protein-bound ssRNA chains. On a benchmark of seven experimental ssRNA–RRM complexes, near-native models (with a mean heavy-atom deviation of <3 Å from experiment) were generated for six out of seven bound RNA chains, and even more precise models (deviation < 2 Å) were obtained for five out of seven cases, a significant improvement compared to the state of the art. The method is not restricted to RRMs but was also successfully applied to Pumilio RNA binding proteins. PMID:27131381
DEFF Research Database (Denmark)
El-Sayed, Ahmed Ali; Pedersen, Erik B.; Khaireldin, Nahid Y.
2016-01-01
In continuation of our investigation of characteristics and thermodynamic properties of the i-motif 5′-d[(CCCTAA)3CCCT)] upon insertion of intercalating nucleotides into the cytosine-rich oligonucleotide, this article evaluates the stabilities of i-motif oligonucleotides upon insertion of naphtha......In continuation of our investigation of characteristics and thermodynamic properties of the i-motif 5′-d[(CCCTAA)3CCCT)] upon insertion of intercalating nucleotides into the cytosine-rich oligonucleotide, this article evaluates the stabilities of i-motif oligonucleotides upon insertion...... of naphthalimide (1H-benzo[de]isoquinoline-1,3(2H)-dione) as the intercalating nucleic acid. The stabilities of i-motif structures with inserted naphthalimide intercalating nucleotides were studied using UV melting temperatures (Tm) and circular dichroism spectra at different pH values and conditions (crowding...
DEFF Research Database (Denmark)
von Essen, Marina; Menné, Charlotte; Nielsen, Bodil L
2002-01-01
. The other pathway is dependent on protein kinase C (PKC)-mediated activation of the CD3 gamma di-leucine-based receptor-sorting motif. Previous studies have failed to demonstrate a connection between ligand- and PKC-induced TCR down-regulation. Thus, although an apparent paradox, the dogma has been...... that ligand- and PKC-induced TCR down-regulations are not interrelated. By analyses of a newly developed CD3 gamma-negative T cell variant, freshly isolated and PHA-activated PBMC, and a mouse T cell line, we challenged this dogma and demonstrate in this work that PKC activation and the CD3 gamma di...
Rtt107/Esc4 binds silent chromatin and DNA repair proteins using different BRCT motifs
Directory of Open Access Journals (Sweden)
Jockusch Rebecca A
2006-11-01
Full Text Available Abstract Background By screening a plasmid library for proteins that could cause silencing when targeted to the HMR locus in Saccharomyces cerevisiae, we previously reported the identification of Rtt107/Esc4 based on its ability to establish silent chromatin. In this study we aimed to determine the mechanism of Rtt107/Esc4 targeted silencing and also learn more about its biological functions. Results Targeted silencing by Rtt107/Esc4 was dependent on the SIR genes, which encode obligatory structural and enzymatic components of yeast silent chromatin. Based on its sequence, Rtt107/Esc4 was predicted to contain six BRCT motifs. This motif, originally identified in the human breast tumor suppressor gene BRCA1, is a protein interaction domain. The targeted silencing activity of Rtt107/Esc4 resided within the C-terminal two BRCT motifs, and this region of the protein bound to Sir3 in two-hybrid tests. Deletion of RTT107/ESC4 caused sensitivity to the DNA damaging agent MMS as well as to hydroxyurea. A two-hybrid screen showed that the N-terminal BRCT motifs of Rtt107/Esc4 bound to Slx4, a protein previously shown to be involved in DNA repair and required for viability in a strain lacking the DNA helicase Sgs1. Like SLX genes, RTT107ESC4 interacted genetically with SGS1; esc4Δ sgs1Δ mutants were viable, but exhibited a slow-growth phenotype and also a synergistic DNA repair defect. Conclusion Rtt107/Esc4 binds to the silencing protein Sir3 and the DNA repair protein Slx4 via different BRCT motifs, thus providing a bridge linking silent chromatin to DNA repair enzymes.
Motif formation and industry specific topologies in the Japanese business firm network
Maluck, Julian; Donner, Reik V.; Takayasu, Hideki; Takayasu, Misako
2017-05-01
Motifs and roles are basic quantities for the characterization of interactions among 3-node subsets in complex networks. In this work, we investigate how the distribution of 3-node motifs can be influenced by modifying the rules of an evolving network model while keeping the statistics of simpler network characteristics, such as the link density and the degree distribution, invariant. We exemplify this problem for the special case of the Japanese Business Firm Network, where a well-studied and relatively simple yet realistic evolving network model is available, and compare the resulting motif distribution in the real-world and simulated networks. To better approximate the motif distribution of the real-world network in the model, we introduce both subgraph dependent and global additional rules. We find that a specific rule that allows only for the merging process between nodes with similar link directionality patterns reduces the observed excess of densely connected motifs with bidirectional links. Our study improves the mechanistic understanding of motif formation in evolving network models to better describe the characteristic features of real-world networks with a scale-free topology.
Binding properties of SUMO-interacting motifs (SIMs) in yeast.
Jardin, Christophe; Horn, Anselm H C; Sticht, Heinrich
2015-03-01
Small ubiquitin-like modifier (SUMO) conjugation and interaction play an essential role in many cellular processes. A large number of yeast proteins is known to interact non-covalently with SUMO via short SUMO-interacting motifs (SIMs), but the structural details of this interaction are yet poorly characterized. In the present work, sequence analysis of a large dataset of 148 yeast SIMs revealed the existence of a hydrophobic core binding motif and a preference for acidic residues either within or adjacent to the core motif. Thus the sequence properties of yeast SIMs are highly similar to those described for human. Molecular dynamics simulations were performed to investigate the binding preferences for four representative SIM peptides differing in the number and distribution of acidic residues. Furthermore, the relative stability of two previously observed alternative binding orientations (parallel, antiparallel) was assessed. For all SIMs investigated, the antiparallel binding mode remained stable in the simulations and the SIMs were tightly bound via their hydrophobic core residues supplemented by polar interactions of the acidic residues. In contrary, the stability of the parallel binding mode is more dependent on the sequence features of the SIM motif like the number and position of acidic residues or the presence of additional adjacent interaction motifs. This information should be helpful to enhance the prediction of SIMs and their binding properties in different organisms to facilitate the reconstruction of the SUMO interactome.
Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.
Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei
2017-11-03
Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hydrogen bond disruption in DNA base pairs from (14)C transmutation.
Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A
2014-09-04
Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.
DEFF Research Database (Denmark)
Carli, Lorenzo; Genta, G; Cantatore, Angela
2011-01-01
3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to ...
Sutera, V A; Han, E S; Rajman, L A; Lovett, S T
1999-10-01
The recJ gene, identified in Escherichia coli, encodes a Mg(+2)-dependent 5'-to-3' exonuclease with high specificity for single-strand DNA. Genetic and biochemical experiments implicate RecJ exonuclease in homologous recombination, base excision, and methyl-directed mismatch repair. Genes encoding proteins with strong similarities to RecJ have been found in every eubacterial genome sequenced to date, with the exception of Mycoplasma and Mycobacterium tuberculosis. Multiple genes encoding proteins similar to RecJ are found in some eubacteria, including Bacillus and Helicobacter, and in the archaea. Among this divergent set of sequences, seven conserved motifs emerge. We demonstrate here that amino acids within six of these motifs are essential for both the biochemical and genetic functions of E. coli RecJ. These motifs may define interactions with Mg(2+) ions or substrate DNA. A large family of proteins more distantly related to RecJ is present in archaea, eubacteria, and eukaryotes, including a hypothetical protein in the MgPa adhesin operon of Mycoplasma, a domain of putative polyA polymerases in Synechocystis and Aquifex, PRUNE of Drosophila, and an exopolyphosphatase (PPX1) of Saccharomyces cereviseae. Because these six RecJ motifs are shared between exonucleases and exopolyphosphatases, they may constitute an ancient phosphoesterase domain now found in all kingdoms of life.
Complete motif analysis of sequence requirements for translation initiation at non-AUG start codons.
Diaz de Arce, Alexander J; Noderer, William L; Wang, Clifford L
2018-01-25
The initiation of mRNA translation from start codons other than AUG was previously believed to be rare and of relatively low impact. More recently, evidence has suggested that as much as half of all translation initiation utilizes non-AUG start codons, codons that deviate from AUG by a single base. Furthermore, non-AUG start codons have been shown to be involved in regulation of expression and disease etiology. Yet the ability to gauge expression based on the sequence of a translation initiation site (start codon and its flanking bases) has been limited. Here we have performed a comprehensive analysis of translation initiation sites that utilize non-AUG start codons. By combining genetic-reporter, cell-sorting, and high-throughput sequencing technologies, we have analyzed the expression associated with all possible variants of the -4 to +4 positions of non-AUG translation initiation site motifs. This complete motif analysis revealed that 1) with the right sequence context, certain non-AUG start codons can generate expression comparable to that of AUG start codons, 2) sequence context affects each non-AUG start codon differently, and 3) initiation at non-AUG start codons is highly sensitive to changes in the flanking sequences. Complete motif analysis has the potential to be a key tool for experimental and diagnostic genomics. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Copp, William; Denisov, Alexey Y; Xie, Jingwei; Noronha, Anne M; Liczner, Christopher; Safaee, Nozhat; Wilds, Christopher J; Gehring, Kalle
2017-09-29
Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2'-deoxyribose, 2'-O-methyl-ribose, 2'-deoxy-2'-fluoro-ribose, arabinose and 2'-deoxy-2'-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2' modifications gave a variety of effects. Arabinose and 2'-deoxy-2'-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2'-O-methyl and 2'-deoxy-2'-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment
Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.
2000-01-01
Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)
Sayadi, Ahmed
2011-07-20
The function of proteins is often mediated by short linear segments of their amino acid sequence, called Short Linear Motifs or SLiMs, the identification of which can provide important information about a protein function. However, the short length of the motifs and their variable degree of conservation makes their identification hard since it is difficult to correctly estimate the statistical significance of their occurrence. Consequently, only a small fraction of them have been discovered so far. We describe here an approach for the discovery of SLiMs based on their occurrence in evolutionarily unrelated proteins belonging to the same biological, signalling or metabolic pathway and give specific examples of its effectiveness in both rediscovering known motifs and in discovering novel ones. An automatic implementation of the procedure, available for download, allows significant motifs to be identified, automatically annotated with functional, evolutionary and structural information and organized in a database that can be inspected and queried. An instance of the database populated with pre-computed data on seven organisms is accessible through a publicly available server and we believe it constitutes by itself a useful resource for the life sciences (http://www.biocomputing.it/modipath).
Gorochowski, Thomas E; Grierson, Claire S; di Bernardo, Mario
2018-03-01
Network motifs are significantly overrepresented subgraphs that have been proposed as building blocks for natural and engineered networks. Detailed functional analysis has been performed for many types of motif in isolation, but less is known about how motifs work together to perform complex tasks. To address this issue, we measure the aggregation of network motifs via methods that extract precisely how these structures are connected. Applying this approach to a broad spectrum of networked systems and focusing on the widespread feed-forward loop motif, we uncover striking differences in motif organization. The types of connection are often highly constrained, differ between domains, and clearly capture architectural principles. We show how this information can be used to effectively predict functionally important nodes in the metabolic network of Escherichia coli . Our findings have implications for understanding how networked systems are constructed from motif parts and elucidate constraints that guide their evolution.
Castro-Mondragon, Jaime Abraham; Jaeger, Sébastien; Thieffry, Denis; Thomas-Chollier, Morgane; van Helden, Jacques
2017-07-27
Transcription factor (TF) databases contain multitudes of binding motifs (TFBMs) from various sources, from which non-redundant collections are derived by manual curation. The advent of high-throughput methods stimulated the production of novel collections with increasing numbers of motifs. Meta-databases, built by merging these collections, contain redundant versions, because available tools are not suited to automatically identify and explore biologically relevant clusters among thousands of motifs. Motif discovery from genome-scale data sets (e.g. ChIP-seq) also produces redundant motifs, hampering the interpretation of results. We present matrix-clustering, a versatile tool that clusters similar TFBMs into multiple trees, and automatically creates non-redundant TFBM collections. A feature unique to matrix-clustering is its dynamic visualisation of aligned TFBMs, and its capability to simultaneously treat multiple collections from various sources. We demonstrate that matrix-clustering considerably simplifies the interpretation of combined results from multiple motif discovery tools, and highlights biologically relevant variations of similar motifs. We also ran a large-scale application to cluster ∼11 000 motifs from 24 entire databases, showing that matrix-clustering correctly groups motifs belonging to the same TF families, and drastically reduced motif redundancy. matrix-clustering is integrated within the RSAT suite (http://rsat.eu/), accessible through a user-friendly web interface or command-line for its integration in pipelines. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Vassilev Boris
2010-04-01
Full Text Available Abstract Background A large proportion of an organism's genome encodes for membrane proteins. Membrane proteins are important for many cellular processes, and several diseases can be linked to mutations in them. With the tremendous growth of sequence data, there is an increasing need to reliably identify membrane proteins from sequence, to functionally annotate them, and to correctly predict their topology. Results We introduce a technique called structural fragment clustering, which learns sequential motifs from 3D structural fragments. From over 500,000 fragments, we obtain 213 statistically significant, non-redundant, and novel motifs that are highly specific to α-helical transmembrane proteins. From these 213 motifs, 58 of them were assigned to function and checked in the scientific literature for a biological assessment. Seventy percent of the motifs are found in co-factor, ligand, and ion binding sites, 30% at protein interaction interfaces, and 12% bind specific lipids such as glycerol or cardiolipins. The vast majority of motifs (94% appear across evolutionarily unrelated families, highlighting the modularity of functional design in membrane proteins. We describe three novel motifs in detail: (1 a dimer interface motif found in voltage-gated chloride channels, (2 a proton transfer motif found in heme-copper oxidases, and (3 a convergently evolved interface helix motif found in an aspartate symporter, a serine protease, and cytochrome b. Conclusions Our findings suggest that functional modules exist in membrane proteins, and that they occur in completely different evolutionary contexts and cover different binding sites. Structural fragment clustering allows us to link sequence motifs to function through clusters of structural fragments. The sequence motifs can be applied to identify and characterize membrane proteins in novel genomes.
A cell-surface-anchored ratiometric i-motif sensor for extracellular pH detection.
Ying, Le; Xie, Nuli; Yang, Yanjing; Yang, Xiaohai; Zhou, Qifeng; Yin, Bincheng; Huang, Jin; Wang, Kemin
2016-06-14
A FRET-based sensor is anchored on the cell surface through streptavidin-biotin interactions. Due to the excellent properties of the pH-sensitive i-motif structure, the sensor can detect extracellular pH with high sensitivity and excellent reversibility.
International Nuclear Information System (INIS)
Palmero, F; Archilla, J F R; Hennig, D; Romero, F R
2004-01-01
Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder
DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water
Energy Technology Data Exchange (ETDEWEB)
Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Toyohashi, Aichi, 441-8580 (Japan); Shulga, S. [Institute for Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv (Ukraine); Danilov, V. I. [Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv (Ukraine)
2016-02-01
To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.
DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water
International Nuclear Information System (INIS)
Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.
2016-01-01
To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes
[Cover motifs of the Tidsskrift. A 14-year cavalcade].
Nylenna, M
1998-12-10
In 1985 the Journal of the Norwegian Medical Association changed its cover policy, moving the table of contents inside the Journal and introducing cover illustrations. This article provides an analysis of all cover illustrations published over this 14-year period, 420 covers in all. There is a great variation in cover motifs and designs and a development towards more general motifs. The initial emphasis on historical and medical aspects is now less pronounced, while the use of works of art and nature motifs has increased, and the cover now more often has a direct bearing on the specific contents of the issue. Professor of medical history Oivind Larsen has photographed two thirds of the covers and contributed 95% of the inside essay-style reflections on the cover motif. Over the years, he has expanded the role of the historian of medicine disseminating knowledge to include that of the raconteur with a personal tone of voice. The Journal's covers are now one of its most characteristic features, emblematic of the Journal's ambition of standing for quality and timelessness vis-à-vis the news media, and of its aim of bridging the gap between medicine and the humanities.
Insights into the motif preference of APOBEC3 enzymes.
Directory of Open Access Journals (Sweden)
Diako Ebrahimi
Full Text Available We used a multivariate data analysis approach to identify motifs associated with HIV hypermutation by different APOBEC3 enzymes. The analysis showed that APOBEC3G targets G mainly within GG, TG, TGG, GGG, TGGG and also GGGT. The G nucleotides flanked by a C at the 3' end (in +1 and +2 positions were indicated as disfavoured targets by APOBEC3G. The G nucleotides within GGGG were found to be targeted at a frequency much less than what is expected. We found that the infrequent G-to-A mutation within GGGG is not limited to the inaccessibility, to APOBEC3, of poly Gs in the central and 3'polypurine tracts (PPTs which remain double stranded during the HIV reverse transcription. GGGG motifs outside the PPTs were also disfavoured. The motifs GGAG and GAGG were also found to be disfavoured targets for APOBEC3. The motif-dependent mutation of G within the HIV genome by members of the APOBEC3 family other than APOBEC3G was limited to GA→AA changes. The results did not show evidence of other types of context dependent G-to-A changes in the HIV genome.
Dye-sensitized solar cell with a pair of carbon-based electrodes
International Nuclear Information System (INIS)
Kyaw, Aung Ko Ko; Demir, Hilmi Volkan; Sun Xiaowei; Tantang, Hosea; Zhang Qichun; Wu Tao; Ke, Lin; Wei Jun
2012-01-01
We have fabricated a dye-sensitized solar cell (DSSC) with a pair of carbon-based electrodes using a transparent, conductive carbon nanotubes (CNTs) film modified with ultra-thin titanium-sub-oxide (TiO x ) as the working electrode and a bilayer of conductive CNTs and carbon black as the counter electrode. Without TiO x modification, the DSSC is almost nonfunctional whereas the power conversion efficiency (PCE) increases significantly when the working electrode is modified with TiO x . The performance of the cell could be further improved when the carbon black film was added on the counter electrode. The improved efficiency can be attributed to the inhibition of the mass recombination at the working electrode/electrolyte interface by TiO x and the acceleration of the electron transfer kinetics at the counter electrode by carbon black. The DSSC with a pair of carbon-based electrodes gives the PCE of 1.37%. (paper)
I-motif DNA structures are formed in the nuclei of human cells
Zeraati, Mahdi; Langley, David B.; Schofield, Peter; Moye, Aaron L.; Rouet, Romain; Hughes, William E.; Bryan, Tracy M.; Dinger, Marcel E.; Christ, Daniel
2018-06-01
Human genome function is underpinned by the primary storage of genetic information in canonical B-form DNA, with a second layer of DNA structure providing regulatory control. I-motif structures are thought to form in cytosine-rich regions of the genome and to have regulatory functions; however, in vivo evidence for the existence of such structures has so far remained elusive. Here we report the generation and characterization of an antibody fragment (iMab) that recognizes i-motif structures with high selectivity and affinity, enabling the detection of i-motifs in the nuclei of human cells. We demonstrate that the in vivo formation of such structures is cell-cycle and pH dependent. Furthermore, we provide evidence that i-motif structures are formed in regulatory regions of the human genome, including promoters and telomeric regions. Our results support the notion that i-motif structures provide key regulatory roles in the genome.
Single base pair mutation analysis by PNA directed PCR clamping
DEFF Research Database (Denmark)
Ørum, H.; Nielsen, P.E.; Egholm, M.
1993-01-01
A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....
PandA : pairings and arithmetic
Chuengsatiansup, C.; Naehrig, M.; Ribarski, P.; Schwabe, P.; Cao, Z.; Zhang, F.
2014-01-01
This paper introduces PandA, a software framework for Pairings and Arithmetic. It is designed to bring together advances in the efficient computation of cryptographic pairings and the development and implementation of pairing-based protocols. The intention behind the PandA framework is to give
A naturally-occurring new lead-based halocuprate(I)
Energy Technology Data Exchange (ETDEWEB)
Welch, Mark D.; Rumsey, Michael S. [Department of Earth Sciences, Natural History Museum, London SW7 5BD (United Kingdom); Kleppe, Annette K. [Diamond Light Source, Harwell Science and Innovation Campus, Didcot, Oxfordshire OX11 0DE (United Kingdom)
2016-06-15
Pb{sub 2}Cu(OH){sub 2}I{sub 3} is a new type of halocuprate(I) that is a framework of alternating [Pb{sub 4}(OH){sub 4}]{sup 4+} and [Cu{sub 2}I{sub 6}{sup ]4−} units. The structure has been determined in orthorhombic space group Fddd to R{sub 1}=0.037, wR{sub 2}=0.057, GoF=1.016. Unit cell parameters are a=16.7082(9) Å, b=20.8465(15) Å, c=21.0159(14) Å, V=7320.0(8) Å{sup 3} (Z=32). There is no synthetic counterpart. The structure is based upon a cubane-like Pb{sub 4}(OH){sub 4} nucleus that is coordinated to sixteen iodide ions. Cu{sup +} ions are inserted into pairs of adjacent edge-sharing tetrahedral sites in the iodide motif to form [Cu{sub 2}I{sub 6}]{sup 4-} groups. The Raman spectrum of Pb{sub 2}Cu(OH){sub 2}I{sub 3} has two O-H stretching modes and as such is consistent with space group Fddd, with two non-equivalent OH groups, rather than the related space group I4{sub 1}/acd which has only one non-equivalent OH group. Consideration of the 18-electron rule implies that there is a Cu=Cu double bond, which may be consistent with the short Cu…Cu distance of 2.78 Å, although the dearth of published data on the interpretation of Cu…Cu distances in halocuprate(I) compounds does not allow a clear-cut interpretation of this interatomic distance. The orthorhombic structure is compared with that of the synthetic halocuprate(I) compound Pb{sub 2}Cu(OH){sub 2}BrI{sub 2} with space group I4{sub 1}/acd and having chains of corner-linked CuI{sub 4} tetrahedra rather than isolated Cu{sub 2}I{sub 6} pairs. The paired motif found in Pb{sub 2}Cu(OH){sub 2}I{sub 3} cannot be achieved in space group I4{sub 1}/acd and, conversely, the chain motif cannot be achieved in space group Fddd. As such, the space group defines either a chain or an isolated-pair motif. The existence of Pb{sub 2}Cu(OH){sub 2}I{sub 3} suggests a new class of inorganic halocuprate(I)s based upon the Pb{sub 4}(OH){sub 4} group. - Graphical abstract: Projection onto (100) of the structure of the
A Study on the Motif Pattern of Dark-Cloud Cover in the Securities
Directory of Open Access Journals (Sweden)
Long Jing
2017-01-01
Full Text Available Morphological analysis is the analysis and mining of the graphics formed of the securities price changes. Investors need to forecast the trend of future before buying and selling points, which can avoid great loss. Therefore, the analysis of motif pattern of K-line in the form of futures investment technology analysis is very significant. Based on the thoughts of short-term trend clustering, this paper proposes a method of detecting the motif pattern of Dark-Cloud Cover in stock time series by analysing stock historic data and K-line shape, in order to predict the stock market trends. And we prove the effectiveness and practicality of the method by a series of experimental analysis.
Capturing alternative secondary structures of RNA by decomposition of base-pairing probabilities.
Hagio, Taichi; Sakuraba, Shun; Iwakiri, Junichi; Mori, Ryota; Asai, Kiyoshi
2018-02-19
It is known that functional RNAs often switch their functions by forming different secondary structures. Popular tools for RNA secondary structures prediction, however, predict the single 'best' structures, and do not produce alternative structures. There are bioinformatics tools to predict suboptimal structures, but it is difficult to detect which alternative secondary structures are essential. We proposed a new computational method to detect essential alternative secondary structures from RNA sequences by decomposing the base-pairing probability matrix. The decomposition is calculated by a newly implemented software tool, RintW, which efficiently computes the base-pairing probability distributions over the Hamming distance from arbitrary reference secondary structures. The proposed approach has been demonstrated on ROSE element RNA thermometer sequence and Lysine RNA ribo-switch, showing that the proposed approach captures conformational changes in secondary structures. We have shown that alternative secondary structures are captured by decomposing base-paring probabilities over Hamming distance. Source code is available from http://www.ncRNA.org/RintW .
Identification of a putative nuclear export signal motif in human NANOG homeobox domain
International Nuclear Information System (INIS)
Park, Sung-Won; Do, Hyun-Jin; Huh, Sun-Hyung; Sung, Boreum; Uhm, Sang-Jun; Song, Hyuk; Kim, Nam-Hyung; Kim, Jae-Hwan
2012-01-01
Highlights: ► We found the putative nuclear export signal motif within human NANOG homeodomain. ► Leucine-rich residues are important for human NANOG homeodomain nuclear export. ► CRM1-specific inhibitor LMB blocked the potent human NANOG NES-mediated nuclear export. -- Abstract: NANOG is a homeobox-containing transcription factor that plays an important role in pluripotent stem cells and tumorigenic cells. To understand how nuclear localization of human NANOG is regulated, the NANOG sequence was examined and a leucine-rich nuclear export signal (NES) motif ( 125 MQELSNILNL 134 ) was found in the homeodomain (HD). To functionally validate the putative NES motif, deletion and site-directed mutants were fused to an EGFP expression vector and transfected into COS-7 cells, and the localization of the proteins was examined. While hNANOG HD exclusively localized to the nucleus, a mutant with both NLSs deleted and only the putative NES motif contained (hNANOG HD-ΔNLSs) was predominantly cytoplasmic, as observed by nucleo/cytoplasmic fractionation and Western blot analysis as well as confocal microscopy. Furthermore, site-directed mutagenesis of the putative NES motif in a partial hNANOG HD only containing either one of the two NLS motifs led to localization in the nucleus, suggesting that the NES motif may play a functional role in nuclear export. Furthermore, CRM1-specific nuclear export inhibitor LMB blocked the hNANOG potent NES-mediated export, suggesting that the leucine-rich motif may function in CRM1-mediated nuclear export of hNANOG. Collectively, a NES motif is present in the hNANOG HD and may be functionally involved in CRM1-mediated nuclear export pathway.
Brovarets', O O; Hovorun, D M
2010-01-01
A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.
Dragon polya spotter: Predictor of poly(A) motifs within human genomic DNA sequences
Kalkatawi, Manal M.; Rangkuti, Farania; Schramm, Michael C.; Jankovic, Boris R.; Kamau, Allan; Chowdhary, Rajesh; Archer, John A.C.; Bajic, Vladimir B.
2011-01-01
. These models are trained to recognize 12 most common poly(A) motifs in human DNA. Our predictors are available as a free web-based tool accessible at http://cbrc.kaust.edu.sa/dps. Compared with other reported predictors, our models achieve higher sensitivity
Directory of Open Access Journals (Sweden)
Rie Kawai
2012-03-01
Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.
Directory of Open Access Journals (Sweden)
Anselm H.C. Horn
2015-11-01
Full Text Available The efficiency of many cellular processes relies on the defined interaction among different proteins within the same metabolic or signaling pathway. Consequently, a spatial colocalization of functionally interacting proteins has frequently emerged during evolution. This concept has been adapted within the synthetic biology community for the purpose of creating artificial scaffolds. A recent advancement of this concept is the use of peptide motifs and their cognate adaptor domains. SH2, SH3, GBD, and PDZ domains have been used most often in research studies to date. The approach has been successfully applied to the synthesis of a variety of target molecules including catechin, D-glucaric acid, H2, hydrochinone, resveratrol, butyrate, gamma-aminobutyric acid, and mevalonate. Increased production levels of up to 77-fold have been observed compared to non-scaffolded systems. A recent extension of this concept is the creation of a covalent linkage between peptide motifs and adaptor domains, which leads to a more stable association of the scaffolded systems and thus bears the potential to further enhance metabolic productivity.
Directory of Open Access Journals (Sweden)
Cécile Segonzac
2017-08-01
Full Text Available Ralstonia solanacearum is the causal agent of the devastating bacterial wilt disease in many high value Solanaceae crops. R. solanacearum secretes around 70 effectors into host cells in order to promote infection. Plants have, however, evolved specialized immune receptors that recognize corresponding effectors and confer qualitative disease resistance. In the model species Arabidopsis thaliana, the paired immune receptors RRS1 (resistance to Ralstonia solanacearum 1 and RPS4 (resistance to Pseudomonas syringae 4 cooperatively recognize the R. solanacearum effector PopP2 in the nuclei of infected cells. PopP2 is an acetyltransferase that binds to and acetylates the RRS1 WRKY DNA-binding domain resulting in reduced RRS1-DNA association thereby activating plant immunity. Here, we surveyed the naturally occurring variation in PopP2 sequence among the R. solanacearum strains isolated from diseased tomato and pepper fields across the Republic of Korea. Our analysis revealed high conservation of popP2 sequence with only three polymorphic alleles present amongst 17 strains. Only one variation (a premature stop codon caused the loss of RPS4/RRS1-dependent recognition in Arabidopsis. We also found that PopP2 harbors a putative eukaryotic transcriptional repressor motif (ethylene-responsive element binding factor-associated amphiphilic repression or EAR, which is known to be involved in the recruitment of transcriptional co-repressors. Remarkably, mutation of the EAR motif disabled PopP2 avirulence function as measured by the development of hypersensitive response, electrolyte leakage, defense marker gene expression and bacterial growth in Arabidopsis. This lack of recognition was partially but significantly reverted by the C-terminal addition of a synthetic EAR motif. We show that the EAR motif-dependent gain of avirulence correlated with the stability of the PopP2 protein. Furthermore, we demonstrated the requirement of the PopP2 EAR motif for PTI
Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M
2015-12-01
Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Nuclear localization of the dehydrin OpsDHN1 is determined by histidine-rich motif
Hernández-Sánchez, Itzell E.; Maruri-López, Israel; Ferrando, Alejandro; Carbonell, Juan; Graether, Steffen P.; Jiménez-Bremont, Juan F.
2015-01-01
The cactus OpsDHN1 dehydrin belongs to a large family of disordered and highly hydrophilic proteins known as Late Embryogenesis Abundant (LEA) proteins, which accumulate during the late stages of embryogenesis and in response to abiotic stresses. Herein, we present the in vivo OpsDHN1 subcellular localization by N-terminal GFP translational fusion; our results revealed a cytoplasmic and nuclear localization of the GFP::OpsDHN1 protein in Nicotiana benthamiana epidermal cells. In addition, dimer assembly of OpsDHN1 in planta using a Bimolecular Fluorescence Complementation (BiFC) approach was demonstrated. In order to understand the in vivo role of the histidine-rich motif, the OpsDHN1-ΔHis version was produced and assayed for its subcellular localization and dimer capability by GFP fusion and BiFC assays, respectively. We found that deletion of the OpsDHN1 histidine-rich motif restricted its localization to cytoplasm, but did not affect dimer formation. In addition, the deletion of the S-segment in the OpsDHN1 protein affected its nuclear localization. Our data suggest that the deletion of histidine-rich motif and S-segment show similar effects, preventing OpsDHN1 from getting into the nucleus. Based on these results, the histidine-rich motif is proposed as a targeting element for OpsDHN1 nuclear localization. PMID:26442018
Nuclear localization of the dehydrin OpsDHN1 is determined by histidine-rich motif
Directory of Open Access Journals (Sweden)
Itzell Euridice Hernández-Sánchez
2015-09-01
Full Text Available The cactus OpsDHN1 dehydrin belongs to a large family of disordered and highly hydrophilic proteins known as Late Embryogenesis Abundant (LEA proteins, which accumulate during the late stages of embryogenesis and in response to abiotic stresses. Herein, we present the in vivo OpsDHN1 subcellular localization by N-terminal GFP translational fusion; our results revealed a cytoplasmic and nuclear localization of the GFP::OpsDHN1 protein in Nicotiana benthamiana epidermal cells. In addition, dimer assembly of OpsDHN1 in planta using a Bimolecular Fluorescence Complementation (BiFC approach was demonstrated. In order to understand the in vivo role of the histidine-rich motif, the OpsDHN1-ΔHis version was produced and assayed for its subcellular localization and dimer capability by GFP fusion and BiFC assays, respectively. We found that deletion of the OpsDHN1 histidine-rich motif restricted its localization to cytoplasm, but did not affect dimer formation. In addition, the deletion of the S-segment in the OpsDHN1 protein affected its nuclear localization. Our data suggest that the deletion of histidine-rich motif and S-segment show similar effects, preventing OpsDHN1 from getting into the nucleus. Based on these results, the histidine rich motif is proposed as a targeting element for OpsDHN1 nuclear localization.
Selection against spurious promoter motifs correlates withtranslational efficiency across bacteria
Energy Technology Data Exchange (ETDEWEB)
Froula, Jeffrey L.; Francino, M. Pilar
2007-05-01
Because binding of RNAP to misplaced sites could compromise the efficiency of transcription, natural selection for the optimization of gene expression should regulate the distribution of DNA motifs capable of RNAP-binding across the genome. Here we analyze the distribution of the -10 promoter motifs that bind the {sigma}{sup 70} subunit of RNAP in 42 bacterial genomes. We show that selection on these motifs operates across the genome, maintaining an over-representation of -10 motifs in regulatory sequences while eliminating them from the nonfunctional and, in most cases, from the protein coding regions. In some genomes, however, -10 sites are over-represented in the coding sequences; these sites could induce pauses effecting regulatory roles throughout the length of a transcriptional unit. For nonfunctional sequences, the extent of motif under-representation varies across genomes in a manner that broadly correlates with the number of tRNA genes, a good indicator of translational speed and growth rate. This suggests that minimizing the time invested in gene transcription is an important selective pressure against spurious binding. However, selection against spurious binding is detectable in the reduced genomes of host-restricted bacteria that grow at slow rates, indicating that components of efficiency other than speed may also be important. Minimizing the number of RNAP molecules per cell required for transcription, and the corresponding energetic expense, may be most relevant in slow growers. These results indicate that genome-level properties affecting the efficiency of transcription and translation can respond in an integrated manner to optimize gene expression. The detection of selection against promoter motifs in nonfunctional regions also implies that no sequence may evolve free of selective constraints, at least in the relatively small and unstructured genomes of bacteria.
Liang, Feng; Lindsay, Stuart; Zhang, Peiming
2012-11-21
With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.
Paired structures and other opposite-based models
DEFF Research Database (Denmark)
Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel
2015-01-01
, that we will assume dependent on a specific negation, previously determined. In this way we can define a paired fuzzy set as a couple of opposite valuation fuzzy sets. Then we shall explore what kind of new valuation fuzzy sets can be generated from the semantic tension between those two poles, leading...... to a more complex valuation structure that still keeps the essence of being paired. In this way several neutral fuzzy sets can appear, in particular indeterminacy, ambivalence and conflict. Two consequences are then presented: on one hand, we will show how Atanassov´s Intuitionistic Fuzzy Sets can be viewed...
De Novo Discovery of Structured ncRNA Motifs in Genomic Sequences
DEFF Research Database (Denmark)
Ruzzo, Walter L; Gorodkin, Jan
2014-01-01
De novo discovery of "motifs" capturing the commonalities among related noncoding ncRNA structured RNAs is among the most difficult problems in computational biology. This chapter outlines the challenges presented by this problem, together with some approaches towards solving them, with an emphas...... on an approach based on the CMfinder CMfinder program as a case study. Applications to genomic screens for novel de novo structured ncRNA ncRNA s, including structured RNA elements in untranslated portions of protein-coding genes, are presented.......De novo discovery of "motifs" capturing the commonalities among related noncoding ncRNA structured RNAs is among the most difficult problems in computational biology. This chapter outlines the challenges presented by this problem, together with some approaches towards solving them, with an emphasis...
DNA electronic circular dichroism on the inter-base pair scale
DEFF Research Database (Denmark)
Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer
2015-01-01
A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....
Lucky Motifs in Chinese Folk Art: Interpreting Paper-cut from Chinese Shaanxi
Xuxiao WANG
2013-01-01
Paper-cut is not simply a form of traditional Chinese folk art. Lucky motifs developed in paper-cut certainly acquired profound cultural connotations. As paper-cut is a time-honoured skill across the nation, interpreting those motifs requires cultural receptiveness and anthropological sensitivity. The author of this article analyzes examples of paper-cut from Northern Shaanxi, China, to identify the cohesive motifs and explore the auspiciousness of the specific concepts of Fu, Lu, Shou, Xi. T...
Viroids: from genotype to phenotype just relying on RNA sequence and structural motifs
Directory of Open Access Journals (Sweden)
Ricardo eFlores
2012-06-01
Full Text Available As a consequence of two unique physical properties, small size and circularity, viroid RNAs do not code for proteins and thus depend on RNA sequence/structural motifs for interacting with host proteins that mediate their invasion, replication, spread, and circumvention of defensive barriers. Viroid genomes fold up on themselves adopting collapsed secondary structures wherein stretches of nucleotides stabilized by Watson-Crick pairs are flanked by apparently unstructured loops. However, compelling data show that they are instead stabilized by alternative non-canonical pairs and that specific loops in the rod-like secondary structure, characteristic of Potato spindle tuber viroid and most other members of the family Pospiviroidae, are critical for replication and systemic trafficking. In contrast, rather than folding into a rod-like secondary structure, most members of the family Avsunvioidae adopt multibranched conformations occasionally stabilized by kissing loop interactions critical for viroid viability in vivo. Besides these most stable secondary structures, viroid RNAs alternatively adopt during replication transient metastable conformations containing elements of local higher-order structure, prominent among which are the hammerhead ribozymes catalyzing a key replicative step in the family Avsunvioidae, and certain conserved hairpins that also mediate replication steps in the family Pospiviroidae. Therefore, different RNA structures ⎯either global or local ⎯ determine different functions, thus highlighting the need for in-depth structural studies on viroid RNAs.
MOMFER: A Search Engine of Thompson's Motif-Index of Folk Literature
Karsdorp, F.B.; van der Meulen, Marten; Meder, Theo; van den Bosch, Antal
2015-01-01
More than fifty years after the first edition of Thompson's seminal Motif-Indexof Folk Literature, we present an online search engine tailored to fully disclose the index digitally. This search engine, called MOMFER, greatly enhances the searchability of the Motif-Index and provides exciting new
Das, Shubhajit
2015-09-17
We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.
Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan
2015-01-01
We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.
Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J
2012-09-12
8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.
Directory of Open Access Journals (Sweden)
Das Tanmoy
2012-03-01
Full Text Available We show that, by using the unit-cell transformation between 1 Fe per unit cell to 2 Fe per unit cell, one can qualitatively understand the pairing symmetry of several families of iron-based superconductors. In iron-pnictides and iron-chalcogenides, the nodeless s±-pairing and the resulting magnetic resonance mode transform nicely between the two unit cells, while retaining all physical properties unchanged. However, when the electron-pocket disappears from the Fermi surface with complete doping in KFe2As2, we find that the unit-cell invariant requirement prohibits the occurrence of s±-pairing symmetry (caused by inter-hole-pocket nesting. However, the intra-pocket nesting is compatible here, which leads to a nodal d-wave pairing. The corresponding Fermi surface topology and the pairing symmetry are similar to Ce-based heavy-fermion superconductors. Furthermore, when the Fermi surface hosts only electron-pockets in KyFe2-xSe2, the inter-electron-pocket nesting induces a nodeless and isotropic d-wave pairing. This situation is analogous to the electron-doped cuprates, where the strong antiferromagnetic order creates similar disconnected electron-pocket Fermi surface, and hence nodeless d-wave pairing appears. The unit-cell transformation in KyFe2-xSe2 exhibits that the d-wave pairing breaks the translational symmetry of the 2 Fe unit cell, and thus cannot be realized unless a vacancy ordering forms to compensate for it. These results are consistent with the coexistence picture of a competing order and nodeless d-wave superconductivity in both cuprates and KyFe1.6Se2.
How pathogens use linear motifs to perturb host cell networks
Via, Allegra; Uyar, Bora; Brun, Christine; Zanzoni, Andreas
2015-01-01
Molecular mimicry is one of the powerful stratagems that pathogens employ to colonise their hosts and take advantage of host cell functions to guarantee their replication and dissemination. In particular, several viruses have evolved the ability to interact with host cell components through protein short linear motifs (SLiMs) that mimic host SLiMs, thus facilitating their internalisation and the manipulation of a wide range of cellular networks. Here we present convincing evidence from the literature that motif mimicry also represents an effective, widespread hijacking strategy in prokaryotic and eukaryotic parasites. Further insights into host motif mimicry would be of great help in the elucidation of the molecular mechanisms behind host cell invasion and the development of anti-infective therapeutic strategies.
Yang, Peng; Wu, Min; Guo, Jing; Kwoh, Chee Keong; Przytycka, Teresa M; Zheng, Jie
2014-02-17
As a fundamental genomic element, meiotic recombination hotspot plays important roles in life sciences. Thus uncovering its regulatory mechanisms has broad impact on biomedical research. Despite the recent identification of the zinc finger protein PRDM9 and its 13-mer binding motif as major regulators for meiotic recombination hotspots, other regulators remain to be discovered. Existing methods for finding DNA sequence motifs of recombination hotspots often rely on the enrichment of co-localizations between hotspots and short DNA patterns, which ignore the cross-individual variation of recombination rates and sequence polymorphisms in the population. Our objective in this paper is to capture signals encoded in genetic variations for the discovery of recombination-associated DNA motifs. Recently, an algorithm called "LDsplit" has been designed to detect the association between single nucleotide polymorphisms (SNPs) and proximal meiotic recombination hotspots. The association is measured by the difference of population recombination rates at a hotspot between two alleles of a candidate SNP. Here we present an open source software tool of LDsplit, with integrative data visualization for recombination hotspots and their proximal SNPs. Applying LDsplit on SNPs inside an established 7-mer motif bound by PRDM9 we observed that SNP alleles preserving the original motif tend to have higher recombination rates than the opposite alleles that disrupt the motif. Running on SNP windows around hotspots each containing an occurrence of the 7-mer motif, LDsplit is able to guide the established motif finding algorithm of MEME to recover the 7-mer motif. In contrast, without LDsplit the 7-mer motif could not be identified. LDsplit is a software tool for the discovery of cis-regulatory DNA sequence motifs stimulating meiotic recombination hotspots by screening and narrowing down to hotspot associated SNPs. It is the first computational method that utilizes the genetic variation of
Network motif frequency vectors reveal evolving metabolic network organisation.
Pearcy, Nicole; Crofts, Jonathan J; Chuzhanova, Nadia
2015-01-01
At the systems level many organisms of interest may be described by their patterns of interaction, and as such, are perhaps best characterised via network or graph models. Metabolic networks, in particular, are fundamental to the proper functioning of many important biological processes, and thus, have been widely studied over the past decade or so. Such investigations have revealed a number of shared topological features, such as a short characteristic path-length, large clustering coefficient and hierarchical modular structure. However, the extent to which evolutionary and functional properties of metabolism manifest via this underlying network architecture remains unclear. In this paper, we employ a novel graph embedding technique, based upon low-order network motifs, to compare metabolic network structure for 383 bacterial species categorised according to a number of biological features. In particular, we introduce a new global significance score which enables us to quantify important evolutionary relationships that exist between organisms and their physical environments. Using this new approach, we demonstrate a number of significant correlations between environmental factors, such as growth conditions and habitat variability, and network motif structure, providing evidence that organism adaptability leads to increased complexities in the resultant metabolic networks.
Non-standard base pairing and stacked structures in methyl xanthine clusters
Czech Academy of Sciences Publication Activity Database
Callahan, M. P.; Gengeliczki, Z.; Svadlenak, N.; Valdes, Haydee; Hobza, Pavel; de Vries, M. S.
2008-01-01
Roč. 10, č. 19 (2008), s. 2819-2826 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:NSF(US) CHE-0615401 Institutional research plan: CEZ:AV0Z40550506 Keywords : non-standard base pairing * stacked structures * in methyl xanthine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.064, year: 2008
Sterpone, Fabio; Nguyen, Phuong H; Kalimeri, Maria; Derreumaux, Philippe
2013-10-08
We have derived new effective interactions that improve the description of ion-pairs in the OPEP coarse-grained force field without introducing explicit electrostatic terms. The iterative Boltzmann inversion method was used to extract these potentials from all atom simulations by targeting the radial distribution function of the distance between the center of mass of the side-chains. The new potentials have been tested on several systems that differ in structural properties, thermodynamic stabilities and number of ion-pairs. Our modeling, by refining the packing of the charged amino-acids, impacts the stability of secondary structure motifs and the population of intermediate states during temperature folding/unfolding; it also improves the aggregation propensity of peptides. The new version of the OPEP force field has the potentiality to describe more realistically a large spectrum of situations where salt-bridges are key interactions.
BayesMD: flexible biological modeling for motif discovery
DEFF Research Database (Denmark)
Tang, Man-Hung Eric; Krogh, Anders; Winther, Ole
2008-01-01
We present BayesMD, a Bayesian Motif Discovery model with several new features. Three different types of biological a priori knowledge are built into the framework in a modular fashion. A mixture of Dirichlets is used as prior over nucleotide probabilities in binding sites. It is trained on trans......We present BayesMD, a Bayesian Motif Discovery model with several new features. Three different types of biological a priori knowledge are built into the framework in a modular fashion. A mixture of Dirichlets is used as prior over nucleotide probabilities in binding sites. It is trained...
Directory of Open Access Journals (Sweden)
Judith Lind
Full Text Available The clinical outcome of Helicobacter pylori infections is determined by multiple host-pathogen interactions that may develop to chronic gastritis, and sometimes peptic ulcers or gastric cancer. Highly virulent strains encode a type IV secretion system (T4SS that delivers the effector protein CagA into gastric epithelial cells. Translocated CagA undergoes tyrosine phosphorylation at EPIYA-sequence motifs, called A, B and C in Western-type strains, by members of the oncogenic Src and Abl host kinases. Phosphorylated EPIYA-motifs mediate interactions of CagA with host signaling factors--in particular various SH2-domain containing human proteins--thereby hijacking multiple downstream signaling cascades. Observations of tyrosine-phosphorylated CagA are mainly based on the use of commercial phosphotyrosine antibodies, which originally were selected to detect phosphotyrosines in mammalian proteins. Systematic studies of phosphorylated EPIYA-motif detection by the different antibodies would be very useful, but are not yet available. To address this issue, we synthesized phospho- and non-phosphopeptides representing each predominant Western CagA EPIYA-motif, and determined the recognition patterns of seven different phosphotyrosine antibodies in Western blots, and also performed infection studies with diverse representative Western H. pylori strains. Our results show that a total of 9-11 amino acids containing the phosphorylated EPIYA-motifs are necessary and sufficient for specific detection by these antibodies, but revealed great variability in sequence recognition. Three of the antibodies recognized phosphorylated EPIYA-motifs A, B and C similarly well; whereas preferential binding to phosphorylated motif A and motifs A and C was found with two and one antibodies, respectively, and the seventh anti-phosphotyrosine antibody did not recognize any phosphorylated EPIYA-motif. Controls showed that none of the antibodies recognized the corresponding non
Lucky Motifs in Chinese Folk Art: Interpreting Paper-cut from Chinese Shaanxi
Directory of Open Access Journals (Sweden)
Xuxiao WANG
2013-11-01
Full Text Available Paper-cut is not simply a form of traditional Chinese folk art. Lucky motifs developed in paper-cut certainly acquired profound cultural connotations. As paper-cut is a time-honoured skill across the nation, interpreting those motifs requires cultural receptiveness and anthropological sensitivity. The author of this article analyzes examples of paper-cut from Northern Shaanxi, China, to identify the cohesive motifs and explore the auspiciousness of the specific concepts of Fu, Lu, Shou, Xi. The paper-cut of Northern Shaanxi is an ideal representative of the craft as a whole because of the relative stability of this region in history, in terms of both art and culture. Furthermore, its straightforward style provides a clear demonstration of motifs regarding folk understanding of expectations for life.
Mitrea, Diana M; Cika, Jaclyn A; Guy, Clifford S; Ban, David; Banerjee, Priya R; Stanley, Christopher B; Nourse, Amanda; Deniz, Ashok A; Kriwacki, Richard W
2016-02-02
The nucleolus is a membrane-less organelle formed through liquid-liquid phase separation of its components from the surrounding nucleoplasm. Here, we show that nucleophosmin (NPM1) integrates within the nucleolus via a multi-modal mechanism involving multivalent interactions with proteins containing arginine-rich linear motifs (R-motifs) and ribosomal RNA (rRNA). Importantly, these R-motifs are found in canonical nucleolar localization signals. Based on a novel combination of biophysical approaches, we propose a model for the molecular organization within liquid-like droplets formed by the N-terminal domain of NPM1 and R-motif peptides, thus providing insights into the structural organization of the nucleolus. We identify multivalency of acidic tracts and folded nucleic acid binding domains, mediated by N-terminal domain oligomerization, as structural features required for phase separation of NPM1 with other nucleolar components in vitro and for localization within mammalian nucleoli. We propose that one mechanism of nucleolar localization involves phase separation of proteins within the nucleolus.
Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie
2017-10-06
In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators
International Nuclear Information System (INIS)
Andreozzi, F.; Covello, A.; Gargano, A.; Ye, L.J.; Porrino, A.
1985-01-01
The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v = 0, v = 1, and v = 2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states
Directory of Open Access Journals (Sweden)
Sourav Roy
2013-03-01
Full Text Available Most eukaryotic pathogens have complex life cycles in which gene expression networks orchestrate the formation of cells specialized for dissemination or host colonization. In the oomycete Phytophthora infestans, the potato late blight pathogen, major shifts in mRNA profiles during developmental transitions were identified using microarrays. We used those data with search algorithms to discover about 100 motifs that are over-represented in promoters of genes up-regulated in hyphae, sporangia, sporangia undergoing zoosporogenesis, swimming zoospores, or germinated cysts forming appressoria (infection structures. Most of the putative stage-specific transcription factor binding sites (TFBSs thus identified had features typical of TFBSs such as position or orientation bias, palindromy, and conservation in related species. Each of six motifs tested in P. infestans transformants using the GUS reporter gene conferred the expected stage-specific expression pattern, and several were shown to bind nuclear proteins in gel-shift assays. Motifs linked to the appressoria-forming stage, including a functionally validated TFBS, were over-represented in promoters of genes encoding effectors and other pathogenesis-related proteins. To understand how promoter and genome architecture influence expression, we also mapped transcription patterns to the P. infestans genome assembly. Adjacent genes were not typically induced in the same stage, including genes transcribed in opposite directions from small intergenic regions, but co-regulated gene pairs occurred more than expected by random chance. These data help illuminate the processes regulating development and pathogenesis, and will enable future attempts to purify the cognate transcription factors.
Stochastic Resonance in Neuronal Network Motifs with Ornstein-Uhlenbeck Colored Noise
Directory of Open Access Journals (Sweden)
Xuyang Lou
2014-01-01
Full Text Available We consider here the effect of the Ornstein-Uhlenbeck colored noise on the stochastic resonance of the feed-forward-loop (FFL network motif. The FFL motif is modeled through the FitzHugh-Nagumo neuron model as well as the chemical coupling. Our results show that the noise intensity and the correlation time of the noise process serve as the control parameters, which have great impacts on the stochastic dynamics of the FFL motif. We find that, with a proper choice of noise intensities and the correlation time of the noise process, the signal-to-noise ratio (SNR can display more than one peak.
Wayward Warriors: The Viking Motif in Swedish and English Children's Literature
Sundmark, Björn
2014-01-01
In this article the Viking motif in children's literature is explored--from its roots in (adult) nationalist and antiquarian discourse, over pedagogical and historical texts for children, to the eventual diversification (or dissolution) of the motif into different genres and forms. The focus is on Swedish Viking narratives, but points of…
Catania, Francesco; Lynch, Michael
2010-05-04
In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.
Energy Technology Data Exchange (ETDEWEB)
Han, S.; Tainer, J.A.
2001-08-01
ADP-ribosylation is a widely occurring and biologically critical covalent chemical modification process in pathogenic mechanisms, intracellular signaling systems, DNA repair, and cell division. The reaction is catalyzed by ADP-ribosyltransferases, which transfer the ADP-ribose moiety of NAD to a target protein with nicotinamide release. A family of bacterial toxins and eukaryotic enzymes has been termed the mono-ADP-ribosyltransferases, in distinction to the poly-ADP-ribosyltransferases, which catalyze the addition of multiple ADP-ribose groups to the carboxyl terminus of eukaryotic nucleoproteins. Despite the limited primary sequence homology among the different ADP-ribosyltransferases, a central cleft bearing NAD-binding pocket formed by the two perpendicular b-sheet core has been remarkably conserved between bacterial toxins and eukaryotic mono- and poly-ADP-ribosyltransferases. The majority of bacterial toxins and eukaryotic mono-ADP-ribosyltransferases are characterized by conserved His and catalytic Glu residues. In contrast, Diphtheria toxin, Pseudomonas exotoxin A, and eukaryotic poly-ADP-ribosyltransferases are characterized by conserved Arg and catalytic Glu residues. The NAD-binding core of a binary toxin and a C3-like toxin family identified an ARTT motif (ADP-ribosylating turn-turn motif) that is implicated in substrate specificity and recognition by structural and mutagenic studies. Here we apply structure-based sequence alignment and comparative structural analyses of all known structures of ADP-ribosyltransfeases to suggest that this ARTT motif is functionally important in many ADP-ribosylating enzymes that bear a NAD binding cleft as characterized by conserved Arg and catalytic Glu residues. Overall, structure-based sequence analysis reveals common core structures and conserved active sites of ADP-ribosyltransferases to support similar NAD binding mechanisms but differing mechanisms of target protein binding via sequence variations within the ARTT
SA-Mot: a web server for the identification of motifs of interest extracted from protein loops.
Regad, Leslie; Saladin, Adrien; Maupetit, Julien; Geneix, Colette; Camproux, Anne-Claude
2011-07-01
The detection of functional motifs is an important step for the determination of protein functions. We present here a new web server SA-Mot (Structural Alphabet Motif) for the extraction and location of structural motifs of interest from protein loops. Contrary to other methods, SA-Mot does not focus only on functional motifs, but it extracts recurrent and conserved structural motifs involved in structural redundancy of loops. SA-Mot uses the structural word notion to extract all structural motifs from uni-dimensional sequences corresponding to loop structures. Then, SA-Mot provides a description of these structural motifs using statistics computed in the loop data set and in SCOP superfamily, sequence and structural parameters. SA-Mot results correspond to an interactive table listing all structural motifs extracted from a target structure and their associated descriptors. Using this information, the users can easily locate loop regions that are important for the protein folding and function. The SA-Mot web server is available at http://sa-mot.mti.univ-paris-diderot.fr.
International Nuclear Information System (INIS)
Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi
2010-01-01
2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.
Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A
2016-05-17
The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.
2013-01-01
Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596
Efficient Implementation of the Pairing on Mobilephones Using BREW
Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki
Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.
iELM—a web server to explore short linear motif-mediated interactions
Weatheritt, Robert J.; Jehl, Peter; Dinkel, Holger; Gibson, Toby J.
2012-01-01
The recent expansion in our knowledge of protein–protein interactions (PPIs) has allowed the annotation and prediction of hundreds of thousands of interactions. However, the function of many of these interactions remains elusive. The interactions of Eukaryotic Linear Motif (iELM) web server provides a resource for predicting the function and positional interface for a subset of interactions mediated by short linear motifs (SLiMs). The iELM prediction algorithm is based on the annotated SLiM classes from the Eukaryotic Linear Motif (ELM) resource and allows users to explore both annotated and user-generated PPI networks for SLiM-mediated interactions. By incorporating the annotated information from the ELM resource, iELM provides functional details of PPIs. This can be used in proteomic analysis, for example, to infer whether an interaction promotes complex formation or degradation. Furthermore, details of the molecular interface of the SLiM-mediated interactions are also predicted. This information is displayed in a fully searchable table, as well as graphically with the modular architecture of the participating proteins extracted from the UniProt and Phospho.ELM resources. A network figure is also presented to aid the interpretation of results. The iELM server supports single protein queries as well as large-scale proteomic submissions and is freely available at http://i.elm.eu.org. PMID:22638578
Faster exact Markovian probability functions for motif occurrences: a DFA-only approach.
Ribeca, Paolo; Raineri, Emanuele
2008-12-15
The computation of the statistical properties of motif occurrences has an obviously relevant application: patterns that are significantly over- or under-represented in genomes or proteins are interesting candidates for biological roles. However, the problem is computationally hard; as a result, virtually all the existing motif finders use fast but approximate scoring functions, in spite of the fact that they have been shown to produce systematically incorrect results. A few interesting exact approaches are known, but they are very slow and hence not practical in the case of realistic sequences. We give an exact solution, solely based on deterministic finite-state automata (DFA), to the problem of finding the whole relevant part of the probability distribution function of a simple-word motif in a homogeneous (biological) sequence. Out of that, the z-value can always be computed, while the P-value can be obtained either when it is not too extreme with respect to the number of floating-point digits available in the implementation, or when the number of pattern occurrences is moderately low. In particular, the time complexity of the algorithms for Markov models of moderate order (0 manage to obtain an algorithm which is both easily interpretable and efficient. This approach can be used for exact statistical studies of very long genomes and protein sequences, as we illustrate with some examples on the scale of the human genome.
Finding a Leucine in a Haystack: Searching the Proteome for ambigous Leucine-Aspartic Acid motifs
Arold, Stefan T.
2016-01-01
LDMF predicted 13 new LD motifs in humans. Using biophysical assays, we experimentally confirmed in vitro interactions for four novel LD motif proteins. Thus, LDMF allows proteome-wide discovery of LD motifs, despite a highly ambiguous sequence pattern. Functional implications will be discussed.
Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.
2012-01-01
8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947
POWRS: position-sensitive motif discovery.
Directory of Open Access Journals (Sweden)
Ian W Davis
Full Text Available Transcription factors and the short, often degenerate DNA sequences they recognize are central regulators of gene expression, but their regulatory code is challenging to dissect experimentally. Thus, computational approaches have long been used to identify putative regulatory elements from the patterns in promoter sequences. Here we present a new algorithm "POWRS" (POsition-sensitive WoRd Set for identifying regulatory sequence motifs, specifically developed to address two common shortcomings of existing algorithms. First, POWRS uses the position-specific enrichment of regulatory elements near transcription start sites to significantly increase sensitivity, while providing new information about the preferred localization of those elements. Second, POWRS forgoes position weight matrices for a discrete motif representation that appears more resistant to over-generalization. We apply this algorithm to discover sequences related to constitutive, high-level gene expression in the model plant Arabidopsis thaliana, and then experimentally validate the importance of those elements by systematically mutating two endogenous promoters and measuring the effect on gene expression levels. This provides a foundation for future efforts to rationally engineer gene expression in plants, a problem of great importance in developing biotech crop varieties.BSD-licensed Python code at http://grassrootsbio.com/papers/powrs/.
APOCALYPTIC MOTIFS IN THE CYCLE OF STORIES BY M.A. BULGAKOV «NOTES OF A YOUNG DOCTOR»
Directory of Open Access Journals (Sweden)
Evgeniy Igorevich Erokhov
2015-10-01
Full Text Available The motif analysis of a cycle of stories by M.A. Bulgakov «Notes of a Young Doctor» from the point of view of their apocalyptic problematics was first performed in this article. To identify apocalyptic motifs the method of motif analysis, developed by B.M. Gasparov, was used which will also help to prove the interpenetration of motifs in the cycle of stories. The result of the research work is the identification of apocalyptic motifs which are manifested in the experiences of the main character and the events taking place around him and passing through the prism of physician’s perception of the world. Our identified motifs show that the stories in the cycle are united not only thematically and with the help of the image of the main character, but with the help of the motifs which reflect interpenetration of apocalyptic motifs in the stories of one cycle. There are the following apocalyptic motifs in the cycle of stories by Bulgakov: diseases, darkness (as part of the landscape, resurrection from the dead and beast. They all belong to the biblical type which is allocated on the basis of the associative bond of these motifs with the biblical texts.
Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.
2011-01-01
The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242
Poly(A) motif prediction using spectral latent features from human DNA sequences
Xie, Bo; Jankovic, Boris R.; Bajic, Vladimir B.; Song, Le; Gao, Xin
2013-01-01
Motivation: Polyadenylation is the addition of a poly(A) tail to an RNA molecule. Identifying DNA sequence motifs that signal the addition of poly(A) tails is essential to improved genome annotation and better understanding of the regulatory mechanisms and stability of mRNA.Existing poly(A) motif predictors demonstrate that information extracted from the surrounding nucleotide sequences of candidate poly(A) motifs can differentiate true motifs from the false ones to a great extent. A variety of sophisticated features has been explored, including sequential, structural, statistical, thermodynamic and evolutionary properties. However, most of these methods involve extensive manual feature engineering, which can be time-consuming and can require in-depth domain knowledge.Results: We propose a novel machine-learning method for poly(A) motif prediction by marrying generative learning (hidden Markov models) and discriminative learning (support vector machines). Generative learning provides a rich palette on which the uncertainty and diversity of sequence information can be handled, while discriminative learning allows the performance of the classification task to be directly optimized. Here, we used hidden Markov models for fitting the DNA sequence dynamics, and developed an efficient spectral algorithm for extracting latent variable information from these models. These spectral latent features were then fed into support vector machines to fine-tune the classification performance.We evaluated our proposed method on a comprehensive human poly(A) dataset that consists of 14 740 samples from 12 of the most abundant variants of human poly(A) motifs. Compared with one of the previous state-of-the-art methods in the literature (the random forest model with expert-crafted features), our method reduces the average error rate, false-negative rate and false-positive rate by 26, 15 and 35%, respectively. Meanwhile, our method makes ?30% fewer error predictions relative to the other
Poly(A) motif prediction using spectral latent features from human DNA sequences
Xie, Bo
2013-06-21
Motivation: Polyadenylation is the addition of a poly(A) tail to an RNA molecule. Identifying DNA sequence motifs that signal the addition of poly(A) tails is essential to improved genome annotation and better understanding of the regulatory mechanisms and stability of mRNA.Existing poly(A) motif predictors demonstrate that information extracted from the surrounding nucleotide sequences of candidate poly(A) motifs can differentiate true motifs from the false ones to a great extent. A variety of sophisticated features has been explored, including sequential, structural, statistical, thermodynamic and evolutionary properties. However, most of these methods involve extensive manual feature engineering, which can be time-consuming and can require in-depth domain knowledge.Results: We propose a novel machine-learning method for poly(A) motif prediction by marrying generative learning (hidden Markov models) and discriminative learning (support vector machines). Generative learning provides a rich palette on which the uncertainty and diversity of sequence information can be handled, while discriminative learning allows the performance of the classification task to be directly optimized. Here, we used hidden Markov models for fitting the DNA sequence dynamics, and developed an efficient spectral algorithm for extracting latent variable information from these models. These spectral latent features were then fed into support vector machines to fine-tune the classification performance.We evaluated our proposed method on a comprehensive human poly(A) dataset that consists of 14 740 samples from 12 of the most abundant variants of human poly(A) motifs. Compared with one of the previous state-of-the-art methods in the literature (the random forest model with expert-crafted features), our method reduces the average error rate, false-negative rate and false-positive rate by 26, 15 and 35%, respectively. Meanwhile, our method makes ?30% fewer error predictions relative to the other
Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium
Directory of Open Access Journals (Sweden)
Lynch Michael
2010-05-01
Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.
Base pairing and structural insights into the 5-formylcytosine in RNA duplex
Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia
2016-01-01
Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978
Metalophillic attraction in the consecutive T-HgII-T DNA base pairs
Czech Academy of Sciences Publication Activity Database
Benda, Ladislav; Straka, Michal; Bouř, Petr; Tanaka, Y.; Sychrovský, Vladimír
2012-01-01
Roč. 12, č. 1 (2012), s. 50-50 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : T-HgII-T * DNA base pairs Subject RIV: CF - Physical ; Theoretical Chemistry
Discriminative Motif Discovery via Simulated Evolution and Random Under-Sampling
Song, Tao; Gu, Hong
2014-01-01
Conserved motifs in biological sequences are closely related to their structure and functions. Recently, discriminative motif discovery methods have attracted more and more attention. However, little attention has been devoted to the data imbalance problem, which is one of the main reasons affecting the performance of the discriminative models. In this article, a simulated evolution method is applied to solve the multi-class imbalance problem at the stage of data preprocessing, and at the sta...
Identification of helix capping and {beta}-turn motifs from NMR chemical shifts
Energy Technology Data Exchange (ETDEWEB)
Shen Yang; Bax, Ad, E-mail: bax@nih.gov [National Institutes of Health, Laboratory of Chemical Physics, National Institute of Diabetes and Digestive and Kidney Diseases (United States)
2012-03-15
We present an empirical method for identification of distinct structural motifs in proteins on the basis of experimentally determined backbone and {sup 13}C{sup {beta}} chemical shifts. Elements identified include the N-terminal and C-terminal helix capping motifs and five types of {beta}-turns: I, II, I Prime , II Prime and VIII. Using a database of proteins of known structure, the NMR chemical shifts, together with the PDB-extracted amino acid preference of the helix capping and {beta}-turn motifs are used as input data for training an artificial neural network algorithm, which outputs the statistical probability of finding each motif at any given position in the protein. The trained neural networks, contained in the MICS (motif identification from chemical shifts) program, also provide a confidence level for each of their predictions, and values ranging from ca 0.7-0.9 for the Matthews correlation coefficient of its predictions far exceed those attainable by sequence analysis. MICS is anticipated to be useful both in the conventional NMR structure determination process and for enhancing on-going efforts to determine protein structures solely on the basis of chemical shift information, where it can aid in identifying protein database fragments suitable for use in building such structures.
Identification of helix capping and β-turn motifs from NMR chemical shifts
International Nuclear Information System (INIS)
Shen Yang; Bax, Ad
2012-01-01
We present an empirical method for identification of distinct structural motifs in proteins on the basis of experimentally determined backbone and 13 C β chemical shifts. Elements identified include the N-terminal and C-terminal helix capping motifs and five types of β-turns: I, II, I′, II′ and VIII. Using a database of proteins of known structure, the NMR chemical shifts, together with the PDB-extracted amino acid preference of the helix capping and β-turn motifs are used as input data for training an artificial neural network algorithm, which outputs the statistical probability of finding each motif at any given position in the protein. The trained neural networks, contained in the MICS (motif identification from chemical shifts) program, also provide a confidence level for each of their predictions, and values ranging from ca 0.7–0.9 for the Matthews correlation coefficient of its predictions far exceed those attainable by sequence analysis. MICS is anticipated to be useful both in the conventional NMR structure determination process and for enhancing on-going efforts to determine protein structures solely on the basis of chemical shift information, where it can aid in identifying protein database fragments suitable for use in building such structures.
A novel k-mer set memory (KSM) motif representation improves regulatory variant prediction.
Guo, Yuchun; Tian, Kevin; Zeng, Haoyang; Guo, Xiaoyun; Gifford, David Kenneth
2018-04-13
The representation and discovery of transcription factor (TF) sequence binding specificities is critical for understanding gene regulatory networks and interpreting the impact of disease-associated noncoding genetic variants. We present a novel TF binding motif representation, the k -mer set memory (KSM), which consists of a set of aligned k -mers that are overrepresented at TF binding sites, and a new method called KMAC for de novo discovery of KSMs. We find that KSMs more accurately predict in vivo binding sites than position weight matrix (PWM) models and other more complex motif models across a large set of ChIP-seq experiments. Furthermore, KSMs outperform PWMs and more complex motif models in predicting in vitro binding sites. KMAC also identifies correct motifs in more experiments than five state-of-the-art motif discovery methods. In addition, KSM-derived features outperform both PWM and deep learning model derived sequence features in predicting differential regulatory activities of expression quantitative trait loci (eQTL) alleles. Finally, we have applied KMAC to 1600 ENCODE TF ChIP-seq data sets and created a public resource of KSM and PWM motifs. We expect that the KSM representation and KMAC method will be valuable in characterizing TF binding specificities and in interpreting the effects of noncoding genetic variations. © 2018 Guo et al.; Published by Cold Spring Harbor Laboratory Press.
Directory of Open Access Journals (Sweden)
Joshi NV
2009-01-01
Full Text Available Abstract Background Regulation of gene expression in Plasmodium falciparum (Pf remains poorly understood. While over half the genes are estimated to be regulated at the transcriptional level, few regulatory motifs and transcription regulators have been found. Results The study seeks to identify putative regulatory motifs in the upstream regions of 13 functional groups of genes expressed in the intraerythrocytic developmental cycle of Pf. Three motif-discovery programs were used for the purpose, and motifs were searched for only on the gene coding strand. Four motifs – the 'G-rich', the 'C-rich', the 'TGTG' and the 'CACA' motifs – were identified, and zero to all four of these occur in the 13 sets of upstream regions. The 'CACA motif' was absent in functional groups expressed during the ring to early trophozoite transition. For functional groups expressed in each transition, the motifs tended to be similar. Upstream motifs in some functional groups showed 'positional conservation' by occurring at similar positions relative to the translational start site (TLS; this increases their significance as regulatory motifs. In the ribonucleotide synthesis, mitochondrial, proteasome and organellar translation machinery genes, G-rich, C-rich, CACA and TGTG motifs, respectively, occur with striking positional conservation. In the organellar translation machinery group, G-rich motifs occur close to the TLS. The same motifs were sometimes identified for multiple functional groups; differences in location and abundance of the motifs appear to ensure different modes of action. Conclusion The identification of positionally conserved over-represented upstream motifs throws light on putative regulatory elements for transcription in Pf.
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-01-01
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116
Daquinag, A C; Sato, T; Koda, H; Takao, T; Fukuda, M; Shimonishi, Y; Tsukamoto, T
1999-02-16
Phenoloxidase inhibitor (POI), found in the hemolymph of housefly pupae, is a novel dopa-containing and cystine-rich peptide that competitively inhibits phenoloxidase with a Ki in the nanomolar range. [Tyr32]POI is a potential precursor molecule also found in the hemolymph that may be posttranslationally oxidized to the dopa-containing peptide after creation of a rigid structure. By employing both a solid-phase peptide synthesis system based on a 9-fluorenylmethoxycarbonyl strategy and a specific air oxidation technique to ensure correct folding, we have been able to synthesize [Tyr32]POI. The synthetic [Tyr32]POI was confirmed to be identical to the native [Tyr32]POI by coelution high-performance liquid chromatography analysis and by enzymatic analysis using the phenoloxidase inhibition assay. To determine the disulfide pairings within the peptides, a series of enzyme hydrolyses and partial reduction/alkylation steps were performed. Three cystine pairs (Cys11-Cys25, Cys18-Cys29, and Cys24-Cys36) were determined by identification of the resulting peptides. The disulfide pairings of the two adjacent Cys residues (Cys11-Cys25 and Cys24-Cys36) were unambiguously assigned by comparing the derived fragments with the two possible isomers synthesized through a novel disulfide-linking technique. The arrangement of the disulfide bridges in POI was found to be topologically identical to those found for several peptides within the inhibitor cystine knot structural family. Although these peptides share a low primary sequence homology and display a diversity of biological functions, they nonetheless share similarities in their cystine motifs and tertiary structure. The tertiary structure model of POI, which was derived through molecular dynamics and energy minimization studies using restraints with determined disulfide connectivities, suggests that POI is a new class member of the inhibitor cystine-knot structural family.
Kishine, Masahiro; Tsutsumi, Katsuji; Kitta, Kazumi
2017-12-01
Simple sequence repeat (SSR) is a popular tool for individual fingerprinting. The long-core motif (e.g. tetra-, penta-, and hexa-nucleotide) simple sequence repeats (SSRs) are preferred because they make it easier to separate and distinguish neighbor alleles. In the present study, a new set of 8 tetra-nucleotide SSRs in potato ( Solanum tuberosum ) is reported. By using these 8 markers, 72 out of 76 cultivars obtained from Japan and the United States were clearly discriminated, while two pairs, both of which arose from natural variation, showed identical profiles. The combined probability of identity between two random cultivars for the set of 8 SSR markers was estimated to be 1.10 × 10 -8 , confirming the usefulness of the proposed SSR markers for fingerprinting analyses of potato.
Multi-pair states in electron–positron pair creation
Directory of Open Access Journals (Sweden)
Anton Wöllert
2016-09-01
Full Text Available Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.
Multi-pair states in electron–positron pair creation
Energy Technology Data Exchange (ETDEWEB)
Wöllert, Anton, E-mail: woellert@mpi-hd.mpg.de; Bauke, Heiko, E-mail: heiko.bauke@mpi-hd.mpg.de; Keitel, Christoph H.
2016-09-10
Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.
Multi-pair states in electron–positron pair creation
International Nuclear Information System (INIS)
Wöllert, Anton; Bauke, Heiko; Keitel, Christoph H.
2016-01-01
Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.
International Nuclear Information System (INIS)
Swasey, Steven M; Gwinn, Elisabeth G
2016-01-01
The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)
ROMANIAN TRADITIONAL MOTIF ELEMENT OF MODERNITY IN CLOTHING
Directory of Open Access Journals (Sweden)
ŞUTEU Marius Darius
2017-05-01
Full Text Available In this paper are presented the phases for improving from an aesthetic point of view a clothing item, the T-shirt for women using software design patterns, computerised graphics and textile different modern technologies including: industrial embroidery, digital printing, sublimation. In the first phase a documentation was prepared in the University of Oradea and traditional motif was selected from a collection comprising a number of Romanian traditional motifs from different parts of the country and were reintepreted and stylized whilst preserving the symbolism and color range specified to the area. For the styling phase was used CorelDraw vector graphics program that allows changing the shape, size and color of the drawings without affecting the identity of the pattern. The embroidery was done using BERNINA Embroidery Software Designer Plus Software. This software allows you to export the model to any domestic or industrial embroidery machine regardless of brand. Finally we observed the resistance of the printed and embroided model to various: elasticity, resistance to abrasion and a sensory analysis on the preservation of color. After testing we noticed the imprint resistance applied to the fabric, resulting in a quality that makes possible to keep the Romanian traditional motif from generation to generation.
Yaffe, Yakey; Shepshelovitch, Jeanne; Nevo-Yassaf, Inbar; Yeheskel, Adva; Shmerling, Hedva; Kwiatek, Joanna M; Gaus, Katharina; Pasmanik-Chor, Metsada; Hirschberg, Koret
2012-08-01
Occludin (Ocln), a MARVEL-motif-containing protein, is found in all tight junctions. MARVEL motifs are comprised of four transmembrane helices associated with the localization to or formation of diverse membrane subdomains by interacting with the proximal lipid environment. The functions of the Ocln MARVEL motif are unknown. Bioinformatics sequence- and structure-based analyses demonstrated that the MARVEL domain of Ocln family proteins has distinct evolutionarily conserved sequence features that are consistent with its basolateral membrane localization. Live-cell microscopy, fluorescence resonance energy transfer (FRET) and bimolecular fluorescence complementation (BiFC) were used to analyze the intracellular distribution and self-association of fluorescent-protein-tagged full-length human Ocln or the Ocln MARVEL motif excluding the cytosolic C- and N-termini (amino acids 60-269, FP-MARVEL-Ocln). FP-MARVEL-Ocln efficiently arrived at the plasma membrane (PM) and was sorted to the basolateral PM in filter-grown polarized MDCK cells. A series of conserved aromatic amino acids within the MARVEL domain were found to be associated with Ocln dimerization using BiFC. FP-MARVEL-Ocln inhibited membrane pore growth during Triton-X-100-induced solubilization and was shown to increase the membrane-ordered state using Laurdan, a lipid dye. These data demonstrate that the Ocln MARVEL domain mediates self-association and correct sorting to the basolateral membrane.
Kanno, Shin-ichiro; Kuzuoka, Hiroyuki; Sasao, Shigeru; Hong, Zehui; Lan, Li; Nakajima, Satoshi; Yasui, Akira
2007-01-01
DNA damage causes genome instability and cell death, but many of the cellular responses to DNA damage still remain elusive. We here report a human protein, PALF (PNK and APTX-like FHA protein), with an FHA (forkhead-associated) domain and novel zinc-finger-like CYR (cysteine–tyrosine–arginine) motifs that are involved in responses to DNA damage. We found that the CYR motif is widely distributed among DNA repair proteins of higher eukaryotes, and that PALF, as well as a Drosophila protein with tandem CYR motifs, has endo- and exonuclease activities against abasic site and other types of base damage. PALF accumulates rapidly at single-strand breaks in a poly(ADP-ribose) polymerase 1 (PARP1)-dependent manner in human cells. Indeed, PALF interacts directly with PARP1 and is required for its activation and for cellular resistance to methyl-methane sulfonate. PALF also interacts directly with KU86, LIGASEIV and phosphorylated XRCC4 proteins and possesses endo/exonuclease activity at protruding DNA ends. Various treatments that produce double-strand breaks induce formation of PALF foci, which fully coincide with γH2AX foci. Thus, PALF and the CYR motif may play important roles in DNA repair of higher eukaryotes. PMID:17396150
Parallel motif extraction from very long sequences
Sahli, Majed; Mansour, Essam; Kalnis, Panos
2013-01-01
Motifs are frequent patterns used to identify biological functionality in genomic sequences, periodicity in time series, or user trends in web logs. In contrast to a lot of existing work that focuses on collections of many short sequences, modern
Efficient sequential and parallel algorithms for planted motif search.
Nicolae, Marius; Rajasekaran, Sanguthevar
2014-01-31
Motif searching is an important step in the detection of rare events occurring in a set of DNA or protein sequences. One formulation of the problem is known as (l,d)-motif search or Planted Motif Search (PMS). In PMS we are given two integers l and d and n biological sequences. We want to find all sequences of length l that appear in each of the input sequences with at most d mismatches. The PMS problem is NP-complete. PMS algorithms are typically evaluated on certain instances considered challenging. Despite ample research in the area, a considerable performance gap exists because many state of the art algorithms have large runtimes even for moderately challenging instances. This paper presents a fast exact parallel PMS algorithm called PMS8. PMS8 is the first algorithm to solve the challenging (l,d) instances (25,10) and (26,11). PMS8 is also efficient on instances with larger l and d such as (50,21). We include a comparison of PMS8 with several state of the art algorithms on multiple problem instances. This paper also presents necessary and sufficient conditions for 3 l-mers to have a common d-neighbor. The program is freely available at http://engr.uconn.edu/~man09004/PMS8/. We present PMS8, an efficient exact algorithm for Planted Motif Search. PMS8 introduces novel ideas for generating common neighborhoods. We have also implemented a parallel version for this algorithm. PMS8 can solve instances not solved by any previous algorithms.
Energy Technology Data Exchange (ETDEWEB)
Wiese, Claudia; Hinz, John M.; Tebbs, Robert S.; Nham, Peter B.; Urbin, Salustra S.; Collins, David W.; Thompson, Larry H.; Schild, David
2006-04-21
In vertebrates, homologous recombinational repair (HRR) requires RAD51 and five RAD51 paralogs (XRCC2, XRCC3, RAD51B, RAD51C, and RAD51D) that all contain conserved Walker A and B ATPase motifs. In human RAD51D we examined the requirement for these motifs in interactions with XRCC2 and RAD51C, and for survival of cells in response to DNA interstrand crosslinks. Ectopic expression of wild type human RAD51D or mutants having a non-functional A or B motif was used to test for complementation of a rad51d knockout hamster CHO cell line. Although A-motif mutants complement very efficiently, B-motif mutants do not. Consistent with these results, experiments using the yeast two- and three-hybrid systems show that the interactions between RAD51D and its XRCC2 and RAD51C partners also require a functional RAD51D B motif, but not motif A. Similarly, hamster Xrcc2 is unable to bind to the non-complementing human RAD51D B-motif mutants in co-immunoprecipitation assays. We conclude that a functional Walker B motif, but not A motif, is necessary for RAD51D's interactions with other paralogs and for efficient HRR. We present a model in which ATPase sites are formed in a bipartite manner between RAD51D and other RAD51 paralogs.
Salt-bridge Swapping in the EXXERFXYY Motif of Proton Coupled Oligopeptide Transporters
DEFF Research Database (Denmark)
Aduri, Nanda G; Prabhala, Bala K; Ernst, Heidi A
2015-01-01
to as E1XXE2R), located on Helix I, in interactions with the proton. In this study we investigated the intracellular substrate accumulation by motif variants with all possible combinations of glutamate residues changed to glutamine and arginine changed to a tyrosine; the latter being a natural variant......-motif salt bridge, i.e. R-E2 to R-E1, which is consistent with previous structural studies. Molecular dynamics simulations of the motif variants E1XXE2R and E1XXQ2R support this mechanism. The simulations showed that upon changing conformation, arginine pushes Helix V, through interactions with the highly...
Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)
2014-12-11
Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein ,†,‡ Peter J...ac504076k | Anal. Chem. 2015, 87, 821−828827 (24) Cho, M.; Oh, S. S.; Nie, J.; Stewart, R.; Eisenstein , M.; Chambers, J.; Marth, J. D.; Walker, F
2011-01-01
Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172
Through the Portal: Viking Motifs Incorporated in the Romanesque Style in Telemark, Norway
Directory of Open Access Journals (Sweden)
Kristine Ødeby
2013-09-01
Full Text Available This paper presents the results of an analysis of motifs identified on six carved wooden Romanesque portal panels from the Norwegian county of Telemark. The findings suggest that animal motifs in the Late Viking style survived long into the Late Medieval period and were reused on these medieval portals. Stylistically, late expressions of Viking animal art do not differ a great deal from those of the subsequent Romanesque style. However, their symbolical differences are considered to be significant. The motifs themselves, and the issue of whether the Romanesque style adopted motifs from pre-Christian art, have attracted less attention. The motif portraying Sigurd slaying the dragon is considered in depth. It will be suggested that Sigurd, serving as a mediator between the old and the new beliefs when he appeared in late Viking contexts, was given a new role when portrayed in Christian art. Metaphor and liminality are a central part of this paper, and the theories of Alfred Gell and Margrete Andås suggest that the portal itself affects those who pass through it, and that the iconography is meaningful from a liminal perspective.
Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs
International Nuclear Information System (INIS)
Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie
2015-01-01
Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l p of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l p ∼ 50 nm
An intracellular motif of GLUT4 regulates fusion of GLUT4-containing vesicles.
Heyward, Catherine A; Pettitt, Trevor R; Leney, Sophie E; Welsh, Gavin I; Tavaré, Jeremy M; Wakelam, Michael J O
2008-05-20
Insulin stimulates glucose uptake by adipocytes through increasing translocation of the glucose transporter GLUT4 from an intracellular compartment to the plasma membrane. Fusion of GLUT4-containing vesicles at the cell surface is thought to involve phospholipase D activity, generating the signalling lipid phosphatidic acid, although the mechanism of action is not yet clear. Here we report the identification of a putative phosphatidic acid-binding motif in a GLUT4 intracellular loop. Mutation of this motif causes a decrease in the insulin-induced exposure of GLUT4 at the cell surface of 3T3-L1 adipocytes via an effect on vesicle fusion. The potential phosphatidic acid-binding motif identified in this study is unique to GLUT4 among the sugar transporters, therefore this motif may provide a unique mechanism for regulating insulin-induced translocation by phospholipase D signalling.
Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs
Directory of Open Access Journals (Sweden)
Ye Zhi-Qiang
2011-08-01
Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.
qPMS7: a fast algorithm for finding (ℓ, d-motifs in DNA and protein sequences.
Directory of Open Access Journals (Sweden)
Hieu Dinh
Full Text Available Detection of rare events happening in a set of DNA/protein sequences could lead to new biological discoveries. One kind of such rare events is the presence of patterns called motifs in DNA/protein sequences. Finding motifs is a challenging problem since the general version of motif search has been proven to be intractable. Motifs discovery is an important problem in biology. For example, it is useful in the detection of transcription factor binding sites and transcriptional regulatory elements that are very crucial in understanding gene function, human disease, drug design, etc. Many versions of the motif search problem have been proposed in the literature. One such is the (ℓ, d-motif search (or Planted Motif Search (PMS. A generalized version of the PMS problem, namely, Quorum Planted Motif Search (qPMS, is shown to accurately model motifs in real data. However, solving the qPMS problem is an extremely difficult task because a special case of it, the PMS Problem, is already NP-hard, which means that any algorithm solving it can be expected to take exponential time in the worse case scenario. In this paper, we propose a novel algorithm named qPMS7 that tackles the qPMS problem on real data as well as challenging instances. Experimental results show that our Algorithm qPMS7 is on an average 5 times faster than the state-of-art algorithm. The executable program of Algorithm qPMS7 is freely available on the web at http://pms.engr.uconn.edu/downloads/qPMS7.zip. Our online motif discovery tools that use Algorithm qPMS7 are freely available at http://pms.engr.uconn.edu or http://motifsearch.com.
Alam, Tanvir
2014-05-29
LD motifs (leucine-aspartic acidmotifs) are short helical protein-protein interaction motifs that have emerged as key players in connecting cell adhesion with cell motility and survival. LD motifs are required for embryogenesis, wound healing and the evolution of multicellularity. LD motifs also play roles in disease, such as in cancer metastasis or viral infection. First described in the paxillin family of scaffolding proteins, LD motifs and similar acidic LXXLL interaction motifs have been discovered in several other proteins, whereas 16 proteins have been reported to contain LDBDs (LD motif-binding domains). Collectively, structural and functional analyses have revealed a surprising multivalency in LD motif interactions and a wide diversity in LDBD architectures. In the present review, we summarize the molecular basis for function, regulation and selectivity of LD motif interactions that has emerged from more than a decade of research. This overview highlights the intricate multi-level regulation and the inherently noisy and heterogeneous nature of signalling through short protein-protein interaction motifs. © 2014 Biochemical Society.
Alam, Tanvir; Alazmi, Meshari; Gao, Xin; Arold, Stefan T.
2014-01-01
LD motifs (leucine-aspartic acidmotifs) are short helical protein-protein interaction motifs that have emerged as key players in connecting cell adhesion with cell motility and survival. LD motifs are required for embryogenesis, wound healing and the evolution of multicellularity. LD motifs also play roles in disease, such as in cancer metastasis or viral infection. First described in the paxillin family of scaffolding proteins, LD motifs and similar acidic LXXLL interaction motifs have been discovered in several other proteins, whereas 16 proteins have been reported to contain LDBDs (LD motif-binding domains). Collectively, structural and functional analyses have revealed a surprising multivalency in LD motif interactions and a wide diversity in LDBD architectures. In the present review, we summarize the molecular basis for function, regulation and selectivity of LD motif interactions that has emerged from more than a decade of research. This overview highlights the intricate multi-level regulation and the inherently noisy and heterogeneous nature of signalling through short protein-protein interaction motifs. © 2014 Biochemical Society.
I-Ad-binding peptides derived from unrelated protein antigens share a common structural motif
DEFF Research Database (Denmark)
Sette, A; Buus, S; Colon, S
1988-01-01
on the I-Ad binding of the immunogenic peptide OVA 323-339. The results obtained demonstrated the very permissive nature of Ag-Ia interaction. We also showed that unrelated peptides that are good I-Ad binders share a common structural motif and speculated that recognition of such motifs could represent...... that I-Ad molecules recognize a large library of Ag by virtue of common structural motifs present in peptides derived from phylogenetically unrelated proteins....
Lauf, Peter K; Heiny, Judith; Meller, Jarek; Lepera, Michael A; Koikov, Leonid; Alter, Gerald M; Brown, Thomas L; Adragna, Norma C
2013-01-01
Chelerythrine [CET], a protein kinase C [PKC] inhibitor, is a prop-apoptotic BH3-mimetic binding to BH1-like motifs of Bcl-2 proteins. CET action was examined on PKC phosphorylation-dependent membrane transporters (Na+/K+ pump/ATPase [NKP, NKA], Na+-K+-2Cl+ [NKCC] and K+-Cl- [KCC] cotransporters, and channel-supported K+ loss) in human lens epithelial cells [LECs]. K+ loss and K+ uptake, using Rb+ as congener, were measured by atomic absorption/emission spectrophotometry with NKP and NKCC inhibitors, and Cl- replacement by NO3ˉ to determine KCC. 3H-Ouabain binding was performed on a pig renal NKA in the presence and absence of CET. Bcl-2 protein and NKA sequences were aligned and motifs identified and mapped using PROSITE in conjunction with BLAST alignments and analysis of conservation and structural similarity based on prediction of secondary and crystal structures. CET inhibited NKP and NKCC by >90% (IC50 values ~35 and ~15 μM, respectively) without significant KCC activity change, and stimulated K+ loss by ~35% at 10-30 μM. Neither ATP levels nor phosphorylation of the NKA α1 subunit changed. 3H-ouabain was displaced from pig renal NKA only at 100 fold higher CET concentrations than the ligand. Sequence alignments of NKA with BH1- and BH3-like motifs containing pro-survival Bcl-2 and BclXl proteins showed more than one BH1-like motif within NKA for interaction with CET or with BH3 motifs. One NKA BH1-like motif (ARAAEILARDGPN) was also found in all P-type ATPases. Also, NKA possessed a second motif similar to that near the BH3 region of Bcl-2. Findings support the hypothesis that CET inhibits NKP by binding to BH1-like motifs and disrupting the α1 subunit catalytic activity through conformational changes. By interacting with Bcl-2 proteins through their complementary BH1- or BH3-like-motifs, NKP proteins may be sensors of normal and pathological cell functions, becoming important yet unrecognized signal transducers in the initial phases of apoptosis. CET
International Nuclear Information System (INIS)
Yang, Xiaoxia; Ji, Xiaoqing; Shi, Chunhuan; Liu, Jing; Wang, Haiyang; Luan, Yuxia
2014-01-01
The amantadine drug and oleic acid surfactant are used to form amantadine-based ion pair amphiphiles based on proton transfer reaction between the drug and the surfactant molecules. The ion pair amphiphiles are characterized by 1 H-nuclear magnetic resonance, Fourier transform infrared spectroscopy, and X-ray diffraction. Self-assembly properties of amantadine-based ion pair amphiphiles are studied by surface tension determination, transmission electron microscopy, zeta potential, and dynamic light scattering. The aggregation behavior studies indicate that the as-prepared ion pair amphiphiles can self-assemble into vesicles with the size of 200–300 nm in aqueous solution. The drug release results show that the amantadine release rate could be well controlled by incorporating the amantadine-based ion pair vesicles in poly (lactic-co-glycolic acid)-poly (ethylene glycol)-poly (lactic-co-glycolic acid) (PLGA–PEG–PLGA) copolymer hydrogel. The drug release from the AT–OA vesicle-loaded PLGA–PEG–PLGA hydrogel is significantly inhibited in comparison with the AT-loaded PLGA–PEG–PLGA hydrogel. The present work thus demonstrates that the vesicle-loaded hydrogel is a good candidate for the drug delivery system with long-term controlled drug release behavior
Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.
Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J
2017-07-06
The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.
Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2014-02-24
The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
The human Ago2 MC region does not contain an eIF4E-like mRNA cap binding motif
Directory of Open Access Journals (Sweden)
Grishin Nick V
2009-01-01
Full Text Available Abstract Background Argonaute (Ago proteins interact with small regulatory RNAs to mediate gene regulatory pathways. A recent report by Kiriakidou et al. 1 describes an MC sequence region identified in Ago2 that displays similarity to the cap-binding motif in translation initiation factor 4E (eIF4E. In a cap-bound eIF4E structure, two important aromatic residues of the motif stack on either side of a 7-methylguanosine 5'-triphosphate (m7Gppp base. The corresponding Ago2 aromatic residues (F450 and F505 were hypothesized to perform the same cap-binding function. However, the detected similarity between the MC sequence and the eIF4E cap-binding motif was questionable. Results A number of sequence-based and structure-based bioinformatics methods reveal the reported similarity between the Ago2 MC sequence region and the eIF4E cap-binding motif to be spurious. Alternatively, the MC sequence region is confidently assigned to the N-terminus of the Ago piwi module, within the mid domain of experimentally determined prokaryotic Ago structures. Confident mapping of the Ago2 MC sequence region to the piwi mid domain results in a homology-based structure model that positions the identified aromatic residues over 20 Å apart, with one of the aromatic side chains (F450 contributing instead to the hydrophobic core of the domain. Conclusion Correct functional prediction based on weak sequence similarity requires substantial evolutionary and structural support. The evolutionary context of the Ago mid domain suggested by multiple sequence alignment is limited to a conserved hydrophobicity profile required for the fold and a motif following the MC region that binds guide RNA. Mapping of the MC sequence to the mid domain structure reveals Ago2 aromatics that are incompatible with eIF4E-like mRNA cap-binding, yet display some limited local structure similarities that cause the chance sequence match to eIF4E. Reviewers This article was reviewed by Arcady Mushegian
Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR
International Nuclear Information System (INIS)
Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.
1995-01-01
For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-09-18
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Comprehensive human transcription factor binding site map for combinatory binding motifs discovery.
Directory of Open Access Journals (Sweden)
Arnoldo J Müller-Molina
Full Text Available To know the map between transcription factors (TFs and their binding sites is essential to reverse engineer the regulation process. Only about 10%-20% of the transcription factor binding motifs (TFBMs have been reported. This lack of data hinders understanding gene regulation. To address this drawback, we propose a computational method that exploits never used TF properties to discover the missing TFBMs and their sites in all human gene promoters. The method starts by predicting a dictionary of regulatory "DNA words." From this dictionary, it distills 4098 novel predictions. To disclose the crosstalk between motifs, an additional algorithm extracts TF combinatorial binding patterns creating a collection of TF regulatory syntactic rules. Using these rules, we narrowed down a list of 504 novel motifs that appear frequently in syntax patterns. We tested the predictions against 509 known motifs confirming that our system can reliably predict ab initio motifs with an accuracy of 81%-far higher than previous approaches. We found that on average, 90% of the discovered combinatorial binding patterns target at least 10 genes, suggesting that to control in an independent manner smaller gene sets, supplementary regulatory mechanisms are required. Additionally, we discovered that the new TFBMs and their combinatorial patterns convey biological meaning, targeting TFs and genes related to developmental functions. Thus, among all the possible available targets in the genome, the TFs tend to regulate other TFs and genes involved in developmental functions. We provide a comprehensive resource for regulation analysis that includes a dictionary of "DNA words," newly predicted motifs and their corresponding combinatorial patterns. Combinatorial patterns are a useful filter to discover TFBMs that play a major role in orchestrating other factors and thus, are likely to lock/unlock cellular functional clusters.
Directory of Open Access Journals (Sweden)
Febrian Febrian
2017-10-01
Full Text Available Geometri transformasi merupakan pengetahuan yang krusial dalam geometri yang dapat membangun banyak kemampuan lainnya seperti penalaran matematis. Oleh karena itu, geometri transformasi disarankan untuk diberikan pada pebelajar mulai dari usia dini. Penelitian terdahulu menunjukkan bahwa anak-anak memiliki sense untuk melihat karakteristik kedinamisan pada benda, oleh karena itu memfasilitasi pembelajaran yang dapat memanfaatkan sense ini menjadi sangat penting untuk membangun pemahaman geometri transformasi. Penelitian design research ini bertujuan untuk memfasilitasi siswa sekolah dasar untuk dapat mengembangkan pengetahuan awal mereka mengenai komposisi transformasi. Subjek penelitian adalah siswa kelas IV Sekolah Dasar Negeri 001 Toapaya, Kabupaten Bintan, Kepulauan Riau. Pendekatan pembelajaran yang digunakan adalah PMRI dengan konteks motif melayu itik pulang petang dengan bantuan grid. Hasil menunjukkan bahwa setting pembelajaran dapat memfasilitasi penalaran geometri transformasi melalui kegiatan eksplorasi motif dengan bantuan grid. Kata Kunci: komposisi transformasi, penalaran, motif melayu, grid, PMRI Transformation geometry is a crucial knowledge in geometry that can emerge many skills especially mathematical reasoning. Therefore, transformation geometry is suggested to be taught to children especially the young learners. Existing research implies that children have particular sense to see dynamic characteristic of an object or others. On the behalf of this statement, facilitating students in learning process that makes use of this students sense becomes important to undertake to help develop students reasoning of transformation geometry. The subtopic being highlighted is the composition of transformation. This design research aims to facilitate this situation. The subject of the research is fourth graders of the State Elementary School of 001 at Toapaya, Kabupaten Bintan, Kepulauan Riau. The learning approach used was PMRI by using
An intracellular motif of GLUT4 regulates fusion of GLUT4-containing vesicles
Directory of Open Access Journals (Sweden)
Welsh Gavin I
2008-05-01
Full Text Available Abstract Background Insulin stimulates glucose uptake by adipocytes through increasing translocation of the glucose transporter GLUT4 from an intracellular compartment to the plasma membrane. Fusion of GLUT4-containing vesicles at the cell surface is thought to involve phospholipase D activity, generating the signalling lipid phosphatidic acid, although the mechanism of action is not yet clear. Results Here we report the identification of a putative phosphatidic acid-binding motif in a GLUT4 intracellular loop. Mutation of this motif causes a decrease in the insulin-induced exposure of GLUT4 at the cell surface of 3T3-L1 adipocytes via an effect on vesicle fusion. Conclusion The potential phosphatidic acid-binding motif identified in this study is unique to GLUT4 among the sugar transporters, therefore this motif may provide a unique mechanism for regulating insulin-induced translocation by phospholipase D signalling.
Multiple TPR motifs characterize the Fanconi anemia FANCG protein.
Blom, Eric; van de Vrugt, Henri J; de Vries, Yne; de Winter, Johan P; Arwert, Fré; Joenje, Hans
2004-01-05
The genome protection pathway that is defective in patients with Fanconi anemia (FA) is controlled by at least eight genes, including BRCA2. A key step in the pathway involves the monoubiquitylation of FANCD2, which critically depends on a multi-subunit nuclear 'core complex' of at least six FANC proteins (FANCA, -C, -E, -F, -G, and -L). Except for FANCL, which has WD40 repeats and a RING finger domain, no significant domain structure has so far been recognized in any of the core complex proteins. By using a homology search strategy comparing the human FANCG protein sequence with its ortholog sequences in Oryzias latipes (Japanese rice fish) and Danio rerio (zebrafish) we identified at least seven tetratricopeptide repeat motifs (TPRs) covering a major part of this protein. TPRs are degenerate 34-amino acid repeat motifs which function as scaffolds mediating protein-protein interactions, often found in multiprotein complexes. In four out of five TPR motifs tested (TPR1, -2, -5, and -6), targeted missense mutagenesis disrupting the motifs at the critical position 8 of each TPR caused complete or partial loss of FANCG function. Loss of function was evident from failure of the mutant proteins to complement the cellular FA phenotype in FA-G lymphoblasts, which was correlated with loss of binding to FANCA. Although the TPR4 mutant fully complemented the cells, it showed a reduced interaction with FANCA, suggesting that this TPR may also be of functional importance. The recognition of FANCG as a typical TPR protein predicts this protein to play a key role in the assembly and/or stabilization of the nuclear FA protein core complex.
Amino acid pair- and triplet-wise groupings in the interior of α-helical segments in proteins.
de Sousa, Miguel M; Munteanu, Cristian R; Pazos, Alejandro; Fonseca, Nuno A; Camacho, Rui; Magalhães, A L
2011-02-21
A statistical approach has been applied to analyse primary structure patterns at inner positions of α-helices in proteins. A systematic survey was carried out in a recent sample of non-redundant proteins selected from the Protein Data Bank, which were used to analyse α-helix structures for amino acid pairing patterns. Only residues more than three positions apart from both termini of the α-helix were considered as inner. Amino acid pairings i, i+k (k=1, 2, 3, 4, 5), were analysed and the corresponding 20×20 matrices of relative global propensities were constructed. An analysis of (i, i+4, i+8) and (i, i+3, i+4) triplet patterns was also performed. These analysis yielded information on a series of amino acid patterns (pairings and triplets) showing either high or low preference for α-helical motifs and suggested a novel approach to protein alphabet reduction. In addition, it has been shown that the individual amino acid propensities are not enough to define the statistical distribution of these patterns. Global pair propensities also depend on the type of pattern, its composition and orientation in the protein sequence. The data presented should prove useful to obtain and refine useful predictive rules which can further the development and fine-tuning of protein structure prediction algorithms and tools. Copyright © 2010 Elsevier Ltd. All rights reserved.
The city as a motif in Slovene youth literature
Directory of Open Access Journals (Sweden)
Milena Mileva Blažić
2003-01-01
Full Text Available The article presents the city as motif of Slovenian youth literature in four different periods, beginning in the first period of original Slovenian youth literature in the second half of the 19th century, second period in the first half of the 20th century, third period in the second half of the 20th century and after 1950, when significant books were produced in the field of short modern stories, emphasising on picture books and realistic narrative prose, and the fourth period after 1990. A discernable shift can be observed in the thirties of the 20th century, during the times of socialist realism. The most significant change occurred after 1960, when massive migration from rural to urban environments caused by industrialisation began. The motif of urban environment especially marked modern realistic narrative, coined problematic narrative after 1990, with its focus on issues of growing up in such environments. The city as motif or theme doesn’t appear only in realistic narrative, but since the early 20th century also in fantastic narrative, thus it dichotomically presents the image of real world in Slovenian youth realistic narrative.
Determination of the pairing-strength constants in the isovector plus isoscalar pairing case
Mokhtari, D.; Fellah, M.; Allal, N. H.
2016-05-01
A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.
Energy Technology Data Exchange (ETDEWEB)
K Kucera; A Koblansky; L Saunders; K Frederick; E De La Cruz; S Ghosh; Y Modis
2011-12-31
Profilins promote actin polymerization by exchanging ADP for ATP on monomeric actin and delivering ATP-actin to growing filament barbed ends. Apicomplexan protozoa such as Toxoplasma gondii invade host cells using an actin-dependent gliding motility. Toll-like receptor (TLR) 11 generates an innate immune response upon sensing T. gondii profilin (TgPRF). The crystal structure of TgPRF reveals a parasite-specific surface motif consisting of an acidic loop, followed by a long {beta}-hairpin. A series of structure-based profilin mutants show that TLR11 recognition of the acidic loop is responsible for most of the interleukin (IL)-12 secretion response to TgPRF in peritoneal macrophages. Deletion of both the acidic loop and the {beta}-hairpin completely abrogates IL-12 secretion. Insertion of the T. gondii acidic loop and {beta}-hairpin into yeast profilin is sufficient to generate TLR11-dependent signaling. Substitution of the acidic loop in TgPRF with the homologous loop from the apicomplexan parasite Cryptosporidium parvum does not affect TLR11-dependent IL-12 secretion, while substitution with the acidic loop from Plasmodium falciparum results in reduced but significant IL-12 secretion. We conclude that the parasite-specific motif in TgPRF is the key molecular pattern recognized by TLR11. Unlike other profilins, TgPRF slows nucleotide exchange on monomeric rabbit actin and binds rabbit actin weakly. The putative TgPRF actin-binding surface includes the {beta}-hairpin and diverges widely from the actin-binding surfaces of vertebrate profilins.
Energy Technology Data Exchange (ETDEWEB)
Philip, Vivek M [ORNL; Harris, Jason B [ORNL; Adams, Rachel M [ORNL; Nguyen, Don [University of Tennessee, Knoxville (UTK); Spires, Jeremy [University of Tennessee, Knoxville (UTK); Howell, Elizabeth E. [University of Tennessee, Knoxville (UTK); Hinde, Robert J [ORNL
2011-01-01
Protein structures are stabilized using noncovalent interactions. In addition to the traditional noncovalent interactions, newer types of interactions are thought to be present in proteins. One such interaction, an anion pair, in which the positively charged edge of an aromatic ring interacts with an anion, forming a favorable anion quadrupole interaction, has been previously proposed [Jackson, M. R., et al. (2007) J. Phys. Chem. B111, 8242 8249]. To study the role of anion interactions in stabilizing protein structure, we analyzed pairwise interactions between phenylalanine (Phe) and the anionic amino acids, aspartate (Asp) and glutamate (Glu). Particular emphasis was focused on identification of Phe Asp or Glu pairs separated by less than 7 in the high-resolution, nonredundant Protein Data Bank. Simplifying Phe to benzene and Asp or Glu to formate molecules facilitated in silico analysis of the pairs. Kitaura Morokuma energy calculations were performed on roughly 19000 benzene formate pairs and the resulting energies analyzed as a function of distance and angle. Edgewise interactions typically produced strongly stabilizing interaction energies (2 to 7.3 kcal/mol), while interactions involving the ring face resulted in weakly stabilizing to repulsive interaction energies. The strongest, most stabilizing interactions were identified as preferentially occurring in buried residues. Anion pairs are found throughout protein structures, in helices as well as strands. Numerous pairs also had nearby cation interactions as well as potential stacking. While more than 1000 structures did not contain an anion pair, the 3134 remaining structures contained approximately 2.6 anion pairs per protein, suggesting it is a reasonably common motif that could contribute to the overall structural stability of a protein.
Peptide-binding motifs of two common equine class I MHC molecules in Thoroughbred horses.
Bergmann, Tobias; Lindvall, Mikaela; Moore, Erin; Moore, Eugene; Sidney, John; Miller, Donald; Tallmadge, Rebecca L; Myers, Paisley T; Malaker, Stacy A; Shabanowitz, Jeffrey; Osterrieder, Nikolaus; Peters, Bjoern; Hunt, Donald F; Antczak, Douglas F; Sette, Alessandro
2017-05-01
Quantitative peptide-binding motifs of MHC class I alleles provide a valuable tool to efficiently identify putative T cell epitopes. Detailed information on equine MHC class I alleles is still very limited, and to date, only a single equine MHC class I allele, Eqca-1*00101 (ELA-A3 haplotype), has been characterized. The present study extends the number of characterized ELA class I specificities in two additional haplotypes found commonly in the Thoroughbred breed. Accordingly, we here report quantitative binding motifs for the ELA-A2 allele Eqca-16*00101 and the ELA-A9 allele Eqca-1*00201. Utilizing analyses of endogenously bound and eluted ligands and the screening of positional scanning combinatorial libraries, detailed and quantitative peptide-binding motifs were derived for both alleles. Eqca-16*00101 preferentially binds peptides with aliphatic/hydrophobic residues in position 2 and at the C-terminus, and Eqca-1*00201 has a preference for peptides with arginine in position 2 and hydrophobic/aliphatic residues at the C-terminus. Interestingly, the Eqca-16*00101 motif resembles that of the human HLA A02-supertype, while the Eqca-1*00201 motif resembles that of the HLA B27-supertype and two macaque class I alleles. It is expected that the identified motifs will facilitate the selection of candidate epitopes for the study of immune responses in horses.
High affinity recognition of a Phytophthora protein by Arabidopsis via an RGD motif
Senchou, V.; Weide, R.L.; Carrasco, A.; Bouyssou, H.; Pont-Lezica, R.; Govers, F.; Canut, H.
2004-01-01
The RGD tripeptide sequence, a cell adhesion motif present in several extracellular matrix proteins of mammalians, is involved in numerous plant processes. In plant-pathogen interactions, the RGD motif is believed to reduce plant defence responses by disrupting adhesions between the cell wall and
DXD Motif-Dependent and -Independent Effects of the Chlamydia trachomatis Cytotoxin CT166
Directory of Open Access Journals (Sweden)
Miriam Bothe
2015-02-01
Full Text Available The Gram-negative, intracellular bacterium Chlamydia trachomatis causes acute and chronic urogenital tract infection, potentially leading to infertility and ectopic pregnancy. The only partially characterized cytotoxin CT166 of serovar D exhibits a DXD motif, which is important for the enzymatic activity of many bacterial and mammalian type A glycosyltransferases, leading to the hypothesis that CT166 possess glycosyltransferase activity. CT166-expressing HeLa cells exhibit actin reorganization, including cell rounding, which has been attributed to the inhibition of the Rho-GTPases Rac/Cdc42. Exploiting the glycosylation-sensitive Ras(27H5 antibody, we here show that CT166 induces an epitope change in Ras, resulting in inhibited ERK and PI3K signaling and delayed cell cycle progression. Consistent with the hypothesis that these effects strictly depend on the DXD motif, CT166 with the mutated DXD motif causes neither Ras-ERK inhibition nor delayed cell cycle progression. In contrast, CT166 with the mutated DXD motif is still capable of inhibiting cell migration, suggesting that CT166 with the mutated DXD motif cannot be regarded as inactive in any case. Taken together, CT166 affects various fundamental cellular processes, strongly suggesting its importance for the intracellular survival of chlamydia.
Regulation of TCF ETS-domain transcription factors by helix-loop-helix motifs.
Stinson, Julie; Inoue, Toshiaki; Yates, Paula; Clancy, Anne; Norton, John D; Sharrocks, Andrew D
2003-08-15
DNA binding by the ternary complex factor (TCF) subfamily of ETS-domain transcription factors is tightly regulated by intramolecular and intermolecular interactions. The helix-loop-helix (HLH)-containing Id proteins are trans-acting negative regulators of DNA binding by the TCFs. In the TCF, SAP-2/Net/ERP, intramolecular inhibition of DNA binding is promoted by the cis-acting NID region that also contains an HLH-like motif. The NID also acts as a transcriptional repression domain. Here, we have studied the role of HLH motifs in regulating DNA binding and transcription by the TCF protein SAP-1 and how Cdk-mediated phosphorylation affects the inhibitory activity of the Id proteins towards the TCFs. We demonstrate that the NID region of SAP-1 is an autoinhibitory motif that acts to inhibit DNA binding and also functions as a transcription repression domain. This region can be functionally replaced by fusion of Id proteins to SAP-1, whereby the Id moiety then acts to repress DNA binding in cis. Phosphorylation of the Ids by cyclin-Cdk complexes results in reduction in protein-protein interactions between the Ids and TCFs and relief of their DNA-binding inhibitory activity. In revealing distinct mechanisms through which HLH motifs modulate the activity of TCFs, our results therefore provide further insight into the role of HLH motifs in regulating TCF function and how the inhibitory properties of the trans-acting Id HLH proteins are themselves regulated by phosphorylation.
International Nuclear Information System (INIS)
Lee, K.M.; Marshall, A.G.
1987-01-01
Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's
Wiese, Claudia; Hinz, John M; Tebbs, Robert S; Nham, Peter B; Urbin, Salustra S; Collins, David W; Thompson, Larry H; Schild, David
2006-01-01
In vertebrates, homologous recombinational repair (HRR) requires RAD51 and five RAD51 paralogs (XRCC2, XRCC3, RAD51B, RAD51C and RAD51D) that all contain conserved Walker A and B ATPase motifs. In human RAD51D we examined the requirement for these motifs in interactions with XRCC2 and RAD51C, and for survival of cells in response to DNA interstrand crosslinks (ICLs). Ectopic expression of wild-type human RAD51D or mutants having a non-functional A or B motif was used to test for complementation of a rad51d knockout hamster CHO cell line. Although A-motif mutants complement very efficiently, B-motif mutants do not. Consistent with these results, experiments using the yeast two- and three-hybrid systems show that the interactions between RAD51D and its XRCC2 and RAD51C partners also require a functional RAD51D B motif, but not motif A. Similarly, hamster Xrcc2 is unable to bind to the non-complementing human RAD51D B-motif mutants in co-immunoprecipitation assays. We conclude that a functional Walker B motif, but not A motif, is necessary for RAD51D's interactions with other paralogs and for efficient HRR. We present a model in which ATPase sites are formed in a bipartite manner between RAD51D and other RAD51 paralogs.
International Nuclear Information System (INIS)
Lee, Asaka; Asahina, Kota; Okamoto, Takumi; Kawaguchi, Kosuke; Kostsin, Dzmitry G.; Kashiwayama, Yoshinori; Takanashi, Kojiro; Yazaki, Kazufumi; Imanaka, Tsuneo; Morita, Masashi
2014-01-01
Highlights: • ABCD proteins classifies based on with or without NH 2 -terminal hydrophobic segment. • The ABCD proteins with the segment are targeted peroxisomes. • The ABCD proteins without the segment are targeted to the endoplasmic reticulum. • The role of the segment in organelle targeting is conserved in eukaryotic organisms. - Abstract: In mammals, four ATP-binding cassette (ABC) proteins belonging to subfamily D have been identified. ABCD1–3 possesses the NH 2 -terminal hydrophobic region and are targeted to peroxisomes, while ABCD4 lacking the region is targeted to the endoplasmic reticulum (ER). Based on hydropathy plot analysis, we found that several eukaryotes have ABCD protein homologs lacking the NH 2 -terminal hydrophobic segment (H0 motif). To investigate whether the role of the NH 2 -terminal H0 motif in subcellular localization is conserved across species, we expressed ABCD proteins from several species (metazoan, plant and fungi) in fusion with GFP in CHO cells and examined their subcellular localization. ABCD proteins possessing the NH 2 -terminal H0 motif were localized to peroxisomes, while ABCD proteins lacking this region lost this capacity. In addition, the deletion of the NH 2 -terminal H0 motif of ABCD protein resulted in their localization to the ER. These results suggest that the role of the NH 2 -terminal H0 motif in organelle targeting is widely conserved in living organisms
Proteome-level assessment of origin, prevalence and function of Leucine-Aspartic Acid (LD) motifs
Alam, Tanvir; Alazmi, Meshari; Naser, Rayan Mohammad Mahmoud; Huser, Franceline; Momin, Afaque Ahmad Imtiyaz; Walkiewicz, Katarzyna Wiktoria; Canlas, Christian; Huser, Raphaë l; Ali, Amal J.; Merzaban, Jasmeen; Bajic, Vladimir B.; Gao, Xin; Arold, Stefan T.
2018-01-01
and migration, and revealed a new type of inverse LD motif consensus. Our evolutionary analysis suggested that LD motif signalling originated in the common unicellular ancestor of opisthokonts and amoebozoa by co-opting nuclear export sequences. Inter
TOPDOM: database of conservatively located domains and motifs in proteins.
Varga, Julia; Dobson, László; Tusnády, Gábor E
2016-09-01
The TOPDOM database-originally created as a collection of domains and motifs located consistently on the same side of the membranes in α-helical transmembrane proteins-has been updated and extended by taking into consideration consistently localized domains and motifs in globular proteins, too. By taking advantage of the recently developed CCTOP algorithm to determine the type of a protein and predict topology in case of transmembrane proteins, and by applying a thorough search for domains and motifs as well as utilizing the most up-to-date version of all source databases, we managed to reach a 6-fold increase in the size of the whole database and a 2-fold increase in the number of transmembrane proteins. TOPDOM database is available at http://topdom.enzim.hu The webpage utilizes the common Apache, PHP5 and MySQL software to provide the user interface for accessing and searching the database. The database itself is generated on a high performance computer. tusnady.gabor@ttk.mta.hu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.
Directory of Open Access Journals (Sweden)
Peter K. Lauf
2013-02-01
Full Text Available Background/Aims: Chelerythrine [CET], a protein kinase C [PKC] inhibitor, is a prop-apoptotic BH3-mimetic binding to BH1-like motifs of Bcl-2 proteins. CET action was examined on PKC phosphorylation-dependent membrane transporters (Na+/K+ pump/ATPase [NKP, NKA], Na+-K+-2Cl+ [NKCC] and K+-Cl- [KCC] cotransporters, and channel-supported K+ loss in human lens epithelial cells [LECs]. Methods: K+ loss and K+ uptake, using Rb+ as congener, were measured by atomic absorption/emission spectrophotometry with NKP and NKCC inhibitors, and Cl- replacement by NO3ˉ to determine KCC. 3H-Ouabain binding was performed on a pig renal NKA in the presence and absence of CET. Bcl-2 protein and NKA sequences were aligned and motifs identified and mapped using PROSITE in conjunction with BLAST alignments and analysis of conservation and structural similarity based on prediction of secondary and crystal structures. Results: CET inhibited NKP and NKCC by >90% (IC50 values ∼35 and ∼15 µM, respectively without significant KCC activity change, and stimulated K+ loss by ∼35% at 10-30 µM. Neither ATP levels nor phosphorylation of the NKA α1 subunit changed. 3H-ouabain was displaced from pig renal NKA only at 100 fold higher CET concentrations than the ligand. Sequence alignments of NKA with BH1- and BH3-like motifs containing pro-survival Bcl-2 and BclXl proteins showed more than one BH1-like motif within NKA for interaction with CET or with BH3 motifs. One NKA BH1-like motif (ARAAEILARDGPN was also found in all P-type ATPases. Also, NKA possessed a second motif similar to that near the BH3 region of Bcl-2. Conclusion: Findings support the hypothesis that CET inhibits NKP by binding to BH1-like motifs and disrupting the α1 subunit catalytic activity through conformational changes. By interacting with Bcl-2 proteins through their complementary BH1- or BH3-like-motifs, NKP proteins may be sensors of normal and pathological cell functions, becoming important yet
Directory of Open Access Journals (Sweden)
Guo Hao
2011-05-01
Full Text Available Abstract Background High-throughput screens have revealed large-scale protein interaction networks defining most cellular functions. How the proteins were added to the protein interaction network during its growth is a basic and important issue. Network motifs represent the simplest building blocks of cellular machines and are of biological significance. Results Here we study the evolution of protein interaction networks from the perspective of network motifs. We find that in current protein interaction networks, proteins of the same age class tend to form motifs and such co-origins of motif constituents are affected by their topologies and biological functions. Further, we find that the proteins within motifs whose constituents are of the same age class tend to be densely interconnected, co-evolve and share the same biological functions, and these motifs tend to be within protein complexes. Conclusions Our findings provide novel evidence for the hypothesis of the additions of clustered interacting nodes and point out network motifs, especially the motifs with the dense topology and specific function may play important roles during this process. Our results suggest functional constraints may be the underlying driving force for such additions of clustered interacting nodes.
Directory of Open Access Journals (Sweden)
Ugo Moens
2017-11-01
Full Text Available Human polyomavirus 9 (HPyV9 was originally detected in the serum of a renal transplant patient. Seroepidemiological studies showed that ~20–50% of the human population have antibodies against this virus. HPyV9 has not yet been associated with any disease and little is known about the route of infection, transmission, host cell tropism, and genomic variability in circulating strains. Recently, the HPyV9 variant UF-1 with an eight base-pair deletion, a thirteen base-pair insertion and with point mutations, creating three putative Sp1 binding sites in the late promoter was isolated from an AIDS patient. Transient transfection studies with a luciferase reporter plasmid driven by HPyV9 or UF1 promoter demonstrated that UF1 early and late promoters were stronger than HPyV9 promoters in most cell lines, and that the UF1 late promoter was more potently activated by HPyV9 large T-antigen (LTAg. Mutation of two Sp1 motifs strongly reduced trans-activation of the late UF1 promoter by HPyV9 LTAg in HeLa cells. In conclusion, the mutations in the UF1 late promoter seem to strengthen its activity and its response to stimulation by HPyV9 LTAg in certain cells. It remains to be investigated whether these promoter changes have an influence on virus replication and affect the possible pathogenic properties of the virus.
Investigations into nuclear pairing
International Nuclear Information System (INIS)
Clark, R.M.
2006-01-01
This paper is divided in two main sections focusing on different aspects of collective nuclear behavior. In the first section, solutions are considered for the collective pairing Hamiltonian. In particular, an approximate solution at the critical point of the pairing transition from harmonic vibration (normal nuclear behavior) to deformed rotation (superconducting behavior) in gauge space is found by analytic solution of the Hamiltonian. The eigenvalues are expressed in terms of the zeros of Bessel functions of integer order. The results are compared to the pairing bands based on the Pb isotopes. The second section focuses on the experimental search for the Giant Pairing Vibration (GPV) in nuclei. After briefly describing the origin of the GPV, and the reasons that the state has remained unidentified, a novel idea for populating this state is presented. A recent experiment has been performed using the LIBERACE+STARS detector system at the 88-Inch Cyclotron of LBNL to test the idea. (Author)
FTZ-Factor1 and Fushi tarazu interact via conserved nuclear receptor and coactivator motifs
Schwartz, Carol J.E.; Sampson, Heidi M.; Hlousek, Daniela; Percival-Smith, Anthony; Copeland, John W.R.; Simmonds, Andrew J.; Krause, Henry M.
2001-01-01
To activate transcription, most nuclear receptor proteins require coactivators that bind to their ligand-binding domains (LBDs). The Drosophila FTZ-Factor1 (FTZ-F1) protein is a conserved member of the nuclear receptor superfamily, but was previously thought to lack an AF2 motif, a motif that is required for ligand and coactivator binding. Here we show that FTZ-F1 does have an AF2 motif and that it is required to bind a coactivator, the homeodomain-containing protein Fushi tarazu (FTZ). We also show that FTZ contains an AF2-interacting nuclear receptor box, the first to be found in a homeodomain protein. Both interaction motifs are shown to be necessary for physical interactions in vitro and for functional interactions in developing embryos. These unexpected findings have important implications for the conserved homologs of the two proteins. PMID:11157757
Characterizing the binding motifs of 11 common human HLA‐DP and HLA‐DQ molecules using NNAlign
DEFF Research Database (Denmark)
Andreatta, Massimo; Nielsen, Morten
2012-01-01
‐based method NNAlign, we characterized the binding specificities of five HLA‐DP and six HLA‐DQ among the most frequent in the human population. The identified binding motifs showed an overall concurrence with earlier studies but revealed subtle differences. The DP molecules revealed a large overlap...
Exon silencing by UAGG motifs in response to neuronal excitation.
Directory of Open Access Journals (Sweden)
Ping An
2007-02-01
Full Text Available Alternative pre-mRNA splicing plays fundamental roles in neurons by generating functional diversity in proteins associated with the communication and connectivity of the synapse. The CI cassette of the NMDA R1 receptor is one of a variety of exons that show an increase in exon skipping in response to cell excitation, but the molecular nature of this splicing responsiveness is not yet understood. Here we investigate the molecular basis for the induced changes in splicing of the CI cassette exon in primary rat cortical cultures in response to KCl-induced depolarization using an expression assay with a tight neuron-specific readout. In this system, exon silencing in response to neuronal excitation was mediated by multiple UAGG-type silencing motifs, and transfer of the motifs to a constitutive exon conferred a similar responsiveness by gain of function. Biochemical analysis of protein binding to UAGG motifs in extracts prepared from treated and mock-treated cortical cultures showed an increase in nuclear hnRNP A1-RNA binding activity in parallel with excitation. Evidence for the role of the NMDA receptor and calcium signaling in the induced splicing response was shown by the use of specific antagonists, as well as cell-permeable inhibitors of signaling pathways. Finally, a wider role for exon-skipping responsiveness is shown to involve additional exons with UAGG-related silencing motifs, and transcripts involved in synaptic functions. These results suggest that, at the post-transcriptional level, excitable exons such as the CI cassette may be involved in strategies by which neurons mount adaptive responses to hyperstimulation.
A Conserved GPG-Motif in the HIV-1 Nef Core Is Required for Principal Nef-Activities.
Directory of Open Access Journals (Sweden)
Marta Martínez-Bonet
Full Text Available To find out new determinants required for Nef activity we performed a functional alanine scanning analysis along a discrete but highly conserved region at the core of HIV-1 Nef. We identified the GPG-motif, located at the 121-137 region of HIV-1 NL4.3 Nef, as a novel protein signature strictly required for the p56Lck dependent Nef-induced CD4-downregulation in T-cells. Since the Nef-GPG motif was dispensable for CD4-downregulation in HeLa-CD4 cells, Nef/AP-1 interaction and Nef-dependent effects on Tf-R trafficking, the observed effects on CD4 downregulation cannot be attributed to structure constraints or to alterations on general protein trafficking. Besides, we found that the GPG-motif was also required for Nef-dependent inhibition of ring actin re-organization upon TCR triggering and MHCI downregulation, suggesting that the GPG-motif could actively cooperate with the Nef PxxP motif for these HIV-1 Nef-related effects. Finally, we observed that the Nef-GPG motif was required for optimal infectivity of those viruses produced in T-cells. According to these findings, we propose the conserved GPG-motif in HIV-1 Nef as functional region required for HIV-1 infectivity and therefore with a potential interest for the interference of Nef activity during HIV-1 infection.
Linear motif atlas for phosphorylation-dependent signaling
DEFF Research Database (Denmark)
Miller, Martin Lee; Jensen, LJ; Diella, F
2008-01-01
bind to them remains a challenge. NetPhorest is an atlas of consensus sequence motifs that covers 179 kinases and 104 phosphorylation-dependent binding domains [Src homology 2 (SH2), phosphotyrosine binding (PTB), BRCA1 C-terminal (BRCT), WW, and 14-3-3]. The atlas reveals new aspects of signaling...
Matched molecular pair-based data sets for computer-aided medicinal chemistry
Bajorath, Jürgen
2014-01-01
Matched molecular pairs (MMPs) are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR) transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the ChEMBL database (release 17) for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community. PMID:24627802
The conjugal-bed motif in the Alcestis Barcinonensis: two notes
Directory of Open Access Journals (Sweden)
Rosario Moreno Soldevila
2011-06-01
Full Text Available This paper focuses on the centrality occupied by the conjugal-bed motif in the anonymous poem known as Alcestis Barcinonensis, in the light of which two new interpretations of lines 21-22 and 83-85 are provided. In the first passage, beato … toro should be read as a subtle allusion to marital love, one of the central themes of the poem; in the second, uestigia alludes to a well-known literary motif related to the bed of love, thus providing a more accurate interpretation of the post mortem fidelity which Alcestis demands from her husband.
Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.
Ishida, Riyoko; Iwahashi, Hideo
2018-03-01
Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).
Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks
2017-11-02
The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J
2013-12-12
The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.
Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing
2017-09-01
Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.
Pierced Lasso Bundles are a new class of knot-like motifs.
Directory of Open Access Journals (Sweden)
Ellinor Haglund
2014-06-01
Full Text Available A four-helix bundle is a well-characterized motif often used as a target for designed pharmaceutical therapeutics and nutritional supplements. Recently, we discovered a new structural complexity within this motif created by a disulphide bridge in the long-chain helical bundle cytokine leptin. When oxidized, leptin contains a disulphide bridge creating a covalent-loop through which part of the polypeptide chain is threaded (as seen in knotted proteins. We explored whether other proteins contain a similar intriguing knot-like structure as in leptin and discovered 11 structurally homologous proteins in the PDB. We call this new helical family class the Pierced Lasso Bundle (PLB and the knot-like threaded structural motif a Pierced Lasso (PL. In the current study, we use structure-based simulation to investigate the threading/folding mechanisms for all the PLBs along with three unthreaded homologs as the covalent loop (or lasso in leptin is important in folding dynamics and activity. We find that the presence of a small covalent loop leads to a mechanism where structural elements slipknot to thread through the covalent loop. Larger loops use a piercing mechanism where the free terminal plugs through the covalent loop. Remarkably, the position of the loop as well as its size influences the native state dynamics, which can impact receptor binding and biological activity. This previously unrecognized complexity of knot-like proteins within the helical bundle family comprises a completely new class within the knot family, and the hidden complexity we unraveled in the PLBs is expected to be found in other protein structures outside the four-helix bundles. The insights gained here provide critical new elements for future investigation of this emerging class of proteins, where function and the energetic landscape can be controlled by hidden topology, and should be take into account in ab initio predictions of newly identified protein targets.
Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.
2013-01-01
Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer
Gaji, Rajshekhar Y; Howe, Daniel K
2009-07-01
The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.
Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy
2007-05-17
Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.
Identification of novel conserved functional motifs across most Influenza A viral strains
Directory of Open Access Journals (Sweden)
El-Azab Iman
2011-01-01
Full Text Available Abstract Background Influenza A virus poses a continuous threat to global public health. Design of novel universal drugs and vaccine requires a careful analysis of different strains of Influenza A viral genome from diverse hosts and subtypes. We performed a systematic in silico analysis of Influenza A viral segments of all available Influenza A viral strains and subtypes and grouped them based on host, subtype, and years isolated, and through multiple sequence alignments we extrapolated conserved regions, motifs, and accessible regions for functional mapping and annotation. Results Across all species and strains 87 highly conserved regions (conservation percentage > = 90% and 19 functional motifs (conservation percentage = 100% were found in PB2, PB1, PA, NP, M, and NS segments. The conservation percentage of these segments ranged between 94 - 98% in human strains (the most conserved, 85 - 93% in swine strains (the most variable, and 91 - 94% in avian strains. The most conserved segment was different in each host (PB1 for human strains, NS for avian strains, and M for swine strains. Target accessibility prediction yielded 324 accessible regions, with a single stranded probability > 0.5, of which 78 coincided with conserved regions. Some of the interesting annotations in these regions included sites for protein-protein interactions, the RNA binding groove, and the proton ion channel. Conclusions The influenza virus has evolved to adapt to its host through variations in the GC content and conservation percentage of the conserved regions. Nineteen universal conserved functional motifs were discovered, of which some were accessible regions with interesting biological functions. These regions will serve as a foundation for universal drug targets as well as universal vaccine design.
SSTRAP: A computational model for genomic motif discovery ...
African Journals Online (AJOL)
Computational methods can potentially provide high-quality prediction of biological molecules such as DNA binding sites and Transcription factors and therefore reduce the time needed for experimental verification and challenges associated with experimental methods. These biological molecules or motifs have significant ...
International Nuclear Information System (INIS)
Carli, L; Cantatore, A; De Chiffre, L; Genta, G; Barbato, G; Levi, R
2011-01-01
3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to the Expression of Uncertainty in Measurement), was carried out, considering 3D-SEM reconstructions of a wire gauge with a reference diameter of 250 µm. Starting from the more commonly used tilting strategy, one based on the item rotation inside the SEM chamber was also adopted. The latter enables multiple-view reconstructions of the cylindrical item under consideration. Uncertainty evaluation was performed starting from a modified version of the Piazzesi equation, enabling the calculation of the z-coordinate from a given stereo-pair. The metrological characteristics of each input variable have been taken into account and a SEM stage calibration has been performed. Uncertainty tables for the cases of tilt and rotation were then produced, leading to the calculation of expanded uncertainty. For the case of rotation, the largest uncertainty contribution resulted to be the rotational angle; however, for the case of tilt it resulted to be the pixel size. A relative expanded uncertainty equal to 5% and 4% was obtained for the case of rotation and tilt, respectively
Structural motifs of pre-nucleation clusters.
Zhang, Y; Türkmen, I R; Wassermann, B; Erko, A; Rühl, E
2013-10-07
Structural motifs of pre-nucleation clusters prepared in single, optically levitated supersaturated aqueous aerosol microparticles containing CaBr2 as a model system are reported. Cluster formation is identified by means of X-ray absorption in the Br K-edge regime. The salt concentration beyond the saturation point is varied by controlling the humidity in the ambient atmosphere surrounding the 15-30 μm microdroplets. This leads to the formation of metastable supersaturated liquid particles. Distinct spectral shifts in near-edge spectra as a function of salt concentration are observed, in which the energy position of the Br K-edge is red-shifted by up to 7.1 ± 0.4 eV if the dilute solution is compared to the solid. The K-edge positions of supersaturated solutions are found between these limits. The changes in electronic structure are rationalized in terms of the formation of pre-nucleation clusters. This assumption is verified by spectral simulations using first-principle density functional theory and molecular dynamics calculations, in which structural motifs are considered, explaining the experimental results. These consist of solvated CaBr2 moieties, rather than building blocks forming calcium bromide hexahydrates, the crystal system that is formed by drying aqueous CaBr2 solutions.
Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen
2016-12-01
The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A nucleobase-centered coarse-grained representation for structure prediction of RNA motifs.
Poblete, Simón; Bottaro, Sandro; Bussi, Giovanni
2018-02-28
We introduce the SPlit-and-conQueR (SPQR) model, a coarse-grained (CG) representation of RNA designed for structure prediction and refinement. In our approach, the representation of a nucleotide consists of a point particle for the phosphate group and an anisotropic particle for the nucleoside. The interactions are, in principle, knowledge-based potentials inspired by the $\\mathcal {E}$SCORE function, a base-centered scoring function. However, a special treatment is given to base-pairing interactions and certain geometrical conformations which are lost in a raw knowledge-based model. This results in a representation able to describe planar canonical and non-canonical base pairs and base-phosphate interactions and to distinguish sugar puckers and glycosidic torsion conformations. The model is applied to the folding of several structures, including duplexes with internal loops of non-canonical base pairs, tetraloops, junctions and a pseudoknot. For the majority of these systems, experimental structures are correctly predicted at the level of individual contacts. We also propose a method for efficiently reintroducing atomistic detail from the CG representation.
Insertion of tetracysteine motifs into dopamine transporter extracellular domains.
Directory of Open Access Journals (Sweden)
Deanna M Navaroli
Full Text Available The neuronal dopamine transporter (DAT is a major determinant of extracellular dopamine (DA levels and is the primary target for a variety of addictive and therapeutic psychoactive drugs. DAT is acutely regulated by protein kinase C (PKC activation and amphetamine exposure, both of which modulate DAT surface expression by endocytic trafficking. In order to use live imaging approaches to study DAT endocytosis, methods are needed to exclusively label the DAT surface pool. The use of membrane impermeant, sulfonated biarsenic dyes holds potential as one such approach, and requires introduction of an extracellular tetracysteine motif (tetraCys; CCPGCC to facilitate dye binding. In the current study, we took advantage of intrinsic proline-glycine (Pro-Gly dipeptides encoded in predicted DAT extracellular domains to introduce tetraCys motifs into DAT extracellular loops 2, 3, and 4. [(3H]DA uptake studies, surface biotinylation and fluorescence microscopy in PC12 cells indicate that tetraCys insertion into the DAT second extracellular loop results in a functional transporter that maintains PKC-mediated downregulation. Introduction of tetraCys into extracellular loops 3 and 4 yielded DATs with severely compromised function that failed to mature and traffic to the cell surface. This is the first demonstration of successful introduction of a tetracysteine motif into a DAT extracellular domain, and may hold promise for use of biarsenic dyes in live DAT imaging studies.
Target motifs affecting natural immunity by a constitutive CRISPR-Cas system in Escherichia coli.
Directory of Open Access Journals (Sweden)
Cristóbal Almendros
Full Text Available Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR and CRISPR associated (cas genes conform the CRISPR-Cas systems of various bacteria and archaea and produce degradation of invading nucleic acids containing sequences (protospacers that are complementary to repeat intervening spacers. It has been demonstrated that the base sequence identity of a protospacer with the cognate spacer and the presence of a protospacer adjacent motif (PAM influence CRISPR-mediated interference efficiency. By using an original transformation assay with plasmids targeted by a resident spacer here we show that natural CRISPR-mediated immunity against invading DNA occurs in wild type Escherichia coli. Unexpectedly, the strongest activity is observed with protospacer adjoining nucleotides (interference motifs that differ from the PAM both in sequence and location. Hence, our results document for the first time native CRISPR activity in E. coli and demonstrate that positions next to the PAM in invading DNA influence their recognition and degradation by these prokaryotic immune systems.
Mapping of Minimal Motifs of B-Cell Epitopes on Human Zona Pellucida Glycoprotein-3
Directory of Open Access Journals (Sweden)
Wan-Xiang Xu
2012-01-01
Full Text Available The human zona pellucida glycoprotein-3 (hZP3 by virtue of its critical role during fertilization has been proposed as a promising candidate antigen to develop a contraceptive vaccine. In this direction, it is imperative to map minimal motifs of the B cell epitopes (BCEs so as to avoid ZP-specific oophoritogenic T cell epitopes (TCEs in the ZP3-based immunogens. In this study, based on known results of mapping marmoset and bonnet monkey ZP3 (mstZP3 and bmZP3, two predictable epitopes23–30 and 301–320 on hZP3 were first confirmed and five minimal motifs within four epitopes on hZP3 were defined using serum to recombinant hZP3a22–176 or hZP3b177–348 as well as a biosynthetic peptide strategy. These defined minimal motifs were QPLWLL23–28 for hZP323–30, MQVTDD103–108 for hZP393–110, EENW178–181 for hZP3172–190, as well as SNSWF306–310 and EGP313–315 for hZP3301–320, respectively. Furthermore, the antigenicity of two peptides for hZP3172–187 and hZP3301–315 and specificity of the antibody response to these peptides were also evaluated, which produced high-titer antibodies in immunized animals that were capable of reacting to ZP on human oocytes, r-hZP3b177–348 protein, as well as r-hZP3172–190, r-hZP3303–310, and r-hZP3313–320 epitope peptides fused with truncated GST188 protein.
Sun, Eric I; Leyn, Semen A; Kazanov, Marat D; Saier, Milton H; Novichkov, Pavel S; Rodionov, Dmitry A
2013-09-02
In silico comparative genomics approaches have been efficiently used for functional prediction and reconstruction of metabolic and regulatory networks. Riboswitches are metabolite-sensing structures often found in bacterial mRNA leaders controlling gene expression on transcriptional or translational levels.An increasing number of riboswitches and other cis-regulatory RNAs have been recently classified into numerous RNA families in the Rfam database. High conservation of these RNA motifs provides a unique advantage for their genomic identification and comparative analysis. A comparative genomics approach implemented in the RegPredict tool was used for reconstruction and functional annotation of regulons controlled by RNAs from 43 Rfam families in diverse taxonomic groups of Bacteria. The inferred regulons include ~5200 cis-regulatory RNAs and more than 12000 target genes in 255 microbial genomes. All predicted RNA-regulated genes were classified into specific and overall functional categories. Analysis of taxonomic distribution of these categories allowed us to establish major functional preferences for each analyzed cis-regulatory RNA motif family. Overall, most RNA motif regulons showed predictable functional content in accordance with their experimentally established effector ligands. Our results suggest that some RNA motifs (including thiamin pyrophosphate and cobalamin riboswitches that control the cofactor metabolism) are widespread and likely originated from the last common ancestor of all bacteria. However, many more analyzed RNA motifs are restricted to a narrow taxonomic group of bacteria and likely represent more recent evolutionary innovations. The reconstructed regulatory networks for major known RNA motifs substantially expand the existing knowledge of transcriptional regulation in bacteria. The inferred regulons can be used for genetic experiments, functional annotations of genes, metabolic reconstruction and evolutionary analysis. The obtained genome
Directory of Open Access Journals (Sweden)
Kim Man-Sun
2012-05-01
Full Text Available Abstract Background Network motifs provided a “conceptual tool” for understanding the functional principles of biological networks, but such motifs have primarily been used to consider static network structures. Static networks, however, cannot be used to reveal time- and region-specific traits of biological systems. To overcome this limitation, we proposed the concept of a “spatiotemporal network motif,” a spatiotemporal sequence of network motifs of sub-networks which are active only at specific time points and body parts. Results On the basis of this concept, we analyzed the developmental gene regulatory network of the Drosophila melanogaster embryo. We identified spatiotemporal network motifs and investigated their distribution pattern in time and space. As a result, we found how key developmental processes are temporally and spatially regulated by the gene network. In particular, we found that nested feedback loops appeared frequently throughout the entire developmental process. From mathematical simulations, we found that mutual inhibition in the nested feedback loops contributes to the formation of spatial expression patterns. Conclusions Taken together, the proposed concept and the simulations can be used to unravel the design principle of developmental gene regulatory networks.
Conformational analysis of a covalently cross-linked Watson-Crick base pair model.
Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J
2008-11-15
Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.
Philip, Vivek; Harris, Jason; Adams, Rachel; Nguyen, Don; Spiers, Jeremy; Baudry, Jerome; Howell, Elizabeth E; Hinde, Robert J
2011-04-12
Protein structures are stabilized using noncovalent interactions. In addition to the traditional noncovalent interactions, newer types of interactions are thought to be present in proteins. One such interaction, an anion-π pair, in which the positively charged edge of an aromatic ring interacts with an anion, forming a favorable anion-quadrupole interaction, has been previously proposed [Jackson, M. R., et al. (2007) J. Phys. Chem. B111, 8242-8249]. To study the role of anion-π interactions in stabilizing protein structure, we analyzed pairwise interactions between phenylalanine (Phe) and the anionic amino acids, aspartate (Asp) and glutamate (Glu). Particular emphasis was focused on identification of Phe-Asp or -Glu pairs separated by less than 7 Å in the high-resolution, nonredundant Protein Data Bank. Simplifying Phe to benzene and Asp or Glu to formate molecules facilitated in silico analysis of the pairs. Kitaura-Morokuma energy calculations were performed on roughly 19000 benzene-formate pairs and the resulting energies analyzed as a function of distance and angle. Edgewise interactions typically produced strongly stabilizing interaction energies (-2 to -7.3 kcal/mol), while interactions involving the ring face resulted in weakly stabilizing to repulsive interaction energies. The strongest, most stabilizing interactions were identified as preferentially occurring in buried residues. Anion-π pairs are found throughout protein structures, in helices as well as β strands. Numerous pairs also had nearby cation-π interactions as well as potential π-π stacking. While more than 1000 structures did not contain an anion-π pair, the 3134 remaining structures contained approximately 2.6 anion-π pairs per protein, suggesting it is a reasonably common motif that could contribute to the overall structural stability of a protein.
Energy Technology Data Exchange (ETDEWEB)
Philip, Vivek M [ORNL; Harris, Jason B [ORNL; Adams, Rachel M [ORNL; Nguyen, Don [University of Tennessee; Spiers, Jeremy D [ORNL; Baudry, Jerome Y [ORNL; Howell, Elizabeth E [ORNL; Hinde, Robert J [ORNL
2011-01-01
Protein structures are stabilized using noncovalent interactions. In addition to the traditional noncovalent interactions, newer types of interactions are thought to be present in proteins. One such interaction, an anion-{pi} pair, in which the positively charged edge of an aromatic ring interacts with an anion, forming a favorable anion-quadrupole interaction, has been previously proposed [Jackson, M. R., et al. (2007) J. Phys. Chem. B111, 8242-8249]. To study the role of anion-{pi} interactions in stabilizing protein structure, we analyzed pairwise interactions between phenylalanine (Phe) and the anionic amino acids, aspartate (Asp) and glutamate (Glu). Particular emphasis was focused on identification of Phe-Asp or -Glu pairs separated by less than 7 {angstrom} in the high-resolution, nonredundant Protein Data Bank. Simplifying Phe to benzene and Asp or Glu to formate molecules facilitated in silico analysis of the pairs. Kitaura-Morokuma energy calculations were performed on roughly 19000 benzene-formate pairs and the resulting energies analyzed as a function of distance and angle. Edgewise interactions typically produced strongly stabilizing interaction energies (-2 to -7.3 kcal/mol), while interactions involving the ring face resulted in weakly stabilizing to repulsive interaction energies. The strongest, most stabilizing interactions were identified as preferentially occurring in buried residues. Anion-{pi} pairs are found throughout protein structures, in helices as well as {beta} strands. Numerous pairs also had nearby cation-{pi} interactions as well as potential {pi}-{pi} stacking. While more than 1000 structures did not contain an anion-{pi} pair, the 3134 remaining structures contained approximately 2.6 anion-{pi} pairs per protein, suggesting it is a reasonably common motif that could contribute to the overall structural stability of a protein.
Directory of Open Access Journals (Sweden)
Lars Matthias Voll
2011-08-01
Full Text Available During compatible interactions with their host plants, biotrophic plant pathogens subvert host metabolism to ensure the sustained provision of nutrient assimilates by the colonized host cells. To investigate, whether common motifs can be revealed in the response of primary carbon and nitrogen metabolism towards colonization with biotrophic fungi in cereal leaves, we have conducted a combined metabolome and transcriptome study of three quite divergent pathosystems, the barley powdery mildew fungus (Blumeria graminis f.sp. hordei, the corn smut fungus Ustilago maydis and the maize anthracnose fungus Colletotrichum graminicola, the latter being a hemibiotroph that only exhibits an initial biotrophic phase during its establishment.Based on the analysis of 42 water-soluble metabolites, we were able to separate early biotrophic from late biotrophic interactions by hierarchical cluster analysis and principal component analysis, irrespective of the plant host. Interestingly, the corresponding transcriptome dataset could not discriminate between these stages of biotrophy, irrespective, of whether transcript data for genes of central metabolism or the entire transcriptome dataset was used. Strong differences in the transcriptional regulation of photosynthesis, glycolysis, the TCA cycle, lipid biosynthesis, and cell wall metabolism were observed between the pathosystems. Increased contents of Gln, Asn, and glucose as well as diminished contents of PEP and 3-PGA were common to early post-penetration stages of all interactions. On the transcriptional level, genes of the TCA cycle, nucleotide energy metabolism and amino acid biosynthesis exhibited consistent trends among the compared biotrophic interactions, identifying the requirement for metabolic energy and the rearrangement of amino acid pools as common transcriptional motifs during early biotrophy. Both metabolome and transcript data were employed to generate models of leaf primary metabolism during
Kumar, Anil; Sevilla, Michael D.
2009-01-01
On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319
Functional motifs responsible for human metapneumovirus M2-2-mediated innate immune evasion.
Chen, Yu; Deng, Xiaoling; Deng, Junfang; Zhou, Jiehua; Ren, Yuping; Liu, Shengxuan; Prusak, Deborah J; Wood, Thomas G; Bao, Xiaoyong
2016-12-01
Human metapneumovirus (hMPV) is a major cause of lower respiratory infection in young children. Repeated infections occur throughout life, but its immune evasion mechanisms are largely unknown. We recently found that hMPV M2-2 protein elicits immune evasion by targeting mitochondrial antiviral-signaling protein (MAVS), an antiviral signaling molecule. However, the molecular mechanisms underlying such inhibition are not known. Our mutagenesis studies revealed that PDZ-binding motifs, 29-DEMI-32 and 39-KEALSDGI-46, located in an immune inhibitory region of M2-2, are responsible for M2-2-mediated immune evasion. We also found both motifs prevent TRAF5 and TRAF6, the MAVS downstream adaptors, to be recruited to MAVS, while the motif 39-KEALSDGI-46 also blocks TRAF3 migrating to MAVS. In parallel, these TRAFs are important in activating transcription factors NF-kB and/or IRF-3 by hMPV. Our findings collectively demonstrate that M2-2 uses its PDZ motifs to launch the hMPV immune evasion through blocking the interaction of MAVS and its downstream TRAFs. Copyright © 2016 Elsevier Inc. All rights reserved.
Core signalling motif displaying multistability through multi-state enzymes
DEFF Research Database (Denmark)
Feng, Song; Saez Cornellana, Meritxell; Wiuf, Carsten Henrik
2016-01-01
Bistability, and more generally multistability, is a key system dynamics feature enabling decision-making and memory in cells. Deciphering the molecular determinants of multistability is thus crucial for a better understanding of cellular pathways and their (re)engineering in synthetic biology....... Here, we show that a key motif found predominantly in eukaryotic signalling systems, namely a futile signalling cycle, can display bistability when featuring a two-state kinase. We provide necessary and sufficient mathematical conditions on the kinetic parameters of this motif that guarantee...... the existence of multiple steady states. These conditions foster the intuition that bistability arises as a consequence of competition between the two states of the kinase. Extending from this result, we find that increasing the number of kinase states linearly translates into an increase in the number...
PDL1 Signals through Conserved Sequence Motifs to Overcome Interferon-Mediated Cytotoxicity
Directory of Open Access Journals (Sweden)
Maria Gato-Cañas
2017-08-01
Full Text Available PDL1 blockade produces remarkable clinical responses, thought to occur by T cell reactivation through prevention of PDL1-PD1 T cell inhibitory interactions. Here, we find that PDL1 cell-intrinsic signaling protects cancer cells from interferon (IFN cytotoxicity and accelerates tumor progression. PDL1 inhibited IFN signal transduction through a conserved class of sequence motifs that mediate crosstalk with IFN signaling. Abrogation of PDL1 expression or antibody-mediated PDL1 blockade strongly sensitized cancer cells to IFN cytotoxicity through a STAT3/caspase-7-dependent pathway. Moreover, somatic mutations found in human carcinomas within these PDL1 sequence motifs disrupted motif regulation, resulting in PDL1 molecules with enhanced protective activities from type I and type II IFN cytotoxicity. Overall, our results reveal a mode of action of PDL1 in cancer cells as a first line of defense against IFN cytotoxicity.
Knabe, Johannes F; Nehaniv, Chrystopher L; Schilstra, Maria J
2008-01-01
Methods that analyse the topological structure of networks have recently become quite popular. Whether motifs (subgraph patterns that occur more often than in randomized networks) have specific functions as elementary computational circuits has been cause for debate. As the question is difficult to resolve with currently available biological data, we approach the issue using networks that abstractly model natural genetic regulatory networks (GRNs) which are evolved to show dynamical behaviors. Specifically one group of networks was evolved to be capable of exhibiting two different behaviors ("differentiation") in contrast to a group with a single target behavior. In both groups we find motif distribution differences within the groups to be larger than differences between them, indicating that evolutionary niches (target functions) do not necessarily mold network structure uniquely. These results show that variability operators can have a stronger influence on network topologies than selection pressures, especially when many topologies can create similar dynamics. Moreover, analysis of motif functional relevance by lesioning did not suggest that motifs were of greater importance to the functioning of the network than arbitrary subgraph patterns. Only when drastically restricting network size, so that one motif corresponds to a whole functionally evolved network, was preference for particular connection patterns found. This suggests that in non-restricted, bigger networks, entanglement with the rest of the network hinders topological subgraph analysis.
Identification of a Baeyer-Villiger monooxygenase sequence motif
Fraaije, MW; Kamerbeek, NM; van Berkel, WJH; Janssen, DB; Kamerbeek, Nanne M.; Berkel, Willem J.H. van
2002-01-01
Baeyer-Villiger monooxygenases (BVMOs) form a distinct class of flavoproteins that catalyze the insertion of an oxygen atom in a C-C bond using dioxygen and NAD(P)H. Using newly characterized BVMO sequences, we have uncovered a BVMO-identifying sequence motif: FXGXXXRXXXW(P/D). Studies with
Directory of Open Access Journals (Sweden)
Yaron Orenstein
Full Text Available The new technology of protein binding microarrays (PBMs allows simultaneous measurement of the binding intensities of a transcription factor to tens of thousands of synthetic double-stranded DNA probes, covering all possible 10-mers. A key computational challenge is inferring the binding motif from these data. We present a systematic comparison of four methods developed specifically for reconstructing a binding site motif represented as a positional weight matrix from PBM data. The reconstructed motifs were evaluated in terms of three criteria: concordance with reference motifs from the literature and ability to predict in vivo and in vitro bindings. The evaluation encompassed over 200 transcription factors and some 300 assays. The results show a tradeoff between how the methods perform according to the different criteria, and a dichotomy of method types. Algorithms that construct motifs with low information content predict PBM probe ranking more faithfully, while methods that produce highly informative motifs match reference motifs better. Interestingly, in predicting high-affinity binding, all methods give far poorer results for in vivo assays compared to in vitro assays.
Smit, Cornelis H; van Diepen, Angela; Nguyen, D Linh; Wuhrer, Manfred; Hoffmann, Karl F; Deelder, André M; Hokke, Cornelis H
2015-07-01
Glycans present on glycoproteins and glycolipids of the major human parasite Schistosoma mansoni induce innate as well as adaptive immune responses in the host. To be able to study the molecular characteristics of schistosome infections it is therefore required to determine the expression profiles of glycans and antigenic glycan-motifs during a range of critical stages of the complex schistosome lifecycle. We performed a longitudinal profiling study covering schistosome glycosylation throughout worm- and egg-development using a mass spectrometry-based glycomics approach. Our study revealed that during worm development N-glycans with Galβ1-4(Fucα1-3)GlcNAc (LeX) and core-xylose motifs were rapidly lost after cercariae to schistosomula transformation, whereas GalNAcβ1-4GlcNAc (LDN)-motifs gradually became abundant and predominated in adult worms. LeX-motifs were present on glycolipids up to 2 weeks of schistosomula development, whereas glycolipids with mono- and multifucosylated LDN-motifs remained present up to the adult worm stage. In contrast, expression of complex O-glycans diminished to undetectable levels within days after transformation. During egg development, a rich diversity of N-glycans with fucosylated motifs was expressed, but with α3-core fucose and a high degree of multifucosylated antennae only in mature eggs and miracidia. N-glycan antennae were exclusively LDN-based in miracidia. O-glycans in the mature eggs were also diverse and contained LeX- and multifucosylated LDN, but none of these were associated with miracidia in which we detected only the Galβ1-3(Galβ1-6)GalNAc core glycan. Immature eggs also exhibited short O-glycan core structures only, suggesting that complex fucosylated O-glycans of schistosome eggs are derived primarily from glycoproteins produced by the subshell envelope in the developed egg. Lipid glycans with multifucosylated GlcNAc repeats were present throughout egg development, but with the longer highly fucosylated
A novel fibronectin binding motif in MSCRAMMs targets F3 modules.
Directory of Open Access Journals (Sweden)
Sabitha Prabhakaran
Full Text Available BBK32 is a surface expressed lipoprotein and fibronectin (Fn-binding microbial surface component recognizing adhesive matrix molecule (MSCRAMM of Borrelia burgdorferi, the causative agent of Lyme disease. Previous studies from our group showed that BBK32 is a virulence factor in experimental Lyme disease and located the Fn-binding region to residues 21-205 of the lipoprotein.Studies aimed at identifying interacting sites between BBK32 and Fn revealed an interaction between the MSCRAMM and the Fn F3 modules. Further analysis of this interaction showed that BBK32 can cause the aggregation of human plasma Fn in a similar concentration-dependent manner to that of anastellin, the superfibronectin (sFn inducing agent. The resulting Fn aggregates are conformationally distinct from plasma Fn as indicated by a change in available thermolysin cleavage sites. Recombinant BBK32 and anastellin affect the structure of Fn matrices formed by cultured fibroblasts and inhibit endothelial cell proliferation similarly. Within BBK32, we have located the sFn-forming activity to a region between residues 160 and 175 which contains two sequence motifs that are also found in anastellin. Synthetic peptides mimicking these motifs induce Fn aggregation, whereas a peptide with a scrambled sequence motif was inactive, suggesting that these motifs represent the sFn-inducing sequence.We conclude that BBK32 induces the formation of Fn aggregates that are indistinguishable from those formed by anastellin. The results of this study provide evidence for how bacteria can target host proteins to manipulate host cell activities.
Marlowe, Ashley E.; Singh, Abhishek; Semichaevsky, Andrey V.; Yingling, Yaroslava G.
2009-03-01
Nucleic acid nanoparticles can self-assembly through the formation of complementary loop-loop interactions or stem-stem interactions. Presence and concentration of ions can significantly affect the self-assembly process and the stability of the nanostructure. In this presentation we use explicit molecular dynamics simulations to examine the variations in cationic distributions and hydration environment around DNA and RNA helices and loop-loop interactions. Our simulations show that the potassium and sodium ionic distributions are different around RNA and DNA motifs which could be indicative of ion mediated relative stability of loop-loop complexes. Moreover in RNA loop-loop motifs ions are consistently present and exchanged through a distinct electronegative channel. We will also show how we used the specific RNA loop-loop motif to design a RNA hexagonal nanoparticle.
A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.
Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens
2013-10-01
A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.
Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model
Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.
2008-01-01
Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...
Analysis of a conserved RGE/RGD motif in HCV E2 in mediating entry
Directory of Open Access Journals (Sweden)
Rong Lijun
2009-01-01
Full Text Available Abstract Background Hepatitis C virus (HCV encodes two transmembrane glycoproteins E1 and E2 which form a heterodimer. E1 is believed to mediate fusion while E2 has been shown to bind cellular receptors. It is clear that HCV uses a multi-receptor complex to gain entry into susceptible cells, however key elements of this complex remain elusive. In this study, the role of a highly conserved RGE/RGD motif of HCV E2 glycoprotein in viral entry was examined. The effect of each substitution mutation in this motif was tested by challenging susceptible cell lines with mutant HCV E1E2 pseudotyped viruses generated using a lentiviral system (HCVpp. In addition to assaying infectivity, producer cell expression and HCVpp incorporation of HCV E2 proteins, CD81 binding profiles, and conformation of mutants were examined. Results Based on these characteristics, mutants either displayed wt characteristics (high infectivity [≥ 90% of wt HCVpp], CD81 binding, E1E2 expression, and incorporation into viral particles and proper conformation or very low infectivity (≤ 20% of wt HCVpp. Only amino acid substitutions of the 3rd position (D or E resulted in wt characteristics as long as the negative charge was maintained or a neutral alanine was introduced. A change in charge to a positive lysine, disrupted HCVpp infectivity at this position. Conclusion Although most amino acid substitutions within this conserved motif displayed greatly reduced HCVpp infectivity, they retained soluble CD81 binding, proper E2 conformation, and incorporation into HCVpp. Our results suggest that although RGE/D is a well-defined integrin binding motif, in this case the role of these three hyperconserved amino acids does not appear to be integrin binding. As the extent of conservation of this region extends well beyond these three amino acids, we speculate that this region may play an important role in the structure of HCV E2 or in mediating the interaction with other factor(s during
GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.
Directory of Open Access Journals (Sweden)
Kohal Das
Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.
MicroRNA categorization using sequence motifs and k-mers.
Yousef, Malik; Khalifa, Waleed; Acar, İlhan Erkin; Allmer, Jens
2017-03-14
Post-transcriptional gene dysregulation can be a hallmark of diseases like cancer and microRNAs (miRNAs) play a key role in the modulation of translation efficiency. Known pre-miRNAs are listed in miRBase, and they have been discovered in a variety of organisms ranging from viruses and microbes to eukaryotic organisms. The computational detection of pre-miRNAs is of great interest, and such approaches usually employ machine learning to discriminate between miRNAs and other sequences. Many features have been proposed describing pre-miRNAs, and we have previously introduced the use of sequence motifs and k-mers as useful ones. There have been reports of xeno-miRNAs detected via next generation sequencing. However, they may be contaminations and to aid that important decision-making process, we aimed to establish a means to differentiate pre-miRNAs from different species. To achieve distinction into species, we used one species' pre-miRNAs as the positive and another species' pre-miRNAs as the negative training and test data for the establishment of machine learned models based on sequence motifs and k-mers as features. This approach resulted in higher accuracy values between distantly related species while species with closer relation produced lower accuracy values. We were able to differentiate among species with increasing success when the evolutionary distance increases. This conclusion is supported by previous reports of fast evolutionary changes in miRNAs since even in relatively closely related species a fairly good discrimination was possible.
DEFF Research Database (Denmark)
Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel
2015-01-01
In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...
Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J
2010-07-29
A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the
An Intelligent Model for Pairs Trading Using Genetic Algorithms.
Huang, Chien-Feng; Hsu, Chi-Jen; Chen, Chi-Chung; Chang, Bao Rong; Li, Chen-An
2015-01-01
Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice.
Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study
Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.
2005-01-01
We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure
Organofluorine chemistry: synthesis and conformation of vicinal fluoromethylene motifs.
O'Hagan, David
2012-04-20
The C-F bond is the most polar bond in organic chemistry, and thus the bond has a relatively large dipole moment with a significant -ve charge density on the fluorine atom and correspondingly a +ve charge density on carbon. The electrostatic nature of the bond renders it the strongest one in organic chemistry. However, the fluorine atom itself is nonpolarizable, and thus, despite the charge localization on fluorine, it is a poor hydrogen-bonding acceptor. These properties of the C-F bond make it attractive in the design of nonviscous but polar organic compounds, with a polarity limited to influencing the intramolecular nature of the molecule and less so intermolecular interactions with the immediate environment. In this Perspective, the synthesis of aliphatic chains carrying multivicinal fluoromethylene motifs is described. It emerges that the dipoles of adjacent C-F bonds orientate relative to each other, and thus, individual diastereoisomers display different backbone carbon chain conformations. These conformational preferences recognize the influence of the well-known gauche effect associated with 1,2-difluoroethane but extend to considering 1,3-fluorine-fluorine dipolar repulsions. The synthesis of carbon chains carrying two, three, four, five, and six vicinal fluoromethylene motifs is described, with an emphasis on our own research contributions. These motifs obey almost predictable conformational behavior, and they emerge as candidates for inclusion in the design of performance organic molecules. © 2012 American Chemical Society
Mechanism for activation of the growth factor-activated AGC kinases by turn motif phosphorylation
DEFF Research Database (Denmark)
Hauge, Camilla; Antal, Torben L; Hirschberg, Daniel
2007-01-01
investigated the role of the third, so-called turn motif phosphate, also located in the tail, in the AGC kinases PKB, S6K, RSK, MSK, PRK and PKC. We report cooperative action of the HM phosphate and the turn motif phosphate, because it binds a phosphoSer/Thr-binding site above the glycine-rich loop within...
The Q Motif Is Involved in DNA Binding but Not ATP Binding in ChlR1 Helicase.
Directory of Open Access Journals (Sweden)
Hao Ding
Full Text Available Helicases are molecular motors that couple the energy of ATP hydrolysis to the unwinding of structured DNA or RNA and chromatin remodeling. The conversion of energy derived from ATP hydrolysis into unwinding and remodeling is coordinated by seven sequence motifs (I, Ia, II, III, IV, V, and VI. The Q motif, consisting of nine amino acids (GFXXPXPIQ with an invariant glutamine (Q residue, has been identified in some, but not all helicases. Compared to the seven well-recognized conserved helicase motifs, the role of the Q motif is less acknowledged. Mutations in the human ChlR1 (DDX11 gene are associated with a unique genetic disorder known as Warsaw Breakage Syndrome, which is characterized by cellular defects in genome maintenance. To examine the roles of the Q motif in ChlR1 helicase, we performed site directed mutagenesis of glutamine to alanine at residue 23 in the Q motif of ChlR1. ChlR1 recombinant protein was overexpressed and purified from HEK293T cells. ChlR1-Q23A mutant abolished the helicase activity of ChlR1 and displayed reduced DNA binding ability. The mutant showed impaired ATPase activity but normal ATP binding. A thermal shift assay revealed that ChlR1-Q23A has a melting point value similar to ChlR1-WT. Partial proteolysis mapping demonstrated that ChlR1-WT and Q23A have a similar globular structure, although some subtle conformational differences in these two proteins are evident. Finally, we found ChlR1 exists and functions as a monomer in solution, which is different from FANCJ, in which the Q motif is involved in protein dimerization. Taken together, our results suggest that the Q motif is involved in DNA binding but not ATP binding in ChlR1 helicase.
Directory of Open Access Journals (Sweden)
Cutler Sean R
2007-06-01
Full Text Available Abstract Background The carboxy termini of proteins are a frequent site of activity for a variety of biologically important functions, ranging from post-translational modification to protein targeting. Several short peptide motifs involved in protein sorting roles and dependent upon their proximity to the C-terminus for proper function have already been characterized. As a limited number of such motifs have been identified, the potential exists for genome-wide statistical analysis and comparative genomics to reveal novel peptide signatures functioning in a C-terminal dependent manner. We have applied a novel methodology to the prediction of C-terminal-anchored peptide motifs involving a simple z-statistic and several techniques for improving the signal-to-noise ratio. Results We examined the statistical over-representation of position-specific C-terminal tripeptides in 7 eukaryotic proteomes. Sequence randomization models and simple-sequence masking were applied to the successful reduction of background noise. Similarly, as C-terminal homology among members of large protein families may artificially inflate tripeptide counts in an irrelevant and obfuscating manner, gene-family clustering was performed prior to the analysis in order to assess tripeptide over-representation across protein families as opposed to across all proteins. Finally, comparative genomics was used to identify tripeptides significantly occurring in multiple species. This approach has been able to predict, to our knowledge, all C-terminally anchored targeting motifs present in the literature. These include the PTS1 peroxisomal targeting signal (SKL*, the ER-retention signal (K/HDEL*, the ER-retrieval signal for membrane bound proteins (KKxx*, the prenylation signal (CC* and the CaaX box prenylation motif. In addition to a high statistical over-representation of these known motifs, a collection of significant tripeptides with a high propensity for biological function exists
Deuterium isotope effects and fractionation factors of hydrogen-bonded A:T base pairs of DNA
International Nuclear Information System (INIS)
Vakonakis, Ioannis; Salazar, Miguel; Kang, Mijeong; Dunbar, Kim R.; Li Wang, Andy C.
2003-01-01
Deuterium isotope effects and fractionation factors of N1...H3-N3 hydrogen bonded Watson-Crick A:T base pairs of two DNA dodecamers are presented here. Specifically, two-bond deuterium isotope effects on the chemical shifts of 13 C2 and 13 C4, 2 Δ 13 C2 and 2 Δ 13 C4, and equilibrium deuterium/protium fractionation factors of H3, Φ, were measured and seen to correlate with the chemical shift of the corresponding imino proton, δ H3 . Downfield-shifted imino protons associated with larger values of 2 Δ 13 C2 and 2 Δ 13 C4 and smaller Φ values, which together suggested that the effective H3-N3 vibrational potentials were more anharmonic in the stronger hydrogen bonds of these DNA molecules. We anticipate that 2 Δ 13 C2, 2 Δ 13 C4 and Φ values can be useful gauges of hydrogen bond strength of A:T base pairs
Chakraborty, Debayan; Wales, David J
2018-01-04
The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.
The position of the Gly-xxx-Gly motif in transmembrane segments modulates dimer affinity.
Johnson, Rachel M; Rath, Arianna; Deber, Charles M
2006-12-01
Although the intrinsic low solubility of membrane proteins presents challenges to their high-resolution structure determination, insight into the amino acid sequence features and forces that stabilize their folds has been provided through study of sequence-dependent helix-helix interactions between single transmembrane (TM) helices. While the stability of helix-helix partnerships mediated by the Gly-xxx-Gly (GG4) motif is known to be generally modulated by distal interfacial residues, it has not been established whether the position of this motif, with respect to the ends of a given TM segment, affects dimer affinity. Here we examine the relationship between motif position and affinity in the homodimers of 2 single-spanning membrane protein TM sequences: glycophorin A (GpA) and bacteriophage M13 coat protein (MCP). Using the TOXCAT assay for dimer affinity on a series of GpA and MCP TM segments that have been modified with either 4 Leu residues at each end or with 8 Leu residues at the N-terminal end, we show that in each protein, centrally located GG4 motifs are capable of stronger helix-helix interactions than those proximal to TM helix ends, even when surrounding interfacial residues are maintained. The relative importance of GG4 motifs in stabilizing helix-helix interactions therefore must be considered not only in its specific residue context but also in terms of the location of the interactive surface relative to the N and C termini of alpha-helical TM segments.
Kulakovskiy, Ivan V.
2011-08-18
Motivation: Modern experimental methods provide substantial information on protein-DNA recognition. Studying arrangements of transcription factor binding sites (TFBSs) of interacting transcription factors (TFs) advances understanding of the transcription regulatory code. Results: We constructed binding motifs for TFs forming a complex with HIF-1α at the erythropoietin 3\\'-enhancer. Corresponding TFBSs were predicted in the segments around transcription start sites (TSSs) of all human genes. Using the genome-wide set of regulatory regions, we observed several strongly preferred distances between hypoxia-responsive element (HRE) and binding sites of a particular cofactor protein. The set of preferred distances was called as a preferred pair distance template (PPDT). PPDT dramatically depended on the TF and orientation of its binding sites relative to HRE. PPDT evaluated from the genome-wide set of regulatory sequences was used to detect significant PPDT-consistent binding site pairs in regulatory regions of hypoxia-responsive genes. We believe PPDT can help to reveal the layout of eukaryotic regulatory segments. © The Author 2011. Published by Oxford University Press. All rights reserved.
Examples of the Motif of the Shrew in European Literature and Film
Vasvári, Louise O.
2001-01-01
In her article "Examples of the Motif of the Shrew in European Literature and Film" Louise O. Vasvári presents the shrew-taming story as a masterplot of both Eastern and Western folklore and literature concerned with establishing the appropriate power dynamic between a married couple. Vasvári firts reviews the comparative groundwork of the story she has documented in her earlier studies of the topic. In addition to tracing the bundle of motifs that make up the shrew story from medieval Arabic...
Gao, Chunsheng; Xin, Pengfei; Cheng, Chaohua; Tang, Qing; Chen, Ping; Wang, Changbiao; Zang, Gonggu; Zhao, Lining
2014-01-01
Cannabis sativa L. is an important economic plant for the production of food, fiber, oils, and intoxicants. However, lack of sufficient simple sequence repeat (SSR) markers has limited the development of cannabis genetic research. Here, large-scale development of expressed sequence tag simple sequence repeat (EST-SSR) markers was performed to obtain more informative genetic markers, and to assess genetic diversity in cannabis (Cannabis sativa L.). Based on the cannabis transcriptome, 4,577 SSRs were identified from 3,624 ESTs. From there, a total of 3,442 complementary primer pairs were designed as SSR markers. Among these markers, trinucleotide repeat motifs (50.99%) were the most abundant, followed by hexanucleotide (25.13%), dinucleotide (16.34%), tetranucloetide (3.8%), and pentanucleotide (3.74%) repeat motifs, respectively. The AAG/CTT trinucleotide repeat (17.96%) was the most abundant motif detected in the SSRs. One hundred and seventeen EST-SSR markers were randomly selected to evaluate primer quality in 24 cannabis varieties. Among these 117 markers, 108 (92.31%) were successfully amplified and 87 (74.36%) were polymorphic. Forty-five polymorphic primer pairs were selected to evaluate genetic diversity and relatedness among the 115 cannabis genotypes. The results showed that 115 varieties could be divided into 4 groups primarily based on geography: Northern China, Europe, Central China, and Southern China. Moreover, the coefficient of similarity when comparing cannabis from Northern China with the European group cannabis was higher than that when comparing with cannabis from the other two groups, owing to a similar climate. This study outlines the first large-scale development of SSR markers for cannabis. These data may serve as a foundation for the development of genetic linkage, quantitative trait loci mapping, and marker-assisted breeding of cannabis.